CA2137558A1 - Method of intracellular binding of target molecules - Google Patents

Abstract

The present invention relates to a method by which one can target an undesired target molecule or target antigen, preferably a protein. The method comprises the intracellular expression of an antibody capable of binding to the target. A DNA sequence is delivered to a cell, the DNA sequence contains a sufficient number of nucleotides coding for the portion of an antibody capable of binding to the target operably linked to a promoter that will permit expression of the antibody in the cell(s) of interest. The antibody is then expressed intracellularly and binds to the target, thereby disrupting the target from its normal actions.

Description

_WO 94/02610 PCI/US93/06735 213~

METH~:)D OF INTRACELLULAR BLNDING OF TAR~ET MOLECyLES

The present invention is directed to a method for intracellular binding of specific molecules, preferably proteins. More specfically, this method involves the intracellular expression and subsequent us0 of antibodies specific for a desired molecule.

Various abnormalities appear to be the result of the undesired expression of a particular molecule such as a protein. For example, many tumors are believed to be the result of the overexpression of cellular oncbgenes, such as neu, myc, abl, etc. Other malignancies are believed to be the result of expression of an altered receptor. Certain illnesses are caused by the undesired cellular expression of viral proteins. For example, the human immunodeficiency virus (HIV) uses mammalian cells for the preparation of viral encoded proteins including structrual proteins and regulatory enzymes. Human T-cell Leukemia virus type 1 or 2, (HTLV^1 or ,, 2) produce tumors in infected individuals as a result of viral expression.
Such viral encoded proteins can result in the assembly of virions which can in turn infect other cells.

Therapeutlc strategies have Included the development of drugs to target the undesired proteins, means of intercellular blocking of such proteins, for example, soluble CD4, and the use of drugs which will selectively kill cells expressing the undesired proteins.
-Another method of treatment that has been suggested is the transfer of genetic materials into cell. For example, by receptor mediated SUBSTITUTE SHEET

wo 94/02~10 ~cr/us93/06735 r~

.

gene delivery, transkaryo~ic implantation and viral shuttle vectors such as retroviral gene transfer. In such methods, broadly referred to as gene therapy, cells which are either deficient in a protein or produce a , dysfunctional protein are hoped to be rnended by introducing into the cell DNA coding for the normal gene product.

.~i In vivo gene expression has been reported following direct injection of non-infectious, non-oncogenic plasma DNA encapsuiated in Iyposomes [Nicolau, C., et al., Proc. Natl. Acad. Sci. 80:1068 (1983)]
immunoliposomes lWang, C.Y., et al., Pr~c. Natl. Acad. Sci 84:7851 f (1987)] and in a liposome/red blood cell mernbrane hybrid [Kaneda, Y., et ~ al., Scjence 243:375 (1989)]. Expression from a variety of calcium ;~ phosphate-precipitated gene sequences has been reported following direct , intraperitoneal injection [Benvenitsy, N., et al., Proc. Natl. Acad. Sci - 15 83:9551 ~1986); Felgner, P.L., et al., Na~re 349:351 11991)~ orfollowing ~ranskaryotic implementation lSeldon, R.F., et al., Science ~ 2 2:714 tt 987)]. In vivo gene targeting has also been accomplished by !~ ~ receptor mediated gene delivery in which a complex between an asialoorosomucoid/polysine conjugate and plasmid receptor genes have 2û been used to target expression exclusively to the liver, following intravenous administration [Wu, G.Y., et al., J. 6'iol. Chem. 263:14621 (1988)]. Retroviral gene transfer is reported to offer high efficiency of infection, stablb integration and expression in most cells [Anderson, W.F., Science 226:401 (1984)] In vivo sen~ therapy has been initiated in patients with ADA deficiency who have had reinfused into their blood, autologous Iymphocytes carrying the ADA gene and in cancer patients with advanced melanoma who have had reinfused tumor infiltrating Iymphocytes (TIL) which carry the gene for tumor necrosis factor (TNF) i SUBSTITUTE SHEET

_ WO94/02610 ~1 37~ PCI/IJS93/06735 1, . j ~

~r lRosenberg, S.A., et al., N. ~ng. J. Med. 323 570 ~1990) all of these articles are specifically incorporated herein by reference].

Gene modification of celis which continually express a viral inhibitor .~ 5 and resuit in the inhibition of viral infection have been proposed and ~ referred to as intracellular immunization. [Baltimore, D., Na~ure 33~:395-`~ 196 ~1988)]. Towards this goal, several approaches have been tested including HIV-1 specific ribozymes lSarver, N., et al., Science 227:122~
~; ~1990)~, antisense RNA ~Posnansky, M., et al., J. Virol. 65:532 (1991)], tar decoys [Sullenger, B.A., et al., Cell 63:601 (1990); Lisziewicz, J., et al., Vll Internat'l. Conf. AI~S 2:28 (1991)], dominant negative mutants ~^3, and others. [Buonocorei, et al., Natvre 345:625-62B (1990~; Hassaloff, :j J., et 21" Nature 334:585-591 (1988); VanderKrol, A.R., et ai., BioTechniques 6:958-976 ~1988); Malim, M.H., et al., Cell 58:205-214 (1989); and Trono, D., et al., Cell 59:113-120 ~1989)~. A major impediment to the development of effective gene inhibition protocols ~, using sush antisense RNA or ribozymes is the ability to achieve a high ;~ level of expression of the inhibitor encoding DNA template in the~ transformed cells and this may also be a potential problem for using ''J, 20 dominant negative mutants because of the competitive nature of the inhibition.
i; It would be desirable to have a method which can be used to ~ achieve a high level of expression of an inhibitor to the desired molecule.

:~3 25 It would be desirable to have a method which can specifically target ;~ these undesired molecules and which has wide applicability.
~Jl 1; , ~, A;

~ WO 94/02610 P~/U~93/06735 ~

2 ~ ~7 ~
` 4 ,~, '............... It would be desirable to have a method which does not introduce cytotoxic chemicals into a cell.
., i would be desirable to have a method which provides a ready .~ 5 means of targeting undesired proteins.
", ~
:', SUMMARY OF THE INVENTION

We have now discovered a method by which one can target aln undesired molecule ~sometimes referred to as a target molecule or target anti~en), preferably a protein. This method comprises the intracellular expression of an an~ibody capable of bindins to the target. A DNA
sequence containing a sufficient number of nucleotides coding for the ' portion of an antibody capable of binding to the target operably linked to a '-~ 15 promoter that will permit expression of the antibody in the cell(s) of ., .
, interest ~antibody cassette) is delivered to a cell. Thereafter, the antibody is expressed intracellulary and binds to the target, thereby disrupting the .;
target from its normal actions. In one preferred embodiment, the ~' "antibody gene" of the antibody cassette would utilize a cDNA encoding heavy chain variable (VH) and light chain variable (VL) domains of an antibody which can be connected at the l)NA level by an appropriate oli~onucleotide as a bridge of the two variable domains, which on translation, form' a single polypeptide (referred to as a single chain variable fragment (sFv)) capable of binding to a target such as a protein. The antibody gene does not encode an operable secretory sequence and thus 'i the expressed antibody remains within the cell. In certain preferred embodiments, a nucleotide sequence encoding an intracellular localization leader is also used.
~y ,;, , i;. SUBSTITUTE SHEET

WO 94/02610 PCI/US93/~6735 1 ~
2137~8 1:

Preferred cell targets are retrovirally infected cells such as HIV
infected cells, where the targets are the virally encoded protein. For example, one can use antibodies against structural proteins such as the envelope g!ycoprotein and gag protein, and/or against tat, rev, nef, vpu and/or vpx regulatory proteins. In one preferred embodirnent, one would use an antibody cocktail (i.e. mixture of antibodies~ to target a variety of the viral target proteins. Another preferred target includes oncogenes such as trans-mernbrane growth factor receptors, recep~ors, growth factors, membrane associated guanine nucleotide binding proteins, etc.
BRIEF C)ESCRIPTION OF THE D~AWIN~j~

Figure 1 shows the location of PCP~ primers for cloning of variable and constant regions of immunoglobulin heavy and light chain genes.
Figure 2 is a diagram of the structures of Fv, sFv and sFv-KDEL of a broadly neutralizing antibody to envelope glycoprotein, F105. The three complementarity determining regions (CDRs) of each chain are shaded.

Figure 3 are autoradiograms showing a pulse chase of COS-1 cells transfeeted with a plasmid expressing Fab fragments of a broadly neutralizing antibody to envelope glycoprotein.

Figure 4 is an autoradiograph of a 12.5% SDS-poiyacrylamide gel showing proteins immunoprecipitated from cells Iysate or culture medium.

Figure 5 shows immunofluorescent staining of transformed cells.

SUBSTITUTE SHEET

5~ ~

Figure 6A and Fi~ure 6B are autoradiograms of polyacrylamide gels showing sFv 1t)5(A) or sFv 105-KDEL (B) coprecipitated with the HIV-1 glycoprotein.

Fi3ure 7 shows the inhibition of the syncytium formation in cells expressing sFv or sFV-KDEL.

Figure 8 are autoradiograms of a single chain antibody havin~ a localization sequence showing specific binding to the HIV-1 giycoprotein 19 in cells.

Figure 9 are au~oradiograms showing that a single chain antibody to a particuiar target is not coprecipitated with unrelated proteins.

Figure 10 are aul:oradiograms showing that an intracellularly retained anti-~at antibody does not bind HIV-~ glycoprotein.

~~ Fi~ure 11 shows the production of infectious HIV-1 in cells expressing sFv or sFv-KDEL.
Figur~ 12 shows virus tite~ by syncytium formation in SupT1 cells.

Figure ~3 are autoradiograms showing SupT cells stably transformed with a single chain antibody under the control of either an inducible promoter or a CMV promoter.

Figure 14 shows the strategy of antibody-mediated gene transfer.

SUBSTITUTE SHEET

_ WO94/02610 PCT/US93/06735 f 2 1 3 7 'J`~

Figure 15 shows the synthesis of antibody-polylysine conjugates.

Figure 16 are autoradiograms showing expression of the sFv F105 in SupT HlV-infected cells under vzrying concentration of tat protein.
Figures 17A through 17D show FACS analysis of gp120 expression in CD4 SupT cells infected with HIV-1 and stably transducsd with th2 F105 sFv.

1û IFigures 18A through 18D show surface CD4 expression in infected SupT cells transduced with sFv F105.

Figure 19 shows the result of syncytia formation studies af~er infecting SupT svector cells or SupT sFv 105 cells with HIV-1.
Figure 20 shows trans-activation of cells expressing a plasmid containing an HIV-1 LTR-CAT reporter transfected with Tat at varying concen~rations.

Figure 21 shows tst activity in the presence of three different ~at antibodies.

Fi~ure Z2 shows tat activity for the antibodies of Figure 21 at a - different antibody concentration.

SUBSTITUTE SHEET

WO~4/02610 P(~/US93J06735 r i~'3'38` - 8 -DETAILED DESCRIPTIC)N OF THE INVENTION

-The present invention is directed to a method of ~argeting a particular molecule ~targe~ molecule), preferably a protein such as an undesired pro~ein. This method comprises ~he intracellular expression of arl antibody which is capable of binding to a specific target (e.g. a targe~
protein), wherein the antibody preferably does not contain sequence;s coding for its secretion. Such antibodies will bind the target intracellularly. As used herein, the term antibody refers to at least t31at portion of an irnmunoglobulin capable of selectively binding to a target such as a protein. The antibody is expressed from a DNA sequence which contains a sufficient number of nucleotides coding for the portion of an antibody capable of binding to the target, referred to herein as the antibody gene. The gene is operably iinked to a promoter that will permit expression of the antibody in the cell(s) of interest. Promoters are well known in the art and can readily be selected depending on what cell type you wish to target. Furthermore, the use of inducable promoters, which are also well known in the art, in some embodiments are preferred. Such as when the function of a target protein is a resuit of its over~xpression.
Then by "turning the promoter on" one can selectively obtain the expression of the antibody. The entire sequence of antibody gene and promoter is described herein as an antibody cassette. The cassette is delivered to the cell by any of a nurnber of means described below, which permit intracellular delivery of a gene.
The cassette results in the intrasellular expression of the antibody.
The expressed antibody can then bind to the target antigen. This permits a wide variety of useful applications.

_ WO ~4/02610 PCI /US93/06735 2137 j 3 8 g Almost any kind of biolo~ic molecule can serve as an antigen, for t example, intermediate metabolites, sugars, lipids, autacoids, an~ f hormones as well as rnacron~olecules such as complex carbohydrates, phospholipids, nucleic acids such as RNA and DNA, and proteins. The skilied artisan can generate antibodies that wiil specifically bind to both the small molecules and macromolecules. For example, with small molecules one commonly attaches the smalJ molecule (sometimes referred to as a hapten) to a macromolecule (sometimes referred to as a carrier) before immunization. The hapten-carrier complex acts as an immunogen.
Thus antibodies that will specifically bind to a wide ran~e of targets are known. The preferred target molecules include pro~eins, RNA, DNA and haptens. More preferably, the targets are proteins, RNA and DNA. Still more preferably, the target is a protein.

Overexpression of a nurnber of oncogenes has been reported to be associated with malignant cellular transformation. For example, amplification of my& has been reported in COLO 320 colon carcinoma cell cultures, the SKBR3 breast carcinoma cell line and in lung carcinoma cell lines. Amplification of N-myc has been reported in neuroblastoma cell lines and retinoblastoma. Amplification of c-abl, c-myb, and other on~ogenes have also been reported to be associated with malignant transformation. See, chapter 12 "Human Oncogenes" pp 487-543, RNA
Tumor Viruses. Molecular Bi~loav of Tumor Viruses, 2nd Ed., Weiss, R. et al., Ed. (Cold Spring Harbor Laboratory (1985)).
High levels of various oncogenes has also been reported to effect the risk of recurrence of the tumor. For example, a correlation between the level of neu/c-erbB-2 and the cause and course of human breast SUBSTITUTE SHEET

WO 94/02610 P~r/u~93/06735 ~

3~- 3~

cancer has been reported. S~e, Paterson, M.C., et al., Cancer Research 51:556-567 ~1991); high levels of rnyc, int-2 and hst-1 have also been associa~ed with breast cancer. Similarly, elevated levels of the receptor for EGF, EGF-R have been shown to be associated with breast cancer.
Grimaux, M., et al., Int. J. C~ncer 45: 25 5-262 ( 1 990) . The overexpression of these and other oncogenes have also been reported as being associated with other cancers.

Many oncogenes show some hornology to genes involved in cell gro~h. For example, see the table below.

TABLE
~ ' l _ __ , _ ._ ..
HOMOLOGOUS

~ _ ~ ~ .
Growth Factors sis PDGF-/2 int-2 FGF-like 1, , , , , .
Transmembrane ¦ erbB EGF receptor grovvth factors ¦ neu (erbB-2, ¦ fms M-CSF receptor ros, kit, and others . . . _ . . .

, 1 Adapted from Druker, B.J., et al., N. Eng. J. of Mol. 321:1383-1392 (1989).
PDGF denotes platelet-derived growth factor, FGF fibroblast grovvth factor, EGF
epidermal growth factor, and M-CSF mononuclear-phagocyte growth factor.

SUBSTITUTE SHEET

` WO 94/~2610 2 1 3 ~ PCI/U~;93/0673 TABLE - con~inued l HOMOLOGOUS
CATEGORY I ONCOGENE CELLULAR GENE
~ ~ ._~ =_ Membrane-associated abl tyrosine kinases . ~ ~ j ~ , . .
Membrane associated src family guanine nucleotide fes.fps3 binding proteins K-, N- and H-ras I _ Cytopiasmic serine- raf/mil threonine kinases mos Cytoplasmid horrnone erbA Thyroid hormone receptors receptor .~ - _ ~ , Nuclear factors ¦¦ c-myc, N-myc, ¦¦
L-myc, fos, jun, 11 l ~I myb, ets, ski, ll ¦
11 and others il I
. I
Antioncogenes ¦¦ RB 11 11 ~_ -- "I ----"--''---i'~ ' ~1 Others ¦¦ bc1-2 ll ll ` 11 bc1-1 ll 11 11 int-1 Antibodies to most of these oncogenes have been reported. In addition, to overexpression of oncogenes (sometimes referred to as oncs), some oncogenes undergo a mutation from a proto-onc (normal gene for normal protein) to an onc I~ene whose protein can cause malignant transformation\ which appears to result in malignant transformation of 2The family includes src, fgr, yes, Ick, hck, fyn, Iyn, and tkl.

3The subcellular location of these oncogene products is uncertain.

~I!P~TITUTE S~E~T

WO 94/02610 PCI/US93/06735 "~

~1~7 ~-^JP~ .

cells. For example, point mutations of the ras gene at the codons for the ras p21 at residue positions 12, 13 and 61 have resulted in mutant ras p21 proteins which are assooiated with various cancers. Antibodies specific to many of these ras mutants are known.

Similarly, expression of viral proteins can lead to diseases resulting in illnsss and even death. Th~ virus can be either RNA or DNA viruses.
For example, one type of RNA viruses, retroviruses are typically classified as being part of one of three subfamilies, namely oncoviruses, spumaviruses and lentiviruses. Infection by oncoviruses is typically associated with malignant disorders. The viral proteins encoded inctude the ga~, pol, 2nd envelope. In some instance the virus contains oncogenes which encode a protein capable of malignant transformation of a cell in culture. Lentiviruses result in infection which is generally slow and cause chronic debilitating diseases after a long latency period. In addition to genes encoding the gag, pol and envelope structural proteins, they also encode a variety of regulatory proteins. The virus's RNA and/or DNA can take over the cell machinery to produce ths virally encsded protein.
For example, HTLV-1 is a retrovirus which is the etiological agent of adult T-cell leukemia-lymphoma (ATLL), an aggressive neoplasm of CD4~
T-cells lPoiesz, B.J., et al., Proc. Natl. Acad. Sci. 77:7415-7419 (1980)].
The viral proteins expressed by such virus result in the transformation of the cell. The tax and rex gene and gene products appear to be significant with respect to tumorgenicity. Thus, they are a preferred grouping of target molecules.

SUBSTITUTE SHEET

W o 94/02610 P~r/u593/06735 2~37;3 ,~ J' !

HIV cons~itutes a family of lentiviruses including HIV-1 and HlV-2, that are the etiological agents of immunodefiGiency diseases such as the t acquired immune deficiency syndrome (AIDS) and related disorders ~Barre-Sinoussi, et al., Science 220:868-871 (19831; Gallo, et al., Science 224:500-503 ()1984); Levy, et al., Science 225:840-842 (1984);
Popovic, et al., Science 224:497-500 (1984)1.

The Epstein-Barr Virus has been linked to a nurnber of tumors such as selected outbreaks of Burkitt's Iymphoma, nasopharygeal cancer and B-Iymphomas in immunosuppressed individuals. ~zur Hausen, H., Science 254:1 1 67-1 173 (1991 )].

Hepatitis B virus has been linked to hepatocellular canGer ~zur Hausen, Scienc~, supra]. In particular, the X open reading frame of the virus seems to be involved ~tbial. Accordingly, an antibody that targets this region or expression products from this region would be preferable in the prese~t method.

Papillomaviruses have been linked to anogenital cancer l/bidlr in 2~) these viruses the E6 and E7 genes appear to be involved and would be good targets.

By intracellular binding to nucleic acid such as a DNA provirus one - can prevent or inhibit the virus's integration into the cell. By binding to the RNA of the virus one can interfere with its expression o~ viral protein.
Anti-nucleotide antibodies have been extensively studied [Van Es, J.H., et al., J. of Immun. 149:223~2240 (1992); Brigido, M.M. et al., J. of Immun. 150:469-479 (1993); Stollar, B.D., et al., Proc. Natl. Acad. Sci.

S U B STIT U TE S H E ET

~3~ 3 i8 Pcr/lJsg3/06735 ~

- ~4 -USA 83:4469-4473 (1986); Eilat, D., et al., J. of Jmmun. 141:1745-1753 (1988~; Brigido, M.M., et al., J. of Immun. 146:2005-2009 (1991)]
and the antibodies share the same basic features.

These antibodies can be produced and/or screened by standard techniques such as using a nucleotide sequence such as RNA to screen a library containing antibodies ~Tsai, D.E., et al., J. of Immun. 150:1 137-1145 (1993); Okano, Y., et al., J. of Immun. 149:1093-1098 (1992);
Tsai, D.E., Proc. Natl. Acad. Sci. USA 89:8864-8868 (1992).
One can also preferably select and/or designs antibodies to target and interfere with an important nucleic acid binding site. For example, the TAR element of the primate immunodeficiency viruses. This nucleic acid sequence is present in the 5' LTR and is responsive to tat resulting in enhanced expression of viral protein.

By intracellular binding to target proteins of these oncogenes and viruses it is possible to disrupt the normal functioning of such proteins reducing or avoiding the disruptive effect of the protein.
For example, binding to a protein that has to be further processed such as a receptor proteln, a viral envelope protein, e.g. HIV gp160, can significan~ly reduce the cleavage of the protein into its active components.
As another example, the capsid protein, e.g. the HIV capsid protein, is modified co-translationally by addition of the fatty acid, myristic acid. It appears that myristic acid is involved in the attachment of the capsid precursor protein to the inner surface of cells. In HIV proviruses, which have been altered so that they are not capable of adding this myristic SUBSTIT~ITE SHEET

WO 94/02610 2 1 3 7 '3 ~ 8 PCI`~US93/06735 acid, the provirus is not infectious. Studies of the process of myristylation reveal a requirement for glycine at position two from the - amino terminus and also at amino acid residues within six to ten amino acids from the site of myristylation. Thus, antibody binding to the protein at and near these sites can disrupt myristylation.

Similarly, binding to a protein that has a significant external domain can hinder the effect of the protein.

In another em~odiment, by binding to a dysfunctional receptor protein, one can block the undesired interactions that can result in cellular dysfunction such as malignant transformation.

For example, many proteins, such as surface receptors, transmembrane proteins, etc. are processed through the endoplasmic reticulum (sometimes referred to as ER)-Golgi apparatus. Examples of such proteins include neu, envelope glycoproteins such as those of the primate lentiviruses, e.g., HIV-1 or HIV-2. By using antibodies that can be delivered to such à region of the cell and be specific for a particular protein, one can disrupt the function of such protein without disrupting other cellular functions. For example, the PDGF-/2 and FGF-like factors produced by 5iS and int-? pass th,rough the ER. These factors are involved in many cancers. Thus, in addition to targeting the receptor, one can target the growth factors by using antibodies to them.
Growth factors are also expressed by many other malignant cells such as frorn carcinoid syndrome tumors and these wouid be another target.

SUBSTITUTE SHEET
,~ ....... ~ ,.. ... . . . .

