CA1304703C - Molecules useful for detecting nucleic acid sequences - Google Patents
Molecules useful for detecting nucleic acid sequencesInfo
- Publication number
- CA1304703C CA1304703C CA000524411A CA524411A CA1304703C CA 1304703 C CA1304703 C CA 1304703C CA 000524411 A CA000524411 A CA 000524411A CA 524411 A CA524411 A CA 524411A CA 1304703 C CA1304703 C CA 1304703C
- Authority
- CA
- Canada
- Prior art keywords
- nucleic acid
- composition
- acid sequence
- sequences
- scissile linkage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6823—Release of bound markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
Abstract
MOLECULES USEFUL FOR DETECTING NUCLEIC ACID SEQUENCES
Abstract of the Disclosure A synthetic, non-naturally occurring molecule having the structure:
[NA1---S---NA2]n wherein NA1 and NA2 are noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n is an integer from 1 to 1000.
Variations of this molecule and methods for using the molecules for detecting nucleic acid sequences are provided.
Abstract of the Disclosure A synthetic, non-naturally occurring molecule having the structure:
[NA1---S---NA2]n wherein NA1 and NA2 are noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n is an integer from 1 to 1000.
Variations of this molecule and methods for using the molecules for detecting nucleic acid sequences are provided.
Description
13~7~3 MOLECULES USEFUL FOR DETECTING NUCLEIC ACID SEQUENCES
Current DNA probe methodology basically involves at-taching target DNA to a nitrocellulose filter by bring-ing it into contact with the filter directly or via theSouthern transfer technique from an agarose gel. The DNA iS then denatured and the filters baked to ensure firm attachment. Generally, the preparation of the DNA
and the running of the gels is a time consuming, costly process requiring a reasonably high technical skill level.
The next step is to prepare the probe DNA. Probe DNA
is prepared by labelling radioactively specific DN~ by nick translation, polynucleotide kinase, or some other polymerase type copy reaction using nucleotides la-belled with 32p. Once prepared, the probe DNA is per-mitted to hybridize with the bound target DNA. Hybrid-ization is allowed to proceed at a suitable tempera~
ture, typically for several hours. The DNA probe will associate to form hybrid duplexes with any of the bound target DNA that has complementary base sequences.
Extraneous material, including unbound probe DNA, is then washed away from the filter and the filter is then exposed to film sensitive to the radioactive label.
International Patent Application No. Wo 84/03520 (Mal-colm et al.) discloses a method of detecting nucleic acid sequences which utilizes tandem hybridization of a nucleic acid probe and an enzyme containing marker.
'`~
~3~7~3 The method involves contacting the probe with a sample containing a complementary target sequence under hy-bridizing conditions. Before or after hybridization with the target sequence, the probe is attached by hybridization to an enzyme labelled marker polynucleo-tide which has a sequence complementary to a sequence on the probe.
U.S. Patent No. 4,358,535 (Falkow et al.) discloses radioactively labeled nucleotide probes which are com-plementary to a target nucleic acid sequence of inter-est and a method of using these probes to detect the presence of a pathogen from which the terget nucleic acid sequence is derived. The method comprises first fixing the target nucleic acid sequence to an inert support before hybridization with the probe. Next, the fixed nucleic acid is contacted with the radioactively labeled probe under hybridizing conditions, with hy-bridization taking place on the 801 id support. Then, the presence of the target nucleic acid sequence is determined by detecting the presence of any label on the inert support. A disadvantage of such a system is that the probe itself cannot be immobilized. If the probe of Falkow et al. is immobilized, rather than the target nucleic acid ~equence, then the label molecules of the immobilized probe will be bound to the solid support regardless of whether the probe has hybridized with a target nucleic acid sequence. The result would not permit the detection of the presence of target nucleic acid.
European Patent Application Publication No. 0 117 440 discloses non-radioactive chemically labeled polynucle-otide probes and methods of using the probes. The methods disclosed are similar to the method of Falkow 13U4~(~3 et al. in that the target nucleic acid sequence is fixed to a solid support before hybridization.
Recently, other detection systems have been developed, such as fluorescent tags or color change enzyme sys-tems. However, such systems have had significant prob-lems with sensitivity and background levels (noise).
U.S. Patent No. 4,362,867 (Paddock) discloses a hybrid nucleic acid construction which comprises two comple-mentary deoxynucleotide sequences which are hybridized to form a double-stranded helical structure. Situated between and covalently bonded to the two deoxynucleo-tides i8 a ribonucleotide sequence. The construction formq a single unit, in which none of the nucleotide sequences repeat themselves.
The present invention provides a method for the detec-tion of specific DNA or RNA sequences in a test (tar-get) DNA solution. The method provides a means ofspecifically cleaving the nucleic acid sequence of the probe in at least one point so as to remove any detect-able reporter molecules not bound to a complementary target DNA sequence and thereby improve the signal to noise ratio of the detection system. Such a system enables the use of very high probe concentrations to drive the hybridization reaction without a correspond-ing increase in background noise level.
~3~47(?3 Sum~a~y o~ the Invention The present invention concerns a synthetic, non-natu-rally occurring molecule having the structure:
[ NAl---S---NA2 ]
wherein NAl and NA2 are noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n i8 an integer from 1 to 1,000.
A synthetic, non-naturally occurring molecule is pro-vided which has the structure:
[ NAl---S---NA2 ]
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n is an integer from 2 to 1,000.
A molecule is provided which has the structure:
X-L t NAl---S---NA2 ~ M
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage;
wherein n is an integer from 1 to 1,000;
13(~7~3 wherein the solid lines represent chemical bonds;
wherein X is a solid support;
wherein L is a chemical entity which links NAl to the solid support; and wherein M is a marker.
The present invention also pertain3 to a molecule hav-ing the structure:
Y~NAl---S---NA2~ Z
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage;
wherein n is an integer from 1 to 1,000;
wherein Y i8 absent or is a chemical entity which con-fers a unique identifying characteristic; and wherein Z i8 absent or is a chemical entity which con-fers a different unique identifying characteristic.
A method oP detecting in a sample the presence of a nu-cleic acid sequence of interest comprises:
a) contacting the sample with a non-immobilized molecule of the present invention, which com-prises a nucleic acid sequence having a de-tectable marker attached and which is substan-tially complementary to the nucleic acid se-quence of interest, under hybridizing condi-tions;
13~47Q3 b) immobilizing the resulting molecule on a solid support;
c) treating the immobilized molecule so as to cleave the scissile linkage;
d) separately recovering the immobilized mole-cule; and e) detecting the presence of the marker on the immobilized molecule and thereby the nucleic acid sequence of interest.
Another method of detecting in a sample the presence of a nucleic acid sequence of interest comprises:
a) contactlng the sample with an immobilized molecule of the present invention which com-prises a nucleic acid sequence having a de-tectable marker attached and which is substan-tially complementary to the nucleic acid se-quence of interest, under hybridizing condi-tions;
b) treating the immobilized molecule so as to cleave the scissile linkage;
c) separately recovering the immobilized mole-cule; and d) detecting the presence of the marker on the lmmobilized molecule and thereby the nucleic acid sequence of interest.
~3~4~(~3 Figure 1 depicts the nucleic acid probe of the present invention ar.d the different results obtained when this probe is contacted with a complementary target DNA
; sequence (left side of figure) and a non-complementary non-target DNA sequence (right side of figure).
3(~ 3 lled Descri~tion of t~e Invention ~he present invention concerns a synthetic, non-natu-rally occurring molecule having the structure:
s [ NA~ S---NA2 ]n wherein NAl and NA2 are noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n 1B an integer from 1 to 1,000.
A synthetic, non-naturally occurring molecule, is pro-vided, which has the structure:
[ NAl---S---NA2 ]n wherein NAl and NA2 are nucleic acid sequences;
wherein ---S~-- is a scissile linkage; and wherein n is an integer from 2 to 1,000.
In the molecules of the present invention, the dashed lines of the scissile linkage represent chemical bonds, which may be covalent bonds or hydrogen bonds.
Within molecules of the present invention NAl and NA2 may be DNA sequences, which may or may not be the same sequence. Alternatively, the molecules may be con-structed of RNA sequences, which may or may not be the same sequence, or NAl and NA2 may be a combination of $3(~7~3 RNA and DNA sequences. The DNA or RNA sequences uti-lized may be naturally occurring sequences or they may be synthetically formed. Each of NAl and NA2 may be from about 8 bases to 10,000 bases in length. Less than eight bases results in inefficient hybridization.
Preferably, the sequences are about 5000 bases in length.
The molecules of the present invention may have detect-able marker attached to one or more of the nucleic acidsequences, NAl or NA2. This marker is contemplated to be any molecule or reagent which is capable of being detected. Examples of such detectable molecules are radioisotopes, radiolabelled molecules, fluorescent molecules, fluorescent antibodies, enzymes, or chemilu-minescent catalysts. Another suitable marker is a ligand capable of binding to specific proteins which have been tagged with an enzyme, fluorescent molecule or other detectable molecule. One example of a suit-able ligand is biotin, which will bind to avidin orstreptavidin. Another suitable ligand is a hemin mole-cule, which will bind to the apoenzyme portion of catalase.
The present lnvention also concerns a composition com-prlsing a solid support and a molecule of the present inventlon immobilized thereon. The immobilized mole-cule may have attached a detectable marker.
The molecules of the present invention have a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting any nucleic acid se-quence of the molecule itself or of the target nucleic acid sequence. As used herein, a scissile linkage is any connecting chemical structure which joins two 13~7(?3 nucleic acid sequences and which is capable of bein~
selectively cleaved without cleavage of the nucleic acid sequences to which it is joined. The scissile linkage may be a single bond or a multiple unit se-quence. An example of such a chemical structure is anRNA sequence. Other chemical structures suitable as a scissile linkage are a DNA sequence, an amino acid sequence, an abasic nucleotide sequence or an abasic nucleotide, or any carbohydrate polymer, i.e. cellu-lose or starch. When the scissile linkage is a nucleicacid sequence, it differs from the nucleic acid se-quence 6 of NAl and NA2.
In molecules of the present invention in which n is greater than one, the unit NAl---S---NA2 repeats. It i8 contemplated that the unit may be the same within each repeat or it may vary randomly or in a defined pattern. The unit may vary in that NAl or NA2 or both may vary within each repeat. NA1 or NA2 may vary in that they have different nucleic acid sequences from one repeat unit to the next. This variation may occur randomly such that in every repeat unit NA1 and NA2 are different. The variation also may occur in a defined pattern such that the variation repeats itself in every defined multiple of a unit. NA1 and NA2 may also vary in that the number of bases of each may vary, either greater or less, from one repeat to the next. This variation may also occur randomly or ln a pattern. An example of a random variation where n=3 and both NA
A2 vary is:
NAl ~~ ~ S~ ~~ NA2 NAl ~ ~ ~ ~ S~ ~ ~ NA2 I NAl n _ -- S~ ~ ~ NA2 n An example of a patterned variation where n=4 and both NAl and NA2 vary is:
~3~47t~3 NA~ S---NA2 NAl'---S---NA2' NAl---S---NA2 NAl '----S----NA2 ' In both of the above examples, the solid lines joining each unit are chemical bonds which may be either hydro-gen bonds or covalent bonds.
The repeat unit may also vary by variations in the scissile linkage such that one unit has a scissile linkage which is an amino acid sequence and another unit has a scissile linkage which is an RNA sequence.
The variation in the scissile linkage may ~lso be in a random or patterned fashion as discussed above. Also, the repeat units may vary by any combination of the above-mentioned differences in NAl, NA2 or the scissile linkage and the variations may be random or patterned.
A molecule is provided which has the structure:
X-L--~--NAl___S___NA2 ~ M
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- i5 a scissile linkage;
wherein n is an integer from 1 to l,000;
wherein the solid lines represent chemical bonds;
wherein X is a solid support:
wherein L i5 a chemical entity which links NAl to the solid support; and 13~47~3 wherein M is a marker.
In the molecule represented above, X may be a silica-ceous, cellulosic, or plastic material or controlled pore glass. The chemical bonds represented by solid lines may be either covalent or hydrogen bonds. The dashed lines of the scissile linkage also represent chemical bonds, which may be covalent or hydrogen bonds. M is a detectable marker which may be a radio-isotope, a radiolabeled molecule, a fluorescent mole-cule or a suitable ligand. M may also comprise a marked nuclelc acid seguence complementary to a se-quence within NA2. L may comprise a nucleic acid which has a sequence substantially complementary to the se-quence of NAl, wherein L is chemically bound to thesolid support and wherein L links NAl to the solid support by means of hydrogen bonds between complementa-ry nucleic acid sequences.
The present invention also concerns a molecule having the structure:
Y~NAl-__$___NA2~ Z
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage;
wherein n ls an integer from 1 to 1,000;
wherein Y is absent or is a chemical entity which con-fers a unique identifying characteristic; and wherein Z is absent or is a chemical entity which con-fers a different unique identifying characteristic.
13~47(~3 This embodiment of the invention, which has Y and Z
conferring unique identifying characteristics to the molecule, is suitable for use in a biphasic concentra-tion system. In such a molecule, when the identifyingcharacteristic of Y is hydrophobicity or hydrophilici-ty, the identifying characteristic of Z is hydrophili-city or hydrophobicity, respectively. Also, one of Y
or Z may be absent in which case the other is a hydro-phobic entity. In this case, the nucleic acid se~quence, NAl or NA2, which does not have Y or Z at-tached will serve as the hydrophllic portion of the molecule. Also, the Y or Z group may be an identifying marker and the other group a hydrophobic group. Also, Y or Z may serve as a linker entity which attaches the molecule to a solid support.
In the molecule represented above, the chemical bonds represented by solid lines may be either covalent or hydrogen bonds. The dashed lines of the scissile link-age also represent chemical bonds, which may be either covalent or hydrogen bonds. This molecule may have a detectable marker attached to one of NAl or NA2~
The molecules of the present invention are useful for detecting target DNA which is bacterial DNA, i.e. ~
ms~LLa and ~ herichia ~Qll, or viral DNA, i.e. her-pes simplex virus types I and II, adenovirus, and cyto-megalovirus. Detection of bacterial or viral DNA is useful for diagnosing human, plant, or animal diseases.
One particular use is the detection of human infec-tious disease, such as gonorrhea. Another ~se is in the diagnosis of human genetic disorders, i.e. sickle cell anemia.
13~7(~3 The molecules of the present invention are useful as probes for detecting nucleic acid sequences and may be utilized in two different forms: 1) immobilized to a solid support for use in a heterogeneous system; or 2) non-immobilized for use in a homogeneous system. In the immobilized form, the nucleic acid sequence having a free terminus has a detectable marker attached.
Examples of sùitable solid supports for immobilizing the probe are those which are silicaceous materials, cellulosic materials, plastic materials, i.e. polys~y-rene, or controlled pore glass (CPG). The preferred solid support is any solid which has reactive groups, such as hydroxyl, carboxyl, or amino groups, which a~e capable of attaching to the molecule~ of the present invention. Also, the molecules of the present inven-tion may be attached to a solid ~upport by adhesion to the support. In the non-immobilized form, the terminus that does not have the marker attached may have a nucleic acid sequence attached to its free end that is complementary to a previously immobilized sequence.
The immobilized molecules of the present invention may be attached to a solid support directly via reaction of the 3' end o~ the molecule with the support, or indi-rectly via a chemical entity ~ which links the moleculeto the support by reacting with the 3' end of the mole-cule to form a covalent bond and reacting with the solid support to form another covalent bond. Another version of the linking entity is one which has a first reactive site which is a nucleic acid sequence comple-mentary to a sequence at the 3' end of the molecule of the present invention which is capable of forming hy-drogen bonds with the molecule and a second reactive site which is capable of forming a covalent or hydrogen bond with the solid support. The present invention ~ 13~7~3 J
also contemplates attachment of the novel molecules to a solid support by diazo coupling.
