CA2083271C - Fibrin binding domain polypeptides and uses and methods of producing same - Google Patents

Abstract

This invention provides an imaging agent which comprises a polypeptide labeled with an imageable marker, such polypep-tide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occuring human fibronectin and being capable of binding to fibrin. The invention further provides a method wherein the imaging agent is used for imaging a fibrin-containing substance, i.e., a thrombus or atherosclerotic plaque.
Further provided are plasmids for expression of polypep-tides having an amino acid sequence substantially present in the fibrin binding domain of naturally-occuring human fibronectin and being capable of binding to fibrin, hosts containing these plasmids, methods of producing the polypeptides, methods of treat-ment using the polypeptides, and methods of recovering, refolding and reoxidizing the polypeptides. The invention also provides for purified polypeptides substantially free of other substances of human origin which have an amino acid sequence substantially present in the fibrin binding domain of naturally-occuring human fibronectin and which are capable of binding to fibrin.

Description

l~~t~ 91/17765 PCT/US91/03584 FIBRIN BIND:CNG DOIdAIN POLYP$PTIDBS
AND USE8 AND ~~ETHOD8 OF PRODOCIHG 8AMB
Ba.ckg~round of the Invention Throughout this application, various publications are referenced by Arabic numerals within parentheses. Full citations for these references may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference in this application in order to more~fully describe the state of the art to which this invention pertains.
Endothelial injury is believed to be an initial step in thrombus formation and may be caused by, e.g., hemodynamic strain, hypercholesterolemia, hypertension and immune complex disease.
Endothelial injury leads to thickening of the intima, cell proliferation, cholesterol: accumulation, and formation of connective tissue fibers. IgG and complement factor C3 accumulation in injured endothelial cells and nonendothelialized intima has been observed. Mononuclear cells derived from blood are also part of the cell population in atherosclerotic lesions. The mechanism of plaque formation is not fully known. However, a probable mechanism is that the earliest lesions, fatty streaks, consisting of mixtures of T cells and monocyte-derived macrophages, form in the subendotheliurn followed by a secretion of various cytokines, which leads to a migration of smooth cells into the intima and their accumulation therein.

Wfl 91/17765 PCT/1)S91/03584 ~, l "1 ~.9 ~9 1.1~ 1.x 4~.7 _2_ Most existing procedures for the diagnosis and treatment of atherosclerosis and thrombosis are invasive, costly, and of limited effectiveness in a significant percentage of patient cases.
The concept of plaque enhancement by application of a stain ' has been reported [Spears, J. et al., J. Clin. Invest. 71:
395-399 (1983)]. These stains mark the plaque surfaces with a fluorescent compound. Plaque destruction by photoactivation of hematoporphyrin derivatives using an intraluminal laser-transmitting optical fiber has been suggested [Abela, G. et al., Am. J. Cardiol. 50: 1199-1205 (1982)]. Moreover, tetracycline stains have also been suggested. [Murphy-Chutorian, D. et al:, Am. J. Cardiol.
55: 1293-1297 (1985)].
The above-identified stains were selected fox their ability to bind to components of the atherosclerotic plaque. In principle, the stain absorbs laser light concentrating the light at the stained surface. Some staining of healthy tissue occurs causing stain associated damage to the surrounding tissue. Because laser light wavelength is limited to the absorption wavelength of the stain, chromophores offering optimum absorption of laser light must be used to provide best controlled ablation.
Imaging, and detection of coronary thrombi, pulmonary emboli, deep venous thrombosis and atherosclerotic lesions are of great clinical importance especially in view of the new thrombalytic agents which have recently been developed.
Several experimental approaches for non-invasive detection of thrombi by use of radiopharmaceutical agents have been reported but none has gained wide clinical recognition because of intrinsic drawbacks associated with each agent.

a~~,..,-.T,.~«, The basic characteristics of a radiopharmaceutical for early detection of intravascular atherosclerotic lesions and thrombi are the following: (i) high.affinit~ for thrombus components; (ii) relatively fast pharmacokinetic blood clearance rate [in order to obtain a high ratio of thrombus (bound) to blood (unbound) radiolabeled tracer]; (iii) safety; non-toxic and non-immunogenic; and (iv) simplicity of preparation and use.
to The various agents for imaging thrombi described in the literature and their drawbacks are as follows: (a) autol-ogous platelets labeled with 111In: the procedure is cumber-some, time consuming and the blood clearance time is relatively long, viz.~2 days (2); (b) 131-fibrinogen: the assay is based on the (low) affinity of injected radiolabeled fibrinogen for the thrombus but it is not suitable for rapid imaging tests because of its long residence time in blood and furthermore it does not become incorporated into older thrombi nor is it incorporated in 2Q the presence of heparin (3, 36); (c) fragment E1 of human fibrin: although it seems superior to fibrinogen it is difficult to prepare in sufficient quantities for widespread clinical use (4); (d) mouse anti-fibrin monoclonal antibodies: although they are specific and have high affinities for thrombi, they have a relatively long blood clearance time and are potentially immunogenic to human subjects (5, 33, 34); (e) mouse monoclonal antibodies specific for activated platelets (6, '7): disadvantage as (d); and (f) labeled f,ibranectin (1): although fibronectin (see below) has an affinity for a number of substances occurring in thrombi it has a relatively long blood clearance time and the buildup of radioactivity in the thrombus is slaw. Thus there is a need in the art for a thrombus-specific radiopharmaceutical for rapid imaging of thrombi.

~0 9ii1776s pc.-rms~ma~s~s _4_ ~:Tr «.r~.pra~.
lCr'l.ai.:71n.5:~~ ,/
U.S. Patent 4,343,734 (Lien et al.) describes specific gamma-carboxyglutamic acid (GLA) antibodies which can be labeled with fluorescein for immunofluorescence staining of tissue to determine the presence therein of GLA. Specific GLA antibodies bind to GLA which is present in advanced atherosclerotic plaque, having calcium deposits. Lien et al, report that GLA is not found in uncalcified plaques and that GLA is found in cardiac valves and aortas, and in circulating proteins such as prothrombin, clotting factors VII, TX and X, Protein C and Protein S. However, the GLA
binding antibodies of Lian et al. do not selectively bind to atherosclerotic plaques.
Fibronectin is a glycoprotein composed of two identical subunits each of approximately 220,000 molecular weight.
Two major forms of fibronectin are produced and secreted by human cells in culture and in vivo (8). The cell-associated fibronectin is relatively insoluble and participates in sell adhesion, wound healing, cell differentiation and phagocytosis. The plasma fibronectin, produced primarily in the liver, is a soluble serum protein with biological properties similar to those of cell fibronect:n.
Fibronectin is considered a multifunctional modular protein since limited proteolytic cleavage produces polypeptides with distinct activities. The major functional domains of the fibronectin molecule have been obtained and defined by partial protealytic digestion, and include heparin, bNA, fibrin, collagen or gelatin, and call binding domains (8-13).
Baralle, F.E., European Patent Publication No. 207,751, published January 7, 1989, discloses the complete cDNA
sequence of fibronectin. Haralle also discloses the expression of fusion proteins containing a portion of the collagen binding domain of fibronectin fused to the W~ 9I1~7765 PCT/US9!/03584 ~'~r~~s~ 'n°~1u~'~~
ac~~ ~ ~s:,:.:~ r Escherichia coli protein ~~-galactosidase. Similar fusion proteins are disclosed by Owens and Baralle (14). Obara et al. (1987) disclose the expression of a portion of the cell binding domain of human fibronectin fused to Escherichia co i B-galactosidase (15). Additionally, Obara et a1.
(1988) disclose the expression of portions of the cell binding domain fused to B-galactosidase which have been mutagenized, i.e., site specific deletions of portions of the cell binding domain were obtained as fused proteins (16). The carboxy terminal fibrin-binding domain of human fibronectin has been expressed in mouse L cells as a fusion protein with the signal sequence of human protein C
inhibitor (17).
None of the above references discloses the expression of the N-terminal fibrin binding domain of fibronectin; furthermore all the recombinant proteins they disclose are fusion proteins.
This invention provides polypeptides having an amino acid sequence substantially present in the N-terminal fibrin binding domain of fibronectin. These polypeptides have approximate molecular weights of 31 kD, 20 kD, 18.5 kD and 12 kD, as defined by comparison markers on SDS gels under reducing conditions, and have the following characteristics which make them promising pharmaceutical agents: (i) have an amino acid sequence present in a human protein and thus are contemplated to not be immunogenic; (~.i) have specificity to fibrin based on their ability to become covalently cross-linked in a trans-glutaminase catalysed reaction to nascent as well as to preformed thrombi (clots) ;
(iii) bind to extracellular matrix, which property may be exploited to detect atherosc~.erotic plaques; (iv) have a relatively short blood clearance time; (v) incorporate into clots in the presence of heparin; and (vi) are produced by 'W~ 91/17765 PCT/U~91/035&t ~~r~.-,.T.,~,.,.-; ,, ~i~;'as~r~., a -... -6-recombinant techniques and can therefore potentially be manufactured on a large scale.
The subject invention provides an inexpensive, accurate method for imaging fibrin-containing substances, i.e., a thrombus and atherosclerotic plaque, both in vitro and ~n vivo. In addition, the subject invention provides plasmids for expressing polygeptides having an amino acid sequence substantially gresent in the fibrin binding domain of zo naturally-occurring human fibronectin and capable of binding to fibrin which are labeled and used for imaging the fibrin-containing substances, and methods of producing such polypeptides.

_7_ ,y~,"wrl~-'~~~"1~
c4, ;l ~ys~;m 9 summary of the Invention This invention provides imaging agents which comprise polypeptides labeled with an imageable marker, such polypeptide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin.
Further provided is a method for imaging a fibrin-containing l0 substance, i.e. a thrombus or atherosclerotic plaque, which comprises contacting the fibrin-containing substance to be imaged with the imaging agent disclosed above under conditions such that the agent binds to the fibrin-containing substance and imaging the bound agent and thereby imaging the fibrin-containing substance.
Also provided is a plasmid for expression of a polypeptide which having an amino acid sequence substantially present in the fibrin binding damain of naturally-occurring human fibronectin and being capable of binding to fibrin comprising DNA encoding the polypeptide and DNA encoding suitable regulatory elements positioned relative to the DNA
encoding the polypeptide so as to effect expression of the polypeptide in a suitable host cell.
~°he invention also provides a purified polypeptide substantially free of other substances of human origin which has an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibroncactin and being capable of binding to fibrin.
Further provided axe methods of recovering and refolding and reoxidizing such polypeptides and methods of treatment using such palypeptides.

~'O 91/17765 PCT/US91/03584 T~ ~ c..T ~~d .
~c,.a',i.L~~~;m a _g-Hxief Description of the Fi~cur~s In the figures, the number; in brackets adjacent certain of the restriction enzyme sites shown correspond to the identically numbered positions along the nucleotide sequence of human f ibronectin cDNA as shown in Figure 2 ( see also Figure 3 of Baralle, F.E., European Patent Publication No.
207,751, published January 7, 1987).
l0 The following figures describe the construction of plasmids expressing polypeptides having an amino acid sequence substantially present in the amino-terminal fibrin binding domain (FBD) of fibronectin. The FBD commences at amino acid number 1 of mature fibronectin, which is glutamine and corresponds to the fourth amino acid (Q) shown in Figure 2A, i.e., the N-terminus of the FBD sequence is Q-A-Q-Q (gluta-mine-alanine-glutamine-glutamine); the corresponding first nucleotide in the cDNA sequence of Figure 2A is therefore number 14, indicated by an arrow. All the recombinant FBD
polypeptides described in these figures and throughout the specification are numbered from this first glutamine as amino acid number 1 and all the corresponding cDNA sequences are numbered as shown in Figure 2.
Some of the figures describe the construction of plasmids expressing an FBD polypeptide joined at its C-terminus to part of the cell binding domain (CBD) of fibronectin. The cDNA sequence corresponding to the CBD which applicants have cloned and expressed is massing the 270 by extra domain (ED) 3a segment which extends from nucleotides 4811 to 5080, inclusive, on the Baralle map (see Figure 2). Thus, the cDNA seguence which is said to extend from nucleotide 3317 to 5566 on the Baralle map, contains only 1980 nucleotides, because it is missing the 270 nucleotides of the ED segment, namely from nucleotides 4811 to 5080 inclusive; this region is also known in the art as the ED-A region. Because w~T.vws-~~~o')w i lGr, i..,> V.Y1.'s~i~l d ~.
nucleotide 5081 is changed from G to A, the amino acid 1690 is changed from alanine to threonine. Similarly, the polypeptide expressed by that DNA fragment would encode from amine acid 1102 to amino acid 1851 on the Baralle map but would be missing the 90 amino acids encoded by the ED
region, namely amino acids 1600-1689 inclusive, and thus it would contain only 660 amino acids. This is true for all CBD polypeptides described in this application which span the FD region. (The region known in the art as the ED-B
l0 region is missing both in Baralle's sequence and in applicants' DNA.) The definition of the polypeptides expressed as 31 kD, 20 kD, 18.5 kD, 12 kD and 33 kD is an operational definition, based on their approximate molecular weight determined on SDS polyacrylamide gels under reducing conditions compared to that of markers of known molecular weight.
Figure 1. This figure is a schematic description of the 2o various fibronectin domains and the recombinant polypeptides constructed.
Fic~tre 2. This figure shows the nucleotide sequence of human fibronectin cDNA.
Figure 3. Seven pairs of chemically synthesized oligomers were prepared. The synthetic oligomers code for the first 153 N-terminal amino acids of human fibronectin (FN). This figure shows the sequence of these 7 pairs of synthetic oligomers.
Fiau~e-4. The DNA fragment coding for amino acids 1 to 153 of the N~terminal domain of human FN was assembled from the 7 pairs of chemically synthesized oligomers shown in Figure 3 as follows:

,r~,Q w,~r'~eW 4~1 -1~-3ta~~t.'sG~7 / ~~
Oligomers 3/4, 5/6, 7/8 and 9/10, each pair in a separate tube, were annealed and then phosphorylated at the 5' end using T4 polynucleotide kinase enzyme.
In the second step, pairs 3/4 and 5/6 were ligated to each other using T4 DNA ligase. Similarly, reaction pairs 7/8 and 9/10 were ligated to each other. After each step of ligation an aliquot of the ligation mixture was analyzed on gel to determine the size of the newly farmed fragments and the efficiency of ligation.
In the third step, the two above mentioned ligation mixtures were mixed together and pair 6, oligomers 11/12 which had been annealed and phosphorylated previously in a separate tube were added to the mixture. A 326 base pair DNA
fragment obtained from the above ligation mixture was isolated from an agarose gel and purified.
The purified synthetic 326 fragment was added to two additional pairs of synthetic linkers: Pair 1, oligomers 1/2 and Pair 7 aligomers 13/14. In Pair 1 anly oligomer 2 was phosphorylated at the 5' end and in Pair 7 only oligomer 13 was phosphorylated at the 5' end.
After ligation with T4 DNA ligase the mixture without any further isolation was added to pBR322 vector DNA digested with EcoRI and BamHI endonucleases.
The plasmid abtained, designated pFN 932-18 contained the entire synthetic EcoRI (5' end) - Baml3I (3' end) restriction fragment coding for the N-terminal 153 amino acids of human FN, in a pBR322 vector. , E~preasion o~ the N-terminal 153 amino acid sequence of E'N.

WO 91/17765 P~ lf/US91/03584 -1 ~ - ~'A A~ 4-~'f, .z4°i ~.
rt.~ L~ ~~ ~ a w .t Plasmid pFN 932-18 was digested with NdeI and BamHT
endanucleases. The Ndel-BamHI DNA fragment coding for FN
(first 153 amino acids + additional N-terminal methionine) was isolated and ligated into the large fragment obtained by digestion of plasmid pTV301 with NdeI and BglII
endonucleases. (Plasmid pTV301 expresses human growth hormone, hGH, under the control of ~, PL promoter and the cII
RBS).
l0 The plasmid obtained was designated pFN949-2.
F~c.'mre 6. Insertion of termination colon TAA at the 3' end of the N-terminal domain of FN fat amino acid 2621 A synthetic oligonucleotide containing a TAA termination colon and a BglII site having the following sequence:
CTGTTT~GCA

2 0 GACAA.A~TCGTCTAG
was ligated to the 3' end (PvuII site) of an EcoRI-PwII FN
fragment isolated from cDNA plasmid p931-5 (see Figure 6) digested with EcaRI and PvuII. The ligation was carried out in the presence of DNA vector plasmid pBR322 digested with EcoRI and BamFII (large fragment). The plasmid obtained was designated pFN935-12.
k'iaure 7. Co 'so o a co et cs o ,~'~b~,onectin (FN1 and r31 kD FHD in,~ats 125I-FN (0.1 mg/kg; 5 x 106 cpm) or 1251-r31 FBD (0.1 ~ug/kg~
5 x 106 cpm) were injected intravenously and at the time indicated blood samples were withdrawn. Insoluble radioactivity in the blood samples was determined by trichloroacetic acid precipitation; at zero time, the 100%

WO 91117765 PCT/US91/0358d d~~ P~~43~ l l~Ii ~.~

value represents 40,000 cpmfml for FN and 46,000 cpm/ml for FBD.
Fiaure 8. Binding of S.'aureus to Catheters Binding of 3.0 x 106 PFU/ml of lzSI-S. aureus (1 CPM/3 PFU) to "Uno" bronchial plastic catheters (3 cm for each reaction, in duplicate) coated with FN was carried out as described in methods. When competition reactions were per-formed, the bacteria and the added protein were pre-incubated at room temperature for 30 minutes and then added to the catheters for further incubation as described in the methods section.
The polypeptides used in the competition reactions were: P
31 (p31 kD), r-20 (recombinant 20 kD FBD polypeptide fragment) and r-31 (reoxidized and refolded r3lkD). Some of the reactions (see figure) were measured in the presence of 5 uM Heparin (from porcine intestinal mucosa, molecular weight - 10,000; Sigma).
The binding.of the "control" reaction in the absence of com petitors (8.8% of input bacteria) was normalized to 100%.
~'.Zy~e 9. Recombinant polypeptides of fibronectin do-mains compared to fui ~ -l.enc~f ibronectin This figure shows the alignment of cDNA clones encoding 3o various recombinant polypeptides relative to one another and to the full-length sequence of fibranectin cDNA and to a schematic'representation of the various domains present within the human.fibronectin molecule.
,~,~,qq,~re 10.
6- w presses the r12 kD FBD polypeptide WO 91/17765 PCT/US91/035~4 -13- a~,r-,rlT,r,y4 t t~.v ~~:.:~:an B ~, .
The large Bsx~MT-HindIII fragment obtained by digestion of plasmid pFN 975-25 (Figure 10) with BspMI and HindIII was ligated by T4 DNA ligase to the synthetic pair of lizikers A
(see Figure 15). Plasmid pFN 196-2 was produced, transformed into Escherichia coli strain A1645 and retransformed into Escherichia coli strain A4255. Plasmid pFN 196-2 contains the 5'-terminal sequence of fibronectin cDNA from nucleotide 14 to nucleotide 340, i.e., it encodes the first 109 amino acids of the FBD of fibronectin to terminating with an arginine residue. An additional N-terminal methionine is present in the final polypeptide.
Plasmid pFN 196-2 gives good expression of an r12 kD FBD
polypeptide under the control of the ~1 promoter and B-lactamase ribosomal binding site, and has been deposited in the ATCC under Accession No. 68328.
Fic,~ure 11.. Construction of ,plasmid pFN 197-10, which egresses a modified 12 kD FBD ooly~~
( 12 kD'' 1 Plasmid pFN 975-25 was treated as described in Figure to except that a different pair of linkers, B (see Figure 15) was used. The ligation produced plasmid pFN 197-10 which encodes the N-terminal sequence of the FBD of FN; however, a modification after nucleotide 340 to produce an Ndel site (CATATG) befr~re the stop codon results in the encoding of a polypeptide containing 111 amino acids where the first 109 amino acids correspond to those of the r12 kD polypeptide follawed by twa additional amino acid residues, viz.
3o histidine and methionine. An additional N-terminal methionine residue is present in the final polypeptide.
Plasmid pFN 197-10 was transformed into Es ~exi~~ia coli strain A1645 and hence into Escherichia coli strain A4255, and gave good expression of a modified r12 kD (12 kD') FBD
palypeptide under the control of the ~ promoter and the B-lactamase ribosomal binding site.

'W, O 91 / t 7765 PCT/US91 /035&s Fic-rare 12.. Construction of Dlasmid ~FN 202-5 which empresses r12 kD' FBD fused to the r33 kD
cell binding domain (CBD) of fibronectin The large fragment produced after NdeI and HindIII digestion of plasmid pFN 197-10 (Figure 11) was ligated by T4 DNA
ligase to the Nde7C-HindIII CBD (cell binding domain) fragment of plasmid pFN 137-2. Plasmid pFN 137-2, deposited in the ATCC under Accession No. 67910 has been described in l0 the pCT published applicati~~n WO 90/07577; the r33 kD CBD sequence contains amino acids numbered 1329-1722 of fibronectin (see Figure 2j excluding the 90 amino acids numbered 1.600-1689 encoded by the ED-A region (see preface to Brief Description of the Figures).
The resulting plasmid, pFN 202-5, was transformed into Hscherichia coli strain A1645 and thence to Escherichia coli strain A4255. Plasmid pFN 202-5 contains the cDNA sequence of the 111 amino acids encoded by plasmid pFN 197-10 .2 0 f of lowed by the cDNA sequence f or r3 3 kD CBD commencing with the codon for serine. (the first amino acid of the r33 kD
CBD). This plasmid gave good expression of an approximately 45 kD polypeptide comprising the r12 kD fibrin binding domain and the 33 kL) cell binding domain of fibronectin;
:?5 this fused polypeptide was expressed under the control of the ~ promoter and the B-lactamase ribosomal binding site.
Figure 13. Constn~ction of plasmid pFN 195-4 which dresses the r31 kD FBD fused to the :f 0 ~ se a ice DGRGDS
The large fragment obtained by digestion of plasmid pFN 975-with PvuII and HindIII was isolated and ligated with T4 DNA ligase to a pair' of synthetic linkers, C (see Figure a5 15). The resulting plasmid, designated pFN 195-4 was transformed into Escherichia coli strain A1645 and thence to W~ 91/17765 PC.°T/US91/035~4 _15-a'm ~ a.,~ ~e ~~-,.~
R.~ L~ ~l ,.a-s d ~..
~scherichia coli strain A4255. Plasmid pFN 195°-4 contains the full-length FBD cDNA sequence from nucleotide 14 to nucleotide 793 (encoding 260 amino acids) followed by a sequence encoding asp-gly-arg-gly-asp-ser, i.e., the polypeptide encoded has a total of 260 amino acids followed by the sequence DGRGDS. An additional N-terminal methionine residue is present in the final palypeptide. Plasmid pFN
195-4 is a good expressor of the r31 kD fibrin binding domain fused to the sequence asp-gly-arg-gly-asp-ser (DGRGDS), under the control of the ~1 promoter and the 8-lactamase ribosomal binding site. , Figure 14. Construction of plasmid pFN 194-2 which extiresses a fused 31 kD FBD-33 kD C1a_D
polypeptide The large PvuII-HindIII fragment produced by digestion of plasmid pFN 975-25 with PvuII and HindIII was isolated and ligated with T4 DNA ligase to a pair of linkers, D (Figure 15) and then ligated to the cell binding domain (CBD) fragment obtained by digestion of plasmid pFN 137-2 (ATCC
Accession No. 67910) with Ndel and HindIII; see Figure 12 for definition of the CBD domain. The resulting plasmid, designated pFN 194-2, was transformed to Escherichia coli strain A1645 and thence to ~scherichia coli strain A4255.
Plasmid pFN 194-2 is a low expressor of a fused r31 kD FBD-r33 kD CBD polypeptide of approximate molecular weight 64 kD, under the control of the .1 P~ pxomoter and the 9-lacta-mase ribosomal binding site. The polypeptide encoded by plasmid pFN 194-2 contains DNA encoding the first 265 amino acids of fibronectin fused to a methionine colon, followed by the cDNA sequence for the CBD of fibronectin, commencing at the codon fax amino acid serine at position 1 of the CBD.
One skilled in the art knows how to achieve high expression of the polypeptide,expressed by plasmid pFN 194-2. An WO 91/177b5 P't.'T/US91/03584 r. ~ t;, ~n ~> ~~~i d4~tr~.7~.S~a4, 8 example of such a high expressor is plasmid pFN 205--5 described in Figure 25.
Ficrure 15. Oligonucleotide linkers used in construction of~~lasmids Four pairs of chemically synthesized oligomers (A, B, C and D) were prepared and were used.to construct plasmids as described in Figures 10, 11, 13 and 14, respectively).
Ficrure 16. Uptake of labeled- r31 kD FBD by stainless steel coil-induced venous thr~ o The bars and vertical brackets represent the mean ~ SEM
(N=1o) of the specific radioactivity associated with isolated thrombi, vein segments carrying the thrombus ~('°thrombi in-situ'°), or peripheral blood samples 24h after administration of zzST-31 kD FBD. For details, see Example 7, Section A.
Figure 17. Com ari o o abeled 2 D F$D polypeptides in the rat venous t rambus model The bars and vertical brackets represent the mean ~ SEM
(N=5) of the specific radioactivity associated with isolated thrombi (T) or blood (B) 24 hours after administration of the a25T-labeled recombinant polypeptides, as indicated.
For details, see Example 7, Section B.
Fi ~_r~ 1 g , a ' c g b 125 ~, b~
FBD "L~r3 ~atS
Rats were injected intravenously with Z25T-r31 kD FBD (5 x 106 cpm/rat) in a similar experiment to that described in Figure 7. At the time intervals indicated blood samples were removed, placed in sodium citrate_containing tubes WO 91/17765 PCT/US91/035&1 -17_ 7 1 wi , Jut.:~i\.i.:\~ ~
(final sodium-citrate concentration = 0.38%) and resulting blood aliquots were directed as follows: either (a) treated with 20% TCA and the TCA insoluble counts (after TCA
precipitation) were measured; or (b) incubated with preformed clot (using 20 ~1 whole blood from control rat);
binding of the 1251_31 kD FBD to the preformed clot was measured under the conditions of the two-step reaction II
(Example 6). The radioactivity was measured by a gamma counter and the activity of each sample was calculated as a percentage of total cpm present in the reaction mixture.
(Normally TCA precipitation includes placing sample aliquots on filters which are counted for total cpm, washing the filter 3 times with 20% TCA followed by twice with 20%
ethanol to extract the TCA, and recounting filters for TCA
insoluble counts whereby the percentage of TCA-insoluble counts can be calculated.) FiQUre 19. 'ndi o r poly .~e~ptides to the f ibri~ clot This experiment was carried out essentially as de-scribed for the two-step Reaction II (Example 6). 0.15 ACM 125_I of one of the fibrin binding domain polypeptides as indicated below was incubated at 37°C with preformed fibrin clot derived from 20 ~.1 citrated whole blood. The binding was measured in the, presence of 5 mM CaCl2 and 0.02 units/ml transglutaminase. The reaction was terminated, after a 45 minute incubation, by centrifugation; the pellet was washed three times with PBS and the radioactivity was measured in 3 0 a gamma countar .

