CA2029906A1 - Vaccines for combatting septicemic bacteria - Google Patents

Abstract

(57) Abstract The bacteria expressing iron-regulated outer membrane proteins of which certain are siderophore or transferrin receptors can be used in a vaccinal preparation. Said bacteria are obtained from a culture in a medium in which the iron content is reduced to a level for obtaining an increased expression of said proteins, and in particular of receptors, sufficient to induce, when said bacteria are used in a vaccine, the formation of antibodies preventing the specific recognition of siderophores by their receptors.

Description

' 3~ J

VACCINE AGAINST SEPTICEMIC BACTERIA, SEPTICEMIC
BACTERIA ANTIGEN PREPARATIONS, NEW BACTERIA AND
VECTORS FOR THE PREPARATION OF THESE ANTIGENS OR VACCINES

This invention relates to bacteria belonging to genera including pathogenic bacteria and expressing large amounts of external membrane antigenic proteins regulated by iron.
It also relates to processes for the production of these bacteria.
It furthermore relates to vaccines against septicemic bacteria containing as an active principle bacteria which express in large amounts external membrane antigenic proteins regulated by iron, or fragments of these bacteria or antigens expressed by these bacteria.
It furthermore relates to other bacterial, viral or other vectors allowing the expression of these antigenic proteins, as well as to vaccines containing these proteins as their active principle~
It furthermore relates to recombinant live vaccines, notably bacterial or viral vaccines . .

. ~

c~ 3 expressing these antigenic proteins in the vaccinated organism.
It is known that apart from some lactobacilli iron is a necessary nutr~ment for all living forms including bacteria. These need iron to be able to multiply in a host cell. The capacity of the bacterium to multiply in vivo is an essential factor of its virulence.
Although iron is present in large amounts in a human body, the bacterium only has a very small amount of free iron atitsdisposal in order to multiply.
Indeed by far the greater part of an animal host iron is intracellular (in the form of ferritin , hae~osiderin r heme) and therefore its access is difficult. The small amount of iron which is present in the body fluids only exists in the form of extremely stable complexes, which are principa~ly made up of two iron chelating glycopro-teins : transferrin in the plasma and lactoferrin in the secretions. The existence of these glyco-proteins strongly, but in a reversible manner, linking the iron, is necessary in order to allow its use by the cells, preventing its precipitation in the form of ferric hydroxide.
The plasma contains iron complexes in the form of haptoglobin-heme, ceruloplasmine, ferritin , lactoferrin and transferrin.
The major part of the iron is transported by transferrin s. Three major classes of transferrin5 may be recognized : seric transferrin , lactoferrin and ovotransferrin .
The transferrin captures about 9s%of the iron in the plasma and its saturation rate is only about 35~ in the healthy individual.

3 . . f; i 3 1 ~ . s Lactoferrin has a very small iron saturation rate and keeps its chelating properties in a wide pH range ; its presence in all secretions of the organism, that is to say at the level of potential microbial invasion sites, impos~ a wider restriction for iron in these places than elsewhere in the organism.
The complexation of iron to glycoproteins results in that only a very small concentration o of free ferric iron (10 9M) remains, this being quite insufficient to allow a normal growth of bacteria.
In order to acquire the iron they need to multiply in the host, bacteria have a number of means available.
It seems that some microorganisms may obtain their iron by a mechanism impl ying direct interaction between the bacterial cell surface and the protein linking the iron in the host.
However, this direct acquisition mode only affects a very limited number of species. Most bacteria, pathogenous or not, react to the lack of availability of the iron in a hosL/in some aerobic environments, by producing iron chelating compounds called siderophores.
Siderophores are made up by molecules having a small molecular weight forming specific complexes with a very high affinity for the ferric ion. Their biosynthesis is regulated by the iron and their function is to supply the bacterial cell with iron.
These siderophores possess an extremely high affinity for the ferric ion (their association constant is about 1030M 1) which allowsthem to displace the iron associated with the host protein or to solubilize the ferric iron which is precipitated in the form of hydroxide.
Most of previously identified siderophores belong to two chemical classes : phenolates-catecholates (deriving from 2,3-dihydroxybenzoic acid) and hydroxamates (deriving from hydroxamic acia).
The better known among siderophores o belonging to the class of phenolates- is the entero-bactin which is excreted by the bacteria belonging to the genera Escherichia, Klebsiella, Salmonella and Shiqella. This enterobactin is made up of a cyclic trimer of 2,3-dihydroxy-N-benzoyl-L-serine and is the chemical compound having thehighest known affinity with the ferric ion (Ka =
105 M ).
Several enteric species synthetise another hydroxamate siderophore~aei-obactin, This 2u siderophoreis particularly synthetised by septicemic ox invasive Es~herichia coli strains having a ._ type Col V plasmid, or by Salmonella typhymurium and Shi~ella.
This biosynthesis of siderophoresby bacteria is associated with the production of proteins at the outer membrane, some of these proteins behaving as receptors for siderophoxes, as well as mechanisms allowing iron transportation and release inside the bacterium.
The common characteristic of these proteins which are formed in the outer membrane, and are often called "IROMP" meaning Iron Regulated Outer Membrane Protein, is a size between 70 kDa and 90 kDa, and their synthesis as well ln vitro ~ - ~ r ~j 3 in a restricted iron environment as in vivo during infec-tion.
The outer membrane proteins, or siderophore receptors, are therefore the second element of systems characterized as having a high affinity for the bacterial intake of iron (the first element being made up by siderophor es)~
Apart fr~ these high affinity systems, many bacteria possess low affinity transportation systems which allow them to use ferric hydroxide in polymerized forms.
The absorption mechanisms for iron have been particularly studied with Escherichia coli which is the bestgenetically known micro-organism.
The high affinity iron transportation endogenous system in E. coli uses the siderophore enterobactin. Enterobactin is synthetised and excreted in the medium when E. coli is placed in a restricted iron environment. The ferric entero-bactin complexes are then taken up by the outer membrane (81 kDa Fep A protein) and transported to the cytoplasm. When internalized the iron is freed by erric enterobactin hydrolysis, then reduced to ferrous iron.
E. coli's enterobactin system comprises at least thirteen genes. Seven genes (ent) are involved in the biosynthesis of the siderophore, and five genes (fep) code for transportation ~0 proteins.
Apart from the enterobactin system, E. coli septicemic strains excrete and carry an hydroxamate siderophore,aerobactin.
It has been discovered in 1979 by P.H.
WILLIAMS (37) that some Col V type plasmids carried genes for the aerobactin siderophore and its s receptor located in the outer membrane and called Iut A protein (74 kDa protein).
Although the aerobactin has an association constant with the ferric ion which is lower than that of enterobactin, it however has structural properties increasing its capacity to take up the iron linked to the transferrin or to the lactoferrin.
After this was demonstrated in 1979 by P.H. WILLIAMS, many studies have shown that the aerobactin's iron transportation system played a major part in the virulence of pathogenic strains of E. coli and many other bacteria (GRIFFITH
and al. (13)).
The presence of the aerobactin siderophore ~u strongly favours the virulence of pathogenic strains.
Although aerobactin is less powerfulthan enterobactin as a chelating agent, it is active in much more varied environment conditions (enterobactin is very sensitive to oxidation ~5 and pH variations). Aerobactin therefore confers a higher degree of adaptation to the bacterium.
Besides, aerobactin is a better bacterial growth stimulator, and it seems that it is much more quickly excreted than enterobactin , probably 3~ because of a preferential genetic induction when E. coli is grown in the presence of a chelating agent.

7 '~

With the aerobactin operon, the bacterium acquires an extremely efficient iron transportation system with a minimum number of additional genes, or only four genes for the synthesis of aerobactin which is a small simple siderophore,and one gene which codes for the outer membrane receptor. Indeed the other genes necessary for the transportation of hydroxamates are inherently present in all Escherichia coli.
The expression of all genes coding for membrane proteins, side;-ophorereceptors and corresponding siderophoresis regulated by a single protein, Fur, which acts as a repressor when the iron is available in sufficient amounts. The central regulation is superimposed on an individual modulation which regulates the expression of each system according to the state of the environment.
Some authors have grown bacteria, so as to increase the expression of IROMPs in environment with an iron deficiency with the help of chemical chelators, such as ~, ~' dipyridyl (A.
BINDEREIF et al~ The cloacin receptor of Col V-bearing Escherichia coli is part of the Fe 3+
aerobactin system, J. Bacteriol., 1982, 150, 1472-475 ; C. MAROLDA et al. : Flanking and internal regions of chromosomal genes mediating aerobactin iron uptake system in enteroinvasive Escherichia coli and Shigella flexneri, J. General Microbiology, 1987, 133, 2269-2278 ; A. BINDEREIF et- al. :
Cloning of the aerobactin-mediated iron assimilation system of plasmid col V, J. Bacteriol., 1983, 153, ~ _1113 ; De LORENZO et al. : Aerobactin biosynthesis and transport genes of plasmid col V -K 30 in Escherichia coli K 12, J. Bacteriol. 1986, r ~ r ;) 165, 570-578 ; P. WARNER et al. : col V - plasmid-specified aerobactin synthesis by invasive strains of Escherichia coli, Infection and Immunity, 1981, 33, 540-545 ~. E. F . GRIFFITHS et al. have shown in : Synthesis of aerobactin and a 76000 Daltons iron-regulated outer membrane protein by Escherichia coli K-12 - Shiqella flexneri hybrids and by enteroinvasive strains of Escherichia coli, Infection and Immunity, 1985, 49, 67-71, that enteroinvasive lo strains of E. coli produce aerobactin and a 76 K outer membrane protein when grown in a reduced iron environment in the presence of ovotransferrin.
The recently acquired knowledge on the iron absorption systems of bacteria has allowed one to explore new ways of fighting pat~ genic bacteria.
It has been suggested to synthetize siderophoreanalogs which are toxic for the bacterium and may deceive the iron transportation systems ~0 in order to penetrate into the bacterial cell.
But these synthetic chelators have a lower affinity for the iron (III) than natural siderophoreS,and they are unable to displace iron in transferrins.
- ROGERS has suggested to form complexes between aerobactin and trivalent metal ions in order to use them as antimetabolites towards the enterobactin -Fe natural complex. Only complexes formed with scandium (Sc3 ) and indium (In3 ) have some antibacterial activity (ROGERS et al.
(26) : ROGERS (27)).
It has also been suggested to adsorb phenolate type siderophores,which are aromatic molecules, on some seric proteins, which then play the part of carrier molecules, this allowing the induction of specific antibodies against the siderophore.
Thus, BYERS (5) has described a vaccine against/phenolate siderophorewhich is produced by Aeromonas hydrophila (a bacteri~which is responsible for human and fish septicemia), which has been assayed with fish. The siderophore is covalently coupled with human or bovine albumine. Fish~which are immunized with these preparations generate antibodies reacting against the siderophore It is, however not specified if the antibodies which are formed are able to neutralize the siderophore5.
One has also tried to prevent the bacteria from taking up siderophoreswith antibodies that would be specifically directed against the siderophore receptors.
BOLLIN eb al. (4) report the results of a study indicating some passive immunization with antibodies against the outer membrane proteins regulated by iron, thus protecting turkeys from an Escherichia coli septicemia.
However, all efforts towards the elaboration of an efficient vaccine have, until now, failed because of the difficulties in having a bacterium express membrane proteins which are regulated by iron at a sufficient level in the bacterial culture.
This invention allows one to overcome this difficulty by suggesting the use in a vaccine as an active principle, of bacteria expressing in large amounts membrane proteins which are 10 ~ ~ ~ ~ r~ ~ r~

regulated by iron and more particularly, siderophore receptors at a sufficient level to induce the development of antibodies which prevent the specific recognition of siderophoresby their receptors.
An aim of the invention is to supply bacteria expressing outer membrane proteins regulated by iron (IROMPs), which may be used as protective antigens.
Another aim of the invention is to lo suggest the synthesis of outer membrane proteins regulated by iron of septicemic bacteria by genetic recombination.
Another aim of the invention is to supply large amounts of IROMPs, notably Iut A
and Fep A proteins, siderophore receptors, aerobactin and enterobactin in Escherichia coli and other families, through synthesis of these proteins by a genetic recombination.
Another aim of the invention is to supply vaccines containing as an active principle, bacteria or fragments of these bacteria having in their outer membrane large amounts of IROMPs and notably Iut A and Fep A proteins, as obtained by genetic recombination or by other processes.
Another aim of the invention is to supply vaccines contai~ing as an active principle IROMPs, for example, Iut A and/or Eep A proteins or antigenic preparations incorporating these proteins.
This invention therefore uses bacteria expressing outer membrane proteins regulated by iron and some of which are sideropho~ receptors, which may be used in a vaccine preparation.