Suitable chemical linking entities are any reactive nucleic acid-binding ligand capable of attaching the molecule of the present invention to a solid support without impairing the molecule's nucleic acid function.
Examples of such linking entities are listed in Europe-an Patent Application Publication No. 0 130 523 and may be selected from any derivative of the following class-es of nucleic acid intercalator compounds: acridine dyes, phenanthridines, phenazines, phenothiazines, quin~lines, aflatoxins, polycyclic hydrocarbons and their oxirane derivatives, actinomycins, anthracycli-nones, thiaxanthenones, anthramycin, mitomycin, plati-num complexes, fluorenes, fluorenones and furocouma-rins.
A method of detecting in a sample the presence of a nucleic acid sequence of interest comprises:
a) contacting the sample with a non-immobilized molecule of the present invention which com-prises a nucleic acid sequence having a de-tectable marker attached and which is sub-stantially complementary to the nucleic acid sequence of interest, under hybridizing con-ditions;
b) immobilizing the resulting molecule on a solid support;
c) treating the immobilized molecule so as to cleave the scissile linkage;
d) separately recovering the immobilized mole-cule; and e) detecting the presence of the marker on the immobilized molecule and thereby the nucleic acid sequence of interest.
-` ~3C1~7~;~
Another method of detecting in a sample a nucleic acid sequence of interest comprises:
a) contacting the sample with an immobilized molecule of the present invention which com-prises a nucleic acid sequence having a de-tectable marker attached and which is sub-stantially complementary to the nucleic acid sequence of interest, under hybridizing con-ditions;
b) treating the immobili3ed molecule so as to cleave the scissile linkage;
c) separately recovering the immobilized mole-cule; and d) detecting the presence of the marker on the immobilized molecule and thereby the nucleic acid sequence of interest.
Another method of detecting in a sample a nucleic acid sequence of interest comprises:
a) contacting, under hybridizing conditions, the sample with an aqueous solution comprising a molecule represented by the structure Y-~NAl---s---NA2 ~ z which comprises a nucleic acid sequence having a detectable marker attached and which is substantially complementary to the nucleic acid sequence of interest and which includes a hydrophobic entity Y and a hydrophilic entity Z;
b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the molecule is present at the phase inter-face of the biphasic solution, with Y being oriented in one phase and Z being oriented in the other phase;
- ~ 3~17~?3 c) treating the molecule so as to cleave the scissile linkage;
d) recovering the molecule so treated; and e) detecting the presence of the marker and thereby detecting the nucleic acid sequence of interest.
A further method of detecting in a sample a nucleic acld sequence of interest comprlses:
.a) contactlng, under hybridizing conditions, the sample with a non-immobilized molecule of the present invention which comprises a nucleic acid sequence having a detectable marker attached and which is substantially comple-mentary to the nucleic acid sequence of in-terest 80 as to form a hybridized product;
b) contacting, under hybridizing conditions, the product of step (a) with a nucleic acid se~
quence whlch i~ complementary to the sequence of the non-immobilized molecule of step (a) but has about 1-10 fewer bases and i8 capable of rendering the molecule undetectable when hybridized to the molecule, so that the nucleic acid sequence complementary to the molecule hybridizes with unhybridized mole-cule; and c) detecting the presence of the marker, thereby the presence of the hybridized product, and thereby the nucleic acid sequence of inter-est ~3C~47~3 The present invention provides a method for detecting the presence of a foreign pathogen in a sample qualita-tively which comprises detecting a nucleic acid se-quence characteristic of the pathogen using any of the methods of the present invention. It also provides a quantitative method for measuring the amount of a for-eign pathogen in a sample which comprises detecting a nucleic acid sequence characteristic of the pathogen using any of the methods of the present invention.
A method for quantitatively determining in a sample the amount of a nucleic acid sequence of interest com-prises:
a) contacting the sample with a predetermined amount of a non-immobilized molecule of the prêsent invention which comprises a nucleic acid sequence having a detectable marker attached and which is substantially comple-mentary to the nucleic acid sequence of in-terest, under hybridizing conditions;
b) imMobilizing the resultlng molecule on a solld support;
c) treating the immobilized molecule so as to cleave the scissile linkage;
d) separately recovering the immobilized mole-cule; and e) quantitatively determining the amount of marker present on the immobilized molecule and thereby the amount of nucleic acid se-quence of interest.
"` 13~D4~3 Another method for quantitatively determining in a sam-ple the amount of a nucleic acid sequence of interest comprises:
a) contacting the sample with a predetermined amount of an immobiliæed molecule of the present invention which comprises a nucleic acid sequence having a detectable marker attached and which is substantially comple-mentary to the nucleic acid sequence of in-terest, under hybridizing conditions;
b) treating the immobllized molecule so as to cleave the sci~sile linkage;
c) separately recovering the immobilized mole-cule; and d) quantitatively determining the amount of marker present on the immobilized molecule and thereby the amount of nucleic acid se-quence of interest.
A further method for quantitatively determlnlng in a sample the amount of a nucleic acid sequence of in-terest comprises:
a) contacting under hybridizing conditions the sample with an aqueous solution comprising a molecule represented by the structure Y-~-NAl---S---NA2 ~ Z which comprises a nucleic acid sequence having a detectable marker attached and which is substantially complementary to the nucleic acid sequence of interest and which includes a hydrophobic entity Y and a hydrophilic entity Z;
~3~7(~3 b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the molecule is present at the phase inter-face of the biphasic solution, with Y being oriented in one phase and Z being oriented in the other phase;
c) treating the molecule so as to cleave the scissile linkage;
d) recovering the molecule so treated; and e) quantitatively determining the amount of marker and thereby the nucleic acid sequence of interest~
The molecules of the present invention are useful as probes for DNA or RNA . Before hybridization, the probe molecule may be immobilized on a suitable solid support. Such immobilization is typically effected by a bond between the support and one of the two DNA se-quences of the molecule or simply by adhesion of the molecule to the solid support. The other DNA sequence included wl~.hin the molecule contains a detectable marker. After hybridizing the DNA sequences of the molecule with a DNA sequence of interest, disrupting the linkage between the immobilized DNA sequence of the molecule and the DNA sequence of the molecule which contains the detectable marker, and removing any mate-rial not immobilized, e.g. by washing, the only de-tectable marker remaining is the detectable marker of hybridized molecules. Any non-hybridized sequences containing the detectable marker are no longer bound to the immobilized sequence, either by the linker or ~3~147(~3 by hybridization and are therefore removed. Thus, the presence of the detectable marker indicates the pres-ence of the sequence of interest.
Immobili~in~ the probe molecule prior to hybridization affords a high effective concentration of probe mole-cules for hybridization with the nucleotide sequence of interest. The effective probe concentration in this embodiment is significantly higher than that obtained by conventional methods in which the sequence of inter-est rather than the probe is immobilized prior to the hybridization step. After contacting the immobilized probe of this embodiment with material suspected of containing the sequence of interest, the probe mole-cules are contact~d with an appropriate reagent, suchas RNase if the scissile linkage is RNA, under suitable conditions to excise, cleave or digest the linkage or otherwise disrupt the linkage between DNA sequences of the probe. Unless the immobilized probe has hybridized with the sequence of interest, the DNA sequences are cleaved by the RNAse, and, unconnected to the sequence of interest, are removed by washing. Hence the pres-ence, after washing, of the detectable marker indicates presence of ~:he ~equence of interest.
The molecules of the present invention may contain a homopolymer tail, e.g. poly dA, poly dT or any defined sequence complementary to a previously immobilized sequence. Before or after hybridization of the mole-cule to the nucleotide sequence of interest, the poly dA tail may be used to attach (via hybridization) the molecule to a previously immobilized poly dT fragment.
Thus, the molecule may be hybridized to a sequence of interest in solution and may then be immobilized to eliminate unhybridized molecule prior to detection.
13~J~7~
~22-Another aspect of the present invention involves a biphasic concentration system. Such a system is use-ful for modifying the partition behavior of nucleic acid constructions. The biphasic system involves con-structing a probe molecule with a scissile linkage and having a hydrophilic group at one end of the probe and a lipophilic group at the other end. Either of these groups may also serve as a detection molecule or an additional detection molecule can be attached to one end. If no hybridization to the sought after molecule takes place, then, in a biphasic solution, cleavage of the scissile linkage cause~ the disper6ion of the hydrophilic and lipophilic groups to their respective solubility preference.
~owever, if hybridization has occured, then the hydrophilic and lipophilic groups are bridged together and remain concentrated at the interface. This inter-face can then be isolated and exposed to the appropri-ate visualizer for the specific marker utilized.
With respect to the hydrophoblc/hydrophlllc sclssile linkage probe sy6tem, the following construct is con-templated. A short nucleic acld probe is attached to a llpophllic molecule (which may or may not also serve as a marker molecule). The probe is sparingly soluble in aqueous conditions but highly soluble in non-polar solvents. ~ybrldization is carried out in aqueous conditions. Upon subsequent addition of a non-polar, non-miscible phase, ~he unhybridized probe partitions into this phase whereas the hybridized probe concen-trates at the interface due to the additional hybrid-ized component of hydrophilic DNA. This construct, unlike other partioning constructs of the present in-vention does not require a scissile linkage.
13~47~3 Such a biphasic concentration system is useful in iso-lating small quantities of a target nucleic acid from a sample having a large aqueous volume. The sample is subjected to the biphasic concentration system and target material is concentrated at the interface of the two phases. The interface has a relatively small vol-ume compared to that of the two phases. Separation of the interface from the system results in the target nucleic acid sequence being present in relatively high concentration in a small volume of interface.
The biphaslc concentration syste~ is also useful in isolating mRNA from a sample. A biphasic probe mole-cule with a poly dT tail may be used to hybridize withthe mRNA and then the mRNA is isolated using the sol-vent partitioning method of the present invention.
Such a system has advantages over a poly dT column, such as faster isolation time and no problems with extraneous material clogging the column.
The purpose of the present invention is to provide a method for the detection of specific DNA or RNA se-quences in a sample. The method provides a means of speciflcally cleaving the DNA sequence of the probe in at least one point so as to remove any detectable mark-er molecules not bound to a complementary target DNA
sequence and thereby improve the signal to noise ratio of the detection system.
The differential lability of DNA and RNA may be ex-ploited in a heterogeneous system to achieve the pur-pose of the present invention when the scissile linkage is an RNA moiety. Consider Figure 1, which depicts the different results obtained when the DNA probe of the 13~917(?3 present invention is contacted with a complementary DNA
target sequence and a non-complementary DNA sequence.
Complementary target DNA hybridizes with the DNA
strands of the probe so as to connect the DNA strand attached to the solid support with the DNA strand hav-ing the detectable marker after the scissile linkage has been disrupted. In the case where the probe comes in contact with non-complementary DNA, the marker is cleaved from the probe when the scissile linkage is disrupted. The result of such an arrangement is that a marker remains attached to the probe only if the probe has hybridized with a complementary target DNA
sequence. The cleaved markers of non-hybridized probes are eluted from the system. This rids the system of unreacted detection component which causes high back-ground noise. The only detection system componentremaining is that which i8 hybridized to a target DNA
molecule. When the remaining components of the detec-tion system are added only hybridized material reacts.
This enables the use of very high probe concentrations to drive the hybridization reaction without a corre-sponding increase in background noise level.
When the scissile linkage is an RNA ~equence, the llnk-age may be cleaved by an enzyme destructive to RNA.
Varlous RNases may be used to cleave an RNA link.
When RNase A is used, only single stranded RNA (ie.
unhybridized) i8 cut so that the detection component is removed from unhybridized probe molecules, but hy-bridized probe molecules remain intact. When RNase H
i5 u8ed~ only RNA found in an RNA/DNA double-stranded hybrid is cleaved. This leaves a single stranded DNA
gap in a hybridized probe molecule which is then avail-able for rehybridization with another component of the detection system. This type of differential lability `` ~3~4~3 makes it possible to use a variety of detection sys-tems.
It is contemplated that the scissile linkage may also be formed by one or a series of abasic nucleotides.
Any modified base which can be differentiated from deoxy (A,T,G,C) may serve a6 a substrate for the forma-tion of a cleavable point in a DNA sequence. That is to say that the base portion of the deoxyribonucleoside or the ribonucleoside may be removed either before or after synthesis of the probe. The scissile linkage in the probe sequence may be synthesized by u6ing abasic precursor molecules or by enzymatically removing the base after synthesis. An example of the latter is as follows: when deoxyuridine is used during synthesis as the linker entity, one may subsequently remove the uracil base from the deoxyuridine by treatment with the enzyme N-uracil DNA glycosylase. This creates an abasic link wherever there was a deoxyuridine. This link is cleavable by basic conditions or by treatment with one of a group of enzymes called Ap endonucleases which can cleave at any abasic site. It should be noted that uridine moieties in the probe sequence may be created either through direct ~ynthesis or by chemi-cal deamination of cyto6ine moieties. There are indi-cation~ in the literature that this deamination may be accomplished by judicious treatment with sodium bisul-phite. After deamination of cytosine, the resulting uridine moiety may be converted to an abasic link by the action of N-uracil DNA glycosylase. Subsequent cleavage is then effected by either basic conditions or the action of Ap endonucleases. This latter approach allows a scissile linkage to be ~ormed in pre-existing DNA so that non-synthetic or natural DNA sequences may be used as probes in a scissile link system.
`" 13~47~3 With respect to Ap endonuclease activity, the enzyme may be selected such that the end product of its activ-ity is a terminal sugar moiety. This may provide a substrate for a subsequent detection reaction.
A contemplated detection system is a system which uti-lizes a marker component that ls a subunit of a lumi-nescent enzyme system, such as luciferase. Addition of the other subunit plu8 suitable cofactors and sub-strate results in luminescence which may then be am-plified and detected.
Another contemplated detection system is a system hav-ing a solid probe matrix set up as a ~dipstick~ system having an enzyme attached to the probe. The probe matrix is dipped into a target DNA solution for a spec-ified time at a specified temperature. It is then dipped in RNAse to cleave off probe enzyme from probes which have not hybridized. Finally, after a brief washing the matrix i9 dipped in a solution of the en-zyme's substrate which then allows a detectable reac-tion to occur (ie. a color reactlon).
The dlfferential labllity and scl~sile 11nk cleavage tactics which are discussed above may be used in ho-mogenous systems as well as heterogenous systems. The major problem with a homogeneous system, where the probe is not fixed to a solid support, is the preven-tion of the detection of unhybridized detection compo-nents so that background noise is not intolerable.
This problem is overcome with the use of an agent that blocks the detectable marker from reacting. After hybridization has occurred, a competing nucleic acid counterprobe sequence may be added that bears an at-~3~03 tach~ent that sterically hinders or blocks the partic-ipation of unhybridized marker in any further detection reaction. When the steric blocker is added before the addition of a secondary component required for the detection reaction, detection of unhybridized detect-able markers is blocked. When the blocker is intro-duced via an RNA complementary sequence, the procedure is reversible and the blocker may be effectively re-moved by adding an RNAse.
The counter probe itself is constructed to be slightly shorter, i.e. about 1-5 base pairs, than the nucleic acids of the probe. This insures that the cou~terprobè
is less eff~cient than target sequence at hybridizing with probe nucleic acid and therefore the counterprobe does not compete with the target sequence for the probe nucleic acid.
Probe molecules used for testing the scissile link concept have been constructed on a solid support medium (either sillca gel or controlled pore glass) using either a hydrolysable linkage or a permanent (non-hy-drolysable) linkage. Published chemical methods were used for thls synthesis. (Alvarado-Urbina, G., G. M.