'6V0 91 i 17765 PCT/US91 /035F'!

1. plasmatic: 31 kD FBD (p31 kD) 2. r12 kD
3. r20 kD

4 , r31 kD (E~atch A) 5. r31 kD (Hutch B) 6. r31 kD (Hutch C) g,iwre 20. COmDa~~son of binding of 125I-- r12 kD to free and frozen fibrin clots l0 This experiment was carried out essentially as described for the two-step Reaction II (Example 6). Preformed fibrin clots derived from 20 ~cl citrated whole human blood were either frozen at -'70°C for 7 days (frozen clots) or used immediately after their formation (fresh clots).
The fibrin clots were incubated with 0.15 uM 125I-r12 kD in the presence or ab~;ence of 0.02 units/ml guinea-pig liver transglutaminase (Sigma). The binding to fibrin clots was measured as described in Example 6.
Figure 21. efoidincx and purification of the r20 kD
~peotide as monitored by elution~rofiles om a Superose 12 column (attached to a FPLCL
Aliquots of 200 ~1 of the r20 kD polypeptide at various stages of the refolding and purification process were injected on top of a Superose~l2 column (attached to a FPLC). The column was equilibrated and eluted with ~a solution of 150 mM NaCl/20 mM Tris HC1, pH 7.8, at a flow rate of 0.8 ml/min. The lower trace is obtained from the FPLC Controller LCC~-500. A. Pellet of r20 kD polypeptide solubilized in 6 M c:,uanidine-HC1 and reduced with 50 mM B-mercaptoethanol; H,. Refolded and air-reoxidized r20 kD
polypepLide; C. Q-Sepharose bound polypeptides, i.e., * Trademark WQ 91/17765 P~f/US91/03584 K'a,r~ ~~.r~ e-t~.~a~.
Pam ~ W :y:e.~

material which was separated from the purified r20 kD; D.
Flow-through from the ,~-Sepharose column; E. Flow-through from the Heparin-Sepharose column, i.e., material which was separated from the purified r20 kD; F. Purified 20 kD
polypeptide (retention time = 18.16 min), eluted from the Heparin-Sepharose calumn with 0.5 M NaCl. Note that there is no peak at this retention time of 18.16 min in Profile A, where the material is in reduced form, nor in Profiles C &
E, which contain incorrectly folded forms of the 20 kD
polygeptide.
Ficxure 22. Refolding and t~urification of the rl2 kD
polypeptide as monitored by elution profiles from a Superose 12 column (attached to a Waters HPLC system) Aliquots of 25-200 ~1 of the rl2 kD polypeptide at various stages of the refolding and purification process were injected on top of a Superose 12 column (attached to a Waters HPLC system). The column was equilibrated and eluted with a solution of 150 mM NaCl/20 mM Tris HC1, pH 7.8, at a flow rate of 0:8 ml/min. A. Pellet of r12 kD polypeptide solubilized in 6 M Guanidine-HC1 and reduced with 50 mt~ B-mercaptoethanol; 13. Refolded and air-reoxidized r12 kD
polypeptide; C. Q-Sepharose bound polypeptides, i.e., material which was separated from the purified rl2 kD; D.
Flow-through frown both the Q- and Heparin-Sepharose columns (in this case, the columns were connected in series and the flow-through from the Q-Sepharose was therefore 3o automatically loaded on the Heparin-sepharose column), i.e., material which was separated from the purified rx2 kD; E.
Purified r12 kD polypeptide (retention tame - 18.83 min), eluted from the Heparin-Sepharose column with 0.5 M NaCl.
Note that there is no peak at this retention time of 18.83 min in Profile A, where the material is in reduced form, nor w0 91/a 7765 PCTIUS91l03584 F~. ~.. ~sm:w ~

in Profiles C & D, which contain incorrectly folded forms of the r12 kD polypeptide.
Figure 23. Construction of Plasmid pFN 208-~.3 Two aliquots of plasmid pFN 975-25 (ATCC No. 67832) were separately digested with Xmnl and Xbal-StyI respectively.
The large fragments were isolated from each digest and mixed together with the synthetic oligomer shown in Figure 8. The l0 mixture was then boiled for 2.5 minutes, cooled gradually for 60 minutes at 30°C, followed by 60 minutes at 4°C, and finally 30 minutes at 0°C. The now reannealed DNA was then filled in by Klenow fragment and ligated with T4 DNA ligase.
The DNA was transformed into .ca i A1645 and transformants were screened for a clone positive for the oligomer. The plasmid from a positive clone was designated pFN 208-13, and deposited in the ATCC in a host .co A4255 as Accession No. 68456. This plasmid expresses an 18.5 kD FBD polypeptide of the amino terminal end of the molecule under control of the ~t PL promotor and the ~-lactamase ribosomal binding site.
~'~c~24. Synthetic Linker Used in Construction of ~lasmid~FN 208-13 This figure shows the synthetic oligome: used in construction of plasmid pFN 208-13 (Figure 23) ,F~~ cue 2 5 . o s t o s The small fragment was isolated from the digestion of plasmid pFN 194-2 (Figure 14) by Xbal-HindIII. The small fragment was isolated from Ndel-HindIII digestion of plasmid pFN 962-3 (disclosed in coassigned patent application PCT/US89/05875 and published as. international publication no. WO/90/07577 on July 12, 1990, Figures 45-49 and the WO 91117765 PCT/tJS91/U3584 ~~, 1 11 ,n i-lv.~) ~.
gf. ~ ~o ~.J e.~ :a'~
description of the figures). These two fragments were then ligated with the large fragment isolated from the NdeI-HindIII digest of plasmid pMLK-100 (ATCC Accession No.
68605). The resulting plasmid designated 205-5 is a high expressor of a 64 kD polypeptide containing the 31 kD FBD
fused to the 33 kD CBD under control of the ~1PL promotor, CII ribosomal binding site and containing the trp transcription terminator designated "ter" immediately downstream of the structural gene. This polypeptide has been purified and refolded essentially as described for a 31 kD FBD polypeptide disclosed in the above-referenced PCT
publication.
Ficxure 26. Construction of Plasmid pFN 201-3 The large fragment was isolated from the HindIII-StyI digest of plasmid pFN 949-2 (ATCC Accession No. 67831), and ligated with the small fragment isolated from the HindIII-StyI
digest of plasmid pFN 196-2 (ATGC Accession No. 68328). The resulting plasmid designated pFN 201-3 expresses the 12 kD
FBD polypeptide under control of the ~1PL promotor and CII
ribosomal binding site.
Figure 27. Construction of Plasmid pFN 203-2 The large fragment was isolated from the Ndel-HindIII digest of plasmid pMLK-100 (deposited in .co 4300 under ATCC
Accession No. 68605) and ligated with the small fragment isolated from the Ndel-HindIII digest of plasmid pFN 201-3.
The resulting plasmid designated pFN 203-2 which expresses the 12 kD FBD palypeptide under control of the ~ P~
promotor, Cx~ ribosomal binding site and trp transcription termination sequence designated "ter" was deposited in ATCC
in E.coli A4255 under ATCC Accession No. 68606. Plasmid pFN
203-2 is also known as pFN 203-2-3.

WO 91/17765 PCT/US91l03584 itvl~~4J'i4.) 8 F~,rnare 28. Bindincx of FBD Polyoex~tide Fracrments to_ Vascular Components This figure shows the low degree of binding of the Z2 kD
polypeptide to vascular components such as endothelial cells, extracellular matrix, and immobilized fibronectin by comparison with the 31 kD as described in Example 9. The binding of the 12 kD was increased but still remained relatively low in comparison to the 31 kD even with the 20 addition of exogenous transglutaminase.
Ficrure 29. Effect of Various FBD Polype~tide Fracnnents on the Binding of S.aureus to Endothelia Cells tEC) Preparation of labelled S. aureus and the endothelial cell (EC) binding assay are described in Example 9. The inhibitory effect of plasmatic and recombinant 31 kD, recombinant 18.5 kD, and recombinant 12 kD on binding of Sy.
auxeus to EC were tested.
This figure shows the dose effect of different FaD
polypeptides on binding of S. aureus to endothelial cells at 4°C in the presence or absence of fetal calf serum (FCS).
(Previous experiments showed a dramatic increase of 2-3 fold in binding of S a aureus to EC in the presence of FCS at 37°C, but only a slight increase at 4°C. The increase is probably due to the presence of plasma fibronectin in FCS.) In the present experiment performed at 4°C, there is no significant effect of added FCS on the binding. Hoth the plasmatic and recombinant 31 kD show a strong dose dependent inhibition of binding, while the recombinant 18.5 kD and l2 kD polypeptide fragments caused virtually no inhibition of binding indicating they have little or no S.aur~us binding affinity.

WO 91l177u5 PC1'/U591/03584 23 ~,_~a.,°,~~'~''~'~~.
~~,ai.SL-iGt) B
Ficrure 30. Bindincr of Different- fHD Polype_ptide Frarnnents to Preformed Fibrin Clot_ (Reaction II) This figure shows the specificity of different FBD
polypeptides to a preformed fibrin clot as described in Example 9. The FBD polypeptides tested were the 31 kD, 20 kD, 18.5 kD and 12 kD. Additionally, a 45 kD fusion polypeptide of the 12 kD FBD fragment fused to the 33 kD CBD
(Example 40) was tested. A 33 kD CBD polypeptide (coassigned PCT Publication No. WO/90/07577, pages 62-64) was included as a control. All of the FBD golypeptides tested, including the 45 kD fusion polypeptide, bound to a preformed fibrin clot in similar proportions (25-38% bound) .
The 33 kD CHD alone bound to the clot in a small proportion anly. The transglutaminase inhibitor iodoacetate (2AC) inhibited binding by 50-75% indicating that transglutaminase is an active component of the binding reaction. The binding of the 33 kD CBD polypeptide was not appreciably affected by iodoacetate indicating that it binds by a different mechanism.
Figure 31. In vivo thrombi labeling using the 12 kD and 18.5 kD FBD polypeptide fragments is described in Example 13. The figure shows the results as specific radioactivity of thrombus (hatched bars) and blood (open bars) of stainless-steel coil-bearing rats, 24h after intravenous administration of zlzln-labelled recombinant FBD proteins.
The bars and vertical brackets represent the means and SEM
of cpm/g wet weight, respectively. The thrombus: blood ratios are shown in Figure 32.
~'igvre 32. Thrombus to blood ratios of specific radioactivity 24h after administration of lllln-labelled 12 kD-», 18.5 kD-- and 31 kD-FBD in the rat coil model described in Fig. 31.

WC) 91~y77s5 P~T/U591103584 r ,..,, . . Fy,.~1 f.,. n ~,., ..:: :.9:'_~ t _F~,c~ure 33. Lineweaver-Burke plats for human Glu-Plasminogen activation kinetics, at pH 7.4 and 37°C, using either SK or the FBD-SK complex as activators. Zn a 200 ~,1 volume, in 96-well plates, the plasminogen substrate concentration varied between 0.9x10-~ and 2.7x10-6M. The S-2251 substrate (H-D-Val-Leu-Lys-pNA) final concentration was,5x10-4M and the final activator concentration was 2x10'9M. The rate of reaction, v, represents the change in absorbents at 405nm, DA (absorbents units), per time dt (min).
FiQUre 34. Fibrin-agar plates were prepared by mixing 5 ml (2mg/ml) fibrinogen, 5 ml (0.4%) Noble-agar, 0.5 ml (1M) CaCl2 and 0.5 ml (l0u/ml) thrombin, all in imidazole-buffered saline pH 7.4. After polymerization small wells were made using Pasteur pipettes and vacuum, into which aliquots of SK ar FBD-SK complex, at concentrations between 102-104ng/ml, were added. After incubation at.37°C overnight the lysis zone was measured.
Ficture 35. Gu~,nea Pia Transglutaminase Cata,~yzed Incorporation of [Z4C1, Putrescine into FBD or the FBD-SK Complex__ Assays were performed up to 3o min at room temperature with 6 ACM FBD SK, or FBD-SK complex, 0.05u/ml transglutaminase, 6 ~rM[14C] putrescine, 6 ~,M cold putrescine, 5o mM Tris HCl pH 7.5 and 10 mM CaCl2. Controls with 20 mM EDTA (dotted lane) or 5 mM DTT (dashed line) were also included. (4) SK, (~l) FBD, (D) FBD-SK complex.

bV0 91/17765 PCT/US91/03584 ,t,~ ~ ~.D i ~ 4 Deta~.lec~ D~sorintion of the Ta~reation The plasmids pFN 975-25, pFN 949-2, pFN 137-2, and pFN 196-2 were deposited pursuant ta, and in satisfaction of, the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852 under ATCC Accession Nos. 67832, 67831, 67910 and 68328, respectively. Similarly, many of the other ATGC
deposits referred to in the subject application were also deposited pursuant to, and in satisfaction of, the requirements of the Budapest Treaty.
The primary sequence of human fibronectin has been shown to be organized in three types of homologous repeats, Types I, II, and III. The fibrin-binding domain (FBD), comprised of 259 amino acids with an apparent molecular weight of 31 kD, is made up of five Type I repeats ( ~~ fingers ~~ ) , each about 4 5 amino acids long with two disulfide bonds, connected to two stretches of about 20 amino acids each at both the N-and C-terminal ends of the protein.
An overall schematic view of the structure of the domains of fibronectin and the recombinant molecules constructed is shown in Figure 1.
The recombinant fibrin binding domain (FBD) polypeptides claimed herein aomp~ise polypeptide fragments of the fibrin binding domain (r20 kD, r18.5 kD and r12 kD polypeptides).
These polypeptides are smaller than the 31 kD polypeptide and comprise part of the sequence of the fibrin binding domain. Many other polypeptides of the fibrin binding domain may be expressed by additional plasmids constructed, using methods known in the art, from plasmids described in this application and these polypeptides may be refolded, ~6'O 91!17765 PCT/US91/03584 P4.,~:r..:5;.r':E~ 9P
reoxidized, and purified using methods described in this application.
The full length recombinant fibrin binding domain (the r31 kD polypeptide) described in this application comprises the first 262 amino acids of fibronectin with the sequence arg-ala-ale-val at the carboxy-terminus. An additional methionine residue is present at the amino terminus of all the final polypeptides and polypeptide fragments of the FBD.
The plasmatic fibrin binding domain derived by tryptic digestion of plasma fibronectin comprises the first 259 amino acids of fibronectin, i.e. with arginine at the carboxy-terminus and the first encoded amino acid, glutamine, converted to a pyroglutamate residue.
The r31 kD polypeptide has five of the Type I homology loops or fingers discussed above (i.e. 10 disulfide bonds) , the r20'kD polypeptide and r18.5 kD polypeptide both have three loops (i.e. 6 disulfide bonds), and the rl2 kD polypeptide has two loops (i.e. 4 disulfide bonds) . The presence of these disulfide bonds explains the necessity and also the difficulty of the refolding/reoxidation proo~~dure developed to obtain and purify correctly folded FBD polypeptides which have the correct disulfide bonds. The correctly folded FBD
polypeptides are biologically active, i.e. they can bind to fibrin; additionally, the r31 kD polypeptide can bind to stap~~lococcus aureus.
The recombinant FBD polypeptides are produced in inclusion bodies which are obtained in the pellet produced after disruption of the cell cake.
This invention discloses the production of recombinant polypeptide fragments of the fibronectin fibrin binding domain (FBD) for use in thrombus imaging and prevention of WO 91f17765 PCTlUS91/035~4 ,Y~, ',1f,1'f?9~)w~. . .
~tl~d Lys.DSW1 thrombus formation. These polypeptides may also be bound to a thrombolytic agent for targeting the agent to a thrombus.
The recombinant cells which produce the polypept.ide fragments of the FBD can be any cells in which a DNA
sequence encoding an FBD polypeptide fragment has been introduced by recombinant DNA techniques. The cell must be capable of expressing the DNA sequence and producing the polypeptide product. The cell may be a mammalian cell, a l0 fungal cell such as a yeast cell, or a bacterial cell.
The bacterial cell can be any strain including auxotrophic, prototrophic and lytic strains, F+ and F° strains, strains harboring the cI857 repressor sequence of the :t prophage and strains deleted for the deo repressors or the eo gene.
Examples of wild type Escherichia c~li strains are protatroph ATCC No. 12435, and auxotroph MC1061 (ATCC
Accession No: 67361).
Examples of ~scher~,h~a calf, strains which harbor the cI857 repressor sequence are the auxotrophs A1645 harboring plasmid pTVR 279-8 (ATCC No. 53216), A1637 harboring plasmid pTV 104(2) (ATCC No. 39384), and A2097 harboring plasmid pSODa2 (ATCC No. 39786), and the prototrophs A4255 harboring plasmid pFN 975-25 (ATCC No. 67832) and biotin-independent A4346 harboring plasmid pHG44 (ATCC No. 53218).
An example of a lytic Escherichi~, ~ strain is A4048 which harbors plasmid pHG44 (ATCC No. 53217).
Examples of F° strains are Escherichia coli S~930 (F°) harboring plasmid pMF 5534 deposited under ATCC No. 67703 and ~';~~h,p~; ~"of W31100 (F°) harboring plasmid pMFS 929 deposited under ATCC Na. 67705.

wo gm77~s Pcrr~us9oa~ssa ~28~
Pw ~ . ' . ~ ;i .!
Examples of Escherichia coli strains deleted for the eo gene or deo repressors are S~p732 harboring plasmid pMF 2005 (ATCC No. 67362), S~p540 harboring plasmid pJBF 5401 (ATCC
No. 67359), and 5930 harboring plasmid pEFF 920 (ATCC No.
67706) (see European Patent Application Publication No.
0303972, published February 22, 1989).
The plasmids of this invention may be introduced into suitable bacterial host cells, preferably Escherichia coli.
An example of a suitable Escherichia coli cell is strain A4255 (F+) [ATCC Accession No. 67832), but other Escherichia coli strains and other bacteria can also be used as host cells for the plasmids. Such bacteria include Pseudomonas aerucrinosa and Bacillus subtilis.
All of the Escherichia co~i host strains described above can be °cured°' of the plasmids they harbor by methods well known in the art, e.g, the ethidium bromide methods described by R.P. Novick in Bacteriol. Rev. ~: 210 (1969).
The bacterial cell may contain the FBD sequence encoding the FBD polypeptide in the body of a vector DNA molecule such as a plasmid. The vector or plasmid is constructed by recombinant DNA techniques so that the sequence encoding the FBD polypeptide is incorporated at a suitable gosition in the molecule.
Plasmids used for production of the FBD polypeptides can harbor a variety of promoters such as the ~, promoter or the eo promoters.
Among the plasmids which may be used for production of FBD
polypeptides are the following:

a) Plasmid pFN 975-25 which expresses the r31 kD FBD and which has been deposited in Escherichia co~i strain A4255 in the ATCC under Accession No. 67832;
b) Plasmid pFN 949-2 which expresses the r20 kD FBD and which has been deposited in Escherichia coli strain A4255 in the ATCC under Accession No. 67831;
c) Plasmid pFN 196-2 which expresses the r12 kD FBD and which has been deposited in ~scherichia call strain A4255 in the ATCC under Accession No. 68328;
d) Plasmid pFN 197-10 which expresses a modified 12 kD FBD
polypeptide, and which has been described in Figure 11 of this application;
e) Plas~nid pFN 195-4 which expresses the r31 kD
polypeptide fused to the sequence DGRGDB, and which, has been described in Figure 13 of this application;
f) Flasmid pFN 201-3 which expresses a 12 kD FBD
polypeptide fragment under control of APL and the CII
rbs, and which has ben described in Figure 26 of this application.
g) Plasn~id pFN 203-2 which expresses a 12 kD FBD
polypeptide fragiuent under control of ,~F~ and the CIz rbs, and 'additionally contains a transcription terminator designated ~~ter,~~ and which has been described in Figure 27 of this application and which has been deposited in ~sg,~,"re~ ~~chi a cold A4255 in ATCC
under Accession No. 68606.
lx) Plasmid pFN 205-5 which expresses a 64 kD polypeptide comprising a 31 kD full-length FBD polypeptide fused to a 33 kD fragment of the fibranectin cell-binding domain WO 91117765 PCT/U~91/03584 (CHD) and which has been described in Figure 25 of this application.
i) Plasmid pFN 208-13 which expresses an 18.5 kD FHD
5 polypeptide fragment which has been described in Figure 23 of this application and has been deposited in Escherichia coli A4255 in ATCC under Accession No.
68456.
10 j) Any plasmid, derived from the above plasmids, containing FBD sequences encoded by the above plasmids;
and k) Any plasmid which contains FBD sequences encoded by the 15 above plasmids.
The subject invention provides an imaging agent which comprises a polypeptide labeled with an imageable marker, such polypeptide having an amino acid sequence substantially 20 present in the fibrin binding domain of naturally-accurring human fibroneotin and being capable of binding to fibrin.
Also provided is a composition comprising an effective imaging amount of such an imaging agent and a physiologically acceptable carrier.
The polypeptides which are labeled with an imageable marker may be polypeptide fragments of the.fibrin binding domain of human fibronectin; they may be produced using recombinant DNA techniques; or encoded by genes synthesized in a DNA
synthesizer. Applicants have provided three examples of such polypeptides, with the preferred embodiments being the 18.5 kD and 12 kD polypeptides. As would be understood by one skilled in the art, the terms "having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin" encompasses, i.e., naturally-occurring allelic variations and recombinant WD 91/17765 PCd'/iJ591/03584 -31- , e~~~.~~'~~.
variations, such as site-directed mutagenesis. These are all encompassed by applicants' "polypeptide," the only limitation being the ability to bind to fibrin.
The imageable marker used is a matter of choice to one skilled in the art. It is preferred that the marker be a radioactive isotope, an element which is~ opaque to X-rays, or a paramagnetic ion.
Radioactive isotopes are commonly used in medicine and are well known to those skilled in the art. It is presently preferred that the marker be indium-111, technetium-99m, iodine-123, iodine-125, iodine-131, krypton-81m, xenon-133, or gallium-67, or mixtures thereof. Most preferably, the .marker is technetium-99m or indium-111.
The detectable marker may also be a paramagnetic ion.
Paramagnetic ions are also commonly used in medicine.
Examples of such markers include chelated metal ions of chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), praseodymium (III), neodymium (III), samarium (III), gadolinium (III), terbium (xIZ); dysprosium (III), holmium (III), erbium (III), ytterbium (III), or mixtures thereof.
preferably, the imaging agent comprises a 20 kD palypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibranectin and having 'the amino acid sec~uenae of amino acids 1-153 as Shawn in Figure 2 and about 20 additional amino acids; or an 18.5 kD
palypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin and having the amino acid sequence of amino acids 1-154 as shown in Figure 2; or a 12 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human 'fibronectin and having the amino acid sequence of amino WO 91/177b5 1'CT'/US91/U35R4 ,.

acids Z-109 as shown in Figure 2. By means of partial amino acid sequence analysis we have shown that the 12 kD and 20 kD as well as the previously disclosed 31 kD polypeptides all contain an additional N-terminal methionine. Since all the polypeptide fragments of the FBD have identical N
terminal sequences it may be assumed that the 18.5 kD, 45 kD
and 64,kD polypeptides also have the additional N-terminal methionine. However, the invention claimed herein also includes the palypeptides without the additional N-terminal l0 methionine.
The subject invention also provides a method for imaging a fibrin-containing substance, i.e. a thrombus or atherosclerotic plaque, which comprises contacting the fibrin-containing substance to be imaged with the agent as disclosed above under conditions such that the agent binds to the fibrin-containing substance and imaging bound agent and thereby imaging the fibrin-containing substance.
Further provided is a method far imaging a fibrin-containing substance in a subject which comprises:
(a) administering to the subject a composition of the agent as disclosed above under conditions permitting the imaging agent therein to~enter the blood stream and bind to fibrin present in the blood vessels;
(b) imaging bound agent within the blood vessels; and thereby (c) imaging the fibrin-containing substance.
Preferably, the polypeptide of the reagent used in the above methods far imaging a fibrin-containing substance is a 20 kD
polypeptide corresponding to an amino acid sequence present WO 91/1776 PCf/US91/U3584 _33-in the fibrin binding domain of human fibronectin and having the amino acid sequence of amino acids 1-153 as shown in Figure 2; the 20 kD polypeptide comprising less than about 20 additional amino acids; an 18.5 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin and having the amino acid sequence of amino acids 1-15~ as shown in Figure 2 ; or a 12 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin and having the amino acid sequence of amino acids 1-109 as shown in Figure 2.
Preferred markers used in the above methods for imaging a fibrin-containing substance are radioactive isotopes, elements which are opaque to X-rays, or paramagnetic ions.
Most preferred markers are radioactive isotopes, such as indium-111, technetium-99m, iodine-123, iodine-125, iodine-131, krypton-81m, xenon-133, and gallium-67.
Imaging may be done through any of the methods known to one skilled in the art. These methods include but are not limited to X-ray, CAT scan, PET scan, NMRI, and fluoroscopy.
Preferably, the imaging of the fibrin-containing substance by the above methods is carried out using a gamma camera.
Further provided is a plasmid for expression of a polypeptide having an amino acid sequence substantially present~in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin 3a comprising DNA encoding the polypeptide and DNA encoding suitable regulatory elements pasitioned relative to the DNA
encoding the polypeptide so as to effect expression of the polypeptide in a saitable host cell.
Applicants have provided three examples of polypeptide fragments of the fibrin binding domain of fibronectin.