c ` s ~
1 1 ' ~ i sacteria according to the invention are characterized in that they express larger amounts of these outer membrane proteins, and more particularly, transferrin receptors, notably siderophore receptors, to induce, when these proteins are used in a vaccine, the generation of antibodies preventing the specific recognition function by the receptors, and thus putting an end to the iron supply of the pathogenic bacterium.
Bacteria which are used are preferably enterobacteria and they preferably excrete enterobactin and/or aerobactin siderophores.
Bacteria are preferably chosen among the group made up by Escherichia coli, Klebsiella, Salmonella thyphimurium, Shiqella.
Bacteria preferably excrete together the aerobactin and enterobactin siderophores.
According to the invention and according to a first embodiment thereof, bacteria are obtained by growing naturally existing strains or strains that may be found in laboratories or collections in a minimal medium wherein the availability o~
iron is reduced to a level allowing a satisfying higher expression of/~brane proteins.The culture is preferably grown in presence of a strong iron (III)chelating protein such as lactoferrins, these being che]ators which advantageously establish an iron shortage with the same characteristics as those that are to be found _ vivo.
Object of the invention is also a process for producing such bacteria to be used for the preparation of vaccines, characterized in that ' ~ , .. ..

~2 said bacteria are grown in a culture medium containing an iron (III) chelating protein such as transferrins, and notably lactoferrins.
As a minimum medium, one can use that which is described for instance by SIMON and TESSMAN (30).
However, this embodiment remains difflcult to apply, because with the iron chelators which are generally used one must sufficiently reduce the iron content in the culture medium so as to obtain a sufficient expression of the outer membrane proteins. Often, small amounts of iron remain, preventing the expression of membrane proteins (iron from the fermentor, for instance or from pipes which are, generally, made of stainless steel). One must then resort to comparatively complex process~in order to lower the iron content to a level allowing the expression of the external membrane proteins of bacteria, and their application is costly.
According to a second embodiment of the invention, which is also the preferred embodiment, bacteria expressing in large amounts the outer membrane proteins, sideropho~e receptors, are transformed by recombinant plasmids.
Indeed, the advantages of synthetizing the outer membrane proteins, sideropho~e/ or tPransferrin, through genetic recombination, are many :
- it allows one to generate an important expression of these proteins, whatever the iron concentration in the culture medium, - it allows one to study immune reactions directly aiming at these proteins, while excluding any other constituent of the original strain, - it represents the cheaper solution for the expression of membrane proteins in an environment wherein iron is always present (fermentors, pipes and sundry stainless steel equipment).
If the applicant more particularly aims at the synthesis of Iut A and Fep A proteins, aerobactin and enterobactin siderophore receptors of E. Coli, it can be understood that the below described genetic recombination methods - will apply by an ~ogy with the synthesis of membrane proteins (IROMPs), siderophore receptors, aerobactin and enterobactin or tranferrins from pathogenic bacteria other than E. coli.
The invention therefore also relates to the preparation of E. coli Iut A and/or Fep A
proteins by genetic recombination.
The Iut A protein may be synthetized by a process according to which, in particular :
- one isolates the plasmid or chromosomefrom Salmonella, Shigella or Klebsiella pathogenic E. coli strains, bearing the~aerobactin operon, - one separates from t.he plasmid or chromosome a fragment containing the iut A gene, - one links said fragments with a cloning vector, - one inserts the clones having inte grated the iut A gene in an expression vector (for example GTI 001 plasmid), - one then expresses the Iut A protein by growing the clones.

14 ~ r J ~ ,J

The Fep A protein is obtained :
- by isolating from a plasmid (for example pMS 101 plasmid built by LAIRD and YOUNG
(19)) or from a bacterial chromosome, E. coli, Salmonellae or Klebsiellae, a fragment bearing the f~e_~ gene, - by cloning said fragment in a cloning vector, - by inserting the fep A gene in an expression vector, preferably in a vector which is used for the expression of Iut A protein (GTI
001 plasmid), - by the expression of the Fep A protein by growing the clones.
The expression vectors for Iut A and/or Fep A proteins may be bacteria and one prefers to use E. coli whose expression systems are best known. One may however also use other vectors, notably viral vectors or vectors made up of yeast, and which can be built by specialists.
Bacterial clones expressing Iut A and/
or Fep A proteins may be multiplied in an appropriate medium at a sufficiently low temperature so as to prevent or limit the expression, generally below 32C. The expression is then induced by rising the temperature, for example to 42C
during about 4 hours, so as to induce the expression of iut A and fep A genes.
One therefore obtains bacteria integrating Iut A and Fep A proteins as well as their proIut A and proEep A precursors, these having the shape of large size cytoplasmic inclusions.

15 ¢.

These bacteria as used in a vaccine, as an active principle, induce the generation of antibodies directed against Iut A and Fep A proteins, preventing recognition by these proteins of their respective siderophores aerobactin and enterobactin, this therefore strongly reducing the iron supply to the bacterium and blocking its multiplication.
The invention therefore also relates to vaccines containing as an active principle recombinant bacteria expressing external membrane proteins regulated by iron.
The invention more particularly relates to vaccines containing as an active principle :
recombinant bacteria or fragments of these bacteria, notably fragments of membranes integrating Iut A and/or Fep A proteins or their precursors, proIut A and/or proFep A ; or again Iut A and/or Fep A proteins and/or their precursors, for example, extracted from cytoplasm or eX-tracted from the outer membrane of recombinant bacteria.
In another embodiment, the invention relates to vaccines containing as an active principle :
bacteria which are homologous to septicemic bacteria, or fragments of these bacteria, grown in a medium with restricted iron supply, and which integrate ln larger amounts Iut A and/ror Fep A proteins and/or their precursors; /I~t A and/or Fep A proteins (and/or their precursors) being suitably extracted The latter vaccines are preferably prepared from bacteria which are grown in a medium containing a strong protein type iron (III) chelator, notably transferrin, lactoferrin, or ovotransferrin.
The invention would be better understood on reading the following specification , referring to the appended drawings, wherein :
Figure 1 is the protein profile as obtained by electrophoresis of a clone expressing Iut A protein, Figure 2 is a protein profile as obtained by electrophoresis of a clone expressing Fep A protein.
Theabbreviations used in the following specification have the following meanings :
Ampr ampicillin resist2nt Clos cloacin sensitive dATP deoxy-adenosin-triphosphate EDTA ethylene-diamine-tetraacetic acid.
Ent enterobactin E.O~P.S. without specific pathogenic organisms IPTG isopropyl-~-thiogalactopyranosid kpb bases kilopair LB luria broth OMP Outer-membrane protein PAGE polyacrylamide gel electrophoresis pb bases pair~
PBS phosphate buffered saline SDS Sodium dodecyl sulfate 5T Simon and Tessman TEMED N,N,N',Ii'-tetramethylene diamine Tris tris-hydroxy-aminomethyl-methane tetr tetracyclin resistant.

MATERIALS AND METHODS
I. MATERIALS
1. Stralns Table I recapitulates the various strains.
The pathogenic strains used are septicemic strains from calves otchicks and are to be found in the RHONE-MERIEUX strain collection.
The host strains _ used for cloningr sequencing and expression are all derived from o Escherichia coli K 12.
These strains may be easily replaced by other wild septicemic strains or laboratory strains;

2. Plasmids Origin and characteristics of plasmids used for cloning and expression are presented ln Table II.

3. Media SIMON and TESSMAN mlnimum medium (30) Contents :
NaCl 5.8 XC1 3,7 g cacl2~ 2H2 0 15 MgC12, 2 0.10 g NH4C1 1.10 9 Na2S4 0,142 g KH2~04 0.272 Tris 11 20 9 H20 ~5p loOO ml pH 7~4 The only carbon source is sodium succinate added to a final concentration of 10 g/l.

In order to establish a limitation to the iron in this medium, one adds ovotransferrln (SIGMA) at a final concentration of 250 ~g/ml (One may have concentrations abo~e 500 ~g/ml).
The iron-rich control medium is obtained by adding FeC13, 6 H20 (MERCK) at a final concentratlon of 40 uM.
M9 MANIATIS minimum medium (29) Na2HP0~ 6.0 g KH2P04g NaCl0.5 g NH4C11.0 g H20 ~sp1000 ml pH 7,4 to this basic medium are added :
M~ S04 1M 2 ml/1000 ml glucose 20 ~O 10 ml/1000 ml CaC12 1M 0.1 m1/1000 ml - LB rich medium (MANIATIS and al. (23)) bactotryptone 10 g Yeast extract 5 g NaCl 5 g H20 q.s.p. 1000 ml pH 7~4 - BTS rich medium (BIO MERIEUX) Biotryptase17 g Biosoyase 3 NaC1 5 g K2HP04 2.5 glucose 2.5 g H20 l~sp1000 ml pH 7~3 - BHI rich medium (heart-brain BIO MERIEUX) Calf brain infusion 200 g ox heart infusion 250 g ~lo~ lytone 10 NaCl 5 g Na2HPO4 2,5 glucose 2 0 ~
1~2() ~s~ 1000 ~1pH 7,4 - "M9 SP" rich medium for the expression medium :
SP (tryptone 3.2~ : yeast 2~) 100 ml M9 (6.6 x concentrate filtered on 0~22 ym filter (Millipore) 15 ml MgSO4 100 mM 1.5 ml FeC13 0.1 mM 1.5 ml vitamin B1 (5% solution) 1.5 ml 'l'he solid media have the same composition as that of the corresponding llquid media and o contain 12 g agar per liter of the medium.
Antibiotics are used in solid and liquid media at the following final concentratlons :
Ampicillin 25 ~g/ml tetracyclin 12.5 yg/ml isopropyl-~-D-thiogalactopyranoside (IPTG) is optionally added at a final concentration from 0.05 mM to 0,4 mM.
Sterilization of liquid and solid media is made by autoclave at 120C during 20 minutes.
Antibiotics, vitamin Bl, sodium succinate M9 6.6X, MgSO4, FeC13, IPTG and ovotransferrin solutions are made in the form of concentrated stock solutions, and sterilized by ~iltration on a filter having 0.22 ym porosity (Millipore).
After sterilization, the growth media are kept at room temperature.
Antibiotics, IPTG and ovotransferrin solutions are kept at -20C.
Other solutions are kept at +4C
II. METHODS
1. 3acterial cultures Apart from clones with structures built in the pGTI 001 expression vector, which are grown at +30C, all cultures are made at +37C, while stirring, during 18 hours.
Whenever necessary, bacterial growth is estimated by measuringthe suspension turbidity at600 nm, with the help of a BECKMAN DU 40 spectro-photometer.
Cultures are usually made in a volume of 2 ml after seeding with a colony. Cultures in a more important volume (20 ml to 1000 ml) are made by seeding to the l/lOOth with a preculture in stationary phase~
2. Sensitivity toward bacterocins Productions of cloacin DF 13 and colicin B are made with Enterobacter cloacae DF 13 and Escherichia coli 1300 strains, respectively, according to the process described by DE GRAAF (DE GRAAF
et al. (8) and (9)).
These strains are grown at +37C, in a BHI medium, until the optical density reaches 0.5 (1 cm, 600 nm).Mitomycin C is then added to the growth medium, so as to reach a final concentration of 1 ~g/ml, which allows one to induce the synthesis of bacteriocins. This culture is prolonged during 6 hours, at +37C, until lysis phase. Bacterial bo-~ies are centrifugated (8000 g, 30 nm, +4C) and the supernatant is harvested. Ammonium sulfate is then slowly added at +4C, until the concentration reaches 365 g/litre.
The supernatant is taken up in 0.05 M
phosphate buffered pH 7.0 and dialysed against several succeeding baths of this buffer. The dialysate is filtrated over 0.22 ~m (Millipore) and kept at -20C.
About 10 bacteria of the clone under study are spread on LB agarose containing the appropriate selection antibiotic. When the deposition liquid is comple~lyabsorbed, one places at the center of the Petri dish 75 ~1 of the bacteriocin solution. When this drop has itself dried, the Petri dish is placed in an incubator t+30C or +37C, as the case may be) during 18 heures. Clones which present a growth inhibition around this deposition have became bacteriocin-sensitive.
Clones which resist the toxic effect of bacteriocin on the contrary exhibit a uniform bacterial mat.
3. Preparation of antisera directed a~ainst the outer membrane proteins regulated by iron The protocol which is used is a repetition of that which is described by BOLIN and JENSEN

