CA2145873A1 - Methods for stonewashing fabrics using endoglucanases - Google Patents
Methods for stonewashing fabrics using endoglucanasesInfo
- Publication number
- CA2145873A1 CA2145873A1 CA002145873A CA2145873A CA2145873A1 CA 2145873 A1 CA2145873 A1 CA 2145873A1 CA 002145873 A CA002145873 A CA 002145873A CA 2145873 A CA2145873 A CA 2145873A CA 2145873 A1 CA2145873 A1 CA 2145873A1
- Authority
- CA
- Canada
- Prior art keywords
- cellulase
- cellulase composition
- components
- fabric
- cbh
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/16—Organic compounds
- C11D3/38—Products with no well-defined composition, e.g. natural products
- C11D3/386—Preparations containing enzymes, e.g. protease or amylase
- C11D3/38645—Preparations containing enzymes, e.g. protease or amylase containing cellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
-
- D—TEXTILES; PAPER
- D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
- D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
- D06M16/00—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic
- D06M16/003—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic with enzymes or microorganisms
-
- D—TEXTILES; PAPER
- D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
- D06P—DYEING OR PRINTING TEXTILES; DYEING LEATHER, FURS OR SOLID MACROMOLECULAR SUBSTANCES IN ANY FORM
- D06P5/00—Other features in dyeing or printing textiles, or dyeing leather, furs, or solid macromolecular substances in any form
- D06P5/15—Locally discharging the dyes
- D06P5/158—Locally discharging the dyes with other compounds
-
- D—TEXTILES; PAPER
- D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
- D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
- D06M2200/00—Functionality of the treatment composition and/or properties imparted to the textile material
- D06M2200/50—Modified hand or grip properties; Softening compositions
Abstract
Disclosed are improved aqueous processes and compositions for obtaining a "stonewashed" look in colored fabric while reducing the amount of redeposition of colorant onto the fabric, as well as the fabrics produced from these methods. In particu-lar, the disclosed methods as directed to contacting fabrics with fungal cellulase composition which is substantially free of CBH
type components. Fabrics so treated show reduced redeposition of colorant.
type components. Fabrics so treated show reduced redeposition of colorant.
Description
W094/07983 2l4587~ Pcr/US93/0873s MET~ODS FOR
S-lOh~ ~TNG FABRICS USING ENDOGLU~ANA.
BAC~GRO~ND OF THE lN v ~ ON
5 Field of the Invention The pr~sent invention is directed to compositions and methods for achieving a stonewashed appearance in fabric while reducing or preventing the backstaining of colorant onto the fabric as well as to the fabric and clothing produced from these methods. In particular, the improved methods of the present invention are directed to contacting the fabrics with an aqueous solution containing a fungal cellulase composition which comprises endoglucanase type components substantially free of CBH type components. When the fabric is treated with such solutions, the amount of backstaining of colorant onto the fabric during the stonewashing of the fabric is reduced.
S-lOh~ ~TNG FABRICS USING ENDOGLU~ANA.
BAC~GRO~ND OF THE lN v ~ ON
5 Field of the Invention The pr~sent invention is directed to compositions and methods for achieving a stonewashed appearance in fabric while reducing or preventing the backstaining of colorant onto the fabric as well as to the fabric and clothing produced from these methods. In particular, the improved methods of the present invention are directed to contacting the fabrics with an aqueous solution containing a fungal cellulase composition which comprises endoglucanase type components substantially free of CBH type components. When the fabric is treated with such solutions, the amount of backstaining of colorant onto the fabric during the stonewashing of the fabric is reduced.
2 0 ~tate of the Art Clothing made from cellulosic fabrics, such as cotton denim, is stiff in texture due to the presence of sizing compositions used to ease manufacturing, handling and assembling of clothing items and typically has a fresh dark dyed appearance. One desirable characteristic of indigo-dyed denim cloth is the alteration of dyed threads with white threads, which gives denim a white on blue appearance.
SUBSTITUTE SHEET
w094/07983 ~1 ~587 3 PCT/US93/08735 After a period of extended wear and laundering, the clothing items, particularly denim, can develop in the clothing panels ànd on seams, localized areas of variation in the form of a lightening, in the depth or density of color. In addition, a general fading of the clothes, some pucker in seams and some wrinkling in the fabric panels can often appear.
Additionally, after laundering, sizing is substantially removed from the fabric resulting in a softer feel. In recent years such a distressed or "stonewashed" look, particularly in denim clothing, has become very desirable to a substantial proportion of the public.
The previous methods for producing the distressed look involved stonewashing of a clothing item or items in a large tub with pumice stones having a particle size of about l to 10 inches and with smaller pumice particles generated by the abrasive nature of the process. Typically the clothing item is tumbled with the pumice while wet for a sufficient period such that the pumice abrades the fabric to produce in the fabric panels, localized abraded areas of lighter color and similar lightened areas in the seams. Additionally the pumice softens the fabric and produces a fuzzy surface similar to that produced by the extended wear and laundering of the fabric. This method produced the desired white on blue contrast described above.
The use of the pumice stones has several disadvantages, including overload damage to the machine motors, mechanical damage to transport mechanisms and washing drums, environmental waste problems from the grit produced and high labor costs W094/07983 2 1 ~ 58 73 PCT/US93/08735
SUBSTITUTE SHEET
w094/07983 ~1 ~587 3 PCT/US93/08735 After a period of extended wear and laundering, the clothing items, particularly denim, can develop in the clothing panels ànd on seams, localized areas of variation in the form of a lightening, in the depth or density of color. In addition, a general fading of the clothes, some pucker in seams and some wrinkling in the fabric panels can often appear.
Additionally, after laundering, sizing is substantially removed from the fabric resulting in a softer feel. In recent years such a distressed or "stonewashed" look, particularly in denim clothing, has become very desirable to a substantial proportion of the public.
The previous methods for producing the distressed look involved stonewashing of a clothing item or items in a large tub with pumice stones having a particle size of about l to 10 inches and with smaller pumice particles generated by the abrasive nature of the process. Typically the clothing item is tumbled with the pumice while wet for a sufficient period such that the pumice abrades the fabric to produce in the fabric panels, localized abraded areas of lighter color and similar lightened areas in the seams. Additionally the pumice softens the fabric and produces a fuzzy surface similar to that produced by the extended wear and laundering of the fabric. This method produced the desired white on blue contrast described above.
The use of the pumice stones has several disadvantages, including overload damage to the machine motors, mechanical damage to transport mechanisms and washing drums, environmental waste problems from the grit produced and high labor costs W094/07983 2 1 ~ 58 73 PCT/US93/08735
- 3 -associated with the manual removal of the stones from the pockets of the garments.
In view of the problems associated with pumice stones in stonewashing, whole cellulase solutions are used as a replacement for the pumice stones under agitating and cascading conditions, i.e., in a rotary drum washing machine, to impart a "stonewashed"
appearance to the denim (U.S. Patent No. 4,832,864).
A problem with the use of whole cellulase compositions from Trichoderma sp. microorganisms and other fungal sources is the incomplete removal of colorant caused by redeposition or backstaining of some of the dye back onto the cloth during the stonewashing process. In the case of denim fabric, this causes recoloration of the blue threads and blue coloration of the white threads, resulting in less contrast between the blue and white threads and abrasion points (i.e., a blue on blue look rather than the preferred white on blue). See, American Dyestuff Reporter, Sept. 1990, pp. 24-28. This redeposition is objectionable to some users.
Trichoderma cellulases, even though they result in backstaining are preferred because of their higher activity on denim material. In addition, cellulases with a higher degree of purity may be beneficial in the present invention. ~igh specific activity or a high level of purity results in a higher degree of abrasion in a significantly shorter processing time and therefor, is preferable to the denim processors.
Attempts to reduce the amount of redeposition of dye included the addition of extra chemicals or enzymes, such as surfactants, proteases or other agents, into the cellulase wash to help disperse the loosened dye. In addition, processors have used less ~i45873 4 active whole cellulase, along with extra washings.
However, this results in additional chemical costs and longer processing times. Another method includes the use of a mild bleach agent or stain removing agent in the process. This method affects the garment's final shade and increases the processing time. Finally the use of enzymes and stones together leave the processor with all the pro~lems caused by the use of the stones alone.