13'O 91/17765 PCT/US91/035$4 _34_ ~~~ i~:'~~.
These include the r20 kD, r18.5 kD and r12 kD polypeptides.
These polypep,tides exhibit the binding and adhesive proper-ties of portions of naturally-occurring human fibronectin.
The scope of the claims of the subject application are not intended to be limited to these three FBD polypeptide fragments, which are examples of preferred embodiments only.
In preferred embodiments, the polypeptide is about a 20 kD
polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin; about an 18.5 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin;
or about a 12 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin.
In more preferred embodiments, the polypeptide is an 18.5 kD
polypeptide corresponding to an amino acid sequence present in the fibrin binding domain and having tha amino acid sequence of amino acids 1-154 as shown in Figure 2, a 20 kD
polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin and having the azaino acid sequence of amino acids 1-153 as shown in Figure 2; the 20 kD polypeptide comprising less than about 20 additional amino acids; or a 12 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibrnnectin and having the amino acid sequence of amino acids 1-109 as shown in Figure 2. As noted above, the polypeptides also may have the additianal N-terminal methionine. Hawevsr, the invention claimed herein also includes the polypeptides without the additional N-terminal methionine.
Naturally-occurring human fibronectin is as it occurs in the human body (in plasma).

~~ysrw~~.
As used throughout this application, a substantial portion is at least one fifth (1/5). A polypeptide which has the biological activity of the fibrin binding domain of naturally-occurring human fibronectin exhibits binding or adhesive properties similar to those of the fibrin binding domain of naturally-occurring human fibronectin when the level of such activity is assayed or determined.
In this invention, the amino acid seduence of the various functional domains are determined by cleavage of the cDNA
which encodes the domains with restriction enzymes, and do not necessarily correspond to the amino acid sequence of the domains as obtained and defined by proteolytic digestion of fibronectin.
The plasmid of this invention further comprises suitable regulatory elements positioned relative to the DNA encoding the polypeptide so as to effect expression of the polypeptide in a suitable host cell, such as promoters and operators, e.g. ~, PLOL, ribosomal binding sites, e.g. CII, and repressors. Other suitable regulatory elements include, for example, the lac, trp, tac, lpp and die promoters (European Patent Application Publication No. 0303972, published February 22, 1989).
The suitable regulatory elements are positioned relative to the DNA encoding the polypeptide so as to effect expression of the polypeptide in a suitable bacterial host cell. 7Cn preferred e~bodiments of the inventian, the regulatory elements are positioned close to and upstream of the DNA
encoding the polypeptide.
Further provided is a plasmid designated pFN 949-2 and deposited in ~scherichia coli strain A1645 under ATCC
Accession No. 67831. Plasmid pFN 949-2 encodes a 20 kD
polypeptide fragment of the fibrin binding domain of human WC) 91/17765 PCT/US97/03584 .:, , o~ ~~ ~.a ~:bnn~~~.
fibronectin comprising amino acids 1-153 of Figure 2 with an additional N-terminal methionine, and less than 20 additional amino acids.
Also provided is a plasmid designated pFN 196--2 and deposited in Bscherichia coli strain A4255 under ATCC
Accession No. 68328. Plasmid pFN 196-2 encodes a 12 kD
polypeptide fragment of the fibrin binding domain of human fibronectin comprising amino acids 1-109.
Also provided is a plasmid designated pFN 208-13 deposited in Escherichia coli A4255 under ATCC Accession No. 68456.
Plasmid pFN 208-13 encodes an 18.5 kD polypeptide fragment of the fibrin binding domain of human fibronectin comprising amino acids 1-154 of Figure 2 and may be assumed to have an additional N-terminal methionine as described above,.
Also provided is a plasmid designated pFN 203-2 deposited in Fscherichia coli A4255 under ATCC Accession No. 68606.
Plasmid pFN 203--2 expresses a 12 kD polypeptide fragment of the fibrin-binding domain of human fibronectin comprising amino acids 1-109 of Figure 2 with an additional N-terminal methionine.
Also provided is a plasmid designated pFN 205-5 which expresses a 64 kD polypeptide comprising a ~31 kD full-length FBD polypeptide fused to a 33 kD fragment of the fibronectin CBD (described in Figure 25).
As discussed abo~re, it may be assumed that all of the polypeptides produced by the plasmids of this invention contain an additional N-terminal methionine.
In presently preferred embodiments, the invention provides an ~sch~ atria coli cell containing the plasmid designated pFN 975-25 and wherein the cell is deposited under ATCC

W~O 91/17765 PC.'T/U~91/03584 . ., ". - : , Accession No. 67832; an ~s_c_hex~i.chia coli cell containing the plasmid designated pFN 949-2 and wherein the cell is deposited under ATCC Accession No. 67831; and an ~'.scherichia cali cell containing the plasmid designated pFN 196-2 and wherein the cell is deposited under ATCC Accession No.
68328; an ~scherichia coli cell containing the plasmid designated pFN 203-2 and wherein the cell is deposited under ATCC Accession No. 68606; and an Escher~~,~,ia coli cell containing the plasmid designated pFN 208-13 and wherein the cell is deposited under ATCC Accession No. 68456.
The invention provides a method of producing a polypeptide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin which comprises treating a cell containing a plasmid comprising DNA encoding the polypeptide so that the DNA directs expression of the polypeptide and recovering Pram the cell the polypeptide so expressed.
Preferably, the polypeptide so produced is an 18.5 kD, 20 kD, ox 12 kD polypeptide fragment of the fibrin binding domain.
Further provided is a purified polypeptide substantially free of other substances of human origin which has an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin.
Preferably, the polypeptide is a 20 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin and having the amino acid sequence of amino acids 1-153 as shown in Figure 2; the 20 kD polypeptide comprising less than about 20 additional amino acids; or an 18.5 kD polypeptide W~ 91/17765 PCT/US91/03584 _38_ corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin and having the amino acid sequence of amino acids 1-154 as shown in Figure 2; or a 12 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibranectin and having the amino acid sequence of amino acids 1-109 as shown in Figure 2. As noted above, the polypeptides also may have the additional i~-terminal methionine. However, the invention claimed herein also l0 includes the polypeptides without the additional N-terminal methionine. - .
These shorter FBD polypeptide fragments, i.e. 20 kD, 18.5 kD, and 12 kD are advantageous over the 31 kD FBD
polypeptide. They are easier to refold, lack the bacterial binding domain, and have a much reduced binding specificity for other vascular components such as endothelial cells, extracellular matrix and fibronectin by comparison to the 31 kD polypeptide, while maintaining a fibrin-binding activity similar to that of the 31 kD polypeptide.
The invention further provides such a purified polypeptide substantially free of other substances of human origin fused to a second polypeptide, the second polypeptide comprising a substantial portion of the amino acid sequence of the cell binding domain. of naturally-occurring human fibronectin.
Preferably, the fused polypeptide is a 45 kD fused polypeptide, wherein the purified palypeptide is a 12 kD
polypeptide and the second polypeptida which comprises a substantial portion of thc~ cell binding domain of naturally-occurring human fibronectin is a 33 kD polypeptide. The fused polypeptide may also comprise a 31 kD ,purified polypeptide and a second polypeptide which contains the amino acid sequence DGRGDS. Another preferred fused polypep-tide is a 64 kD fused polypeptide, wherein the purified WO 91/17765 PCI'/US91/0358d palypeptide is a 31 kD polypeptide and the second polypeptide which comprises a substantial portion of the cell binding domain of naturally-occurring human fibronectin is a 33 kD polypeptide.
The invention also provides a plasmid for expression of the 45 kD fused polypeptide, disclosed above, designated pFN
202-5; a plasmid for expression of the 31 kD/GRGDS fused polypeptide, disclosed above, designated pFN 195-4; and a plasmid for expression of the 64 kD fused polypeptide, disclosed above, designated.pFN 194-2.
As used throughout the subject application, "fused" or "bound" encompasses polypeptides bound covalently, non-covalently, or conjugated. The polypeptides may be conju-gated through other chemical moities including amino acid or polypeptide cross-linkers, which are standardly used in the art and are well-known to those skilled in the art to which the subject invention pertains.
ZO
Numerous methods are known in the art for detection of thrombi, such as radioactive labeling (nuclear medicine use of isotopes), radio-opaque labeling (such as CAT scan), and Magnetic Resonance Imaging (MRI). Any of these labeling methods can be used in the method of the subject invention for detesting the thrombus. In each of these detection methods the polypeptide is used as a diagnostic agent for detecting the thrombus.
Alsa provided is a method of refolding and reoxidizing a polypeptide having an amino acid sequenc4 substantially present in the fibrin binding domain of naturally-occurring human fibronectin but lacking the disulfide bonds of naturally-occurring human fibronectin and being capable of binding to fibrin which comprises contacting the polypeptide with a thiol-containing compound in the presence or absence -40_ r 1 ~.r> v;W .9 ~~~~~~~ r ~.of a disulfide so as to refold and reoxidize the polypep-tide.
Preferably, the thiol-containing compound is selected from the group consisting of glutathione, thioredoxin, B-mercaptoethanol, and cysteine.
Preferably, the thiol-containing compound is B-mercapto ethanol and the disulfide is produced in situ by introduction of air.
Preferably, the polypeptide is selected from the group con-sisting of an 18.5 kD polypeptide, a 20 kD polypeptide, a 12 kD polypeptide and a 45 kD polypeptide. The 45 kD chimera polypeptide consisting of the 12 kD FBD fused to the 33 kD
CBD has been refolded and reoxidized using exactly the same method as the smaller FBD polypeptides.
The method of refolding and reoxidizing may additionally comprise contacting the polypeptide with a denaturant.
Preferred denaturants are guanidine hydrochloride and urea.
Preferably, the polypeptide is at a low concentration, such as below 1, 000 ~sg/ml.
The subject invention also provides a method for recovering a purified biologically active polypeptide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin which comprises:
(aj producing in a bacterial cell by means of expression of a plasmid containing DNA encoding the palypeptide a first polypeptide having the amino acid sequence of the polypeptide but lacking the disulfide bond;

WO 91/17765 p~I'/US91/03584 -, ~-n ra w (b) disrupting the cell so as to produce a lysate containing the first polypeptide;
(c) centrifuging the lysate so as to concentrate the first polypeptide;
(d) separating the concentrated first polypeptide;
(e) solubilizing the separated, concentrated ZO first polypeptide;
(f) refolding and reoxidizing the solubilized first polypeptide so as to form the biologically active polypeptide;
(g) separating the refolded and reoxidized biologically active polypeptide;
(h) recovering the purified, refolded and reoxidized biologically active polypeptide; and (i), purifyi.ng the biologically active polypeptide so recovered. ' Preferably, the refolding and reoxidizing comprises contacting the polypeptide w~,th a thiol-containing compound in the presence ox absence of a disulfide so as to refold and reoxidize the polypeptide. Preferably, the thiol-containing compound is selected from the group consisting of glutathione, thioredoxin, 6-mercaptoethanol, and cysteine.
In one preferred embodiment, the thiol-containing compound is B~mercaptaethanol and the disulfide is produced ' si a by intraduction of air.

Vd~ 91/17765 1'CT/US91/03584 ~~~a.~~~ df~.
Preferably, the polypeptide is selected from the group con-sisting of an 18.5 kD polypeptide, a 20 kD polypeptide, a 12 kD polypeptide and a 45 kD polypeptide. As noted above, the 45 kD chimera polypeptide consisting of the 12 kD FBD fused to the 33 kD CBD has been refolded and reoxidized using exactly the same method as the smaller FBD polypeptides.
The method may additionally comprise contacting the polypeptide with a denaturant, such as guanidine hydro l0 chloride or urea.
Preferably, the polypeptide is at a law concentration, such as below 1,000 ~g/ml.
Preferably, the separating of the concentrated polypeptide in step (c) comprises chromatography, preferably Heparin-Sepharose chromatography.
The subject invention also provides a method of inhibiting thrombus formation in a subject susceptible to thrombus formation which comprises administering to the subject an amount of a polypeptide (selected from the polypeptides and fused polypeptides disclosed above) effective to inhibit thrombus formation. The polypeptide may be reduced or alternatively the S-H groups may be blocked (e.g. by carboxymethylation or carboxamidomethylation to prevent reoxidation).
The subject invention also provides a polypeptide as disclosed above bound to a thrambalytic agent for the 'targeting of thrombolytic agents. The thrombolytic agents may be selected from tissue plasminogen activator (TPA), urokinase, streptokinase, prourokinase, Anisoylated Plasminogen-Streptokinase Activator Complex (EminaseTM), TPA
analogs, ar a protease.

WO 91/17765 PCf/US91/03584 In one embodiment of the invention, the polypeptide has an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin, is capable of binding to fibrin, has a molecular weight above about 6 kD but less than about 20 kD, has the amino acid sequence gln-ala-gln-gln or met-gln-ala-gln-gln at the N-terminus of the polypegtide and wherein the thrombolytic agent is streptokinase.
In a preferred embodiment, the polypeptide is a 12 kD
polypeptide and the thrombolytic agent is streptokinase.
Further provided is a method for achieving thrombolysis of a thrombus which comprises administering to a subject an amount of the polypeptide bound to a ~thrombolytic agent effective to achieve thrombolysis.
The inventian also provides a method of treating a subject with a wound which comprises administering to the subject an amount of a purified polypeptide, which is substantially free of other substances of human origin which has an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin arid is capable of binding to fibrin, in conjunction with a polypeptide which comprises a substantial portion of the cell binding domain of naturally-occurring human fibronectin effective to treat the wound. Tn one embodiment of the method, the cell binding domain polypeptide is a 40 kD
polypeptide or a 33 kD polypeptide.
Further provided is a method of treating a subject with a wound which comprises administering to the subject an amount of the fused polypeptide of a purified polypeptide, which is substantially free of other substances of human arigin which has an amino acid sequence substantially present in the WO 91/17765 PCT/~S91/03584 "~.~ ~r, oor i4~ ~ ...~~:b ~.~ ~P ~.
fibrin binding domain of naturally-occurring human fibronectin and which is capable of binding to fibrin, fused to a second palypeptide which comprises a substantial portion of the amino acid sequence of the cell binding domain of naturally-occurring human fibronectin effective to treat the subject. In one embodiment of the method, the fused polypeptide may be a 45 kD polypeptide, wherein the polypeptide is a 12 kD polypeptide and the second polypeptide is a 33 kD polypeptide. In another embodiment, the fused palypeptide may be a 64 kD fused polypeptide, wherein the polypeptide is a 31 kD polypeptide and the second palypeptide is a 33 kD polypeptide.
The wound treated by the methods of the invention may be a cutaneous wound, such as an incisional wound, a skin deficit wound, a skin graft wound, or a burn wound. The wound may also be an eye wound, wherein the eye wound is a corneal epithelial would or a corneal stromal wound. Furthermore, the the wound may be a tendon injury.

ar~~.s~~,bn~~n di~.. ,_ EXAP~IPLES
All the references to map positions correspond to the identically numbered positions along the nucleotide sequence of human fibronectin cDNA shown in Figure 2 (see also Figure 3 of Baralle, F.E., European Patent Publication No. 207,751, published January 7, 1987).
This patent application is directed to polypeptide fragments of the N-terminus fibrin binding domain (FBD). Experimental results with the 31 kD polypeptide are presented for purposes of comparison with the shorter fragments. Some of 'the proteins described are fusion proteins comprising an FBD
fragment j pined at its C-terminus to the N-terminus of a fragment of the cell binding domain (CBD).
The cDNA sequence corresponding to the CBD which applicants have cloned and expressed is missing the 270 by extra domain (ED} segment which extends from nucleotides 4811 to 5080, inclusive, on the Baralle map (see Figure 2}. Thus, the cDNA sequence which is said to extend from nucleotide 3x17 to 5566 on the Baralle map, contains only 1980 nucleotides, because it is missing the 270 nucleotides of the ED segment, namely from nucleotides 4811 to 5080 inclusive; this region is also known in the art as the ED-A region. Because nucleotide 5081 is changed from G to A, amino acid 1690 is changed from alanine to threonine. Similarly, the polypeptide expressed by that DNA fragment would encode from.
amino acid 1102 to amino acid 1851 on the Baralle map but would be missing the 90 amino acids encoded by the ED
region, namely amino acids 1600-1689 inclusive, and thus it would contain only 660 amino acids. Thi6 is true for all CBD fragments described in this application which span the ED region. (The region known in the art as the ED-B region is missing bath in Baralle°s sequence and in applicants°
cDNA.) WO 91/17765 PC.TlUS911035~t ''~~; ~saa r-~49~ ~-' The EcoRI cleavage site shown at position 3317 was constructed by applicants during the cloning procedure by use of EcoRZ linkers. This GAATTC sequence at positions 3313 to 3318 differs in 1 nucleotide from the corresponding Baralle sequence GATTC. This introduces a single nucleotide change C to A at nucleotide .3315. This changes the corresponding amino acid number 1100 from Thr to Asn.

WO 91/17765 PCf/1JS91/03584 E~A~iPZ,E 1 Preparation of a Fibronectin cDNA Library tc~,~,~a.sc n l ~.
A cDNA library was prepared in ~gtll from poly A+ mRNA
isolated from human liver according to the published pro cedures (13,14). The cDNA fragments were cloned using EcoRT
linkers and the cDNA library was screened for fibronectin (FN) positive plasmids using the following synthetic DNA
l0 probes:
Probes for cell binding domain fCBD)o P obe Nucleotides (3')CACTCTATAATGTCCTAGTGAATGCCTCTTTGTCCTCC (4355-4392) (3')AGAATCTCCTTCTGTCTTTTGTCCAGAACTAAG (3967-3999) (3')CCGGTTGTTAGTTGTCAAAGACTACAAGGCTCCCTGGACC (4200-4239) Probes fox N-terminal fibrin binding domain fFBD):
(3')GGGGGTCGGAGGGATACCGGTGACACAGTGTCTTAA (817-850) (3')CGACGGGTGCTCCTTTAGACGTGTTGGTTACTTCCCCAGTAC (1310-1340) A series of FN cDNA clones covering the entire region o~
fibrin, collagen, heparin and cell binding domains was identified and isolated (Figure 9). The cDNA fragments were subcloned into the EcaRI site of pBR322.

W~ 91/17765 PCT/US9a/03584 a~~n The mRNA of FN is alternatively spliced and therefore dif-ferent length cDNA's have been reported in the literature.
Applicants' cDNA corresponding to the cell binding domain has a 270 base pair deletion from base 4811 to base 5080 on the FN physical map (the complete non spliced cDNA).

W~ 91/17769 PCT/tJ891/03584.
-49- , . , ~~~ 8~ ~ ~.

Expression and Purification of Fibrin Binding Domain tFBD) Polypeptides A. Expression of a partial FBD 20 kD polvr~eptide The FN cDNA clones obtained as described in Example 1 and depicted in Figure 9, did not include DNA encoding amino acids 1-190 of the FN molecule. These amino acids are part of the FBD. The DNA corresponding to nucleotides 14 to 472 and coding for amino acids 1-153 (Figure 2A) was constructed by ligation of 7 pairs of chemically synthesized nucleotides (Figures 3 and 4). The synthetic DNA fragment was designed to contain an ATG initiation colon at the 5~ end as well as convenient restriction sites for introduction into various expression vectors, To enable further manipulation of the DNA sequence coding for the FBD, nucleotide number 19, thymidine (T) was changed to adenine (A), thereby eliminating a Ddel restriction site without altering the amino acid sequence. (The site of the nucleotide change is denoted by an asterisk in linker ~1 shown in Figure 3A. ) The various steps for the cloning of the above synthetic DNA
fragment into pBR322 plasmid vector digested with EcoRI and BamHI are described in Figure 4. The plasmid obtained was designated pFN 932-18. The DNA ,fragment coding for the first 153 N-terminal amino acids of fibronectin from plasmid pFN 932-18, was inserted into pTV 301, a ~ P~ expression vector, between the Ndel and BgIII sites replacing the DNA
sequence coding for human growth hormone (hGH) in plasmid pTV 301. (Figure 5).
The resulting plasmid, pFN 949-2, was deposited with the American Type Culture Collection under Accession No. 67831.
Plasmid pFN 949-2 was used to transform Escheriah~a co7~
prototroph A4255. These transformed Escherichia coli cells wo 9ii»769 Pc°rius9no~s~a -, ~T,~.;a,. t -50-~~~~:~ r 1.
were found to express the partial FBD polypeptide in amounts comprising about 5~ of the total cellular proteins. The polypeptide has a mobility of about 20 kD on reduced SDS
polyacrylamide gels as determined from the mobility of the size markers. The polypeptide camprises the first 153 amino acids of fibronectin followed by 4 amino acids coded for by a. synthetic linker and then several amino acids resulting from readthrough into the pBR322 vector due to the lack of a TAA termination codon, i.e., a total of 153 amino acids plus less than 20 additional amino acids, with an additional N-terminal methionine. Throughout this specification the polypeptide is referred to as the r20 kD polypeptide or the r20 kD FBD.
B. Expression of a ~~complete~~ FBD poly~ebtide In order to obtain expression of the entire FBD polypeptide containing amino acids 1 to 262 the following glasmids were constructed:
1. Insertion of termination codon TAA at the 3' end A synthetic oligonucleotide containing a TAA termination codon and a BglII site having the following sequence:
5' CTGTTT~TAAGCA
3' GACAAATTCGTCTAG
was ligated to the 3' end of an EcoRT-PvuII fragment isolated from FN cDNA clone p931-5 and to a pBR322 vector digested with EcoRI and Bam~TI as described in Figure 6. The plasmid obtained was designated pFN935-12.
2, be o of a rbo to al re 'on of FBD i a ~~, extaxession vector WO 911177fi5 P~LTl~JS911035g4 An EcoRI-HincTI DNA fragment coding for the carboxy terminal region of the FBD was isolated from plasmid pFN935-12 and ligated to plasmid pTV 194-80 digested with EcoRI and SmaI
as described in coassigned PCT Publication No. WO 90/07577 (Figure 46). The plasmid obtained was designated pFN 946-12.
3. Syntheses and cloning of DNA corresponding to nucleotides 468-599 of FN
Three pairs of chemically synthesized nucleotides were ligated to an EcoRI-DdeI FN fragment isolated from plasmid pFN932-18 (Figure 4) in the presence of pUCl9 vector DNA
(purchased from GIBCO BRL Co.) digested with EeoRI au~d XbaI
as described in detail in the above-referenced PCT
Publication (Figure 47). The plasmid obtained was designated pFN 948-4.
4. C s ct'o of s d a o a o a FBD region In order to construct a plasmid which codes for the entire FBD, amino acid 1 to amino acid 262, an EcoRI-Xbal DNA
fragment coding for FN was isolated fram plasmid pFN948-4 and inserted into plasmid pFN 946-12 digested with EcoRI and Xbal as described in the above-referenced PCT Publication (Figure 48). The plasmid obtained was designated pFN-957, This plasmid contains the complete coding sequence for FBD
but does not express the FBD polypeptide as it lacks a ribosomal binding site (RBS).
5. ~ cession of the ~"BD under A
~y promoter and cII
An NdeT-HindIII fragment containing the FBD coding region and the T1T2 transcription terminators was isolated from ,a,.~~o~A.~~ -52-~.v~~q,, plasmid pFN-957 and inserted iota plasmid pTV 301 digested with NdeI and HindIII as described in the above-referenced PcT Publication (Figure 49). The resulting plasmid, desig-nated as pFN 962-3, directs the expression of a FBD
polypeptide under 'the control of ~, PL promoter and cII
ribosomal binding site. Esahe~ichia coli strains A1645 and A4255 transformed with this plasmid expressed only small amounts of the FBD polypeptide. The expression of the FBD
polypeptide was detectable only by Western blot analysis using polyclonal antibodies directed against human plasma derived FN.
6. Expression of an FBD polypeptide under the ~t PL
t~romoter and the B-lactamase promoter and ribosomal bindinct site As the level of expression of the FBD polypeptide obtained with plasmid pFN 962-3 was low, we added a DNA fragment coding for the B-lactamase promoter and B-lactamase RBS
(PBLA). The DNA fragment coding for PBLA was isolated from plasmid pBLAll (ATCC Accession No. 39788) and inserted into plasmid pFN 962-3 digested with Ndel, filled in with Klenow enzyme and digested with EcoRI (see the above-referenced PCT
Publication). The plasmid obtained, designated pFN 975-25, was deposited with the American Type Culture Collection under ATCC Accession No. 67832. This plasmid was used to transform Escher.~chia coli prototroph A4255 (F+).
These Esc't~eriah:ia aoli cells were found to express the ~~complete~~ FBD polypeptide at levels comprising about 5-8~
of the total callular proteins. The polypeptide migrated on SDS-PAGE gels under reducing conditions with an apparent molecular weight of 31 kD, hence it is referred to as the 31 kD polypeptide or the r31 kD FBD.
C. ~ermentatian and qrawth gonditians The clone expressing the r31 kD FBD polypeptide was fer-mented in rich medium (yeast extract and casein hydrolysate) containing ampicillin. Growth was carried out at 30°C.
Expression was obtained upon induction at 42°C for 2 hours, and subsequently bacterial cell cake containing the r31 kD
FBD polypeptide was obtained. Similarly, the clone expressing the r20 lkD FBD was fermented and bacterial cell cake containing the r20 kD FBD polypeptide was obtained.
l0 D. refolding, and purification of recombinant fibrin binding domain jr31 kDl polypeptide The process is made up of three stages:
1. Crude processing of the bacterial cake.
2. Refolding/reoxidation.
3. Purification.
1. Crude grocess inc The cake is disrupted first in 5 volumes of 50 mM Tris-HC1/50 mM Na-EDTA, pH 8 (Buffer 1); the pellet is then treated with 1.2 volumes of Buffer 1 containing 100 mg/liter lysozyme (2 hours agitation at 37°C). Triton X 100 is added to the resulting suspension (to 1%), and after 30 min. at room temperature the suspension is centrifuged and the pellet is resuspended and washed twice with water. All these steps are performed by disruption of the pellet and centrifugation and the 31 kD stays in the pellet, as evidenced from SDS-PAGE gels.
The washed pellet ins suspended in 14 volumes of lO.mM Tris-HC1/5 mM EDTA/2 mM PMSF/2mM 6-aminocaproate, pH 7.5 (Buffer A) and then treated successively with Buffer A containing:
1% decyl sulfate, 1% decyl sulfate/5% glycerol and 5%
* Trademark WO 91/17765 P(:T/US91/035&!
n glycerol. The final treatment is with Buffer A withaut additives.
2. RefoldinqJreoxidation Principle: To dissolve the pellet in 6M guanidine-HC1 -GuCl - in the presence of a thiol reducing agent, such as glutathione - GSH - and to refold/reoxidize at a lower GuCl concentration by the addition of oxidized glutathione-GSSG.
The washed pellet from step 1 above is dissolved in 150-700 volumes of 6M GuCl/3mM GSH in Buffer A. The concentration of GuCl is lowered gradually, i.e., first 2 M, then 1 M and 0.5 M, while keeping the concentration of all other components constant, except for the volume, which at this stage is brought to 500-1000 fold higher than that of the pellet. At one of the intermediate concentrations of GuCI, i. e. , between 0. 5 and 2 M, refolding is initiated by the addition of 0.3 mM of GSSG and incubation at room temperature for 24-48 hours. The refolded 3Z kD is then dialyzed against Buffer A without additives.
3. Puri 'cation Concentration: The large volume of refolded 3l kD is first centrifuged to remove the insoluble pellet that contains no 31 kD and is then dialyzed against Tris-HC1, pH 7.8, before being concentrated. and initially purified on a Heparin 3o Sepharose column.
improved procedures for refolding/reoxidation and purification of the polypeptide fragments of the xBD are described in Examples 5 and l0.