(4).
The outer membrane proteins regulated by iron are separated by polyacrylamide gel preparative electrophoresis with sodium dodecyl sulfate added.
When the gels are coloured, the strip containing the IRCMP to be used for the immunlzation is cut offJthen comminuted with distilled water, by passing through several needles havin~ sinaller and smaller diameters.
This ground product is injected to E.O.P.S.

Ne~ Zealand White rabbits, from the RHONE MERIEUX
Company Farm, according to the protocol presented in table III.
To eliminate antibodies against other outer membrane proteins, lipopolysaccharids and other Escherichia coli antigens, sera harvested in immunized rabbits are adsorbed with an Escherichia coli strain which does not express IROMPs.
To each milliliter serum are added about 101 bacterial bodies which have been inactivated by heat during 30 minutes at 100C and the mixture is then incubated at +37C during 1 hour.
After centrifugation, the surpernatant serum is recovered and filtrated on a 0.22 ~m porositty filter (Millipore).
It is kept at -20C.

5. Outer membrane proieins extraction The method which is used to extract proteins from the outer membrane derives from me-thods described by VAN TIEL-MENXVELD et al.
(36) and by FISS et al. (12).
After centrifugation, the bacterial pellet T is resuspended in Tris-Hcl 0.2M pH 8.0 buffer so as to obtain an optical density of about 10.
~acterial cells are then ruptured by sonication using ultrasoundS 3 x 3 minutes while keeping the bacterial suspension on anice-ethanol bath.
Cellular debris and untouched bacteria, are eliminated by centrifugation at 5000 g during 1.0 minute at ~4C.
Bacterial membranes suspended in the supernatant are collected by ultracentrifugation at 110 000 g during 60 minutes at +4C.
The membrane pelletistaken off with 5 ml extraction buffer described by SCHNAITMAN

(29) : Triton X-100 2% ; MgC12 10 mM ; Tris/HCl 50 mM pH 8Ø
Incubation is carried out during 30 minutes at room temperature, while shaking every five minutes. During incubation the cytoplasmic membrane proteins are preferentially solubilized by Triton X-100. Outer membranes are collected through a new ultracentrifugation (111,000 g, 60 minutes, +4C). The obtained pellet is thrice washed in distilled water, finally resuspended in 1 ml distilled watex and frozen at -20C for storage.

6. Proteins dosaqe The membrane extract protein concentration is measured by a colorimetric method derived from that published ~y LOWRY et al (20).
To 0.5 ml protein solution to be dosed are added 2.5 ml of the following solution :
1~ CuSO4 solution 1 ml 2~ sodium tartrate solution 1 ml 2~ sodium carbonate solution in 0.lN NaOH q.s.p.
After incubating 10 minutes at room temperature, 0.25 ml 50~ Folin reactant (Merck) is added.
Incubation is carried out for 30 minutes at room temperature, and the optical density of the blue color which has evolved is measured at 779 nm.
Protein concentration of samples is determined with a standard interval prepared with bovine serum albumin .

The optical density is proportional to the proteln concentration in an interval of 5 to 200 ~m/ml.

7. Techniques for the analysis of the outer membrane protein composition : polyacrylamide qel electrophoresis under denaturatin~conditions Polyacrylamide gels are prepared according to the characteristics described by LUGTENBERG
et al. (21).
lo The align~ment gel has the following composition :
acrylamide-bisacrylamide (30/0,8 p/p) 5% ; ~ris/HCl 130 nm pH 6,8 ; SDS 3,5 mM ; ammonium persulfate 44 mM TEMED 8 mM.
The separation gel has the same composition as the align~ent gel, except for the acrylamide/bis-acrylamide concentration (8 or 10%) and the Tris/HCl buffer 380 mM pH 8.8 concentration.
The migration buffer used has the following 20 composition :
glycine 14.4 g Tris3.0 g SDS 1.0 g H2O q.s.p. 1000 ml pH 8.3 Extracts to be analyzed or purified by electrophoresis are diluted in at least an equal volume of the following dissociation buffer :
Tris/HCl 100 mM pH 6.8 ; glycerol 20~ ; SDS 70 mM, ~-mercapto-ethanol 100 mM ; bromophenol blue 75 ~m., The thus diluted extracts are heated to 100C during 5 minutes.
In order to analyze the outer membrane protein composition 30 to 50 ~g proteins are deposited in each well.

For preparative electrophoreses, as much as 2 mg proteins are deposited in the sole preparative well.
Migration is carried out at +14C during 5 hours at 160 V or 14 hours at 60 V (Vertical gel LKB apparatus). In order to increase the resolution of the outer membrane proteins regulated by iron, some electrophoreses have been under a voltage of 100 V during 16 hours. At the end of the electrophoreses, proteins are fixated and coloured during 30 minutes at room temperature with 1.2 mM Coomassie blue in a (50:10:50 v/v/v) methanol/acetic acid/water mixture. The unfixated colour is eliminated with several succeeding (40:15:145 v/v/v) methanol/acetic acid/water baths at 37C. Once decolorated, the gel is photographed, and dried.
The outer membrane protein profiles for each strain may then be analyzed by densitometry (LKB ULTROSCAN laser Densitometer).

8. Detection and analysis of anti-IROMPs antibodies The presence of specific anti-IROMPs antibodies is lnvestigated with the microplate ~LISA technique (ENGVALL and PERLMANN (10) ; COULTON
(7)). Antigens which are coupled to the solid phase are fractions which are very much enriched in proFep A protein or proIut A protein.
The revelation of anti-IROMPs antibodies is made with a rabbit anti IgG conjugate (or chicken anti IgG) coupled to peroxidase (Nordic). The substrate used is orthophenylene-diamine. Readings of optical densities are made at 492 nm.

.

~ . r~ r~

-"Western-blotting" technique Proteins which are separated by polyacrylamide jel e1ectrophoresiswith SDS are transferred on a polyvinylidene fluoride membrane (PVDF 0.45 ~m Millipore) according to the method described by TOWBIN et al. (34).
Transfer is made under 24 V during one hour with a RIOLYON apparatus using the following anodic and cathodic buffers :
10 anodic buffer cathodic buffer Tris 0.3 g Tris 0.3 g glycine 1.44 g glycine 1.44 g methanol 100 ml SDS 0.1 g H~O qsp 500 ml H2O qsp 500 ml After transfer, the PVDF membrane is saturated during one hOur at +37C in PBS buffer containing 1% S'cimmed milk.
The membrane is then cut into strips corresponding to electrophoresis tracks.
Sera to be studied are diluted into PBS buffer containing 1% ~'cim.~e~ milk, then contacted with membrane strips, 4ml diluted serum per strip.
After incubation for one hour at +37C, while gently stirring, three 20 minutes washings are made in PBS buffer containing 2% skimmed milk at room temperature.
An anti IgG conjugate coupled to peroxIdase, diluted to the 1/1000 in PBS containing 1% skimmed milk is added at a rate of 3 ml per strip.
After incubating one hour at +37C
while gently stirring, 3 20 minutes washings are made at room temperature in PBS buffer.

The diaminobenzidine substrate, diluted to 0.1~ in a physiological water at pH 7.15 to which 30 volumes 0.1% H2O2 have been added, is then added to the whole. One then notices (after 5 to 20 minutes) brown coloured strips around proteins which are recognized by the antibodies in the serum under study.
The membrane is then washed in distilled water and dried up.

9. Plasmid DNA preparation method Large plasmids contained in pathogenic strains are extracted according to the method published by KADO et al. (16).
Plasmids obtained during the various stages of cloning, undercloning, and construction in the expression vector are extracted according to the method of BIRNBOIM (BIRNBOIM and DOLY) (3). Plasmid DNA obtained after preparative extractionS
made with one/~ese methodsis purified on caesiurn chloride gradient (MANIATIS et al. (23)).
Whence purified, the plasmids are taken up in Tris 10 mM ; EDTA 1 m~1 pH 8.0 buffer so as to reach a final concentration of l~g DNA/~l, and frozen at -20C for storage.

10. DNA analysis and modification methods All methods used for cloning, DMA digesting, restriction fragment analysis in agarose gel, modification of the ends of restriction fragments, hybridation with a radioactive probe after tranfer of DNA on nitrocellulose membrane, are described by MANIATIS (MANIATIS et al. (23)).
DNA has been sequenced and oligonucleotides have been synthetized according to special methods.

r~ r~ f i ~

11. DNA sequenclnq Genes to be sequenced are subcloned in M13 mp 18 and mp 19 vectors (YANISCH-PERRON
et al. (38)) and sequenced according to the chain endmethod by dideoxynucleotides (SANGER
et al. (28)). Labelling of the various chains is made with 5S dATP (AMERSHAM).
Sequencing proper is made with reactants and sequencing kits enzymes Amersham and Sequenase lo (USB). Electrophoreses in a polyacrylamide gel with urea are made in a Sequi-Gen (BioRad) apparatus.
Sequencing data are processed with Microgénie (Beckman) software.

12. Oliqonucleotides synthesis The various oligonucleotides which are necessary to theconstructions/the expressing vectors or to the mutageneses are synthetised according to the cyano-ethyl-phosphoramidites method on anApplied Systems 381-A apparatus.
These oligonucleotides are directly used after deprotection and precipitation with ethanol.

13. Directed mutagenesis method Mutagenesis is made according to the method described by ECKSTEIN (TAYLOR et al. (33) ;
NAKAMAYE and ECKSTEIN (24)) with the directed mutagenesis kit sold by the Amersham Company.
RESULTS
1. ISOLATION AND ANALYSIS OF iut A
GENES
The presence of the aerobactin operon has been searched on plasmids born by 15393, 15972 and 16003.