Accordingly, it would be desirable to find a method to prevent redeposition of colorant during stonewashing of clothing with cellulases.
SUMMARY OF TXE lNv~NlION
The present invention is directed to the discovery that the redeposition of colorant onto fabric during the stonewashing process can be reduced by employing a fungal cellulase composition which is substantially free of CBH type components. It has been found that stonewashing with EG type components result in the reduced redeposition of colorant onto fabric resulting in abrasion points that are more distinct. For example, with indigo dyed denim improved contrast between white and blue yarns is obtained giving a superior stonewashed look.
In view of the above, in one of its method aspects, the present invention is directed to an improved method for reducing colorant redeposition during the stonewashing of colored fabrics which method comprises contacting the fabric with an effective amount of a fungal cellulase solution derived from a redepositing whole fungal cellulase W O 94/07983 ~ 1 ~ 5~ 7 3 PC~r/US93/08735 }
composition under conditions sufficient to impart a stone-washed appearance to the fabric wherein said cellulase solution is substantially free of CBH type components. In a preferred embodiment, the fungal cellulase composition employed herein comprises substantially pure EG I, EG II, and/or substantially pure EG III components. In still another preferred embodiment, the fungal cellulase composition comprises at least about 40 weight percent and preferably at least about 70 weight percent of EG
type components based on the total weight of protein in the cellulase composition.
Cotton-containing fabrics or clothing treated by the methods of this invention unexpectedly posses both enhancement of a stonewashed appearance and a reduced redeposition of colorant as compared to the fabric treated with whole cellulase.
In its composition aspects, the present invention is directed to a cotton-containing fabric or clothing treated in the methods of this invention as defined above.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is an outline of the construction of p~CR~TPyr4 .
FIG. 2 illustrates deletion of the T.
longibrachiatum gene by integration of the larger EcoRI fragment from p~CBHIEyE~ at the cbhl locus on one of the T. lonqibrachiatum chromosomes.
FIG. 3 is an autoradiograph of DNA from T.
lonqibrachiatum strain GC69 transformed with EcoRI
digested p~CBHI~yE~ after Southern blot analysis W O 94/07983 PC~r/US93/08735 ~g8YI ~ 6 -using a 32p labelled p~CBHIpvr4 as the probe. The sizes of molecular weight markers are shown in kilobase pairs to the left of the Figure.
FIG. 4 is an autoradiograph of DNA from a T.
lonqibrachiatum strain GC69 transformed with EcoRI
digested PA~R~TEYE~ using a 32p labelled pIntCBHI as the probe. The sizes of molecular weight markers are shown in kilobase pairs to the left of the Figure.
FIG. 5 is an isoelectric focusing gel displaying the proteins secreted by the wild type and by transformed strains of T. lonqibrachiatum.
Specifically, in FIG.5, Lane A of the isoelectric focusing gel employs partially purified CBHI from T.
lonqibrachiatum; Lane B employs a wild type T.
lonqibrachiatum : Lane C employs protein from a lonqibrachiatum strain with the cbhl gene deleted;
and Lane D employs protein from a T. lonqibrachiatum strain with the cbhl and cbh2 genes deleted. In FIG.
5, the right hand side of the figure is marked to indicate the location of the single proteins found in one or more of the secreted proteins. Specifically, BG refers to the ~-glucosidase, E1 refers to endoglucanase I, E2 refers to endoglucanase II, E3 refers to endoglucanase III, C1 refers to exo-cellobiohydrolase I and C2 refers to exo-cellobiohydrolase II.
FIG. 6A is a representation of the T.
lonqibrachiatum cbh2 locus, cloned as a 4.1 kb EcoRI
fragment on genomic DNA and FIG. 6B is a representation of the cbh2 gene deletion vector pP~CBHII.
FIG. 7 is an autoradiograph of DNA from T.
lonqibrachiatum strain P37P~CBHIPyr-26 transformed with EcoRI digested pP~CBHII after Southern blot 2~5~73 analysis using a 32p labelled pP~CBHII as the probe~
The sizes of molecular weight markers are shown in kilobase pairs to the left of the Figure.
FIG. 8 is a diagram of the plasmid pEGIEyE~.
FIG. 9 is an outline of the construction of plasmid pTEX-EG1.
FIG. 10 illustrates the RBB-CMC activity profile of an acidic EG enriched fungal cellulase composition (CBH I and II deleted) derived from Trichoderma lonqibrachiatum over a pH range at 40C; as well as the activity profile of an enriched EG III cellulase composition derived from Trichoderma lonqibrachiatum over a pH range at 40C.
FIG. 11 illustrates the effect of different cellulase compositions on the redeposition of colorant during the stonewashing process.
DET~TT~n DESCRIPTION OF THE PREFERRED EMBODIMENTS
As noted above, the methods of this invention are directed toward a method of stonewashing fabrics with fungal cellulase while reducing the amount of backstaining of colorant onto the fabric. The method comprises using a specific fungal cellulase solution substantially free of CBH type components which reduces the backstaining of the colorant onto the fabric. However, prior to discussing this invention in detail, the following terms will first be defined.
.
W O 94/07983 PC~r/US93/08735 1) Definitions:
The term "fabric" refers to sewn or unsewn fabrics, including knits and wovens, made of pure cotton or cotton blends and the like. When cotton blends are employed, the amount of cotton in the fabric should be at least about 40 percent by weight cotton; preferably, more than about 60 percent by weight cotton; and most preferably, more than about 75 percent by weight cotton. When employed as blends, the companion material employed in the fabric can include one or more non-cotton fibers including synthetic fibers such as polyamide fibers (for example, nylon 6 and nylon 66), acrylic fibers (for example, polyacrylonitrile fibers), and polyester fibers (for example, polyethylene terephthalate), polyvinyl alcohol fibers (for example, Vinylon), polyvinyl chloride fibers, polyvinylidene chloride fibers, polyurethane fibers, polyurea fibers and aramid fibers. The fabric typically has been colored wth dye or pigment, for instance with the dye indigo.
One desirable characteristic of colored fabric is the alteration of colored threads with white threads, for example, in the case of denim this gives denim a white on blue contrast appearance.
The term "stonewashing" means the treatment of dyed denim fabric with a fungal cellulase solution under agitating and cascading conditions, i.e., in a rotary drum washing machine which impart a "stonewashed" appearance to the denim. Methods for imparting a stonewashed appearance to denims are described in U.S. Patent No. 4,832,864 which is incorporated herein by reference in its entirety.
W O 94/07983 2 1 4 5 8 7~ PC~r/US93/08735 g The term "fungal cellulase" refers to the enzyme composition derived from fungal sources or microorganisms genetically modified so as to incorporate and express all or part of the cellulase genes obtained from a fungal source. Cellulases act on cellulose and its derivatives to hydrolyze cellulose and give primary products, glucose and cellobiose. Fungi capable of producing cellulases useful in preparing cellulase compositions described herein are disclosed in British Patent No. 2 094 826A, the disclosure of which is incorporated herein by reference.
A "redepositing cellulase" as used herein refers to those cellulases which in the enzymatic stonewashing of denim tend to backstain the fabric.
Such backstaining of the fabric leads to incomplete stonewashing because instead of the desired blue on white contrast, the redeposition results on blue on blue. Redepositing cellulases include microorganisms such as the fungal microorganism Trichoderma sp. and the like.
Most fungal cellulases generally have their optimum activity in the acidic or neutral pH range although some fungal cellulases are known to possess significant activity under neutral and slightly alkaline conditions, i.e., for example, cellulase derived from ~umicola insolens is known to have activity in neutral to slightly alkaline conditions.
Fungal cellulases are known to be comprised of several enzyme classifications having different substrate specificity, enzymatic action patterns, and the like. Additionally, enzyme components within each classification can exhibit different molecular weights, different degrees of glycosylation, 2~ 3 - lo -different isoelectric points, different substrate specificity etc`. For example, fungal cellulases can contain cellulase classifications which include endoglucanases (EGs), exo-cellobiohydrolases (CBHs), ~-glucosidases (BGs), etc. On the other hand, while bacterial cellulases are reported in the literature as containing little or no CBH components, there are a few cases where CBH-like components derived from bacterial cellulases have been reported to possess exo-cellobiohydrolase activity.