Pharmacodvnamics of the r31 kDs r20 kD r18.5.kD and r12 kD
Fibrin Bindinct Domain Polypeptide Fragments The intensity and resolution of a clot (thrombus) image is governed by the interplay of the rate of incorporation of the radiopharmaceutical and its blood clearance rate. In order to elucidate the metabolic behavior of the r31 kD
l0 fibrin-binding domain, and to compare it to fibronectin (FN), the r31 kD fibrin binding domain and plasma fibronectin were both iodinated with 125I by the IC1 method (24) and injected intravenously into rats. The results are spawn in Figure 7 which represents the pharmacokinetic behavior of 1251-r31 kD FBD and 1251-FN. Blood samples were withdrawn at the times shown on the graph.
Figure 7 demonstrates that the clearance rates of the two radioactive molecules are different and after 5 hours, only 3% of the r31 kD FBD but 20% of FN respectively remain in circulation.
Some of the rats were kept in individual metabolic cages, and accumulated urine and feces were collected at 7 hours and 24 hours. About 30% of the injected l2sl_r31 kD
radioactivity was excreted in the urine during the first 7 hours, and more than 94% was excreted after 24 hours. All of the urinary radioactivity was trichloroacetic aoid-soluble, which is indicative of proteolytic degradation.
The analysis of a variety of organs (kidney, stomach, liver, lung, uterus, ovary, adrenal, colon, ileum, skin, brain, eye, muscle, bladder, heart, spleen, trachea, aorta and vane-cave) did not reveal any specific accumulation, and the kinetics of disappearance of the radioactivity followed a pattern similar to that of the blood. In most of~ the WO 91/17765 PC'T/US91/03584 ..aa-,, R-, ~, ~f~~.
~ ,.. ~Wr av.9 organs, the specific radioactivity (cpm/gram tissue) was lower than that of the serum.
The results indicate that exogenous recombinant 31 kD amino-terminal polypeptide of FN is moderately degraded and excreted in the body. The pharmacokinetic behavior is not consistent with a first-order kinetics, which may indicate that the polypeptide is moderately distributed in the tissues and body compartments other than blood. This is also evident from the f finding that the degree of degradation does not increase during the 4-24 hour period, thus reflecting a gradual release of the polypeptide from body compartments. The exclusive and relatively earlx appearance of the metabolites in the uxine indicates that the Z5 polypeptide is readily excreted through the kidneys. The lack of accumulation of the material in the liver may be an indication that this organ is not a major locus of degradation and is not involved in detoxification.
The relatively short half-life of r31 kD FHD is important for its possible use in diagnostic imaging of thrombi. The recombinant 31 kD FBD (r31 kD) may be labeled radioactively or by other means and 'then introduced into the blood for the purpose of imaging thrombi.
The shorter half-life of the molecule is also important when utilizing it to prevent clot formation. By contrast, heparin, the current therapeutic agent of choice, suffers from a very long half-life.
A similar experiment was performed using iodinated 31 kD
fibrin binding domain of plasmatic fibronectin and similar pharmacokinetics and distribution of radioactivity were observed.

WO 91!17765 1't.'f/US91l03584 4 ~1 ~Z ~~
~~.WSt~.~ d ~.
The 31 kD polypeptide was obtained by cleavage of plasmatic FN as follows: the plasmatic FN was purified on a Gelatin-Sepharose column from which it was eluted and stored in 1 M
guanidinium hydrochloride. Thereafter, 206 mg of FN, after dialysis against 10 mM of Tris-HC1, were digested with 0.01%
of TPCK-trypsin at 37°C for 5 minutes. The Cryptic digest was loaded on a DE52 column (6 ml) and 1/5 of the flow through fraction (50 m1) was applied to a CM-Sepharose column (3 ml) and eluted with a NaCl gradient (0-0.5 M).
About 80% of the polypeptide was recovered in the salt gradient (peak at about 220 mM) and after dialysis to remove the salt about 1/2 of the polypeptide was loaded on a Heparin-Sepharose column (1.5 ml) and eluted with 0.5 M
NaCl. Approximately 75% of the polypeptide was recovered in this fraction, i.e., about 1 mg (about 40% of the theoreti cal yield). This fraction was >90% pure 31 kD polypeptide, and was iodinated by the method described above. In an improved embodi~tent the CM-Sepharose step is omitted and the Heparin-Sepharose step is.performed directly after the DE52 column.
Note that plasmatic 31 kD FBD contains the first 259 amino acids of FN, whereas the recombinant 31 kD FBD contains the first 262 amino acids of FN and an additional N-terminal methionine.
co 'net'cs o the 20 kD 8.5 D n D b b~1~3.~.~.~lvtaept ides 3o Similar experiments were performed using labeled r20 kD, r18.5 kD and r12 kD fibrin binding domain polypeptides produced as described in Examples 2, 4, 5 and 10. The pharmacokinetics of these polypeptides was found to be very similar to that of the r31 kD polypeptide.

WO 91/17765 P(.'T/L1S91/035$4 _58-~~~Jw,~t7~..
EXA1~IPLE 4 ~xmression and Fermentation of Additional Fibrin Bindinc_r Domain (FBD1_~oly.,peptides In Example 2 the expression of a partial r20 kD FBD and the full-length r31 kD FBD was described and in coassigned PCT
Publication No. WO 90/07577, Example 24, an improved procedure for refolding and purification of the 31 kD FBD
was disclosed. The construction of plasmids for expression of additional polypeptide fragments of the FBD is now described.
A. Expression of r12 kD FBD polvt~et~tide Plasmid pFN 975-25, ATCC No. 67832, expresses the full-length r31 kD FBD of fibronectin and from it plasmid pFN
196-2 which expresses a partial FBD was constructed as shown in Figure 10. This plasmid was transformed into Escherichia coli strain A1645 and thence into Escherichia cola strain A4255 and deposited' in A4255 in the ATCG under Accession No.
68328. These transformed cells were found to be good expressors of the partial FBD polypeptide in amounts comprising about 5% of the total cellular protein. The polypeptide has a mobility of about 24.4 kD on SDS
polyacrylamide gels under reducing conditions as determined from the mobility of the size markers. The polypeptide comprises the first 109 amino acids of fibronectin. An additional methionine residue is present at the N-terminus of the final polypeptide. Throughout this specification this polypeptide is referred to as the r12 kD polypeptide fragment or the r12 kD FBD.

laYO 91117765 1'C.T1U891/p3584 ~;~:u ~ ; ~'.
B. Expression of a modified 12 kD X12 kD' 1 partial polypegtide Plasmid pFN 975-25 (ATCC No. 67832), which expresses the full-length r31 kD FBD, was used to construct plasmid pFN
197-10 which expresses a modified r12 kD polypeptide (r12 kD') as shown in Figure 11. The fibronectin FBD sequence was modified to produce an NdeI site immediately after nucleotide 340. This plasmid was transformed into Escherichia coli strain AI645 and thence into Escherichia coli strain A4255. These transformed cells were found to be good expressors of the modified r12 kD partial FBD in amounts comprising about 5~ of the total cellular protein.
The polypeptide has a similar mobility to the unmodified 12 kD FBD as determined on reduced SDS polyacrylamide gels.
The polypeptide comprises the first 109 amino acids of fibronectin followed by additional amino acids histidine and methionine. An additional methionine residue is present at the N-terminus of the final polypeptide. This polypeptide is designated the r12 kD' polypeptide or the r12 kD' FBD.
C. ~ression of a modified r12 kD' FBD fused to the 33 kD
cell binding domain Plasmid pFN .197-10 which contains an NdeI site at the 3' terminus of the modified 12 kD FBD was used to construct a plasmid, designated pFN 202-5, which encodes the modified 12 kD FBD fused to the 33 kD cell binding domain (CBD). This construction was performed as shown in Figure 12 where the 33 kD CBIJ fragment was taken from plasmid pFN 137-2 (deposited in the ATCC under ATCC Accession No. 67910).
Plasmid pFN 202-5 was transformed to Escherichia coli strain A1645 and thence to Esche~ichia coli strain A4255 and is a good expressor (8~ of total protein). The 45 kD polypeptide consists of the 12 kD' FBD fused to the 33 kD CBD (first 109 WO 91/17765 PCf/LJS91/a35f34 °60-ec:~~~a'Aisi..
amino acids of FBD followed by amino acid residues histidine and methionine followed by the CBD commencing with serine.
An additional methionine residue is present at the N-terminus of the final polypeptide).
D. Expression of a 31 kD FBD polypeptide fused to the amino acid seguence DGRGDS
In order to obtain expression of a 31 kD FBD polypeptide fused at the carboxy terminus to the sequence asp-gly-arg-gly-asp-ser (DGRGDS) the following construction was made.
Plasmid pFN 975-25 which expresses the 31 kD FBD was digested with PvuII and HindIII and ligated to a synthetic linker as shown in Figure 13. The resulting plasmid, designated pFN 195-4, was used to transform Escherichia coli strain A1645 and thence Escherichia coli strain A4255.
These cells were found to be good expressors of the 31 kD-DGRGDS polypeptide, at levels of about 8% of total cellular protein. The sequence of this polypeptide is described in the description of Figure 13.
E. E~Cpression of a fused 31 kD FBD-33 kD CBD
In order to obtain expression of a "full length" r31 kD FBD
polypeptide fused to the r33 kD CBD the following construction was made.
Plasmid pFN 975-25 which expresses the 31 kD FBD was digested with PwuII and HindIII, and the large fragment resulting was ligated to a synthetic linker and to the r33 kD cell binding domain obtained from plasmid pFN 137-2 after Ndel and HindIII digestion (as shown in Figure 14). The resulting plasa~id, designated pFN 194-2, encodes the r31 kD
FBD linked to the 33 kD CBD. Plasmid pFN 194-2 was transformed to Esche~:ichia coli strain A1645 and than to ~scherichia c_Q~, strain A4255, and the resulting cells were WO 91/17765 PC.'T/IJS91103584 -61_ ~:~~~~ 'q'~.
low expressors of a 64 kD polypeptide which comprises the 31 kD FBD fused to the 33 kD CBD. The sequence of this polypeptide is described in the description of Figure 14.
Fermentation and cjrowth conditions The clone expressing the r12 kD FBD polypeptide was fer-mented in rich medium (yeast extract and casein hydrolysate) containing ampicillin. Growth was carried out at 30°C.
Expression was obtained upon induction at 42°C for 2 hours and subsequently bacterial cell cake containing the r12 kD
FBD polypeptide was obtained. Similarly, cell cake containing other proteins described above was obtained.
F. Additional Plasmid Constructions 1. 18 5 kD FBD nolyneptide fra ent: As described above, (Example 2A) the 20 kD FBD fragment expressed by plasmid pFN
949-2 (ATCC No. 68456) contains up to 20 additional amino acids of the pBR 322 vector due to readthrough past the end of the FN gene in the absence of a properly located TAA
transcription termination codon. Tn order to provide a more authentic "3 fingered" FBD polypeptide fragment than the 20 kD fragment described in Example 2A, a plasmid encoding an 18.5 kD FBD polypeptide was constructed.
The construction is shown in Figure 23 and described in the Dascri~tion of the figures. The resulting plasmid designated pFN 208-13 expresses an x.8.5 kD FBD polypeptide fragment under control of the PL promoter and the ,9-lactamase ribosomal binding site. Plasmid pFN 208-13 was deposited in ATCC in E, co i A4255 under Accession No. 68456.
This plasmid expresses the first 154 amino acids of fibronectin with an additional N-terminal methionine.

WO 91/17765 PCf/US91/03554 ~p.~ d' ~~
's~w~s ~~ ~~~i - 6 2 -2 . Improved ex~aressor of the 12 kD FBD ~o~ ypeytide ~,l~a_g~ment: Plasmid pFN 196-2 (ATCC No. 68328) expressing a 12 kD FBD polypeptide fragment (2 "fingers") under control of the ~1PL promoter and ~-lactamase ribosomal binding site was described above. In order to further improve the level of expression of the 12 kD fragment, plasmid pFN 203-2 was constructed as shown in Figures 26 and 27 and described in the description of the figures. Plasmid pFN 203-2 expresses the 12 kD fragment under control of the kPL promoter, CII
ribosomal binding site and a 36 by trp ta~anscription termination sequence. Plasmid pFN 203-2 was deposited in ATCC in E.coli A4255 under Accession No. 68606. These transformed cells were found to be good expressors of the 12 kD FBD polypeptide fragment in amounts comprising about 12-18~ of the total cellular protein.
3. High expression of fused 31 kD FBD - 33 kD CBD
Polvpeptide: Plasmid pFN 194-2, a low-level expressor of a 64 kD fused FBD-CBD polypeptide under control of ~1PL
promoter and ~B-lactamase ribosomal binding site was described above. A plasmid was constructed to enable high level expression of the 64 kD polypeptide under control of the APL promoter, CII ribosomal binding site, and 36 by trp transcription termination sequence. This plasmid, designated pFN 205-5 was constructed as shown in Figure 25 and described in the description of the figures.
Fermentation and growth conditions for all these expressian plasmids (1-3 above) were essentially as described for production of the other FBD polypeptides (see Example 2C).
Purification and refolding were as described in Example 5 and Example 10.

WO 91117765 PC'T/US911035~4 .r q-~.,(i,'r'J°~4'.1 ~~R 5 r~~wLaw., 4 ~,.
Refolding and Purification of Recombinant 20 kD and 12 kD
Fibrin-Binding Polypeptides of Fibronectin.
The process for refolding and purification of the r20 kD and rl2 kD polypeptides is made up of three stages:
1. Crude processing of the bacterial cake.
2. Refolding/reoxidation.
3. Purification.
1. Crude processing 1.1 Washincx and extraction of the pellet: The bacterial cell cake, obtained as described in Example 2 for the r20 kD polypeptide and as described in Example 4 for the rl2 kD polypeptide, is disrupted and washed essentially as for the r31 kD polypeptide (see coassigned PCT Publication No. WO 90/07577, page 121 gt se .); however, changes were introduced in the extraction procedure used for both the r20 kD and the r12 kD polypeptides. The following is an example of the washing and extraction procedure performed on the bacterial cell cake of the r20 kD polypeptide; the rl2 kD polypep~ide is extracted in a similar way.
1.2 Procedu.e: Bacterial cake containing the r20 kD
palypeptide was produced as described in Example 2 by fermentation of Escherichia col3~ strain A4255 harboring plasmid pFN 949-2. A portion of this bacterial cake (14.8 g) was suspended in to volumes of 5o mM Tris HC1, 50 mM EDTA (Buffer B), pH 7.5. The suspension was homogenized for 15-30 seconds at a medium speed, _64-"~~,~,~w~'e ~..
sonicated 3 times for 4 minutes with pulsing, and centrifuged at 15,000 rpm for 30 minutes. The pellet was resuspended in 2.4 volumes (36 m1) of Buffer B.
Lysozyme (0.1 mg/ml) was added and the suspension was incubated in a water bath at 37°C for 2 hours with stirring. Triton X-100 was added to a final concentration of 1%, stirred at room temperature for 30 minutes and centrifuged. The pellet was resuspended three times in 148 ml of water (i.e., 10 times the vol-ume of the original pellet), homogenized, stirred for 30 minutes at room temperature and centrifuged. The final pellet weighed approximately 1.5 g, i.e., only 10% of the original weight; however, both the r20 kD
and the r12 kD polypeptides stay in the pellet, as evidenced by SDS-polyacrylamide gel-electrophoresis.
The washed and extracted pellet was kept frozen at -20°C until further processed.
2. So ubil'zatio and refoldi of the a t ante ~ et 2.1 The reagents arid procedure used for the refolding/-reoxidation are different in this case from those used for the r31 kD polypeptide. The extracted pellet of the r20 kD or the r12 kD polypeptide is dissolved in 6 M guanidine-HC1 (GuCl) in the presence of 50 mM B-mercaptoethanol and, following a tenfold dilution, is allawed to reoxidize by air.
2.2 Praced~xe: The frazen r20 kD pellet (1.5 g) was solubilized and homogenized in 10 volumes of 10 mM Tris HC1, 5 m~i BDTA (Buffer C), pH 8.0, containing additionally 6 M Guanidine-HC1. The sample was reduced by the addition of 57 ~l of undiluted B-mercaptoethanol (final concentration: 50 mM) and stirred in the absence of air, i.e., in a sealed container, for 30 minutes. It was then dripped at the rate of about 5 mi/min into 10 volumes (148 ml) of puffer C, pH 8.0 and -allowed to oxidize while being constantly and gently stirred, in an open beaker for 48-72 hours at room temperature. Alternatively, the oxidation was performed in a closed container in the presence of 0.3 mM GSSG. Although at this stage some polypeptide precipitation had already occurred, the suspension, including the precipitate, was dialyzed over 24 hours against 15 volumes of Buffer C, pH 8.5 with three changes of buffer. The dialysate was then subjected to centrifugation for 45 minutes at 15,000 rpm (22,500 x g) in a high-speed Beckman centrifuge equipped with a JA-17 rotor. This removes many contaminant proteins and aggregates of the r20 kD or r12 kD, which have been produced during reoxidation.
3. Purification and Characterization Since the location of the heparin binding site within the fibrin binding domain was not known, it therefore could not be known in advance if the new shorter r20 kD
and rl2 kD polypeptides would bind to Heparin-Sepharose. However, we found that the shorter molecules did in fact bind to Heparin-Sepharose.
We found that there was no need for a phenyl-Sepharose column, as in the case of the r31 kD, in order to purify the re~oxidized r20 kD or r12 kD polypeptides.
In fact, the material could be directly purified on Heparin-Sepharose, but considerable improvement, with respect. to removal of contaminants, incorrectly folded molecules and dimers, was achieved when the sample was chromatographed on a Q-Sepharose column before chromatography on a Heparin-Sepharose column. In some cases, the po:lypeptide was concentrated on a Pellicon * ~hrademark V1~'O 91/17765 -66- PCT/US91/03584 system (Mill.ipore Corp.), using membranes with appropriate cut-off points, i.e., 10 kD for the r20 kD
_polypeptide and 3 kD for the r12 kD polypeptide, prior to being loaded on the Q-Sepharose column. The Hepa rin-Sepharose column is also used for concentration of both polypept.ides. The following is an example of the purification procedure used in the case of the r20 kD
polypeptide.
3.1. O-Sepharose Chromatoqrap,~y: One-third of the reoxidized r20 kD (47 ml) was applied to a 10 ml column of Q-Sepharose Fast Flow *column, which had been pre-equilibrated in Buffer C, pH 8.5 at 1.2 ml/min flow-rate. The flow-through fraction was collected and saved (70 ml). The polypeptides which adhered to the column were eluted with Buffer C, pH 8.5 containing 0.5 M NaCl and ths~ column was regenerated with 0.5 M NaOH.
3.2 Hepap rin_-Segharose Chromato aphy: The flow-through from the Q-Sepharose column was applied to a 10 ml column of Heparin-Sepharose pre-equilibrated in pH 8.5 buffer at a flow rate of 0.5 ml/min. The flow-through fraction contained mostly contaminants and incorrectly folded r20 kD polypeptide. The purified (>95% pure) r20 kD polypeptide was eluted in Buffer C, pH 8.5 containing 0. °_. M NaCl and the column was regenerated in the same buffer containing additionally 6M Guanidine-HC1. Representative purification tables for the r20 kD
(Table A) and r12 kD (Table B) polypeptides are pro-vided.
3.3 Characterizat:~: Supernatants from the processing of the bacterial cake for both the r20 kD and the r12 kD
polypeptide, ass well as aliquots from subsequent column fractions, were assayed for polypeptide and analyzed by SDS-polyacrylamide gel electrophoresis; their elution * Trademark WQ 91/177fr5 PCf/U591/03584 _67-profiles were obtained on a Superose 12 column attached to either a FPLC or a HPLC. These profiles at various stages of the refolding, as well as of the purification, are shown for the r20 kD (Figure 21) and the r12 kD (Figure 22). The purified r20 kD or r12 kD
polypeptides elute as single sharp bands. These profiles corroborate the results seen on SDS-PAGE gels under non--reducing conditions; the bands of bath the 20 kD and the r12 kD polypeptides samples are non-diffuse, indicating a single molecular form. In the case of the r20 kD, the band of the non-reduced polypeptide runs (as in the case of the r31 kD
polypeptide) faster than that of the reduced form; this is a similar effect to that seen in the case of the r31 kD polypeptide. However, no such difference is observed in the case of the r12 kD po.lypeptide.
Additional details on characterization of FBD
polypeptides are provided in Example I1.
These FBD polypeptides are available for radiolabeling in order to use them as radiopharmaGeuticals for imaging of thrombi and atherosclerotic lesions.
The advantages of using the smaller FBD polypeptides (r20 kD and r12 kD) for 1~he above-mentioned purposes as opposed to using the larger r31 kD polypeptide is that we have developed after considerable effort a simpler method for the preparation of the smaller molecules, i. e. , the methods described above for the refolding and purification of the r20 kD and rl2 kD polypeptides are faster and easier than the method for refolding and purification of the r31 kD polypeptide. Tn addition, these methods result in a higher yield than does the method for the x31 kD polypeptide and a higher concentration of polypeptide can be achieved for the .
shorter FBD polypeptide fragments (up to lOmg/ml).

W~ 9/1'7765 PCTJU591/03584 °68-°~ n w ~ °1.~i 94s 1..- w'7~:Di~ t ~ ~"
An improved embodiment of this method for refolding and purification of the FBD polypeptide fragments is described in Example 10.

WO 91!17765 - 69 - PC.'T/US91/03584 etsw4il O 4!

0 .1.~

U

0 rl ~ O

N w O' rl ~ d tT l.i M rs CO O
O ~

a~ w '~1 ~ ~

La O rl rl N N
~ .1-) w I~ 0~ ~t' ~ .i ' ~9' Q1 O ,~ N

rt dP O d tn N N fl, y ... ~ n ~

0 b p ri ~ 6ia N O N N

r/
~

R: O ~D V' c-1 e-a ~D
r~
O

O ~ W
N
.

f., ? ~

, .~ C1~
U b ~ N Et b ~ ~ ~ ~ ~ W

~ ~ O
c O ~
~

w .,..~
z H

y ~ o ~ ~ ~ . ~ ~ ro .~' cr . co o r~ c>' '1'~
O S~ -r ~ c~ rl eC
~ .
Q
-~,",H .
, W N

C7 b er , ~ .. '~ ro p N
' '~1 ~ ro ~1 ~fJ. d' .
U ~ 'd ~ N ~ C7 ~rl U ~ ~ N
~

W .~ ~ O O O y~ ~ U

~

~

~

r ~
f.
~
.

.a ~ w .... co m ro -a ri a ~ ~ pa ~
b w C ~ .1-~

w 0 ~

,~ ~

l N ro ro O ~t~
O

~ ~~ ~ro ~ pox ~' roa ~

b , ~

rl N N .~' rl IjJ N
OI Cr Cue' W S1 .1J

~ ~~ ro~~ W~

a~ ~~~ ro~ ~, b ,~ .~ .., cn w w rn b w w o ~n ~

rl O

f!1 fn O O a '.1"r Q'd ~1 U1 W tn GI " O

1N0 91/177b5 - 70 - PCTIUS91/035i34 i~'~~ 5c~.'~1~.
v v 'o +
,, rtt w v w rn ~~ v o ~ o ~o v~ o v w . o o .~

Ca o ~-i cn c o b '~
w .N

~ro w w ~r ~

v ,.. o o ..a o ~ ~ Sri ~a N
~
o r-1 CO f~ -I "
W ~

GL N

~
O

O ~ 'o O ~

C) .tJ

f11 ~ tc. vD O cr1 U
...

~ N

D ~O ~ url t n .s~ U ,O

W

W .d O ~

H ~ V i~ O ~ ~
W

t m Y

W

G
~ b w .~s z .

'~ ~ vro v u.. ~, c o.

O o N

i. ~n u! O
.~ ~
v H H Gr ~ ~ ~ .-a f~, LT ~ p N

~ ~ ~ WU" N .E b p, ~ ~ b N
~ ~

O t"r l0 N r-I
Ch W U
~

~D O O O

rl f"~ N

W ' rl a ~ ~
~
~ U

p ,, H ~ ..'~-I ral tCS ,~ fO-1 O O
~

r- O O O b 1 r-o~ o ~ ~ ~ .
boo a~

~ ro ~ a. b ~

w +' ~ .a.~ N ~

N ~ N O .1-~ .L1 .N
~ Cl' C~

C1 v ~ ~' a ro ~ o b c c :a ~i ~ ~i o ~ i' ro a W ~ U ~ G7 ~ .~ n a b a o a z . c .
~

N o aw x .~N
~ o v c c c n n nz ro .n Ei s~

WO 91/17765 PCT/US91/035~4 -71_ ~~~~~~ 'i'~..