WO 94/02610 PCI~/US93/0~735 .~
~3rl~ f~

' ' One can also use this method to dirrupt a function that is undesirable at a particuiar time. For example, the MHC class I and class ll molecules are important in the immune systems recognition of antigens.
[Teyton, L., et al., The New Bio/ogist 4~ 447 ~1992); Cox, J.H., et al., Science 247:715-718 (1990); Peters, P.J., et al., Natur~ 349:669-676 ~1991); Hackett, Nature 349:655-656 ~1991)]. ~lowever, such immune recognition, particularly from MHC class ll molecules can cause problems such as in organ transplants. [Schreiner, G.F., et al., Science 240:1032-1033 (1988)]. Thus, by targeting class ll molecules with organ transplants you can down reguatee the host immune response. These molecules can preferably be targeted at different points in their processing pathway. Preferably, one would use an inducable promoter for the antibody gene.

Thus, by taking into account the particular target many variations of this method can be designed by the skilled artisan.
~ . , For instance, the HIV-1 envelope gene directs the synthesis of a precursor polyglycoprotein termed gpl 60. This protein is modified by addition of multiple N-linked sugars as it enters the endoplasmic reticulum [Allan, J.S., et ai., Science 228:1091-1094 (1985); Robey, W.G., Science 228:593-S95 (1985); DiMarzo-Veronese, F., et al., Science 229:1402-1405 ~1985); Willey, R.L., Cell Biol. 85:9580-9584 (1988)].
The glycosylated envelope protein precursor is then cleaved within the Golgi apparatus to yield a mature envelope protein comprised of an exterior glycoprotein, gp120, and a transmembrane protein, gp41 ~Willey, Cell 8iol., supra; Stein, B.S., et al., J. Biol. Chem. 265:2640-2649 (1990); Earl, P.L., et al., J. Virol. 65:2047-2055 ~1991)]. The envelope SUBSTITUTE SHEET

~ W094/02610 PCI/US93/06735 ' 21J7~58 ;, - 17-~I I

glycoprotein compiex is anchored to the virion envelope and infects cell membranes by gp41 through non-covalent interactions [DiMarzo-Veronese, Science, supra; Gelderblom, H.R., e~ al., Lancetii:1016-1017 ~1~ (1985)~. Following binding of the gp120 exterior glycoprotein to the CD4 receptor, the fusion of viral and host cell membranes allows virus entry lStein, B.S., Cel/49:659-668 ~1987)]. The fusogenic domain of the gp1 20/gp41 complex is thought to reside at the amino ~errninus of gp41 L because this region exhibits sequence homology with a fusogenic domain of other viral proteins [Gallaher, W.R., Cel/ 50:327-328 (1987)];
Gonzalez-Scarano, F.,A/C)SRes. Hum. ~e~rovir. 3:245-252 (1987)] and because mutations in this region inactivate the virus and prevent viral fusion lKowalski, M., et al., Science 237:1351-1355 11987~; Kowalski, M., et al., J. Virol. 65:281-291 (1991), McCune, J.M., et al., Cell 53:55-67 (1988)3.
1~ .
While the processed gp120 and gp41 are transported to the cell surface and secreted as part of the virus' virion, sometimes referred to as viral particles, the uncleaved gpl 60 is delivered to Iysosomes for degradation. The cleava~e process normally is relatively inefficient.
Thus, the method of using intracellular antibodies to bind to the newly synthesized gp160 in the lumen of the endoplasmic reticulum and inhibit its transport to the Golgi apparatus, greatly reduces the amount of protein available for cleavage ~o gpl20 and gp41. Accordingly, the viral particles produced have greatly diminished amounts of gp120 and gp41 on their surface. Such particles are not considered as infectious. This discussion of the HIV-1 gpl60/120/41 proteins is exemplary of other envelope proteins and processed proteins. The same techniques used herein can be adapted by known techniques based upon the present disclosure.

SUBSTITUTE SHEET
.. ,.. ~, .. , . . , . . . ............... . , ' . . .. .

wo s4/026to Pcr/us93/0673 3~

Additionaliy, the envelope protein of the imrnunodeficiency viruses has been implicated in the other aspects of the disease ~DeRossi, A., et al., Proc. Natl. ,4cad. Sci. 83:4297-4301 (1986~].

For example, HIV infection of cell cultures typically generates an acute and/or chronic infection. In both cases, virus is produced and becomes released by budding at the cellular membrane. An acute infection is typically characterized by a cytopathic effect manifested by vacuolization of cells and formation of syncytia and consequently cell Iysis [Laurent-Crawford, Virol. 185:829-83 (1991)]. In tissue cultures, the cytopathic effects of HIV-1 consist of rnultinucleated giant cell (syncytium) formation and the Iysis of single cells. lPopovic, M., sGlence 224:497-500 (1984), Somasundarin, M., et al., J. Viro/. 61 :31 14-31 19 (1987)~ Syncytium formation is mediated solely by the HIV-1 envelope protein expressed on the infected cell surface ~Sodroski, J., et al., I\lature 322:470-474 (1986); Lifson, J~D., et al., Nature 323:725-728 (1986)].
The envelope binds to the CD4 receptor present on adjacent cells and then, via a fusion reaction agnalogous to that involved in virus entry, the apposed cell membranes are fused so that heterokaryons are formed.
Single ceil Iysis also depends on efficient membrane fusion induced by the envelope glycoproteins as some mutations in the gp41 amino terminus result in replication competent viruses that are attenuated for both syncytium formation and single cell Iysis lKowalski, M.L., et al., J.
Virol. 65, supra (1991)1. It has also been reported that amino acid changes in gp120 which effect processing of the gpl 60 precursor can decrease single cell Iysis ~Stevenson, M., et al., J. VJrol. 64:3792-3803 (1990)] and that single cell Iysis requires adequate levels of CD4 SUBSTITUTE SHEET

;/ ~;
WO 9~/0~610 PCI'/US93/06735 :- !
~ 3 7 3 ~ 8 ..~
`
- expression independent of the level of viral protein expression or viral DNA in the infected cell [De Rossi, A., et al., Proc. Nat~. Acad. Sci, IJSA, -~- supra~. ¦

In addition, the HIV envelope ~Iycoprotein has been irrplicated by a number of other individuals in explaining the onset of the assc-:iated immunodeficiency infected individuals. Siliciano, R.F., et al., [Cel/
54:561-575 (1988)] have shown that a subset of CD4+ gp120-specific '. clone manifes~ cytolytic activity and Iyse uninfected autologous CD4+ T-cells in the presence of gp12C) in a process that is strictly dependent upon CD4 mediated uptake of gp120 by T- cells. Since gp120 can be shed q from infected cells, this CD4 dependent autocytolytic mechanism Gan contribute to the profound depletion of CD4~ T-cells in AIDS patients.
Kion,T.A., etal., lScience253:1138-1140 ~1991)] and Hoffman, G.W., et ai., ~Proc. Natl. Acad. Sci. USA 88:3060-3064 (1991)] have shown that an autoimmune idiotypic networlc develops in HIV-1 infections which leads to the development of autoimmune antibodies that destroy CD4+ T-cells. This autoimmune mechanism develops because of the sequence homologies between gp120 and class ll MHC molecules [Young, _I.A.T, Nature 333:215 (1988)1. The immunosuppresive effects of gp120 on the CD4+ T-cell proliferation to antigenic stimulus have been demonstrated [Hoxie, J.A., et al., Science 234:1 123-1 127 51986); Diamond, D.C., et al., J. Immunol. 141:3715-3717 11988); Gurley, R.J., et al., Proc. Na~l.
Aca~. Sci. USA 86:1993-1997 (1989); Crise, B., et al., J. Virol.
66:2296-2301 (1992)]. These studies suggest that immunodeficiency diseases such as HIV-1 may affect major histocompatibility complex ll restricted antigen recognition independent of CD4+ T-cell loss. In rodent neurons, gpl20 has been shown to cause an increase in intracellular SUBSTITU~E SHEE~T
,~ ,.. .... . . .

Wo 94/026l0 Pcr/lJs93/û6735 ~,~3~ 20-calcium and neuronal toxicity ~Dreyer, E.B., et al., Science 248:364-367 (1990)], an effect which might be mediated by activation of the nuclear endonucleas~. In addition, activation induced T-cell death, or apoptosis, has also been proposed as occurring in vivo and accounting for the progressive deple~ion of CD4 I T-cells that leads to AIDS [Groux, H., et al., J. Exp. Med. 175:331-340 (1992); Meyaard, L., et al., Science 25~:217--219 (1992~]. In vitro and in vivo soluble gp120 can interact with CD4 receptors on uninfected cells leading to an abortive cell activation and ~hus trigger apoptosis lMcconkey, D.J., et al., /mmunol.
Joday 11:120-121 (1990); Pinching, A.J., et al., immunol. Today 11:256-259 (1990); Newell, M.K., et al., NatLlre 347:286-289 (1988)]. It has also been proposed that the envelope glycoprotein can act as a sup~rantigen binding only the variable-,B region of the T-ceil antigen receptor, thereby inducing massive stimulation and expansion of such T-cells, followed by deletion or anergy. Pantaleo, G., et al., N. Eng. J. of Med. 238:327-335 (1993). Thus, by decreasing the amount of gp120, effects associated with AIDS can be alleviated and retarded.

As will be discussed in greater detail herein, we have established that in~racellular expression of an antibody to its target, for example, the antibody to the envelope glycoprotein or the antibody to HIV tat protein, results in an antibody that binds the target, e.g. envelope glycoprotein or fat pro~ein, respectively, in the cell and prevents further processing. The present method is highly specific and does not adversely affect cellular 2~ functioning. Thus, a mutant envelope protein that contains a single point mutation that abolishes the protein's ability to bind to this antibody will be processed normally in cells that constitutively express the protein.
Similarly, single chain antibodies to other proteins will not affect the SUBSTITUTE SHEET

wo 94/02610 PCr/U~93106735 - 21 2l37'3 ~ 8 ' processing of the envelope protein. Thus, the present methodology permits using an antibody specific to a particular pro~ein and results in a process that can be tailored for specific diseases. Additionally, the methodoiogy can be use~ prophylatically. One could even have the 5 antibody under the control of a promoter that will be specifically activated by the target (e.~. an HIV LTR) thereby oniy turning the antibody on when the target is present. Other types of inducible promoters are known in the ar~ and can be selected and used based upon the present dïsclosule.

The use of the present antibodies do not affect ~he processing of other proteins. For example, the antibody to the HIV envelope glycoprotein does not bind other envelope glycoproteins and does not prevent processing of such a protein. For example, the processin~ of an unrelated envelope glycoproteins, such as Bunyavirus envelope glycoprotein, will not be affected. We have shown that ceils that are 7 subjected to the present method, for example by intracellular delivery of 7 an antibody to the envelope protein to produce a cell that constitutively expresses that antibody, results in a 1,000 to 10,000 fold reduction in the activity of viral particles produced when compared to virus from parental celis.
.i Nurnerous other sites can be targeted. For example, targeting the 7 ' cytoplasmic side of a membrane receptor. It is through the cytoplasmic 3 tail that signal transduction occurs. lLuttrell, L.M. et al., Science 259:1453-1457 (1993); Epstein, R.J." et al., Proc. Natl. Acad. Sci USA
89:10436-10439 (1992)]. For example, using the neu/erbB-2 receptor or G protein receptor one can target the loop or cytoplasrnic tail thereby preventing such signal transduction. For example, one preferably uses -SUBSTIT~JTE S~IEET

,, WO 94/02610 PCr/US93/0~73~ _~

antibodies to activated receptors such as ~o phosphorylated amino acids.
Thus, the pool of target recepto,rs can be reduced.
$
The antibodies will bind specifically to the target, e~g. a protein, and can thus effectively compete with other molecules that will also form cbmplexes with ~he protein. To insure that the antibodies of the present invention can compets successfully with other molecules, they must retain at least about 75% of the binding effectiveness of the complete antibody to that target, i.e. having constant as well as variable regions.
More preferably, it has at least 85% of the binding effectiveness of the complete antibody. Still more preferably, it has at least 90% sf the binding effectiveness of the complete antibody. Even more preferabiy, it has at least 95% of the binding effectiveness.

~, .
We have developed a method that is broadly applicable to a wide range of target molecules includin~ proteins, RNA, DNA, haptens, phospholipids, carbohydrates, etc. as will be discussed below.
,i - The target molecules can be present in a wide range of hosts. For example, animals, birds, and plants. Preferably, the target is animals ~, including humans. More preferably, the species is one that has industrial importance such as fowl, pigs, cattle, cows, sheep, etc. Most preferably, the species is a human.

, .
Al~hough antibodies have the ability to recognize an almost limitless number of foreign molecules, in nature, antibodies recognize stuctures exterior to the cell. lWinter, G., et al., Na~ure 349:293 (1991)]. Once synthesized, antibodies are secreted into the surrounding fluid or remain ~!

~ SUBSTITUTE SHE~T `

WO 94/0~610 PCI/US93/0~735 - 23 - ~37~

bound to the outer cell membrane [Klein, IrnmunQlo~v, Blackwell Scientific Publications, Cambridge, MA 1990~). We have found a means to express - antibodies which retaining the ability to specifically bind to a tar~et intracellularly.
Thus, specificity for a particular targ~t can be obtained by using the immune system, itself. One uses the target or an antigenic portion thereof or a hapten-carrier complex to generate an antibody. This can be accomplished by standard techniques.

For example, the antigen binding or variable regions is formed by the interaction of the variable heavy (VH) and variable light (VL) dornains at ths amino termini of the chains~ The smallest fragment containing a complete binding site is referr~ tO as Fv and is a heterodymer of the VH
and VL domains. However, it is possible to obtain binding without a complete binding site. For example, one can obtain antigen binding activity using only a heavy chain binding domain (dAbs, also referred to as single domain antibodies). As aforesaid, in the present invention, one can ~3 use a gene coding for such an antibody fragment as long as it retains s1 20 sufficient binding ability compared to the parent antibody~ Preferably, one -, uses at least at least a VH and VL heterodimer lFv).

Determination of the three-dimensional structures of antibody fragments by X-ray crystalography has lead to the realization that variable domains are each folded into a characteristic structure composed of nine strands of closel~ packed ~-sheets. The structure is maintained despite sequence variation in the VH and V, domains [Depreval, C., et al., J. Mol.
Biol. 102:657 (1976); Padlan, E.A., Q. Rev. Biophys. 10:35 (1977)].

,, ,, SUBSTITUTE SHEET

W O 94/02610 P~r/US93/06735 ~ _ ~ ~3~`3~3~ - 24 -j-Anaiysis of antibody primary sequence data has established the existence of two classes of variable reyion sequence. Hypervariable sequences and framework sequences [Kabat, E.A., et al., Sequences of Protein of Immunoloaical Interests, 4th ed. U.S. Dept. Health and Human Services (1987~. The framework sequences are responsible for the correct ~-sheet :~ folding of the VH and V, domains and for the interchain interactions that bring the domains together. Fach variable domain contains three hypervariable sequences which appear as loops. The six hypervariable sequences of the variable region, three from the VH and three from the VL
.~ 10 form the antigen binding site, are referred to as a complementarity 3 determining region ~CDRs).

By cloning the variable region genes for both the VH and VL chains of interest, it is possible to express these proteins in bacteria and rapidly , test their function. One method is by using hybridoma mRNA or splenic ~ mRNA as a template for PCR amplification of such genes lHuse. et al., ,~ Science '~46:1276 (1989)]. Thus, one can readily screen an antibody to insure that it has a sufficient binding affini~y for the ar~tigen. The binding affinity (Kd) should be at least about 1071/M, more preferably at least about 1 0-81/M.
,~

Figure 1 shows the immunoglobulin genes and location of PCR
primers. The light and heavy chain immunoglobulin genes are shown with V, D, and J segments noted as well as the constant regions. Also I 25 depicted are the CDR regions. The primers for PCR amplification can be ,1 RNA or genomic DNA as shown for both Fv and Fab gene amplification.

SUBSTITUTE SHEET

WO 94/O~tjlO PCI`/US93/06735 21~3~

In one preferred embodiment, the genes encoding the light chain and heavy chain encode a linker to make a single chain antibody (sFv).
The sFv will properly fold even under the reducing eonditions sometimes encountered intracellulariy. The sFv typically comprises a single peptide with the sequence VH~Ijnker V, or V~-linker-VH. The linker is chosen to permit the heavy chain and light chain tO bind together in their proper conformational orientation. See for example, Huston, J.S., et al., Methods In Enzym. 203:46-121 (1991), which is incorporated herein by reference. Thus, the linker should be able to span the 3.5 nm distanee between its points of fusion to the variable domains without distortion of the native Fv conformation. The amino acid residues constituting the linker must be such that it can span this distance and should be 5 amino acids or lar~er. The amino acids chosen also need to be selected so that the linker is hydrophilic so it does not ~et buried into the antibody.
Preferably, the linker should be at least about 10 residues in length. Still more preferably it should be about 15 residues. While the linker should not be toQ short, it also should not be too long as that can result in steric interference with the eombining site. Thus, i~ preferably should be 25 residues or less. The linker (Gly-Gly-Gly-Gly-Ser)3 (SEQ ID NO:1) is a preferred linker that is widely applicable tO many antibodies as it provides sufficient flexibility. Other linkers include Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser (SEQ !D Nt:):2), Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr (SEQ ID NO:3), Glu Gly Lys Ser Ser Gly Ser ~ - Gly Ser Glu Ser Lys Ser Thr Gln (SEQ ID NO:4), Glu Gly Lys Ser Ser Gly s - 25 Ser Gly Ser Glu Ser Lys Val Asp ~SEQ ID NO:5~, Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly l.ys Gly (SEQ ID NO:6), Lys Glu Ser Gly Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser Leu Asp ~SEQ ID NO:7), and Glu Ser Gly Ser Val Ser Ser Glu Glu Leu Ala Phe Arg Ser Leu Asp (SEQ ID

, ,, SUBSTlTUTE SHEET

wO 94/02610 Pcr/vss3/o673~ , ~

~3rt ~

NO:8~. Alternatively, you can take a 1 5-mer, such as the ~Gly-Gly-Gly-Gly-Ser~3 (SEQ ID NO:1 ) linker, although any sequence can be used and through mutagenesis randomize the amino acids in the linker, then with phage display vectors pull out the antibodies with the different linkers and screen for the highest affinity single chain antibody generated.

Preferably, the gene does not encode the normal leader sequence for the variable chains. It is preferable that the antibody does no~ encode a leader sequence. The nucleotides coding for the binding portion of the antibody pr~ferably do not encode the antibody's secretory sequences (i.e. the sequences that cause the àntibody to be secreted from the cell).
Such sequences can be contained in the constant region. Preferably, one - also does not use nucleotides encoding the entire constant region of the antibodies. More preferably, the gene encodes less than six amino acids 1;5 of the constant region.
, -As discussed above, the immune system can prepare the antibody which will bind to a specific molecule such as a target protein by standard immunological techniques. For example, using the protein or an 20 ~ immunogenic fragment thereof or a peptide chemically synthesized based - upon such protein. Any of these sequences can be conjugated, if desired, to keyhole limpet hemocya,nin; ~KLH) and used to raise an antibody in animals such as a mice, rabbits, rats, and hamsters. Thereafter, the animals are sacrificed and their spleens are obtained. Monoclonal antibodies are produced by using standard fusion techniques for forming hybridoma cells. Ses, Kohler, G., et al. Nature 256:495 (1975). This typically involves fusing an antibody-producing cell ~i.e., spleen) with an immortal cell line such as a myeloma cell to produce the hybrid cell.

SUBSTITU T E Sl~

WO 94/~2610 PCI/US93~06735 ~137IJ~ 8 Another method for preparing antibodies is by in vitro immunization techniques, such as using spleen cells, e.g., a culture of murine spleen cells, injecting an antigen, and then screening for an antibody produced to said antigen. With this method, as little as 0.1 micrograms of antigen can be used, although abou~ 1 microgram/rnilliliter is preferred. For in vitro immunization, spleen cells are harvested, for example, mice spleen cells, and incubated at the desired amount, for example, 1 x 107 cells/milliliter, in medium plus with the desired antigen at a concentration typically around 1 microgramJmilliliter. Therea~er, one of several adjuvants depending upon the results of the filter immunoplaque assay are added to the cell culture. These adjuvants include N-acetylmuramyl-L-alanyl-D-isoglutamine ~Boss, Methods in Enzymo/o~y 12~ :27-33 (1 986ll.
Salmonella typhimurium mytogen [Technical Bulletin, Ribi ImmunoChem.
~- Res. Inc., Hamilton, Montanal or T-cell condition which can be produced by conventional techniques lSee, Borrebaeck, C.A.K., Mol. /mmunol.
21:841-845 (1984); 80rrebaeck, C.A.K., J. tmmunal~ 136:3710-3715 ~1986) or obtained commercially, for example, from Hannah 8iologics, Inc. or Ribi IrnmunoChem. Research lnc. The spleen cells are incubated with the antigen for four days and then harvested.
7~' 20 Single cell suspensions of the in vitro immunized mouse spleen cells are then incubated, for example on antigen-nitrocellulose membranes in miorofil~er plates, such as those available from Millipore, Corp. The ~, antibodies produced are detec~ed by using a label for the antibodies such as horseradish peroxidase-labeled second antibody, such as rabbit anti-mouse Ig~, IgG, and IgM. In determining the isotype of the secreted antibodies, biotinylated rabbit anti-mouse heavy chain specific antibodies, .
i ~,, .

."

"
SUBSTITUTE SHEET

WO 94/02610 PCI'/US93/06735 2~ .3 ~ 8 ~'~

such as from Zymed Lab., Inc. can be used followed by a horseradish peroxidase-avidin reagent, such as that available from Vector Lab.

The insoluble products of the enzymatic reaction are visualized as blue plaques on the membrane. These plaques are counted, for example, by using 25 times magnification. Nitrocellulose membrane of the microfilter plaques readily absorb a variety of antigens and the filtration unit used for the washing step is preferred because it facilitates the plaque assay.
One then screens the antibodies by standard techniques to find an$ibodies of interest. Cultures con~aining the antibodies of interest are grown and induced and the supematants passed through a filter, for example, a 0.45 micromiter filter and then through a column, for example, an antigen affinity column or an anti-tag pep~ide column. The binding ~ffinity is tested using a mini gel filtration technique. See, for example, Niedel, J., Biol. C:hem. 256:9295 ~1981). One can also use a second assay such as a radioimmunoassay using magnetic beads coupled with, for exarnple, anti-rabbit IgG to separa~e free 1251-labeled antigen frorn 1251-labeled antigen bound by rabbit anti-tag peptide antibody. In a preferred altsrnative one can measure "on" rates and "off" rates using, for example, a biosensor-based analytical system such as "BlAcore" from Pharmacia Biosensor AB lSee, Nature 361:186-187 (1993)l.

This latter technique is preferred over in vivo immunization because the in vivo method typically requires about 50 micrograms of antigen per mouse per injection and there are usually two boosts following primary immunization for the in vivo method.

SUBSTITUTE SHEET

W094/02610 Pcr/us~3/0673~ !

- 29 - ~37;3S8 Alternativ~ly, one can use a known antibody to the target protein.
Thus, one can obtain antibodies to the desired target protein. Thereafter, a gene to at least the antigen binding portion of the antibody is synthesized as desoribed below. The gene preferably will not contain the normal signal peptide sequences. In some preferred embodiments it will also encode an intracellular localiza~ion sequence such as one for the endoplasmic reticulum, nucleus, nucleolar, etc. When you w~nt expression in the ER normal antibody secretory sys~ern such as the endoplasmic reticulum, golgi apparatus a leader sequence should be used.
To retain such antibodies at a specific place, a localization sequence such as the KDEL sequence may be used. In some embodiments the antibody gene preferably also does not encode functional secretory sequences.