SAthe, W. C. Liu, M. F. Gillan, P. D. Duck, R. Bender, and ~. R. Ogilvie (19811, Automated Synthesis of Gene Fragments, Science ~ 270-274; Roberts, D. M., R.
Crea, M. Malecha, G. Alvarado-Urbina, R. H. Chiarello, and D. M. Watterson (1985), Chemical Synthesis and Expression of a Calmodulin gene designed for a Site-Specific Mutagenesis, Biochemistry, in p~e~s; Van Boom, J. H., and C. T. Wreesman (1984), Chemical Synthesis of Small Oligoribonucleotides in Solution, In Oligonucleo-tide Synthesis--A Practical Approach, pp. 153-183, Ed.
M. J. Gait, IRL Press). Standard protected deoxynucle-13~47(~3 oside monomers were obtained from commercial sources whereas protected deoxyuridine and the ribonucleoside monomers were prepared using published procedures.
(Ti, G.S., B. L. Gaffney, and R. A. Jones (1982), Tran-sient Protection:Efficient One Flask Synthesis of Pro-tected Nucleosides, J. AM. Chem. Soc. lQ~:1316). Syn-thesis was performed with a ~IO LOGICALS automated syn-thesizer using a cycle time of 10 minutes for each DNA
condensation and 12 minutes for each RNA condensation.
The following probe constructions were used in various test systems.
SCISSILE LIN~ PRC@ES
P. L. = Permanent Linkage to Solid Support H. L. = Hydrolysable Linkage to Solid Support ,, ~3047~?3 1. MRC046:
5 ' d (TTTTTTTTTT ) r ( UUUUVU~ d (TTTTTTTTTTT ) 3 ' - P . L .
Current DNA probe methodology basically involves at-taching target DNA to a nitrocellulose filter by bring-ing it into contact with the filter directly or via theSouthern transfer technique from an agarose gel. The DNA iS then denatured and the filters baked to ensure firm attachment. Generally, the preparation of the DNA
and the running of the gels is a time consuming, costly process requiring a reasonably high technical skill level.
The next step is to prepare the probe DNA. Probe DNA
is prepared by labelling radioactively specific DN~ by nick translation, polynucleotide kinase, or some other polymerase type copy reaction using nucleotides la-belled with 32p. Once prepared, the probe DNA is per-mitted to hybridize with the bound target DNA. Hybrid-ization is allowed to proceed at a suitable tempera~
ture, typically for several hours. The DNA probe will associate to form hybrid duplexes with any of the bound target DNA that has complementary base sequences.
Extraneous material, including unbound probe DNA, is then washed away from the filter and the filter is then exposed to film sensitive to the radioactive label.
International Patent Application No. Wo 84/03520 (Mal-colm et al.) discloses a method of detecting nucleic acid sequences which utilizes tandem hybridization of a nucleic acid probe and an enzyme containing marker.
'`~
~3~7~3 The method involves contacting the probe with a sample containing a complementary target sequence under hy-bridizing conditions. Before or after hybridization with the target sequence, the probe is attached by hybridization to an enzyme labelled marker polynucleo-tide which has a sequence complementary to a sequence on the probe.
U.S. Patent No. 4,358,535 (Falkow et al.) discloses radioactively labeled nucleotide probes which are com-plementary to a target nucleic acid sequence of inter-est and a method of using these probes to detect the presence of a pathogen from which the terget nucleic acid sequence is derived. The method comprises first fixing the target nucleic acid sequence to an inert support before hybridization with the probe. Next, the fixed nucleic acid is contacted with the radioactively labeled probe under hybridizing conditions, with hy-bridization taking place on the 801 id support. Then, the presence of the target nucleic acid sequence is determined by detecting the presence of any label on the inert support. A disadvantage of such a system is that the probe itself cannot be immobilized. If the probe of Falkow et al. is immobilized, rather than the target nucleic acid ~equence, then the label molecules of the immobilized probe will be bound to the solid support regardless of whether the probe has hybridized with a target nucleic acid sequence. The result would not permit the detection of the presence of target nucleic acid.
European Patent Application Publication No. 0 117 440 discloses non-radioactive chemically labeled polynucle-otide probes and methods of using the probes. The methods disclosed are similar to the method of Falkow 13U4~(~3 et al. in that the target nucleic acid sequence is fixed to a solid support before hybridization.
Recently, other detection systems have been developed, such as fluorescent tags or color change enzyme sys-tems. However, such systems have had significant prob-lems with sensitivity and background levels (noise).
U.S. Patent No. 4,362,867 (Paddock) discloses a hybrid nucleic acid construction which comprises two comple-mentary deoxynucleotide sequences which are hybridized to form a double-stranded helical structure. Situated between and covalently bonded to the two deoxynucleo-tides i8 a ribonucleotide sequence. The construction formq a single unit, in which none of the nucleotide sequences repeat themselves.
The present invention provides a method for the detec-tion of specific DNA or RNA sequences in a test (tar-get) DNA solution. The method provides a means ofspecifically cleaving the nucleic acid sequence of the probe in at least one point so as to remove any detect-able reporter molecules not bound to a complementary target DNA sequence and thereby improve the signal to noise ratio of the detection system. Such a system enables the use of very high probe concentrations to drive the hybridization reaction without a correspond-ing increase in background noise level.
~3~47(?3 Sum~a~y o~ the Invention The present invention concerns a synthetic, non-natu-rally occurring molecule having the structure:
[ NAl---S---NA2 ]
wherein NAl and NA2 are noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n i8 an integer from 1 to 1,000.
A synthetic, non-naturally occurring molecule is pro-vided which has the structure:
[ NAl---S---NA2 ]
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n is an integer from 2 to 1,000.
A molecule is provided which has the structure:
X-L t NAl---S---NA2 ~ M
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage;
wherein n is an integer from 1 to 1,000;
13(~7~3 wherein the solid lines represent chemical bonds;
wherein X is a solid support;
wherein L is a chemical entity which links NAl to the solid support; and wherein M is a marker.
The present invention also pertain3 to a molecule hav-ing the structure:
Y~NAl---S---NA2~ Z
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage;
wherein n is an integer from 1 to 1,000;
wherein Y i8 absent or is a chemical entity which con-fers a unique identifying characteristic; and wherein Z i8 absent or is a chemical entity which con-fers a different unique identifying characteristic.
A method oP detecting in a sample the presence of a nu-cleic acid sequence of interest comprises:
a) contacting the sample with a non-immobilized molecule of the present invention, which com-prises a nucleic acid sequence having a de-tectable marker attached and which is substan-tially complementary to the nucleic acid se-quence of interest, under hybridizing condi-tions;
13~47Q3 b) immobilizing the resulting molecule on a solid support;
c) treating the immobilized molecule so as to cleave the scissile linkage;
d) separately recovering the immobilized mole-cule; and e) detecting the presence of the marker on the immobilized molecule and thereby the nucleic acid sequence of interest.
Another method of detecting in a sample the presence of a nucleic acid sequence of interest comprises:
a) contactlng the sample with an immobilized molecule of the present invention which com-prises a nucleic acid sequence having a de-tectable marker attached and which is substan-tially complementary to the nucleic acid se-quence of interest, under hybridizing condi-tions;
b) treating the immobilized molecule so as to cleave the scissile linkage;
c) separately recovering the immobilized mole-cule; and d) detecting the presence of the marker on the lmmobilized molecule and thereby the nucleic acid sequence of interest.
~3~4~(~3 Figure 1 depicts the nucleic acid probe of the present invention ar.d the different results obtained when this probe is contacted with a complementary target DNA
; sequence (left side of figure) and a non-complementary non-target DNA sequence (right side of figure).
3(~ 3 lled Descri~tion of t~e Invention ~he present invention concerns a synthetic, non-natu-rally occurring molecule having the structure:
s [ NA~ S---NA2 ]n wherein NAl and NA2 are noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage; and wherein n 1B an integer from 1 to 1,000.
A synthetic, non-naturally occurring molecule, is pro-vided, which has the structure:
[ NAl---S---NA2 ]n wherein NAl and NA2 are nucleic acid sequences;
wherein ---S~-- is a scissile linkage; and wherein n is an integer from 2 to 1,000.
In the molecules of the present invention, the dashed lines of the scissile linkage represent chemical bonds, which may be covalent bonds or hydrogen bonds.
Within molecules of the present invention NAl and NA2 may be DNA sequences, which may or may not be the same sequence. Alternatively, the molecules may be con-structed of RNA sequences, which may or may not be the same sequence, or NAl and NA2 may be a combination of $3(~7~3 RNA and DNA sequences. The DNA or RNA sequences uti-lized may be naturally occurring sequences or they may be synthetically formed. Each of NAl and NA2 may be from about 8 bases to 10,000 bases in length. Less than eight bases results in inefficient hybridization.
Preferably, the sequences are about 5000 bases in length.
The molecules of the present invention may have detect-able marker attached to one or more of the nucleic acidsequences, NAl or NA2. This marker is contemplated to be any molecule or reagent which is capable of being detected. Examples of such detectable molecules are radioisotopes, radiolabelled molecules, fluorescent molecules, fluorescent antibodies, enzymes, or chemilu-minescent catalysts. Another suitable marker is a ligand capable of binding to specific proteins which have been tagged with an enzyme, fluorescent molecule or other detectable molecule. One example of a suit-able ligand is biotin, which will bind to avidin orstreptavidin. Another suitable ligand is a hemin mole-cule, which will bind to the apoenzyme portion of catalase.
The present lnvention also concerns a composition com-prlsing a solid support and a molecule of the present inventlon immobilized thereon. The immobilized mole-cule may have attached a detectable marker.
The molecules of the present invention have a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting any nucleic acid se-quence of the molecule itself or of the target nucleic acid sequence. As used herein, a scissile linkage is any connecting chemical structure which joins two 13~7(?3 nucleic acid sequences and which is capable of bein~
selectively cleaved without cleavage of the nucleic acid sequences to which it is joined. The scissile linkage may be a single bond or a multiple unit se-quence. An example of such a chemical structure is anRNA sequence. Other chemical structures suitable as a scissile linkage are a DNA sequence, an amino acid sequence, an abasic nucleotide sequence or an abasic nucleotide, or any carbohydrate polymer, i.e. cellu-lose or starch. When the scissile linkage is a nucleicacid sequence, it differs from the nucleic acid se-quence 6 of NAl and NA2.
In molecules of the present invention in which n is greater than one, the unit NAl---S---NA2 repeats. It i8 contemplated that the unit may be the same within each repeat or it may vary randomly or in a defined pattern. The unit may vary in that NAl or NA2 or both may vary within each repeat. NA1 or NA2 may vary in that they have different nucleic acid sequences from one repeat unit to the next. This variation may occur randomly such that in every repeat unit NA1 and NA2 are different. The variation also may occur in a defined pattern such that the variation repeats itself in every defined multiple of a unit. NA1 and NA2 may also vary in that the number of bases of each may vary, either greater or less, from one repeat to the next. This variation may also occur randomly or ln a pattern. An example of a random variation where n=3 and both NA
A2 vary is:
NAl ~~ ~ S~ ~~ NA2 NAl ~ ~ ~ ~ S~ ~ ~ NA2 I NAl n _ -- S~ ~ ~ NA2 n An example of a patterned variation where n=4 and both NAl and NA2 vary is:
~3~47t~3 NA~ S---NA2 NAl'---S---NA2' NAl---S---NA2 NAl '----S----NA2 ' In both of the above examples, the solid lines joining each unit are chemical bonds which may be either hydro-gen bonds or covalent bonds.
The repeat unit may also vary by variations in the scissile linkage such that one unit has a scissile linkage which is an amino acid sequence and another unit has a scissile linkage which is an RNA sequence.
The variation in the scissile linkage may ~lso be in a random or patterned fashion as discussed above. Also, the repeat units may vary by any combination of the above-mentioned differences in NAl, NA2 or the scissile linkage and the variations may be random or patterned.
A molecule is provided which has the structure:
X-L--~--NAl___S___NA2 ~ M
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- i5 a scissile linkage;
wherein n is an integer from 1 to l,000;
wherein the solid lines represent chemical bonds;
wherein X is a solid support:
wherein L i5 a chemical entity which links NAl to the solid support; and 13~47~3 wherein M is a marker.
In the molecule represented above, X may be a silica-ceous, cellulosic, or plastic material or controlled pore glass. The chemical bonds represented by solid lines may be either covalent or hydrogen bonds. The dashed lines of the scissile linkage also represent chemical bonds, which may be covalent or hydrogen bonds. M is a detectable marker which may be a radio-isotope, a radiolabeled molecule, a fluorescent mole-cule or a suitable ligand. M may also comprise a marked nuclelc acid seguence complementary to a se-quence within NA2. L may comprise a nucleic acid which has a sequence substantially complementary to the se-quence of NAl, wherein L is chemically bound to thesolid support and wherein L links NAl to the solid support by means of hydrogen bonds between complementa-ry nucleic acid sequences.
The present invention also concerns a molecule having the structure:
Y~NAl-__$___NA2~ Z
wherein NAl and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage;
wherein n ls an integer from 1 to 1,000;
wherein Y is absent or is a chemical entity which con-fers a unique identifying characteristic; and wherein Z is absent or is a chemical entity which con-fers a different unique identifying characteristic.
13~47(~3 This embodiment of the invention, which has Y and Z
conferring unique identifying characteristics to the molecule, is suitable for use in a biphasic concentra-tion system. In such a molecule, when the identifyingcharacteristic of Y is hydrophobicity or hydrophilici-ty, the identifying characteristic of Z is hydrophili-city or hydrophobicity, respectively. Also, one of Y
or Z may be absent in which case the other is a hydro-phobic entity. In this case, the nucleic acid se~quence, NAl or NA2, which does not have Y or Z at-tached will serve as the hydrophllic portion of the molecule. Also, the Y or Z group may be an identifying marker and the other group a hydrophobic group. Also, Y or Z may serve as a linker entity which attaches the molecule to a solid support.
In the molecule represented above, the chemical bonds represented by solid lines may be either covalent or hydrogen bonds. The dashed lines of the scissile link-age also represent chemical bonds, which may be either covalent or hydrogen bonds. This molecule may have a detectable marker attached to one of NAl or NA2~
The molecules of the present invention are useful for detecting target DNA which is bacterial DNA, i.e. ~
ms~LLa and ~ herichia ~Qll, or viral DNA, i.e. her-pes simplex virus types I and II, adenovirus, and cyto-megalovirus. Detection of bacterial or viral DNA is useful for diagnosing human, plant, or animal diseases.
One particular use is the detection of human infec-tious disease, such as gonorrhea. Another ~se is in the diagnosis of human genetic disorders, i.e. sickle cell anemia.
13~7(~3 The molecules of the present invention are useful as probes for detecting nucleic acid sequences and may be utilized in two different forms: 1) immobilized to a solid support for use in a heterogeneous system; or 2) non-immobilized for use in a homogeneous system. In the immobilized form, the nucleic acid sequence having a free terminus has a detectable marker attached.
Examples of sùitable solid supports for immobilizing the probe are those which are silicaceous materials, cellulosic materials, plastic materials, i.e. polys~y-rene, or controlled pore glass (CPG). The preferred solid support is any solid which has reactive groups, such as hydroxyl, carboxyl, or amino groups, which a~e capable of attaching to the molecule~ of the present invention. Also, the molecules of the present inven-tion may be attached to a solid ~upport by adhesion to the support. In the non-immobilized form, the terminus that does not have the marker attached may have a nucleic acid sequence attached to its free end that is complementary to a previously immobilized sequence.