Biolocrical Activity of tie r31 kD r20 kD and x12 kD Fibrin Binding Domain Polypeptides The biological activity of the r31 kD FBD was described in coassigned PCT Publication No. WO 90/07577, page 134 et sea.
relating to its binding to fibrin clot in vivo and in vitro, binding to bacteria and binding to extracellular matrix. In l0 this example, additional results relating to the r31 kD
polypeptide are presented and the biological activity of the 20 kD and 12 kD FBD polypeptides is demonstrated.
In this Example the binding of the recombinant fibrin binding domains to fibrin clots was measured as follows:
Binding of 125I_rFBD (r31 kD. r20 kD or r12 kDl to a preformed fibrin clot (two-step Reaction II1 Step 1 Formation of fibrin clot: This may be done in one of two ways:
Either (a) Incubation at 37°C of 20 ~1 citrated human whole blood with 5 mM CaCl2, 1 unit/ml thrombin and PBS in a final volume of 250 ul. The reaction is terminated after 45 minutes by centrifugation and washing of the pellet (twice) with 1 ml PBS;
or (b) Incubation at 37°C of 20 ~~. non-citrated whale human blood ("naive" blood). The reaction is terminated after 150 minutes by centrifugation and washing as in (a).
~teg'2 B~dinc(", o~'~the 125I-FBD polypeptide to the ~preformed fibrin clot WO 91/17755 PCTl1JS91/03584 _72~
9~i~~~GV.o ~
Clots are incubated at 37°C in a final volume of 250 ~1 PBS with l2sl_rFBD
polypeptide. Other constituents may be added as indicated for each experiment. The binding reaction is terminated after 45 min-utes by centrifugation and washing three times with PBS. The tubes containing the l2sl-rFBD - fibrin pellet were measured for radioactivity in a gamma counter.
to Results A. Metabolic stability of l2sr_labeled r31 kD FBD in ats~
ex-vivo binding to fibrin versus TCA insolubility As described in the description of Figure 18, rats were injected intravenously with r31 kD FBD labeled with 12~I and blood samples taken at intervals were added to Na citrate.
Aliquots of the blood were treated as follows: either (a) 2o treated with 20~ TCA and the TCA insoluble counts were measured; or (b) incubated with preformed clot (using 20 ~1 whole blood from control rat); binding of the lzSl-31 kD FBD
to preformed clot was measured under the conditions of~the two-step Reaction ~z described above.
The radioactivity was measured by a gamma counter and the activity of each sample was calculated as a percentage of total cpm present in the reaction mixture.
The results demonstrated in Figure 18 indicate a good correlation between the physical decay of the r31 kD (as measured by the decrease in TCA insolubility) and the functional decay (as measured by the decrease in ~x-vivo binding of the r31 kD to a preformed fibrin clot.) However, at the initial stage of the comparative studies there are marked differences; at 30 min a the functional decay is dV0 91 /17765 PCT/ i.JS91 /03584 _73_ "~,~,~'~~a 'i'~.
several fold higher than the physical decay. These results, which suggest a much faster decrease of functional stability than physical degradation, can be explained since the main site for the covalent reaction of the FBD with the fibrin clot is the glutamine residue located at the extreme amino terminus of the FBD molecule at amino acid no. 3; this glutamine residue, being located in a 20 amino acid stretch outside -the Type 1 homology structure, is not protected from degradation by the tertiary structure, which is typical of the rest of the FBD domain.
B. Snecificitv of binding of r31 kD to fibrin: effect of transalutaminase The covalent binding of the fibrin binding domain of plasmatic fibronectin to fibrin in a clot is mainly due to the reaction of amino acid no. 3 of fibroneetin (glutamine) with fibrin; this binding reaction is enzymatically controlled by the enzyme transglutaminase which specifically recognizes the amino acid sequence containing this glutamine residue.
The following experiment was performed to investigate if transglutaminase is involved in the binding of the recombinant r31 kD FBD to clots. All the exogenous transglutaminase used in the experiments described in this application is guinea-pig liver transglutaminase (Sigma).
The binding of 0.3 ACM solutian of the following molecules to preformed fibrin clot derived from 20 ;cl of whole human blood wag measured in the presence and absence of transglutaminase using the two-step Reaction II described above: 1~C-~putrescine-r31 kD FBD, 125I-r31 kD FBD and 125I-recombinant bovine growth hormone (control). The 14C-pwtrescine-~r31 kD protein complex where the glutamine W~ 91/1776s PCT/tJS91/03584 ~~ ~~~'-1 ~~~r~i~, I ~, residue at position 3 is blocked by covalent reaction with 1~C-putrescine, was prepared as follows:
A solution containing 3 ~M r31 kD FBD, 10 mM CaCl2, 0.015 units/ml transglutaminase and 60 ACM x4G putrescine (specifac activity 100 mc/mmole) was incubated at 37°C far 5 hours.
The amount of 14C-putrescine incorporated into the 31 kD FBD
was measured by TCA precipitation of an aliquot of this reaction solution and demonstrated the incorporation of an equivalent amount to 2.8-3 ~M solution of 14C-putrescine into the r31 kD protein; this indicates that more than 90%
of the glutamine at position number 3 of the FBD covalently reacted with the a4C-putrescine. The 1~C-putrescine r31 kD
material was stored at 0°C and used within a few days without further treatment. The r31 kD FBD and the control recombinant bovine growth hormone analog (bGH) prepared as described in EPO Publication No. 131843 were labeled with a2sl using the IGl method described in Example 3.
Results The counts bound in the two-step Reaction II in the presence and absence of transglutaminase were obtained and the ratio of counts bound in the presence and absence of transglutaminase was calculated for each polypeptide tested.
This ratio differs dramatically when intact 31 kD FBD is compared to putrescine-FBD ("blocked" FBD) or to the control bGH. In the two latter cases the ratio of counts is close to Z which shows that transglutaminase does not affect the binding and total cpm present in the clot is 10-15% of total cpm in the reactionj. In the case of the intact 31 kD FBD
the ratio is dramatically higher than 1 (in different experiments the ratio varied between 1.8-7 depending on the quality and freshness of 'the blood and the transglutaminase) and total cpm present in the clot is 40-70% of total cpm in V6r~ 91/17765 PCT/U591/03584 <aa-, ~qaw Nw'a.r ~ tb W~a ! ~.
the reaction) i.e., transglutaminase greatly increased the binding of r31 kD polypeptide to the clot.
These results indicate the strong effectiveness of unblocked glutamine at position number 3 for the binding of the r31 FBD polypeptide to the fibrin clot in the presence of transglutaminase.
Other experiments have shown that the addition of 20 transglutaminase to the two-step Reaction II increases the binding of the r20 kD and r12 kD polypeptides to the clot, comparable to the effect observed with the r31 kD.
C. Characterization of r31 kD FBD-fibrin eomgalex by SD-~S
polvacrvlamide c~el electrophoresis In order to determine the size of complex formed by the binding of r31 kD to a fibrin clot the following series of experiments was undertaken. Clots were derived from either 20 ~sl whole human blood (A) or 250 ~1 of a solution of 0.8 ~M human fibrinogen (B). In some of the fibrinogen experi-ments dental coils (as described in Bxample 7) were added to the tubes together with the fibrinogen.
The binding of 1252_r31 FBD to the fibrin clot was measured using the two-step Reaction II described above, in the presence of 0.15 ~M 125-r31 kD FBD and 5 mM CaCl2. The reaction was terminated by three times washing with PBS.
The pellet, aftex the various treatments described below, was centrifuged and 15 ~l aliquats of the supernatant (i.e., the soluble material) were electropharesed on polyacrylamide gels which separates the material of molecular wej.ght >106 from molecular weight >105 and from lower molecular weight materials. An autoradiogram was produced which shows the following: in the presence of transglutaminase high molecular weight forms of r31 kD - fibrin complex appear WO~ 91/17765 PCf/US91/03584 ~:~...~
~~;~~n.~ r hick are resistant to boiling in the presence of the strong ionic detergent SDS and B-mercaptoethanol, which reduces S-S
bonds.
Additionally, when 4M urea is included in the boiling reaction the very high molecular weight forms (>106) are quantitatively converted to the intermediate molecular weight forms (>100,000) as expected for hydrophobic bonded aggregates of high molecular weight fibrin clots. The l0 amount of free r31 kD polypeptide in the clots is normally small; this is the material released on boiling with phosphate-saline buffer only. The resistance of the intermediate molecular weight forms to additional treatment with urea supports the involvement of a covalent linkage between the 12s1-r31 kD and the fibrin.
D. Effect of fibronectin and heparin on the binding of m5I_r31 kD to,preformed fibrin clots (i) Effect of fibronect~~ (FN1 Human plasma contains substantial levels of FN (300 ~g/ml) which potentially could compete with the binding of 1251-r31 kD polypeptide to preformed clots. Such competition may affect the efficiency of clot radiolabeling and subsequently the imaging process. To examine the effect of FN, 1251-r31 kD ( 0.15 ACM) was added together with purif ied FN ( 1 ACM) to a preformed clot in PBS. Although FN was added in a molar excess of 7 relative to 1~5I-r31 kD, the binding of the latter polypeptide was only slightly affected (20~
inhibition). ~'he observatian that excess FN does nat compete with 1251-r31 kD binding could be interpreted in two ways: the number of sites far crosslinking onto the clot is in excess to accommodate both FN and l2sl-FHD, or the affinity of FHD to the clot is much higher than that of FN.
Haled on several observations, we believe that both excess WO 91/17765 Pt.'T/LJS91f035~4 _77_ ~~; ~r. b~Fr~~..
binding sites and higher affinity of the l2sl_r31 kD enable its binding to the clot in the presence of plasma cc.:aentra_ tions of FIB.
(ii) ~~fect o~~epar~B
Some radioscintigraphic agents such as 111In_labeled platelets and labeled fibrinogen are ineffective in the presence of therapeutic heparin. It was important, therefore, to analyze the effect of heparin on the incorporation of l2sl_r31 kD to the clots. The results showed that heparin has no significant effect on the binding of r31 kD FBD to preformed clots. Other experiments showed that the same amount of heparin affects dramatically the binding of r31 kD to a fibrin clot during its formation, 1.2., ReaCtlOn I.
E. Com ar son of t a b' d' of v ous ecomb' na t D
polypeQtides and plasmatic FBD to ,preformed clots To compare the binding to preformed clots of the various recombinant FBD polypeptides (r31 kD, r20 kD and r12 kD) and plasmatic 31 kD FBD, a series of experiments using the two_ step Reaction II was carried out as described in Figure 19.
2~ The results show that the plasmatic 31 kD binds to a similar level as the r31 kD whereas the r20 kD and r12 kD
polypeptides both bind at about half the level of the larger (31 kD) molecule. The level of binding of the r20 kD and r12 kD polypeptides is still sufficiently high to demonstrate the potential of radiolabeled r20 kD and r12 kD
polypeptides as radiopharmaceuticals for thrombus imaging.
Similar experiments using the r31 kD_DGRGDS polypeptide (Example 4, D and Figure 13) showed that it binds at about the same level as the r31 kD.

°?~-~:~~ ~~~~'~.
F. Bindinct of 125I°x12 kD to fresh or frozen clots In order to study the effect of freezing the clots prior to use in binding experiments with FBD polypeptides, the following experiment was carried out. Fibrin clots were either used fresh or after storage at -70°C in a two-step Reaction II binding experiment with 125I-r12 FBD, prepared as described in Example 5.
The experiment was carried out as described in the l0 Description of Figure 15 in the presence or absence of transglutaminase. Figure 20 shows that there is little sigriificant effect of freezing on the abilities of clots to bind r12 kD FBD. Normally, frozen clots without added transglutaminase yield binding results similar to fresh clots in the presence of transglutaminase; there is no effect on the binding reaction when exogenous transglu-taminase is added to frozen clots, probably because of the release of endogenous transglutaminase from the frozen red blood cells.
As noted in Section B above, there is a wide range of response to addition of exogenous transglutaminase in Reaction II.
C. o 'o s fo b'n 'n 125 - 1 kD FB o a o ed clots To investigate the conditions for binding of 1251-r31 kD to preformed clots, the following series of experiments were carried out. The binding of la~I-r31 kD polypeptide to preformed clots formed fram citrated or '°nai~re~' blood was examined, using the twa step Reaction TI method, and in the presence or absence of various constituents (calcium, hirudin, transglutaminase). The pattern of results using thc~ "citrated" blood or "naive" blood clots is similar WO 91/17765 PCTllJS91/035~4 -79- a~ ~'1 v'~~.1 e~ ,a ~ t:r n-, d ~.
although the binding of the r31 kD polypeptide is higher to citrated blood.
Hirudin (Sigma) is a specific inhibitor of any thrombin-mediated reaction and the hirudin was therefore added in order to investigate the effect of thrombin on the binding reaction (step 2). No effect' of hirudin was shown and therefore thrombin has no effect on the binding of the r31 kD polypeptide to the clot. However, the same amount of hirudin totally inhibits the binding when added at step 1 where fibrin is formed from fibrinogen, as was expected.
These results also show that exogenous transglutaminase increases the binding of r31 kD FBD to clots and furthermore that this transgliataminase reaction is dependent on the presence of calcium ions. Since the exogenous transglutaa~inase used is tissue transglutaminase (in its active form) we expect that the serum transglutaminase, factor XIII, which has to undergo activation by thrombin to form factor XIIIa, will be highly sensitive to hirudin inhibition.
H. ondit'o s o n 125 _r 1 kD BD to t a extra-cellular matrix (ECM) The binding of 125I_r31 kD to the extracellular cell matrix of endothelial cells (ECM) was demonstrated in coassigned PCT Publication No. WO 90/07577, page 144. The binding was now further characterized by examination of the binding of 0.3 ~M 1251-r31 kD FBD to ECM in the presence and absence of exogenous transglutaminas~e; additionally the binding in the presence of transglutaminase was examined in the presence of each of heparin, fibronectin or spermidine.
The results of these experiments demonstrate that the binding of the r31 kD FBD to ECM is increased by the WO 91!17765 PCT/US91/035&1 a ~ 'W-',v~wo1 ~~ W .bn.. ~'..
addition of transglutaminase. Heparin has no significant effect on the binding whereas spermidine, a known inhibitor of transglutaminase, inhibits the binding. Collagen also inhibits the binding, suggesting the possible involvement of collagen as an acceptor molecule on the matrix of the endothelial cells. Fibronectin has little effect on the binding reaction.
These results give more support to the potential use of radiolabeled recombinant FBD polypeptides as radiopharmaceuticals for imaging the initial plaque formation in denudated blood vessels.
Further experiments demonstrating the biological activity of various polypeptide fragments of the FBD of fibronectin are described in Example 9. t -gl-Uptake of Recombinant 125I_31 kD FBD and Fragments Thereof by Stainless Steel Coil-Induced Venous Thrombi in Rats The stainless stee:L coil-induced venous thrombus model in rats was used to study the uptake of labeled r31 kD, r20 kD
and r12 kD FBD po7~ypeptides. The model employed was as described by Maffrand et al. [Thrombosis and Haemostasis 59:
225-230 (1988)].
Experimental Details A. Investictation of the uptake of 1251-31 kD by the stainless steel coil-induced venous thrombus Wistar-derived female rats (200-250 g) were anaestetized by *
Ketamine HC1 plus Xylazin HC1. A midline abdominal incision was made and the inferior vena cava was exposed. A
stainless steel wire coil (a dental paste carrier, fine No.
31, 21 mm long) was inserted into the lumen of the vein at the site just below the junction, and the incision was sutured. Each inscerted device was individually weighed before insertion a:nd each weight recorded. Three hours after the operat ion, the animals were given an i.v.
injection of l ml a:E 0.9% NaI solution in order to saturate the thyroid iodide spool. One hour later, the rats received an i.v. injection of 1251-r31 kD FBD (5 x 106 cpm; loo ~g/kg). The r31 kD polypeptide was labeled as described in Example 3. At 24 hours after the administration of the labeled polypeptide, blood was drawn by cardiac puncture, and the rats were sacrificed. The segment of the vein carrying the coil was removed while taking care to drain away all residual blood. In one group, the segments carry-ing the coil were weighed as such and taken for measurement of radioactivity (the "Thrombus in Situ" group) . In another * Trademark WO 91!17765 PCT/US91/03584 _82_ o~~~ 9~~0 ~.
group the vein sections were incised longitudinally, and the coils carrying the thrombi were carefully removed, weighed and the radioactivity was measured. The blood radioactivity levels were measured using peripheral blood.
Calculation of the results:
In the two groups, the initial weight of each coil was subtracted from its final weight, and the specific radioactivity in each case was calculated by division of the cpm value by the net weight. The specific abtivity of the peripheral blood samples was also calculated.
Results:
At 24 hours, the blood levels of radioactivity were around 5000--10,000 cpm/g, while in the isolated blood clot the specific radioactivity was around 300,000 cpm/g, i.e.~, 30 to 60 fold higher (see Figure 16). When the entire segment of 2o the vein carrying the clot was included in the analysis, and a so-called "specific radioactivity" value calculated, the resultant values were 4-5 fold higher than those of the blood, thus indicating that a good signal-to-noise ratio may be obtained for gamma-camera imaging of blood clots 'n v vo using labeled r31 kD FBD.
the effect of heparin pretreatment was studied in this motel. This kind of experiment is essential because patients that are candidates for thrombus imaging are usually treated with this anticoagulation agent. In order to study this question, a group of rats were treated with heparin (500 units/rat intravenously) 10 minutes before administration of the labeled polypeptide. This treatment of heparin did not affect the uptake of label, as measured 24 hours later.

'8V0 91/17765 PC,'f/US91/03584 d These results demonstrate that thrombus imaging using the FBD of FN may be done in the presence of heparin.
B. Comparison of recombinant 12 kD. 20 1~~ 3rd 31 kD-FBD
polyp~tides in the stainless steel coi:1-i.n~uced venous thrombus model The three recombinant polypeptides were labeled with 1251 as described in Example 3 and utilized in the rat model as l0 described in A above. The results, shown in Figure 17, indicate that each of the three molecules was specifically localized in the clots as compared to the blood, by comparing the specific radioactivities; the specific radioactivity of the clots appeared to be higher with the longer molecules than the charter polypeptides (143,000, 78,500 and 63,000 cpm/g clot for the r31 kD, r20 kD and rl2 kD polypeptides, respectively) , but the differences were not statistically significant. The specific radioactivity values for blood (after 24 hours) were similarly related to the molecular size (7040, 5016 and 3300 cpm/g for the r31 kD, r20 kD and r12 kD polypeptides, respectively) and might reflect differences in the blood clearance rates of these molecular species. Hence, the calculations of the ratio of clot to blood specific radioactivity resulted in values that were similar for the three different polypeptides, and ranged around 20. These results suggest that all three FBD
species (or other fragments of the FBD) could serve for thrombus imaging.

WO 91/17765 PCT/IJ~9I/0358d ~-,~~~a:~~ i ,~;~:.Sxsr-. o ~.
Labelincx of the fibrin binding domain polypeptides for ~mac~nct atherosclerotic lesions and thrombi The fibrin binding domain polypeptides described in this application (the r31 kD, the r20 kD and the rl2 kD
polypeptides), or other polypeptide fragments of the FBD, may be radioactively labeled to carry a radiotracer to a to thrombus'in order to permit its external detection by gamma camera imaging. This application discloses in Example 3 the labeling of these three polypeptides by means of iodine-125 (125I), which has a long half life of 60 days.
Another radioiodine is iodine-131 (131=) which may be used to label the FBD polypeptides using known methods such as described by Uehara et al (1). However, 13~I also has a relatively long half life of 8 days.
optimally, a radiopharmaceutical for clinical imaging of atherosclerotic lesions and thrombi should yield positive results within the first few hours after injection (33).
For such a test a shorter lived radiolabel could be used.
Recent studies have suggested that indium-111 (111In) or technetium-99m (99'°Te) may be more suitable as radiotracers, since they have half-life of 67 hours and 6 hours, respectively (32); another short-lived low energy label is iodine-123 (i23I) with a half-life of 13.3 hours.
The labeling of the FBD polypeptides by 99mTc may be Carried out using known methods (21, 33, 34, 35). 9~'rTc is a very suitable diagnostic single photon radianuclide because of its short half-life, a detection level of 140 KeV with the gamma counter, no particulate radiation and inexpensive, convenient availability. These attributes allow the routine administration of doses of 30m Ci that result in high iC~~3~~'a~ ~~~,.
W~ 91/17765 P~1'/iJS91/fl3584 photon-flux levels facilitating lesion detection by single photon emission computerized tomography (32, 35).
Other radiolabels which may be used to label the FBD
polypeptides include krypton-81m (81n'Kr) and xenon-133 (133Xe), which has a half-life of 5.3 days, as reviewed by Knight (4). Another potential radiolabel is gallium-67 (6~Ga) as described by Yamamoto (36); 67Ga has a half-life of 78 hours.
We have labeled the r31 kD, r20 kD, r18.5 kD and r12 kD
polypeptides and the plasmatic 31 kD fragment by means of ~~lln using the method described for human serum albumin by Hnatowich, D.3., Layne, W.W. and Childs, R.L. in J. Appl.
Radiat. Inst. 33: 327 (1982). Preliminary experiments have shown that the labeled FBD polypeptides bind to preformed thrombi in vitro, measured by the two-step Reaction II
(Example 6) and to thrombi v'vo measured by the model described in Example 7, and giving a high thrombus:blood ratio in the range of 80-200 after 24 hours.
Radiolabelinq off, the 12 kD and 18.5 kD proteins DTPA modification of the 12 kD and 18.5 kD polypeptide fragments of the FBD was performed, essentially according to published methods (Hnatowich, D.J. Layne, W.W. and Childs, R.L. (1982) Tnt. 0'. Appl. Radiat-Isot. ,~"3_ 327-332; Knight, L.C. Kollman, M, Maurer, A.H. and Budzynski, A.Z (1987) Biochim, Biaphys. Acta ,~, 45- 53), using the cyclic anhydride, of DTPA. Aliquots of a dry chloroform solution, containing calculated amounts of DTPA equivalents, were evaporated and reacted with the proteins, in either phosphate - or bicarbonate - buffered saline (pH 7.4 and 8.0~0.2, xespectively). Excess of (hydrolyzed) DTPA was removed by exhaustive dialysis. Labeling was performed with carrier-free l~iIn, in a HC1 solution neutralized to about WO 91/17765 P~'T/US91103584 _g~_ ~~~ tea., ~ ~.
pH 6 with sodium acetate. In one experiment (in PBS) the 12 kD polypeptide produced as described in Example 5 was labeled and this resulted in a thrombus to blood ratio (in the rat model) of 86 (see below), a calculated molar excess of DTPA - over the 12 kD protein - of,5 was employed (there are 5 lysyl E-amino groups and la amino group in the 12 kD
protein). Upon labeling with 111In, free (unbound) 111In was estimated to be below 15% (by TLC).
l0 In another set of experiments (in BBS), a 1:1 ratio betwean DTPA anhydride and either the 12 kD or 18.5 kD protein was employed.
In order to estimate the number of DTPA residues incorporated per molecule of 12 kD, DTPA-modified protein (before separation of the excess of DTFA) was labeled with illln (Knight et al., see above). The number of DTPA
residues incorporated was found to be 0.12 per molecule of 12 kD. The DTPA-labeled 12 and 18.5 kD proteins had identical Superose 12 (gel-filtration) elution profiles as those of the control unmodified protein (retention times of 19.17 min and 18.29 min, respectively - control values are in Table E). Upon labeling with 111In, after separation of excess DTPA, the amount of free (unbound) iiiln was found to be 28 and 29% for the 12 and 18.5 kD proteins, respectively, . which resulted in thrombus to blood ratios (in the rat model) of 27 and 25, respectively.
NMRI, ultrasound and X-ray imaging with metal chelates are described in U.S. Patent 4,647,447. ~n addition, antibody coupling with metal chelates is mentioned at column 7, line 42. Monoclonal antibodies labeled with polymeric paramagnetic chelates and their use in NMRI methods have also been described [Shreve, P. et al., Magnetic Resonance in Medicine 3_: 336-340 (1986) and Brady, T. et al. in Proceedings of the Society of Magnetic Resonance in aci~~a~n~ lt~.
WO 91/17765 -87- P('.TlUS91/03584 Medicine, Second ~rnnual Meeting, Soc. of Magnetic Resonance in Medicine, Inc., San Francisco, p 10, 1983 referenced by Koutcher, J. et al., ,7. Nucl. Med. ~5: 506-513 (1984)].