Antibody genes can be prepared based upon the present disclosure < 15 by using known techniques.

Using any of ~hese antibodies, one can construct VH and VL genes.
For instance, creating VH and V, libraries from murine spleen cells that have been immuni7ed either by the above-described in v~tro immunization technique or by conventional in vivo immunization and from hybridsma '3 cell lines that have already been produced or are commercially available.
One can also use commerciaily available VH and VL libraries. One method '5, ' involves using the spleen cells to obtain mRNA which is used to syn~hesis by cDNA. Double stranded cDNA can be made by using PCR to amplify .. 25 the variable region with a degenative N terminal V region primer and a J
region primer or with VH family specific primers, e.g., mouse-12, human-7 .

,~

q ' SUBSTITUT' SHEET

WO 94/02610 PCr/USg3/06735 ~

?, ,3~S~3 30 For example, the genes of the VH and V, domains of a broadly neutralizing antibody to the envelope glycoprotein of HIV-1 such as F105 [Oishevsky, et al., J. Virol. 64:5701-5707 (1990); Thali, et al., J. Viro/, 65:6188-6193 ~1991); and Posner, et al., J. Immunol. 146:4325-4332 (1991)] can be cloned and sequenced. The first strand cDNA can be synthesized from total RNA by using oligo dT priming and the Moloney murine leukemia virus reverse transcriptase according to known procedures. This first strand cDNA is then used to perform PCR
reactions. One would use typical PCR condi~ions, for example, 25 to 30 cycles, to amplify the cDNA of the immunoglobulin genes. DNA sequence analysis is then performed. lSanger, et al., Proc, Natl. Acad. Scj. USA
79:5463-5467 (1977)1.

Heavy chain primer pairs consist of a forward VH primer and a ; 15 reverse JH primer, each containing convenient restriction sites for cloning.
One could use, for example, the Kabat data base on immunoglobulins IKabat, et al., supral to analyze the amino acid and codon distribution found in the seven distinct human VH families. From this, the 35 base pair universal 5' VH primer is designed. One could use a primer such as mGCGGC~TCAGGTGCA(G/AJCTG~TCGAGTC(T/C)GG (SEQ ID
NO:9), which is degenerate for two different nucleotides at two positions and will anneal to the 5' end of FR1 sequences. A restriction site such as the 5' Not I site (left-underlined) can be introduced for cloning the amplified DNA and is located 5' ~0 the first codon to the VH gene.
Similarly, a second rsstriction site such as an internal Xhol site can be introduced as well ~right-underiined).

SUBSTITUTE ~Y~T

WO94/026l0 PCT/US93/06735 5 ~

Similarly, a 66-base pair JH region oligonuoleotide can be designed ~or reverse priming at the 3' end of the heavy chain variable gene, e.g., AGATCCGCCGCCACCGCTCCCACCACCTCCGGAGCCACCGCCACCTGA
~iGTGACC GTGACC lA/G) (G/T) GGT ~SEQ ID N0:10). This primer additionally contains a 45 nucleotide sequence that encodes a linker, such as the (Gly-Gly-Gly-t;ly-Ser)3 (SEQ ID N0:1) interchange linker. This primer contains two degenera~e positions with two nucleotides at each position based on the nucleotide sequence of the six human JH region minigenes. Restriction sites can be used, for example, a BspEI site (left-underlined) is introduced into the interchan~e linker for cohesive end ligation with the overlapping forward V,~.pp~, primer. An internal BsTEII site ~right-underlined) is introduced as well for further linker exchange procedures.

1-5 A similar strategy using the 45 nucleotide interchange linker is 'i ~ incorporated into the design of the 69 nucleotide human Vk~"". primer.
There are four families of human Vk.p~. genes. The 5' Vk.,~p. primer GtiTGGCGGTGGCTCC~GAGGTGGTGl:;GAGCGGTGGCGGCGGATCT AG
C:TÇ (G/C)(T/A)G(A/C)TGACCCAGTCTCCA (SEQ ll~ N0:11), which will anneal to the 5' end of the FR1 sequence is degenerate at 3 positions (2 nucleo~ides each). The interchange linker portion can contain a BspEI site fsr cohesive end cloning with the reYerse JH primer, other restriction sites can also be used. An intern~l Sacl site (right-underlined) can be introduced as well to permit further linker exchange procedures.
The reverse 47 nucleotide Ck.p". primer (Kabat positions 109-113 GGG TcTAGAcTcGAGGATccTTATTAAcGcGTTGGTGcAGccAcAGT
(SEQ ID N0:12) is designed to be complementary to the constant regions ., x ,, SUBST1TUTE ~EET

wo 94~02610 PC~/US93/0673~ ~

of kappa chains tKabat positions 109-113). This primer will anneal to the 5' most end of the kappa constant region. The primer contains an internal Mlul site ~right-underlined) proceeding two stop codons. In addition, multiple restriction sites such as Bam Hl Xhol/Xbal (left-underlined) can be introduced after the tandem stop codons. A similar reverse nucleotide C-kappa primer such as a 59 nucleotide primer can also be designed that will contain a signal for a particular intraeellular site, such as a carboxy ~erminal endoplasmic reticulum reten~ion signal, Ser-Glu-Lys-Asp-G!u-Leu (SEQID NO:13)(SEKDEL),GGGTCTAGACTCGAGGATCCTTATTACAGCT
CGTCCTTTTCGCTTGGTGCAGCCACAGTISEQID NO:14). Similar multiple restriction sites (Bam Hl Xhol/Xbal) can be introduced after the tandem stop codons.

After the primary nucleotide sequence is determined for both the heavy and kappa chain genes and the germ line genes are determined, a PCP~ primer can then be designed, based on the leader sequence of the VH
71-4 germ line gene. For example, the VH 71-4 leader primer A~CAT(;GAACATCTt;TGGTTC (SEQ ID NO:15) contains a 5' Ncol site (underlined). This leader primer ~P-L) is used in conjuction with a ~, 20 second JH primer for PCR amplification experiments. The 35 base pair JH
region oligonucleotide is designed to contain the same sequence for reverse priming at the 3' end of the heavy chain variable gene, rrAG~GCGCTGAGGTGACCGTGACC(A/G)(G/T)GGT (SEQ ID NO: 1 6) .
This prirner contains two degenerate positions with two nucleotides at each position. A 8ssH ll site (left-underlined) 3' to and immediately adjacent to the codon deterrninin~ the last amino acid of the J region, allows convenient cloning at the 3' end of the VH gene. An internal BstE
3/ îl site (right-underlined) is introduced as well. This sequence is used to r ~ç
x SUBSTITUTE SHEET

, I
amplify the VL sequence~ The fragments amplified by the P-L (leader primer) and P linker (reverse primer) and P-K (V2 primer) and P-CK primers - (reverse CK primer) are then cloned into an expression vector, such as the pRc/CMV ~Invitrogen) and the resultant recombinant contains a signal peptide, VH interchain linker and V~ sequences under the control of a promter, such as the CMV promoter. The skilled artisan can readily choose other promoters that will express the gene in the cell system of choice, for example, a mammalian cell, preferably human cells.

1C This single chain antibody can be prepared based upon the present disctosure by any of a number of known means For example, the \JH/JH-ICL and ICL-Vk.pp~/Ck~,, PCR fragments are digested with Not IlBsp El and Bsp El/Xba 1, respectively and cloned into a plasmid such as pSL1180 ~Pharmacia) using SURE bacteria (Strategy) as hosts. The resulting sFv is restriction enzyme digested and the Not IIBgl ll fragment is cloned into the Not IlBam Hl ;site that is located 3' to the pelB signal peptide in a pET
expression vector. The resulting plasmid is then transformed into the , appropriate host, such as BL21 (DE3). Plasmid fragments are obtained after suitable times, for example, 2 to 4 hours a~er induction at 24 with ~20 0.2mM IPTG and tested for its ability to bind its target, e.g., ~p120 binding activity, by standard techniques, e.g., ELISA using gpl 20 ~American Biot~echnology, !nc.) coated ELISA plates (Dynatech Labs) and detection with alkaline phosphatase coupled affinity column purified goat - anti-human kappa chain antibody. The sFv bound gpt20 is blocked by ~25 soluble C1~4 and is absorbed to and eluted from a gpl20 affinity column (Affi-Gel, BioRad, Inc.) f W O 94/02610 ~ P(~r/US93/06735 ,_ The VH 71-4 leader and a JH-BssH il primers are used ~o PCR
amplify an intronless fragment containing the leader peptide and rearranged heavy chain gene. The fragment is blunt end cloned in the forward direction into an Eco RV site in a plasmid, for example, pSL1180.
Subsequently, a Nco l/Bst Ell fragment is obtained and combined wi~h the Bst Ell/Sph I fragment of e.g., F105 sFv from pSL1180 in a three piece ligation with Nco ItSpH I digested pSL118~) to producethe VH 71-4/SCA.
A VH 71-4 SCA containing the carboxyi-terminal SEKDEL sequence can be constructed by using a IC:L-Vk"pp~,-SEKDEL PCR product that is blunt and cloned in the forward direction into an Eco RV site in pSL1180. Thle fragment is removed by Bsp E l/Xba I digestion and combined with the Nco itBsp El fra~men~ of VH 71-4/SCA in a three part ligation with Nco I/Xba I digested pSL1180 to produce VH 71-4/KDEL. Before cloning into pRC/CMV (Invitrogen~) a Eco Rl to Hind 151 conversion linker Ts introduced into Eco Rl digested pSL 1180 containing the two single chain antibodies.
Subsequentl~,r, a Hind Ill/Xba I fragment from both single chain antibodies is obtained and cloned into Hind Ill/XBa I digested pRC/CMV to produce pRC/SCA and pRC/KDEL.

See, Figure 2 which is a diagram of the structures of Fv, sFv and sFv-KDEL of one broadly neutralizing antibody, F105. The three complementarity determining regions (CDRs) of each chain are shaded.

I Similar strategies can be used to prepare virtually any other 'i 25 antibodies. For example, using the combination of mRNA purification, single strand cDNA synthesis and PCR amplification using the VH and JH
degenerative primers discussed above, an approximately 350 bp product can be obtained from spleen cells immunized against tat and anti-tat SUBSTlTUTE SHEET

WO 9~/026~ PCl`~U~;93/0673~ .
~75~

hybridoma cell lines. Using the same techniques, as described for heavy chains, a 320 bp Vk"~,p" gene product can be obtained from spleen cells - immunized against tat and the anti-tat hybridoma cell lines using the V,~.,p.
and Jk~pp- degenerative primers, discussed above. Once obtained, the VH
S and VL doma}ns can be used to construct sFv, Fv or Fab fragments.

A preferred target is one processed by the endoplasmic reticulum, where proteins are typically made.

However, there are instances where a greater degree of intrac,ellular specificity is desired. For example, with targeting nuclear proteins, RNA, DNA or celluiar pro~eins or nucleic acids that are subsequently processed.
For example, with virally encoded proteins such as lentiviruses structural proteins are ~ypicaliy cytoplasmically e~pressed, whereas regulatory proteins can be expressed in or near the nucleus. Thus, one preferably uses localization sequences for such targets. Our antibodies can be - d~livered intracellularly and can be expressed there and bind to a target protein.

Localization sequences have been divided into routing signals, sorting si~nals, retention or salvage signals and membrane topology-stop transfer sign~ls. [Pugsley, A.P., Protein Targeting, Academic Press, Inc.
(1989)1. For example, in order to direct the antibody to a specific lo~ation, one can us~ specific localization sequences. For example, ~j 25 signals such as Lys Asp Glu Leu (SEQ ID NO:17) lMunro, et al., Cell i~ 48:899-907 (1987)1 Asp Asp Glu Leu (SEQ ID NO:18), Asp Glu Glu Leu ~! (SEQ ID NO:19~, Gln Glu Asp Leu (SEQ ID NO:20) and Arg Asp Glu Leu (SEQ It:3 NO:21) [Hangejorden, et al., J. Biol. Chem. 266:6015 (1991), for i .~ .
SUBSTIT~JTE SHEET

WO 94/02610 P~US93/0~73~

~,~3~ ~;

the endoplasmic retriculum; Pro Lys Lys Lys Arg Lys Val (SEQ ID N0:22) [Lanford, et at. Cell 46:575 (1986)~ Pro Gln Lys Lys lle Lys Ser (SEQ ID
N0:23) lStanton, L.W., e~ al., Proc. Natl. Acad. Sci USA 83:1772 (1986);
Gln Pro Lys Lys Pro (SEQ ID N0:24) [Harlow, et al., tl~ol. Cell Biol. 5:1605 1985~, Arg Lys Lys Arg ~SEQ ID N0:56), for ~he nucleus; and Arg Lys Lys Arg Arg Gln Arg Arg Arg Ala His Gln (SEQ ID N0:25), ~Seomi, et al., J.
Virology 64:1803 (1990)], Arg Gln Ala Arg Arg Asn Arg Arg Arg Arg Trp Arg Glu Arg Gln Arg (SEQ ID N0:26) [Kubota, et ai., Biochem. and Biophy, Res. Comm. 162:9~3 (1989)], Met Pro Leu Thr Arg Arg Arg Pro Ala Ala Ser Gln Ala Leu Ala Pro Pro Thr Pro (sEn ID N0:27) lSiomi, et al., Cell 55:197 (1988)] for the nucleolar region; Met Asp Asp Gln Arg Asp Leu lle Ser Asn Asn Glu Gln Leu Pro (SEQ ID N0:28), [Bakke, et al., Cell 63:707-716 (1g90)l for the endosomal compartment. See, Letourneur, et al., Cell 69:1 183 ( 1992) for targetting liposomes. Myristolation sequences, can be used to direct the antibody to the plasma membrane.
Table 1, sets forth the amino-terminal sequences for known N-myristoylproteins and their subcellular location. In addition, as shown in Table I below, myristoylation sequences can be used to direct the antibodies to different subcellular loeations such as the nuclear region.
Localization sequences may also be used to direct antibodies to organelles, such as the mitochondria and the Golgi apparatus. The sequence Met Leu Phe Asn Leu Arg Xaa Xaa Leu Asn Asn Ala Ala Phe Arg His Gly His Asn Phe Met Val Arg Asn Phe Arg Cys Gly Gln Pro Leu Xaa (ID N0:29~ can be used to direct the antibody to the mitochondrial matrix. (Pugsley, supra). See, Tang, et al., J. 8io. Chem. 207:10122, for localization of proteins to the Golgi apparatus. For example, it is known that tat is located in subnuclear and subnucleolar regions for infected cells. Thus, it is preferable that the tat antibody target the nuclear and/or SUBSTITUTE SHEEl' WO 94/02610 PCI/US93/0673S ' `
-- 2137~e~X

nucleoiar regions o~ the cell. Since this antibody is to be synthesized in the cytoplasm, it does not have a leader sequence. to target the nuclear and/or nucleolar regions it does need a localization sequence. Preferred nuclear targeting sequences are SV40 and preferred nucleolar targeting ~ regions are ~t nucleolar signals. For example, we have shown that a tat antibody, for example, a single chain antibody, with SV40 nuclear localization signal will bind to tat and can reduce tat activity by over 80%
when compared to the antibody with an immunoglobulin leader sequence, which directs the antibody to a different cellular compartment, e.g., the ER. Preferably, with viruses, e.g. HIV, the structural proteins are targeted in the cytoplasm such as envelope, and gag, whereas the reguiatory proteins such as tat and rev, are targsted in the nucleus and nucleolar regions. More preferably, one would tar~et rev using ~he rev nucleolar sequence Arg Gln Ala Arg Arg Asn Arg Arg Arg Arg Trp Arg Glu Arg Gln Arg ISEQ ID N0:2~). lKubota, supra]. For example, tax of HTLV-1 or HTLV-2 is also preferably searched for in the nucleus or nucleolus. If possiblej it is preferable to use the localization signals of the target proteinto direct the antibody to the desired location. For example, HIV-1 tat pro~ein has a nucleolar localization signal, which is preferably used.
We have shown that by using localization sequences one can have the antibodies expressed and/or retained at an intracellular region where they do not ordinarily appear. For example, after expression we retained a - t~t antibody in the ER. Similarly, we have expressed anti-HlV envelope and anti-tat antibodies in the cytoplasm.

To demonstrate that single chain antibodies can be expressed at an intercellular region where they do not norrnally appear, we have expressed .
SUBSTlTUTE Sl !EET

WO 94/02610 Pcrtus93/06735 5_ 3~

antibodies in the cytoplasm. For example, using cytoplasmically-expressed antibodies which havë been modified on the 3' end to include additional localization signals, for instance, the SV40 nuclear localiza~ion signal for expression in the nucleus or translocation in the nucleus. For example, the F105 single chain amibody, which is typically expressed in the ER, was reamplified, containing a new 5' primer tha~ anneals to the framework 1 region of the antibody. It ~herefore does not contain the leader peptide but contains a strong initiation start signal with a extra methionine at the 5' end as a start codon. This primer has 3 Hindlll site at the 5' end, followed by the Ncol site containing the Met s~art codon.
I I l-AAG-C~-ACC AT~:;-GCC-CAG-GTG-CAG-CTG-CAG-GAG-TCG-GG
(SEQ ID NO:57J and codes for Met Ala Gln Val Gln Leu Gln Glu Ser G1y (SEQ ID NO:58). In addition to that methionine, which is right in the middle of the Ncol site, there is an additional amino acid, Ala. At the carboxy end of the signal peptide for bacterial expression, there is an Ala-Met-Ala cleavage. The cleavage into the periplasm occurs right after the second Ala and before the first amino acid of the framework. So, this is a verstaile primer that can be used or modified and used in many situations.
For example, one can start with the Ncol site by the appropriate 29 endonuclease and clone it into a bacterial expression vector. The same primer can be reused to amplify or to take the amplified material that still has the Hindlll site and digest it with Hindlll. Thus, one has a single chain antibody wi~h the additional methionine as well as an Ala on the 5' end, that can be cloned into a vector, such as the pRC/CMV expression vector, transfected with lipofection, radiolabelled with S35 methionine and , immunoprecipitated with anti-kappa antibody. We have used the technique and obtained expression of an antibody to envelope in the cytoplasm. One can use this basic strategy and modify the antibody to SUBSTITUTE SHEET

. WO 94/02610 . PCI'/US~3/06735 21~7~ ~ 8 also have a localization signal to transport the expressed antibody to a desired target. For example, using a single chain antibody, such as the tat and have it reamplified on the 5' end with a primer that anneais to ~he framework 1 region of the variable re~ion and has a methionine residue for a start codon and an Hindlll site for cloning. This antibody gene is then reamplified for cloning, and expression in pRC/CMV. In addition, that antibody is further modified so that, in addition to using that new 5' primer for cytoplasmic expression, the C-terminus contains the SV40 nuclear locali~ation signal. Thus, the antibody can be expressed in the cytoplasm and where we also used, for instance, the SV40 nuclear localization signal, and tranported into the nucleus.
.

We have used these two forms of the antibody, as well as two negative controls. The negative controls include different kappa chains, that were ampli~ied from the same myeloma. We have made various anti-tat single chain antibody constructs capable of being expressedi n the cytoplasrn. From the myeloma cell line, producing the anti-tat monoclonal antibody, two different single chain antibodies containing the different kappa chains were also amplified with the SV40 nuclear localization sequence. Thus we prepared single chain antibodi~s to be expressed in the cytoplasm with or without a nuclear localization signal. To show specificity of the antibody, the incorrect light chain was also used. All four forms of that antibody have been expressed in eukarayotic cells. In these experiments, the four different plasmids were transfected into COS
cells, and these experiments were performed with and without co-expressing a tat expressor plasmid. The KDEL envelope antibody was unstable until ligand or gp120 bound to it, so we confirmed that the same thin~ could occur in the cytoplasm. All four antibodies expressed with SUBSTITUTE SHEET

W~ 94/0261û PCI'/US93/06735 f ?.~ 3~

and without tat. Immunoprecipitating those radiolabelled Iysates from COS cells with a pool of rabbit anti-mouse immunoglobulins and by autoradiography, it app~ars that in the presence of tat protein, a stronger immunoprecipitation of the antibodies occurs than in the absence of tat.
We have shown that the tat antibodies can ir!hibit ta~ activity. For example, in HeLa cells expressing a plasmid containing HIV-1 LTR-CAT
reporter as li~tle as 0.01 ~9 of tat expressing plasmid can result in 2'iX
trans-activation. The addition of 10 or ~ ~J9 of anti-tat SCA (VK)~ anti-tat SCA with SV40 nuclear loca!ization signal (VK SV40) and anti-tat SCA
antibody with an immunoglobulin leader se~uence to direct the antibody into the ER were co-transfected with 0.1 ~g of a tat expressing plasmid into such HeLa cells showed that intracellular expression of the tat antibodies can significantly reduce tat activity (see Figures 21 and 22).
The tat antibody with the imrnunoglobulin leader serves as a negative control in these experiments. At 10 ~9 the anti-tat V,~ shows only 4% of the activi~y of the anti-tat SCA expressed in the ER, where tat is not present.

The localization signals can be located anywhere on the antibody so lon~ as the signal is exposed in the antibody and its placement does not disrupt the binding ability of the antibody. For example, it can be placed at the carboxy or amino terminus or even on the linker between the heavy and light chain of a sFv antibody, providing it satisfies the above conditions.

i ~ ' .
~,' jf SlJBSTITUTE SHEET

. WO 94/02610 PCI/US93/06735 2~:~7'3J8 AMINO-TERMINAL SUBCELWLAR PROTEIN REFERENCE
SEQUENCE~ LOCATION5 _ _ _ ___ _ _ _ .
GCVCSSNP PMp56USTRATClC Marchildon, et (SEQ ID N0 :30~ al Proc Natl 81:7679-7682 . ~1980 VoronoYa, et al.
Mo~. Cell.
Biol.4:2705-2713 11984) _ _ __ . _, . _ GQTVrTPL PMMuî.V gag Hendersonr et (SEQ ID N0:31 ) al, Proc Natl.
( 1987) _ _ ___ _ ._ __ _ .

10 ¦ (SEQ ID N0 2) ¦ ¦ M-PMV gag ¦ vo,ol 61 1045- ¦¦

. Schultz, et al. J.
: VirOI. 46:355-361 t19831 , _ __--_ ~a ~.......................... AJG

4To assist the reader, the standard single letter amino acid code is used in the Table, the amino acid sequences using the three letter code are set out in the Sequence15 Listing.

5Abbreviations are PM, plasma membranes, G. Golgi; N, Nuclear; C, Cytoskeleton;
s, cytoplasm ~soluble); M, membrane.