After purification on caesium chloride gradient, these plasmids are digested by Bam HI, Hind III, Pvu and Sal I restriction enzymes (Boehringer).
The various restriction fragments of each plasmid are separated on 0.8% agarose gel and transferred on a nitrocellulose membrane according to the "Southern blot" (SOUTHERN (31)) method. These fragments are then hybridated with two radioactive probes (labelled with 32p by displacement of cut) prepared from pABNl plasmid restriction fragments bearing the aerobactin operon of pCol V-K30, (BINDEREIF and NEILANDS (2)). It has been found that the gene coding for the IutA receptor exists on all plasmids on a 6.6 kb Bam HI-Bam Hi restriction fragment. These results are a confirmation of the authors' work of undercloning this gene from an equivalent PCol V-K30 fragment (KRONE et al. (17)).
- Cloninq of plasmid DNA fragments bearing the iut A gene Plasmids of 15393, 15972 et 16003 strains are digested by Bam HI restriction enzyme.
After electrophoresis on 0.8~ agarose gel, the gel strip containing the 6.6 kb fragment of each plasmid is cut and the DNA is electroeluted.
The three 6.6 kb Bam HI-Bam HI fragments are ligated separately and the paT 153 vector digested by Bam HI. The three ligation mixtures are used to transform competent HB 101 bacteria (table IV)~
The DNA of ampicillin-resistant, tetra-cycline sensitive clones is extracted (by the method of BIRNBOIM and DOLY) and digested by Bam HI in order to check the size of the insert.

3 ~

Clones having integrated the 6.6 kb fragment are selected on the basis of their sensitivity to cloacine DF 13.
For each starting plasmid a cloacine sensitive clone is kept for analyses and further build ups. They are the following clones :
Strain 15393 clone HB 101 p 5 - 15 Strain 15972 clone HB 101 p P - 13 Strain 16003 clone HB 101 p 4 - 18 lo - Clones analysis A study of the expression of Iut A
receptor.
Having been able to select the desired clones with a cloacine sensitivity test shows 15 that there is an expression of the receptor to cloacine and aerobactin. Expression of the iut A gene born by the 6.6 kb Bam HI-Bam HI fragment probably depends from a weak promoter situated on this fragment (KRONE et al. (17)) and does not depend 20 on the iron concentration as does the main promoter of the operon aerobactin. Indeed, the sensitivity to cloacine is demonstrated with a culture on iron-rich ampicillin-LB ~elose.
In order to study the expression level 25 of the Iut A receptor, the various clones are grown in LB-ampicillin medium (for one night at +37C) with or without ovotransferrin (500 ~g/ml).
The outer membrane proteins of each of the three clones are extracted and analyzed 30 on polyacrylamide gel with SDS.
Whatever the growth conditions, it is impossible to note a 76 kDa supernumerary protein expression in cloacine sensitive clones.
- Restriction ma~s Plasmid DNA of clones 4-18, 5-15 and P-13 is extracted in large amounts and purified on caesium chloride gradient.
Restriction mapshaving the three 6.6 fra~ments kb Bam HI-Bam HI/whlch have been cloned are drawn with Bgl II, Bst E II, Cla I, Eco RI, Kpn I, Pst I, Pvu II and Sma I.
These three maps are totally identical and correspond to the restriction map of the 6.6 kb Bam HI-Bam HI fragment of p ColV-K30 aerobactin operon deduced from maps published by BINDEREIF
and NEIEANDS (1,2) and KRONE et al. (17).
These four maps are represented in table V.
- Sequencing of iut A qenes When comparing restriction maps for the three 6.6 kb Bam HI-Bam HI fragments with the restriction map as deduced from the sequence of the iut A gene (KRONE et al. (18)), it appears that the iut A gene is entirely to be found on a 3.2 kb Bst E II-Bst E II restriction fragment (table VI).
This fragment is isolated by electro-elution, religated upon itself with T4 phage ligase (Boehringer) and digested with several restriction enzyme systems. The various fragments thus obtained (size 150-600 pb) are isolated by Geneclean (Bio 101) and sub~cloned in the M13 mp 18 and mp 19 vectors previously digested with the appropriate enzymes. The sequence of each su~clone is then ~ F

determined according to SANGER's method with the use of Amersham and Sequenase ~USB) sequencing kits.
Only the 3.2 kb Bst E II-Bst E II
fragment of clone P-13 has been entirely sequenced.
The two remaining iut A genes have been sequenced between the Bgl II (1) site and the Eco RV (2396) site.
The Bst E II-Bgl II region of clone P-13 has been compared with the sequence of the iuc D gene 51Ocated just upstream of iut A
(HERRERO et al. (14)) and the Pvu II-Bst E II
region of this clone has been compared with the sequence/ISl element (OHTSUBO and OHTSUBO (25)).
These comparisons as well as the comparisonS of the three iut A genes with the sequence of the iut A gene of pColV-K30 are presented in table VII.
Analysis of these four sequences reveals that the iut A gene was extremely well kept at the molecular level. Apart from one or two bases, the three iut A genes isolated from E. Coli strains of animal origins are identical. Differences observed with the sequence published by KRONE et al. (18) are minimal.
The three iut A gene under study are 99.77% homologous to the iut A gene of pColV-K30.
Regions where differences have been demonstrated are represented in table VIII. (Numbers relate to the position of bases in sequences presented in table VII).

,~

,~

V ~ 9i;

Two important regions are totally preserved :
the sequence coding for the signal peptide and the consensus sequence (~Ton B box" ) typical of the outer membrane protein receptors whose function depends from Ton B.
The existence of four inserts in relation to gene iut A of ColV-K30 has been demonstrated on each of the three sequenced genes. These inserts trigger limited changes in the reading frame.
Thus, the primary structure of iut A proteins coded by isolated plasmids of the strains under study is a little larger (+ 8 amino acids) than that of protein Iut A of p ColV-K30. The sequence of isolated iut A genes of the strains under study codes for a 733 amino acid polypeptide comprising a 25 amino acids signal peptide which is identical to that of the Iut A polypeptide of strain ColV-K30. The calculated mass of the mature protein is 78097 daltons, which differs slightly from the size observed on gel (76 kDa). However, the changes in the primary structure are not sufficiently important to alter the secondary structure and the hydrophilicity profile.
~. EXPRESSION OF CLONED IUT A AND fep A
GENES
- Characteristics of the vector under study The expression vector used is the GTI 001 plasmid built up by the Mérieux Institute 3 genetics engineering laboratory.
The genes it bears and its restriction map are presented in table IX.

This plasmid may be built up as follows .
Plasmid pBRTac, made up by pBR322 (Bolivar F. et al. Gene 2, 95-113 (1977)) propagating between HindIII and BamHI~promotor Tac (Ammann E. et al., Gene 25, 167, (1983)), has its XhoI
site destroyed by the Kleenow polymerase (also called "the kleenow") to give plasmid pBRTacX .
This plasmid is digested by NcoI, treated by the kleenow, then digested by AvaI, and its smallex fragment is ligated to the pMC9 fragment (Casadaban M.J. et al., Journal of Bacteriology, 143, 971-980 (1980)) digested by MstII, treated with the kleenow and then digested by AvaI bearing gene Lac i and the replication origin of pBR322.
The resulting plasmid (named pBRLaciX ) is digested by HindIII, treated with the kleenow and then digested by PstI, and the 2350 bases pair (or "pb") fragment is ligated to the 2300 pb'fragment of pBRTac digested by EcoRI, and then treated with the kleenow, and digested by PstI, thus creating plasmid pBRTaci. The latter's 4406 pb fragment, obtained by digested with EcoRI and PstI is ligated with a 1688 pb fragment digested by EcoRI and PstI and derived from pBR322 sequences and bearing the pBR322's tetracycline resistance gene.
The obtained plasmid is called pBRTaciTet.
The latest replication origin is separated by digestion with BamHI, and the remaining 2096 pb fragment is ligated to the 2033 pb fragment of pATI53 (Twigg A.J. & Sherratt, D. Nature, 283, 216-218 (1980)) digested by XhoI, thus creating plasmid pATTaciOri.

C ? ,' ~ ? !~
~, ., .' ., / ) This plasmid is digested by EcoRI, then treated with the kleenow, and digested by AvaI and the 2704 pb fragment is ligated with a fragment bearing promoter Pr and its thermosensitive CI857 repressor of the 3076 pb Lambda bacterio-phagederived from pCQV2 ~Queen C. et al., J. Mol.
Appl. Genèt. 2, 1-10 (1983)) by digestion by PstI, treatment with the Mung Bean nuclease, and partial digestion with AvaI. The resulting plasmid is lo called pGTI001.
The replication origin of this plasmid is under control of promoter tac, which allows one to regulate the number of copies by growing the bacteria in a medium containing various IPTG
(gene lac i inductor) concentration.
The gene to be expressed is placed under control of phage CI 857 strong "Pr" promoter (the phage's repressor being thermosensitive).
The ATG of the gene to be expressed is replaced by the ATG of gene cro. This ATG is created by partial Bam HI digestion of p GTI 001 followed by digestion with Mung Bean nuclease so as to obtain a~ blunt end.
The gene to be expressed is inserted in phase (starting from codon number 2) between the blunt ATG end and the XhoI site. An ending signal for the transcription, placed just downstream from the XhoI site, avoids the production of too long messenger RNAs.
Other plasmids of this kind able to express gene iut A (or fep A), are easy to obtain or to build and one l~nows such piasmids wherein the gene to be expressed is controlled by a promoter whose repressor is thermosensitive.
- Construction_of the expression vector of gene _ut A

~; '': ~'' l'l " ' iut A genes isolated from strains 15972 and 16003 are cloned with their .signal sequence at the level of the expression site Bam HI (899) of p GTI 001.
To obtain a blunt 5' end, starting with the ,~econd amino acid of the signal sequence (this time methionine), a two strands synthetic oligonucl.eotide is used to replace the region comprised between the initi.ation ATG and the only Acc I site s:Ltuated in 5' of the coding sequence.
,o The sequence of this oligonucleotide is presented in table X.
The two complementary s-trands of this oligonucleotide are .synthetised and the double strands form is obtained by heating to 90C
15 in a NaCl 50 mM, Tris 10 mM, MgCl 10 mM, pH 7.5 buffer, of an equimolar mixture of the two simple strands, ol.1.owed by a slow cooling down to room temperature, The strategy which is followed in order 20 to insert gene iut ~ of strain 15972 (clone p P-13) is presented in table XI.
With a not very satisEyi.nc, yield, a modified strategy is adopted to put in phase gene iut A of strain, 16003. This new strategy uses a" sub-cloning 25 of the E:co RI-Eco RI region of the intermediary construct ~step 4, table XII~ in vector pSB 118.
This vector is a pVC 18 derivative. It has a "polylinker" bet~Jeell two Eco RI sites. Sub-cloning of the Eco RI-Eco RI fragment in this vector has thus 30 allowed o~e to pu-t in phase gene iu-t A while avoiding partial digestions. (Table XII).

r~
~, J .