WO 91/17765 PCT/U~91/03584 r'., :.. ~.i;..~...~1~'"~. -88-~~3~E_ 9 Additional Experiments Demonstrating Biological Acti~yi~ of Various FBD Polypeptides The biological activity of the x31 kD, r20 kD, r12 kD FBD
polypeptides has been described in Example 6. This example will disclose additional results observed using the FBD
polypeptide fragments; these are the 12 kD obtained as described in Examples 4 and 5, and the 18.5 kD constructed, oxidized/refolded, and purified as shown in Examples 4 and 10.
I. Binding to Fibrin Clot The clot formation and FBD binding were performed as described below in a modified version of the two-step reaction II described in Example 6. Tn avoid artifacts of aggregation and precipitation of the FBD polypeptides, the final centrifugation step is eliminated and the clot is transferred to a new tube and then extensively washed.
a. Clotting of "preformed clot'°
Reaction mixtures (300 ~l) prepared in siliconized plastic vials (7 ml) of the gamma counter, contained 150 ~l of Mix I [0.2 x Tyrode's buffer ("1 X Tyrode's Buffer'°: 1 mM Hepes pH 7.35; Dextrose 0.2%; 27 mM NaCl;
0.76 mM NaH2P04; 0.5a mM KCI; 0.2 mM MgCl~), 3U/ ml Thrombin (Sigma), 0.6% BSA (Sigma), 1B mM CaCl2, 150 mM
NaCI, 20 mM NaHCO~, pH 8.0] and 150 ~Cl fresh citrated whole human blood.
protocol: Incubation at 37°C for 3 hrs. The serum is removed by vacuum, and the tubes containing the fibrin ~~~~~ i ~.
W~ 91/17765 PCTlUS91/~i3584 ~gg_ clot are kept frozen at -70°C. Preformed clots can be used for several months.
b. Bindinct of FBD to "t~reformed clot"
To vials containing "preforraed clots" (thawed at room temperature), add 300 ~1 150 mM NaCl, 20 mM NaHCO3, pH
8.0, containinga lx Tyrode's buffer; 0.6% BSA; 5 mM
CaCl2 and 0.15 ~M ~25I-FBD: The binding reaction is l0 carried out (in,the absence or presence of 0.03% sodium iodoacetate may be added to this mixture to inhibit the activity of the endogenous transglutaminase, Factor XIIIa) at 37°C, for 18 hours. The clot is then transferred to a si7.iconized vial, washed 3 times with 1 ml "wash buffer" 20 mM NaHC03, 1% BSA, 1 mM PMSF, 2 mM EDTA), and counted in a gamma counter.
The results comparing plasmatic and recambinant 31 kD with recombinant 18.5 kD, 12 kD, ~5 kD (12 kD FBD fused to 33 kD
CBD produced as shown in Figure 12), and 33 kD CBD are shown in Figure 30. All. the FBD polypeptide fragments bound to a similar degree while the. CBD polypeptide bound only to a very small degree. The 50'75% inhibition caused by the addition of the transglutaminase (Factar XIII) inhibitor iodoacetate shows that traDSglutaminase 'is active in the binding reaction. Its lack of effect on 33 kD CBD binding to clot indicates that CBD binding to clot i~ mediated by a different, possibly non-specif is mechanism. As previously shown in coassigned PCT Publication Plo. X10 90/07577 (page a0 138, lines 1._24), the FBD is covalently bound to the fibrin clot. The participatian of transglutaminase as shown and the biochemical characterization of z25I-FBD-fibrin complex indicate that at least 70% of the FBD polypeptide is covalently bound to the fibrin.
II. Binding,ta Vascular Components WO 91117765 1'Cd'/US91/03584 _90_ ~'~~ ~~::'li~..
In addition to specific binding to fibrin, FBD polypeptides also show a certain degree of non-specific binding to other vascular components with which they come in contact.
Examples of vascular components are endothelial cells (EC), extra cellular matrix (ECl~i), and even fibroneetin itself (FN). This non-specific binding is one of the factors that determine the background level when performing diagnostic imaging procedures. The lower the non-specific binding, the more effective the imaging and the less the total radioactive reagent it is necessary to administer to the patient. Therefore experiments were performed to compare non-specific binding to vascular components of the 12 kD FBD
fragment and 31 kD FBD polypeptide.
1 ml aliquots of 0.3 ~M 125I_12 kD or I25Z-31 kD (5x105 cpm/~,g and 7.5 x lOSCpm/~g in PBS containing 0.1% BSA, respectively), were added in duplicate to 35mm petri dishes (Falcon) containing: confluent endothelial cells ("EC"), Extracellular matrix ("ECM"), (Eldor et al., Blood ~x:1477 (1985)) or immobilized human fibronectin ("FN"), (1 ml per plate of FBS containing 50~Cg/ ml FN, incubated at 4° C
overnight and then incubated for two hours at room temperature with 1 ml of PBS ccntaining 1% BSA for blocking). When indicated "-~TG", dates also contained transglutaminase at 0.02 U/ ml (Sigata~. Experimental plates were incubated for 60 minutes at 3740 in a C02 incubatar, washed 3 times with 1 ml "washing solution" (PHS containing 2 mM PMSF and 2 mM (EDTA). Bound radioactivity was than extracted by incubation far 60 miri, with "Extraction solution" (washing solution containing 1% deoxycholate, 2 mM
PMSF, 2 mM.EDTA, 2 mM NME, and 2 mM iodoacetic acid). The solution is then transferred to tubes and the radioactivity measured in a gamma counter.
The results summarized in Figure 28 show that the 12 kD FBD
polypeptide binds only weakly to the vascular components WO 91/17765 -91- PCT/US91/035~4 W'~, 1 '1'~'~f71~,1.
~a~ ~.s ~ L.9 ~1 II
endothelial cells, extracellular matrix, and fibronectin by comparison to the binding of the 31 kD FBD polypeptide.
III. acterial Bindinc( The involvement of fibronectin in adhesion to, and invasion of, wounds by a wide range of gram-positive bacteria is well established (18). The fibrin binding domain of authentic plasma derived FN has been shown to interact with high affinity to specific receptors on the surface of bacteria.
The sites at which Sta~h~,lococcus aureus typically initiates infection are rich in FN, e.g. blood clots and subendothelium. Furthermore, exogenous FN ~ enhances bacterial adhesion to these sites. FN binds to S. aureus through saturable, specific surface protein receptors.
Scatchard analysis has revealed high affinity receptors with binding constant of 5 x 10"g M, and a range of 100-20,000 receptors per bacterium (19). The expression of FN
receptors correlates with invasiveness and pathogenicity of the clinical isolates. Removal of the FN receptors from ,~, a~eus by mechanical means, or by growth of the bacteria in the presence of antibiotics decreases their ability to adhere to FN. As FN is a divalent molecule consisting of multiple functional domains with cell binding and collagen binding activities in addition to bacterial binding, it can anchor the bacteria to the wound via the various components of the extracellular matrix as well as via the FN receptor in tissue cells.
3 0 ,Another approach to understanding the int~araction between FN
and S. aureus is through the inhibition of the binding of ~
aura to endothelial cells by the FBD polypeptide fragments.
Binding of the 31 kD FBD polypeptide to S.aureus has previously been disclosed (coassigned PCT Publication No.

WO 91/17765 PCT/US91l03584 -92_ ' ~s[~ .y "a, 9 vUt;9ri.o A .
WO/90/07577, pages 146-153). Similar experiments describe below showed that in contrast to the 31 kD FBD polypeptide, the 12 kD and 18.5 kD FBD polypeptide fragments do not bind S. ~reus, and do not inhibit S. aureus in binding experiments. However, the 20 kD polypeptide does inhibit the binding of S. aureus (see Figure 8); this may be due to the additional (non-authentic) C-terminal amino acids (see Example 2) which may affect its activity directly or indirectly through some specific refolding.
The following sections are presented in order to compare the 31 kD FBD polypeptide to other FBD polypeptide fragments both in terms of direct binding to S. aureus, and in terms of inhibition of binding of S. aureus to endothelial cells.

V4'O 91/17765 PCT/US91/03584 Materials and Methods A. -8indincr of labeled FN or FBD to bacteria 1. Direct bindincr in solution Various concentrations of 125I_r31 kD FBD or 1251-FN, were added to 5 x lOg S. aureus bacteria in a PBS solution additionally containing 0.1% Tween~and 1% BSA. The final volume was 1 ml. Total radioactivity in the reaction was assayed using a 20 ~1 aliquot taken immediately after the addition of the bacteria.
The mixture was incubated for 2 hours at 20°C while rocking.
The amount of binding was assayed by removing 100 ~cl of the incubation mixture and layering on top of 0.5 ml PBS
layered on 3 ml 10% Percoll-0.15 M NaCl in a 5 ml siliconized tube. This was then centrifuged at 1,350 x g (4, 000 rpm in a SW bucket rotor) for 15 minutes at 20°C.
The supernatant waa aspirated and the pellet assayed for radioactivity.
2. competition with unlabeled FN FBD and related molecules The procedure followed was identical to the above procedure except that 3 fig/ m:1 l2sl_p31 kD was used and the specified amount of the competing molecule (FN or FBD) was also added to the initial binding mixture.
* Trademark WO ll / 17765 F'CT/US91 /0354 _gq,-srs~: '~~'iL9x:q'( ~., 3. Binding of radioactivel5r labeled bacteria to immo bilized FN
Plastic vials were coated with 0.3 ml of 50 ~cg/ ml FN, or 1% BSA.
The tubes were incubated with shaking at 4°C overnight. The tubes were then washed with 5 ml PBS three times. Then 0.3 ml of 1% BSA in PBS was added and the tubes were further incubated with shaking for 2-3 hours at 20°C (for blocking free sites).
In indirect-binding experiments, the bacteria were pre-1,5 incubated with inhibitor, at 4°C for 2 hours.
The bacteria (4 x 106 pfu/ m1, 3 pfu/cpm) were added to the vials at concentrations indicated in the figure legends.
The final volume of the assay mix was 0.3 ml PBS. The mix was slowly agitated at 4°C for 90-120 minutes.
The tubes were then decanted and washed with 5 ml PBS three times.
5 ml of scintillatian-liquid was added when assaying for binding of 3H-labeled bacteria.

_95_ ~'LoW ..ASP s~di~
B. Inhibition of Bindincx of S. aureus to Endothelial Cells by F$D Fragments I. Iodination of S. aureus S. aureus SA113 (ATCC Accession No. 35556) were grown in Tryptic Soy Broth (Difco Laboratories, U.S.A.) at 37° using a 1 1 fermentor culture. Bacteria were harvested in the middle of the logarithmic phase when optical density reached 2.30 OD (at 660 nm).The bacterial pellet was resuspended in 500 ml of PBS containing 5 mM PMSF and washed 3 times. The cells were then suspended in 100 ml PBS with 1 mM PMSF and 5 mM NEM (N-Ethyl maleimide, Sigma E-3876), heat-inactivated at 88°C for 20 min. for fixation, cooled in ice-water and then stored in small aliquots at -20°C. Before use, the bacterial concentration was brought to 5x109 PFUj ml. A 100 ~aCi aliquot of Bolton-Hunter reagent far protein iodination (Amersham) was evaporated in a glass tube on ioe. Bacterial suspension (1 ml) was added to the evaporated reagent and 2 0 mixed gently f or 10' on ice. The reaction was stopped by adding 1 ml of 0.2M glycine in 50 mM potassium phosphate buffer pH 8.5. The reaction mixture was then suspended in 20 ml PBS ,containing 1 mM PMSF.. After centrifugation at 3000 rpm for 10' at 5°C, the wash step was repeated twice. The final pellet was suspended. in 2.2 ml PBS containing 1 mM
PMSF and stored at -20°C. The specific activity was generally 20-100 PFU/cpm.

WO 91/17765 PCT/iJS91/03584 ii~~ a;~,'0i~.
II. Growth of Endothelial Cells Bovine Aortic Endothelial cells A5P7 (obtained from A.
Eldor, Hadassa Hospital, Jerusalem), were maintained in tissue culture as previously described (Ogawa S.K. et a1 1985 Infect. Immunol. 50: 218-224). The culture media contained DMEM/+1% D-Glucose and 10% FCS (both from Biological Industries, Kibbutz Beth-Haemek, Israel) ZO supplemented with L-glutamine and gentamycin (7 mM and 5mg/
ml, respectively, both from Sigma Chemicals).
The cells were maintained at 37°C and 5.5% C02 in 150 ml tissue culture flasks (Falcon).
Confluent monolayers far binding experiments were prepared in either 24 well tissue culture plates or 35 mm tissue culture plates (Corning Glassware, Corning N.Y.). Wells and plates were preincubated for 30 min. with 0.5 m1 or 1 ml complete medium, respectively, prior to the addition of cell suspension. In a typical experiment, wells and plates were seeded with 5 x 104 and 105 cells, respectively, and used after 3-4 days when culture became confluent.
III. pj~r~.,j~c~ of z25I-S. aureus to Endothel~,al Cells This procedure is essentially as described in the above 3o mentioned reference (ngawa et al. 1985). An aliquot of labeled S~uxeus prepared as described above was diluted in PBS to 108/ ml. 3.5 ul of labeled bacteria were added to a mix containing 200uL DMEM +10% FCS, 33uL 150 mM NaCl containing 20 mM NaHC03, 17 ~1 of PBS or the competitor to be tested, and then incubated for 2 hours with gentle mixing. The bacteria were then added to confluent monolayers W~ 91/17765 -97- PCT/US91/035~4 ~~lr ~t.~G~s~l1 of endothelial cells pregrown as described above . The endothelial cells were washed with saline immediately prior to performing the assay. The mixture was incubated at 4°C
for 1 hour with gentle shaking or 2 hours at 37°C in 5% C02 without shaking. The unbound labeled bacteria were removed by washing 3 times with cold PBS containing 2 mM PMSF and 2 mM EDTA. The bound labeled bacteria were then extracted by shaking at room temperature for one hour in PBS containing 1% deoxycholate, 20 mM Tris FiCl pli 8.3, 2 mM PMSF, 2 mM
EDTA, 2 mM NEM, and 2 mM iodoacetic arid. The extraction was repeated once, and the combined extract was counted in a gamma counter.
Results A. Binding of bacteria to 125-FN or FBD in solute 1. Direct Bindina Experiments were performed in order to determine the binding of 125I-FN or ~25I-rFBD to . aureus bacteria in suspension.
Various amountslof radioactive FN or r31 kD were added to 5 x 108 bacteria incubated for 2 hours and then centrifuged over a 10% Percoll-saline solution. Radioactivity was monitored in the pellet.
The results showed increased binding of 125I-rFBD (r31 kD) to the bacteria in suspension as compared to the binding of the 12SI-FN.
This increased binding of x25I-rFBD to ,~z ~~reus as compared to ~25I-FN binding to S, aureus can be attributed to a higher affinity of a monovalen~t domain in comparison to bivalent multidomain of intact plasma derived FN.

WQ 911177~b5 -98~ PLTlUS91103584 l.~i~.e P a 4~1~
Similar experiments performed with the 12 kD and 18.5 kD FBD
fragments snowed no binding whatsoever.
2 . Competition with "native" unlabeled FN ~ FBD and Related Molecules A fixed amount of l2sl_pa1 kD (3 fag/ ml) was incubated with 5 x 108 bacteria in the presence of increasing amounts of various FBD molecules as competitors.
The results demonstrate that "native" FPT, as well as properly folded p31 kD or r31 kD FBD inhibited the binding of laSl_p31 kD to S. aureus in a similar. fashion, indicating that recombinant 31 kD is as active as the natural plasma-derived molecules. However, the reduced ("scrambled") forms of recombinant or plasma derived FBD
only minimally inhibit the binding of l2sz_FBD to the bacte-ria, indicating that proper folding is necessary for binding. Furthermore, r18.5 kD and r12 kD FBD polypeptides as well as a CBD polypeptide (33 kD cell binding domain of FN) did not compete with binding of 125I_pFBD to S. aureus, showing conclusively that only the complete 31 kD FBD domain has ,bacterial binding activity while the shorter FBD
fragments do not bind bacteria.
B. Bit~dinq of labeled S aureus to immobil~i~ed FN
To estimate the capacity of rFBD (r31 kDj to interfere with the adherence of bacteria to the extracellular matrix in wounds, a competition assay was developed. In this assay, adherence of S. aureus to plastic surface coated with FN, and the interference of FBD with the binding was measured.
The results demonstrate that the adhesion of S. aureus to FN
coated plastic vials was inhibited following pre-incubation of S. aur_eus with FN, pFBD ( 31 kD) or rFBD ( 31 kD) . The WHO 91/17765 -s9- PCT/IJS91/03584 1~ 4~ ~ ~~~i n:.a u' ~;M ~' ~.
extent of inhibition by these molecules was similar. A non-related protein, BSA, which does not have S. aureus binding sites, did not cause any inhibition in adhesion of radioactive labeled S, aureus to FN coated plastic vials.
In similar experiments performed with the 12 kD FBD
fragments, no inhibition of binding of S.aureus to immobilized FN was detected.
C. Inhibition of Bindincr of S. aureus to Endothelial Cells Figure 29 shows the inhibition by FBD fragments of binding of S. aureus to endothelial cells as described above. The 31 kD shown a dramatic and dose dependent effect on aureus binding to endothelial cells. However, neither the 18.5 kD nor the 12 kD have any inhibitory effect, showing that the binding site on the FBD for the S. ua xeu~, receptor is not found on the l2 kD and 18.5 kD fragments. This is a surprising result since this is the first demonstration that the bacterial binding domain of the FBD of fibronectin can be separated from the S. aureus binding domain.
Summary and Conclusion Table C summarizes and compares the activities of various FBD polypeptide fragments as described above.

W~ 91/17765 P'CTlUS9i/035~4 °100--fable C: ComQarison of Activities an;~ Bindinc,~Sa~ecificity of Various FBD Folyt~ept~.de Fragments Activity 31 kD 2s.5 ~2 ~
~

Fibrin Binding High High High Binding to Vascular High Low Low Components Bacterial Binding Yes No No inhibition of Binding of Yes No No S.S. aureus to Endothelial I
' Cells p It is thus seen that the 1g.5 kD and 12 kD FBD polypeptide fragments have a high covalent binding specificity far fibrin, together with a narrower spectrum of activities and lower specificity for other ligands such as vascular components and bacteria than the 31 kD. This is an advantageous characteristic for a thrombus imaging agent, ensuring that as a diagnostic reagent it has a high affinity for fibrin-containing thrombi, while maintaining 'low background levels. An in vivo example of this is provided in Example 13.

wo ~irm~6s -lol- rc:rivs~mo~ssa ~.~~3x. r ~~mpxoved Method of Refalding/Oxidation and purification of Shorter FBD Polypeptides Fragments The recombinant FBD proteins - r31 kD ('°5 fingers"), 18.5 kD
(a more authentic version of the "3 fingers" than the previously described 20 kD) and r12 kD ("2 fingers") - are expressed in E. coli and refolded/reoxidized, before being purified to homogeneity (>98% purity). The refolding/reoxidation processes used for the' full 31 kD FBD
polypeptide (5-fingered) and for the shorter 12 kD and 18.5 kD FBD polypeptide fragments (2- and 3-fingered) are different and have been described above in Examples 2 and 5.
The method of Example 5 has been found to be applicable to all 2- and 3-fingered FBD proteins, that have so far been refolded, but not to the 5-fingered protein, the 31 kD, even when the reduction (followed by reoxidation) is perfarmed on purified plasma-derived 31 kD, i.e., "opening"
and refolding the protein. This procedure has recently been improved without affecting the principle of the refolding process, and the improved procedure has been. found applicable to the 12 kD, 18.5 kD, and 20 kD polypeptides, and to the 95 kD FBD-CBD hybrid polypeptide (12 kD-33 kD) but not to the 31 kD polypeptide.
The process is essentially as described in Example 5. The following description relates to the 12 kD polypeptide arid similar results were obtained for the x.8.5 kD FBD
polypeptide arid 45 kD FBD-CBD hybrid polypeptides; these polypeptides were expressed by plasmids pFN 203-2 (Figure 27), pFN 208-13 (Figure 23) and plasmid pFN 202-5 (Figure 12), respectively.

WO 91/17765 PCT/US91/0358a The bacterial cake was produced as described in Example 2 by fermentation of ~coli strain A4255 harboring plasmid pFN
203-2- (as described in Figure 27). ' A. Crude ~rocessincr of the bacterial cake: The washing and extracl~ion of the pellet was performed in a similar manner to that of the two- and three-fingered FBD
proteins (see Example 5). The bacterial cake was suspended in 20 volumes of 50 mM Tris HC1, 50 mM EDTA, pH 7.4. After 15 minutes of stirring, the suspension was disrupted by twice passing it through a Dynomill~ kD 5 bead mill at 50 liters/hour. The disrupted suspension was centrifuged ( 14000 x g in a Cepa 101 cs~ntrifuge at a feed rate of 80 liter per hour. The pellet w,as suspended in the above buffer to a final volume 10 times that of the original bacterial cake's dry cell weight. The suspension was brought to 37°C and lysozyme added (2500 U/ ml). After 2 hours of stirring at 37°C, Triton X-100 (1%) was added and incubation with stirring continued for 30 min at room temperature. The suspension was then diluted with an equal volume of deionized water, sonicated by a W 370 sonicator and centrifuged at 14000 x g under the same conditions as above.
The pellet was washed twice by resuspending in deionized water to a final volume 16 times that of the dry cell weight of the bacterial cake, and stirring for 15 min at room temperature at pH 7.4. After stirring the suspension was sonicated with a W 370 sonicator and centrifuged at 14000 x g under the same conditions as above. The washed and extracted pellet containing inclusion bodies of the FBD
polypeptide is kept frozen at -20°C until further processing.
B. $efoldinq,/reoaidation: The resulting washed inclusion bodies (100 g - representing 19.2 g of dry weight) were solubilized in 5 volumes of 10 mM Tris HC1 pH 8.0, 5 * Trademark WO 91/17765 PC:T/US91/03584 mM EDTA, 1 mM phenylmethanesulfonyl fluoride (PMSF), l0 mM
~-aminocaproic acid, containing additionally 6 M guanidine HCl (final volume 600 ml). The sample was reduced by the addition of 2.27 ml of ,8-mercaptoethanol (final concentration: 50 mM) and stirred at room temperature in the absence of air, i.e., in a sealed container, for 90 minutes. The reduced protein was reoxidized (at a protein concentration of 0.81 mg/ ml) in 0.54 M guanidine HC1, as follows: 6 liters of the Oxidation Buffer (l0 mM Tris HCl pH 8.0, 5 mM EDTA, 1 mM PMSF 10 mM e-aminocaproic acid, containing additionally 0.3 mM oxidized glutathione (GSSG), were added to the solution of the reduced protein while stirring at a rate of 150 ml per min. The oxidation process was continued for 65 hours at room temperature in a closed container, while being constantly and gently stirred. The solution of the reoxidized protein was filtered through Whatman Ho. 3 filter paper to remove the precipitates and then concentrated 10-fold on a Pellicon tangential flow ultrafiltration unit equipped with a 3 kD MW cut off membrane and diafiltered on the same membrane, in order to remove the guanidine HCl, the ~B- mercaptoethanol and the GSSG. A further precipitate, which developed upon standing at 4°C overnight, was removed by centrifugation at 22,500 x g for 45 minutes. (For the I8.5 kD and 45 kD polypeptides, ultrafiltration and diafiltration were performed with a 10 kD molecular weight cutoff membrane.) C. Puxif~,aat~,nn: The concentrated and clarified solution (700 ml) was loaded on a Q-Sepharose column (2.5 x 28.5 cm), ~r~ull:Lbrated in 10 mM Tris HC1, 5 mM HDTA, 1 mM PMSF 10 mM s-aminocaproic acid, pH 8Ø The flow-through of the column, containing the 45 kD protein, was applied -in portions of 170-350 mg) onto a Heparin-Sepharose column (2 x 6.5 cm), equilibrated in 10 mM Tris HC1, pH 8.0, 5 mM EDTA. After washing the unbound protein with this buffer, the bound protein was eluted with the same buffer, WO 91117765 PC: T/U~91 /035.1 -io4-~~' ~ ~~,'i ~.
containing additionally 500 mM NaCl. The eluates were pooled and kept frozen at -20°C.
As stated above, this procedure was applied with minor modification to both the 18.5 kD polypeptide and the 45 kD
FBD-CHD hybrid polypeptide. The results for both these polypeptides were very similar to those obtained for the 12 k1~ polypeptide.
Use of buffer containing at least 0.5M NaCl for elution from Heparin-Sepharose and storage was found to be necessary to ensure stability of the polypeptides, which otherwise tended to rapidly lose their activity; this applies particularly to the 31 kD polypeptide.

WO 91/17765 ~ .~,~.~.J~'J;~JJ1/03584 -105-- p~,~", ~~W c';< d EXA_1.~'hE 11, Characterization of FBD Polypeptide Fracrments I. Procedures The FBD polypeptide fragments produced by the methods of this application were evaluated and compared in a series of characterization tests by the following methods known in the art. ' 1. BDS-PACE +P4E (ME - ~-mercaptoethanol): 12.5 %
acrylamide slab gels are loaded with protein, which had previously been treated by boiling 5 minutes in sample buffer containing 1% SDS - under reducing conditions (+ 1%
ME). Electrophoresis was performed with 20 ~Cg per lane and the gels stained with Coomassie Brilliant Blue. The parameters measured are: a) the mobility, which, when compared with molecular weight markers .(94, 67, 43, 30, 20.1 and 14.4 kD) can be expressed in terms of an apparent molecular weight for the protein studied; b) the homogeneity or purity, which can be assessed from the relative intensities of the major and minor hands.
2. BDB-PAaE ~ME: 12.5 % acrylamide slab gels are loaded with protein, which had previously been treated ~ 5 min boiling in sample buffer containing 1% SDS - under non-reducing conditions (-ME). Electrophoresis is performed with 20 ~g per lane and the gels stained with Coomassie Brilliant Blue. The parameters measured are: a) the mobility, which, when compared with molecular weight markers (94, 67, 43, 30, 20.1 and 14.4 kD) can be'expressed in terms of an apparent molecular weight for the protein studied; b) the homogeneity or purity, which can be assessed from the relative intensities of the major and minor bands V1'O 91/17765 PCT/US91103584 - in particular, under these conditions, one can evaluate the amounts of disulfide-linked dimers.
3. ail filt:ration on Sup~ros~ 12: The apparent -~olecular. weight and the homogeneity of the protein preparations were evaluated from elution profiles obtained on a Superose 12 column (HR10/30, Pharmacia Fine Chemicals), attached to either an FPLC apparatus, equipped with a liquid chromatography controller LCC-500 and recorder (Pharmacia Fine Cheamicals) or to an HPLC system (Waters Associates), consisting of 2 pumps (Model 501), an injector (Model U6K) and an automated gradient controller (Model 580) equipped with a variable wavelength detector -Spectro-Monitor * 3000 (LDC/Milton Roy) - and a Chromato-Integrator'~(Merck-Hitachi, Model 2000). The column was calibrated by the following molecular weight standards, whose retention timea were determined : bovine serum albumin (67 kD), ovalbumin (43 kD), chymotrypsinogen (25 kD) and ribonuclease (13.7 k:D) . The flow rate was 0.8 ml/min, using the standard running buffer,i.e., 150 mM NaCl - 20 mM
Tris.HCl, pH 7.8-8Ø Two parameters were monitored: the retention time and the half-height bandwidth.
4. Dv spectroscopy: Spectra were obtained at room temperature in BBS or PBS at concentrations of 0.2-1 mg/ ml on a Philips UV/Vis scanning spectrophotometer Model PU8720 (bandwidth 2 nm) .equipped with a printer/plotter. The spectra were measured in Pye Unicam UV silica cells of 10 mm path-length. Both the absorption coefficient, i.e., E1; at the spectrum's i~ax, and the ratio between the absorbances at ~t~ and imin werE' monitored.
5. Intrinsic fluor~sc~ac~: Data were obtained on a Jasco spectrofluorometer, Model FP-770 at 25°Ct0.1°C.
Excitation wavelength was 280 run and both excitation and emission slits were set at 5 run. The concentration of * Trademark V1'O 91/17765 PCT/US91/03584 proteins in the assay was 8-25 ug/ ml in either PBS or fresh BBS, pH 7.5. There is a marked pH dependence of both measured parameter: , i . a . , ~lm~ ( the wavelength of the spectrum's maximum) and the specific intensity (the fluorescence intensity at the spectrum's maximum normalized by the protein concentration in mg/ ml).
6. llaino acid coaposition: This test is performed according to the Stein & Moore proven methodology for amino acid analysis. Proitein hydrolysis is performed on dried protein following treatment in a Speed Vac centrifuge (Savant): 6.0 N HC1 is added, 1 ml per each mg of protein;
nitrogen is substituted for air by successive evacuations and rinsing by nitrogen. The tube is sealed and heated for 22 h at 110 ~ 0.1°C. The currently used method is essentially in compliance with the USP Drafts of Biotechnology-Derived Products, 1989 USP Convention, Inc..
<954> pp 96-98. The analyzer in use is a Biotronic LC 5000, serial number 515-01.. The parameter evaluated by this method is the number of residues of each amino acid, except for Cys and Trp.