SlJBSTlTUTE SHEET

wo 94/02610 P~r/u~93/0673~ ~

~;3~ `3 ~ - 42 -TABLE 1 - continued , . - ~ -AMINO-TERMINAL SUBCELLULAR PROTEIN REFERENCE
SEQUENCE LOCATION
. _ ~ =
GNSPSYNP PM BLV gag Schultz, et al., (SEQ ID N0:33) 133 431-437 , . _ .. .
GVSGSKGQ PM MMTV gag Schultz, et al.
(SEQ ID NO:34) su,ora . . . .
GQTlrrPL PM FCL.V gag Schultz, et at., (SEQ ID NO:35~ supr~
. _ . , , .
GQTLTTPL PM BaEV gag Schultz, et al.
(SEQ ID NO:36) supra .. , . . .. _ GQIFSRSA PM HTLV-I gag Oo~suyama, et (SEQ ID N0:37) ai., Jpn J.
Cancer Res.
76: 1132-1135 . - - . . _ ~1985~
~15 GQIHGLSP PM HTLV-II gag Ootsuyarna, et (SEQ ID N0:38) al., supra . _ _., , , ~
g GARASVLS PM HIV (HTLV-III) Ratner, et al.
(SEQ ID N0:39) gag . 313 277-284 ., . .
-.i GCTLSAEE PM bovine brain Go a- Schultz, et al., ~3 20 (SEQ ID N0:40) subunit BJO,OhYS. Res.
Commvn.
146:1234-1239 ;, . ~ ~ . ~ 11987) _ _ . I
GQNLSTSN ER Hepatitis B Virus Persin~, et al., (SEQ ID N0:41 ~ __ P~ 5~ .~ ViroL ¦

, :' ."

SUBSTITUTE SHEET
, .

WOg4/0~610 2~37~hJ,~3 P~/US93/06735 - 43 - .

TABLE 1 - continued ~ .- - ~ . , ._ = I
¦ AMINO-TERMINAL SUBCELLULAR PROTEIN REFERENCE
SE~UENCELOCATION _ __ . __ _ _ GAALTILV N Polyoma Virus Streuli, ~t al., (SEQ ID N0:42) VP2 326 619-622 __ . . . . . _ . . _ _ I , GAALTLLG N SV40 Virus VP2 Streuli, et al., l i (SEQ ID N0:43) . . supra ¦
: GAQVSSQK S,ER Poliovirus VP4 Chow, et al., (SEQ ID N0:44) Nature Paul, et al., . ~oc. Natt.
Acad. Sci. USA

.,, . . __ __ _ ._ _, _ I
GAQLSRNT S,ER Bovine Enterovirus Paul, et al., ¦ (SEQ ID NO:45) _ VP4 . supra GNAAAAKK G,S,N,C cAMP-dependent Carr, et al., : (SEQ ID. NO:46) kinase Acad. Scl. USA
79:6128-6131 ~ , ~ - . I
GNEASYPL S,C calcincurin B Aitken, ~tal., ~SEQ ID N0:47) FEBS Lett ¦
~1982) l ¦ _ _ ! _ . _ _ _ _ _ l 3 GSSKSKPK PM, C~ ' p60SFC Schultz etal., (SEQ ID NO:48) 227:427 429 ~1985~ l .~ ! ._ , ~ _.

In order to keep these antibodies in the cell, it is preferable that the expressed antibody does not contain the entire constant region domains.
,c ,~
~ R ~TtTI IT~ ~ U ~r wo 94/02610 PCr/Uss3/06735 f~

Ws believe that it is in this region where ~here are specific sequences which help in the secretion of the antibody from the cell. For example, we have constructed a broadly neutralizing sFv antibody to an envelope glycoprotein that contains only six amino acids of the constant region which is no~ secreted In any large amount by the cell, whereas the unaltered Fab an~ibody to such protein is secreted. This type of design to leave out such sequences can readily be accomplished in the selection and omission of nucleotides coding for the antibody. Although a broadly neturalizing antibody was discussed in this example, the antibodies used do not have to be broadly neutralizing. Neutralization is not required, rather, the antibody needs to bind to the target. Thus, one preferably looks for a epitope on the molecule that is conserved and accessible.

Alternatively, where the secretory signal is retained, the use of 1~ intracellular retention sequences such as KDEL for the endoplasmic reticulum should keep most of the antibodies expressed within the cell.

We have found that the expressed sFv antibody will still bind to ~he BiP protein, which can assist in keeping the resultant antibody target complex within the cell.
,1 In some embodiments one will use antibodies that will not be retained in a cell. For example, one can use a Fab to an envelope glycoprotein such as F105 Fab. The Fabs will bind to the envelope glycoprotein at various locations in and outside the cell as they are secreted~ Accordingly, if the target molecule, in this example the ~; envelope glycoprotein is not all bound at one location, the use of such a seoretable antibody permits targetting of the protein at multiple locations.
/

SUBSTITUTE SHEET

- WO 94/0261~ PCI/US93/0673~
21~7~'.58 ~.

We have found that using cells such as COS cells stably transformed by the F105 Fab antibody gene we have been able to obtain constitutive expression of F105 Fabs. These cell lines secrete the Fabs at about 1-3 ~g/ml. This amount can be changed as desired by the skilled artisan by using different enhancers and promoters. As aforesaid the secreted Fab can target the molecule at different intracellular locations as it is secreted.
In addition, the Fab can also target any moiecule that might have escaped from the cell, extracellularly. For example, as well as targeting envelope glycoprotein as it is being processed, thereby greatly reducing the arnount of processed protein, it can also bind to gp120 on the free virion and stop it from infecting ano~her CD4 receptor or an uninfected cell. For example, the use of these F1ûS Fabs in HIV infeGted COS oells has inhibited synctia formation.
. ~ .
As the term is used herein the gene for the antibody can encompass genes for the heavy chain and light chain regions. In addition, the gene is operably linked to a promoter or promters which results In its expression. Promoters that will permit expression in mammalian cells are well known and include CMV, a viral LTR such as the rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, the SV40 early promoter, E ~oli lac UV5 promoter and the herpes simplex ~k virus promoter. fhis DNA sequence is described as the antibody cassette.

The antibody cassette is delivered to the cell by any of the known means. See for example, Miller, A.D., Nature 357:455-460 (1992);
~nderson, W.F., Science 256:808-813 (1992~; Wu, et al, J. of 8iol.
Chem. 263:14621-14624 (1988). For example, a cassette containing these antibody genes, such as the sFv gene, can be targeted to a SUBSTITUTE SHEET

wo 94/02610 Pcr/us93/0673~

3't~ '~

particular cell by a number of techniques. In the discussion below we will discuss the sFv genes coding for HIV antibodiest which would be preferably introduced into CD4+ T-cells. However, the techniques described can readily be used to introduce the antibody genes into other cells, preferably human cells. For example, using a mammalian expression vector, such as a Herpes vector, an adenovirus vector or a pox vector, a retroviral vec~or, a plasmid bound ~o an antibody, etc. These vectors can be used to transduce cells by standard techniques well known to the skilled artisan. Preferably, this cassette is introduced in the cell by using an HIV viral vector, which is defective in packaging HIV sequences, but will preferentially ~arget HIV susceptable cells. In addition, one can use a promoter that will differentially express the gene in the desired target cell.
For example, using an HIV-LTR as a promoter where the target is HIV
infected cells. In sueh a case, ~he HlV viral proteins in the cell such as tat can result in enhanced expression of the antibody when compared to uninfected cells. In another embodiment one can transduce cells that are ~, at greater risk for viral infection such as CD4 cells.

The intracellular expression of the antibody permits it to bind the target. This disrupts the functioning of the target, e.g., a protein, including the undesired functioning. For instance, expressing the sFv of a broadly neutralizing antibody to enve!ope glycoprotein can intracellularly block the transport and interaction with the CD4 molecules of the HIV-1 glycoprotein, as well as the cleavage of the protein. We cloned both the sFv without any targeting signal and that sFv antibody with an endoplasmic retriculum retention signal ~KDEL). These were then intracellularly inserted into mammalian cells, for example, by using a mammalian cell expression vector, although a retroviral vector is preferred SUBSTITUTE SHEET

~W094/02610 PCll/US93/06735 2137~S8 with this antibody cons~ruct. As another example, using an antibody specific for neu which is targeted to breast tissue can help keep the neu protein in the cell-i The expression of these antibodies should not harm the cells. In ~, fact, if the "ligand" target antibody is no~ present the antibody can be designed so that it will degrade. For example, the antibody to envelope glycoprotein with a KDEL retention sequence was degraded soon after synthesis unless HIV-1 ~nvelope glycoprotein was present ta form an antibody-ligand complex. In contrast, the single chain antibody to the enveiope glycoprotein express~d without ~he retention si~nal was not similarly degraded but rather could be detected after radiolabeling an immunoprecipitation with polyclonal antibody to human immunoglobulin K-chain or heavy chain in the transfected cells. In both instances, the transformed cells appear to have normat morphology and growth rates See, for exarnple, Figure 4, whioh shows transformed COS cells, which were established by neomycin selection expressing either the single chain It antibody or the single chain with the KDEL sequence, which is retained in the endoplasmic retriculum. This antibody bound to the HIV-1 gp1 6Q
protein and oould be coprecipitated with either anti~K or anti-gp120. Very litlie gpl20 was detected even in a four hour chase sample from the sFv transformed cel! while a fraction of gp120 was detected in the vector transformed cells and in a lesser portion in sFv KDEL transformed cells (See, Figure 5). Thus, showing that the expressed sFv antibody binds to the protein gpl 60 and prevents the gp160 protein from further processing. In a preferred embodiment, an antibody to gp41 would also - be delivered to such a cell to target any gp160 protein that was cleaved.
:

SUBSTITUTE SHEET

W O 94/0261D ~ PCT/US93/06735 f_ An alternative strategy is to have the expression of the antibody under the control of an inducible promoter. Preferably, the promoter wiil be inducible by an effect of the target. For example, one can use a viral LTR such as an HIV LTR ~s a promoter. The HIV virus produces proteins, e.g. tat, which "turn on" the promoter.

As explained above the sFv-KDEL product although rapidly degraded without target present, did not appear to be rapidly degraded when the HIV-1 glycoprotein was present. Thus, an sFv-KDEL band became visable in a polyacrylmide gel after radiolabeling and immunoprecipitation. This protein also coprecipitated with the HIV-1 glycoprotein although a small portion of gp120 was detected, which suggests an incomplete block to the glycoprotein transport possibly due to the rapid degredation of newly synthesized antibody before binding to the ligand. Immunofluorescence staining for sFv-KDEL in the transformed cells, co-expressin~ HlV-1-glycoprotein showed an endoplasmic reticulum staining ~attern suggesting that the antibody became stable after binding to its ligand and remained in the endoplasmic reticulum.

~0 The presence of target protein also assists the antibody to fold to ~he correct conformational state~ These antibody-ligand complexes as aforesaid, prevent the target from operating in its typical manner. Fsr instance, cy.opathic fusion mediated by the HIV-1 gp120/41 is inhibited in the cells. This is shown by cotransfecting CD4 ' Hela cells with the HIV-1 glycoprotein expresser pSVIII env and sFv or sFv-KDEL plasmid DNAs at a ratio of 1:5 or tranfecting the transformed cells with pSVIII.
Cells having the intracellular antibody showed a significant reduction of synctium formation while no significant reduction of synctium formation ,j SUBSTITUTE SHEET

W~ 94/02610 PCI'/US93/06735 49 - ~ I 3 7 .

was observed in cells transformed or transfected with the vector that did ,not express the antibody, which indicates that the in~racellular an$ibody can inhibit ~he cytopathic fusion by blocking the transport of the HIV
glycoprotein to the plasi~nid rnembrane and/or the interaction of the HIV-1 glycoprotein with the CD4 molecules on adjacent celis even if the sFv-gp120 complexes were able to reach the celi surface.

Furthermore, very few infec~ious HIV-1 par~icles were produc:ed from these intracellular antibody-containing cells. The cells expressing the intracellular antibody were transfected with infectious HIV-1 proviral DNA
and the supernatants from the transfected cells can be used to infect the CD4 human Iymphocyte 5upT1. A dramatically slower kinetics of infec~ions is observed in such cells when compared with that from vector-transformed cells, although comparable amounts of p24 activity from the supernatants of all these cells were observed which rnay indicate that non-infectious HIV-1 par~icles can be produced in the absence of HIV-1 glycoprotein.

- The SupT sFv105 cells maintain parental phenotype, can respond appropriately to external stimuli, are resistant to the cytopathic effects of HIV-1 infection and the infected cells produce HIV-1 virus particles that are markedly diminished ;in their infectivity.
I
This demonstrates that one can use the present method to intervene in a viral infection such as an HIV-1 infection using an intracellularly expressed antibody such as an engineered single chain ~L antibody and that by binding to the dysfunctional or undesired gene products, the undesirable effects could be alleviated. Using the same i SUBSTITUTE SHEET

WO 94/0~610 PCI/US93/06735 ~_~

"
q~ 50-basic strategy one should be able to intervene in other viral and metabolic diseases such as infections by DNA virus such as herpes simplex and P~NA
viruses such as HTLV-1 and 2. Preferably, this method would be used against viruses that are of long duration, and/or not readily susceptible to other forms of treatment.

The present method permits a wide range of approaches, even against the same disease. For exarnple, antibodies against reverse transcriptase can interfere with template binding functions of the protein ~DeVico, A.L., et al. J. of BioJ. Ct~em. 266:677~6779 11991)].
Antibodies to this protein are known and include C2003 which binds to a sequence in the C-terminal portion of the p66 component [/bid~. This an~ibody also binds to HIV-2 lDeVico, A.L., AIDS Res & fl. Retro. 5:51-60 (1989)~. Such antibodies can be screened for from patient sera and antibodies oloned as described above.

Another approach is to target a critical nucleic acid sequence in the virus such as the TAR element. The tar element, which is responsive to tat, is located at the ~' end of messenger viral RNA. tat binding to this tar element has been shown to result in a derepression of tar inhibition of translation in vftro. In addition, the tar element increases transcription, initiation and also acts as an anti-attenuator of transcription elongation.
, By directing an antibody against the tar sequence, inhibition of tat binding will occur and there will be a dramatic decrease in transcription efficiency.
This will ultimately result in an inhibition or reduction of virus production A similar approach can be used to produce antibodies against the rev s responsive element IRRE). Rev controls the synthesis of viral structural ~'i proteins, including the capsid protein, replicative enzymes and the ;
s Ss SUBSTITUTE SHEET

WO 94/02610 PCr/US93/06735 21~7~58 envelope glycoprotein. The rev protein controls virion protein expression by controlling the cytoplasma accumulation of RNA species. In the absence of rev activity, small muitiply spliced viral RNA species accumulate, in the presence of rev, full-length and partially spliced envelope glycoprotein messenger RNA's accumulate. Antibodies directed against the RRE should inhibit rev binding to RRE and therefore, inhibit the major biological effect of rev. In summary, the rev protein regulates tt~e synthesis of capsid, replicative en~ymes, and envelope glycoprotein production by regulating the accumulation of messenger RNA species from which they are made. Structural protein messenger RNA's require binding of rev protein to the folded RNA structure called RRE for translocation from the nucleus to the cytoplasm. Inhibition of r~v binding by an anti-rev antibody should prevent virus expression from infected cells. Such TAR or RRE antibodies can be synthesized using known technoto~y based upon the disciosure. For example, one can screen an RNA library with an antibody to obtain the desired antibody.

It has been proposed that tumor formation and metastasis is dependent upon angiogenis ~i.e., formation of new capillary blood vessels). lFolkman, et al., Oriqins of Hurnan cance-~ Comnr~h~e Review, Cold Spring Harbor Laboratory Press ~1991)]. For example, human melanoma has been found to produce several proteins with angiogenic actiYity, including fibroblast growth factor (bFGF), F transformin~ growth factor alpha (TGFa), and transforming growth factor ~, 25 beta. [Herlyn, et al., Lab. Invest. 56:461 (1987)1. By using such proteins , as targets for intracellular antibodies, tumor formation and metastasis may ~ be limited.
',~

~ s ,~
. "
SUBSTITUTE SHEET

It has been suggested that aiterations at positions 12, 13 or 61 of the ras p21 proteins result in tumor formation. Using the mutan~ protein as a target for an intracelluiar antibody, which can distinguish the oncogenic ras from proto-ras, should limi~ tumor formation. Antibodies capable of such specific binding are known in the art.

It is preferable to use a "cocktail" approach (i.e. mixture of antibodies) in dealing with undesired viral proteins, thereby targeting a variety of viral proteins at one time and making it more difficult for mutants to evoive which will produce functional targ~t protein capable of avoiding the antibody. For example, a cocktai3 of antibodies to at least envelope glycoprotein and tat is preferred. Other cocktails include antibodies to reverse transcriptase, TAR, RRE, etc. Such "cocktails" can be administered together or by co-transfections. It is preferred that no more than about three proteins in the same intracellular re~ion are targeted, preferably no more than about two. For example, targeting sp160 ar,d gp41 at the endoplasmic reticulum. As long as another intracellular target is in a different cellular region, i.e. nucleus vs endoplasmic reticulum, it can also be targeted without having a detrimental effect on antibody production. One preferred cocktail of an~ibodies would be antibodies for at least one structural viral protein ` such as capsid or envelope and one for regulatory proteins such as HIV
~, rev, tat, HTLV-1 or tax or for a nucleic acid sequence such as TAR or '3j RRE.
Another preferred cocktail would be of antibodies to the same target, but at various intracellular locations. This could be done using different localization sequences. Thus, if some target is not bound to the jlf,,~, L, SUBSTITUTE SHEET

WO 94~0261~ PCr/US~3/0673~;

53 ~37~S8 antibody at sne location and, for instance, is further processed, it can be targetsd at a subsequent location. For example, wi~h the envelope glycoprotein one could use localization sequences to target the protein at a number of points in its processing path. Alternatively, one could use multiple antibodies to ~arget different epitopes of molecules. For example, using one antibody ~o target the CD4 binding region of an envelope glycoprotein and a second antibody to ~arget the fusogenic domain of gp41.

For HIV encoded proteins one preferred vector would be to have at two antibodies to capsid or envelope proteins and at leas~ one to a regulatory protein. For example, to gp160, gp41, tat and rev. Another cocktail would include an~ibodies to both the viral mRNA and the protein it encodes.

Other preferred HIV encoded target proteins are nef, vpr and forHIV-1 vpu, and for HIV-2 vpx. More preferably, nef and vpu. For example, the nef protein exists in the cytoplasm as well as attached to the inner surface of the plasma membrane. The protein is modified co-translationally by addition of myristic acid to the penultimate glycine residue of the amino terminus. The vpr protein has been found . incorporated into the capsid jvirus. The vpu protein is located within the cytoplasm of cells and may be associated with sub-cellular organelles.
Antibodies to these proteins can be made by the methodology described herein. Further, these proteins can be more specifically targeted by the skilled artisan based upon this disclosure by selection of appropriate localization sequences.

.,~

'~
SUBSTITUTE SHEET

WO 94/02610 PCI'/US93/0673;

... ~3a ' q~ ~ - 54 -Thus, using the above-described methodology, one can treat mammals, preferably humans, suffering from an ailment caused by the expression or overexpression of specific proteins. One can use this method to treat viral and metabolic diseases. Individuals infected by viral diseases such as HIV, HTLV-1, HTLV-2, herpes can be treated. Similarly, individuals having malignant tumors or susceptible to malignant cellular transformation caused by a high level of a protein or proteins, an altered protein or proteins or a combination thereof can be treated. For example, one can target at least one of the antigens with an antibody that will specifically bind to such antigen. One delivers an effectiYe amount of a gene capable of expressing the antibody under conditions which will permit i~s intracellular expression to cells susceptible ~o expression of the undesired target antigen. This method can be used as a prophylactic treatment to prevent or make it more difficult for such cells to be adversely effected by the undesired antigen, for eacample, by preventing processing of the protein, interaction by the undesired protein wi~h other proteins, integration by the virus into the host cell, etc. Where a number of targets exist, one preferred target is proteins that are processed by the endoplasmic reticulum. Intracellular delivery of any of the antibody genes can be accomplished by using gene therapy techniques such as described above. The antibody can be any of the antibodies as discussed above.
We discuss herein the use of this system to deliver antibody genes to a virally infected mammal, for example, a human infected with the HIV
virus, but it should be understood that based upon the present disclosure, one can readily adapt such an approach to other systems, for example, an individual with mali~nantly transformed cells.

~s, f ' -SUBSTITUTE SHEET

w094/02610 Pcr/uss3/o673~ 1 55- ~ 3 HIV infects CD4 positive human Iymphocytes and other immune cells. By targeting such cells with an antibody that will bind to at least one HIV encoded target molecle, e.g. a protein/ it is possible to treat an individual infected with the Yirus, slow and/or retard the spread of ;nfection or prophylactically treat such cells to make it more difficult for them to become infected.

One can use any of the known forms of gene therapy to deliver genes to CD4 positive Iymphocytes. For example, using a cell-specific gene transfer mechanism, which uses receptor-mediated endocytosis to carry RNA or DNA molecules into cells (See, for example, Wu 8L Wu, J.
~iol. Chem. 262:4429-4432 (1987)). A protein acting as a iigand is coupled to a poly-L-lysine, which then combines with RNA or DNA (the gene) to form soluble complexes by strong electrostatic interaction, whereby one can deliver the genes (i.e. the RNA or DNA) to the cells of interest such as CD4 cells. For example, using an antibody against gp120 or CD4 as the ligand, one can specifically target such cells. Indeed, such a method of in vivo gene transfer i~ addition to serving as a vector to deliver a therapeutic gene into HIV infected cells or cells susceptible of HiV infection, would also maintain its neutralizing activit~l. We have found that the internalization of antibodies after binding the gp120 or CD4 expressed on the cell surface is highly efficient.

The antibodies that are used to target the oells can be coupled to the polylysine to form an antibody-polylysine conjugate by ligation through disulfide bonds after modification with a reagent such as succinimidyl-3-(2-pyridyldithio) proprionate ~SPDP). The antibody- polylysine-gene cornplexes are produced by mixing the antibody polylysine conjugates SUBSTITUTE SHEET

WO 94/02610 PCI'/US93/0673~ (--~ ,3~3 , with a moiety carrying the antibody cassette i.e. the DNA sequence containing the antibody operably coupled to a promoter suoh as a plasmid or vector ~Fig. 14). Preferably, one will use polylysines having an average chain leng~h of about 60 to 500 Iysine monomers. More preferably, the polylysine has an average chain length of about 90 to 450 Iysine monomers.

As aforesaid, ligation with the antibodies can ~e accomplished using SPDP. First dithiopyridine groups will be introduced into both antibody or polylysine by means of SPI:)P and then the groups in the polylysine can be reduced to give free sulfhydryl compounds, which upon mixing with the antibodies modified as described above, react to give the desired disul~ide bond conjugates. These conjugates can be purified by conventional techniques such as using cation exchange chromatography~
For example, a Pharmacia Mono S column, HR 10/10. See, for example, Figure 15. These conjugates are then mixed with the antibody cassette under ccnditions that will permit binding. For example, incubating for one hour at 25C and then dialyzation for 24 hours against 0.15 M saline through a membrane with a molecular weight limit as desired. Such membranes can be obtained, for exarnple, from Spectrum Medical Industries, Los Angeles, California.