The immobilized molecules of the present invention may be attached to a solid support directly via reaction of the 3' end o~ the molecule with the support, or indi-rectly via a chemical entity ~ which links the moleculeto the support by reacting with the 3' end of the mole-cule to form a covalent bond and reacting with the solid support to form another covalent bond. Another version of the linking entity is one which has a first reactive site which is a nucleic acid sequence comple-mentary to a sequence at the 3' end of the molecule of the present invention which is capable of forming hy-drogen bonds with the molecule and a second reactive site which is capable of forming a covalent or hydrogen bond with the solid support. The present invention ~ 13~7~3 J
also contemplates attachment of the novel molecules to a solid support by diazo coupling.
Suitable chemical linking entities are any reactive nucleic acid-binding ligand capable of attaching the molecule of the present invention to a solid support without impairing the molecule's nucleic acid function.
Examples of such linking entities are listed in Europe-an Patent Application Publication No. 0 130 523 and may be selected from any derivative of the following class-es of nucleic acid intercalator compounds: acridine dyes, phenanthridines, phenazines, phenothiazines, quin~lines, aflatoxins, polycyclic hydrocarbons and their oxirane derivatives, actinomycins, anthracycli-nones, thiaxanthenones, anthramycin, mitomycin, plati-num complexes, fluorenes, fluorenones and furocouma-rins.
A method of detecting in a sample the presence of a nucleic acid sequence of interest comprises:
a) contacting the sample with a non-immobilized molecule of the present invention which com-prises a nucleic acid sequence having a de-tectable marker attached and which is sub-stantially complementary to the nucleic acid sequence of interest, under hybridizing con-ditions;
b) immobilizing the resulting molecule on a solid support;
c) treating the immobilized molecule so as to cleave the scissile linkage;
d) separately recovering the immobilized mole-cule; and e) detecting the presence of the marker on the immobilized molecule and thereby the nucleic acid sequence of interest.
-` ~3C1~7~;~
Another method of detecting in a sample a nucleic acid sequence of interest comprises:
a) contacting the sample with an immobilized molecule of the present invention which com-prises a nucleic acid sequence having a de-tectable marker attached and which is sub-stantially complementary to the nucleic acid sequence of interest, under hybridizing con-ditions;
b) treating the immobili3ed molecule so as to cleave the scissile linkage;
c) separately recovering the immobilized mole-cule; and d) detecting the presence of the marker on the immobilized molecule and thereby the nucleic acid sequence of interest.
Another method of detecting in a sample a nucleic acid sequence of interest comprises:
a) contacting, under hybridizing conditions, the sample with an aqueous solution comprising a molecule represented by the structure Y-~NAl---s---NA2 ~ z which comprises a nucleic acid sequence having a detectable marker attached and which is substantially complementary to the nucleic acid sequence of interest and which includes a hydrophobic entity Y and a hydrophilic entity Z;
b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the molecule is present at the phase inter-face of the biphasic solution, with Y being oriented in one phase and Z being oriented in the other phase;
- ~ 3~17~?3 c) treating the molecule so as to cleave the scissile linkage;
d) recovering the molecule so treated; and e) detecting the presence of the marker and thereby detecting the nucleic acid sequence of interest.
A further method of detecting in a sample a nucleic acld sequence of interest comprlses:
.a) contactlng, under hybridizing conditions, the sample with a non-immobilized molecule of the present invention which comprises a nucleic acid sequence having a detectable marker attached and which is substantially comple-mentary to the nucleic acid sequence of in-terest 80 as to form a hybridized product;
b) contacting, under hybridizing conditions, the product of step (a) with a nucleic acid se~
quence whlch i~ complementary to the sequence of the non-immobilized molecule of step (a) but has about 1-10 fewer bases and i8 capable of rendering the molecule undetectable when hybridized to the molecule, so that the nucleic acid sequence complementary to the molecule hybridizes with unhybridized mole-cule; and c) detecting the presence of the marker, thereby the presence of the hybridized product, and thereby the nucleic acid sequence of inter-est ~3C~47~3 The present invention provides a method for detecting the presence of a foreign pathogen in a sample qualita-tively which comprises detecting a nucleic acid se-quence characteristic of the pathogen using any of the methods of the present invention. It also provides a quantitative method for measuring the amount of a for-eign pathogen in a sample which comprises detecting a nucleic acid sequence characteristic of the pathogen using any of the methods of the present invention.
A method for quantitatively determining in a sample the amount of a nucleic acid sequence of interest com-prises:
a) contacting the sample with a predetermined amount of a non-immobilized molecule of the prêsent invention which comprises a nucleic acid sequence having a detectable marker attached and which is substantially comple-mentary to the nucleic acid sequence of in-terest, under hybridizing conditions;
b) imMobilizing the resultlng molecule on a solld support;
c) treating the immobilized molecule so as to cleave the scissile linkage;
d) separately recovering the immobilized mole-cule; and e) quantitatively determining the amount of marker present on the immobilized molecule and thereby the amount of nucleic acid se-quence of interest.
"` 13~D4~3 Another method for quantitatively determining in a sam-ple the amount of a nucleic acid sequence of interest comprises:
a) contacting the sample with a predetermined amount of an immobiliæed molecule of the present invention which comprises a nucleic acid sequence having a detectable marker attached and which is substantially comple-mentary to the nucleic acid sequence of in-terest, under hybridizing conditions;
b) treating the immobllized molecule so as to cleave the sci~sile linkage;
c) separately recovering the immobilized mole-cule; and d) quantitatively determining the amount of marker present on the immobilized molecule and thereby the amount of nucleic acid se-quence of interest.
A further method for quantitatively determlnlng in a sample the amount of a nucleic acid sequence of in-terest comprises:
a) contacting under hybridizing conditions the sample with an aqueous solution comprising a molecule represented by the structure Y-~-NAl---S---NA2 ~ Z which comprises a nucleic acid sequence having a detectable marker attached and which is substantially complementary to the nucleic acid sequence of interest and which includes a hydrophobic entity Y and a hydrophilic entity Z;
~3~7(~3 b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the molecule is present at the phase inter-face of the biphasic solution, with Y being oriented in one phase and Z being oriented in the other phase;
c) treating the molecule so as to cleave the scissile linkage;
d) recovering the molecule so treated; and e) quantitatively determining the amount of marker and thereby the nucleic acid sequence of interest~
The molecules of the present invention are useful as probes for DNA or RNA . Before hybridization, the probe molecule may be immobilized on a suitable solid support. Such immobilization is typically effected by a bond between the support and one of the two DNA se-quences of the molecule or simply by adhesion of the molecule to the solid support. The other DNA sequence included wl~.hin the molecule contains a detectable marker. After hybridizing the DNA sequences of the molecule with a DNA sequence of interest, disrupting the linkage between the immobilized DNA sequence of the molecule and the DNA sequence of the molecule which contains the detectable marker, and removing any mate-rial not immobilized, e.g. by washing, the only de-tectable marker remaining is the detectable marker of hybridized molecules. Any non-hybridized sequences containing the detectable marker are no longer bound to the immobilized sequence, either by the linker or ~3~147(~3 by hybridization and are therefore removed. Thus, the presence of the detectable marker indicates the pres-ence of the sequence of interest.
Immobili~in~ the probe molecule prior to hybridization affords a high effective concentration of probe mole-cules for hybridization with the nucleotide sequence of interest. The effective probe concentration in this embodiment is significantly higher than that obtained by conventional methods in which the sequence of inter-est rather than the probe is immobilized prior to the hybridization step. After contacting the immobilized probe of this embodiment with material suspected of containing the sequence of interest, the probe mole-cules are contact~d with an appropriate reagent, suchas RNase if the scissile linkage is RNA, under suitable conditions to excise, cleave or digest the linkage or otherwise disrupt the linkage between DNA sequences of the probe. Unless the immobilized probe has hybridized with the sequence of interest, the DNA sequences are cleaved by the RNAse, and, unconnected to the sequence of interest, are removed by washing. Hence the pres-ence, after washing, of the detectable marker indicates presence of ~:he ~equence of interest.
The molecules of the present invention may contain a homopolymer tail, e.g. poly dA, poly dT or any defined sequence complementary to a previously immobilized sequence. Before or after hybridization of the mole-cule to the nucleotide sequence of interest, the poly dA tail may be used to attach (via hybridization) the molecule to a previously immobilized poly dT fragment.
Thus, the molecule may be hybridized to a sequence of interest in solution and may then be immobilized to eliminate unhybridized molecule prior to detection.
13~J~7~
~22-Another aspect of the present invention involves a biphasic concentration system. Such a system is use-ful for modifying the partition behavior of nucleic acid constructions. The biphasic system involves con-structing a probe molecule with a scissile linkage and having a hydrophilic group at one end of the probe and a lipophilic group at the other end. Either of these groups may also serve as a detection molecule or an additional detection molecule can be attached to one end. If no hybridization to the sought after molecule takes place, then, in a biphasic solution, cleavage of the scissile linkage cause~ the disper6ion of the hydrophilic and lipophilic groups to their respective solubility preference.
~owever, if hybridization has occured, then the hydrophilic and lipophilic groups are bridged together and remain concentrated at the interface. This inter-face can then be isolated and exposed to the appropri-ate visualizer for the specific marker utilized.
With respect to the hydrophoblc/hydrophlllc sclssile linkage probe sy6tem, the following construct is con-templated. A short nucleic acld probe is attached to a llpophllic molecule (which may or may not also serve as a marker molecule). The probe is sparingly soluble in aqueous conditions but highly soluble in non-polar solvents. ~ybrldization is carried out in aqueous conditions. Upon subsequent addition of a non-polar, non-miscible phase, ~he unhybridized probe partitions into this phase whereas the hybridized probe concen-trates at the interface due to the additional hybrid-ized component of hydrophilic DNA. This construct, unlike other partioning constructs of the present in-vention does not require a scissile linkage.
13~47~3 Such a biphasic concentration system is useful in iso-lating small quantities of a target nucleic acid from a sample having a large aqueous volume. The sample is subjected to the biphasic concentration system and target material is concentrated at the interface of the two phases. The interface has a relatively small vol-ume compared to that of the two phases. Separation of the interface from the system results in the target nucleic acid sequence being present in relatively high concentration in a small volume of interface.
The biphaslc concentration syste~ is also useful in isolating mRNA from a sample. A biphasic probe mole-cule with a poly dT tail may be used to hybridize withthe mRNA and then the mRNA is isolated using the sol-vent partitioning method of the present invention.
Such a system has advantages over a poly dT column, such as faster isolation time and no problems with extraneous material clogging the column.
The purpose of the present invention is to provide a method for the detection of specific DNA or RNA se-quences in a sample. The method provides a means of speciflcally cleaving the DNA sequence of the probe in at least one point so as to remove any detectable mark-er molecules not bound to a complementary target DNA
sequence and thereby improve the signal to noise ratio of the detection system.
The differential lability of DNA and RNA may be ex-ploited in a heterogeneous system to achieve the pur-pose of the present invention when the scissile linkage is an RNA moiety. Consider Figure 1, which depicts the different results obtained when the DNA probe of the 13~917(?3 present invention is contacted with a complementary DNA
target sequence and a non-complementary DNA sequence.
Complementary target DNA hybridizes with the DNA
strands of the probe so as to connect the DNA strand attached to the solid support with the DNA strand hav-ing the detectable marker after the scissile linkage has been disrupted. In the case where the probe comes in contact with non-complementary DNA, the marker is cleaved from the probe when the scissile linkage is disrupted. The result of such an arrangement is that a marker remains attached to the probe only if the probe has hybridized with a complementary target DNA
sequence. The cleaved markers of non-hybridized probes are eluted from the system. This rids the system of unreacted detection component which causes high back-ground noise. The only detection system componentremaining is that which i8 hybridized to a target DNA
molecule. When the remaining components of the detec-tion system are added only hybridized material reacts.
This enables the use of very high probe concentrations to drive the hybridization reaction without a corre-sponding increase in background noise level.
When the scissile linkage is an RNA ~equence, the llnk-age may be cleaved by an enzyme destructive to RNA.
Varlous RNases may be used to cleave an RNA link.
When RNase A is used, only single stranded RNA (ie.
unhybridized) i8 cut so that the detection component is removed from unhybridized probe molecules, but hy-bridized probe molecules remain intact. When RNase H
i5 u8ed~ only RNA found in an RNA/DNA double-stranded hybrid is cleaved. This leaves a single stranded DNA
gap in a hybridized probe molecule which is then avail-able for rehybridization with another component of the detection system. This type of differential lability `` ~3~4~3 makes it possible to use a variety of detection sys-tems.
It is contemplated that the scissile linkage may also be formed by one or a series of abasic nucleotides.
Any modified base which can be differentiated from deoxy (A,T,G,C) may serve a6 a substrate for the forma-tion of a cleavable point in a DNA sequence. That is to say that the base portion of the deoxyribonucleoside or the ribonucleoside may be removed either before or after synthesis of the probe. The scissile linkage in the probe sequence may be synthesized by u6ing abasic precursor molecules or by enzymatically removing the base after synthesis. An example of the latter is as follows: when deoxyuridine is used during synthesis as the linker entity, one may subsequently remove the uracil base from the deoxyuridine by treatment with the enzyme N-uracil DNA glycosylase. This creates an abasic link wherever there was a deoxyuridine. This link is cleavable by basic conditions or by treatment with one of a group of enzymes called Ap endonucleases which can cleave at any abasic site. It should be noted that uridine moieties in the probe sequence may be created either through direct ~ynthesis or by chemi-cal deamination of cyto6ine moieties. There are indi-cation~ in the literature that this deamination may be accomplished by judicious treatment with sodium bisul-phite. After deamination of cytosine, the resulting uridine moiety may be converted to an abasic link by the action of N-uracil DNA glycosylase. Subsequent cleavage is then effected by either basic conditions or the action of Ap endonucleases. This latter approach allows a scissile linkage to be ~ormed in pre-existing DNA so that non-synthetic or natural DNA sequences may be used as probes in a scissile link system.
`" 13~47~3 With respect to Ap endonuclease activity, the enzyme may be selected such that the end product of its activ-ity is a terminal sugar moiety. This may provide a substrate for a subsequent detection reaction.
A contemplated detection system is a system which uti-lizes a marker component that ls a subunit of a lumi-nescent enzyme system, such as luciferase. Addition of the other subunit plu8 suitable cofactors and sub-strate results in luminescence which may then be am-plified and detected.
Another contemplated detection system is a system hav-ing a solid probe matrix set up as a ~dipstick~ system having an enzyme attached to the probe. The probe matrix is dipped into a target DNA solution for a spec-ified time at a specified temperature. It is then dipped in RNAse to cleave off probe enzyme from probes which have not hybridized. Finally, after a brief washing the matrix i9 dipped in a solution of the en-zyme's substrate which then allows a detectable reac-tion to occur (ie. a color reactlon).
The dlfferential labllity and scl~sile 11nk cleavage tactics which are discussed above may be used in ho-mogenous systems as well as heterogenous systems. The major problem with a homogeneous system, where the probe is not fixed to a solid support, is the preven-tion of the detection of unhybridized detection compo-nents so that background noise is not intolerable.
This problem is overcome with the use of an agent that blocks the detectable marker from reacting. After hybridization has occurred, a competing nucleic acid counterprobe sequence may be added that bears an at-~3~03 tach~ent that sterically hinders or blocks the partic-ipation of unhybridized marker in any further detection reaction. When the steric blocker is added before the addition of a secondary component required for the detection reaction, detection of unhybridized detect-able markers is blocked. When the blocker is intro-duced via an RNA complementary sequence, the procedure is reversible and the blocker may be effectively re-moved by adding an RNAse.
The counter probe itself is constructed to be slightly shorter, i.e. about 1-5 base pairs, than the nucleic acids of the probe. This insures that the cou~terprobè
is less eff~cient than target sequence at hybridizing with probe nucleic acid and therefore the counterprobe does not compete with the target sequence for the probe nucleic acid.