Restriction maps of the GTI P-2 (gene iut A of strain 16003) and GTI
B-5 (gene iut A of strain 16003) expression plasmids thUs obtained are presented in table XIII.
Clones obtained after renewed ligation with the double strand "iut" oligonucleotide are selected on the basis of the preservation of site Acc I in gene iut A and the disappearance o f site Bam HI in p GTI 001. All clones presenting this restriction profile have been controlled at the expression of protein Iut A.
- Control of the expression of Iut A
Qualitative control The selected clones are grown in M9 SP tetracycline medium with 0.4 mM IPTG at 32C
(start of induction). The sensitivity of these clones towards cloacine is examined by the above described method.
Two clones out of 25 are positive for the constructions GTI-iut 15972.
Three clones out of 6 are positive for the constructions GTI-iut 16003.
The cloacine sensitive clones are grown in 50 ml tetracyclin M9 SP medium containing 0.4 mM IPTG.
The culture is made at a temperature of 30C tillthe optical density reaches 1. Induction of gene iutA expression is then made by continui the culture for four hours at +42C. The bacteria are centrifugated and their total proteins are analyzed by polyacrylamide gel-SDS electrophoresis.
This allows one to directly appreciate the importance of Iut A protein production (figure 1). The analysis of clone CMK 603 GTI P-2 reveals that protein Iut A and its precursor represent, after induction, 25% of the bacterium's total proteins. The sole Iut A protein represents 30% of the outer membrane proteins.
- ~ of the expression vector for gene fep A.
Characteristics of the initial clone p MS 101 Following the results of CODERE and EARHART (6) indicating that gene fep a is located on a 6.3 kb Bam HI-Bam-HI fragment of plasmid pMS 101 constructed by LAIRD and YOUNG (19), this fragment is sub-cloned and vector pBR 322 digested by Bam HI. The restriction map of the obtained plasmid (F-l) appears similar to that of plasmid pITS 1 (FLEMING et al. (11) -table XIV).
The publication of the sequence of fep A (LUNDRIGAN and KADNER) (22) has enabled one to precisely locate this gene on the restriction fragment Ssp I-Stu I 2530 pb of plasmid F-l.
The following strategy is used to insert gene fep A into p GTI 001.
An oriented mutagenesis is made in terminal 5' region of the coding region in order to transform sequence :
5'ATGAACAAG 3' into a HpaI restriction site MET ASN LYS

G T T A A C A A G

V. ' ~ ~ .' ', 1 This site is cut into blunt ended ends in the following manner GTT AA C. This allows direct ligation of gene ~ with the ATG end created in p GTI 001.
The mutagenesis is made according to the ECKSTEIN method from7Oligonucleotide (table XV), after sub-cloning of 800 pb Ssp I-Eco RI fragment in the replicative form of phage M13 mp 19.
The mutated fragment is entirely sequenced in order to check that the sequence had not been modified elsewhere than at the desired site.
Details of integration of gene fep A are summarized in tables XVI and X~II.
The various clones obtained after ligating fragment HpaI-XhoI 2350 pb in plasmid GTI 001 are selected by the presence of a 1700 pb Eco RI-Eco RI fragment.
- Control of the expression of Fep A
Qualitative control.
The ligationmixture between the 2350 pb Hpa I- Xho I fragment and plasmid GTI 001 is used to transform competent bacteria RWB 18. This strain being-fep A, it is colicine B resistant.
Clones having the desired restriction map (table XVII) are tested upon their sensitivity to colicine B.
One clone (RWB 18 GTI F-12) appears sensitive to the action of colicine B.
Quantitative control.
The expression of protein Fep A and its precursor is analyzed on polyacrylamide-SDS
gel (figure 2). Clone CMK 603 GTI F-12 expresses ;

Fep A and its precursor in a very large amount (20~ of total proteins).
Protein Fep A represents 32% of the outer membrane proteins.
- Physioloqical and morpholoqical study of clones expressinq Iut A and Fep A
Growth potential The growth potential of obtained clones is tested at various growing temperatures in LB
tetracycline IPTG medium.
When seeded as a layer on LB tetracyclin IPTG agarose 0.1 mM, all clones form bacterial maps which are sensitive to bacteriocins when grown at temperatures between 30C and 34C.
Above 34C, bacterial mat~ no longer form. This has also been observed in liquid LB
medium.
Sensitivity to bacteriocins is also found for IPTG concentrations of only 0.05 mM
and at a temperature of 30C. Therefore, there exists a level of expression for genes iut A and fep A, in the absence of an induction of vector p GTI 001.
Morphological study.
The various clones undergo morphological changes following overexpression of Iut A and Fep A.
Bacteria, when observed with a phase contrast optical microscope after induction at + 42C during 4 hours, show a notable elongation (up to 10 times the average length of a normal K 12 Escherichia coli). However, the more striking .........

s~ s l ~-characteristic is the presence of one to several intracytoplasmic inclusions inside each bacterial body.
Inclusions as observed with the optical 5 microscope may be found again when one observes with an electronic microscope after negative coloring of bacterial sections grown at ~42C
during 4 hours.
These inclusions are peripherical and adjacent to the inner face of the cytoplasmic membrane.
3.Immunological properties of proteins I_ A and FeP A
Immunogenicity of Iut A and FeP A
Iut A proteins extracted from outer membranes of strains E. coli 15022, 15393, 16003 and recombinant strain Escherichia coli CMK 603 GTI P-2 are isolated by preparative polyacrylamide gels and injected to rabbits according to the above described protocol.
Changes in the title of anti-Iut A
antibodies secreted by each rabbit/assessed with the ELISA method, taking as an antigen a "granules"
(precipitated proIut A protein) solution extracted from a culture of the strain E. coli CMK 603 GTI
P-2.
The positive reference serum used is a rabbit anti-Iut A protein serum of E. coli ColV-K30, supplied by B. OUDEGA.
The same protocol is followed for proteins Fep A extracted from membranes of strains E. coli 150022 and E. coli RWB 18 GTI F12.

In all cases, the rabbits react to the injection of proteins Iut A and Fep A by producing a high titer of antibodies specifically directed against these proteins.
- Antiqenic properties of proteins Iut A and Fep A
The specificity of the various obta ined antibodies is studied towards several outer membranes preparations (Strains E.coli 15022, 15393, CMK
603 GTI P-2, CMK 603 GTI B-5 and RWB 18 GTI F-12). This study is made using the "Western blot"
method.
The four anti-Iut A sera which are prepared, as well as the standard anti-Iut A colV-K30 serum specifically recognize a 76 kDa protein in all outer~membrane preparations from strains expressing the aerobactin system.
Whenever the (wild or recombinant) Iut A protein used for their induction, the antibodies of one serum specifically recognize the Iut A protein expressed by bird and ox E. coli proteins and the two Iut A proteins synthetized by the recombinant strains E. coli CMK 603 GTI P-2 and CMK 603 GTI
B-5.
The precursor of the Iut A protein, protein proIut A is also specifically recognized by all anti-Iut A sera. (Immunoblots made with purified "granules" generated by strains CMK 603 GTI P-2 and CMK 603 GTI B-S).
Protein Fep 2 is not recognized by anti-Iut A sera and, conversely, anti-Fep A sera do not recognize Iut A proteins.

Cloning of genes iut A and fepA in expression vector GTI 001 allows one to generate large amounts of proteins Iut A and Fep A as well as their respective precursors. Proteins Iut A or Fep A and their precursors which are synthetized following the induction of the trans-cription by the growth of bacteria at 42C, rapidly accumulate in the form of large cytoplasmic inclusions (granules) which are visible with lo a phase contrast optical microscope. Observation with the electronic microscope of section of induced bacteria reveals that these granules are closely joined to the inner face of cytoplasmic membrane.
One must obser~ the importance of the expression level of Iut A and Fep A precursors (an average of 25% of total proteins under non-optimized conditions). Mature proteins make up as much as 35% of the protein content of the outer membrane. This percentage may be considered as the upper limit for the integration of this type of protein in the outer membrane. As a comparison, proteins Iut A and Fep A expressed by the wild strains Escherichia coli 15022 represent together 30~ of the outer membrane proteins. It thus appears that the total expression of proteins Iut A and Fep A, and their precursors, by recombinant strains according to the invention is much higher than their natural expression.
The characterization of a sensitivity towards cloacine DF 13 in clones expressing the Iut A proteins, and of a sensitivity to colicine B in those which express protein Fep A shows that ! f ~

~4 the synthesis and integration of these proteins in the outer membrane take place normally.
The identity of proteins obtained by genetic recombination with wild proteins is also 5 demonstrated by the recognition of these proteins by antibodies directed against natural Iut A and Fep A proteins. One will note that these antibodies also recognize, with the same specificity, precursors proIut A and proFep A into intracytoplasmic inclusions.
Antibodies induced by proteins Iut A and Fep A as obtained by genetic recombination specifically recognize in the same way proteins Iut A and Fep A as expressed by various strains of pathogenic Escherichia coli.
Overexpression of receptors Iut A and Fep A by cloning of their genes on an expression vector, allows one to obtain in an iron-rich medium external membrane proteins which are functionnally and antigenically identical to proteins expressed by pathogenic bacteria during their ln vivo multiplication.
The synthesis of proteins Iut A and Fep A through genetic recombination thus has many advantages :
- it allows one to obtain proteins Iut A and Fep A in very large amounts, while freeing from regulation by iron, - the synthetised proteins are functionnally and antigenically identical to the proteins as expressed by pathogenic bacteria in their ln vivo multiplication and they induce the production of antibodies, -when used as an active principle in a vaccine, they induce the production of antibodies f r, .-~

preventing the specific recogni~ion by membrane proteins regulated by iron,o the siderophores, thus stopping the supply of iron and blocking their multiplication in a host ; thus they allow, one to prepare very useful vaccines to prevent or fight infections including septicemiae.
Vaccines may also be preparated simply from inactivated recombinant clones or from membrane fragments obtained by lysis of recombinant clones followed by purification, according to usual methods for the preparation of vaccines based on surface or wall antigens.
IV. PREPARATION OF IROMPS BY GROWING
IN IRON-RESTRICTED MEDIUM.
1) Strain : E. Coli 078 reference 15022 :
origine : chicken 2~ culture :
- Medium :
ST medium + succinate (Simon E.H. and Z Tesmann (1963) Proc. Natl. Acad. Sci. USA 50, 526-532) . addition of lactoferrin (250 ~g/ml) to obtain a medium with an iron deficiency, . or addition of FeC13, 6H2~ (40 ~M) :
for an iron-rich medium.
- Culture - passing 3 times the strain in a iron-rich medium, this being followed by an adaptating stage in a deficient medium before final culture in a deficient medium, - simultaneously, one proceeds to grow the same strain in an iron-rich medium, - the cultures are made at 37C during 24 heures.
3) Analysis At end of growth, in each medium, one proceeds to the followlng operations :
- harvesting by centrifugation, - collecting~pellet in 0.2 M Tris HCl Ph 8, and ultrasonication, - centrifugation (5000 g 30 minutes) - recentrifugation of supernatant (100 000 g, 1 hour), - taking up ofthe pelletin Tris HCl (50 mM, pH
8), MgC12(10 mM), EDTA 1 mM, Triton 100 (2~) and agitating during 20 minutes at 37C, - centrifugating one hour at 100 000 g then reextracting the pellet, - washing the pe/letn demineralised water, - analysing thepellet in polyacrylamide gel (PAGE
SDS) under denaturating conditions (mercaptoethanol, SDS)-4. Result :
- Membranes of bacteria grown with lactoferrin :
presence of two proteins, in large amounts, having apparent molecular weights80000 da (enterobactin receptor Fep A) and 76000 da (aerobactin receptor Iut A), - membranes of bacteria grown in iron-rich medium :
no 76000 and 80000 da band.
V - PREPARATION OF VACCINES
Preferably, the active principles according to the invention will be associated, in the vaccines, with a conventional antigenic preparation in known human or animal antibacterial vaccines, and notably in the case when one uses purified proteins.
These vaccines may show the active inventive principles in usual liquid vehicles for parenteral administratlon. They may include conventional , for example oily adjuvants.
The legends of figures 1 and 2, hereabove refer-red to, follow :

For figure 1 :
Control of the expression of the Iut A protein and of its precursor on two CMK 603 clones containing GTI-Iut A constructs.

PAGE-SDS pattern of total proteins of the clones:
1 E coli CMK 603 GTI-001 .
3. E. coli CMK 603 GTI-Iut A (strain 16003) 4. E. coli CMK 603 GTI-Iut A (strain 15972) 2. Molecular weight references.

For figure 2 :
Control of the expression of the Fep A protein and of its precursor.

PAGE-SDS pattern of total proteins of the clones.
1. E. coli CMK 603 GTI 001 2. E. coli CMK 603 GTI-Fep A.