7. Heparin-eepharose chrosatography: Samples of up to 200 ul were injected onto an analytical Heparin-Sepharose column (5.5 x 0.5 cm), attached to an HPLC system (Waters Associates) , consisi~ing of 2 pumps (Model 501) , an injector (Model U6K) and an automated gradient controller (Model 580) equipped with a variable wavelength detector -Spectro-Monitor 3000 (LDC/Milton Roy) - and a Chromato-Integrator (Merck-Hitachi, Model 2000). The column was preequilibrated in 10 mM Na-phosphate pH 6.5, 75 mM
NaCl at a flow rate of 0.5 ml/min and washed for 5 minutes in the same buffer. The proteins were eluted in a linear gradient from 75 to 500 mM NaCl in buffer in 37.5 minutes.
Two parameters werca evaluated, the retention time (ret.
time) , which is proportional to the salt concentration at * Trademark VVO 91/17765 -108- PCT/US91/0358.~
which the protein elutes and the half-height band width (half-ht. b.w.), which assesses the peak's homogeneity.

8. Rsvarss phase-BpLC chromatography: Samples were injected onto an analytical Waters C18 Bondapak*reverse phase column (30 x 0.39 cm), attached to an HPLC system as in Section 1.7. The: column was preequilibrated in 80% H20, 0.1% TFA/20% acetonitrile, 0.08% TFA at a flow rate of 1 ml/min and washed for 5 min with the same solvents. The IO proteins were eluted in a linear gradient to 40% H20 - 0.1%
TFA: 60%' acetonitrile - 0.08% TFA in 40 minutes. Two parameters were evaluated, the retention time (ret. time) and the half- height band width (half-ht. b.w.), which assesses the peak's homogeneity.

9. Trpptic maps: 200 ~cg samples of the various batches were digested for 10 min at 37° at various trypsin w/w ratios, in %: 0.25, 0.5, 1.0, 2.5, 5.0 & 10Ø The reaction was stopped with 5 mM PMSF, and following 30 min on ice, was treated. with sample buffers ~ME (see Sections 1.1.& 1.2.) and run on 20 % acrylamide slab gels - as above.
The degree of equivalence between the band patterns was assessed after staining with Coomassie Brilliant Blue.

10. Ellaan's =~thod for thiol d~t~raination in proteins: The detE:rmination is performed on denatured proteins, in order to enable full exposure of thiol groups.
8tocx solutions: :L. Guanidine-HC1 (of purest quality available) 7.2 M in 10 mM Tris-HCl, pH 8 (GuCl); 2. DTNB
(Ellman's reagent) 5x10 -3 M in 100 mM K- phosphate buffer, pH 7.
I~Isthod: A protein sample containing 10-100 ~M of thiol groups is made up to 0.15 ml; a DTNB blank, (i.e. without * Trademark WO 91/17765 -lob- d'CT/1J~91/03584 a. tm protein included); 0.?5 ml of GuCl 7.2 M is added to give a final concentration of 6 M. After incubation for 15-30 minutes at room temperature, the blank of the protein solutions is read at 412 nm. 100 ~1 DTNB is then added to a final concentration of 5 x 10-4 M. After incubation for 30 minutes at room temperature, the samples are read at 412 nm versus the DTNB blank. The concentration is calculated using e= 13,600 M-lcm-1, i.e., 100 psM of thiol groups give an absorbance value of 1.36.

11. Pr~cipitati~a/Acisorpticn Eppendorf tubes containing frozen 1251-FBD are allowed to thaw at room temperature, and then mixed by vortexing. Two 5 ~S1 aliquots are removed for radioactivity monitoring.
.~7hen high specific activity 125T-FBD is used, dilution in siliconized tubes with high salt buffer (0.6 M NaCl- 20 mM, NaHCO3 pH 8-9) should be carried out before counting. The stack solution is then centrifuged at top speed in an Eppendorf centrifuge and the supernatant removed to another siliconized tube. Two 5 ul aliquots are counted again. The differences between the radioactivity obtained before and after centrifugation represent the "percent precipitation".
When 12~T-F)3D is kept frozen (at -70°C) in siliconized tubes and in the high salt (0.6 M NaCl) buffer the protein is quite stable. We found only minimal precipitation of 125_ FBD of 0-7% within a period of 2 weeks. However, when kept in non-siliconized tubes and in a law salt (150 mM NaCl) buffer, 125x-FHD precipitation could be as high as to 60-80%
in Z-3 days, Under these conditions both precipitation and adsorption to the tube are substantial.

12. Eteaction of FBD arith 14C-putr~scin~

The reaction measures the accessibility of Gln #3 of the FBD
to the transglutaminase reaction of Factor XIIIa).
Method: The reaction mixtures (100 ~1) in siliconized Eppendorf tubes conl~ain: 10 mM CaCl2, 50 mM Tris-HC1 (pH
7.5), 5 mM DTT, 120 ,uM 14C-putrescine (Sigma), 6 ~cM FBD and 0.05U/ ml guinea pig liver transglutaminase (Sigma). After incubation at room temperature for 0,15,30 and 60 min, aliquots (10 ul) are' added to tubes containing 200 ul stop reagent (0.4 mg/ ml BSA, 50 mM EDTA, 150 mM NaCl, 20 mM
NaHC03, pH 8.0) at Cs°C (on ice) . Cold 20% TCA (250 ~1) is added and following 10 min incubation on ice, an additional 3 ml of cold 20% TCA is added and the tube content is filtered on a glass fiber filter (Whatman GF\C) . The filters are washed 3 times with cold 20% TCA and once with 70%
ethanol. TCA precipit:able radioactive material was monitored in a beta counter. The accessibility of Gln #3 in the FBD
to transglutamination was calculated based on the specific activity of 14C- putrescine and on the concentration of FBD
in the reaction mixture; incorporation of 5% of the total counts is equivalent to 100% accessibility.

13. self I~ssociation The reaction is carried out in 300 ~C1 of a 150 mM NaCl-20 mM
NaHC03, pH 8.0, containing also: O.lx Tyrode's buffer; 0.6%
BSA; 5 mM CaCl2; 0. J_5 ~M 125I-FBD; 6 ~1 Transglutaminase (0.02U/ ml) - see Section 12.
Reaction mixtures were incubated at 37°C for 18 hours, followed by vacuum aspiration of the reaction solution, washing 3 times with 1 ml "wash buffer" and measuring the radioactivity in a gamma counter.
* Trademark WO 91/17765 PC.'T/US91/035~4 ~ v ~r ~ ~'~ a.m z a ~, A ~,.
II. Results All the FBD proteins contain an extra methionine at the amino terminus, and instead of the pyroglutamate residua, which is the blocked N-terminus of the p31 kD (obtained by post-translational modification from the coded Gln), their N-terminal Met is followed by a Gln residue. The positive l0 identification of FBD proteins was also confirmed by Western blot analysis of the gels - developed with anti-20 kD. The 45 kD was identified by developing its blots with both anti-20 kD and anti-33 kD of the cell binding domain.
The FBD fragments and the 45 kD FBD-CBD hybrid were further characterized by a variety of: a) physico-chemical tests as described above in comparison to the 31 kD (see Tables C and D) .
b) biochemical and biological tests in vitro: accessibility of Gln ;~3 to transglutaminase-catalyzed transamidation (see Tables C and D); and self association. Binding to preformed fibrin clots is described in Example 9.
c) biological tests in vivo: binding to venous thrombi in rats is described in Example 13.
Table D details the parameters assayed in the chemical and physico-chemical characterization of FBD polypeptides and of 'the FBD-CHD hybrid,~The 12 kD, 18.5 kD and 45 kD
palypeptides were produced by plasmids pFN 203-2, pFN 208-13, and pFN 202-5, respectively.
Table E provides actual measured values for the FBD
polypeptides assayed.

WO 91!17765 PCTlUS91I03584 -11~-s~'e'~.
G. aracterizat'o a amete s far the F of ' s M8'.~HOD PTER~

1. SDS-PAGE +ME molecular weight (,rte. markers);

purity & homogeneity 2. " -ME molecular weight (cue, markers);

purity & homogeneity 3. Gel Tilt. retention time; half-height (Superose 12) bandwidth 4. UV spectroscopy absorption coeffic.l~ax1%.;absorbance ratio ~~ax/amin 5. Intrinsic specific intensity (I/prot.

f luorescence cone ) ; Rm~
I

I Amino acid residue number - equivalence 6. to composition theoretical value 7. Heparin- retention time; half-height Sepharose bandwidth 8. RP-HPLC retention time; half-height bandwidth 9. Ellman Free thiols.

lO .Reaction with, Percent of theoretical binding -14c-putrescine representing accessibility of Gln ~3 to transglutaminase dependent transamidation (<0.5%

binding in the absence of the enzyme) .

v W i.'a is-o A
aP ap co co vr1 ~ b o~,o' m ~ ~; ro a~
M A A r-I . O ~'> 7'd N x x ~ r . O

~ ~ ~ ~
a co r >~ r o0 C1 N r1 f'1'-i f~ rlW 1.J

op dP

O O

AI ~I -r.l G7 d1 O
G C C

G7 Ca ~ TJ 'O 'C3 x x ~n ~
W N ri t0 O O O
e9'3' ri N C f:~., O
E
O

I

p, A ~ ~ O
~ to s0 _ a .N
o~ ov N f0 ~, /~IAI C er 1!
r4 lt1O C, U r-I
~ C~ ~ N ~ ri d, W
N d' O tt1 ,~", ./ O
a N ' B1 ~ GY'J
ri rl r-1 rl l'1 W .E.1 A

W

~ dP dp 0 GO 00 C1 M .~Jrl /~inl ~ 'e9' ~ oo O ~ U
W ~ '~A',~ .,.I
~ r~ a r01.N
W n r rt!
"'~ N ci o ~ a~
co r H co 00 a' O' .G>
r-1r1 .-~ rl C7 W .t>

...

o ~ ro o N f-1 U CIr~lr1 W .L~UI .La I U U .8~

~ ro ~Xi K4 ~-IN C d,1 N
rl H C1~ W d p, ~ ri faO O

N

p ~ ~ ~

c C7 ~ w ~ U
l~ ..

P~

.

ri N M V~ Ifi ~0 WO 9i/1$064 _~ 14_ PCTlGB91100~11 ~ c i rn o ~o N ~ r.

r1 N N VI O~
O~

U J~! ~
F3 ~ . ~ C

'Cf'C
Z N ~ i~
J.aJJ

~ a o 0 a ~ >~

~, c c o ~ ..~
s s ~. ~ o U7 r! lL1 N .
.

a s-I r-1 O O
f"1 N V) a-1 Q .w .,.

~ i~ N dP dP
1~ O N O

s . . v ft1 N f'7 O ~D
~ ~"'~ N VI CO

.C;

.1.~
!", ~ G 0 N
b x ~

v o v Q

Cw E0 ~1 r1 WO 91/17765 PCT/US91/035$d °115-yc~~,,~~~.a~a d EXAMP E 1.2 D'rected thrombolysis uti~lizin~FBD-SK complexes I. ~ntraduction Simple and efficient fibrin-directed thrombolytic agents are a major goal of the pharmaceutical industry. Our approach l0 for the development of such a drug is based on the observation that the N-terminal fibrin binding domain of fibronectin (FBD) can be specifically cross-linked to fibrin clots by Factor XIIIa. Since newly formed thrombi are the only environment which is enriched in activated Factor XIII, Z5 FBD may display preferential binding to new over old thrombi and become an ultimate targeting vehicle. We therefore generated, by chemical cross-linking, chimeric FgD-Streptokinase conjugates and analyzed their activity in clot dissolution.
Tissue plasminogen activator (TPA) arid Streptokinase (SK) are known as the best fibrinolytic agents used in cardiovascular therapy. TPA and SK both degrade fibrin, but they differ in their mode of action. TPA exhibits fibrin -selective plasminogen activation. The selectivity of TPA is due to the presence of fibrin binding sites at the amino texx~naainal region of the molecule. TPA binds to fibrin with a Kd of 0.16 ~tM. When bound to fibrin, its Km for the process of plasminogen activation decreases from 83 ~cM to 0.18 uM resulting in an efficient enzymatic conversion of plaaminogen to plasmin.
SK interacts with plasminogen to farm an activation complex capable of catalyzing the formation of plasmin. This interaction is net dependent on' fibrin binding. The activated SK-plasminogen complex in the blood stream may wo 9ir~77ss Pcrrus9aro3s~a alyze a systemic conversion of circulating plasminogen to ~~,.~rR.:o:~, ~l.smin. The activated lasmin is p p preferentially inhibited by a2-antiplasmin. once the inhibitor capacity is exhausted, free fibrinogen, fibrin and some other plasma proteins are degraded by plasmin. rrhe resulting fibrinogenolysis causes disruption of the normal coagulation mechanisms, increasing thereby the risk of hemorrhage.
Due to the affinity of TPA to fibrin it is assumed to be advantageous as a fibrinolytic agent relative to SK which does not bind fibrin. TPA and SK were recently compared for their therapeutic efficiency in several large scale human clinical trials. According to the accumulated data SK is the agent of choice for most patients (Scrip No. 1597, pages 22-23, Piarch 8, 1991) . A mayor interest still exists in developing an improved fibrinolytic agent with increased fibrin selectivity. Hoth chemical cross-linking and recombinant DNA methods are used to design the desired molecules. Several chimeric plasminogen activator molecules 2o have been constructed containing various high affinity fibrin binding domains of several plasma-derived proteins or anti--fibrin monoclonal antibodies bound to the catalytic domain of TPA. These molecules are being analyzed by several pharmaceutical companies for their therapeutic efficacy.
Activated factor XIII (transglutaminase) catalyzes the crass-linking of fibrin molecules in the final step of blood coagulation, thereby increasing the mechanical stability of the clot. As described in Example 6H, intact plasmatic fibronectin (fN) is also cross linked to fibrin by factor XIITa.
As described in Examples 2 and 4, applicants have cloned and expressed FBD polypeptide fragments of the FN (12 kD, 18.5 kD, 20 kD and 31 kD). These polypeptides have been WO 91/17765 -11~- ~'t.'1'/US91/03584 st ~~l ~, studied in vitro and in vi~o for their ability to become covalently bound to fibrin clots and thrombi in the presence of factor XIIIa (Example 6, 9, 13). We decided to take advantage of this intrinsic ability of the FBD molecules with respect to their covalent binding to fibrin and to generate by chemical cross-linking (or by recombinant DNA
methods) chimeric FBD-SK molecules in order to target SK to the thrombi, thereby reducing the risk of hemorrhage.
II. Chemical derivatization and cross-linkinct of FBD and SK
FBD polypeptides and fragments spanning the amino terminal region of FN were derivatized with N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) - a heterobifunctional cross-linker.
SPDP reacts at alkaline pH with primary amines introducing 2-pyridyl- disulfide groups into the protein. By measuring the absorbance at 343 nm, which in this pFI range is specific for the thin-pyridine group released after the reduction of the modified FBD, the number of cross-linker groups per FBD
molecule was calculated. With the plasmatic 31 kD FBD
molecule very poor reacticn yields were obtained as it tended to precipitate under the conditions of the chemical modification. Further experiments were performed with the recombinant 12 kD FBD molecule produced by plasmid pFN 196-2 (Figure 10). Approximately 2 residues of cross-linker were found to be introduced per each 12 kD FBD molecule.
SIC, which leaks cysteine residues was derivatized with 2~-iminothiolane. xhis reagent reacts with primary amines, introducing a charged spacer ending with a thiol group. The number of the thiol groups introduced in the SK molecule was determined by the use of Ellman's reagent. Under the conditions of the modification it was found that about 2 thiol groups were introduced per SK molecule.

f as ~vL'ssPn i By mixing the two derivatized polypeptides the free thiol group will exchange with the 2-pyridyl-sulfide group, forming a disulfide bond between the two proteins and releasing pyridine-2-thiol. Conjugation was found to be optimal at 4 to 8 times molar excess of the derivatized FBD.
Under these conditions essentially all derivatized SK
molecules had reacted with FBD molecules. The conjugation process was analyzed by SDS-PAGE and by gel filtration on FP1;C attached Superose 12. Complex formation was complete in about ZO minutes, yielding a mixture of molecules with variable FBD and SK content.
The chemical modification and cross linking reactions were performed according to Runge et al., PNAS, USA, $4: 7659 7662 (1987).
Under the optimized conditions established for the chemical modification reactions, the calculated number of pyridyl-disulfide and thiol groups on each of the FBD and SK
molecules is about 2. The conjugation mixture thus formed contained mostly the desired 1:1 hybrid.
Isolation of the FBD-SK complex Separation between conjugated and free SK and FBD molecules was carried out in two steps as follows: First, gel filtration on Superose 6 was performed in order to remove excess Z2 kD FBD. Second, chromatography on Heparin-Sepharose was used to separate free streptokinase from the conjugate which binds to the resin at 25 mM NaCI, 10 mM Tris/HCl, pH 7.h, and was then eluted with 0.5~I NaCI
in the same buffer. Contamination by free SK, as judged by gel electrophoresis accounts for less than 5% of the final preparation.
~'unct~.onal c aracterization of the FBD-SK complex W~ 91/17765 -119- PC'I"/11591/035~
t ~~v~L.DIM A ~.
The cross-linked FBD-SK complex, purified by Heparin-Sepharose chromatography, was compared to native SK
using the following criteria;
1.. Kinetics of plasminogen activation using the chromogenic substrate S-2251 of plasmin (Figure 33).
2. Fibrinolytic activity utilizing the fibrin-plate assay (Figure 34), according to Neville Marsh, Fibrinolysis, 1981.
3. Human plasma clot lysis, using 1252-fibrinogen, for clot. formation.
The results indicate that the complex retained a level of plasminogen activator activity comparable to that of SK.
From Fig. 33 the apparent K~ .values for the plasminagen substrate, Kplg, were 3.1 x 10-~i and 1,.8 x 10-6M for the SK
and the FBD-SK complex, respectively, whereas the catalytic rate constant for the complex, kplg, was found to be lower by a factor of 2 than that for SK. Furthermore, Fig. 34 demonstrates no significant difference between the lysis zones formed after avernight incubation by either SK or the FBD-SK complex.
In addition, 14C-putrescine was incorporated into the complexes by guinea pig liver tranaglutaminase to about 40%
of the level incorporated into the 12 kD FBD (Figure 35);
34 compare with Table E, Example 11. DTT 9.ncreased incorporation into the complex up to 140. No incorporation inta SK was observed. These findings indicate that the FBD-SK conjugate has retained the potential of becoming cross-linked to thrombi by activated Factor XIII.

W0 91/17765 PC I'/US91/03584 ~~~~~ s ~., -120-Applicants additionally envisage construction of a chimera FBD-SK polypeptide encoded by a recambinant plasmid.

In vivo Labelling of Thrombi by_ 111In-labelled 12 kD and 18.5 kD-FBD in the Rat Stainless-steel Coil Model The model employed is essentially that described in Example 7. Recombinant 12 kD-, 18.5 kD- and 31 kD-FBD polypeptide fragments were labelled with lilln by the DTPA method (Example 8). The labelled materials (specific activity approx. 5x10fi cpm/~Cg) were administered intravenously (5x106 cpm/rat) into coil- bearing rats (Example 7) 5h after insertion of the coils. The coils bearing the thrombi were removed and counted 24h after administration of the label.
Figure 31 presents the results of the specif is radioactivity in the clots and blood, and Figure 32 presents the respective thrombus to blood ratios . As shown, high thrombus specific radioactivity values were obtained with the three compounds. Higher values were found in the thrombi of the 31 kD FBD group, than in those of the 12 kD- and 18.5 kD-FBD
fragments. However, the thrombus/blood ratios were higher for the 12 kD and 18.5 kD-FBD fragments, due to lower blood levels, as compared with the 31 kD-FBD. This may be due to the narrow spectrum of specifities and activities of the shorter fragments by comparison with the 31 kD
polypeptide (Example 9, Table C).

i~VO 91/177bS 1'CT/US91/03584 -lzl-~~~14'1 ~~~~.os~ a ~.
.ALE 14 Use of FBD polS~eptides in Wound Hea inch In early events of wound healing the epithelium migrates over a gel layer of fibrin and fibronectin, before the permanent basement membrane components, such as laminin and type IV collagen, are reformed. The initial plasma-derived gel, that contains both fibrin and fibronectin, is readily to invaded by fibroblasts and serves hemostatic and adhesive functions, providing a provisional matrix for cell migration and a reservoir of chemotactic and growth factors ("wound hormones"). The fibrin extravascular gel, which rapidly foxzas a lattice, incorporates fibronectin. It has been shown that the fibroblasts in vivo attach to the fibrin lattice primarily via fibronectin (Grinnell, F. et al. (1980) Cell Z9 517-525; Calvin, R.B. et. al., (1979) Lab Invest.,~,l 464-473; Knox, P. et. al. (1986), J. Cell Bawl. ,~ 2318-2323).
It is therefore believed that the initial processes of wound 2o healing require both the fibrin binding and cell binding domains of fibronectin: Since the attachment of fibronectin to fibrin occurs presumably via the transglutaminase -catalyzed transamidation of Gln-3 of fibronectin to fibrin lysine residues, any fibrin binding domain polypeptide that contains an intact structure of the region surrounding Gln-3 should be able to act in this system. Thus applicant's l2kD
and 18.5kD polypeptide fragments of the fBD may also be used together with a CBD polypeptide to enhance wound healing.
2tote that recombinant CBD palypeptide may be used, such as the r33kD and r40kD described in copending PCT patent application ~'o. WO 90/07577.
In order to assess the potential of the FBD of human fibronectin in promoting wound healing, it was tested in a cell spreading assay. In this assay fibroblasts are allowed to spread on glass coverslips to which a CBD polypeptide has WO 91/17765 1'CT/US91/03584 n ~~,,n~w~
..~ ~.:,, ~:~ ~,...
been absorbed in the absence or presence of a FBD
polypeptide. Thus, the FBD domain polypeptide is tested for its ability to act as an enhancer of cellular focal adhesion, as a co-substrate with fibronectin's cell binding domain. When used in combination with the 75kD cell-binding domain (CBD) derived from bovine plasma fibronectin, the plasma-derived FBD, p3lkD, and the recombinant FBD, r3lkD, both from human origin, were found to be indistinguishable in their ability to promote focal adhesion of NRK
fibroblasts. Both human protein domains were much more effective than the corresponding fragment from bovine origin , when used at the same concentrations, i.e., 100~c1 of 10~g/ml of a 1:1 mixture of FBD and CBD proteins (see below for experimental details). The difference between the effects of the 75kD CBD alone and in combination with FBD
was striking. Interference reflection microscopy (IRM) of cells spread on the 75kD CBD alone, showed only amorphous 'grey' patches and spots (which, from electron microscopy -EM - of ventral membrane replicates, are known to be 2o associated with clathrin-based structuresa), but incorporation of FBD (recombinant or plasma-derived) as co-substrate induced formation of clearly-defined focal adhesion structures, visualized in IRM as dense black streaks (the density of color showing closer contact of the ventral surface to the substrate). IRM/EM correlations showed that these tight, ordered adhesions corresponded to the termini of cytoskeletal stress fibers.
For further investigation of the combined effects of the FBD
and CBD on wound healing the 45 kD polypeptide (12 kD FBD -33 kD CBD) and 64 kD polypeptide (31 kD FBD - 33 kD CBD) were constructed (Figures 12 and 25 respectively). Similar hybrid polypeptides are envisaged using 12 kD or 18.5 kD FBD
instead of the 31 kD FBD and using the 40 kD CBD polypeptide instead of the 33 kD CBD polypeptide.