Probe molecules used for testing the scissile link concept have been constructed on a solid support medium (either sillca gel or controlled pore glass) using either a hydrolysable linkage or a permanent (non-hy-drolysable) linkage. Published chemical methods were used for thls synthesis. (Alvarado-Urbina, G., G. M.
SAthe, W. C. Liu, M. F. Gillan, P. D. Duck, R. Bender, and ~. R. Ogilvie (19811, Automated Synthesis of Gene Fragments, Science ~ 270-274; Roberts, D. M., R.
Crea, M. Malecha, G. Alvarado-Urbina, R. H. Chiarello, and D. M. Watterson (1985), Chemical Synthesis and Expression of a Calmodulin gene designed for a Site-Specific Mutagenesis, Biochemistry, in p~e~s; Van Boom, J. H., and C. T. Wreesman (1984), Chemical Synthesis of Small Oligoribonucleotides in Solution, In Oligonucleo-tide Synthesis--A Practical Approach, pp. 153-183, Ed.
M. J. Gait, IRL Press). Standard protected deoxynucle-13~47(~3 oside monomers were obtained from commercial sources whereas protected deoxyuridine and the ribonucleoside monomers were prepared using published procedures.
(Ti, G.S., B. L. Gaffney, and R. A. Jones (1982), Tran-sient Protection:Efficient One Flask Synthesis of Pro-tected Nucleosides, J. AM. Chem. Soc. lQ~:1316). Syn-thesis was performed with a ~IO LOGICALS automated syn-thesizer using a cycle time of 10 minutes for each DNA
condensation and 12 minutes for each RNA condensation.
The following probe constructions were used in various test systems.
SCISSILE LIN~ PRC@ES
P. L. = Permanent Linkage to Solid Support H. L. = Hydrolysable Linkage to Solid Support ,, ~3047~?3 1. MRC046:
5 ' d (TTTTTTTTTT ) r ( UUUUVU~ d (TTTTTTTTTTT ) 3 ' - P . L .
2. MRC059:
5 ' d (TTTTTTTTTT) r ( UUUU) d(TTTTTTTTTTTT)3' - H . L.
5 ' d (TTTTTTTTTT) r ( UUUU) d(TTTTTTTTTTTT)3' - H . L.
3. MRC060:
5 ' d ( TTTTTTTTTTTT ) R ( UUUU ) D ( TTTTTTTTTT ) 3 ' - ~ . L .
5 ' d ( TTTTTTTTTTTT ) R ( UUUU ) D ( TTTTTTTTTT ) 3 ' - ~ . L .
4. MRC064:
5 ' d (TTTTTTTTTTTT ) d ( UUUUUUtlV) d (TTTTTTTTTT ) 3' - H . L.
5. MRC068:
5 ' d (TTTTTTTTTTTTTT) d ( UUUUUUUU) d (TTTTTTTTTT) 3 ' - H. L.
5. MRC068:
5 ' d (TTTTTTTTTTTTTT) d ( UUUUUUUU) d (TTTTTTTTTT) 3 ' - H. L.
6. MRC069:
5 'd (GGGTAACGCCAG)r(GGUUUU)d(CCCAGTCAC) 3' - H. L.
5 'd (GGGTAACGCCAG)r(GGUUUU)d(CCCAGTCAC) 3' - H. L.
7. MRC070:
5 'd (GGGTAACGCCAG)r(GGUUUU) d (CCCAGTCAC) 3 ' - P. L.
5 'd (GGGTAACGCCAG)r(GGUUUU) d (CCCAGTCAC) 3 ' - P. L.
8. MRC071:
5 ' d (TTTTTTTTTTTTTTT)r(UU) d (TTTTTTTTTT) 3' - H. L.
Courlter Probes 9. MRC043:
5 ' d (ACAACGTCGTGACTGGGA) 3 ' - H. L.
5 ' d (TTTTTTTTTTTTTTT)r(UU) d (TTTTTTTTTT) 3' - H. L.
Courlter Probes 9. MRC043:
5 ' d (ACAACGTCGTGACTGGGA) 3 ' - H. L.
10. MRC045:
5 ' d (ACAACGTCGTGACTGGGAA)3' - P.L.
5 ' d (ACAACGTCGTGACTGGGAA)3' - P.L.
11 . MRC058:
5'd(ACAACGTCGTGACTGGGAAT)3' - P.L.
25 1 2 . MRC 06 2:
5'd(CAACGTCGTGACTGGGAMMCTTTTTTT)-3' - H . L .
13. MRC06 3:
5 ' d (CAACGTCGTGACTGGGAAMCTTTTTTT)-3 ' - P . L .
14. MRC067:
5 d (CAACGTCGTGACTGGGAAMCTTTTTTTTT)-3'-P. L.
15. MRC072:
5 ' d ( GTTTTCCCAGTCACGACGTTGTTTTTTTTTTTT)-3 ' - P . L .
16. MRC073:
5 ' d ( GTTTTCCCAGTCACGACGTTGTTTTTTTTTTTT) -3'- H . L .
13~4~3 EXA~p~ 1 C~NS~UCT T ON O~ Scl55~~ L~ 9~
Probe molecules 1-3 and 5-8 were shown to be cleavable at the ribonucleotides by a number of RNases including pancreatic RNase as well as by basic conditions (e~., 0.5 M NaOH). Most general methods for cleava~e by RNases and other routine procedures can be fo~nd in Maniatis et al. (Maniatis, T., E. F. Fritsch, and J.
Sambrook, (19~2), Molecular Cloning, A Laboratory Manu-al, Cold Spring Harbor Laboratory). Probe number 4 was treated with N-uracil glycosylase which removed the uracil base from the uridine moieties leaving an abasic linkage. Subsequent treatment with Ap endonuclease or mild base cleaved the linkage. For simplicity the detector molecule in the experiments was p32, which was attached to the 5' end of the probe with polynucle-otide kinase.
A scissile link probe (eg. MRC 068) was kinased with p32 while the probe sequence was still attached to the solid support upon which it was synthesized. Ater cleavage wlth Pancreatic RNase, the solid ~upport was spun down in a Microfuge for a few seconds and the supernatant dried down and resuspended in a small vol-ume for checking on a 20~ polyacrylamide gel. The solid support remaining was found to have little or no radioactivity associated with it. All the radioactive counts were hydrolysed off by the RNase. When these counts were checked, electrophoretically, they were found to reside in the 14 base fragment 5' distally to the RNA link. Sometimes 1 or 2 ribonucleotides re-mained attached. When the remaining sequence was hy-drolysed from the solid support with concentrated ammo-- 13Q~
nium hydroxide and then kinased with p32, it was found to correspond to the 3' distal DNA 10-mer. It may also have 1 or 2 ribonucleotides attached.
On the other hand, when the 5' labelled scissile link probe is hybridized to an excess of oligo dA (simulates an unknown) prior to treatment with pancreatic RNAse, little or no radioactive label is released from the solid support to which the probe is attached. The same is true when RNase H is used even though the RNA link i8 presumably cleaved. ~he oligo dA piece acts as a hybridization brldge between the 3' DNA 10-mer and the 5' DNA 14-mer, thereby preventing the release of the 5' p32 labelled 14-mer into the supernatant. In this manner unhybridized probe material can be discriminat-ed from hybridized probe material. Other experiments performed with MRC o70,5'-P32 labelled probe which is homologous to a region of the single strand DNA phage M-13 yielded similar results. In these cases, M-13 is used as the unknown and is hybridized to the MRC-070 probe. After RNase treatment unhybridized probe is washed away from the solid support. The counts o~
radioactivity remaining associated wlth the solid sup-port are a reflection of the amount of M-13 hybridized to the MRC 070 probe.
13~ 73 E~aMPI~ 2 coN~cRu-c~rTo~ QF COUNTER PROE~ES
Counter probe molecules 9 through 16 were used in ex-periments to determine suitable hybridization condi-tions. Sequences 9-14 have the same sequence as a short region of the single-stranded DNA phage M-13.
Sequences 15-16 are complementary to this M-13 region.
Initial experiments involved p32 labelling a short synthetic sequence from M-13 (5~ p32 GTTTTCCCAGTCACGACGTTG). Counterprobes complementary to tbis sequence and attached to a solid support were then used to remove the labelled seguence from solution. A
variety of hybridization conditions were tried and the system was found to tolerate considerable variation. A
factor which was found to considerably influence the efficiency of binding counterprobe to probe was the length of the non-specific arm between the solid sup-port and the 3' end of the complementary sequence. Ingeneral, a 12-T arm pulled out virtually all of the labelled probe from solution within 30 minutes at an excess of about 4000X. With no T arm between the solld support and the complementary sequence, only about 60~
of the labelled probe was removed rom solution. An important point emerging from competitlon studies is that the counterprobe sequence complementary to the probe should be 1-5 bases shorter than the probe.
Since the counterprobe is the same sequence as the target sequence, it ls important to minimize competi-tion for the probe between the target sequence and the counterprobe so that the counterprobe does not displace the probe from target sequence.
5'd(ACAACGTCGTGACTGGGAAT)3' - P.L.
25 1 2 . MRC 06 2:
5'd(CAACGTCGTGACTGGGAMMCTTTTTTT)-3' - H . L .
13. MRC06 3:
5 ' d (CAACGTCGTGACTGGGAAMCTTTTTTT)-3 ' - P . L .
14. MRC067:
5 d (CAACGTCGTGACTGGGAAMCTTTTTTTTT)-3'-P. L.
15. MRC072:
5 ' d ( GTTTTCCCAGTCACGACGTTGTTTTTTTTTTTT)-3 ' - P . L .
16. MRC073:
5 ' d ( GTTTTCCCAGTCACGACGTTGTTTTTTTTTTTT) -3'- H . L .
13~4~3 EXA~p~ 1 C~NS~UCT T ON O~ Scl55~~ L~ 9~
Probe molecules 1-3 and 5-8 were shown to be cleavable at the ribonucleotides by a number of RNases including pancreatic RNase as well as by basic conditions (e~., 0.5 M NaOH). Most general methods for cleava~e by RNases and other routine procedures can be fo~nd in Maniatis et al. (Maniatis, T., E. F. Fritsch, and J.
Sambrook, (19~2), Molecular Cloning, A Laboratory Manu-al, Cold Spring Harbor Laboratory). Probe number 4 was treated with N-uracil glycosylase which removed the uracil base from the uridine moieties leaving an abasic linkage. Subsequent treatment with Ap endonuclease or mild base cleaved the linkage. For simplicity the detector molecule in the experiments was p32, which was attached to the 5' end of the probe with polynucle-otide kinase.
A scissile link probe (eg. MRC 068) was kinased with p32 while the probe sequence was still attached to the solid support upon which it was synthesized. Ater cleavage wlth Pancreatic RNase, the solid ~upport was spun down in a Microfuge for a few seconds and the supernatant dried down and resuspended in a small vol-ume for checking on a 20~ polyacrylamide gel. The solid support remaining was found to have little or no radioactivity associated with it. All the radioactive counts were hydrolysed off by the RNase. When these counts were checked, electrophoretically, they were found to reside in the 14 base fragment 5' distally to the RNA link. Sometimes 1 or 2 ribonucleotides re-mained attached. When the remaining sequence was hy-drolysed from the solid support with concentrated ammo-- 13Q~
nium hydroxide and then kinased with p32, it was found to correspond to the 3' distal DNA 10-mer. It may also have 1 or 2 ribonucleotides attached.
On the other hand, when the 5' labelled scissile link probe is hybridized to an excess of oligo dA (simulates an unknown) prior to treatment with pancreatic RNAse, little or no radioactive label is released from the solid support to which the probe is attached. The same is true when RNase H is used even though the RNA link i8 presumably cleaved. ~he oligo dA piece acts as a hybridization brldge between the 3' DNA 10-mer and the 5' DNA 14-mer, thereby preventing the release of the 5' p32 labelled 14-mer into the supernatant. In this manner unhybridized probe material can be discriminat-ed from hybridized probe material. Other experiments performed with MRC o70,5'-P32 labelled probe which is homologous to a region of the single strand DNA phage M-13 yielded similar results. In these cases, M-13 is used as the unknown and is hybridized to the MRC-070 probe. After RNase treatment unhybridized probe is washed away from the solid support. The counts o~
radioactivity remaining associated wlth the solid sup-port are a reflection of the amount of M-13 hybridized to the MRC 070 probe.
13~ 73 E~aMPI~ 2 coN~cRu-c~rTo~ QF COUNTER PROE~ES
Counter probe molecules 9 through 16 were used in ex-periments to determine suitable hybridization condi-tions. Sequences 9-14 have the same sequence as a short region of the single-stranded DNA phage M-13.
Sequences 15-16 are complementary to this M-13 region.
Initial experiments involved p32 labelling a short synthetic sequence from M-13 (5~ p32 GTTTTCCCAGTCACGACGTTG). Counterprobes complementary to tbis sequence and attached to a solid support were then used to remove the labelled seguence from solution. A
variety of hybridization conditions were tried and the system was found to tolerate considerable variation. A
factor which was found to considerably influence the efficiency of binding counterprobe to probe was the length of the non-specific arm between the solid sup-port and the 3' end of the complementary sequence. Ingeneral, a 12-T arm pulled out virtually all of the labelled probe from solution within 30 minutes at an excess of about 4000X. With no T arm between the solld support and the complementary sequence, only about 60~
of the labelled probe was removed rom solution. An important point emerging from competitlon studies is that the counterprobe sequence complementary to the probe should be 1-5 bases shorter than the probe.
Since the counterprobe is the same sequence as the target sequence, it ls important to minimize competi-tion for the probe between the target sequence and the counterprobe so that the counterprobe does not displace the probe from target sequence.
Claims (53)
1. A synthetic, non-naturally occurring composition comprising the structure:
wherein NA1 and NA2 are different noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence capable of hybridizing to the NA1 and NA2 sequences, or to the NA1 and NA2 sequences and the scissile linkage of said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA1 and NA2 are DNA sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA sequences; and wherein n is an integer from 1 to 4.
wherein NA1 and NA2 are different noncomplementary nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence capable of hybridizing to the NA1 and NA2 sequences, or to the NA1 and NA2 sequences and the scissile linkage of said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA1 and NA2 are DNA sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA sequences; and wherein n is an integer from 1 to 4.
2. The composition of claim 1, wherein the dashed lines represent chemical bonds.
3. The composition of claim 2, wherein the chemical bonds are covalent bonds.
4. The composition of claim 1, wherein the scissile linkage is selected from the group consisting of RNA sequences, DNA sequences, amino acid sequenc-es, abasic nucleic acid sequences or carbohydrate polymers.
5. The composition of claim 1, wherein the scissile linkage is a nucleic acid sequence.
6. The composition of claim 1 immobilized on a solid support.
7. The composition of claim 1, wherein NA1 and NA2 are DNA sequences.
8. The composition of claim 1, wherein NA1 and NA2 are RNA sequences.
9. The composition of claim 1, wherein when the scissile linkage is other than a nucleic acid sequence NA1 is either an RNA or DNA sequence and NA2 is either an RNA or DNA sequence.
10. The composition of claim 1, wherein NA1 and NA2 comprises a sequence which is not a naturally occurring nucleic acid sequence.
11. The composition of claim 1, wherein NA1 or NA2 is a naturally occurring nucleic acid sequence.
12. The composition of claim 1, wherein in each -[-NA1---S---NA2-] a marker is attached to one of NA1 or NA2.
13. The composition of claim 12 immobilized on a solid support.
14. The composition of claim 12, wherein the marker is a radioisotope, a radiolabelled molecule, a fluores-cent molecule, biotin, an enzyme, or a ligand.