A fungal cellulase composition produced by a naturally occurring source and which comprises one or more CBH and EG components wherein each of these components is found at the ratio produced by the source is sometimes referred to herein as a "complete fungal cellulase system" or a "complete fungal cellulase composition" to distinguish it from the classifications and components of cellulase isolated therefrom, from incomplete cellulase compositions produced by bacteria and some fungi, or from a cellulase composition obtained from a microorganism genetically modified so as to overproduce, underproduce, or not produce one or more of the CBH
type and/or EG type components of cellulase.
The fermentation procedures for culturing fungi for production of cellulase are known per se in the art. For example, cellulase systems can be produced either by solid or submerged culture, including batch, fed-batch and continuous-flow processes. The collection and purification of the cellulase systems from the fermentation broth can also be effected by procedures known per se in the art.
"Endoglucanase ("EG") type components" refer to all of those fungal cellulase components or W094/07983 2 1~ 5873 PCT/US93/0873~
combination of components which exhibit textile activity properties similar to the endoglucanase components of Trichoderma longibrachiatum (previously classified as Trichoderma reesei). In this regard, the endoglucanase components of Trichoderma longibrachiatum (specifically, EG I, EG II, EG III, and the like either alone or in combination) impart improved feel, improved appearance, softening, color enhancement, and/or a stonewashed appearance to denim fabrics (as compared to the fabric prior to treatment) when these components are incorporated into a textile treatment medium and the fabric is treated with this medium.
Accordingly, endoglucanase type components are those cellulase components which impart improved feel, improved appearance, softening, color enhancement, and/or a stonewashed appearance to denim fabrics (as compared to the fabric before treatment) when these components are incorporated into a medium used to treat the fabrics. Certain EG components may impart reduced strength loss to denim fabrics as compared to the strength loss arising from treatment with a similar cellulase composition but which additionally contains CBH I components.
Such endoglucanase type components may not include components traditionally classified as endoglucanases using activity tests such as the ability of the component (a) to hydrolyze soluble cellulose derivatives such as carboxymethylcellulose (CMC), thereby reducing the viscosity of CMC
containing solutions, (b) to readily hydrolyze hydrated forms of cellulose such as phosphoric acid swollen cellulose (e.g., Walseth cellulose) and hydrolyze less readily the more highly crystalline ~5~
forms of cellulose (e.g., Avicel, Solkafloc, etc.).
On the other hand, it is believed that not all endoglucanase components, as defined by such activity tests, will impart one or more of the enhancements to denim fabrics as well as reduced strength loss to denim fabrics. Accordingly, it is more accurate for the purposes herein to define endoglucanase type components as those components of fungal cellulase which possess similar textile activity properties as possessed by the endoglucanase components of Trichoderma longibrachiatum.
Fungal cellulases can contain more than one EG
type component. The different components generally have different isoelectric points, different molecular weights, different degrees of glycosylation, different substrate specificity, different enzymatic action patterns, etc. The different isoelectric points of the components allow for their separation via ion exchange chromatography and the like. In fact, the isolation of components from different sources is known in the art. See, for example, Bjork et al., U.S. Patent No. 5,120,463;
Schulein et al., International Application WO
89/09259; Wood et al., Biochemistry and Genetics of Cellulose Degradation, pp. 31-52 (1988); Wood et al., Carbohydrate Research, Vol. 190, pp. 279-297 (1989);
Schulein, Methods in Enzymology, Vol. 160, pp. 234-242 (1988); and the like. The entire disclosure of each of these references is incorporated herein by reference.
Preferably the fungal cellulase compositions of the present invention include substantially pure EG I
or EG III cellulase components. It is contemplated that the fungal cellulase composition of the present .
invention may include substantially pure EG II
cellulase component. However, it is also contemplated that combinations of EG type components may give a synergistic response in reducing the amount of backstaining of dye onto denim during the stonewashing of denim. On the other hand, a single EG type component may be more stable or have a broader spectrum of activity over a range of pHs.
Further these anti-redeposition properties may be enhanced for one or more specific EG type components.
Accordingly, the EG type components employed in this invention can be either a single EG type component or a combination of two or more EG type components.
When a combination of components is employed, the EG
type component may be derived from the same or different sources.
It is possible that proteins other than CBH type cellulase components present in the whole cellulase composition may cause redeposition of colorant onto the fabric during the stonewashing process.
Therefore, it is comtemplated that the use of substantially pure EG I, EG II or EG III components may eliminate some or all of these proteins present in the whole cellulase composition and may result in a further reduction in redeposition.
The term "substantially pure EG cellulase"
refers to a composition of cellulase proteins containing at least 40 weight percent, preferably at least 70 weight percent and most preferably at least 90 weight percent of the particular EG type component specified based on the total weight of the cellulase proteins.
The term "EG I cellulase" refers to the endoglucanase component derived from Trlchoderma spp.
W094/07983 5~73 - 14 - PCT/US93/08735 characterized by a pH optimum of about 4.0 to 6.0, and isoelectric point (pI) of from about 4.5 to 4.7, and a molecular weight of about 47 to 49 Kdaltons.
Preferably, EG I cellulase is derived from either S Trichoderma longibrachiatum or from Trichoderma viride. EG I cellulase derived from Trichoderma longibrachiatum has a pH optimum of about 5.0, an isoelectric point (pI) of about 4.7 and a molecular weight of about 47 to 49 Kdaltons. EG I cellulase derived from Trichoderma ~iride has a pH optimum of about 5.0, an isoelectric point (pI) of about 5.3 and a molecular weight of about 50 Kdaltons.
It is noted that EG II has been previously referred to by the nomenclature "EG III" by some authors but current nomenclature uses the term EG II.
In any event the EG II protein is substantially different from the EG III protein in its molecular weight, pI and pH optimum. The term "EG II
cellulase" refers to the endoglucanase component derived from Trichoderma spp. characterized by a pH
optimum of about 4.0 to 6.0, and isoelectric point (pI) of from about 5.5, and a molecular weight of about 35 Kdaltons. Preferably, EG II cellulase is derived from either Trichoderma longibrachiatum or from Trichoderma viride.
The term "EG III cellulase" refers to the endoglucanase component derived from Trichoderma spp.
characterized by a pH optimum of about 5.0 to 7.0, and isoelectric point (pI) of from about 7.2 to 8.0, and a molecular weight of about 23 to 28 Kdaltons.
Preferably, EG III cellulase is derived from either Trichoderma longibrachiatum or from Trichoderma viride. EG III cellulase derived from Trichoderma longibrachiatum has a pH optimum of about 5.5 to 6.0, an isoelectric point (pI) of about 7.4 and a molecular weight of about 25 to 28 Kdaltons. EG III
cellulase derived from Trichoderma viride has a pH
optimum of about S.5, an isoelectric point (pI) of about 7.7 and a molecular weight of about 23.5 Kdaltons.
It is contemplated that EG type components can be derived from bacterially derived cellulases.
"Exo-cellobiohydrolase type ("CBH type") components" refer to those fungal cellulase components which exhibit textile activity properties similar to CBH I and/or CBH II cellulase components of ~richoderma longibrachiatum. In this regard, when used in the absence of EG type cellulase components lS (as defined above), the CBH I and CBH II components of Trichoderma longibrachiatum alone do not impart any significant enhancements in feel, appearance, color enhancement and/or stonewashed appearance to the so treated denim fabrics. Additionally, when used in combination with some EG type components, in a ratio of approximately 2.5:1 of CBH I to EG
components, the CBH I component of Trichoderma longibrachiatum imparts enhanced strength loss to the denim fabrics.
Accordingly, CBH I type components and CBH II
type components refer to those fungal cellulase components which exhibit textile activity properties similar to CBH I and CBH II components of Trichoderma longibrachiatum, respectively. As noted above, for - 30 CBH I type components, this includes the property of enhancing strength loss of denim fabrics when used in the presence of certain EG type components.