TABLE I

PATHOGENIC STRAINS SEROTYP~ ORIGINAL ANIMAL REFERENCE

E. eoli 15 022 O 78 chieken souchothèque RM
15 393 0 86 calf " 15 972 O 2 chicken "
" 16 000 0138 calf "
" 16 003 0138 calf "
10E. eoli KM 576 (p ColV-K30)Man B. O~DEGA

Host strains E. coli _ K12 genotype origin or reference . C 600 F- thr, thi, leu, lac Y, fhu A, sup E ~ ~ r~ e~
. ~3 101 F- hsd (r~~, m~~), recA, ara, Pro, lacY, ( ~ P~ie~ ~31 8~1. r~5, xYl, mtl, suPE
~WB 18 F- thi, ProG, leu, ~ , en~, ~?A ~H-LL ~ D e~
NEn~ 4) . CMK 603 F~ thr, thi, leu, suPE, re~ BC, fhu A, Instl~u~ ~er.eux lac Y, r~~, m~
. 15~25 F- Souchothèque RM

Bacteriocines-producing strains E. coli 1300 Colicin B produeing R. PORTALIER
Enterobacter clocae DF 13 S458 Cloacin DF 13 producing B. OUDEGA

4~

'rABLE II

Name Size Characteristics Reference or origin (bases pairs) pB~ 322 ~363 ~mpr Te~ ~. BOLIV~R
cloning vector 10 pAT 153 3600 Ampr Tetr A. TWIGG
cloning vector pSB 118 2692 ~mp' derived from P. STRAGIER
pUCl8 cloning vector It.Pasteur Par1s 15 pGTI 001 5780 Tetr expressing vector P. BRUNEAU
I t Mérieux pABN 1 18300 Ampr vector p Plac + E~E~F ~
16.3 kb Hind III frag- N~IN~ (2) ment of ColV-K30 bearing operon aerobactin pMS 101 15300 Ampr vector pBr 322 + L~RDe~
11 kb HInd III fragment of E. coli chro~osome bearing genes entD, fepA, r'es et entF

.:
.

ç ~ ~ r~

TABLE III

Day Day 14 Day 28 Day 35 intradermic intramuscular intramuscular intramuscular injection injection injection injection ~.25~g 125~g 125~g 250u~
Blood5 ml Blood 10 ml sampling sampling Day 42Day 49 Day 56 intramuscular intramuscular injection injection 250~8250~
Blood50 ml Blood 60 ml sampling sampling r,. -TABLE IV f f ~ Eco R I
(WILD PLASMID ) ~ ~am kbDigestion Bam HI ~ / A~R TETR
~3 ~7 pAT 153 - - - \ ~ , g, ~
6,7 ~~~ ~ectroelution ,~,3 ~ D1gestion eam HI

LIGATION
BAM HI

AM~ R
~ ~ TETg \\ /
>~
Bam hI

Selection. with cloacine CLONES AMPR TETg CLOg CLONING STRATEGY OF iut A GENES

52 f,, ~ , rj w ~ 8 ~ O= -C$9~ _ _~ ~ ~ '~

~z h~) ~ ~ q ~ _~ ~

W

~O ~ ~ ~/~ ~ ~t~9~

~ r5 '~ -~r9" -~ _~
O~q ~ _, o~ ~
W ~

C ~ 7[ ~ 1 t 5 3 f TAE~LE VI
~- ]~

Z~
~i U~

5 4 s~ r~ r.
TABLE. VII
Comparison between nucleotide sequences of Bst~ BstE II
(3.2 kpb) restriction fragments ~of aerobacti~e operons of p Col.V-K30 et p 15972 C~lV~ GGTTACCGTTCTGCGTTGCCACAAATACTTCCCTCACTGATGCCCCT5ATCACCATGCAC
15972 GGTTACCGTTCTGCGT,GCCACAAATACTTCCClCACTGATGCCCCIuArCACCATGCAC
61 GATAAGAAcAccTTTAAAGTGcGTGATGAcTTcAcTcTuGAATGGAGTrùGcccGAAAGAG
61 GATAAGAAcAcclTTAAAGTGcGTGATGdcTTcAcTcTGGAAT5GAGT5GcrcGAAAGAG
121 AAcAAcATcTTcGTGGTcAAcGccAGTATGcAAAcccATGGcATcGcc5AAccccAGcTc !81 AGccTGATGGcATGGAGATcTGcAcGTATTcTTAATcGcGTAATGGGAcJTGATTlATTr 181 AGCCtGATGGCATGGAGATCTGCACGTATTCTTAATCGCGTAATGGGACGrGATTTATTC
15 241 GATcTcAGTATGcrGcccGcccTGATTcAGTGGcGcAGGcAccT~GGAAAAcGcAGccG

END 1 uc D

301 GACTTGTC TTAAcTcGcTAcAcAGcATcTTTGGGclGArlTTTTccGcc;GlATGGAGG
20 '61 AATAA-~uATGATAAGCAAAAAGTATACGCTTTGuGGCTCTCAACCCAC',CrTCTTACCA
~6; AATAArl-ATGATAAGcAAAAAGlAlAcGcTTTGGûc-l`-cAAcccAc-Gc -c -Al:CA' ~2' GATGGcuccAGcAGlcrucTcAAcAAAcc5AlTGATGAAAc5TTcùTGG-GlciTuccAAccG
1^' GATûGCGCCAGCAGTC5CTCAACAAACCGArGAT5AAACGTTCGT5G;'GTîT5CCAACC5 481 CAGcAATfGcAccGTAGcGGAGAT5GcGcAAAccAccTGGGTTATcGAAAAcGccGAAcT
48: CAGcAATcrucAccGTAGcGGAGATGGcGcAAAccAccTGGGTTATcGAAAAcGccGAAcT
54i GGhAcAGcAGATTrAGGGcGGcAAAGAGcTTAAAGAcGcAcTGGc-cAGcT5AlrcccrGG
541 GGAACAGCAGATTCAGGGCGGCAAAGAGCTTAAAGACGCACTGGCTCAGCTGATCCCTGû
601 CcTTGAcGTcAGcAGccGGAGccGcAccAAcTAcGGTATGAATGTGcGTGGccGcccGcT

721 CTCTATQGATCCTTTTAATATûCACCATATTGAAGTGATCTTCGGTGCGACGTCCCTGTA
721 CTcTATAGATccTTTTAATATGcAccATATTGAAGTGATcTccGGTGcGAcGTcccTGTA

~81 CGGcGGcGGcAGTAccGGTGGccTGATcAAcATcGTGAccAAAAAAGGccAGccGGAAAc 841 CATGATGGAGTTTGAGGcTGGcAccAAAAGTGGcTTTAGcAGcAGTAAAGATcAcGATGA
841 CATGATGGAGTTTGAGGcTGGcAccAAAAGTGGcTTTAGcAGcAGTAAAGATcAcGATGA

__ .

,r~
J ~ .

TABLE. VII (continued) ~()i AcGcATTGccGGAGcTGTcTccGGcGGAAATciAGcATATcTc~GGAC5TC-TTCC5TGGC
~rJ; AcGcATTGccGGAGcTGTcTccGGcGGAAArGAGcATATrTccsGAcsTcTTTcci-àlGGc ATATcAGAAArTTGGcGGcTGGTTTGAcGGTAAcGGcGArGccAcc--GcTTGArAAcAc '~61 ATATcAGAAATrTGGcGGcTGGTTTGAcGGTAAcGûi5`ATc~l-cAccTTlJcrrGATAAcAc ! ~2: CCAGACCGGCCTI .AG T AC-CCGATCGGCTGGACATCATGG iAAC-. G i T ACGC T G;~rAT
: ~2: CcAGAcc5Gcc~G;AGTAclccGATcGGc~GGAcATcATvGGAAcTG~iTAcGcTGAAcAT
081 CGATGAATCCC ii;CAGCT CAGTTGATCACACAGTAC ATAAAAGCCAûûGCGAC5A(:SA
CGATGAATC'`CGGCAGCTTCAGTTGATCACACAGTACrATAAAAGCCAGGGCGACGAC5h ;!Gl TTAcGGGcl-AATcTcGGGAAAGGcTTcTcTGccATrAGAGGGAccAGcAcGcrAl-cGT
I l 4 l rTAcGGGcTrAArcTcGGGQAAGGcTTcTcTGccATcAGAGGGAccAGcAcGccATTcGT

.201 cAGTAAcGGGcrGAArTccGAccGTATTcccGGcAcT5AGcGGcATrTGArcAGcc-GcA
CAGTAQCGGû(`IGAATTCCGACCGTATTCCCGGCACTGAGCGGCATT~GArCAGCCTGCA
i2~i GTAcTi:r5AcAGcGcTTTlcTGGGAcAGGAGcTGGTcsGlcAGGT TAcrAccGcGAT~A
:26i GTACTC~.ACAGCGC,~TTC,ûGGACAGGAGCTGGTCGGlCAGG,TlACTACCGCGATGA
: ?2: GTCGTTGCGArTC ACCCG T TCCCGPCGGTAAArGCGAACAAACAG -GACGGCTT C C
.32; GTCGTTGCGAr T CTACCC5T T CCCGACGulAAATGC5AACAAPCAGGTûACGGCTT crc 38 I TTcGTcAcAGcAGGAcAccGAccAGTAcGGcATGAAAcrsAcTcrGAAcAGcAAAccGAr ~8~ TTCGTcAcAGcAGûAcAccGAccAGTAcGGcATGAAAc,'SAclcTGAAcAGCAAAccsAT
;aa~ GGACGGCTGGCAAATCACCTGGGGGCTGGATGCTGATCATGAGCGCTTTACC-CCAACCA
aal GGAcGGcTGGcAAATcAccTGGGGGcTGGATGcTGArcATGAGcucTTTAcclccAAccA

!501 GATGTTCTTCGACCTGGCTCAGGCAAGCGCTTCCGGAGGGCTGAACAACAAGAAGATTTA
i 50 I GATGTTCTTCGACCTGGCTCAGGCAAGCGCTTCCGGAGGGCTGAACAACAAGAAGATTTA
1561 CACCACCGGGCGCTATCCGTCGTATGACATCACCAACCTGGCGGCC~--CTGCAATCAGG
:561 CACCACCGGGCGCTATCCGTCGTATGACATCACCAACCTGGCGGCCTTCCTGCAATCAGG
' 621 CTATGAcATcAATAATcTcTTTAcccTcAAcGGTGGcGTAcGcTATcAGTAcAcTGAAAA
! 62 i CTATGACATCAATAATCTCTTTACCCTCAACGGTGGCGTACGCTATCAGTACACTGAAAA
i S8 I CAAGATTGATGATTTCATCGGCTACGCGCAGCAACGGCAGATTGGCGCCGGGAAGGCTAC