To treat the targeted cells, these vectors can be introduced to the cells in vitro with the transduced cells injected into the mammalian host or the vector can be injected into a mammalian host such as a human where it will bind to with the CD4 cell and then be taken up. To increase the efficiency of the gene expression in vivo, the antibody cassette can be part of an episomal mammalian expression vector. For example, a vector SUBSTITUTE SHEET

W094/02610 PCI/l~J593/0673i 21373,~- ~
- ~7 -which contains the human Pappova virus (BK~ origin of replication and the BK large T antigen for extra-chromosomal replication in mammalian cells, a vector which contains an Epstein-Barr ~EB) virus origin of replication and nuclear antigen (EBNA-1 ) to allow hiyh copy episomal replication. Other mammalian expression vectors such as herpes virus expression vectors, or pox Yirus expression vectors can also be used. Such vectors are available frorn a wide number of source, including Invitrogen Corp. The artib~y cassette is inserted into the expression vectors by standard techniques, for example, using a restriction endonuclease and inserting it into a specific sile in such mammalian expression vector. These expression vectors can be mixed with the antibody polysine conjuates and the resu5ting antibody-polysine-expression vector containing antibody cassette complexes can readily be made based upon the disclosure contained herein. One would inject a sufficient amount of these vectors to obtain a 1~ serum concentration ranging between about 0.Q5 ,ug/ml to 20 ~g/ml of antibody conjugate. More preferably between about .1 /Jg/ml to 10 /u~lml.
Still mor~ preferably, between about .5 ~g/ml to 10 ~g/ml.

These vectors can be administered by any of a variety of means, for example, parenteral injection ~intramuscular (I.M.), intraperitoneal (I.P.j, intravenous II.V.), intracranial ~I.C.) or subcutaneous (S.C.)), oral orother known routes of adrninistration. Parenteral injection is typically ' preferred.

The materials can be adrninistrered in any means convenient, for s example, it can be mixed with an inert carrier such as sucrose, lactose or ~- starch. It can be in the form of tablets, capsules and pills. For parenteral adrninistration, it will typically be injected in a sterile aqueous or non-J

c s SUBSTITUTE SHEET

WO ~4/02610 PCI`/US93/0673~ ~--3~ 3~ - 58 -aqueous solution, suspension or emulsion in association with a pharmaceutically-acceptable parenteral carrier such as physiological saline.

The present invention is further illustra~ed by the following examples. These examples are provided to aid in the understanding of the invention and are not construed as a limita~ion thereof.

EXAMPLES
A. CONSTRlJCTION AND EXPRESSION OF A BP~OADLY
NEUTRALIZING ANTIBODY TO THE ENVELOPE GLYCOPROTEIN
1. cDNA Synthesis and PCR Amplification of F105 !mmunoalopulin Genes. _ _ The F10~ hybridoma v~!as derived by fusion of EBV transformants with the HMMA2.11TG/0 cell line, a non-secreting human-mouse myeloma analogue [Posner, et al., J. Immunol. 146:4325-4332 (1991~].
First strand cDNA was synthesized in a 25-ul reaction from 5 ug of total RNA by using oligo(dT) priming and the Moloney murine-leukemia virus reverse transcriptase according to published protocols [G`usler, et al., Gene 25:263-269(1983)]. Five to ten percent of the first s~rand cDNA was used to perforrn the PCR reactions. The temperatures used for the PCR
are: Melt 94C, 1 min.; primer anneal 52C, 2 min; primer extension 72C, 2 min. One min. ramp times were used except a 2 min. ramp time was used between annealing and extension. 25-30 thermal cycles wsre preformed. Ethidium bromide stained 2% agarose gels were used to separate the PCR fragments. The appropriate band was excised, gene cleaned IBio 101, La Jolla, CA), Klenow repaired, restriction enzyme SUBSTITUTE SHEET

VO94/02610 Pcr/uss3/o673s 59 - 2~ ~7 ~8 digested and used for cloning. At least three separate transformants of each PCR fra~men~ were sequenced using both forward ~nd reverse sequencing primers. DNA sequence analysis was performed by the method of Sanger ~Sanger, et al., J. Mol. Biol. 183:161-178(1980)].
2. PCR Primer ûesi~n.
i The heavy chain primer pair consists of a forward VH primer and a ' reverse JH primer, each containing convenient restriction sites for cloning.
The Kabat database on imrnunoglobulins was used to analyze the amino acid and codon dis~ribution found in the six distinct human VH families [Kabat, et al., supra]. Based on ~his analysis, the 35 base pair universal 5~VH prirner was designed mGCGG~CGÇTCAGGTGCAlG/A)CTG
ÇIÇÇAGTC(TIC)GG ~SEQ ID NO:9) that is degenerate for two different nucleotides at two positions and will anneal to the 5' end of FR1 sequences. A 5' Not I site (left-underlined) has been introduced for cloning the amplified DNA and is located 5' to the first codon of the VH
gene. An internal Xho I site has been introduced as well (right-underlined) .
Similarly, a 66 base pair JH region oligonucleotide has been designed for reverse prirning at the 3' end of the heavy chain variable I gene, AGATCCGCCGCCACCGCTCCCACCACCTCCGGAGCCACCGCCAC
I CTGAGGTGACCGTGACC(A/G)~G~GGT(SEQID NO:10). This primer ! 25 additionally contains a 45 nucleotide sequence that encodes the (Gly-Gly-Gly-Gly-Ser)3 (SEQ ID NO:1) interchain linker. Based on the nucleotide sequence of the six human JH region minigenes, this primer contains two degenerate positions with two nucleotides at each position. A BspE I site SUBSTITUTE SHE~T

.. , , ",, . - ." -~ ~ "

W094/02610 PCT/US93/06735 ~^

~'3~
~ 60- :

(left-underlined) has been introduced into the interchain link~r for cohesive end ligation with the overlapping Vko~p~ primer. An internal BstEII site (right-underlined~ has been introciuced as well for future linker exchange experiments.
A similar strategy, using the 45 nucleotide int~rchain linker, has been incorporated into the design of the 69 nucleotide human Vk pp.
primer. There are four families of hurnan Vk"p,. genes. The 5' Vkapp.
prirner GGTGGCGGTGGCTCCGGAGGTGGTGGGAGCGGTGGCGGCGGATC
TGA(iCTC~G/C)IT/AlG(A/C)TGACCCAGTCTCCA (SEQ l:) N0:11), which will anneal ~o the 5' of the FR1 sequences, is degenerate at three ;positions (two nucleotides each). The interchain linker portion contains a BspE I site for cohesive end cloning with the reverse JH primer. An internal Sac I site Iright-underlined) has been introduced as well for future 1~ linker exchange experiments.

The reverse 47 nucleotide Ck pp~ primer (Kabat positions ~ :)9-113) GGGTCTAGACTC~AG(;ATCCTTATTAACG~GTTGGTGCAGCCACAGT
ISEQ ID N0:12) was designed to be complem~ntary to the constant region of kappa chains tKabat positions 109-113) (Kabat). This primer will anneal to the most 5' end of the kappa constant region. The primer contains an internal Mlu I site Iright-underlined~ preceeding two stop codons. In addition, multiple restriction sites ~Bam Hl/Xhol/Xbal) ~left-underlined) were introduced after the tandem stop codons. A simiiar 2~ reverse 59 nucleotide Ck.pp. primer was also designed that contains a carboxy-terminal endoplasmic reticulum retention signal Ser-Glu-Lys-Asp-Glu-Leu (SEQ ID N0:13) ISEKDEL) GGGTCTAGACTCGAGGATCCTTATTA

SUBSTITUTE SHEET

. ~WO94~02610 PCT/US93/06735 l, 2 1 :~ 7~ ~ 8 -6~-CAGCTCGTCCTTTTCGCTTGGTGCAGCCACAGT~SEQID NO:14). Similar multiple restriction sites (Bam Hl/Xhol/Xbal) (underiined) were introduced after the tandem stop codons.

After the primary nucleotide sequence was determined for both the F105 heavy and kappa chain genesandthe gene line genes were identified, a PCR primer was designed based on the leader se~uences of the VH 71-4 (Lee,etal.,l. Mol. BioJ. 195:761-768 (1987) germ line gene.
The VH 71-4 leader primer i ~ rACÇATGGAACATCTGTGGTTC ~SEQ ID
N0:15) contains a 5' Nco I site ~underlined). This leader primer was used in conjunction with a second JH primer for PCR amplification experinnents.
The 35 base pair JH region oligonucleotide was designed to contain the same sequence for reverse priming at the 3' end of the heavy chain variable gene, l~AGCGCGCTGA~ Ç~GTGACC(A/G)(G/T)GGT ~SEQ
ID N0:16). This primer contains two degenerate positions with two nucleotides at each position. A BssH ll site (left-underlined) 3' to and immediately adjacent to the codon determining the last amino acid of the ~egion allows convenient cloninc It the 3' end of the VH gene. An ~ternal BstEII site (right-underlined) has been introduced as well.
3. Construction and Bacterial Expression of F105 Single Chain Antibodies.

For construction of the initial F105 sFv for bacterial expression, the - VH/JH-ICL and ICLVk.pp,/Ck.W. PCR fragments were digested with- Notl/BspEI and BspEi/Xbal, respectively, and cloned into plasmid pSL1180 ~Pharmacia LKB, Biotech. Inc., Piscataway, N.J.) using SURE bacteria (Stratagenem, La ~lolla, Ca) as hosts. The resulting F105 sFv was restriction enzyme digested and the Notl/Bg111 fragment was cloned into SUBSTITUTE SHErT

WO g4/02610 PCr/US93/0673 the No~l/BamHI sits that is located 3' to the pel B signal peptide in a pET
expression vector. The resulting pETpelB F105sFv plasmid was transformed into BL21 (D~3) hosts. The sFv 105 protein is recognized by antiserum to both the human heavy and light kappa chains. The protein binds to purified gpl20 as determined using an ELISA assay in which gp120 is fixed to a plastic surface. Periplasm fractions were obtained 2-4 hrs after induction at 24C with 0.2 mM IPTG an~ tested for gp120 binding activity by ELISA using gp120 (American Bio~echnology, Inc.) coated ELISA plates (Dynatech Labs, Inc., Chantilly, VA) and detection lû with alkaline phosphatase coupled affinity column purified goat anti-human kappa chain antibody (Fisher Scientific). The F105 sFv bound gp120, was blocked by soluble CD4, thereby showing that CD4 competes, and was absorbed to and eluted from a gp1 Z0 affinity column ~Affi-Gel, BioRad, Inc.).

4. Construction and Eukaryotic Expression of F105 Single Chain Antibodies With and Without SEKDEL Endoplasmic Retention Si~nal.

The VH 71-4 leader and JH/BssHII primers were used to PCR amplify an intronless fragment containing the leader peptide and rearranged heavy chain gene. The fragment was blunt end cloned in the forward direction into an EcoRV ;$i~e in pSLt 180. Subsequently, a Ncol/BstEII fragment was obtained and combined with the BstEII/Sphl fragment of F105 sFv s from pSL1180 in a three piece ligation with Ncol/SpHI digested pSL1180 to produce VH 71-4/SCA. For construction of the VH 71^4 SCA containing s the carboxy-terminal SEKDEL sequence a ICL-Vk pp.-SEKDEL PCR product was blunt end cloned in the forward direction into a EcoRV site in pSL1180. The fragment was removed by BspEI/Xbal digestion and s s SUBSTITUTE SHEET

WO 94/02610 PCI`/US93/0673~
21 .~ 7 ~

63 - .
, . , combined with the Ncol/BspEI fra~ment of VH714/SCA in a three piece ?
ligation with Ncol/Xbal digested pSL1180 to produce VH71-4/KDEL.
Before cloning into pRC/CMV llnvitrogen) a EcoRI to Hindlll conversion Iinker was introduced into EcoRI digested pSL1180 containing the ~wo single chain antibodies. Subsequently, an Hindlll/Xbal fragment from both single chain antibodies was obtained and cloned into Hindlll/Xbal digested pRClCMV to produce pP~C/SCA and pRC/KDEL~

See, Figure 2, which is a diagram of the structures of Fv, sFv and sFv-KDEL. The three complementarity determining regions ~CDRs) of each chain are shaded.

5. ~onstruction And Expression of Other EnveloDe Antibodies Two other broadly neutralizing single chain antibodies to ths envelope glycoprotein were produced and expressed using the same basic procedure. These PCR primers go forward for the VH and reverse for V-k~pp~. and as a result an inner chain linker that now has 24 amino acids of JH~24 nucleotides and 24 base pairs of V-kappa is amplified.

One such antibody was a single chain antibody derived from the 1.7b human monoclonal antibody that is directed against a CD4 enhancing epitope on gpl20. Our genetic analysis had determined that that the rearranged heavy chain of the 1.7b monoclonal antibody was derived from the VH1263 germ line gene. A heavy chain primer directed against the leader sequence of the VH1263 leader peptide was used. This primer, I I l-AAGCTT-ACC-ATG-GAC-TGG-ACC-TGG-AGG(SEQID
NO:59) was used in conjunction with a blunt-ended heavy chain ~-IH primer for the 3' end, TGA-GGT-GAC-CGT-GAC-CAG-GGT(SEQIDNO:60) to SUBSTITUTE SHEET

213~ 5S8 -amplify the rearranged heavy chain including its leader sequence. The kappa-chain was similarly amplified. Using the method of overlap extension described above, we assambled a single chain antibody against the CD4 enhancing site on gpl20.

In addition, we have used a leader primer directed against the leader sequence of the DP-35 germ line gene. This rearranged germ tine gene is used by the monoclonal antibody 21 H, that is also directed against the CD4 binding site on gpl20.
The 21H leader primer was used in conjunction with the JH primer.
The JH blunt end primer I I ~-AAG-Cl~-ACC-ATG-GAG~ t;GG-CTG-AGC-TGG ~SEQ ID N0:61 ) was used to amplify the rearranged heavy chain of the 21 H monoclonal antibody. In addition, appropriately designed lambda light chain primers were used to amplify the rearranged light chain of the 21 H monoc~onal antibody. The two purified PCR products were used for overlap extension with an appropriate inner ohain linker that has been modified to contain the lambda sequence for assemly of the 21 H
single chain antibody to be expressed in eukarayotic cells. CTG-CGT-CAACAC AGACTGAGATCCGCC(SEQIDN0:62)jS the foward primer that was used for amplification of the 21 H lambda chain. CGA GGG
GGYRGCCT~GGGCTG(SEalDNO:63)jS the reverse primer directed against the most proximal constant lambda region, i.e. the 3' primer for the 21H lambda chain. I I I-TCT-AGA-TCY-TMT-GAA-CTG-ACT-CAG
(SEQID NO:64)jS the primer used to reamplify the inner chain linker of F105 to put a lambda variable region on it in place of the kappa variable region.

SUBSTITUTE SHEET

: W094/02610 Pcr/u593/06735 - 6~ 7 ~ ~ 8 Namely, as shown in the prior example,we put a leader peptide, a leader primer and a blunt end JH primer to amplify the rearranged heavy chains that have the leader peptide at one end and the JH blunt end se~ment on the other end. The leader peptide had a Hindlll site.

The rearranged heavy cnain along with the inner chain linker was createJ by using primers GGA-ACC-CTG-GTC-ACG-GTC-ACC-TCA (SEQ
ID NO:65) on the 5' end and TGG-AGA-CTG-CGT-CAT-CTC-GAG~
(SEQ ID NO:66) on the 3' end. This rearranged heavy chain was used in oonjunction with the kappa chain in the case of the 1.7b to produce the single chain antibody with the leader sequence. The primers used for the 1.7b are GAA-CTC-GAG-WTG-ACG-CAG-TCT-C(~A (SEQ ID NO: 67), which anneal to the Vk~,pp. region and GG-GTC-TAG--ACT-CGA-GGA-TCC-TTA-l~A-ACG-CGT-TGG-TGC-AGC-CAC-AGT ~SEQ ID NO:68), which will ;~ 15 anneal to the most constant portion of the kappa chain.
:
A~ter the ~hree pieces are added together and assembled by overlap extension, the single chain antibodies have on the 5' end a Hindlll cloning site and on the 3' end the Xbal cloning site. You digest the PCR
assembled fragment by use of appropriate restriction enzymes according to manufacturers instructions and then clone it directly into the plasmid, such as pRC/CMV.

6. C~nstruction and ExDres~on of Mutant Antibodi~s Using any of these broadly neutralizing antibodies, mutant antibodies can be generated. One can use standard mutagenisis SUBSTITUTE SHEET

WO 94~02610 Pcr/usg3/o673s ~-q ~ a techniques to result in cDNA coding for different amino acids in the variable regions of-the heavy chain such as ~he CDR3 region.

The F105 single-chain antibody, which contained the immunoglobulin heavy chain leader peptide, was initially cloned into pSL1180 cloning vector as described above. To prepare this antibody for CDR3 replacement, the following meth~dotogy was performed. Because the antibody had been cloned into a Ncol/Sphl si~e, removal of some stu~fer DNA was required. Thus, the vector was digested with Spel and Nhel to remove the Not I site. Following self-ligation, colonies were selected that had this s~uffer DNA removed by screenin~. The resul1:ant plasrnid contained the F105 single chain antibody with the leader peptide in reverse orientation with t~o unique res~riction sites that flanked the heavy chain CDR3 region. On the 5' end of CDR3, a unique Eagl site existed ACG-GCC-GTG-TAT-TAC TGT-GCG CGA ~SEQ ID NO:59) and on the 3' end of the heavy chain CDR3, a Bst Ell site is present TGG GGC
CAG GGA ACC-CYt;-GTC ACS GTN WCC (SEQ ID NO:70). The vector was digested with Eag I and Bst Ell and a library of CDR3 regions were cloned in. The resultant transformants were digested with PVU2 and mutant antibodies were distinguished from wild type by the change in paKern after PVU2 digestion. A unique PVU2 site exists in heavy chain CDP~3, therefore, in the mutant antibodies, that site is destroyed. Thus, the pattern would be diffèrent from wild type which contained wild type CDR3 that contained the PVU2 site.
For the construction of the synthetic CDR3, 3 primers were used.
The 5' primer contains an Eag I site CGC-ACA-GTA-ATA-CAC (SEQ ID
NO:71). The 3' primer contains a Bst Ell site GT-GAC-CGT-GAC-CGG-, .

SUBSTITUTE SHEET

, ~0 94/02610 PCI'/US93/0673;
21:~7~

GGT (SEQ ID N0:72). The CDR3 involves degenerative sequence of I~NS
x 15, wherein N is any nucleotide and S is C or G. This minimizes the number of stop codons and allow all 20 amino acids to be expressed at each of 15 positions G-GCC-GTG-TAT-TAC-TGT-GCG-CGA-NNS-TGG-GGC-CAG-GGA-ACC-CCG-GTC ~SEQ ID N0:73). Following kinasing of these three peptides as well as annealing by the methodology described above, the resultant peptide had double-str~ndedness on th~ framework nucleotides flanking the CDR3 and contained open restriction sites. The CDR3 itself remained single-stranded. Bacteriai polymerase was allowed to fill in the gaps. See, Cwirla, S.E., et al. Proc. Natl. Acad. Sci. USA
~7:6378-6382 (1990).

An alternative method by which this can be accomplished would be to PCR aniplify this same oligo that we've created using the two short polymers as the annealing polymers to the long oligonucleotide that spans the CDR3 following amplification, the large oligonucleotide would be digested with EAGI and BstEII and then ligated in using a standard molecular biology techniques.

The unique CDR3 mutants were established by PVU2 digestion.
Then the entire antibody cassette was removed by Hindlll-Xba I digestion, which removes the entire antibody cassette along with cloning sites.
These mutant antibodies were then gel-purified, gene cleaned and cloned into pRClCMV that had been digested with Hindlll and Xbal. These resultant plasmids were then transfected by lipofection into COS ceils as praviously described. Thereafter, mutants having different binding affinities to the envelope glycoprotein were screened.

SUBSTITUTE SHEET

WO 94/02610 PCr/US93/0673~ f--~V~`3';3 ' " .;
- ~8 -Using the above-described technique, six mutant sFv105 antibodies were produced in which the amino acids in the CDR 3 region of the heavy chain were replaced by random amino acids One of the six mutants designated R had a CDR3 region which coded for (SEQ ID NO:74) Leu~Thr-Leu-lle-Ser-Ser-Arg-Leu Arg-Leu-Jle-Aia-Val-Arg-Met.

These six mutants did not bind to the HiV-1 envelope protein.

7. Construction of Fab Neutralizing Antibody To Envelope Glvcoprotein.

A eukaryotic exprsssion vector that is capable of producing high ti~ers of human Fab fragments in COS-1 cells was also produced. This vector is bassd on the pRC/CMV vector described above, however, the Fd heavy chain and the light chain are cloned in tandem and each chain is under the control of a separate CMV promoter. The vector also conatins a neomycin gene for stable trarlsfec~ion. Figure 3 shows pulse chase of COS-1 cells transfected with a plasmid expressing Fab fragments of F105 heavy (H) and light (L~ chains. In Figure 3, the first three Janes are the cell Jysate and the second set of three lanes are from the cell medium.
The lanes for each set are at 2, 3 and 4 hours of incubation. After 30 minutes labelirig with 35S-Met, cell Iysates (I) and medium ~M) were harvested after the indicated times of incubation and radioimmunoprecipitates were obtained with a mixture of anti-human IgG
and anti-human kappa chain antibodies. The pulse chase experiment shown in Figure 3 shows that high levels of Fab fragments of F105 are found in both intracellularly and in addition, the Fab fragments are actively SUBSTITUTE SHEET
~.. ,~. ,,.,.. .. . .. ..... - . - . .. . . .. .

WO 94/02610 P~/US93/0673~
2137~

secreted into the medium. Cell Iysates and culture supernatants from the~e F105 Fab ~ransfected COS-1 cells bind gp120 in an ELISA assay and both heavy and light chains can be readily immunoprecipi~ated with either anti-lgG, heavy chain (Fab H in Fig. 3) or anti-kappa chain antibody ~Fab K in Fig. 3).

B. CONSTRUCTION AND EXPRESSION OF ANTI-TAT SINGLE CHAIN
AN~IBODIES _ . _ _ _ The same general methodology was used to express single chain antibodies to other antigens. A single chain antibody tO the HIV-1 tat protein was generated as follows.

1. Heavv Chain~Pr,mer.
The 5' forward VH primer consisted of a 55 base pair oligonucleotide with the followin~ sequence:

CCC TCT AGA CAT ATG TGA ATT CCA CCA TGG CCC AGG T C/G A/C
A A/G CTG CAG C/G AGTC A/T GG ~SEQ ID NO:49).

The reverse murine JH primer beginning at the 5' end had the following sequer~ce: ~ I

GGGGCGC:GCTG A/C GGAGACGGTGACC A/G A/T GGT CCC T G/~ C/G
GCC CCAG ~SEQ ID NO:50).

SUBSTITUTE SHEET

WO94/02610 PCT/US93/n6735 r.