Such exo-cellobiohydrolase type components may not include components traditionally classed as exo-8i 3 - 16 -cellobiohydrolases using activity tests such as those used to characterize CBH I and CBH II from Trichoderma l ongi~rachiatum . For example, such components (a) are competitively inhibited by cellobiose (Kj approximately lmM); (b) are unable to hydrolyze to any significant degree substituted celluloses, such as carboxymethylcellulose, etc., and (c) hydrolyze phosphoric acid swollen cellulose and to a lesser degree highly crystalline cellulose. On the other hand, it is believed that some cellulase components which are characterized as CBH components by such activity tests, will impart improved feel, appearance, softening, color enhancement, and/or a stonewashed appearance to cotton-containing fabrics when used alone in the cellulase composition.
Accordingly, it is believed to be more accurate for the purposes herein to define such exo-cellobiohydrolases as EG type components because these components possess similar functional properties in textile uses as possessed by the endoglucanase components of Trichoderma lonqibrachiatum.
As used herein, the term "fungal cellulase composition substantially free of CBH type cellulase components" means that the cellulase composition, based on the weight of protein, will contain less than 20 weight percent CBH type components, more preferably less than 10 weight percent of CBH type cellulase components. It has been unexpectedly found that the presence of CBH type components is not required to achieve a stonewashed appearance.
However, it is contemplated that a small amount (i.e., less than 20%) may provide some enhancement of stonewashing. It has also been found that the 94/07983 _ l7 _ PCT/~S93/08735 removal of CBH type components from the cellulase reduces the redeposition of colorant. Without being limited to any theory, the CBH type components may reversibly sequester the colorant because they are proteins and because of their affinity for cellulase and it is contemplated that other proteins may have a similar effect.
Cellulase compositions substantially free of CBH
type components can be obtained by purification techniques. Specifically, the complete cellulase system can be purified into substantially pure components by recognized separation techniques well published in the literature, including ion exchange chromatography at a suitable pH, affinity chromatography, size exclusion and the like. For example, in ion exchange chromatography (usually anion exchange chromatography), it is possible to separate the cellulase components by eluting with a pH gradient, or a salt gradient, or both a pH and a salt gradient. After purification, the requisite amount of the desired components could be recombined.
It is also contemplated that mixtures of cellulase compositions substantially free of CBH type components could be prepared by means other than isolation and recombination of the components. In this regard, recombinant techniques can alter the relative ratio of EG type components to CBH type components produced by the organism so as to produce a cellulase composition substantially free of CBH
type components.
In regard to the above, a preferred method for the preparation of cellulase compositions described herein is by genetically modifying a mi-croorganism so as to overproduce one or more EG type components.
X,~.As~?3 Likewise, it is also possible to genetically modify a microorganism so as to be incapable of producing one or more CBH type components which methods do not produce any heterologous protein.
In regard to the above, U.S. Serial No.
07/770,049, filed October 4, 1991 which is a continuation-in-part of U.S. Serial No. 07/593,919, filed October 5, l99o and both of which are incorporated herein by reference in their entirety, disclose methods for genetically engineering Trichoderma lonqibrachiatum so as to be incapable of producing one or more CBH components and/or overproducing one or more EG components. Moreover, the methods of that application create Trichoderma lonqibrachiatum strains which do not produce any heterologous proteins. Likewise, Miller et al., "Direct and Indirect Gene Replacement in AsPerqillus nidulans", Molecular and Cellular Biology, p. 1714-1721 (1985) discloses methods for deleting genes in Asperqillus nidulans by DNA mediated transformation using a linear fragment of homologous DNA.
In view of the above, the deletion of the genes responsible for producing CBH I type and/or CBH II
type cellulase components would have the effect of enriching the amount of EG components present in the cellulase composition.
"B-Glucosidase (BG) components" refer to those components of cellulase which exhibit BG activity;
that is to say that such components will act from the non-reducing end of cellobiose and other soluble cellooligosaccharides ("cellobiose") and give glucose as the sole product. BG components do not adsorb onto or react with cellulose polymers. Furthermore, W O 94/07983 2 1 4 58 73 PC~r/US93/08735 such BG components are competitively inhibited by glucose (~ approximately lmM). While in a strict sense, BG components are not literally cellulases because they cannot degrade cellulose, such BG
components are included within the definition of the cellulase system because these enzymes facilitate the overall degradation of cellulose by further degrading the inhibitory cellulose degradation products (particularly cellobiose) produced by the combined action of CBH type components and EG type components.
Methods to either increase or decrease the amount of BG components in the cellulase composition are disclosed in U.S. Serial No. 07/807,028, filed December 10, 1991 which is a continuation-in-part of U.S. Serial No. 07t625,140, filed December 10, 1990, as Attorney Docket No. 010055-056 and entitled "SACCHARIFICATION OF CELLULOSE BY CLONING AND
AMPLIFICATION OF THE ~-GLUCOSIDASE GENE OF
TRICHODERMA REESEI," both of which applications are incorporated herein by reference in their entirety.
Preferred fungal cellulases for use in preparing the cellulase compositions used in this invention are those obtained from Trichoderma lonqibrachiatum, Trichoderma viride, Trichoderma koninqii, Pencillium s~., Humicola insolens, Asperqillus sp. and the like.
Certain fungal cellulases are commercially available, i.e., CELLUCAST (available from Novo Industry, Copenhagen, Denmark), RAPIDASE (available from Gist Brocades, N.V., Delft, Holland), CYTOLASE 123 (available from Genencor International, South San Francisco, California) and the like. Other fungal cellulases can be readily isolated by art recognized fermentation and isolation procedures.-W O 94/07983 PC~r/US93/08735 ~4~13 - 20 -The term "buffer" refers to art recognized acid/base reagents which sta~ilize the cellulase solution against undesired pH shifts during the cellulase treatment of the denim fabric. In this regard, it is art recognized that cellulase activity is pH dependent. That is to say that a specific cellulase composition will exhibit cellulolytic activity within a defined pH range with optimal cellulolytic activity generally being found within a small portion of this defined range. The specific pH
range for cellulolytic activity will vary with each cellulase composition. As noted above, while most cellulases will exhibit cellulolytic activity within an acidic to neutral pH profile, there are some cellulase compositions which exhibit cellulolytic activity in an alkaline pH profile.
During cellulase stonewashing treatment of the denim fabric, it is possible that the pH of the initial cellulase solution could be outside the range required for cellulase activity. It is further possible for the pH to change during treatment of the denim fabric, for example, by the generation of a reaction product which alters the pH of the solution.
In either event, the pH of an unbuffered cellulase solution could be outside the range required for cellulolytic activity. When this occurs, undesired reduction or cessation of cellulolytic activity in the cellulase solution occurs. For example, if a cellulase having an acidic activity profile is employed in a neutral unbuffered aqueous solution, then the pH of the solution will result in lower cellulolytic activity and possibly in the cessation of cellulolytic activity. On the other hand, the use of a cellulase having a neutral or alkaline pH
W O 94/07983 2 1 4 5 8 7 3 PC-r/US93/08735 profile in a neutral unbuffered aqueous solution should initially provide significant cellulolytic activity.
In view of the above, the pH of the cellulase solution should be maintained within the range required for cellulolytic activity. One means of accomplishing this is by simply monitoring the pH of the system and adjusting the pH as required by the addition of either an acid or a base. However, in a preferred embodiment, the pH of the system is preferably maintained within the desired pH range by the use of a buffer in the cellulase solution. In general, a sufficient amount of buffer is employed so as to maintain the pH of the solution within the range wherein the employed cellulase exhibits activity. Insofar as different cellulase compositions have different pH ranges for exhibiting cellulase activity, the specific buffer employed is selected in relationship to the specific cellulase composition employed. The buffer(s) selected for use with the cellulase composition employed can be readily determined by the skilled artisan taking into account the pH range and optimum for the cellulase composition employed as well as the pH of the cellulase solution. Preferably, the buffer employed is one which is compatible with the cellulase composition and which will maintain the pH of the cellulase solution within the pH range required for optimal activity. Suitable buffers include sodium citrate, ammonium acetate, sodium acetate, disodium phosphate, and any other art recognized buffers.
-W O 94/07983 PC~r/US93/08735 81 3 ~
2. Methodolo~Y
As noted above, the present invention is an improvement over prior art methods for stonewashing denim fabrics insofar as the present invention employs a specific cellulase composition which minimizes redeposition of colorant.