15. The composition of claim 1, wherein NA1 and NA2 each comprise between 8 nucleotides and 10,000 nucleo-tides.
16. The composition of claim 1, wherein n is greater than one and each [NA1---S--NA2] unit is the same.
17. The composition of claim 1, wherein n iB greater than 1 and each [ NA1---S---NA2 ] unit is different.
18. A synthetic, non-naturally occurring composition comprising the structure:
wherein NA1 and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence capable of hybridizing to the NA1 and NA2 seguences, or to the NA1 and NA2 sequences and the scissile linkage of said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA1 and NA2 are DNA sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA sequences; and wherein n is an integer from 2 to 4.
wherein NA1 and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence capable of hybridizing to the NA1 and NA2 seguences, or to the NA1 and NA2 sequences and the scissile linkage of said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA1 and NA2 are DNA sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA sequences; and wherein n is an integer from 2 to 4.
19. The composition of claim 18, wherein a marker is attached to one of NA1 or NA2.
20. The composition of claim 18 immobilized on a solid support.
21. A composition comprising the structure:
wherein NA1 and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence capable of hybridizing to the NA1 and NA2 sequences, or to the NA1 and NA2 sequences and the scissile linkage of said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA1 and NA2 are DNA
sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA sequences;
wherein n is an integer from 1 to 4;
wherein the solid lines represent chemical bonds;
wherein X is a solid support;
wherein L is a chemical entity which links NA1 to the solid support; and wherein M is a marker.
wherein NA1 and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence capable of hybridizing to the NA1 and NA2 sequences, or to the NA1 and NA2 sequences and the scissile linkage of said composition, wherein if the scissile linkage is a nucleic acid sequence it is RNA when both NA1 and NA2 are DNA
sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA sequences;
wherein n is an integer from 1 to 4;
wherein the solid lines represent chemical bonds;
wherein X is a solid support;
wherein L is a chemical entity which links NA1 to the solid support; and wherein M is a marker.
22. The composition of claim 21, wherein X is a silica-ceous, cellulosic, or plastic material or con-trolled pore glass.
23. The composition of claim 21, wherein the chemical bonds are covalent bonds.
24. The composition of claim 21, wherein the chemical bonds are hydrogen or covalent bonds.
25. The composition of claim 21, wherein M is a radioiso-tope, a radiolabelled molecule, a fluorescent molecule, or a ligand.
26. The composition of claim 21, wherein the dashed lines represent chemical bonds.
27. The composition of claim 26, wherein the chemical bonds represented by the dashed lines are covalent bonds.
28. The composition of claim 21, wherein the scissile linkage is selected from the group consisting of RNA sequences, DNA sequences, amino acid sequenc-es, abasic nucleotide sequences or carbohydrate polymers.
29. The composition of claim 21, wherein NA1 and NA2 each comprise between 8 nucleotides and 10,000 nucleotides.
30. The composition of claim 21, wherein n is greater than 1 and each [ NA1---S---NA2 ] unit is the same.
31. The composition of claim 21, wherein n is greater than 1 and each [ NA1---S---NA2 ] unit is differ-ent.
32. A composition comprising the structure:
wherein NA1 and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence, capable of hybridizing to the NA1 and NA2 sequences, or to the NA1 and NA2 sequences and the scissile linkage of said composition , wherein if the scissile linkage is a nucleic acid sequence it is a RNA when both NA1 and NA2 are DNA sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA
sequences;
wherein the solid lines represent chemical bonds;
wherein n is an integer from 1 to 4;
wherein Y is absent or is a chemical entity which confers an identifying characteristic; and wherein Z is absent or is a chemical entity which confers a different identifying characteristic.
wherein NA1 and NA2 are nucleic acid sequences;
wherein ---S--- is a scissile linkage which is capable of being cleaved or disrupted without cleaving or disrupting the nucleic acid sequences of NA1 or NA2 or of a target nucleic acid sequence, capable of hybridizing to the NA1 and NA2 sequences, or to the NA1 and NA2 sequences and the scissile linkage of said composition , wherein if the scissile linkage is a nucleic acid sequence it is a RNA when both NA1 and NA2 are DNA sequences, or the scissile linkage is DNA when both NA1 and NA2 are RNA
sequences;
wherein the solid lines represent chemical bonds;
wherein n is an integer from 1 to 4;
wherein Y is absent or is a chemical entity which confers an identifying characteristic; and wherein Z is absent or is a chemical entity which confers a different identifying characteristic.
33. The composition of claim 32, wherein the chemical bonds are covalent bonds.
34. The composition of claim 32, wherein the identi-fying characteristic of Y is hydrophobicity or hydrophilicity and the identifying characteristic of Z is hydrophilicity or hydrophobicity.
35. The composition of claim 32, wherein when one of Y or Z is absent, the other is hydrophobic.
36. The composition of claim 32, wherein the dashed lines represent chemical bonds.
37. The composition of claim 36, wherein the chemical bonds represented by dashed lines are covalent bonds.
38. The composition of claim 32, wherein the scissile linkage is selected from the group consisting of RNA sequences, DNA sequences, amino acid sequenc-es, abasic nucleotide sequences or carbohydrate polymers.
39. The composition of claim 32, wherein one of Y or Z
is a marker and the other is hydrophobic.
is a marker and the other is hydrophobic.
40. The composition of claim 32, wherein a marker is attached to one of NA1 or NA2.
41. The composition of claim 32, wherein NA1 and NA2 are DNA sequences.
42. The composition of claim 32, wherein NA1 and NA2 are RNA sequences.
43. The composition of claim 32, wherein when the scissile linkage is other than a nucleic acid sequence NA1 is either an RNA or DNA sequence and NA2 is either an RNA
or DNA sequence.
or DNA sequence.
44. The composition of claim 32, wherein NA1 and NA2 comprise a sequence which is not naturally occurring nucleic acid sequence.
45. The composition of claim 32, wherein NA1 or NA2 is a naturally occurring nucleic acid sequence.
46. A method of detecting in a sample the presence of a target nucleic acid sequence of interest comprising:
a) contacting the sample with a composition of claim 12 which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) immobilizing said complex on a solid support;
c) treating the immobilized complex so as to cleave the scissile linkage;
d) separately recovering the immobilized complex; and e) detecting the presence of the marker on the immobilized complex and thereby the target nucleic acid sequence of interest.
a) contacting the sample with a composition of claim 12 which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) immobilizing said complex on a solid support;
c) treating the immobilized complex so as to cleave the scissile linkage;
d) separately recovering the immobilized complex; and e) detecting the presence of the marker on the immobilized complex and thereby the target nucleic acid sequence of interest.
47. A method of detecting in a sample the presence of a target nucleic acid sequence of interest comprising:
a) contacting the sample with a composition of claim 21 which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) treating said complex so as to cleave the scissile linkage;
c) separately recovering the immobilized complex; and d) detecting the presence of the marker on the immobilized complex and thereby the target nucleic acid sequence of interest.
a) contacting the sample with a composition of claim 21 which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) treating said complex so as to cleave the scissile linkage;
c) separately recovering the immobilized complex; and d) detecting the presence of the marker on the immobilized complex and thereby the target nucleic acid sequence of interest.
48. A method of detecting in a sample a target nucleic acid sequence of interest comprising:
a) contacting under hybridizing conditions the sample with an aqueous solution comprising a composition of claim 40 which comprises a nucleic acid sequence complementary to the target nucleic acid sequence of interest to form a hybridized complex, wherein Y is a hydrophobic entity;
b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the complex is present at the phase interface of the biphasic solution, Y being oriented in one phase and Z being oriented in the other phase;
c) treating the complex 80 as to cleave the scissile linkage;
d) recovering the complex so treated; and e) detecting the presence of the marker and thereby detecting the target nucleic acid sequence of interest.-
a) contacting under hybridizing conditions the sample with an aqueous solution comprising a composition of claim 40 which comprises a nucleic acid sequence complementary to the target nucleic acid sequence of interest to form a hybridized complex, wherein Y is a hydrophobic entity;
b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the complex is present at the phase interface of the biphasic solution, Y being oriented in one phase and Z being oriented in the other phase;
c) treating the complex 80 as to cleave the scissile linkage;
d) recovering the complex so treated; and e) detecting the presence of the marker and thereby detecting the target nucleic acid sequence of interest.-
49. A diagnostic method for detecting the presence of a foreign pathogen in a sample which comprises detecting a nucleic acid sequence characteristic of the pathogen using the method of claims 46, 47 or 48.
50. A method for quantitatively determining in a sample the amount of a target nucleic acid sequence of interest comprising:
a) contacting the sample with a predetermined amount of a composition of claim 12, which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) immobilizing said complex on a solid support;
c) treating the immobilized complex so as to cleave the scissile linkage;
d) separately recovering the immobilized complex; and e) quantitatively determining the amount of marker present on the immobilized complex and thereby the amount of target nucleic acid sequence of interest.
a) contacting the sample with a predetermined amount of a composition of claim 12, which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) immobilizing said complex on a solid support;
c) treating the immobilized complex so as to cleave the scissile linkage;
d) separately recovering the immobilized complex; and e) quantitatively determining the amount of marker present on the immobilized complex and thereby the amount of target nucleic acid sequence of interest.
51. A method for quantitatively determining in a sample the amount of a target nucleic acid sequence of interest comprising:
a) contacting the sample with a predetermined amount of a composition of claim 21, which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) treating the immobilized complex so as to cleave the scissile linkage;
c) separately recovering the immobilized complex; and d) quantitatively determining the amount of marker present on the immobilized complex and thereby the amount of target nucleic acid sequence of interest.
a) contacting the sample with a predetermined amount of a composition of claim 21, which comprises a nucleic acid sequence substantially complementary to the target nucleic acid sequence of interest, under hybridizing conditions to form a hybridized complex;
b) treating the immobilized complex so as to cleave the scissile linkage;
c) separately recovering the immobilized complex; and d) quantitatively determining the amount of marker present on the immobilized complex and thereby the amount of target nucleic acid sequence of interest.
52. A method for quantitatively determining in a sample the amount of a target nucleic acid sequence of interest comprising:
a) contacting under hybridizing conditions the sample with an aqueous solution comprising a composition of claim 40 which comprises a nucleic acid sequence complementary to the target nucleic acid sequence of interest to form a hybridized complex, wherein Y is a hydrophobic entity and Z is a hydrophilic entity;
b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the complex is present at the phase interface of the biphasic solution, Y being oriented in one phase and Z being oriented in the other phase;
c) treating the complex so as to cleave the scissile linkage;
d) recovering the complex so treated; and e) quantitatively determining the amount of a marker and thereby the target nucleic acid sequence of interest.
a) contacting under hybridizing conditions the sample with an aqueous solution comprising a composition of claim 40 which comprises a nucleic acid sequence complementary to the target nucleic acid sequence of interest to form a hybridized complex, wherein Y is a hydrophobic entity and Z is a hydrophilic entity;
b) mixing the resulting solution with a nonpolar solvent to form a biphasic solution in which the complex is present at the phase interface of the biphasic solution, Y being oriented in one phase and Z being oriented in the other phase;
c) treating the complex so as to cleave the scissile linkage;
d) recovering the complex so treated; and e) quantitatively determining the amount of a marker and thereby the target nucleic acid sequence of interest.