2. Murine KaDDa Chain Primers.

For PCR amplification of the murine kappa chain, containing the intrachain linker for the production of a single chain antibody, ~he followi ag Vk"pp. primer was produGed.

m GGTCACCGTCTCCTCAGGTGGCG~:;TG(;CTCGGGCGt;TGGTGGGTCG
GGTGGCGGCGGATCT ~/C A A/C~ ATTCAGCTGAC C/A CA G/AT/A
CTCCAtSEQID NO:51~.
For use in conjunction with the above forward Vkappn primer, two different reverse Ck,pp" primers were produced. One was a 44 nucleotide primer having the foilowing sequence: GGGTCTAGACTCGAGGATCCTTA
TTATACAGTTGGTGCAGCATC (SEQ ID NO:52). This primer will anneal from Kabat posi~ions 110 to 115.

The second reverse Ck,pp" primer was used for amplification of the Ck.pp. chain that contains an SV40 nuclear localization signal at its 3' end.
The primer had the following sequence.
G~GTCTAGACTCGAGGATCCTTATTAAACCTTACGII;CTTCTTCGGCGG
AGTTACAGTTGGTGCAGCATC(SEQID NO:53).

This primer will anneal from Kabat positions 1 10 to 1 15 and is then followed by the SV40 nuclear localization signal having the following amino acid sequence:

Thr-Pro-Pro-Lys-Lys-Lys-Lys-Arg-Lys-Val (SEQ ID NO:54) SUBSTITUTE SHEET
,~,,.,.. ~... . ` ~

WO 94/02610 P~r/US93~06735 ~ t ~

PCR AMPLIFICATION
~.
2-3~g of total RNA isolated from anti-tat-lll hybridomas was used to produce cDNA produced by random primer annealiny in a 25~19 reaction. Five to ten percent of the single stranded cDNA was cornbined with the VH primer and VJ primer and PCR was performed as described in Exampie 1. The annealing temperature for the PCR reaction was 56C.

For PCR amplification of the light chain, Vk"ppn primer containing ~he interchain linker was combined with either the Ck,,~,p. primer alone, or the Ck"pp~, primer containing the SV40 nuclear localization signal. Annealing temperature for this reaction was 56C.

For both light and heavy chain amplification, 30 rounds of PCR was 1~ used. These PCR products were ~el purified on a 2% low melting point agarose gel. Because prior sequence analysis of the kappa chain showed an internal BstE-II site, a multistep cloning procedure was necessary.
First, the heavy chain PCR product was Klenow kinase treated to repair the ends and assure that blunt ends were produced. The heavy chain fragment was then digested with Xbal. Likewise, the two different kappa chain constructs, with and without the SV40 nuclear localization signal, were Klenow kinase treated followed by digestion with Xhol. Equal molar amounts of these two`fragrnents were mixed with the PSK+ vector that had been digested with Xbal and Xhol~ This allowed for sticky end cloning at the extrerne 5' and 3' ends, and blunt end cloning between the two PCR products.

SUBSTITUTE SHEET
~,, .. .,. . ~ . ~ .

WO g4/02610 PCr/US93/06735 ~3~

Following successful cloning of the heavy and light chains, plasmid DNA was digested with BstE-II and the approximatBly 120 base pair BstE-ll fragment was recovered and recloned into the same vector. This was necessary to remove extraneous nucleotides at the blunt end site. Several clones were obtained and the orientation of the 3stE-II fragment was confirmed by PCR amplification using either thB VH~ Vk~pp" primers or Vk",p", Ck"~,p" primers set forth above.

For cloning into the eurkaryotic expression vector pRc/CMV
(InYitrogen), an Xball/Apal fragment was obtained from the PSK+ vector and cloned into the PRGCMV vector which had been digested with the same restric~ion enzymes. To confirm the biological activity of the anti-tat single chain antibody obtained from this construct, the single chain an~ibody was reamplified with a new 3' primer to clone into the P-10-1 phagemid vector. Together with the original VH primer, a new reversed Ck.pp, primer was used (ATT AGC GGC CGC TAC AGT TGG TGC AGC
ATC) (SEQ ID N0:5~.
: : ~
The PRC-CMV anti-tat single chain antibody was transfec~ed into COS cells using Iypofection. Expression of the single chain antibody was found.

A second anti-tat sh~, which is similar to the above-described t~t antibody except that it has a ER localization leader sequence was constructed as follows:

The genes of VH and VL domains of a murine an~i-HlV-1 tat hybridoma cell line were cloned and DNA sequenced as described. A

SUBSTITUTE SHEET

` WO 94/02610 PCI/US93/06735 ~137~8 heavy chain leader primer (P-L) with the additional restriction enzyme site, 5'-mAAGCrrACCATGAACTTCGGGCTC-3' (SEQ ID N0:75~, and reverse primer ~P-J) corresponding to the 3' end of the heavy chain variable region, ~'-TC;~A/C) GGAGACGGTGAC::(A/G)(A/T) GGTCCCT-3' (SEQ ID N0:76), were used to amplify the leader sequence and rearranged heavy chain sequences by polymerase chain-reaction as described above. A V, primer (P-K), corresponding to the 5' end sequence of the VLI 5'~GAGCTCGTGCTCACtC/A)CA(G/A)(T/A)CTCC A~3' (SEQ ID
N0:77), and a reverse Ck primer (P-Ck) corresponding to the beginning of the constant region of kappa chain with a stop codon,5'-GGGTCTAGAC
TCGAGGATCCTTATTATACAGTTGGTGCAGCATC-3'(SEQID NO:78) or without 5' GGGTCTAGACTt::GAGGATCC1~ArrATACAGTTGGTGGAGC
ATC-3' (SEQ ID N0:53), the SV40 nuclear localization signal, were used to amplify the V, sequence.

A 93 bp interchain linker was amplified using primers perfectly complerrentary to the (P-J) and (P-K) primers and containing the internal interchain linker sequence (Gly-Gly-Gly-Gly-Ser)3~sE~,D NO~ The three fragments were gel purified and the anti-tat sFv was produced by overlap extension by the methodology of Clackson, T., et al. tNature 352:624 (1991)]. The assembled anti-tat sFv signal sequence was cloned into pRC/C:MV and the DNA sequence was confirmed [Sanger, F., et al. Proc.
Natl. Acad. Sci USA 74:5463 (1977)]. The single chain antibodies were then reamplified using a forward framework one primer with 5'Hindlll site 5'~ AAGCrrACCATGGACGTGAAGCTGI;TGGAGTCT 3' (SEQ ID
NO:79) SUBSTITUTE SHEET `~-, j - . . . . ..

W~ 94/02610 PCr/US93/06735 (~

~ 3~ - 74-C.~ ~

1. Abill~y of Antibodies To Be ExDressed In Mammalial ~el!s.

The ability of these proteins to be expressed in mammalian celis was determined by transient transfection of COS-1 cells and a HeLa cell line that constitutively express the CD4 protein, HeLa-CD4 [Madden, P.J., e~ al., Cell47:333-348 (1986~; McDougal, J.S., et al., J. Immunol.
137:2937-2944 (1986)~ as set forth below. It was found that whereas abundan~ amounts of the sFv105 protein are precipitated by anti-human heavy and light chain antibodies, Yery litt!e of the sFv105-KDEL protein is detected in the ~ransient expression assay.

, Cells that constitu~ively express the sFv105 and sFv105-KDEI
pro~eins (COS sFv105 and CO~ sFv105-KDEL) were made by transfection of COS-1 cells with the two plasmids followed by selection for neornycin resistance.
cos 1 cells on 35 mm dishes were tranfec~ed with 10 ~9 of pCMV-sFv or pCMV-sFv-KDEL or vector plasmid DNAs which contain neomycin resistance gene using lipofeetin ~BRL Corp) as described by Chen, S.Y., et al., J. viro/. 65:5902-5909 (1991). Two hours after 2~ transfection, 1.5 ml of Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum were added to the cells and incubated for 48 hours. The transformed cells were selected in DMEM
with 10% fetal bovine serum containing 500 ~uglml of G418 (BRL). The transformed cells were then grown on 6-well plates and metabolically labeled by incubation for 30 minutes in 0.5 ml cysteine-free containing .. SUBSTITUTE ~HEET
. .. .

..' 21~7 ~
. - 75 -!

100 ~ci35S-cysteine. The cells were then washed and incubated in DMEM
containing 1 0mM unlabeled cysteine. Proteins were immunoprecipitated from the cell Iysates or medium and analyzed by electrophoresis. See, Figure 4. These cells were puise labeled for 30 minutes, chased and immunoprecipltated with anti-human immuno~lobulin K-chain antibody from cell Iysate or culture. The proteins were resolved by electrophoresis on a 12.5% SOS-polyacrylamide gel and visualized by autoradiography.
(Laemmli, U.K., Na~ure 227:680-684 ~1970)3. Postion of the protein ~ markers are shown in the figure. Lane 1, CMV-COS-1 cells, chase l60 3 10 minutes~ Lanes 2-5 saniples immunoprecipitated from cell Iysates of COS
sFv 105. Lanes 6-9 precipita~ed from ~he medium of sFv105-COS. Lanes 2 and 6 chase 30 minutes. Lanes 3 and 7 chase 60 rninutes. Lanes 4 Ç and 8 chase 120 minutes. Lanes 5 and 7 chase 360 minutes.

,, .
Immunofluorescent staining of the sFv or Yector transformed cells was accomplished on 15mM-diameter cover slips which were fixed in solution containing 95% ethanol and 5% acetic acid at -20C for 5 minutes. See, Figure 5A-D. The sFv 105 alone ~A) or vector alone ~D) transformed cells or sFv-KDEL transformed cells tB) cotransfected with 10 20 ~9 of the HIV-1 glycoprotein expressor plasmid pSVIII env described by Helseth, E.M., et al., J. Virol. 64:2416-2420 (1990) were stained with anti-human l~-chain antibody followed by incubation with fluorescein (FlTC)-conjugated anti-rabbit IgG. For ER-staining, the vector-transformed cells were incubated with anti-BlP antibody followed by anti-mouse IgG-25 FITC (C). The vector transformed cells were incubated with anti-Bip antibody at 37C for 30 minutes followed by anti-rabbit IgG-FlTC or anti-mouse IgG-FlTC after washing with phosphate-buffered saline (PBS).

SUBSTITUTE SHEtT

wo 94/02610 Pcr~US93/0~73 After a final washing, the cells were moumed and observed on a Nikkon Microscopy with fluorescence optics at a magnification times 1100.
c Thus, the location of the sFv105 protein within the ceil couid be determined. This antibody stains a tubular network throughout the cyl:oplasm typical of an ER resident protein (Figure 5A~. This pattern is the same as that obtained using an antibody to the ER resident protein immunoglobulin heavy chain-binding proteins, BiP [Wu, G.E., et al. Cell 33:77-83 l1983); Bole, D.G., et al., J. Cell Biol. 102:1558-1566 11986);
Dul, J.L, et al., Proc. Natl. Acad. Sci USA 87:8135-8139 (1990); Knittler, M.R., et al., ~e EMBO J. 1 1 :1573-1 581 (1~92)] In the parental cell (Fig.
5c)-.

2. Ability of Antibody To Envelope Glycoprotein To Inhibit Envelope Protein Biosvnthesis And Activitv.
~ ' .

The ability of cell lines that constitutively express the sFv105 or sFv105-KDEL proteins to inhibit HIV-1 envelope protein biosynthesis and activity was determined by transfection of the COS sFv105 and COS
sFv1 05-KDEL cells with a vector that expresses high levels of the envelope protein. Pulse chase analysis followed by immunoprecipitation of the envelope protein shows~that a significant fraction of ~pl 60 is 1 25 cleaved to gpl 20 in the parental cell line during the four hour chase Jd (Figure 6). Although sirnilar amounts of gpl60 are made in the parental ~d znd COS sFv105 cells, very little gpl20 is evident after the four hour '~ chase (Figure 6). The gp160 protein present in the COS sFv105 cells can be co-precipitated using an anti-human kappa chain antibody. This ' 30 antibody does not precipitate the gpl60 protein made in the parental ~, SUBSTITUTE SHEET

~.37~3 18 COS-1 cell lin~. An antibody to the HIV-1 envelope glycoprotein also co-precipitates the sFv105 protein in cells that express gp160 ~Figure 6).
.. . .
I
The transformed cells were transfected with 10,ug of pSVlllenv S plasma DNA and Z ~9 of pSVIII tat expressing tat ~See, Helssth, E.M., J. I
Vjrol., supra) and pulse-labeled with 35S-cysteine for 30 rninutes and chased for 4 hours. The cell Iysates were immunoprecipitated with anti-K
antibody or polyclonal sheep or rabbit anti-gp120 serum (AIDS Research and Reference Program). As described above, proteins were resolved by electrophoresis on 11% SDS-polyacrylamide gels and visualized by autoradiography as described above. See, Figure 6. Fig. 6A shows cell Iysates imrnunoprecipitated with polyclonal shzep, anti-gp120 serum and Fig. 6B shows cell Iysates irnmunoprecipitated with rabbit anti-gp120 ~. serum. Fig. 6A: Lane 1, mock transfected sFv105-COS-1 using anti-K and s 15 anti-gp120 immunopreoipitated from HIV-1. Lanes 2-4, precipitated from the envelope transfec~ed sFv10S-COS-1. Lane 2, precipitat~d by anti-gp120. ~ane 3, precipitated by chain antibody anti-l~. Lane 4, precipitated by anti-/~ and anti-gp120 antibodies (AIDS Research and Reference Program~. Fig. 63, Lane 1, immunoprecipitated from mock transfec~ed COS-1 using anti-~2 chain and anti-gp120 protein antibodies.
Lanes 2-3, precipitated from the envelope transfected sFv105-KDEL.
Lane 2, precipitated by anti-gp120 antibody. Lane 3, precipitated by anti-K chain antibody. Lane 4, precipitated from sFv105-KDEL cells using anti-~ K chain and anti-gp120 antibodies.
,~ 25 In the COS sFv105-KDEL cells, processing of gp160 to gp120 is partially inhibited IFigure 8). Figure 8 shows sFv105-KDEL specific binding to the HIV-1 glycoprotein in cells by autoradiograms of SUBSTITUTE SHEET

WO 94/02610 PCI'/US93/0~735 polyacrylamide gels showing that sFv105-KDEL protein is coprecipita~ed t with ~he HIV-1 glycoprotein. Lane 1 shows Iysates of mock transfected COS-1 cells precipitated with a mixture of anti-gp120 and anti-kappa chain anl:isera. Lanes 2-3 show Iysates of COS sFv105-KDEL cells transfected with ti e envelope expressor plasmid pSVlllENV. Lane 2 was - precipitated with an anti-gp120 an~iserum. Lane 3 was precipitated with an anti-kappa chain antiserum. Lane 4 shows Iysa~e of COS sFv105- !KDEL cells precipi~ated with a mixture of anti-gp120 and anti-kappa chain antisera. The amount of sFv105-KDEL protein precipitated by an anti-. 10 human kappa chain antibody is increased by the presence of gp160. Thegp160 protein present in the COS sFv105-KDEL cells is also precipitated ~' by an anti-kappa chain antibody. Antiserum that express gpl 60 Is similar to the distribution of the sFv105 protein in COS sFv105 cells (Figure 5B).
Evidently, the sFv105-KDEL protein is stabilized by binding of sp160.

Co-immunoprecipitation experiments were performed with v, antiserum to the ER chaperone protein, BiP. The sFv105 protein is ~ precipitated using an antiserum to the BiP protein. Althou~h .~. immunoglobulin heavy chains and light chains are known to bind to BiP, 20 (Wu, G.E., et al., C:ell 33:77-83 (1983); Bole, D.G., et al., J. Cel/ Biol.
102:1558-1566 (1986); Dul, J.L., et al., Proc. Natl. Acad. Sci. USA
87:8135-8139 (1990); Knittler, M.R., et al., The EMBO J. 1 1 :1573-1581 ', (1992)] several additional experiments were performed to exclude the ~, possibility that inhibition of gp160 processing was due to non-specific activity of the sFv105 antibody.
.. .
The ability of cells that express a single chain antibody capable of binding sFv105 to inhibit processing of a mutant of the env protein was ,~j ~ SUBSTITUTE SHEET

. - W0 94/02610 PCI/US93/06735 ~' 2:~ 3 ~

examined. For this ,ourpose, the COS sFV105 cells were transfected with a plasmid ~hat expresses a mutant of the envelope protein in which - glutamic acid has been substituted with glutamine at position 370. This . mutation has been previously shown to eliminate detectable binding of the ~ i envelope pro~ein by the sFv105 paren~al antibody [Thali, M.C., et al., J.
Virol. 66:5635-5641 (1992)]. The specificity of sFv105 binding to the !~
,: HIV-1 env~lope protein was also examined by transfecting the COS
sFv105 cells with an envelope protein of the Punta Toro virus, a Bunyavirus or with the hemaglu~inin of the WSN strain of the influenza A
virus, an Orthomyxovirus. These two vital proteins havs been prevlously shown to be processed in the ER and Golgi apparatus ~Chen, S.Y., et al., J. Virol. 6~:5902-5909 (1991); Hughey, P.li., et al., J. Virol. 6~:5542-55~Z ~1992)]. Neither the Punta Toto nor the influenza virus proteins were precipitated with anti-human kappa chain antibodies which are ` 15 showntocoprecipitatethesFvlO5HlV-1 gp160complex. Figure9,1anes - 1 and 2 show that in contrast to the block in processing of the parental ` envelope protein in COS sFv105 cells, the mutant gpl60 envelope protein is processed normally into gp120. Thus, Figure 9 shows that sFv105 is not coprecipi~ated with unrelated proteins. The COS sFv cells were transfected with 10 /ug of the mutant HIV-1 glycoprotein expressor 370E/D, which is not bound by F105 [Thali, M.C., et al. J. Virol. supra], pulsed^labelled with 35S-cysteine for 30 minu~es, and then chased for 4 hours. The proteins were immunoprecipitated either with anti-HlV-1 - glycoprotein (lane 1~ or anti-kappa chain antibody (lane 2). The COS-sFv cells were infected with 5 M.O.I of vaccinia virus encoding T7 polymerase for 2 hours and then transfected with 10 IJ9 of plasmid DNAs PTV-G1-G2, . which contains the genes of G1 and G2 glycoproteins of Punta Toro virus 6, under the control of T7 promoter (Chen, S.Y., et al., J. Virol., supra], or /

SUBSTITUTE ~EET

WO 94/02610 PCI/US93/0673~
.,,Q~ -! ~
,:
plasmid T7-HA, which contains the HA gene of the WSN strain of influenza A virus under the control of the T7 promoter lChen, supral. The cells were then pulse-labelled with 35S-eysteine for 30 rninutes and chased for 4 hours. Lane 3 and 4: the Iysates of PTV G1-G~ transfected cells immunoprecipitated with anti-PTV glycoprotein (Chen, supra) ~Lane 3) or anti-kappa chain (Lane 4). Figure 9 also shows that the processing of the Punta toto envelope protein is not affected by the expression of the sFv105 antibody (lanes 3-6).

..
The ability of other single chain antibodies that do not bind to gpl 60 to interfere with processing of the envelope protein was examined.
, Two different single chain antibodies were used. C)ne such antiDody is the single chain an~ibody derived from a murine monoclonal antibody that . recognizes the HIV-1 tat protein. This anti-tat single chain antibody has 1~ been altered from the tat antibody's norrnal intracellular target to have a leader sequence which will targe~ the ER. This antibody is also stably retained intracellulary in COS cells and is not secreted into the medium in a transient expression assay. The processing of gp160 to gpl20 in COS
~ cells was unaffected by cotransfection of a plasmid which expressed the .`, 20 HIV-1 glycoprotein with the plasmid that expressed the anti-tat sFv.
~i Moreover, an anti-imrnunoglobulin antisera that precipitates the anti-t~t ,, sFv does not coprecipitate the HIV-1 enYelope protein (See Figure 1û).
Figùre 10 shows that an intracellularly retained anti-tat sFv does not bind ~ HIV-1 glycoprotein. The COS cells were cotransfected with 10 ~9 of -~ 25 pSVlllenv and 10 ~9 of pRC/CMV-sFvtat plasmid DNA, pulse-labelled with 35S-cysteine for 30 minutes and chased four hours. The proteins were .~, immunoprecipitated with antimouse immunoglobulin antisera (Lane 1 ) or sheep anti-gp120 (Lane 2) and analyzed by SDS-PAGE. The six mutants . ~
., .
~ SUBSTITUTE ~nEET
~r .. . ... ,, ,, " ,, WO 94/02610 PC~/US93/0673;
2 ~ 3 ~
v - 81 -`

of sFv105 produced in which all of the amino acids in the CDR3 region of the heavy chain were replaced by random amino acids and which do not . bind the protein were also used. The processing of gp160 to gp120 in COS cells was unaffected by cotransfection of the plasmids that express these mutant proteins. The anti-immunoglobulin antisera did not coprecipitate the HIV- 1 envelope protein .
;

The ability of the sFv105 and sFv105-KDEL proteins ~o inhibit the function of the envelope protein was determined by measurement of the ability of cells transfected with the envelope g0ne to induce syncytium formation of CD4+ cells. In one set of experiments, the parental COS
vector cells as well as the COS sFv105 and COS sFv105-KDEL cells were transfected with a plasmid that expresses a functional envelope - glycoprotein. At two days post-transfection the cells were mixed at a 1~ ratio of about 1 to 10 with a human CD4' T cell line, SupT1, that is susceptible to envelope mediated fusion. The extent of envelope mediated syncytium formation was reduced by 80-90% in cells which ¦ ~ express either ~he sFv105 or sFv105-KDEL proteins (Figure 7). Similar amounts of gpl 6û were made in all three lines as determined by metabolic labeling and precipitation of the transfected cultures. Reduction in syncytium formation was also observed upon co-transfection of the HeLa CD4+ cell line with a plasmid that expresses a functional envelope , glycoprotein along with a second plasmid tha~ ex~aresses either the sFv105 or sFv105-KDEL proteins (Figure 7). In contrast, there was no significant reduction in syncytium formation when the second plasmid that expresses the anti-tat sFv (Figure 7).

SUBSTITUTE SHEET

WO 94/02610 PCr/US93/0673 ~,..S

CD4+Hela cells were cotransfected with 3 ,~Jg of pSFlllenv and 15 /ug of vector or pCMV-sFv or pCMV-sFv-KDEL. Synctia were counted 30 hours post-tranfection. The transformed cells were transfected with 3 ~g of pSVlllenv which were incubated for 48 hours, then rinsed in PBS and incubated with 50 mM ~DTA at 37C for 40 minutes. The cells were removed from the plate, washed with PBS, and resuspended in Z ml of DMEM supplemented with 10% fetal calf serum. The cells were then added with about 2 x lOff SupT1 Iymphocytes and incubated at 37CC for 12 hours and synctia was scored. To examine the production of infectious HIV-1 by the transformed cells, COS, COS sFv105 and COS
sFv105-KDEL cells were transfected with 5 Jlg infectious pSVlllB DNA.
The supernatants from the cells were harvested at day 4 of transfection and 1 ml ofeach of the supernatants was then inoculated with about 2 x lo8 SupT1 cells for 12 hours. The SupT1 cells were then washed with DMEM twice and placed in the RPMI medium supplemented with 10%
fetal bovine serum after 12 hours. The supernatants of the SupT1 cells were then harvested and the production of viral particles was measured by using a sensitive radioimmunoassay serum for the HIV-1 p24 capsid - - antigen protein ~DuPont-NEN Inc~) following manufacturer's instructions.
Figure 7 shows a significant reduction of synctium formation in the CD4+
HeLa cells and the transformed COS cells expressing sFv or sFv-KDEL.
The percentage of the-values of synctia observed in the CD4+ HeLa cells or the vector transformed cells transfected with pSVIII env are shown.