,7al ATccGccGAcG CATT CTGGCGGCTCAGTCGATTACSA~: AcTTccTGTTcAAcGccGG

r~ ' ' J '~

TABLE VI I ~( continued ) ?~8 rCTGCTGATGCACATCACCGAACCGCAGCAGGCATGGCTrAACT-C,CCCAGGGI-.GIGGA
~01 rCTGCTGArGCAChTCACCGAACGCCAGCAGGCA i-iGC.^AAC~TCT~CCAGGGC5rGrih '858 5CTGCCGGACCCGGGTAAA r AcTATGGTcGcGGcATcTATGGTGcTGcAGTGAAcG5ccA
!861 GCTGCCGGACCC5GGIAAArACTATGGTCGCGGCATCTATGGTGCTGCAGTGAACGGCCA
19!8 TCTTCCICl~ACAAAGAGTGT5AACGTCAGcGACAGcAA5C,5GAAGGC~TGAAA51-5A
,,,,,,..,..,,,.,,,,,,,,,,,,,,,,,,,,.,...,. .,~,.. .... ...
:~,?: TcTTccTcrAAcAAAGAGTGTGAAcGlcAGcGhcAGcAAG!~lGGAAGGcGlGAAAGTcGA
i~7~ TTCTTATGAGCTGGGC~,GGcGCTTTAcTGGcAATAArc-GcG,AccCAAArcGCGGccTA
~ l TTCTTATGhGCTGGGCTGGCGCTTTACTGGCAATAATCTGCGTACCCAAATCGCGGCCTA
2038 CTATTCGATTTCTGATAAGAGCGTGGTGGCGAATAAAGhTCTGACCATCAGCGTGGIGGA
20Gl cTATTcGArlTc-GATAAGAGcGTGGTGGcGAATAAAGATcTGAccArcAGcGTGG-GGA
2098 CGACAAAI:GCC5-,ATT-ACGGCGTGGAAGGTGCGGTGGACTAcrTGAT-CCTGATACTGA
2~ CGAcAAAcG~-5TATTTAcGGcGTGGAAGGTGcGGlGGAcTAccTGAlTrcTGATAcT5A
'!58 CTGGAGTAC;5GA~ iAaCTTCAACGTGcTGAAAAcTGAG,cG~i~AGTliA~c5~~A,rl,i .?16. CTGGAG~ .GAii G~ACT-CAACGTGCTGAAAAI`-GAG C'iA~G,GAACGGTAC'IG
2218 GCAGAAATACGArGIGAAGACAGCAAGCr_ATCAAAAGCGACAGCr,ACATTGGCT5iGC
'22! GCAGAAArAC'iATGT5AAGACAGCAAGCCCATCAAAAGC;iACAGCC-.ACATTGGC-, UliiiC
,?~7`8 QccGiiAccciTGGAGlcTGcGcGTGcAGAGcAccAccl-cTTTGAcGT5AGcGAcGcGcA
`281 ACCGGACCCiiTGGAGICTGCGCGTGCAGAGCACCACCT.--Trl-iAC'i~GAGCGACûCGCA
2338 GGGCTAC~AG5TCGATGGCTATACCACCGTGGAT~TGCTCGG,AG,TATCAGCTTCCGGT
........................... ....... .... .... ...
2341 GGGCTACAAGGICGATGGCTATACCACCGTGGATCliiCTCGiiCAGTlATCAGC-TCCiGl 23~ GGGTACACTCAGCT'CAGCATTGAAAACCTCTTCGACCGTGACTACACCACT5TCTGGG5 2aol GGGTACACTCAGCTTCAGCATTGAAAACCTTTTCGACCGli'iACTACAC_ACTGTCTGGGii 2461 GcAGcGTGcAccAcTGTAcTAcAGcccGGGTTAcGGcccAGcGTcAcTGTAcGAcTAcAA
1~ Il D
25~Q AGGCAGGGGCC CACCTTTGGTCT~eACTACTCTGTGCT5TTCTGACCGGTATTCCTTTA
'52! AGGcA5GGGccGAAccrTTGGTcTGAAcTAcTcTGTliclGTTcT~ GGTArTccTrTA
2577 CAACAAAGGTACGCTGQTATCAACATGGCCGCTGACAGCCAAGTTGATATCArATAAlAC
'5~1 CAACAAAGGTACGCTGATATCAACATGGCCGCTGACAGCCAAGTTGATATCATATAArAC
2637 AcGAcATAATcTGTAGTcAGGGAGGATAGAcTcTTTAcTGAcTAcAGATTATGTccTGTT
264i ACGACATAATCTGTAGTCAGGGAGGATAGACTCTTTACTGACTACAGATTATGTCGTGTT

TABLE VI I ( continued ) 2697 CCGTGCTCArTTCCTCAAAAAAATACAAGAAAAGAAT,~GTAr-CT. AACAAAAAGIGAAA
. 7'-)1 CCGTGCrCArTTCCTCl;AAAAAArACAAGAAAA~ ,AL\AA~ JI~A~.
7~ , AAATTGTATCAAACT~ CcT-TT ~ TAATcc ~ G ~ TGA(~ rAAA l -A~ T l I TGCAATî~GiJAr ~76 i TAAATTGTATCAAACTCCCTCT, TTAATccTGrTGAGTpAArcAGcT~-rTGcAAThGGAT
281, TGAAAGAGTGTAAGTGGAATcTcrrccGGATAcrcGlrAccAccGrGGcrAGAArArcTA
'821 TGAAAGAGrGrAAGTGGAATcTcTTccGGArAcTcrirT~i^.PccG~CGCrAGAAIAr^TA
BEGINNING I
28-- CGGC ,GcGGGGliTGArGcrGccAAcT ~Cr~ArrrAG'G-~ GiiT,'i, TT-G;~
~88 ' cGGcrGcGGGGGTGArGcTGccAAcrrAcTGATT TAGTG-,ArGATGGIGuT-. TT GAGGTG
2937 CTCCAGTGGCTTCTGrTTC T ATCAGCTGTCCCrCCrGTTCAGC-ACTGACGGGGTGGTGC
2941 CTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGT,CAGCTACTGACGGGGTGGTGC
2~ 7 GTAAcGGcAAAAGcAccGccGGAcA-cAGcGcTA~c r~ -cAcrGcc~ TAAAA(AT
300! GTAAcGGcAAAAGcAccGccGGAcArcAGcGc-ATcT~ crc l cAcrGccGTAAAAcAT
3057 GGCAACrGCAGTTCACTTACACCGCTTCTCAACCi-GGTACGCPCCAGAAAATCATTGATA
3061 GGCAACTGCAGTT cAcrTAcAccGcT~TcTcAAcc~-GG-Ac.iiArc~GpApATrATTlip~rp 3; ! ~ TGGccATGAATGGci~TTGGArGc~GGGcAAccGccc~ A r-~-^;iGC;, -Gc~i`c-^A~cA
31 ~ TGGccArGAATGGcGlTGGATGccGGGTAAcTGcccGcAT-AlLiûGcsTTGGcL^-cAAcA
317, cGATlrTTccGccATTTAAAAAAcTcAGGccGcAGTcGGrAAcL
3181 cûArTTTAcGTcAcTTAAAAAAcrcAGGccccAGTcGGTAAcc Matc~.es = 3207 Mismatches = !2 Unmatched = ' Leng~n - 3223 ~atches/length = 99.5 Percent ~ .

.` . ., { . "

TABLE. VIII
7~5 Col~-K30 GTG ATC TTC QGT GCG

16003 ~ ~ ~ - -~~~~~~~~

~ 7411 ColV-K30 GAC GCA TTC TGG CGG CTC AGr CGA TTA CGA CAC TTC
16393 ~ -C ArT CCT GGC ~GC TCA GTC ~Ar TAC GAC AAC ~TC
15972 -- - -C ATT CCT G~C GGC rcA GTC GAT TAC GAC AAC rTc _T~
16003 --C ATT CCT G~C ~C TCA GTC GAT TAC GAC AAC TTC CTG

al4 ColV-~30 ACC GAA CCG CAG CAG
15393 ~ -GC - -1597~ GC
16003 -- ~- - -GC - --ColV-~30 GAA AAC CTC TTC GAC

1~03 - - _ __ _ _ 252~
ColV-~30 G~C C~A CCT TTG GTC TGA
Gly Pro Pro Leu Va 1 E~O
15393 G~C CGA ACC m GGT CTG AAC TAC TCT GTG CTG TTC TGA
15972 -----GA ACC m GGT CTG M C TAC rcT GTG CTG TTC TG~
~6003 -----GA ACC 1ll GGT CTG AAC TAC TCT GTG CTG T~C rGA
Gly Arg Thr Phe Gly Leu Asn Tyr Ser Val Leu Phe ENC

Differences between the sequence of the three clones iut A
_ and the sequence ofqene iut A DE p ColV-K30 ~ABLE IX
Eco RI C~57 ~ \
\ \ Shine and ~ oR2 / Delgarno 5401 Ec~ ~ RI ~ CR1/ de Cro 5125 E~n HI I ~/
Acc ~ ~ ~n HI

A T G G A T C C
\ \ B~n Hl 899 \~Ter" ATG ~e Cro p Gn 001 _ 5780 pb Bam HI 2388 "Ter"

Creation of ATG
Diges.tion BamHi ... A T G G A T C C..
T A C C T A G G..

Digestion ~u~ B~Yn 5~ A T G 3' ~>~ 5' A T G 3' 3'... T A C C T A G 5' > 3' T A C 5' PHYSICAL AND GENETIC MAP of p GTI 001 ,,, ~.

TABLE X
ACC I

A T G A T G A T A A G C A A A A A G r A T A C G C T T

MET MET ILE SER LYS LYS TYR THR LEU

1) 5' A T G A T A A G C A A A A A G T 3' 2) 3' T A C T A T T C G T T T T T C A T A 5' 5' A T G A T A A G C A A A A A G T 3' oligo "iut"
3~ T A C T A T T C G T T T T T C A T A 5' Start of gene iut A and 9equence of double strand oligonucleotide used for the phasing of gene iut A in p GTI 00 TABLE XI
Insertion strategy of B~m HI
gene iut A in p GTI OOl ~
1st part pAT 153 /~ \ Bst E Il 10200 pb ~T HI
ve~:tc~r pAT 153 Bst E II

Dige6tion Bst E II- Removal band 3225 pb ~ Bsm HI Bam HI
Digestion Fco RV KU~W ~GC I ~ AcC I

~560 pb ~
LIGATION ~~~
~(ECD ~V) ¦ ~

. iut A partial digestion 3am HI
6500 pb Eco R V
. ~ (Eoo RV) I partial digestiOnAcc I
Di~ion Eoo RV / ligation wit~ oligo iut ~ I double strand Ligation by 1inker XhoI
~nm H ~ ~V~ / AoC~T)AI~

/ 5 ¦ GTI P-2 j ~ ~ Eco 8010 pb--~
Digestion by Bam HI and XhoI and ¦ \
removal band 2780 pb /

Ligation with pGTI OOlfpartial 9~m HI
Bam ~I/XhoI

~ ~ .