It is contemplated that the methods of this invention will provide additional enhancements to the fabric such as improvements in the feel and/or appearance of the fabric, while reducing strength loss in the treated fabric.
The cellulase compositions described above are preferably employed in a final aqueous treatment solution which contains cellulase and other optional ingredients including, for example, a buffer, a surfactant, a scouring agent, and the like.
The concentration of the cellulase composition employed in this final solution is generally a concentration suf~icient for its intended purpose.
That is to say that an amount of the cellulase composition is employed to provide effective stonewashing of the denim fabric. Thus an "effective amount" of cellulase composition is that amount which will provide stonewashing. The amount of the cellulase composition employed is also dependent on the equipment employed, the process parameters employed (the temperature of the cellulase treatment solution, the exposure time to the cellulase solution, and the like), the cellulase activity (e.g., a cellulase solution will require a lower concentration of a more active cellulase composition as compared to a less active cellulase composition), and the like. The exact concentration of the W~ 94/07983 2 1 4 5 8 73 PCT/US93/08735 cellulase composition can be readily determined by the skilled artisan based on the above factors as well as the desired effect. Preferably, the concentration of the cellulase composition in the final cellulase solution employed herein is from about 5 mgs/liter of cellulase solution to about 2000 mgs/liter of cellulase solution; and more preferably, from about 10 mgs/liter of cellulase solution to about 200 mgs/liter of cellulase solution. (The cellulase concentration recited above refers to the weight of total protein).
When a buffer is employed in the cellulase treatment solution, the concentration of buffer in the aqueous cellulase treatment solution is that which is sufficient to maintain the pH of the solution within the range wherein the employed cellulase exhibits activity which, in turn, depends on the nature of the cellulase employed. The exact concentration of buffer employed will depend on several factors which the skilled artisan can readily take into account. For example, in a preferred embodiment, the buffer as well as the buffer concentration are selected so as to maintain the pH
of the final cellulase solution within the pH range required for optimal cellulase activity. In general, buffer concentration in the cellulase solution is about 0.005N and greater. Preferably, the concentration of the buffer in the cellulase solution is from about 0.01 to about 0.2N.
In addition to cellulase and a buffer, the cellulase treatment solution can optionally contain a surfactant, i.e., less than about 10,000 ppm, and preferably from about 10 ppm to about 1,000 ppm.
Suitable surfactants include any surfactant ~4~ 3 compatible with the cellulase and the fabric including, for example, anionic, non-ionic and ampholytic surfactants.
Suitable anionic surfactants for use herein include linear or branched alkylbenzenesulfonates;
alkyl or alkenyl ether sulfates having linear or branched alkyl groups or alkenyl groups; alkyl or alkenyl sulfates; olefinsulfonates; alkanesulfonates and the like. Suitable counter ions for anionic surfactants include alkali metal ions such as sodium and potassium; alkaline earth metal ions such as calcium and magnesium; ammonium ion; and alkanolamines having 1 to 3 alkanol groups of carbon number 2 or 3.
Ampholytic surfactants include quaternary ammonium salt sulfonates, betaine-type ampholytic surfactants, and the like. Such ampholytic surfactants have both the positive and negative charged groups in the same molecule.
Nonionic surfactants generally comprise polyoxyalkylene ethers, as well as higher fatty acid alkanolamides or alkylene oxide adduct thereof, fatty acid glycerine monoesters, and the like.
Mixtures of surfactants can also be employed.
In a preferred embodiment, a concentrate can be prepared for use in the methods described herein.
Such concentrates would contain concentrated amounts of the cellulase composition described above, buffer and surfactant, preferably in an aqueous solution.
When so formulated, the concentrate can readily be diluted with water so as to quickly and accurately prepare cellulase solutions having the requisite concentration of these additives. Pre~erably, such concentrates will comprise from about 0.5 to about 50 ~ 94/07983 2 ~ ~ S 8 7 3 PCT/US93/08735 weight percent of a fungal cellulase composition described above (protein); from about 1 to about 80 weight percent buffer; from about 0 to about 50 weight percent surfactant; with the balance being water. When aqueous concentrates are formulated, these concentrates can be diluted so as to arrive at the requisite concentration of the components in the cellulase solution as indicated above. As is readily apparent, such concentrates will permit facile formulation of the cellulase solutions as well as permit feasible transportation of the concentration to the location where it will be used. The concentrate can be either in the form of liquid, emulsion, gel, paste, and the like. Such forms are well known to the skilled artisan.
When a solid cellulase concentrate is employed, the cellulase composition is generally a granule, a powder, an agglomerate and the like. When granules are used, the granules are preferably formulated so as to contain a cellulase protecting agent. See, for instance, U.S. Serial No. 07/642,669, filed January 17, 1991 as Attorney Docket No. 010055-073 and entitled "GRANULES CONTAINING BOTH AN ENZYME AND AN
ENZYME PROTECTING AGENT AND DETERGENT COMPOSITIONS
CONTAINING SUCH GRANULES," which application is incorporated herein by reference in its entirety.
Likewise, the granules can be formulated so as to contain materials to reduce the rate of dissolution of the granules into the wash medium. Such materials and granules are disclosed in U.S. Serial No.
07/642,596 filed on January 17, 1991 as Attorney Docket No. GCS-171-US1 and entitled "GRANULAR
COMPOSITIONS," which application is incorporated herein by reference in its entirety.
W O 94/07983 PC~r/US93/0873~
58~3 ~
Other materials can also be used with or placed in the cellulase composition as desired, including stones, fillers, solvents, enzyme activators, other anti-redeposition agents and the like.
The liquor ratios, i.e., the ratio of weight of cellulase treatment solution to the weight of fabric, employed herein is generally an amount sufficient to achieve the desired stonewashing effect in the denim fabric and is dependent upon the process used.
Preferably, the li~uor ratios are generally from about 1:1 and greater, and more preferably greater than about 2:1. Use of liquor ratios of greater than about 20:1 are usually not preferred from an economic viewpoint.
Reaction temperatures for cellulase treatment are governed by two competing factors. ~irstly, higher temperatures generally correspond to enhanced reaction kinetics, i.e., faster reactions, which permit reduced reaction times as compared to reaction times required at lower temperatures. Accordingly, reaction temperatures are generally at least about 30OC and greater. Secondly, cellulase is a protein which loses activity beyond a given reaction temperature which temperature is dependent on the nature of the cellulase used. Thus, if the reaction temperature is permitted to go too high, then the cellulolytic activity is lost as a result of the denaturing of the cellulase. As a result, the maY;mllm reaction temperatures employed herein are generally about 65C. In view of the above, reaction temr~ratures are generally from about 30OC to about 65C; preferably, from about 35C to about 60C; and more preferably, from about 35OC to about 55C.
W 0 94/07983 21~5873 PC~r/US93/08735 Reaction times are generally from about 10 minutes to about 3 hours and, preferably, from about 20 minutes to about 1 hour.
The denim fabrics stonewashed in the methods described above using such cellulase compositions show reduced deposition of dye as compared to the same denim fabric stonewashed in the same manner with a complete cellulase composition.
The following examples are offered to illustrate the present invention and should not be construed in any way as limiting its scope.
EXP~MPLES
Examples 1 - 14 demonstrate the preparation of Trichoderma lonqibrachiatum genetically engineered so as to be incapable of producing one or more cellulase components or so as to overproduce specific cellulase components.
Selection for pyr4~ derivative~ of 2 0 Trichoderma longibrachiatum The EY~ gene encodes orotidine-5'-monophosphate decarboxylase, an enzyme required for the biosynthesis of uridine. The toxic inhibitor 5-fluoroorotic acid (FOA) is incorporated into uridine 25 by wild-type cells and thus poisons the cells.