To examine the ability of the sFv105 proteins to inhibit production of infectious virus, COS vector, COS sFv105, and COS sFv105-KDEL
cells were transfected with a plasmid that contains a copy of the entire viral genome lFisher, A.G., et al., Nature 316:262-26~ (1985); Helseth, js .
SUBSTITUTE SHEET

` WO 94~02610 PCI/US93/06735 - 83 ~ ;3 5 ~
. . ~
. ' I
E.M., et al., J. Virol. 64:2416-2420 t1990)]. Four days post-transfection, the virus in the culture supernatant fluids was used to initiate infection of - the sensitive indicator cell line SupT1. The supernatants of all three -- transfected cells lines were shown to contain similar amounts of the viral capsid protein, p24. Release of capsid proteins into the cell supernatant has previously been shown to occur in the absence of syn~hesis of the envelope glycoprotein as well as in the presence of envelope glycoproteins that con~ain processing defects and are therefore retained in the ER
[McCune, J.M., et al., Cell 53:55-67 t1988); Ratner, L.N., et al., AIDS
Research and Human Retraviruses 7:287-294 (1991)].

Figure 11 shows that virus replica~ion in SupT1 cells initiated by supernatants from ~he transfected COS sFV105 or COS sFv105-KDEI cells is delayed about 5 days rela~ive to that inita$ed by supernatants from the 1~ tranfected COS sFv105 or COS sFV105-KDEL cells is delayed about 5 ? days relative to that initiated by virus produced by a control COS-1 cell line that contains the vector but not the sFV1 OS sequences. Figure 11 shows virus yield by the infected SupT1 cells. The infectious pSVlllB
DNA is~an infectious HIV-1 proviral DNA of the HXBc2 strain lFisher, A.G., et al. Nature 315:262^265 t19851]. The sFvlO5 or sFv105-KDEL or vector transforrned cells were transfected with 5 ~g of pSVI118 plasmid DNA containing an infectious HIV-1 proviral DNA of the HXBc2 strain.
After 4 days of transfection, the supernatants from the transfected cells were inoculated with SupTi cells for 16 hours and then washed, placed in fresh medium, monitored for concentration of viral capsid p24 protein by gag p24 activity in the culture medium. The medium amounts detected from the supernatants of transfected cells were 1.2 ng/ml Ivector-COS), 1.0 ng/ml tCOS sFv105), and 1.4 ng tCOS sFv105-lCDEL) respectively.

SUBSTITUTE SHEET

WO 94/~2610 Pcr/US93/0673 9"~ - 84-The symbols in Figure 11 represent the results obtained using supernatants harvested from the C:OS control cell line that contains the vector alone (O), a COS cell line that consitutively expresses the sFv105 protein ~0), and a COS ceil line that expresses the sFv105-KDEL proteir (~).

When serial dilution of the supernatants were used ~o infect SupT1 cells, there was a greater than 103 fold r~duction in syncytium forrnation (Figure 12). Figure 12 shows virus titer by syncytium formation in SupT1 cells. The transformed COS vector and C9S-sFv105 cells were transfe~ted with 4,ug of pSVlllB plasmid DNA containing an infectious HIV-1 proviral DNA of the HX8c2 strain [Ratner, s-Jpral. After 48 hours of transfection, the supernatants from the transfected cells were harvested and used in serial dilutions to infect SupT1 cells for 16 hours and then washed. After 8 days, syncytia were counted. Data are number of welis positive for syncytialnumber of wells counted. Fi~Je high power fields (HPF) were counted in each well. One or more syncytia in five HPF
- counts as ( + ) for the dill~tion. The delay in replication of virus produced ~ by t'-OS sFvlO5 cells and the decrease in infectious titer is attributed to - 20 low infectivity of the virus relative to that of virus produced by the control cell line. The results of these experiments demonstrate that cells can produce antibodies that function intracellularly. The antibody is stably expressed and retained in the endoplasmic reticulum and is not toxic to . the cells. The antibody binds to the envelope protein within the cell and inhibits the maturation and function of this critical virus protein. The - infectivity of the HIV-1 particles produced by cells that express the single chain amibody is subs~antially reduced.
i .
. SUBSTITUTE SHEET
.

` WO 94/0261û PCI/US93/0673~
21:37~
~j , $
A trans-complementation assay was used, which uses two plasmids, one encoding rev and envelope proteins (pSVlllenv) under control of HIV-1 LTR, and the other containing a HIV-1 provirus with a deletion in the env gene (pHXBenvCAT~ and a chloramphenicol acetytransferase (CAT) gene replacing the nef gene lHelseth, J. Virol.
64:2416 (1990)~. Both plasmids were transfected into COS-1 c~lls and the supernatants from ~he cells, which contained virus particles with single round infectivity, were used to infect parental SupT, SupT vector or SupT sFv105 cells. The CAT activity was determined from the Iysates of the infec~ed cells, which reflects the single-round infectivity of the virus particles. In these experiments, comparable amounts of CAT activity was observed from the parental SupT, SupT vector and SupT sFvlO5 cells infected with the supernatants from the co-transfected COS ce!ls. while no detectable CAT activity was observed from the par~ntal SupT, SupT
vector or S~pT sFv105 cells infected with the supernatants from the COS
cells transfected with either the pSVlllenv or pHXBenvCAT plasmid alone.
These experimental results indicate that the SupT sFv105 cells are susceptible to HIV-1 infection and the observed block of both the cytopathic effects and production of infectious virus is due to a late event in the virus life c~/cle (assembly of infectious virions). This experimsnt confirms that the impaired ability to support HIV-1 replication in the SupT
sFv105 cells was not due to the loss of CD4 receptor function or other unobserved changes thàt` occurred as a result of intracellular antibody production.
The expression of the sFv105 does not interfere with expression of several cell surface molecules. We have shown that surface CD4 expression is normalized after HIV-1 infection in sFv105 producing SupT

SUBSTITUTE SHEET

- WO ~4/02610 PCI'/U~;93/06735 c~ 86-' cells. We have performed FACS analysis on additional surface markers including CD3, CD5, CD7, CD8, ,B2M, CD20 and HLA-DR. There was no difference in fluorescence intensity between SupT vector and SupT
sFv105 cells when comparing surface ievels of CD3, CD5, CD7, CD8 and ~2M. There was no surface expression of CD20 ~r HLA-DR in either cell ~ Iine. These markers are in agreement with the published phenotype of-~ SupT cells.
,~1 Transduced cells are capable of responding to appropriate stimuli with increased levels of inducible proteins. Several PHA stimulation experiments comparing the levels of 3H-thymidine incorporation between SupT vector and SupT sFv105 cells were performed. After 6 hours of in~ubation with or without 8 mM PHA and labelling with 3H-thymidine there was a greater than 10-fold increase in thymidine incorporation in both cell lines whereas unstimulated levels were equivalent (SupT vector -stimulated 1485 cpm/unstimulated 139 cpm; SupT sFv105 cells -stimulated 3330 cpm/unstimulated 263 cpm). Therefore these transduced cells appear to respond to the mitogenic response at equivalent levels.
From these additional data, we conclude the SupT sFv105 cells maintain parental phenotype, can respond appropriately to external ~I stimuli, are resistant to thè cytopathic effects of HIV-1 infection and the infected cells produce HIV-1 virus particles that are markedly diminished in their infectivity. These effects are a result of intracellular binding activity of the sFv105 molecules with gpl60 SUBSTITUTE SHEET

WO 94/02610 PCr/US93~06735 2 ~ ? 7 3 ~3 ~
-87- i .~ ~

4. Abi!i~v of An~i~od~ to T~t Protein tQ Inhibi~ Trans-a~tivati~ ~i f The tat protein from HIV-1 trans-activates genes expressed from HIV-1 long terminal repeat (LTR). A sensitive assay for the presence of tat in the cell has been developed by introducing tat into cells expressing a plasmid eontaining HIV-1 LTR-CAT reporter.

ChiQram~henicol-Acet~Transfçrase ~CAT) As~a~.
. .
H3TI~NIAID Aids Reagent Program) a HeLa cell line containing an integrated LTP-CAT plasmid were grown in Dulbecco's Modified Eagle's Medium ~DMEM) supplementeci wi~h 10% fetal calf serum ~FCS). Cells were grown to ~0% confluence on 6 well Nunc tissue culture plates.
,~ .
Various concentrations of anti-tat SCA with leader, anti-tat SCA
. without SV40 ~VK) and anti-tatSCA with SV40 (VKSV40) were co-infected into H3TI with .1 micrograms of pSVlllenv, a tat expressing pladmid using 7~J
lipofection for two hours.

CAT activity was measured as described lGorman, et al., Mol. Cell.
Biol. 2:1044 1051 (1982)] 72 hours after transfection.

, -~ The transfection of HeLa cells containing the HIV-1 LTR-CAT
i, repor~er plasmid shows significant trans-activation (25X) with thetransfection of as little as .01 micrograms of tat expressing plasmid (Figure 20).

:
:
SUBSTITUTE SHEET

WO 94~0~610 PCI/US93/0673 q~, - 88 -Inhibition of Tat Qctiv tv.

The effect of the presence of anti-ta~ single chain antibodies ~SCA) expressed intracellularly on trans-activation was determined as follows:
10 micrograrns anti-tat SCA ~VK), anti-tat SCA with SV40 nuclear localization si~nal ~VK5V4O) and anti-t~t SCA with an inmmunoglobuliin leader sequence to direct the SCA into the endoplasmic reticulurn were co-transfected with 0.1 microgram pSVlllenv tat expressor plasmid into HeLa cells containing the HIV-1 LTR-CAT plasmid. Since the leader sequence directs the single chain antibody into the ER it should have no effect on tat which is present only in the oytoplasm and nucleus. The results, summarized in Figure 21, show that the presence of anti-tat SCA
VK and anti-tat SCA VKSV40 result in a decrease in trans-activation of HiV-1 LTR-CAT by tat when compared to the activity of the same antibody directed to a different compartrnent in the cell. Anti-tat VK
shows only 4% of the activity of the anti-tat SCA with leader while anti-tat V,~SV40 shows 18.4%.

ii When the amount of antibody added tO the cells is cut in half ~Figure 22), the activity of tat in cells transfected with anti-tat VK show 15% of total activity while anti-tat VKSV40 show 28%.
. ' i 5. Inducibl~ ExDression of.Intracellular Antibodv We cloned the F105 sFv under the control of the HIV-1 5' LTR and have established stable cell lines in SupT cells. As can be seen in Figure 13 lane 1, the F105 sFv is expressed following transfection of stable ;!
d SUBSTITUTE SHEET

. W0 ~4/02610 PCI/US93/0673~ ~
2 ~ ~ 7 .~ ~ ~

F105 sFv LTR SupT celis with the tat expressing plasmid pSVlll~at.
Figure 13 shows SupT ceils stably transformed with pLTR F105 sFv ~Lane 1) or pRC/CMV F105 sFv (Lane 2). SupT LTR F105 sFv cells were additionally transfec~ed with pSVllltat. 80th cells were labelled with 3SS-Cys for 3 hours and cell Iysates prepared. Radioimmunoprecipitation was with anti-human kappa chain antisera followed by 15% SDS-PAGE. No Ftû5 sFv is seen in the absence of ~at protein expression. The prornoter and cell interdeperldence of this expression is shown in lane 2 of Fig. 13 where the CMV promoter is used. Many clones were screened and virtually non produced detectable antibody. Jurkat cells gave similar results.
., .
The above-described stably-transformed SupT cells stably transformed with the F105 sFv under the control of the HIV-1 LTR were i~ 15 indueed with varying concentrations of tat protein. Figure 16 shows that a the F105 sFv was inducibly-expressed with as little as 0.1 ~19 of tat protein. Lane 1 shows administration of 10 ~9 of tat protein; Lane 2 is 1 ,ug of tat protein; Lane 3 is 0-5 /ug of protein; Lane 4 is 0.1 ~9 of protein and Lane 5 is 0 ~9 of protein. There is a marker to indicate the location of the sFv 105. The transformed SupT cells maintain normal morphology and replication rates and can be transduced to express high levels o~ the F105 sFv.

SupT cells were infected with HIV-1 as described above. They were then stably transduced with pLTR F105 sFv as described above.
Figure 17 is a FACS analysis of SupT cells. Figure 17A is a negative control showing a SupT 1 cell that is not infected. Figure 17B is a positive control of the SupT HIV infected cells that was not transduced.

SUBSTITUTE SHEET

WO 94~02610 ~ PCI`/US93/06735 f Figure 17C is a FACS analysis of the SupT HlV-LTR-sFv 105 transduced HlV-infected SupT cells and Figure 17D is the HlV-infeoted SupT cell mock infected with a vector con~aining the HIV-LTR but not the sFv 105 antibody gene.

Figures 17B-D show surface staining of gpl20 using FlT(:-anti-gpl20 (ABr Inc.~ eight days a~er infection with 20 MØ1. HXB2 strain of HIV-1. As can be seen from the analysis, Figure 1 7D shows the same general pattern of staining the SupT cells as the positive control (Fi0.
17B). In contrast, the HlV-infected cell transduced with the antibody according to present invention (Fig. 1~C) shows a background staining similar to the ne~ative control (Fig. 1 7A), thereby demons~rating that surface gp120 expression is markedly diminished in SupT sFv 105 cells.

Figure 1 8A-D look at the surface CD4 expression in such cells.
Figures 1 8A shows background staining in a negative control, whereas Fig. 188 shows the surface staining of CD4 using FlTC-anti^CD4 (ABT, Inc.) at eight days post-infection with 20 MØ1. HXB2 strain of HIV-1 (the positive control). Figure 18D shows the marked down-regulation of CD4 3 20 expression on SupT HlV-infeeted celts that are mocked-infected with the HIV-LTR vector eight days after such infection. In contrast, Figure 1 8C
shows that surface CD4 expression in the SupT HlV-infected ceils ; transduced with sFv 105, under the control of the HlV-LTR, was nearly normal ei~ht days after infection. Thus, these experiments demonstrate 2 5 that surface CD4 expression was not significantly down-regulated in cells wherein HIV protein was targeted according to the present invention. The experiment further implies that the intracellular complexes of CD4-gpl 60, ,.
", ,~

SUBSTITUTE SHEET

- - W0 94/02610 2 1 3 7; S ~ PCIIUS93/06735 I

which are known to form in the ER, can be disrupted by the present method.

Figure 19 shows the cytopathic effects of HIV-1 virus inhibition in CD4 SupT HlV-infected cells expressing the F105 sFv. The ~) lins shows a mock transfected SupT cell. The (f~) is a positive con~rol showin~ a SupT cell that has been infected with HIV under the above-described conditions. The (O~ shows the SupT cell that has been infected under the above-described conditions and transduced with the sFv 105 antibody underthe control of the HIV-LTR as discussed above. This fi~ure shows results of syncytia formation after infeoting the SupT vector cells or SupT sFv 105 cells with 20 MØ1. of HXBC2 strain of HIV-'I as described above. After 11 days post infection there is virtually no syncytia formed in ~he SupT sFv 105 cells. In contrast~ in the SupT cells, 15 ~ a peak of syn~ytia is seen after 4-5 days. These experiments are ¦ ~ ~ consistant with the lack of surface expression of gp120 discussed above suggesting that the present intercellular antibodies lead to resistance of the cytopathic effects of gp120.
~ ,~
~20 The references cited throughout the specification are incorporated herein by reference.

This invention has been described in detail including the preferred embodiments thereof. However, it will be appreciated that ~hose skilled in ~., the art. upon consideration of this disclosure, may make modifications and improvements thereon without departing from the spirit and scope of the invention as set forth in the claims.
:

.

SUBSTITVTE ~IEET

WO94102610 ~ ~ PCT/U593~06735 ~'~

NOT FURNISHED UPON FILING

f ,j :, t, ., ~ ~WO94/02610 21 ~735~ PCr/U593/06735 NOT FURNISHED UPON FILXNG

W094/OZ61~ Pcr/uS93/06735 f ~2) INFORMATION FOR SEQ ID NO:1:
(ii SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids - (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Gly Gly Gly Gly Ser Gly (ily Gly Gly Ser Gly Gly Gly Gly Ser (2) INFORMATION FOR SEQ ID NO:2:
J (i) SEQUENOE CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 33~: ~ (Xi) SEQUENCf DESCRIPTION: SEQ ID NO:2 Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser ~, .
i~
~ ~2) INFORMATION FOR SEQ ID NO:3:
.i (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENOE DESCRIPTION: SEQ ID NO:3:
Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr , . .
:, , .
, i1 ,;
,, . SUBSTITUTE SHEET

w O 94/02610 ~ 13 7 ' ~ 8 PC~r/US93/06735 (2)INFO R M A TIO N FO R SE Q ID N 0:4:
(i) SE Q U EN C E C H A R A CTERISTIC S:
(A) LEN G ~ H: 1 5 a mino acids - (Bl TYPE: amino acid ~D! TOPOLOGY: linear (xi) SEQUENCE DESCRiPTlON: SEQ ID NO:4:
Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr Gln 5 10 t5 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTEP~ISTICS:
(A) LENGTH: 14 amino acids B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUEN~E DESCRIPTION: SEQ ID NO:5:
Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Val Asp (2) INFORMATION FOR SEQ ID NO:6:
li) SE~lUENCE CHARACTEP~ISTICS:
(A~ LENGTlt: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear .
(xi) SEQUENCE DESCRlPTiON: SEQ ID NO:6:
Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly SUBSTITUTE ~Y,_FT

wo 94/02610 Pcr/USs3/0673;

`J ~ - 36 -~2) INFORMAT~ON FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 amino acids (B) TYPE: arnino acid ~D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Lys Glu Ser Gly Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser Leu Asp (2) INFORMATION FOR SEQ ID NO:8:
(iJ SEQUENC~ CHARACTERISTICS: .
(A) LENGTH: 16 amino acids (B) TYPE: amino acid ~D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Glu Ser Gly Ser Val Ser Ser Glu Glu Leu Ala Phe Arg Ser Leu Asp (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYP~: nucleic acid ~C) STRANDEDNESS: single ~D) TOPOLOGY: linear (xii SEQUENCE DESCRIPTION: SEQ ID NO:9:

~, SUBSTITUTE SHEET

- WO 94/02610 PCI'/US93/06735 ~ :
2 1 ~ 7 ~ S 8 ~.
t2) INfORMATlON FOR SEQ ID NO:10:
(i) SEQUENCE CHAP~ACTERISTICS:
(A) LENGTH: 66 base pairs (B) TYPE: nuc5eic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DSCRIPTION: SEQ ID NO:10:
AGATCCGCCG CCACC~iCTCC CACCACCTCC 30 GGAGCCACCG CCACCTGAGG TGACC~TGAC 60 CRKGtiT 66 (2) INFORMATZON FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 69 base pairs ' (B) TYPE: nucleic acid (C) STRANDEDNESS: sinsle (D) TOPOLOGY: linear (Xi) ScQUENCE DESC:F~IPTION: SEQ ID NO:11:

... ..
- (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear J~
,~
'j'i SUBSTITUTE SHEET

wo 94/02610 Pcr/uS93/0673~ ,~

~ ~V 9~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GGGTCTAGAC TCGAGGATCC TTAl~AACGC 30 Gl~GGTGCAG CCACAGT 47 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 6 amino acids (B~ TYPE: amino acid (D) TOPOLOGY: linear ~xi) SE~lUENCE DESCRIPTION: SEQ ID NO:13:
Ser Glu Lys Asp Glu Leu (2~ INFORMATION FOR SEQ ID NO:14:
~i) SEQUENCE CHARAC:TERISTICS:
(~.) LENGTH: 59 base pairs (B) TYPE: nucleic acid (C) STRANOEDNESS: slngle (D) TOPOLOGY: linear (xi) SEQUENCE DES~:RIPTION: SEQ ID NO:14:
GGGTCTAGAC TCGAGGATCC l~ATTACAGC 30 SUBSTITUTE SHEET

.--` WO94/02610 PCI/US93/0673 99 ~ J

(2) INFORMATION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
~A~ LENGTH: 24 base pairs (~) TYPE: nucleic acid (C~ STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
mACCAT~:iG AACATCTGTG GTTC 24 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENÇE CHARACTERISTICS:
lA) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (C)) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
l~AGC: :;CGCT GAGGTGACCG TGACCRKGGT 30 (2) INFORMATION FOR SEQ ID NO:17:
(ij SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear .
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Lys Asp Glu Leu J

SUBSTITUTE SHEET

WO 94/02610 PCI/US93~0673~ ~^

~2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARAC:TERISTICS:
~A) LENGTH: 4 amino acids (~) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Asp Asp Glu Leu (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
Asp Glu Glu Leu (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTFRISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Gln Glu Asp Leu ,!

SUBSTITUTE SHEET

WO 94/02610 PCI/US93/06735 '~

-101 - ~ 7~ 38 (2) INFORMATlt:~N FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS: i (A) LENGTH: 4 amino acids (B) TYPE: amino acid 5D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
Arg Asp Glu Leu (2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B3 T'(PE: amino acid (Dl TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Pro Lys Lys Lys Arg Lys Val (2) INFORMATION FOR SEQ ID NO:23:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCF DESCRIPT!ON: SEQ ID NO:23:
Pro Gln Lys Lys lle Lys Ser SUBSTITUT~- S~-ET

WO 94/02610 PC~/US93/06735 ~--.
,`JCL ' ~-, 1~ .3 u (2~ INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS: ~
(A) LENGTH: 6 amino acids -(B) TYPE: amino acid (D) TOPOLQGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Gln Pro Lys Lys Lys Pro (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LFNGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear `:
(Xi) SEQUFNCE DESCRIPTIC)N: SEQ ID NO:25:
Arg Lys L~/s Arg Arg Gln Arg Arg Arg Ala His Gln ",i j~, (2) INFORMATION FOR SEQ IO NO:26:
'J (i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 16 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:26:
Arg Gln Ala Arg Arg Asn Arg Arg Arg Arg Trp Arg Glu Arg Gln Arg ,, .
,, ,, ' ' - SUBSTITUTE ~HEET

- wo 94/02610 pcr/us93/o6735 - 103 ? 13 (2) INFORMATION FOR SEQ ID NO:27:
(il SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ 3D NO:27:
Met Pro Leu Thr Arg Arg Arg Pro Ala Ala Ser Gln Ala Leu Ala Pro 5 1û 15 Pro Thr Pro (2l INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 15 amino acids (B) TYPE: arnino acid (D) TOPOLOGY: linear (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:28:
Met Asp Asp Gln Arg Asp Leu lle Ser Asn Asn Glu Gln Leu Pro ~2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
Met Leu Phe Asn Leu Arg Xaa Xaa Leu Asn Asn Ala Ala Phe Arg His Gly His Asn Phe Met Val Arg Asn Phe Arg Cys Gly Gln Pro Leu Xaa ( SUBSTlTUTc SHEET

WO 94/02610 P~/US93/06735 (~--(2) INFORMATION FOR SEQ ID NO:30:
(i) SFQUENCE CHARACTFRISTICS: -(A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
Gly Cys Val Cys Ser Ser Asn Pro (2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) I ENGTH: 8 amino acids (~) TYPE: amino acid (D) TOPOLt:)GY: linear (xil SEQUENCE DESCRIPTION: SEQ ID NO:31:
Gly Gln Thr Val Thr Thr Pro Leu (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERiSTlCS:
(A) LENGTH: 8 amino acids (B) TYPE: amino aGid (D) TOPOLOGY: linear - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
Gly Gln Glu Leu Ser Gln His Glu , . .