, ~ ~

' ' ~ ~ PO 1 Y I i~e,-Bam llI Eco RI ABLE XII ~ RI

Step ~ Eco RI ' Eco ~1 ~ i560p~

~~ `~ I .
BalT HI l Digsstlol Eco RI
D i8est ion Eco RI
Fra~nt 2~00 pD ~
~~ Ba~n Hl ~ LI~TICN
- Fra~r~3nt 6260 pb Eco RI ~ 4990 pb ~_ D i gestic~ B~T HI

(E3 Di~e5ti~n ~c I E~ HI ECO RI (t~n ~ ~Eco RI LigatlC~ with /~ ~;c EC~ ~ ol igo iut Di g~tion Eco RI "~
Removal f~ 1750 P~ / ~
,l / ~o I

LIG~nCN

~, ~ ` t'~

TABLE XIII

(Bam HI~
,1 20 ~ ~ ~ Eco RI

276 ~ ~
Acc I y / "1~1" \\
V i~t A ~\ 1380 p ~TI ~2 ~ ~
P GTI ~-6 79gO pb ~ Xho I

2737 \

Bam HI

RESTRICTION MAP OF PLASMID.S GTI P-2 and GTI B-5 : ' ~

;:

~AB L ~ X I V 6~, F~l " ~ ,, ,,J,~ ) Hind III
3~ 1~ ~n HI
/ ~
// ~ Stu I

Bam HI ~
Hind III _ p MS 101 --Eco RI

15 500 p~ ~
/~ Ssp I

-- -.- Ban HI Eco RI Ssp I
digested by Di~e5~icn Bam HI

~~ LIG~TICN
Ban HI

\~ ~' Sgp I
B~n HI /~/
E~ RI Ssp I

RESTRICTION MAP OF p MS l0l and CONSTRUCTION OF p F--1 ~.,.,p~l4i,;~

~ TABLE XV
start of the sequence of gene fep A

5' ~ G A A T A A A A C A A T G A A C A A G A A G A T T 3' MET ASN LYS LYS ILE

~- sequence to be obtained after mutagenesis :

5' G G A A T A A A A C A G T T A A C A A G A A G A T T 3' 3' C C T T A T T T T G T C A A T T G T T C T T C T A A 5' site Hpa I

oligonucleotide(27 mer) used 5' C T T C T T G T T A A C T G T T T T A T T C C 3' SEQUENCE OF SYNTHETIC OLIGONUCLEOTIDE USED FOR THE
MUTAGENESIS OF fep A

`

,:~ .1,"

TABLE XVI
Bam HI INSERTION STRATEGY OF GENE FEP A
IN p GTI 00l Eco RI I 1100 ~ Stu I 1st part /~ ~ 1720 / l ~., \ Dige~tion S~u I
pBR 322 p F-1 ,~.
10600 pb ~ ~ Eco RI
Soh I. ! ~ ~J 810 Addition 1inker Xho I
Bam HI \ ~ Ssp I
LIGATIO~
3Qo ~ o0 Eco RI Bam HI ~
Eco RI Ssp I ~ Xho I
!~ P FX~
ll 1o6oopb ~
~ ~ Eco RI

B3m H ~ ~O I
Eoo RI
Sph I
- l partial digestion Eco RI

linear 10600 pb Di~esticn Sph I
Dig~tion Ss~ I
r ~
removal fragment 810 pO
Removal ; 6gO0 pb fragment Liyation in M13 mp 19~Eco RI ~ H1nc II

~r rlLJ~AC~
~ `

TABLE XVII

. Dlgestion Eco RI-~pn I du of ; utated fragment (810 p~) ~ ' ..
LIGATION

Bam HI
Eoo RI

pBq 322 lSPh _ site Hpa I cr~

Digestion Xho I-~Ph I - Removal fragment 2539 pb I, .
partial diges- ,~sa I - Removal fragmen~ Hpa I-Xho I 2350 P4 tion LIGATION with~GTI 001/ partial Bam HI/Nucl~ase Mung ~/Xho I
~Eoo RI (Bam HI) ATG

Eco RI
~,.\

~110 pb ,~ feo A

. . Xho I

~?
~., . , ~3 .

BIBLIOGRAPH'i (1) BINDEREIF A., BRAUN V. et HANTKE, J. Bacteriol.
150, 1472-1475 (1982) (2) BINDEREIF A et NEILANDS I.B., J. Bacteriol 153, 1111-1113 (1983) (3) BIRNBOIM H.C. et DOLY J., Nucleic Acids Res. 7, 1513-1523 (1979) (4) BOLIN C.A. et JENSEN A.E., Infect. Imm. 55, 1239-1242 (1937) (5) BYERS B.R., p. 111-116, "Iron transport in microbes, plants and animals", G. WINKELMAN, D. VAN DER HELM
et J.B. NEILANDS, VCH Publishers Weinheim, FRG.
(6) CODERRE P. et EARHARDT C.F., "Characterizati~n o~ a plasmid carryin~ the Escherichia coli K12, ent D, fep A, :Ees 15 et ent F" (~ènes FEMS Microbiol. Letters 25, 111-116 (1934).
(7) COULTON J.W., Biochim. Biophys. Acta 717, 154, 162 (1982) (8) DE GRAAF F.R., TIEZE G.A., WENDELAAR BONGA S. et STOUTHAMER A.H., J. Bacteriol. 95, 631-640 (1968) (9) DE GRAAF F.K., GOEDVOLK-DE GROOT et STOUTHAMER
A.H., Biochim. Biophys. Acta, 221, 566-575 (1970) (10) ENGWALL E. et PERLMANN, J. Immunol. 109, 129-135 (1972) (11) FLEMING T.P., NAHLIK M.S., NEILANDS J.B. et Mc 25 INTOSH M.A., Gene, ~ 47-54 (1985) t12) FISS E.H., STANLEY-SAMUELSON P. et NEILANDS J.B., Biochemistry, 21, 4517-4522 (1982) (13) GRIFFITHS E., "Iron and infection : moleculAr, physiological and chemical aspects", J.J. BULLEN et E. GRIF-FITH, JOHN WILEY & SONS LTD, CHICHESTER ENGLAND.

(14) HERRERO M., DE LORENZO V. et NEILANDS J.B., J.
Bacteriol 170, 56-64 (1988).

(15) HOLLIFIELD W.E. et NEILANDS, aiochemistry 17, 1922-1928 (1978) (16) KADO C.I. et LIU S.T., J. Bacteriol. 145, 1365-1373 (1978) ~ ;

o g (17) KRONE W.J.A., OUDEC,A B., STEGEHUIS F. et DE CRAAF
F.K., J. Bacteriol 153, 716-721 (1983).

(18) KRONE W.J.A., STEGEHUIS F., KONINGSTEIN G., VAN
DOORN C., ROSENDAI, B., DE GRAAF F.K. et OUDEGA B., FEMS
Microbiol. 26, 153 161 (1985) (19) LAIRD A.J. et YOUNG I.G., Gene 11, 359-366 (1950) (20) LOWRY O.H., ROSEBROUGH N.J., FARRA L.A. et RANDALL
R.J., J. Biol. Chem. 193, 265-275 (1951) (21) LUGTENBERG B., MEIJERS J., PETERS R., VAN DER HOEK
P. et VAN ALP~EN L., FEBS Lett. 58, 254-258 (1975).

(22) LUNDIGRAN M.D. et KADNER R.J., J. Biol. Chem. 261, 10797-10801 (1986) (23) MANIATIS T., FRITSCH E.F. et SAMBROOK J. (1982), Molecular cloning : on laboratory manual. Cold Sprinq Harbor Laboratory, Cold Spring Harbor NY.

(24) NAKAMAYE K. et ECKSTEIN, Nucl. Acids Res. 14, 9679-9698 (1986) (25) OHTSUBO H. et OHTSUBO E., Proc. Natl. Acad. Sci, USA 75, 615-619 (1973) (26) ROGERS H.J., SYNGE C et WOODS V.E., Antibacterial effect of scandium and indium complexes of enterochelin on Klebsiella pneumoniae. Antimicrob. Agents and Chemotherapy 18, 63-68 (1986) (27) ROGERNS H.J., "Iron transport in microbes, plants and animals" G. WINKELMAN, D. VAN DER HELM, et J.B. NEI-LANDS, p. 223-233 (1987)-VCH Publishers, Weinheim, FRG

(28) SANGER F., NICKLEN S. et COULSON A.R., ~roc. Natl.
Acad. Sci. USA 74, 5463-5467 (1977).

(29) SCHNAITMAN C.A., J. Bacteriol 10a, 545-552 (1971) (30) SIMON E.H. et TESSMAN I., Proc. Natl. Acad. Sci.
USA 50, 526-532 (1963) (31) SOUTHERN E., J. Mol. Biol. 98, 503-517 (1975) (32) TAYLOR J.W., SCHMIDT W., CROSSTICK R., OKRUSZEK A.
et ECKSTEIN F., Nucl. Acids Res. 13, 8749-8764 (1985) (33) TAYLOR J.W., OTT J. et ECKSTEIN F, N~cl. Acids Res. 13, 8765-8785 (1985) 7 ~ ,d (34) TOWBIN H. r STAEHELIN T. et GORDON J., Proc. Natl.
Acad. Sci USA 761 4350~4354 (1979) (3S ) VAN TIEL-MENKVELD G.J., OUDEGA B., KEMPERS O. et DE GRAAF F.K., FEMS, Microbiol. ~ett. 12, 373-380 (1981 ?
(36) VAN TIEL-MENKVELD G.,J., VELTKAMPF E. et DE GRAAF
F.K., J. Bacteriol. 146, 41-48 (1981) (37) WILLIAMS e.H., infect. Immun. 26, 925-932 (1979) (38) YANISCH-PERRON C, VIEIRA J. et MESSING J., Gene 331 103-119 (1985)

Claims (16)

1. A process for growing bacteria expressing outer membrane proteins regulated by iron, of which some are siderophores or transferring receptors, which may be used in a vaccine preparation, characterized in that said bacteria are grown in a medium in which the iron content is reduced, with the help of a strong iron chelating protein, such as a lactoferrins, to a level allowing one to obtain an increased expression of said receptor proteins which is enough to induce, when said bacteria are used in a vaccine, the generation of antibodies preventing the specific recognition of siderophores by their receptors.

2. A process according to claim 1, characterized in that the bacteria belong to the group made up by enterobacteriae belonging to the families Escherichia coli, Klebsiella, Salmonella thyphimurium, Shigella.

3. A process according to claim 2, characterized in that the siderophores which are excreted by bacteria, are aerobactin and/or entero-bactin siderophores.

4. A process according to claim 3, characterized in that the expressed proteins are Iut A and/or Fep A proteins.

5. An anti-septicemic bacteria vaccine characterized in that it includes, as an active principle, antigens comprising whole bacteria as obtained by culture in a medium wherein the iron content is reduced to a level allowing one to obtain an increased expression of outer membrane proteins regulated by iron, and of which some are siderophores or transferrin receptors, or fragments of these bacteria, or transferrins or siderophore receptors proteins, and notably proteins Iut A and Fe A, extracted from these bacteria.

6. A vaccine according to claim 5, characterized in that said bacteria are bacteria obtained by the process according to any of claims 1 - 4.

7. Bacteria expressing in increased amounts at least one outer membrane protein, regulated by iron and forming a transferrin or siderophore receptor, characterized in that they include recombinant expression vectors expressing said protein(s).

8. Bacteria according to claim 7, characterized in that the genes expressed in said vectors belong to the expression system of the outer membrane proteins regulated by iron inside the group consisting of enterobacteria of the families E. coli, Klebsiella, Salmonella thyphimurium, Shigella.

9. Bacteria according to claim 8, characterized in that said proteins belong to the systems of aerobactin and/or enterobactin siderophores.

10. Bacteria according to claim 9, characterized in that the synthetized proteins are proteins Iut A and/or Fep A and/or their precursors.

11. Bacteria according to claim 10, characterized in that protein Iut A is obtained by a process wherein notably one isolates the plasmid part of an E. coli strain or of any other enterobacterium bearing the aerobactine operon, one separates from the plasmid part a fragment bearing gene Iut A , one ligates said fragment with a cloning vector, one inserts the cloned gene iut A
in an expression vector, and one has protein Iut A expressed by growing the clones.

12. Bacteria according to claim 11, characterized in that the expression vector used to express protein Iut A has its replication origin located under the control of the tac promoter and that the gene to express is under control of the strong "Pr" promoter whose repressor is thermosensitive.

13. Bacteria according to 10, characterized in that protein Fep A is obtained by cloning gene fep A in the expression vector defined in claim 11 ou 12.

14. A process for synthesis of IROMPs and notably proteins Iut A and Fep A or their precursors proIut A and proFep A, characterized in that clones as defined in claims 11-13 are grown in an appropriate medium, first at a temperature below 32°C then at 42°C to induce the expression of genes iut A and fep A.

15. Antisepticemic bacterial vaccine, characterized in that it contains as an active principle IROMPs, and notably Iut A and/or Fep A proteins and/or the precursors of these proteins as extracted from the outer membrane or the cytoplasm of recombinant bacteria, according to any of claims 7-13.

16. A vaccine according to claim 13, characterized in that it contains said recombinant bacteria or fragments of these bacteria.