However, cells defective in the EYE~ gene are resistant to this inhibitor but require uridine for growth. It is, therefore, possible to select for 3 ~
EYE~ derivative strains using FOA. In practice, spores of T. lonqibrachiatum (previously classified as T. reesei) strain RL-P37 (Sheir-Neiss, G. and Montenecourt, B.S., Appl. Microbiol. Biotechnol. 20, p. 46-53 (1984)) were spread on the surface of a solidified medium containing 2 mg/ml uridine and 1.2 mg/ml FOA. Spontaneous FOA-resistant colonies appeared within three to four days and it was possible to subsequently identify those FOA-resistant derivatives which required uridine for growth. In order to identify those derivatives which specifically had a defective pyr4 gene, protoplasts were generated and transformed with a plasmid containing a wild-type ~Yr4 gene (see Examples 3 and
In view of the problems associated with pumice stones in stonewashing, whole cellulase solutions are used as a replacement for the pumice stones under agitating and cascading conditions, i.e., in a rotary drum washing machine, to impart a "stonewashed"
appearance to the denim (U.S. Patent No. 4,832,864).
A problem with the use of whole cellulase compositions from Trichoderma sp. microorganisms and other fungal sources is the incomplete removal of colorant caused by redeposition or backstaining of some of the dye back onto the cloth during the stonewashing process. In the case of denim fabric, this causes recoloration of the blue threads and blue coloration of the white threads, resulting in less contrast between the blue and white threads and abrasion points (i.e., a blue on blue look rather than the preferred white on blue). See, American Dyestuff Reporter, Sept. 1990, pp. 24-28. This redeposition is objectionable to some users.
Trichoderma cellulases, even though they result in backstaining are preferred because of their higher activity on denim material. In addition, cellulases with a higher degree of purity may be beneficial in the present invention. ~igh specific activity or a high level of purity results in a higher degree of abrasion in a significantly shorter processing time and therefor, is preferable to the denim processors.
Attempts to reduce the amount of redeposition of dye included the addition of extra chemicals or enzymes, such as surfactants, proteases or other agents, into the cellulase wash to help disperse the loosened dye. In addition, processors have used less ~i45873 4 active whole cellulase, along with extra washings.
However, this results in additional chemical costs and longer processing times. Another method includes the use of a mild bleach agent or stain removing agent in the process. This method affects the garment's final shade and increases the processing time. Finally the use of enzymes and stones together leave the processor with all the pro~lems caused by the use of the stones alone.
Accordingly, it would be desirable to find a method to prevent redeposition of colorant during stonewashing of clothing with cellulases.
SUMMARY OF TXE lNv~NlION
The present invention is directed to the discovery that the redeposition of colorant onto fabric during the stonewashing process can be reduced by employing a fungal cellulase composition which is substantially free of CBH type components. It has been found that stonewashing with EG type components result in the reduced redeposition of colorant onto fabric resulting in abrasion points that are more distinct. For example, with indigo dyed denim improved contrast between white and blue yarns is obtained giving a superior stonewashed look.
In view of the above, in one of its method aspects, the present invention is directed to an improved method for reducing colorant redeposition during the stonewashing of colored fabrics which method comprises contacting the fabric with an effective amount of a fungal cellulase solution derived from a redepositing whole fungal cellulase W O 94/07983 ~ 1 ~ 5~ 7 3 PC~r/US93/08735 }
composition under conditions sufficient to impart a stone-washed appearance to the fabric wherein said cellulase solution is substantially free of CBH type components. In a preferred embodiment, the fungal cellulase composition employed herein comprises substantially pure EG I, EG II, and/or substantially pure EG III components. In still another preferred embodiment, the fungal cellulase composition comprises at least about 40 weight percent and preferably at least about 70 weight percent of EG
type components based on the total weight of protein in the cellulase composition.
Cotton-containing fabrics or clothing treated by the methods of this invention unexpectedly posses both enhancement of a stonewashed appearance and a reduced redeposition of colorant as compared to the fabric treated with whole cellulase.
In its composition aspects, the present invention is directed to a cotton-containing fabric or clothing treated in the methods of this invention as defined above.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is an outline of the construction of p~CR~TPyr4 .
FIG. 2 illustrates deletion of the T.
longibrachiatum gene by integration of the larger EcoRI fragment from p~CBHIEyE~ at the cbhl locus on one of the T. lonqibrachiatum chromosomes.
FIG. 3 is an autoradiograph of DNA from T.
lonqibrachiatum strain GC69 transformed with EcoRI
digested p~CBHI~yE~ after Southern blot analysis W O 94/07983 PC~r/US93/08735 ~g8YI ~ 6 -using a 32p labelled p~CBHIpvr4 as the probe. The sizes of molecular weight markers are shown in kilobase pairs to the left of the Figure.
FIG. 4 is an autoradiograph of DNA from a T.
lonqibrachiatum strain GC69 transformed with EcoRI
digested PA~R~TEYE~ using a 32p labelled pIntCBHI as the probe. The sizes of molecular weight markers are shown in kilobase pairs to the left of the Figure.
FIG. 5 is an isoelectric focusing gel displaying the proteins secreted by the wild type and by transformed strains of T. lonqibrachiatum.
Specifically, in FIG.5, Lane A of the isoelectric focusing gel employs partially purified CBHI from T.
lonqibrachiatum; Lane B employs a wild type T.
lonqibrachiatum : Lane C employs protein from a lonqibrachiatum strain with the cbhl gene deleted;
and Lane D employs protein from a T. lonqibrachiatum strain with the cbhl and cbh2 genes deleted. In FIG.
5, the right hand side of the figure is marked to indicate the location of the single proteins found in one or more of the secreted proteins. Specifically, BG refers to the ~-glucosidase, E1 refers to endoglucanase I, E2 refers to endoglucanase II, E3 refers to endoglucanase III, C1 refers to exo-cellobiohydrolase I and C2 refers to exo-cellobiohydrolase II.
FIG. 6A is a representation of the T.
lonqibrachiatum cbh2 locus, cloned as a 4.1 kb EcoRI
fragment on genomic DNA and FIG. 6B is a representation of the cbh2 gene deletion vector pP~CBHII.
FIG. 7 is an autoradiograph of DNA from T.
lonqibrachiatum strain P37P~CBHIPyr-26 transformed with EcoRI digested pP~CBHII after Southern blot 2~5~73 analysis using a 32p labelled pP~CBHII as the probe~
The sizes of molecular weight markers are shown in kilobase pairs to the left of the Figure.
FIG. 8 is a diagram of the plasmid pEGIEyE~.
FIG. 9 is an outline of the construction of plasmid pTEX-EG1.
FIG. 10 illustrates the RBB-CMC activity profile of an acidic EG enriched fungal cellulase composition (CBH I and II deleted) derived from Trichoderma lonqibrachiatum over a pH range at 40C; as well as the activity profile of an enriched EG III cellulase composition derived from Trichoderma lonqibrachiatum over a pH range at 40C.
FIG. 11 illustrates the effect of different cellulase compositions on the redeposition of colorant during the stonewashing process.
DET~TT~n DESCRIPTION OF THE PREFERRED EMBODIMENTS
As noted above, the methods of this invention are directed toward a method of stonewashing fabrics with fungal cellulase while reducing the amount of backstaining of colorant onto the fabric. The method comprises using a specific fungal cellulase solution substantially free of CBH type components which reduces the backstaining of the colorant onto the fabric. However, prior to discussing this invention in detail, the following terms will first be defined.
.
W O 94/07983 PC~r/US93/08735 1) Definitions:
The term "fabric" refers to sewn or unsewn fabrics, including knits and wovens, made of pure cotton or cotton blends and the like. When cotton blends are employed, the amount of cotton in the fabric should be at least about 40 percent by weight cotton; preferably, more than about 60 percent by weight cotton; and most preferably, more than about 75 percent by weight cotton. When employed as blends, the companion material employed in the fabric can include one or more non-cotton fibers including synthetic fibers such as polyamide fibers (for example, nylon 6 and nylon 66), acrylic fibers (for example, polyacrylonitrile fibers), and polyester fibers (for example, polyethylene terephthalate), polyvinyl alcohol fibers (for example, Vinylon), polyvinyl chloride fibers, polyvinylidene chloride fibers, polyurethane fibers, polyurea fibers and aramid fibers. The fabric typically has been colored wth dye or pigment, for instance with the dye indigo.
One desirable characteristic of colored fabric is the alteration of colored threads with white threads, for example, in the case of denim this gives denim a white on blue contrast appearance.