53. A diagnostic method for measuring the amount of a foreign pathogen in a sample which comprises de-tecting a nucleic acid of the pathogen using the method of claim 50, 51 or 52.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US06/805,279 US4876187A (en) | 1985-12-05 | 1985-12-05 | Nucleic acid compositions with scissile linkage useful for detecting nucleic acid sequences |
| US805,279 | 1985-12-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA1304703C true CA1304703C (en) | 1992-07-07 |
Family
ID=25191131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA000524411A Expired - Fee Related CA1304703C (en) | 1985-12-05 | 1986-12-03 | Molecules useful for detecting nucleic acid sequences |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US4876187A (en) |
| EP (1) | EP0227976A3 (en) |
| JP (2) | JP2691177B2 (en) |
| AU (1) | AU601383B2 (en) |
| CA (1) | CA1304703C (en) |
| FI (1) | FI864964A (en) |
| IL (1) | IL80856A0 (en) |
Families Citing this family (188)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5118605A (en) * | 1984-10-16 | 1992-06-02 | Chiron Corporation | Polynucleotide determination with selectable cleavage sites |
| US5430136A (en) * | 1984-10-16 | 1995-07-04 | Chiron Corporation | Oligonucleotides having selectably cleavable and/or abasic sites |
| US5367066A (en) * | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| US5011769A (en) * | 1985-12-05 | 1991-04-30 | Meiogenics U.S. Limited Partnership | Methods for detecting nucleic acid sequences |
| US4994368A (en) * | 1987-07-23 | 1991-02-19 | Syntex (U.S.A.) Inc. | Amplification method for polynucleotide assays |
| US5273879A (en) * | 1987-07-23 | 1993-12-28 | Syntex (U.S.A.) Inc. | Amplification method for polynucleotide assays |
| JP2565552B2 (en) * | 1987-10-15 | 1996-12-18 | カイロン コーポレイション | Nucleic acid multimer and amplified nucleic acid hybridization analysis method using the same |
| US5403711A (en) * | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
| JP2856804B2 (en) * | 1988-03-24 | 1999-02-10 | ユニバーシティ オブ アイオワ リサーチ ファウンデイション | Catalytic hybridization system for nucleic acid sequence detection based on activity as a cofactor in catalysis to cleave labeled complementary nucleic acid probes |
| AU3764989A (en) * | 1988-05-09 | 1989-11-29 | Salk Institute For Biological Studies, The | Method of making nucleic acid dimers |
| US5683896A (en) * | 1989-06-01 | 1997-11-04 | Life Technologies, Inc. | Process for controlling contamination of nucleic acid amplification reactions |
| AU5931290A (en) * | 1989-06-20 | 1991-01-08 | Meiogenics, Inc. | Nuclease resistant, single-stranded, non-naturally occurring nucleic acid molecules |
| FR2649122B1 (en) * | 1989-07-03 | 1991-10-18 | Pasteur Institut | IMPROVEMENTS IN TECHNIQUES FOR CHAIN POLYMERIZATION (PCR) AMPLIFICATION TECHNIQUES |
| US5721218A (en) * | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
| US5399676A (en) * | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5650302A (en) * | 1990-05-01 | 1997-07-22 | Amgen Inc. | Method for reducing carryover contamination in an amplification procedure |
| HU218095B (en) * | 1990-05-01 | 2000-05-28 | Amgen Inc. | Process for reducing transitional contaminations in amplification processes |
| US5451502A (en) * | 1990-05-04 | 1995-09-19 | Oncor, Inc. | Restriction amplification assay |
| US5256536A (en) * | 1990-11-09 | 1993-10-26 | Syntex (U.S.A.) Inc. | Nucleotide probe for Neisseria gonrrhoeae |
| CA2058232A1 (en) * | 1991-01-22 | 1992-07-23 | Joseph A. Walder | Process to prevent contamination by amplified nucleic acid sequence |
| US5437976A (en) * | 1991-08-08 | 1995-08-01 | Arizona Board Of Regents, The University Of Arizona | Multi-domain DNA ligands bound to a solid matrix for protein and nucleic acid affinity chromatography and processing of solid-phase DNA |
| US5994069A (en) * | 1996-01-24 | 1999-11-30 | Third Wave Technologies, Inc. | Detection of nucleic acids by multiple sequential invasive cleavages |
| US6872816B1 (en) | 1996-01-24 | 2005-03-29 | Third Wave Technologies, Inc. | Nucleic acid detection kits |
| US5846717A (en) | 1996-01-24 | 1998-12-08 | Third Wave Technologies, Inc. | Detection of nucleic acid sequences by invader-directed cleavage |
| JP2780572B2 (en) * | 1991-09-13 | 1998-07-30 | 株式会社島津製作所 | Enzymatic synthesis of oligonucleotides and use of oligonucleotides as primers |
| US20070032446A1 (en) * | 1991-12-24 | 2007-02-08 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
| WO1993022461A1 (en) * | 1992-05-06 | 1993-11-11 | Gen-Probe Incorporated | Nucleic acid sequence amplification method, composition and kit |
| CN1122138A (en) * | 1993-01-21 | 1996-05-08 | 海布里顿公司 | Foldback triplex-forming oligonucleotides |
| US6027884A (en) * | 1993-06-17 | 2000-02-22 | The Research Foundation Of The State University Of New York | Thermodynamics, design, and use of nucleic acid sequences |
| WO1995003427A2 (en) * | 1993-07-19 | 1995-02-02 | Gen-Probe Incorporated | Oligonucleotide screening assay |
| WO1995005480A2 (en) * | 1993-08-18 | 1995-02-23 | Id Biomedical Corporation | Compositions and methods for detecting target nucleic acid sequences utilizing flanking sequence enzyme molecules |
| DK1650303T3 (en) * | 1993-10-27 | 2008-09-08 | Univ Columbia | Method for generating a subtracted cDNA library and using the generated library |
| WO1995014106A2 (en) * | 1993-11-17 | 1995-05-26 | Id Biomedical Corporation | Cycling probe cleavage detection of nucleic acid sequences |
| US6071699A (en) | 1996-06-07 | 2000-06-06 | California Institute Of Technology | Nucleic acid mediated electron transfer |
| US6586568B1 (en) | 1994-02-14 | 2003-07-01 | Abbott Laboratories | Non-A, non-B, non-C, non-D, non-E hepatitis reagents and methods for their use |
| US6558898B1 (en) | 1994-02-14 | 2003-05-06 | Abbott Laboratories | Non-A, non-B, non-C, non-D, non-E hepatitis reagents and methods for their use |
| US5843450A (en) * | 1994-02-14 | 1998-12-01 | Abbott Laboratories | Hepatitis GB Virus synthetic peptides and uses thereof |
| US6156495A (en) * | 1994-02-14 | 2000-12-05 | Abbott Laboratories | Hepatitis GB virus recombinant proteins and uses thereof |
| US6451578B1 (en) | 1994-02-14 | 2002-09-17 | Abbott Laboratories | Non-A, non-B, non-C, non-D, non-E hepatitis reagents and methods for their use |
| US6051374A (en) * | 1994-02-14 | 2000-04-18 | Abbott Laboratories | Non-A, non-B, non-C, non-D, non-E hepatitis reagents and methods for their use |
| US6720166B2 (en) | 1994-02-14 | 2004-04-13 | Abbott Laboratories | Non-a, non-b, non-c, non-c, non-d, non-e hepatitis reagents and methods for their use |
| US5981172A (en) * | 1994-02-14 | 1999-11-09 | Abbott Laboratories | Non-A, non-B, non-C, non-D, non-E Hepatitis reagents and methods for their use |
| US6787304B1 (en) | 1994-12-28 | 2004-09-07 | Georgetown University | Fluorometric assay for detecting nucleic acid cleavage |
| DE69535882D1 (en) * | 1994-12-30 | 2008-12-18 | Univ Georgetown | FLUORESCENT TEST FOR DETECTING THE CLEAVAGE OF NUCLEIC ACID |
| US20030165908A1 (en) * | 1994-12-30 | 2003-09-04 | Georgetown University | Fluorometric assay for detecting nucleic acid cleavage |
| US5750341A (en) * | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5763178A (en) * | 1995-06-07 | 1998-06-09 | Trevigen, Inc. | Oscillating signal amplifier for nucleic acid detection |
| US5656430A (en) * | 1995-06-07 | 1997-08-12 | Trevigen, Inc. | Oscillating signal amplifier for nucleic acid detection |
| US5550025A (en) * | 1995-07-19 | 1996-08-27 | Becton, Dickinson And Company | Detection of hydrophobic amplification products by extraction into an organic phase |
| FR2737223B1 (en) * | 1995-07-24 | 1997-09-12 | Bio Merieux | METHOD OF AMPLIFYING NUCLEIC ACID SEQUENCES BY MOVEMENT USING CHIMERIC PRIMERS |
| DE19527155C2 (en) * | 1995-07-25 | 1998-12-10 | Deutsches Krebsforsch | Method of sequencing by oligomer hybridization |
| US5807670A (en) * | 1995-08-14 | 1998-09-15 | Abbott Laboratories | Detection of hepatitis GB virus genotypes |
| US5955318A (en) * | 1995-08-14 | 1999-09-21 | Abbott Laboratories | Reagents and methods useful for controlling the translation of hepatitis GBV proteins |
| US6248555B1 (en) * | 1995-08-31 | 2001-06-19 | The General Hospital Corporation | Genetic alterations related to familial alzheimer's disease |
| US5747255A (en) * | 1995-09-29 | 1998-05-05 | Lynx Therapeutics, Inc. | Polynucleotide detection by isothermal amplification using cleavable oligonucleotides |
| US20080160524A1 (en) * | 1996-01-24 | 2008-07-03 | Third Wave Technologies, Inc. | Methods and Compositions for Detecting Target Sequences |
| US5985557A (en) * | 1996-01-24 | 1999-11-16 | Third Wave Technologies, Inc. | Invasive cleavage of nucleic acids |
| US6706471B1 (en) | 1996-01-24 | 2004-03-16 | Third Wave Technologies, Inc. | Detection of nucleic acid sequences by invader-directed cleavage |
| US7122364B1 (en) * | 1998-03-24 | 2006-10-17 | Third Wave Technologies, Inc. | FEN endonucleases |
| US7195871B2 (en) * | 1996-01-24 | 2007-03-27 | Third Wave Technologies, Inc | Methods and compositions for detecting target sequences |
| US6090606A (en) * | 1996-01-24 | 2000-07-18 | Third Wave Technologies, Inc. | Cleavage agents |
| US6875572B2 (en) | 1996-01-24 | 2005-04-05 | Third Wave Technologies, Inc. | Nucleic acid detection assays |
| US5955268A (en) * | 1996-04-26 | 1999-09-21 | Abbott Laboratories | Method and reagent for detecting multiple nucleic acid sequences in a test sample |
| US5770370A (en) * | 1996-06-14 | 1998-06-23 | David Sarnoff Research Center, Inc. | Nuclease protection assays |
| US6780982B2 (en) | 1996-07-12 | 2004-08-24 | Third Wave Technologies, Inc. | Charge tags and the separation of nucleic acid molecules |
| US5853990A (en) * | 1996-07-26 | 1998-12-29 | Edward E. Winger | Real time homogeneous nucleotide assay |
| US6096273A (en) * | 1996-11-05 | 2000-08-01 | Clinical Micro Sensors | Electrodes linked via conductive oligomers to nucleic acids |
| US7381525B1 (en) * | 1997-03-07 | 2008-06-03 | Clinical Micro Sensors, Inc. | AC/DC voltage apparatus for detection of nucleic acids |
| CA2273204C (en) | 1996-11-29 | 2008-10-14 | Third Wave Technologies, Inc. | Fen-1 endonucleases, mixtures and cleavage methods |
| US6309874B1 (en) | 1997-06-04 | 2001-10-30 | Karolinska Innovations Ab | Selection marker |
| US6503709B1 (en) | 1997-07-03 | 2003-01-07 | Id Biomedical Corporation | Methods for rapidly detecting methicillin resistant staphylococci |
| US6274316B1 (en) * | 1997-07-03 | 2001-08-14 | Id Biomedical Corporation | Compositions and methods for detecting vancomycin resistant enterococci by cycling probe reactions |
| US6136533A (en) * | 1997-07-03 | 2000-10-24 | Id Biomedical | Additives for use in cycling probe reactions |
| US8182991B1 (en) | 1997-11-26 | 2012-05-22 | Third Wave Technologies, Inc. | FEN-1 endonucleases, mixtures and cleavage methods |
| EP2045334A1 (en) | 1998-06-24 | 2009-04-08 | Illumina, Inc. | Decoding of array sensors with microspheres |
| DE19856796A1 (en) * | 1998-12-09 | 2000-06-15 | Biochip Technologies Gmbh | Cleavage of chemically synthesized oligo- / polynucleotides at a predetermined location |
| US6656692B2 (en) | 1999-12-21 | 2003-12-02 | Ingeneus Corporation | Parallel or antiparallel, homologous or complementary binding of nucleic acids or analogues thereof to form duplex, triplex or quadruplex complexes |
| US6420115B1 (en) | 1999-12-21 | 2002-07-16 | Ingeneus Corporation | Cation mediated triplex hybridization assay |
| US6858390B2 (en) | 1998-12-31 | 2005-02-22 | Ingeneus Corporation | Aptamers containing sequences of nucleic acid or nucleic acid analogues bound homologously, or in novel complexes |
| US6403313B1 (en) | 1999-12-21 | 2002-06-11 | Ingeneus Corporation | Fluorescent intensity assay for duplex and triplex nucleic acid hybridization solution utilizing fluorescent intercalators |
| US6514700B1 (en) * | 1999-04-30 | 2003-02-04 | Aclara Biosciences, Inc. | Nucleic acid detection using degradation of a tagged sequence |
| US20030207295A1 (en) * | 1999-04-20 | 2003-11-06 | Kevin Gunderson | Detection of nucleic acid reactions on bead arrays |
| ATE413467T1 (en) | 1999-04-20 | 2008-11-15 | Illumina Inc | DETECTION OF NUCLEIC ACID REACTIONS ON BEAD ARRAYS |
| US20060275782A1 (en) | 1999-04-20 | 2006-12-07 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US20030235832A1 (en) * | 2000-06-21 | 2003-12-25 | Ahmed Chenna | Multiplexed analysis by chromatographic separation of molecular tags |
| US8481268B2 (en) | 1999-05-21 | 2013-07-09 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| US8080380B2 (en) | 1999-05-21 | 2011-12-20 | Illumina, Inc. | Use of microfluidic systems in the detection of target analytes using microsphere arrays |
| ATE417127T1 (en) | 1999-07-26 | 2008-12-15 | Clinical Micro Sensors Inc | NUKELIC ACID SEQUENCE DETERMINATION USING ELECTRONIC DETECTION |
| US6692918B2 (en) | 1999-09-13 | 2004-02-17 | Nugen Technologies, Inc. | Methods and compositions for linear isothermal amplification of polynucleotide sequences |
| US6927027B2 (en) | 1999-12-21 | 2005-08-09 | Ingeneus Corporation | Nucleic acid multiplex formation |
| US20030181412A1 (en) * | 1999-12-21 | 2003-09-25 | Ingeneus Corporation | Method for modifying transcription and/or translation in an organism for therapeutic, prophylactic and/or analytic uses |
| US6911536B1 (en) | 1999-12-21 | 2005-06-28 | Ingeneus Corporation | Triplex and quadruplex catalytic hybridization |
| US7052844B2 (en) * | 1999-12-21 | 2006-05-30 | Ingeneus, Inc. | Purification of DS-DNA using heteropolymeric capture probes and a triplex, quadruplex or homologous duplex binding mechanism |
| US7309569B2 (en) | 1999-12-21 | 2007-12-18 | Ingeneus, Inc. | Parallel or antiparallel, homologous or complementary binding of nucleic acids or analogues thereof to form duplex, triplex or quadruplex complexes |
| US6924108B2 (en) | 1999-12-21 | 2005-08-02 | Ingeneus Corporation | Nucleic acid binding enhancement by conjugation with nucleotides, nucleosides, bases and/or their analogues |
| US6613524B1 (en) * | 2000-01-24 | 2003-09-02 | Ingeneus Corporation | Amperometric affinity assay and electrically stimulated complexes of nucleic acids |
| US20030170659A1 (en) * | 2000-01-24 | 2003-09-11 | Ingeneus Corporation | Electrical treatment of binding media to encourage, discourage and/or study biopolymer binding |
| US6982147B2 (en) * | 2000-01-24 | 2006-01-03 | Ingeneus Corporation | Apparatus for assaying biopolymer binding by means of multiple measurements under varied conditions |
| US7220541B2 (en) * | 2000-01-24 | 2007-05-22 | Ingeneus, Inc. | Homogeneous assay of biopolymer binding by means of multiple measurements under varied conditions |
| US7611869B2 (en) | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| US7955794B2 (en) | 2000-09-21 | 2011-06-07 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US8076063B2 (en) | 2000-02-07 | 2011-12-13 | Illumina, Inc. | Multiplexed methylation detection methods |
| US20040067498A1 (en) * | 2000-04-28 | 2004-04-08 | Ahmed Chenna | Detection of nucleic acid sequences by cleavage and separation of tag-containing structures |
| JP2004513617A (en) * | 2000-06-26 | 2004-05-13 | ニューゲン テクノロジーズ， インコーポレイテッド | Methods and compositions for transcription-based nucleic acid amplification |
| US7846733B2 (en) | 2000-06-26 | 2010-12-07 | Nugen Technologies, Inc. | Methods and compositions for transcription-based nucleic acid amplification |
| AU1309602A (en) | 2000-10-06 | 2002-04-15 | Nugen Technologies Inc | Methods and probes for detection and/or quantification of nucleic acid sequences |