Experimental Details Both the p75kD CBD (from bovine origin) and the 3lkD FBD
(from recombinant human origin) polypeptides at a concentration of 10~g/ml in PBS, total volume 1001, were allowed to adsorb in a humid atmosphere for 1 hour at room temperature to l3mm glass coverslips (Chance Propper Ltd.
Warley, UK), which had been treated overnight with conc.
H2S04 and rinsed extensively with distilled water. Following washing with PBS pH 7.1 the coverslips were incubated with ovalbumin (lmg/ml in PBS, Sigma Chemical Co.) for 10 min at room temperature in order to reduce non-specific attachment.
The spreading assay was performed with NRK cells, subcultured for 18 hours before being detached by O.lmg/ml TPCK-trypsin (Sigma Chemical Co.) and resuspended in Ca2+-containing Eagle's minimum essential medium (1~) for 20 min at 37°. These cells were obtained in a single-cell suspension by gentles sucking into a 5ml syringe fitted with a hypodermic needle, followed by 3 washes with EMEM
containing 2% w/v ovalbumin. The spreading of the cells was monitored by resuspending the washed NRK cells on the coverslip with the protein substrate at a density of 1x104 cells/cm2. They were examined by interference reflection and phase contrast microscopy, using a Leitz Ortholux III
microscope equipped with x50/1.0 and x100/1.32 PHACO RK
objectives and photographs were taken (Kodak technical Pang 2415 35mm film) . After 2 hours the live cells were fixed with 2.5% v/v glutaraldehyde (TAAB Labs, Reading, Berks, U.K.) in 0.1 M sodiwm cacodylate buffer and the fixed cells were examined by EM.
* Trademark WO 91/17765 -124- P~/US91/03584 BZ7~MPLB 15 : Ose of 111In-DTFh modif ied FHD proteins with ~~gh radiochemical puritp in order to obtain h~ich thrombus to blood ratios in a rat model.
s 1. Modification and radiolabelincr of DTPA-modified FBD
groteins The methodology of D'7CPA modification and the radiolabeling of DTPA-modified FHD proteins described in Example 8 have been improved. These improvements have enabled the obtaining of high thrombus to blood ratios in the coil model in rats.
1.1 DTPl~-modification: All three recombinant molecules, the :l5 r3lkD, r18.5 kD and rl2kD, were modified with a 20-fold 'excess of DTPA in 0.7LM HEPES buffer pH 7.0, and the excess of DTPA was removed by gel filtration.
1.2 Radiolabeling: i0ne of the changes introduced was to :?0 perform the radiolabNeling with 111InC13 at a low pH (0.2M
citrate buffer, pH 5.7) in order to reduce to a minimum the amount of radiocolloids. An additional precautionary measure was taken to ensure the removal of contaminating heavy metal ions that could displace the chelated 111In from the :>.5 DTPA-modified protein by exchanging the buffers of the radiolabeled FBD solution with Chelex-100-treated buffers.
2.Protocol for modification and radiolabeling~ of FBD
a0 proteins The detailed improved procedure for the DTPA modification and radiolabeling of the r31 kD, the r18.5 kD and the r12 kD
polypeptide fragment: of the FBD is given below.
:f 5 * Trademark Nr0 91/17765 PCT/US91/03584 2.1. Desalting: The: proteins (all in 0.5 M NaCl, including millimolar concentrations of EDTA and other protease inhibitors) were desalted and transferred to' HEPES buffer (0.1 M pH 7). The 31 kD FBD (27 ml, 0.6 mg/ml) was desalted by dialysis, whereas both the 18.5 kD FBD (5 ml, 8.7 mg/ml) and the 12 kD FBD (5 ml, 5.6 mg/ml) were desalted on PD-10 gel filtration columns.
2.2 DTPA modification: This was carried out with a 20-fold excess of DTPA anhydride for 1 hour at room temperature in a volume of 27 ml i.n the case of the 3lkD FHD and 7 ml in both the cases of the 12 kD and 18.5 kD FBD proteins.
Aliquots (100 ~cl) of the modification mixture were set aside for the determination of the number of DTPA residues that had been incorporated into the proteins and the free DTPA
was removed from then rest of the material by gel filtration on 2.6x60 cm Sephadex G-25 column, which had been pre-equilibrated and developed with the HEPES buffer. The protein-containing fractions (30 ml) were collected and the protein concentrations obtained were 0.35 mg/ml, 0.8 mg/ml and 0.9 mg/ml for the r3lkD, r18.5kD and rl2kD FBD proteins, respectively. The degree of modification, which was determined by TLC on silica gel (developed in 85% methanol) , 2 5 was found to be 1. 1, 0 . 8 and 1. 6 for the above FBD prote ins , respectively. DTPA-modified FBD proteins were stored frozen at -20°C and thawed aliquots gave reproducible results upon radiolabeling with 111In.
2.3.Radiolab~ling: The labeling was carried out with 111InC13, which had been brought to 0.2 M sodium citrate, pH
5.7, by adding 125 ~1 of 1 M sodium citrate pH 5.7 to 500 ul of the carrier-free 111InC13 stock solution (111In: 3.2 mCi/ml). The reaction mixture for radiolabeling contained (final concentrations) : FBD protein 0.2 ~cg/~1, HEPES 60 mM, HC1 10 mM, sodium citrate 0.2 M and 111In 0.8 ~Ci/~1. The * Trademark:

WO 91117765 PCT/US91/035~4 ~ ,~ .n ra...9 U V L.Ii~~1 a ~, reaction was allowed to proceed for 1 hr at room temperature. The radiochemical purity was analyzed by TLC on silica gel (developed in 85% methanol) and for all the polypeptide fragments of the FBD it was in the range of 91%-95%. Thus, the specific activity of the radiolabeled FBD
proteins is about 3.6 ~aCi/~g (-8x106 cpm/~Sg). Since heavy metal ions, potentially present as trace contaminants in the buffers used during radiolabeling, might displace the 111In which is bound to the DTPA-modified FBD proteins, the l0 radiolabeled FBD proteins were passed through a bed of lOml of Sephadex G_25, which had been pre- equilibrated, and which was developed, .with a BSA-containing BBS buffer, which had been pretreated by Chelex-100 (to remove metal ion contaminants).
3. Biological activity The biological activity was tested with 'in vitro by binding of the 111In-labeled DTPA-modified FBD to prefarmed plots and jn vivo in the steel coil-induced venous thrombi model in rats.
3.1 Bindina to preformed clots This was performed exactly as described in Example 6 for iodinated FBD. The specific activity of the three 111In-labeled DTPA-modified FBD proteins was 6x106 cpm/,~g protein.
Results of the experiments are given in Table F (second column).
3.2 Venpus thrombi Brats The model used (coil-induced venous thrombi in rats) has been described in Example 7. Tn the experiments of this Example each group consisted of 7 rats to which 5x106 cpm (with a specific activity of 6x106 cpm/~g protein) of 111In WO 91/17765 _127_ PCT/dJ891/03584 labeled DTPA modified FDB protein was injected. Results of the experiments are given in Table F (3 last columns).
Table F: Binding FBD proteins thrombi in vitro and in vi o In vitro Venous thrombi in rats clot assay 6pecific radioactivity (cpm/g) Thrombus to FBD Percent Thrombus Blood Blood I of protein input Ratio countsa rl2kD 24% 242642700 375177 78.2117.3 r18.5kD 26% 285485028 28941 98.3113.3 r3lkD 24% 1979614144 1198183 15.62.4 l I

aApproximately 50% of these values are obtained in the presence of iodoacetate, an inhibitor of transglutaminase:

WO 91/177b5 PCT/US91/035i3a y~y ~ ~ p f ~9 R~~°~~~NL°
1. Uehara, A., et al., J. Nuclear Med. ~9,: 1264°1267 (1988) .
2. zoghbi, S.S., et al., Invest. Radio. ,~0_: 198-202 (1985).
3. Kakkar, V.V., et al., Lancet _1: 540-542 (1970).
4. Knight, L.C., Nuclear Med. Common. _9: 849-857 (1988) .
5. Knight, L.C., Nuclear Med. Common.
9: 823-829 (1988) .

6. Som. P., et al., J. Nuc. Med. 2~7: 1315-1320 (-1986) .

7. Palabrica, 'I. M., et al., Proc.Nat. Acad. Sci.

USA F36: 1036-40 (1989).

e. Akiyama, S.K. and Yamada, K.M., Adv. Enzymol.57:

1-57 (198?).

9. Pierschbacher, M.D., et al., Biol. Chem.,~
J.

9593-9597 (1982).

l0. Pande, H. and Shively, J.B., Bio-Arch. Biochem.

phy's. ,'7,~: 258-265 (1982) .

11. Hayashi, M, and Yamada, K.M., Biol. Chem.2~8:
J.

3332-3340 (1983).

-12g_ ~ ,v'~,~~.r~w..i "v~4.~'.~3~~9 IP
12. Sekiguchi, K. and Hakomori, S.-T., Proc. Natl.
Acad. Sci. USA 7?: 2661-2665 (1980).
13. Ruoslahti, E., et al., J. Biol. Chem. ~"6: 7277-7281 (I981).

14. Ovens, R.J. and Baralle, F.E., EMBO J. ~,: 2825-2830 (1988).

15. Obara, PS., et al., FEBS Letters ?~3: 251-264 (-1987).

16. Obara, Pi., et al., Cell 53: 699 (1988).

17. Ichihara-Tanaka, K., et al., J. Biol. Chew. X65,:
401-407 (1990).

18. Ntandel, et al., Principal and Practice of Infec-tious Disease ~,: 1531-1552 (1979).

19. Proctor, R.A., et al., J. Biol. Chem. ~,5,: 1181-1188 (1980).

20. Eldor, A., et al., Thrombosis and Haemostatis x_6(3): 333-339 (1986).

21. Fritzberg, A.R., Nucl. Med. ,~6: 7-12 (1987).

22. Yaung, R.A. and Davis, R.W., Proc. Nat!. Acad.
SCi. USA 80: 1194-1198 (1983).

23. Hugh, T. , et al. , In ,p,N Glo ~xtg~ ~,, Practica:~
A~pp,~oach (D. Glover, ed. ) , IRL Press, Oxford (1984).

WO 91/17765 PC1'/US91/035&i ~!( ' ~e'~
x. ., -~
~,y ~~a.bst, ~~

24. Vogel, et al., proc. Natl. Acad. Sci. USA ~9:

3180-3184 (1972).

25. Bagly, D., et al., Methods in Enzymol. 45: 669-678 ( 1976 ) .

26. Wagner and Hynes, J. Biol. Chem. X54: 6746-6754 (1979):

'27. McDonagh, R.P., at al., FEBS Lett. 12?: 174-178 (1981).

28. Mosher, et al., J. Biol. Chem. 255: 1181-1188 (1980 ) .

29. Russet, P.B. , et al. , J. Clin. Micro. ~,5,:

1087 (198?).

30. Bolton, A.E. and Hunter, W.M., Biochem. J. ~3:

529 (1973).

31. Obara, et al., Cell ,~3-: 649-657 (1988).

32. Fritzberg, A.R., et al., Proc. Natl. Acad. Sci.

~5: 4025-4029 (1988).

33 . Knight, L. C. , et al . , Radiology ,~73 : 163-169 (-1989).

34. Wasser, M.N.J.M., et al., Blood ~,: 708-714 (~-1989).

35. Burger, J.J., et al., Methods in Enzymology ~,~,:

43-56 (1985).

WO 91/17765 -131- PCT/U~91/035~4 ~ap~. .~ °~4~
~. ,... ~ t.~ n., s ~,.
36. Yamamoto, E., et al., Eur. J. Nucl. Med. ~4: 60-64 (2988).
37. Peterson, et al., in Fibronectin, edited by Moshen, Academic Press, USA, 1989: page 124, particularly Figure 2 on page 5.

Claims (107)

What is claimed is:

1. An imaging agent which comprises a polypeptide labeled with an imageable marker, such polypeptide having an amino acid sequence substantially identical to a sequence present in the fibrin binding domain of naturally-occurring human fibronectin, being capable of binding to fibrin, having a molecular weight above about 6 kD but less than about 20 kD, and having the amino acid sequence gln-ala-gln-gln or met-gln-ala-gln-gln at the N-terminus of the polypeptide.

2. An imaging agent of claim 1, wherein the polypeptide additionally has those intramolecular disulfide bonds present in naturally-occurring human fibronectin which are necessary for fibrin binding.

3. An imaging agent of claim 1, wherein the polypeptide has a molecular weight of about 12 kD
or above.

4. An imaging agent of claim 1, wherein the polypeptide has a molecular weight of about 20 kD
or below.

5. An imaging agent of claim 1, wherein the polypeptide has a molecular weight of about 18.5 kD or below.

6. A composition comprising an effective imaging amount of the imaging agent of claim 1 and a physiologically acceptable carrier.

7. An agent of claim 1, wherein the marker is a radioactive isotope, an element which is opaque to X-rays, or a paramagnetic ion.

8. An agent of claim 7, wherein the marker is a radioactive isotope.

9. An agent of claim 8, wherein the radioactive isotope is indium-111.

10. An agent of claim 8, wherein the radioactive isotope is technetium-99m.

11. An agent of claim 8, wherein the radioactive isotope is iodine-123, iodine-125, iodine-131, krypton-81m, xenon-133, or gallium-67.

12. An agent of claim 1, wherein the polypeptide comprises a 20 kD polypeptide wherein the amino acid sequence substantially identical to a sequence present in the fibrin binding domain of human fibronectin is the amino acid sequence of amino acids 1-153 as shown in Figure 2.

13. An agent of claim 12, wherein the polypeptide comprises less than about 20 additional amino acids.

14. An agent of claim 1, wherein the polypeptide is a 12 kD polypeptide wherein the amino acid sequence substantially identical to a sequence present in the fibrin binding domain of human fibronectin is the sequence of amino acids 1-109 as shown in Figure 2.

15. An agent of claim 1, wherein the polypeptide is an 18.5 kD polypeptide wherein the amino acid sequence substantially identical to a sequence present in the fibrin binding domain of human fibronectin is the sequence of amino acids 1-154 as shown in Figure 2.

16. A method for imaging a fibrin-containing substance which comprises contacting the fibrin-containing substance to be imaged with the agent of claim 1 under conditions such that the agent binds to the fibrin-containing substance and imaging bound agent and thereby imaging the fibrin-containing substance.

17. A method of claim 16, wherein the fibrin-containing substance is a thrombus.

18. A method of claim 16, wherein the fibrin-containing substance is atherosclerotic plaque.

19. A method for imaging a fibrin-containing substance in a subject which comprises:
(a) administering to the subject a composition of claim 6 under conditions permitting the imaging agent contained therein to enter the blood stream and bind to fibrin present in the blood vessels;
(b) imaging bound agent within the blood vessels; and thereby (c) imaging the fibrin-containing substance.

20. A method of claim 19, wherein the fibrin-containing substance is a thrombus.

21. A method of claim 19, wherein the fibrin-containing substance is atherosclerotic plaque.

22. A method of claim 16, wherein the polypeptide is an 18.5 kD polypeptide wherein the amino acid sequence substantially identical to a sequence present in the fibrin binding domain of human fibronectin is the sequence of amino acids 1-154 as shown in Figure 2.

23. A method of claim 16, wherein the polypeptide comprises a 20 kD polypeptide wherein the amino acid sequence substantially identical to a sequence present in the fibrin binding domain of human fibronectin is the sequence of amino acids 1-153 as shown in Figure 2.

24. A method of claim 23, wherein the polypeptide comprises less than about 20 additional amino acids.

25. A method of claim 16, wherein the polypeptide is a 12 kD polypeptide wherein the amino acid sequence substantially identical to a sequence present in the fibrin binding domain of human fibronectin is the sequence of amino acids 1-109 as shown in Figure 2.

26. A method of claim 16, wherein the marker is a radioactive isotope, an element which is opaque to X-rays, or a paramagnetic ion.

27. A method of claim 16, wherein the imaging is carried out using a gamma camera.

28. A plasmid for expression of a polypeptide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin, being capable of binding to fibrin, having a molecular weight above about 6 kD but less than about 20 kD, and having the amino acid sequence gln-ala-gln-gln or met-gln-ala-gln-gln at the N-terminus of the polypeptide comprising DNA encoding the polypeptide and DNA
encoding suitable regulatory elements positioned relative to the DNA encoding the polypeptide so as to effect expression of the polypeptide in a suitable host cell.

29. A plasmid of claim 28, wherein the polypeptide is about an 18.5 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin.

30. A plasmid of claim 28, wherein the polypeptide comprises about a 20 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin.

31. A plasmid of claim 28, wherein the polypeptide is about a 12 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin.

32. A plasmid of claim 29, wherein the amino acid sequence present in the fibrin binding domain of human fibronectin comprises amino acids 1-154 as shown in Figure 2.

33. A plasmid of claim 30, wherein the amino acid sequence present in the fibrin binding domain of human fibronectin comprises amino acids 1-153 as shown in Figure 2.

34. A plasmid of claim 33, wherein the polypeptide comprises less than about 20 additional amino acids.

35. A plasmid of claim 31, wherein the amino acid sequence present in the fibrin binding domain of human fibronectin comprises the amino acid sequence of amino acids 1-109 as shown in Figure 2.

36. A plasmid according to claim 34 designated pFN
949-2 and deposited in Escherichia coli strain A1645 under ATCC Accession No. 67831.

37. A plasmid according to claim 35 designated pFN
196-2 and deposited in Escherichia coli strain A4255 under ATCC Accession No. 68328.

38. A plasmid according to claim 35 designated pFN
203-2 and deposited in Escherichia coli strain A4255 under ATCC Accession No. 68606.

39. A cell which comprises the plasmid of claim 28.

40. A bacterial cell according to claim 39.

41. An Escherichia coli cell according to claim 40.

42. An Escherichia coli cell according to claim 41, wherein the plasmid is designated pFN 949-2 and wherein the cell is deposited under ATCC
Accession No. 67831.

43. An Escherichia coli cell according to claim 41, wherein the plasmid is designated pFN 196-2 and wherein the cell is deposited under ATCC
Accession No. 68328.

44. A method of producing a polypeptide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin which comprises treating the cell according to claim 39 so that the DNA directs expression of the polypeptide and the cell expresses the polypeptide and recovering from the cell the polypeptide so expressed.

45. A method of producing a 20 kD polypeptide fragment corresponding to an amino acid sequence present in the fibrin binding domain of naturally-occurring human fibronectin which comprises treating an Escherichia coli cell comprising the plasmid of claim 33 so that the DNA directs expression of the polypeptide and the cell expresses the polypeptide and recovering from the cell the polypeptide so expressed.

46. A method of producing a 12 kD polypeptide fragment corresponding to an amino acid sequence present in the fibrin binding domain of naturally-occurring human fibronectin which comprises treating an Escherichia coli cell comprising the plasmid of claim 35 so that the DNA directs expression of the polypeptide and the cell expresses the polypeptide and recovering from the cell the polypeptide so expressed.

47. A purified polypeptide capable of binding fibrin, substantially free of other substances of human origin, having an amino acid sequence present in the amino terminal fibrin binding domain of naturally occurring human fibronectin, having a molecular weight above about 6 kd but less than about 20 kd and having the amino acid sequence gln-ala-gln-gln or met-gln-ala-gln-gln at the N-terminus of the polypeptide.

48. A polypeptide of claim 47, wherein the polypeptide comprises a 20 kD polypeptide having the amino acid sequence of amino acids 1-153 as shown in Figure 2.

49. A polypeptide of claim 48, wherein the polypeptide comprises less than about 20 additional amino acids.

50. A polypeptide of claim 47, wherein the polypeptide is a 12 kD polypeptide having the amino acid sequence of amino acids 1-109 as shown in Figure 2.

51. A polypeptide of claim 47, wherein the polypeptide is an 18:5 kD polypeptide corresponding to an amino acid sequence present in the fibrin binding domain of human fibronectin, having the amino acid sequence of amino acids 1-154 as shown in Figure 2 and having the amino acid sequence gln-ala-gln-gln or met-gln-ala-gln-gln at the N-terminus of the polypeptide.

52. A polypeptide of claim 47 fused to a second poly-peptide which comprises a portion of the amino acid sequence of the cell binding domain of naturally-occurring human fibronectin having cell binding activity.

53. A 45 kD fused polypeptide of claim 52, wherein the polypeptide is a 12 kD polypeptide and the second polypeptide is a 33 kD polypeptide.

54. A polypeptide of claim 47, wherein the amino acid sequence DGRGDS is fused to the N-terminus of the polypeptide.

55. A 64 kD fused polypeptide of claim 52, wherein the polypeptide is a 31 kD polypeptide and the second polypeptide is a 33 kD polypeptide.

56. A plasmid for expression of the 45 kD fused polypeptide of claim 53 designated pFN 202-5.

57. A plasmid for expression of the polypeptide of claim 54 designated pFN 195-4.

58. A plasmid for expression of the 64 kD fused poly-peptide of claim 55 designated pFN 194-2.

59. A method of refolding the polypeptide of claim 47 and wherein the polypeptide may optionally be fused to a second polypeptide of 33 kD molecular weight comprised of a substantial portion of the cell binding domain of fibronectin having cell binding activity which comprises contacting the polypeptide with a thiol-containing compound and a disulfide so as to refold and reoxidize the polypeptide.

60. A method of claim 59, wherein the thiol-containing compound is selected from the group consisting of glutathione, thioredoxin, .beta.-mercaptoethanol, and cysteine.

61. A method of claim 59, wherein the thiol-containing compound is .beta.-mercaptoethanol and the disulfide is produced in situ by introduction of air.

62. A method of claim 59, wherein the polypeptide is selected from the group consisting of an 18.5 kD
polypeptide, a 20 kD polypeptide, a 12 kD poly-peptide and a 45 kD polypeptide.

63. A method of claim 59, which additionally comprises contacting the polypeptide with a denaturant.

64. A method of claim 63, wherein the denaturant is guanidine hydrochloride or urea.

65. A method of claim 59, wherein the polypeptide is at a low concentration.

66. A method of claim 65, wherein the concentration is below 1,000 µg/ml.

67. A method for recovering a purified, biologically active polypeptide having an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin and being capable of binding to fibrin which comprises:
(a) producing in a bacterial cell by means of expression of a plasmid containing DNA
encoding the polypeptide a first polypeptide having the amino acid sequence of the polypeptide but lacking the disulfide bond;
(b) disrupting the cell so as to produce a lysate containing the first polypeptide;
(c) centrifuging the lysate so as to concentrate the first polypeptide;
(d) separating the concentrated first polypeptide;
(e) solubilizing the separated, concentrated first polypeptide;
(f) refolding and reoxidizing the solubilized first polypeptide so as to form the biologically active polypeptide;
(g) separating the refolded and reoxidized biologically active polypeptide;
(h) recovering the purified, refolded and reoxi-dized biologically active polypeptide; and (i) purifying the biologically active polypep-tide so recovered.

68. A method of claim 67, wherein the refolding and reoxidizing comprises contacting the polypeptide with a thiol-containing compound and a disulfide so as to refold and reoxidize the polypeptide.

69. A method of claim 68, wherein the thiol-containing compound is selected from the group consisting of glutathione, thioredoxin, .beta.-mercaptoethanol, and cysteine.

70. A method of claim 68, wherein the thiol-containing compound is .beta.-mercaptoethanol and the disulfide is produced in situ by introduction of air.

71. A method of claim 67, wherein the polypeptide is selected from the group consisting of an 18.5 kD
polypeptide, a 20 kD polypeptide, a 12 kD poly-peptide and a 45 kD polypeptide.

72. A method of claim 68, which additionally comprises contacting the polypeptide with a denaturant.

73. A method of claim 72, wherein the denaturant is guanidine hydrochloride or urea.

74. A method of claim 68, wherein the polypeptide is at a low concentration.

75. A method of claim 74, wherein the concentration is below 1, 000 µg/ml.

76. A method of claim 67, wherein the separating of the concentrated first polypeptide in step (d) comprises chromatography.

77. Method of claim 76, wherein the chromatography comprises Heparin-Sepharose* chromatography.

78. A use of an amount of a polypeptide of claim 47 effective to inhibit thrombus formation for inhibiting thrombus formation in a subject susceptible to thrombus formation.

79. A use of an amount of a fused polypeptide of claim 52 effective to inhibit thrombus formation for inhibiting thrombus formation in a subject susceptible to thrombus formation.

80. A polypeptide in accordance with claim 47 bound to a thrombolytic agent.

81. A polypeptide bound to a thrombolytic agent in accordance with claim 80, wherein the thrombolytic agent is selected from the group consisting of: tissue plasminogen activator (TPA), urokinase, streptokinase, prourokinase, Anisoylated Plasminogen-Streptokinase Activator Complex (Eminase TM), TPA analogs, or a protease.

82. A polypeptide of claim 81, wherein the polypeptide has an amino acid sequence substantially present in the fibrin binding domain of naturally-occurring human fibronectin, is capable of binding to fibrin, has a molecular weight above about 6 kD but less than about 20 kD, has the amino acid sequence gln-ala-gln-gln or met-gln-ala-gln-gln at the N-terminus of the polypeptide and wherein the thrombolytic agent is streptokinase.

* Trademark

83. A polypeptide of claim 81, wherein the polypeptide is a 12 kD polypeptide and the thrombolylic agent is streptokinase.

84. A use of an amount of the polypeptide of claim 80 effective to achieve thrombolysis for achieving thrombolysis of a thrombus in a patient in need thereof.

85. A use of an amount of the purified polypeptide of claim 47 in conjunction with a polypeptide which comprises a substantial portion of the cell binding domain of naturally-occurring human fibronectin effective to treat a wound for treating a subject with a wound.

86. A use of claim 85 wherein the cell binding domain of naturally-occurring human fibronectin is a 40 kD polypeptide or a 33 kD polypeptide.

87. A use of an amount of the fused polypeptide of claim 52 effective to treat a subject for treating a subject with a wound.

88. A use of claim 87 wherein the fused polypeptide is a 45 kD polypeptide, wherein the polypeptide is a 12 kD polypeptide and the second polypeptide is a 33 kD polypeptide.

89. A use of claim 87 wherein the fused polypeptide is a 64 kD fused polypeptide, wherein the polypeptide is a 31 kD polypeptide and the second polypeptide is a 33 kD polypeptide.

90. A use of claims 85 or 87, wherein the wound is a cutaneous wound.

91. A use of claim 90, wherein the cutaneous wound is an incisional wound, a skin deficit wound, a skin graft wound, or a burn wound.

92. A use of claim 85 or 87, wherein the wound is an eye wound.

93. A use of claim 92, wherein the eye wound is a corneal epithelial wound or a corneal stromal wound.

94. A use of with claim 85 or 87, wherein the wound is a tendon injury.

95. A use of an amount of a polypeptide of claim 47 effective to inhibit thrombus formation for the production of a medicament for inhibiting thrombus formation in a subject susceptible to thrombus formation.

96. A use of an amount of a fused polypeptide of claim 52 effective to inhibit thrombus formation for the production of a medicament for inhibiting thrombus formation in a subject susceptible to thrombus formation.

97. A use of an amount of the polypeptide of claim 80 effective to achieve thrombolysis for the production of a medicament for achieving thrombolysis of a thrombus in a patient in need thereof.

98. A use of an amount of the purified polypeptide of claim 47 in conjunction with a polypeptide which comprises a substantial portion of the cell binding domain of naturally-occurring human fibronectin effective to treat a wound for the production of a medicament for treating a subject with a wound.

99. A use of claim 98 wherein the cell binding domain of naturally-occurring human fibronectin is a 40 kD polypeptide or a 33 kD polypeptide

100. A use of an amount of the fused polypeptide of claim 52 effective to treat a subject for the production of a medicament for treating a subject with a wound.

101. A use of claim 100 wherein the fused polypeptide is a 45 kD polypeptide, wherein the polypeptide is a 12 kD polypeptide and the second polypeptide is a 33 kD polypeptide.

102. A use of claim 100 wherein the fused polypeptide is a 64 kD fused polypeptide, wherein the polypeptide is a 31 kD polypeptide and the second polypeptide is a 33 kD polypeptide.

103. A use of claim 98 or 100, wherein the wound is a cutaneous wound.

104. A use of claim 103, wherein the cutaneous wound is an incisional wound, a skin deficit wound, a shin graft wound, or a burn wound.

105. A use of claim 98 or 100, wherein the wound is an eye wound.

106. A use of claim 105, wherein the eye wound is a corneal epithelial wound or a corneal stromal wound.

107. A use c>f claim 98 or 100, wherein the wound is a tendon injury.