The term "stonewashing" means the treatment of dyed denim fabric with a fungal cellulase solution under agitating and cascading conditions, i.e., in a rotary drum washing machine which impart a "stonewashed" appearance to the denim. Methods for imparting a stonewashed appearance to denims are described in U.S. Patent No. 4,832,864 which is incorporated herein by reference in its entirety.
W O 94/07983 2 1 4 5 8 7~ PC~r/US93/08735 g The term "fungal cellulase" refers to the enzyme composition derived from fungal sources or microorganisms genetically modified so as to incorporate and express all or part of the cellulase genes obtained from a fungal source. Cellulases act on cellulose and its derivatives to hydrolyze cellulose and give primary products, glucose and cellobiose. Fungi capable of producing cellulases useful in preparing cellulase compositions described herein are disclosed in British Patent No. 2 094 826A, the disclosure of which is incorporated herein by reference.
A "redepositing cellulase" as used herein refers to those cellulases which in the enzymatic stonewashing of denim tend to backstain the fabric.
Such backstaining of the fabric leads to incomplete stonewashing because instead of the desired blue on white contrast, the redeposition results on blue on blue. Redepositing cellulases include microorganisms such as the fungal microorganism Trichoderma sp. and the like.
Most fungal cellulases generally have their optimum activity in the acidic or neutral pH range although some fungal cellulases are known to possess significant activity under neutral and slightly alkaline conditions, i.e., for example, cellulase derived from ~umicola insolens is known to have activity in neutral to slightly alkaline conditions.
Fungal cellulases are known to be comprised of several enzyme classifications having different substrate specificity, enzymatic action patterns, and the like. Additionally, enzyme components within each classification can exhibit different molecular weights, different degrees of glycosylation, 2~ 3 - lo -different isoelectric points, different substrate specificity etc`. For example, fungal cellulases can contain cellulase classifications which include endoglucanases (EGs), exo-cellobiohydrolases (CBHs), ~-glucosidases (BGs), etc. On the other hand, while bacterial cellulases are reported in the literature as containing little or no CBH components, there are a few cases where CBH-like components derived from bacterial cellulases have been reported to possess exo-cellobiohydrolase activity.
A fungal cellulase composition produced by a naturally occurring source and which comprises one or more CBH and EG components wherein each of these components is found at the ratio produced by the source is sometimes referred to herein as a "complete fungal cellulase system" or a "complete fungal cellulase composition" to distinguish it from the classifications and components of cellulase isolated therefrom, from incomplete cellulase compositions produced by bacteria and some fungi, or from a cellulase composition obtained from a microorganism genetically modified so as to overproduce, underproduce, or not produce one or more of the CBH
type and/or EG type components of cellulase.
The fermentation procedures for culturing fungi for production of cellulase are known per se in the art. For example, cellulase systems can be produced either by solid or submerged culture, including batch, fed-batch and continuous-flow processes. The collection and purification of the cellulase systems from the fermentation broth can also be effected by procedures known per se in the art.
"Endoglucanase ("EG") type components" refer to all of those fungal cellulase components or W094/07983 2 1~ 5873 PCT/US93/0873~
combination of components which exhibit textile activity properties similar to the endoglucanase components of Trichoderma longibrachiatum (previously classified as Trichoderma reesei). In this regard, the endoglucanase components of Trichoderma longibrachiatum (specifically, EG I, EG II, EG III, and the like either alone or in combination) impart improved feel, improved appearance, softening, color enhancement, and/or a stonewashed appearance to denim fabrics (as compared to the fabric prior to treatment) when these components are incorporated into a textile treatment medium and the fabric is treated with this medium.
Accordingly, endoglucanase type components are those cellulase components which impart improved feel, improved appearance, softening, color enhancement, and/or a stonewashed appearance to denim fabrics (as compared to the fabric before treatment) when these components are incorporated into a medium used to treat the fabrics. Certain EG components may impart reduced strength loss to denim fabrics as compared to the strength loss arising from treatment with a similar cellulase composition but which additionally contains CBH I components.
Such endoglucanase type components may not include components traditionally classified as endoglucanases using activity tests such as the ability of the component (a) to hydrolyze soluble cellulose derivatives such as carboxymethylcellulose (CMC), thereby reducing the viscosity of CMC
containing solutions, (b) to readily hydrolyze hydrated forms of cellulose such as phosphoric acid swollen cellulose (e.g., Walseth cellulose) and hydrolyze less readily the more highly crystalline ~5~
forms of cellulose (e.g., Avicel, Solkafloc, etc.).
On the other hand, it is believed that not all endoglucanase components, as defined by such activity tests, will impart one or more of the enhancements to denim fabrics as well as reduced strength loss to denim fabrics. Accordingly, it is more accurate for the purposes herein to define endoglucanase type components as those components of fungal cellulase which possess similar textile activity properties as possessed by the endoglucanase components of Trichoderma longibrachiatum.
Fungal cellulases can contain more than one EG
type component. The different components generally have different isoelectric points, different molecular weights, different degrees of glycosylation, different substrate specificity, different enzymatic action patterns, etc. The different isoelectric points of the components allow for their separation via ion exchange chromatography and the like. In fact, the isolation of components from different sources is known in the art. See, for example, Bjork et al., U.S. Patent No. 5,120,463;
Schulein et al., International Application WO
89/09259; Wood et al., Biochemistry and Genetics of Cellulose Degradation, pp. 31-52 (1988); Wood et al., Carbohydrate Research, Vol. 190, pp. 279-297 (1989);
Schulein, Methods in Enzymology, Vol. 160, pp. 234-242 (1988); and the like. The entire disclosure of each of these references is incorporated herein by reference.
Preferably the fungal cellulase compositions of the present invention include substantially pure EG I
or EG III cellulase components. It is contemplated that the fungal cellulase composition of the present .
invention may include substantially pure EG II
cellulase component. However, it is also contemplated that combinations of EG type components may give a synergistic response in reducing the amount of backstaining of dye onto denim during the stonewashing of denim. On the other hand, a single EG type component may be more stable or have a broader spectrum of activity over a range of pHs.
Further these anti-redeposition properties may be enhanced for one or more specific EG type components.
Accordingly, the EG type components employed in this invention can be either a single EG type component or a combination of two or more EG type components.
When a combination of components is employed, the EG
type component may be derived from the same or different sources.
It is possible that proteins other than CBH type cellulase components present in the whole cellulase composition may cause redeposition of colorant onto the fabric during the stonewashing process.
Therefore, it is comtemplated that the use of substantially pure EG I, EG II or EG III components may eliminate some or all of these proteins present in the whole cellulase composition and may result in a further reduction in redeposition.
The term "substantially pure EG cellulase"
refers to a composition of cellulase proteins containing at least 40 weight percent, preferably at least 70 weight percent and most preferably at least 90 weight percent of the particular EG type component specified based on the total weight of the cellulase proteins.
The term "EG I cellulase" refers to the endoglucanase component derived from Trlchoderma spp.
W094/07983 5~73 - 14 - PCT/US93/08735 characterized by a pH optimum of about 4.0 to 6.0, and isoelectric point (pI) of from about 4.5 to 4.7, and a molecular weight of about 47 to 49 Kdaltons.
Preferably, EG I cellulase is derived from either S Trichoderma longibrachiatum or from Trichoderma viride. EG I cellulase derived from Trichoderma longibrachiatum has a pH optimum of about 5.0, an isoelectric point (pI) of about 4.7 and a molecular weight of about 47 to 49 Kdaltons. EG I cellulase derived from Trichoderma ~iride has a pH optimum of about 5.0, an isoelectric point (pI) of about 5.3 and a molecular weight of about 50 Kdaltons.
It is noted that EG II has been previously referred to by the nomenclature "EG III" by some authors but current nomenclature uses the term EG II.
In any event the EG II protein is substantially different from the EG III protein in its molecular weight, pI and pH optimum. The term "EG II
cellulase" refers to the endoglucanase component derived from Trichoderma spp. characterized by a pH
optimum of about 4.0 to 6.0, and isoelectric point (pI) of from about 5.5, and a molecular weight of about 35 Kdaltons. Preferably, EG II cellulase is derived from either Trichoderma longibrachiatum or from Trichoderma viride.