| US6858412B2 (en) * | 2000-10-24 | 2005-02-22 | The Board Of Trustees Of The Leland Stanford Junior University | Direct multiplex characterization of genomic DNA |
| JP2005500821A (en) * | 2000-11-15 | 2005-01-13 | サード・ウェーブ・テクノロジーズ・インク | FEN endonuclease |
| CA2430329A1 (en) | 2000-12-13 | 2002-06-20 | Nugen Technologies, Inc. | Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof |
| KR100809949B1 (en) * | 2001-02-15 | 2008-03-06 | 다카라 바이오 가부시키가이샤 | Method of detecting nucleotide polymorphism |
| CA2439074A1 (en) * | 2001-03-09 | 2002-09-19 | Nugen Technologies, Inc. | Methods and compositions for amplification of rna sequences |
| ATE361996T1 (en) | 2001-03-09 | 2007-06-15 | Nugen Technologies Inc | METHODS AND COMPOSITIONS FOR DUPLICATION OF RNA SEQUENCES |
| US20030092157A1 (en) * | 2001-03-16 | 2003-05-15 | Hayden Michael R. | Compositions, screening systems and methods for modulating HDL cholesterol and triglyceride levels |
| CA2446112C (en) | 2001-05-08 | 2011-04-26 | Darwin Molecular Corporation | A method for regulating immune function in primates using the foxp3 protein |
| US20050003356A1 (en) * | 2001-05-25 | 2005-01-06 | Hayden Michael R. | Diagnostic methods for cardiovascular disease, low hdl-cholesterol levels, and high triglyceride levels |
| EP2246438B1 (en) | 2001-07-12 | 2019-11-27 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US6884619B2 (en) | 2001-07-17 | 2005-04-26 | Yale University | Inhibition of BEHAB cleavage and primary central nervous system (CNS) tumors |
| US20050147984A1 (en) * | 2001-08-31 | 2005-07-07 | Clondiag Chip Technologies Gmbh | Interaction detection on several probe arrays |
| DE10142643A1 (en) * | 2001-08-31 | 2003-04-24 | Clondiag Chip Tech Gmbh | Detection of interactions on probe arrays |
| CN1166422C (en) * | 2001-11-05 | 2004-09-15 | 北京源德生物医学工程股份有限公司 | Holder for external high-energy focusing ultrasonic treating apparatus |
| US20050053939A1 (en) * | 2001-11-09 | 2005-03-10 | Ahmed Chenna | Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents |
| DE10201463B4 (en) | 2002-01-16 | 2005-07-21 | Clondiag Chip Technologies Gmbh | Reaction vessel for performing array method |
| WO2003064679A2 (en) * | 2002-01-30 | 2003-08-07 | Id Biomedical Corporation | Methods for detecting vancomycin-resistant microorganisms and compositions therefor |
| ATE405676T1 (en) * | 2002-03-11 | 2008-09-15 | Nugen Technologies Inc | METHOD FOR GENERATING DOUBLE STRANDED DNA WITH A 3' SINGLE STRAND PORTION AND USES OF THESE COMPLEXES FOR RECOMBINATION |
| EP1573056A4 (en) * | 2002-05-17 | 2007-11-28 | Nugen Technologies Inc | Methods for fragmentation, labeling and immobilization of nucleic acids |
| EP1543154A4 (en) * | 2002-08-21 | 2006-08-16 | Epoch Biosciences Inc | Abasic site endonuclease assay |
| AU2003297557B2 (en) * | 2002-11-21 | 2009-02-26 | Cellscript, Inc. | Methods for using primers that encode one strand of a double-stranded promoter |
| WO2004083806A2 (en) | 2003-01-22 | 2004-09-30 | University Of South Florida | Autonomous genosensor apparatus and methods for use |
| US6943768B2 (en) | 2003-02-21 | 2005-09-13 | Xtellus Inc. | Thermal control system for liquid crystal cell |
| US9156986B2 (en) | 2003-04-03 | 2015-10-13 | Enzo Life Sciences, Inc. | Multisignal labeling reagents and processes and uses therefor |
| US7514551B2 (en) * | 2003-04-03 | 2009-04-07 | Enzo Life Sciences, Inc. | Multisignal labeling reagents, and processes and uses therefor |
| US9696298B2 (en) | 2003-04-03 | 2017-07-04 | Enzo Life Sciences, Inc. | Multisignal reagents for labeling analytes |
| CA2521084A1 (en) | 2003-04-14 | 2004-10-28 | Nugen Technologies, Inc. | Global amplification using a randomly primed composite primer |
| US20040259100A1 (en) | 2003-06-20 | 2004-12-23 | Illumina, Inc. | Methods and compositions for whole genome amplification and genotyping |
| ATE485396T1 (en) * | 2003-08-11 | 2010-11-15 | Univ Georgia State Res Found | RNA DETECTION AND QUANTIFICATION |
| US7354706B2 (en) * | 2003-09-09 | 2008-04-08 | The Regents Of The University Of Colorado, A Body Corporate | Use of photopolymerization for amplification and detection of a molecular recognition event |
| US20090163375A1 (en) | 2003-09-09 | 2009-06-25 | Bowman Christopher N | Use of Photopolymerization for Amplification and Detection of a Molecular Recognition Event |
| US20050136414A1 (en) * | 2003-12-23 | 2005-06-23 | Kevin Gunderson | Methods and compositions for making locus-specific arrays |
| EP1711591A4 (en) * | 2003-12-29 | 2010-04-28 | Nugen Technologies Inc | Methods for analysis of nucleic acid methylation status and methods for fragmentation, labeling and immobilization of nucleic acids |
| DE602005011754D1 (en) | 2004-01-23 | 2009-01-29 | Bio Merieux Inc | NOVEL NUCLEOTIDE MIXTURE FOR AN IMPROVED NUCLEIC ACID AMPLIFICATION PROCESS |
| EP1574583A1 (en) * | 2004-03-10 | 2005-09-14 | Roche Diagnostics GmbH | Methods for isolation of bacteria from biological samples |
| EP2290071B1 (en) | 2004-05-28 | 2014-12-31 | Asuragen, Inc. | Methods and compositions involving microRNA |
| US20060078894A1 (en) * | 2004-10-12 | 2006-04-13 | Winkler Matthew M | Methods and compositions for analyzing nucleic acids |
| EP2281887A1 (en) | 2004-11-12 | 2011-02-09 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| EP1871527B1 (en) | 2004-12-23 | 2017-09-27 | Abbott Point of Care Inc. | Molecular diagnostics system |
| JP2008535496A (en) | 2005-04-08 | 2008-09-04 | ナステック ファーマスーティカル カンパニー インク． | RNAi therapeutic factor for respiratory virus infection |
| US20070213293A1 (en) * | 2005-04-08 | 2007-09-13 | Nastech Pharmaceutical Company Inc. | Rnai therapeutic for respiratory virus infection |
| US7666584B2 (en) * | 2005-09-01 | 2010-02-23 | Philadelphia Health & Education Coporation | Identification of a pin specific gene and protein (PIN-1) useful as a diagnostic treatment for prostate cancer |
| CA2621267A1 (en) | 2005-09-07 | 2007-03-15 | Nugen Technologies, Inc. | Improved nucleic acid amplification procedure |
| US7981606B2 (en) * | 2005-12-21 | 2011-07-19 | Roche Molecular Systems, Inc. | Control for nucleic acid testing |
| KR100652903B1 (en) * | 2005-12-21 | 2006-12-04 | 한국과학기술연구원 | Manufacturing method of dehumidifying agent having superabsorbing polymer and manufacturing apparatus thereof |
| US8703445B2 (en) | 2005-12-29 | 2014-04-22 | Abbott Point Of Care Inc. | Molecular diagnostics amplification system and methods |
| CN101370622B (en) | 2006-01-18 | 2013-07-31 | 阿戈斯治疗公司 | Systems and methods for processing samples in a closed container, and related devices |
| US7674924B2 (en) * | 2006-05-22 | 2010-03-09 | Third Wave Technologies, Inc. | Compositions, probes, and conjugates and uses thereof |
| US20080125333A1 (en) * | 2006-05-31 | 2008-05-29 | Antara Biosciences Inc. | Devices and kits for detecting one or more target agents |
| WO2008005459A2 (en) * | 2006-06-30 | 2008-01-10 | Nugen Technologies, Inc. | Methods for fragmentation and labeling of nucleic acids |
| NZ548731A (en) * | 2006-07-24 | 2008-12-24 | Zygem Corp Ltd | Isothermal detection methods and uses thereof |
| US20080131878A1 (en) * | 2006-12-05 | 2008-06-05 | Asuragen, Inc. | Compositions and Methods for the Detection of Small RNA |
| CA2671194A1 (en) * | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | Mir-20 regulated genes and pathways as targets for therapeutic intervention |
| US8361714B2 (en) | 2007-09-14 | 2013-01-29 | Asuragen, Inc. | Micrornas differentially expressed in cervical cancer and uses thereof |
| US20090137405A1 (en) * | 2007-11-16 | 2009-05-28 | Christopher Bowman | Detection of nucleic acid biomarkers using polymerization-based amplification |
| WO2009070805A2 (en) | 2007-12-01 | 2009-06-04 | Asuragen, Inc. | Mir-124 regulated genes and pathways as targets for therapeutic intervention |
| CN101970677A (en) * | 2008-01-08 | 2011-02-09 | 赛进有限公司 | Isothermal detection methods and uses thereof |
| US8034568B2 (en) | 2008-02-12 | 2011-10-11 | Nugen Technologies, Inc. | Isothermal nucleic acid amplification methods and compositions |
| AU2009225835B2 (en) * | 2008-03-15 | 2013-02-14 | Hologic, Inc. | Compositions and methods for analysis of nucleic acid molecules during amplification reactions |
| WO2009117698A2 (en) | 2008-03-21 | 2009-09-24 | Nugen Technologies, Inc. | Methods of rna amplification in the presence of dna |
| WO2009121021A1 (en) * | 2008-03-28 | 2009-10-01 | Life Technologies Corporation | Degradable arrays for preventing reuse |
| US20090247425A1 (en) * | 2008-03-28 | 2009-10-01 | Invitrogen Corporation | Compositions and methods for reusing arrays |
| US20090258355A1 (en) * | 2008-04-11 | 2009-10-15 | Brookhaven Science Associates, Llc | Nanoscale Clusters and Methods of Making Same |
| US8258111B2 (en) | 2008-05-08 | 2012-09-04 | The Johns Hopkins University | Compositions and methods related to miRNA modulation of neovascularization or angiogenesis |
| US8208909B2 (en) | 2008-06-02 | 2012-06-26 | West Corporation | System, apparatus and method for availing a mobile call of address information |
| WO2010030716A1 (en) * | 2008-09-10 | 2010-03-18 | Igor Kutyavin | Detection of nucleic acids by oligonucleotide probes cleaved in presence of endonuclease v |
| KR20100122366A (en) * | 2009-05-12 | 2010-11-22 | 삼성전자주식회사 | Magnetic nanoparticles for nucleic acid sequencing and the method using the same |
| EP2483425B1 (en) | 2009-09-28 | 2016-08-24 | Igor Kutyavin | Methods and compositions for detection of nucleic acids based on stabilized oligonucleotide probe complexes |
| US9176147B2 (en) | 2009-10-29 | 2015-11-03 | Wisconsin Alumni Research Foundation | Detection of B-cell activating factor as a biomarker for antibody mediated rejection in transplant recipients |
| US9644241B2 (en) | 2011-09-13 | 2017-05-09 | Interpace Diagnostics, Llc | Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease |
| CN104080958A (en) | 2011-10-19 | 2014-10-01 | 纽亘技术公司 | Compositions and methods for directional nucleic acid amplification and sequencing |
| GB2513793B (en) | 2012-01-26 | 2016-11-02 | Nugen Tech Inc | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation |
| EP2814975A4 (en) | 2012-02-14 | 2015-12-30 | Great Basin Scient | Methods of isothermal amplification using blocked primers |
| EP2861787B1 (en) | 2012-06-18 | 2017-09-20 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
| US20150011396A1 (en) | 2012-07-09 | 2015-01-08 | Benjamin G. Schroeder | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
| WO2014144092A1 (en) | 2013-03-15 | 2014-09-18 | Nugen Technologies, Inc. | Sequential sequencing |
| CA2929596C (en) | 2013-11-13 | 2022-07-05 | Nugen Technologies, Inc. | Compositions and methods for identification of a duplicate sequencing read |
| WO2015131107A1 (en) | 2014-02-28 | 2015-09-03 | Nugen Technologies, Inc. | Reduced representation bisulfite sequencing with diversity adaptors |
| US10995104B2 (en) | 2017-05-30 | 2021-05-04 | Roche Molecular System, Inc. | Catalysts for reversing formaldehyde adducts and crosslinks |
| US11099202B2 (en) | 2017-10-20 | 2021-08-24 | Tecan Genomics, Inc. | Reagent delivery system |
| TW201936929A (en) * | 2018-02-26 | 2019-09-16 | 美商Ｃｙ分子診斷公司 | Composition and methods for affinity directed enrichment of rare species |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4261968A (en) * | 1979-05-10 | 1981-04-14 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4359535A (en) * | 1979-10-01 | 1982-11-16 | George Pieczenik | Autonomously replicating DNA containing inserted DNA sequences |
| GB2078370A (en) * | 1980-06-13 | 1982-01-06 | Nat Res Dev | Binding assays |
| US4362867A (en) * | 1980-12-10 | 1982-12-07 | Research Corporation | Recombinant cDNA construction method and hybrid nucleotides useful in cloning |
| EP0067597A1 (en) * | 1981-05-29 | 1982-12-22 | ens BIO LOGICALS INC. | Polynucleotide synthesis procedure |
| US4568649A (en) * | 1983-02-22 | 1986-02-04 | Immunex Corporation | Immediate ligand detection assay |
| JPS6091999A (en) * | 1983-10-25 | 1985-05-23 | Fujirebio Inc | Measurement of polynucleotide |
| FR2558172B1 (en) * | 1984-01-16 | 1986-06-13 | Inst Nat Sante Rech Med | PROBE CONTAINING MODIFIED NUCLEIC ACID AND RECOGNITION BY SPECIFIC ANTIBODIES AND USE OF SUCH PROBE AND THESE SPECIFIC ANTIBODIES TO DETECT AND CHARACTERIZE A HOMOLOGATED DNA SEQUENCE |
| FI71768C (en) * | 1984-02-17 | 1987-02-09 | Orion Yhtymae Oy | Enhanced nucleic acid reagents and process for their preparation. |
| DE3586689T2 (en) * | 1984-02-28 | 1993-04-08 | Ortho Diagnostic Systems Inc | DIAGNOSIS OF MALIFICATION BY RESTRICTION CARD ANALYSIS USING A SANDWICH HYBRIDIZATION FORMAT. |
| US4683194A (en) * | 1984-05-29 | 1987-07-28 | Cetus Corporation | Method for detection of polymorphic restriction sites and nucleic acid sequences |
| FR2565996B1 (en) * | 1984-06-15 | 1988-01-22 | Inst Nat Sante Rech Med | CHEMICALLY MARKED NUCLEIC ACIDS, THEIR USE AND THE NECESSARY FOR ITS IMPLEMENTATION |
| US4563417A (en) * | 1984-08-31 | 1986-01-07 | Miles Laboratories, Inc. | Nucleic acid hybridization assay employing antibodies to intercalation complexes |
-
1985
- 1985-12-05 US US06/805,279 patent/US4876187A/en not_active Expired - Lifetime
-
1986
- 1986-12-03 IL IL80856A patent/IL80856A0/en unknown
- 1986-12-03 CA CA000524411A patent/CA1304703C/en not_active Expired - Fee Related
- 1986-12-04 AU AU66108/86A patent/AU601383B2/en not_active Ceased
- 1986-12-04 FI FI864964A patent/FI864964A/en not_active Application Discontinuation
- 1986-12-04 EP EP86116906A patent/EP0227976A3/en not_active Withdrawn
- 1986-12-05 JP JP61290326A patent/JP2691177B2/en not_active Expired - Lifetime
-
1996
- 1996-02-29 JP JP8043440A patent/JP2742905B2/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| AU601383B2 (en) | 1990-09-13 |
| EP0227976A2 (en) | 1987-07-08 |
| JP2691177B2 (en) | 1997-12-17 |
| AU6610886A (en) | 1987-06-11 |
| US4876187A (en) | 1989-10-24 |
| FI864964A (en) | 1987-06-06 |
| JPS62190086A (en) | 1987-08-20 |
| JP2742905B2 (en) | 1998-04-22 |
| EP0227976A3 (en) | 1987-11-11 |
| FI864964A0 (en) | 1986-12-04 |
| IL80856A0 (en) | 1987-03-31 |
| JPH08242896A (en) | 1996-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA1304703C (en) | Molecules useful for detecting nucleic acid sequences | |
| US5424188A (en) | Amplified hybridization assay | |
| CA1340231C (en) | Polynucleotede dertermination with selectable cleavage sites | |
| EP0379559B1 (en) | Method and reagents for detecting nucleic acid sequences | |
| US6696255B2 (en) | Nucleic acid hairpin probes and uses thereof | |
| US5011769A (en) | Methods for detecting nucleic acid sequences | |
| JP4040519B2 (en) | Method combining PCR amplification and hybridization probing assay and reagent therefor | |
| EP0635069B1 (en) | Probe method and composition for detecting different dna sequences | |
| US4752566A (en) | Displacement polynucleotide method and reagent complex employing labeled probe polynucleotide | |
| US4724202A (en) | Use of non-hybridizable nucleic acids for the detection of nucleic acid hybridization | |
| US4959309A (en) | Fast photochemical method of labelling nucleic acids for detection purposes in hybridization assays | |
| EP0373956B1 (en) | Nucleotide probes | |
| EP0131830A1 (en) | Labelled nucleic acid probes and adducts for their preparation | |
| JPH08336400A (en) | Detecting method of target heredity substance | |
| AU653244B2 (en) | Detection of complementary nucleotide sequences | |
| AU724506B2 (en) | Double-stranded conformational polymorphism analysis | |
| US6027879A (en) | Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe | |
| US5783387A (en) | Method for identifying and quantifying nucleic acid sequence aberrations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MKLA | Lapsed |