, ., .- SUBSTITUTE ~HE~T

,, , .. ..... . . .. ~, . .

-- WO 94/02610 P~/US93/06735 - 105 ~ 7~ ~3 8 (2) INFORMATION FOR SEQ ID NO:33: 1 (i) SEQUENCE CHARACTERISTICS: j (A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ll: NO:83:
Gly Asn Ser Pro Ser Tyr Asn Pro (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTEFllSTlCS:
IA) LENGTH: 8 amino acids . (B) TYPE: amino acid ' (D) TQPOLOGY: linear (xi) SEQUENCE DESCRIPTIC)N: SEQ ID NO:34:
~ily Val Ser Gly Ser Lys Gly Gln ~i (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 8 amino acids - (B) TYPE: amino acid (D) TOPOLOGY: linear~ ;
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
Gly Gln Thr lle Thr Thr Pro Leu .:1 ~, SUBSTITUTE SHEET

WO 94/02610 PCI~/US93/0673~
`-'f`~3Q ~ ' 3 ~ -(2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS: ¦
(A) LENGTH: 8 amino acids (B) TYPE: amino acid . :
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
Gly Gln Thr lle Thr Thr Pro Leu ~i I

.

(2) INFORMATION FOR SEQ ID NO:37: - ~
(i) SEQUENCE CHARACTERISTICS: `
(A) LENGTH: 8 amino acids (B) TYPE: amino acid jD) TOPOLOGY: linear (X;) SEQUENCE DESCRIPTION: SEQ 1D NO:37:
Gly Gln lle Phe Ser Arg Ser Ala ~2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 8 amino acids .
(B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
Gly Gln lle His Gly Leu Ser Pro ~` 1 5 , ~ SUBSTITUTE ~H~-T

- Wo 94/02610 Pcr/uss3/o6735 - 107- ~1v~7J~i8 (2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid ~D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Gly Ala Arg Ala Ser Val Leu Ser ~2) INFORMATION FOR SEQ ID NO:40:
Ii) SEQUENCE CHARACTERISTICS:
~A)LENGTH: 8 amino acids ~Bl TYPE: amino acid ~D) TOPOLOGY:linear ' (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
Gly Cys Thr Leu Ser Ala Glu Glu ' 1 5 , u J (2)INFORMATION FOR SEQ ID NO:41:
`~ li) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 8 amino acids ~B) TYPE: amino acid ~D)TOPOLOGY:linear ,. . . , j ;
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Gly Gln Asn Leu Ser Thr Ser Asn ,.

, ,~

~, ~,!

~ SUBSTITUTE ~H-~T

wo ~4/02610 Pcr/usg3/o6735 ,^

(21 INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (8) TYPE: amino acid ID) TOPOLOGY: linear t (xi~ SEQUENCE D~SCRIPTION: SEQ ID NO:42:
Gly Ala Ata Leu Thr lle Leu Val (2) INFORMATION FOR SEQ ID NO:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid :
~D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTIC)N: SEQ ID NO:43:
Gly Ala Ala Leu Thr Leu Leu Gly - (2) INFORMATION FOR SEQ ID NO:44:
~: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids -: ~B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTIQN: SEQ ID NO:44:
Gly Ala Gln Val Ser Ser Gln Lys : 1 5 ~ , i SUBSTITUTE SHEET

WO94/02610 PCI/US93/06735 ,~

log- ~7~

(2) INFORNlATION FOR SEQ ID NO:45 (i) SEQUENCE CHAP~ACTERISTICS:
(A) LENGTH: 8 amino acids - (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:
Gly Ala Gln Leu Ser Arg Asn Thr (2) INFORMATION FOR SEQ ID NO:46 (i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 8 amino acids ~B) TYPE: amino acid ~D) TOPOLOGY: linear (xi) SEQUENCE DESCR~PTION: SEQ ID NO:46:
G!y Asn Ala Ala Ala Ala Lys Lys (2) INFORMATION FOR SEQ ID NO:47 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYP~: amino acid (D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:-Gly Asn Glu Ala Ser Tyr Pro Leu '5 i ~ SUE~STITUTE SHEET

W O 94/02610 PC~r/US93/06735 f ~ J'^~ - 11 O -(2) INFORMATION FOR SEQ ID NO:48:
~i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 8 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:
Gly Ser Ser Lys Ser Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:49:
(i) SEQUENCF CHARACTERISTICS:
~A) LENGTH: 55 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:

' ' .

(2) INFORMATION FOR SEQ ID NO:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 43 base pairs ~B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:

CCCTKSâCCC CAG 43 ~: .

SUBSTITUTE SHEET

7 3 '3 (2) INFORMATION FOR SEQ ID NO:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 89 base pairs (E3) TYPE: nucleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:

(2) INFORMATION FOR SEQ ID NO:52:
(i) SEQUENCE CHARACTERISTICS:
~A~ LENGTH: 44 base pairs (B) TYPE: nucleic acid ~- (C) STP~ANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:

:~ GrrGGTGCAG CATC ~ 44 (2) INFORMATION FOR SEQ ID NO:53:
, . . .
li) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 71 base pairs (8) TYPE: nucleic acid (C) STRANDEDN~SS: single (D) TOPOLOGY: linear ~C!iU~3 STlTUT~_ S ~ - -T

wo 94/02610 Pcr/uss3/o673s r qp~ .

(xi) SEQUENCE l:ESCRIPTION: SEQ ID NO:53:
GGGTCTAGAC TCGAGGATCC TTAl~AAAt:C 30 TTACGmCT TCrrCGGCGG AGrrACAGrr 60 I2) INFORMATION FOR SEQ ID NO:54:
5i~ SEQUENCE CHARACTERISTICS:
IA) LENGTH: 10 amino acids (B7 TYPE: amino acid (G! TOPOLOGY: lin~ar ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:
Thr Pro Pro Lys Lys Lys Lys Arg Lys Val (2) INFORMATION FOR SEQ iD NO:5~:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid ~C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:
Al~AGCGGCC GCTACAGl~G GTGCAGCATC 30 (2) INFORMATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids ~B) TYPE: amino acid (D) TOPOLOGY: linear SUBSTITUTE SHEEl-WO g4/02610 Pcr/us93/0673~

-113 2~37~

(xi) S~QUENCE DESCRIPTION: SEQ ID NO:56:
Arg Lys Lys Arg (2) INFORMATION FOR 5EQ ID NO:57:
(i) SEQUENCE CHARACTERISTICS:
(A~ LEN~;TH: 41 base pairs (B) TYPF: nucleic acid (C) STRANDEDNESS: sin31e (D) TOPOLOGY: linear ~xi) SÉQUENCE DESCRIPTION: SEQ ID NO:~7: :
mAAGCl~A CCATGGC:CCA GGTGCAGCTG 30 CAG :iAGTCGG G 41 ~2) INFORMATION FOR SEQ ID NO:~8:
(i) SECiUENCE CtlARACTERlSTlCS:
(A) LENGTH: 10 amino acids IB) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:
Met Ala Gln Val Gln Leu Gln Glu Ser Gly , (2) INFOR!JIATION FOR SEQ ID NO:59:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 30 base pairs TYPE: nucleic acid ' (C) STP~ANDEDNESS: single (D) TOPOLOGY: linear SUBSTITUTE SHEET

WO ~4/02610 PCI`/US93/06735 (xi3 SEQUENCE DESCRIPTION: SEQ ID NO:59:
I I lAAGCrrA CCATG(iACTG GACCTGGAGG 30 (2) INFORMATION FOR SEQ ID NO:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:

(2) INFORMATION FOR SEQ ID NO:61:
(i) SEQUENC:E CHARACTERISTICS:
(A~ LENGTH: 33 base pairs (B) TYPE: nucleic acid - (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:
I I l AAGC~A CCATGGAGTT TGGGCTGAGC 30 TGG
~,, ~ !
(2) INFORMATION FOR SEQ ID NO:62:
- (i) SE~UENCE CHARACTERISTICS:
IAl LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D3 TOPOLOGY: linear SUBSTITUTE SHEET
, .. ,, ~ . , , 2~37~;58 (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:62:

(2) INFORMATIQN FOR SEQ ID NO:63:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQU~NCE DESCRIPTION: SEQ ID NO:63:

(2) INFORMATION FOR SEQ ID NO:64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDE:)NESS: single (D) TC)POLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:

,, ~2~ INFORMATION FOR SEQ ID NO:65:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 24 base pairs ~1 - (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ . .

~.i ~ SUBSTITUTE SHEET
r,~ "; . , . . ~," - . ~

WO 94/02610 PC~/US93/06735 ~ - 116-(xi) SEQUENCE DESI::RIPTION: SEQ ID NO:65 ~2) INFORMATION FOR SEQ ID NO:66 ~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs IB) TYPE: nucleic acid (C) STRANDEDNESS: single (D~ TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SE~ ID NO:66 TGGA3:iACTGC GTCATCTCGA Gl~C 24 ~2) INFC)RMATlt)N FOR SEQ ID NO:67 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid ~C:3 STRANt3EDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67 ~2) INFORMAl~ION FOR SEQ ID N0 68 1i3 SEQUENCE CHARACTERISTICS:
(A) LENGTH: ~7 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ii, SUBSTITUTE SHEE~

wo s4to2610 Pcr/us93/06735 - 117 - 2~37~
..

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:68 GGGTCTAGAC TCGAGGATCC TTArrAACGC 30 Gl~&GTGCAG CCACAGT 47 (2) INFORMATION FOR SEQ ID NO:69 5i) SEQUENCE CHARACrERiSTlCS:
(A) LENGTH: 24 base pairs - (B) TYPE: nucleic acid IC) STRANDEDNESS: single (D) TOPOLOGY: linear (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:69 ACGGC:CGTGT ATTACTGTGC GCGA 24 (2) INFORMATION FOR SEQ ID NO:70 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) lYPE: nucleic acid (C) STRANDEDNESS: single ~3 (Dl TOPOLC)GY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70 , ~
fj ' (2) INFORMATION FOR SEQ ID NO:71 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs .~ (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ..

,~

~, ~
,., SUBSTITUTE SHEET

WO 94/1)2610 Pcr/uS93/0673 3~ - 118 -(xi) SEQUENCE DESCRIPTION: SEQ ID NO:71 CGCACAGTAA TACAC 15 ~ ¦

(2) INFORMATION FOR SEQ ID NO:72 ~i) SEQUENCE CHARACTERISTICS:
IA) LENGTH: 17 base pairs (B) TYPE: nucl~ic acid (C~ STRANDEDNESS: single (D~ TOPOLOGY: linear txi) SEQUENCE DESCRIPTION: SEQ ID NO:72 (2) INFOP~MATION FOR SEQ ID NO:73 li) SEQUENCE CHARACTERISTICS: -(A) LENGTH: 46 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear txi) SEQUENCE DESCRIPTION: SEQ ID NO:73 }
.f (2) INFORMATION FOR SEQ ID NO:74 .3 (i) SEQUENCE CHARACTERISTICS:
~'f IA) LENGTH: 1 5 amino acids J ~B) TYPE: amino acid (C) STRANDEDNESS: single ID) TOPOLOGY: linear ,, ~, SUBSTITUTE SHEET

~ WO 94/02610 PCI'/USg3/(~6735 - 1 19 ~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:74 Leu Thr Leu lle Ser Ser Arg Leu Arg Leu lle Ala Val Arg Met (2) INFORMATION FOR SEQ ID NO:75 ~t (i) SEQUENCE CHARACTERISTICS: ¦
(A) LEN~iTH: 27 base pairs ~B) TYPE: nucleic acid (C:) STRANDEDNESS: single (D) TOPOLOGY: linear ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:75 mAAGCTTA CCATGAACTT CGGGCTC 27 (2) INFORMATION FOR SEQ ID NO:76 (i~ SEaUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs ~E) TYPE: nucleic acid IC) STRANDEDNESS: single -(DI TOPOLOGY: linear (xi) SEQlJENCE DESCRIPTION: SEQ ID NO:76 , (2) INFORMATION FOR SEQ ID NO:77 (i) SEQUENCE CHARACTERISTICS:
- (Al LENGTH: 27 base pairs ~8) 1 YPE: nucleic acid (C) STRANDEDNESS: single ~D) TOPOLOGY: linear J

SUBSTITUTE SHEET

W~ g4/02610 Pcr/us93/06735 ~, i ,~,3~ - 120 i' (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77 (2) INFORMATION FOR SEQ ID NO:78 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78 :.
(2) INFORMATION FOR SEQ ID NO:79 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C~ STRANDEDNESS: single (D) TOPOLOGY: linear - (xi) SEQIJENCE DESCRIPTION: SEQ ID NO:79 mAAGCTTA CCATGGACGT GAAGCTGGTG 30 SUBSTITUTE SHEET

Claims (81)

WHAT IS CLAIMED:

1. A vector system for the intracellular binding of a specific antigen (target antigen) which comprises:
a nucleotide sequence adapted for intracellular delivery and expression, wherein said nucleotide sequence contains a promoter operably linked to an antibody gene encoding an antibody capable of binding to the target antigen.

2. The vector system of claim 1, wherein the antibody gene encodes a single chain variable fragment, a single domain heavy chain or a Fab.

3. The vector system of claim 1, wherein the target antigen is selected from the group of antigens consisting of intermediate metabolites, sugars, lipids, autacoids, hormones, complex carbohydrates, phospholipids, nucleic acids and proteins.

4. The vector system of claim 1, wherein the target antigen is a hapten, an RNA sequence, a DNA sequence or a protein.

5. The vector system of claim 1, wherein the target antigen is a virally encoded protein, or a protein whose expression results in malignant cellular transformation.

6. The vector system of claim 5, wherein the target antigen results in malignant transformation as a result of overexpression of the protein, an HTLV-1 protein or an HIV viral encoded protein.

7. The vector system of claim 6, wherein the antibody is an antibody capable of binding to the envelope glycoprotein or the capsid protein.

8. The vector system of claim 7, wherein the target antigen is the envelope gp160, or envelope gp41.

9. The vector system of claim 4, wherein the target antigen is a TAR
element or a RRE sequence.

10. The vector system of claim 1, wherein the nucleotide sequence contains genes encoding antibodies to more than one target antigen.

11. The vector system of claim 10, wherein the target antigens are virally encoded proteins and the antibodies are to at least two different viral encoded proteins.

12. The vector system of claim 11, wherein the virally encoded proteins are HIV encoded proteins and the antibodies are to at least one structural protein and at least one regulatory protein.

13. The vector system of claim 12, wherein the structural protein is an envelope glycoprotein and the regulatory protein is either the tat or rev protein.

14. The vector system of claim 13, wherein the envelope glycoprotein is gp160.

15. The vector system of claim 14, which further comprises an antibody to HIV gp41.

16. The vector system of claim 5, wherein the antibody is to that portion of the capsid protein involved in myristylation.

17. The vector system of claim 6, wherein the antibody is to the tat protein.

18. The vector system of claim 1, wherein the antibody gene further encodes an intracellular localization sequence.

19. The vector system of claim 18, wherein the nucleotide sequence contains genes encoding more than one antibody to the same target, wherein the antibodies have different intracellular localization sequences and target the antigen at different intracellular locations.

20. The vector system of claim 19, wherein the target antigen is a virally encoded antigen.

21. The vector system of claim 20, wherein virally encoded antigen is an HIV encoded antigen.

22. The vector system of claim 21, wherein the HIV encoded antigen is an envelope glycoprotein.

23. The vector system of claim 4, wherein the antibody gene further encodes an intracellular localization sequence.

24. The vector system of claim 23, wherein the localization sequence for the structural proteins is cytoplasmic.

25. The vector system of claim 23, wherein the viral protein is selected from the group of viral proteins comprising HIV tat, HIV rev, HTLV-1 tax, HTLV-1 rex, HTLV-2 tax, and HTLV-2 rex, and the localization sequence is a nuclear localization sequence.

26. The vector system of claim 6, wherein the antibody is to that portion of the capsid protein involved in myristylation.

27. The vector system of claim 6, wherein the virally encoded protein is a DNA virus encoded protein.

28. The vector system of claim 6, wherein the virally encoded protein is a RNA virus encoded protein.

29. A DNA vector comprising a gene encoding an antibody capable of binding to a specific antigen operably linked to a promoter, wherein the antibody gene does not encode a secretory signal sequence.

30. The DNA vector of claim 29, wherein the gene comprises a VH-coding DNA sequence, a linker coding DNA sequence, and a VL-coding DNA sequence, encoding a single chain variable fragment.

31. The DNA vector of claim 30, wherein the antibody gene further comprises a DNA sequence encoding a localization sequence.

32. The DNA vector of claim 31, wherein the localization sequence is specific to the endoplasmic reticulum, said sequence is selected from the group consisting of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:21 AND SEQ ID NO:22.

33. The DNA vector of claim 31, wherein the localization sequence is specific to the nuclear region, said sequence is selected from the group consisting of SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID
NO:27.

34. The DNA vector of claim 31, wherein the localization sequence is specific to a plasma membrane, said sequence is selected from the group consisting Of SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ
ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID
NO:37, SEQ ID NO 38, SEQ ID NO:39, SEQ ID NO 40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID
NO:46, SEQ ID NO:47, and SEQ ID NO:48.

35. A DNA vector comprising a promoter operably-linked to a VH and VL
coding DNA sequence of a broadly neutralizing antibody to the HIV
envelope glycoprotein, said sequences being connected by an oligonucleotide encoding SEQ ID NO:1, which upon translation forms a single chain variable fragment.

36. The DNA vector of claim 35 further comprising a DNA sequence coding for SEQ ID NO:13 3' to the VL coding DNA sequence.

37. A DNA vector comprising a promoter operably-linked to a VH and VL
coding DNA sequence of an antibody capable of binding to tat, said sequences being connected by an oligonucleotide encoding SEQ ID
NO:1, which upon translation form a single chain variable fragment.

38. The DNA vector of claim 37, further comprising a DNA sequence coding for SEQ ID NO:54 3' to the V, coding DNA sequence.

39. A cell line constitutively transformed by the vector of claim 29.

40. A cell line constitutively transformed by the vector of claim 38.

41. A pharmaceutical composition comprising the vector system of claim 1 together with a pharmaceutically acceptable carrier thereof.

42. Use of the vector system of claim 1 for the manufacture of a pharmaceutically acceptable vector system for the intracellular binding of a specific antigen (target antigen).

43. Use of the vector system of claim 1 for the intracellular binding of a specific antigen.

44. A method for the intracellular binding of a specific antigen (target antigen) which comprises:
(a) intracellular delivery of a nucleotide sequence containing a promoter operably linked to an antibody gene capable of binding to the target antigen, and (b) intracellular expression of the antibody capable of binding to the target antigen.

45. The method of claim 44, wherein the antibody capable of binding to the target antigen is a single chain variable fragment.

46. The method of claim 44, wherein the antibody capable of binding to the target antigen is a single domain heavy chain.

47. The method of claim 44, wherein the antibody capable of binding to the target antigen is a Fab.

48. The method of claim 44, wherein the target antigen is selected from the group of antigens consisting of intermediate metabolites, sugars, lipids, autacoids, hormones, complex carbohydrates, phospholipids, nucleic acids and proteins.

49. The method of claim 44, wherein the target antigen is a hapten, an RNA sequence, a DNA sequence or a protein.

50. The method of claim 49, wherein the target antigen is a protein.

51. The method of claim 44, wherein the target antigen is a protein whose expression results in malignant cellular transformation.

52. The method of claim 51, wherein the target antigen results in malignant transformation as a result of overexpression of the protein.

53. The method of claim 51, wherein the target antigen is an HTLV-1 protein.

54. The method of claim 49, wherein the target antigen is a hapten.

55. The method of claim 44, wherein the target antigen is a viral encoded protein.

56. The method of claim 55, wherein the viral encoded protein is an HIV viral encoded protein.

57. The method of claim 55, wherein the antibody is an antibody capable of binding to the envelope glycoprotein or the capsid protein.

58. The method of claim 56, wherein the antibody is capable of binding to the envelope glycoprotein.

59. The method of claim 58, wherein the target antigen is the envelope gp160.

60. The method of claim 44, wherein the target antigen is an HIV
provirus.

61. The method of claim 58, wherein the target protein is the envelope gp41.

62. The method of claim 49, wherein the target antigen is a TAR
element or a RRE sequence.

63. The method of claim 44, wherein one uses antibodies to more than one target antigen.

64. The method of claim 63, wherein the target antigens are virally encoded protein and the antibodies are to at least two different virally encoded proteins.

65. The method of claim 64, wherein the virally encoded proteins are HIV encoded proteins and the antibodies are to at least one structural protein and at least one regulatory protein.

66. The method of claim 65, wherein the structural protein is an envelope glycoprotein and the regulatory protein is either the tat or rev protein.

67. The method of claim 66, wherein the envelope glycoprotein is gp160.

68. The method of claim 67, which further comprises an antibody to HIV gp41.

69. The method of claim 55, wherein the antibody is to that portion of the capsid protein involved in myristylation.

70. The method of claim 56, wherein the antibody is to the tat protein.

71. The method of claim 44, wherein the antibody gene further encodes an intracellular localization sequence.

72. The method of claim 71, wherein one uses more than one antibody to the same target, wherein the antibodies have different intracellular localization sequences and target the antigen at different intracellular locations.

73. The method of claim 72, wherein the target antigen is a virally encoded antigen.

74. The method of claim 73, wherein virally encoded antigen is an HIV
encoded antigen.

75. The method of claim 74, wherein the HIV encoded antigen is an envelope glycoprotein.

76. The method of claim 55, wherein the antibody gene further encodes an intracellular localization sequence.

77. The method of claim 76, wherein the localization sequence for the structural proteins is cytoplasmic.

78. The method of claim 76, wherein the viral protein is selected from the group of viral proteins comprising HIV tat, HIV rev, HTLV-1 tax, HTLV-1 rex, HTLV-2 tax, and HTLV-2 rex, and the localization sequence is a nuclear localization sequence.

79. The method of claim 56, wherein the antibody is to that portion of the capsid protein involved in myristylation.

80. The method of claim 55, wherein the virally encoded protein is a DNA virus encoded protein.

81. The method of claim 55, wherein the virally encoded protein is a RNA virus encoded protein.