The term "EG III cellulase" refers to the endoglucanase component derived from Trichoderma spp.
characterized by a pH optimum of about 5.0 to 7.0, and isoelectric point (pI) of from about 7.2 to 8.0, and a molecular weight of about 23 to 28 Kdaltons.
Preferably, EG III cellulase is derived from either Trichoderma longibrachiatum or from Trichoderma viride. EG III cellulase derived from Trichoderma longibrachiatum has a pH optimum of about 5.5 to 6.0, an isoelectric point (pI) of about 7.4 and a molecular weight of about 25 to 28 Kdaltons. EG III
cellulase derived from Trichoderma viride has a pH
optimum of about S.5, an isoelectric point (pI) of about 7.7 and a molecular weight of about 23.5 Kdaltons.
It is contemplated that EG type components can be derived from bacterially derived cellulases.
"Exo-cellobiohydrolase type ("CBH type") components" refer to those fungal cellulase components which exhibit textile activity properties similar to CBH I and/or CBH II cellulase components of ~richoderma longibrachiatum. In this regard, when used in the absence of EG type cellulase components lS (as defined above), the CBH I and CBH II components of Trichoderma longibrachiatum alone do not impart any significant enhancements in feel, appearance, color enhancement and/or stonewashed appearance to the so treated denim fabrics. Additionally, when used in combination with some EG type components, in a ratio of approximately 2.5:1 of CBH I to EG
components, the CBH I component of Trichoderma longibrachiatum imparts enhanced strength loss to the denim fabrics.
Accordingly, CBH I type components and CBH II
type components refer to those fungal cellulase components which exhibit textile activity properties similar to CBH I and CBH II components of Trichoderma longibrachiatum, respectively. As noted above, for - 30 CBH I type components, this includes the property of enhancing strength loss of denim fabrics when used in the presence of certain EG type components.
Such exo-cellobiohydrolase type components may not include components traditionally classed as exo-8i 3 - 16 -cellobiohydrolases using activity tests such as those used to characterize CBH I and CBH II from Trichoderma l ongi~rachiatum . For example, such components (a) are competitively inhibited by cellobiose (Kj approximately lmM); (b) are unable to hydrolyze to any significant degree substituted celluloses, such as carboxymethylcellulose, etc., and (c) hydrolyze phosphoric acid swollen cellulose and to a lesser degree highly crystalline cellulose. On the other hand, it is believed that some cellulase components which are characterized as CBH components by such activity tests, will impart improved feel, appearance, softening, color enhancement, and/or a stonewashed appearance to cotton-containing fabrics when used alone in the cellulase composition.
Accordingly, it is believed to be more accurate for the purposes herein to define such exo-cellobiohydrolases as EG type components because these components possess similar functional properties in textile uses as possessed by the endoglucanase components of Trichoderma lonqibrachiatum.
As used herein, the term "fungal cellulase composition substantially free of CBH type cellulase components" means that the cellulase composition, based on the weight of protein, will contain less than 20 weight percent CBH type components, more preferably less than 10 weight percent of CBH type cellulase components. It has been unexpectedly found that the presence of CBH type components is not required to achieve a stonewashed appearance.
However, it is contemplated that a small amount (i.e., less than 20%) may provide some enhancement of stonewashing. It has also been found that the 94/07983 _ l7 _ PCT/~S93/08735 removal of CBH type components from the cellulase reduces the redeposition of colorant. Without being limited to any theory, the CBH type components may reversibly sequester the colorant because they are proteins and because of their affinity for cellulase and it is contemplated that other proteins may have a similar effect.
Cellulase compositions substantially free of CBH
type components can be obtained by purification techniques. Specifically, the complete cellulase system can be purified into substantially pure components by recognized separation techniques well published in the literature, including ion exchange chromatography at a suitable pH, affinity chromatography, size exclusion and the like. For example, in ion exchange chromatography (usually anion exchange chromatography), it is possible to separate the cellulase components by eluting with a pH gradient, or a salt gradient, or both a pH and a salt gradient. After purification, the requisite amount of the desired components could be recombined.
It is also contemplated that mixtures of cellulase compositions substantially free of CBH type components could be prepared by means other than isolation and recombination of the components. In this regard, recombinant techniques can alter the relative ratio of EG type components to CBH type components produced by the organism so as to produce a cellulase composition substantially free of CBH
type components.
In regard to the above, a preferred method for the preparation of cellulase compositions described herein is by genetically modifying a mi-croorganism so as to overproduce one or more EG type components.
X,~.As~?3 Likewise, it is also possible to genetically modify a microorganism so as to be incapable of producing one or more CBH type components which methods do not produce any heterologous protein.
In regard to the above, U.S. Serial No.
07/770,049, filed October 4, 1991 which is a continuation-in-part of U.S. Serial No. 07/593,919, filed October 5, l99o and both of which are incorporated herein by reference in their entirety, disclose methods for genetically engineering Trichoderma lonqibrachiatum so as to be incapable of producing one or more CBH components and/or overproducing one or more EG components. Moreover, the methods of that application create Trichoderma lonqibrachiatum strains which do not produce any heterologous proteins. Likewise, Miller et al., "Direct and Indirect Gene Replacement in AsPerqillus nidulans", Molecular and Cellular Biology, p. 1714-1721 (1985) discloses methods for deleting genes in Asperqillus nidulans by DNA mediated transformation using a linear fragment of homologous DNA.
In view of the above, the deletion of the genes responsible for producing CBH I type and/or CBH II
type cellulase components would have the effect of enriching the amount of EG components present in the cellulase composition.
"B-Glucosidase (BG) components" refer to those components of cellulase which exhibit BG activity;
that is to say that such components will act from the non-reducing end of cellobiose and other soluble cellooligosaccharides ("cellobiose") and give glucose as the sole product. BG components do not adsorb onto or react with cellulose polymers. Furthermore, W O 94/07983 2 1 4 58 73 PC~r/US93/08735 such BG components are competitively inhibited by glucose (~ approximately lmM). While in a strict sense, BG components are not literally cellulases because they cannot degrade cellulose, such BG
components are included within the definition of the cellulase system because these enzymes facilitate the overall degradation of cellulose by further degrading the inhibitory cellulose degradation products (particularly cellobiose) produced by the combined action of CBH type components and EG type components.
Methods to either increase or decrease the amount of BG components in the cellulase composition are disclosed in U.S. Serial No. 07/807,028, filed December 10, 1991 which is a continuation-in-part of U.S. Serial No. 07t625,140, filed December 10, 1990, as Attorney Docket No. 010055-056 and entitled "SACCHARIFICATION OF CELLULOSE BY CLONING AND
AMPLIFICATION OF THE ~-GLUCOSIDASE GENE OF
TRICHODERMA REESEI," both of which applications are incorporated herein by reference in their entirety.
Preferred fungal cellulases for use in preparing the cellulase compositions used in this invention are those obtained from Trichoderma lonqibrachiatum, Trichoderma viride, Trichoderma koninqii, Pencillium s~., Humicola insolens, Asperqillus sp. and the like.
Certain fungal cellulases are commercially available, i.e., CELLUCAST (available from Novo Industry, Copenhagen, Denmark), RAPIDASE (available from Gist Brocades, N.V., Delft, Holland), CYTOLASE 123 (available from Genencor International, South San Francisco, California) and the like. Other fungal cellulases can be readily isolated by art recognized fermentation and isolation procedures.-W O 94/07983 PC~r/US93/08735 ~4~13 - 20 -The term "buffer" refers to art recognized acid/base reagents which sta~ilize the cellulase solution against undesired pH shifts during the cellulase treatment of the denim fabric. In this regard, it is art recognized that cellulase activity is pH dependent. That is to say that a specific cellulase composition will exhibit cellulolytic activity within a defined pH range with optimal cellulolytic activity generally being found within a small portion of this defined range. The specific pH
range for cellulolytic activity will vary with each cellulase composition. As noted above, while most cellulases will exhibit cellulolytic activity within an acidic to neutral pH profile, there are some cellulase compositions which exhibit cellulolytic activity in an alkaline pH profile.
During cellulase stonewashing treatment of the denim fabric, it is possible that the pH of the initial cellulase solution could be outside the range required for cellulase activity. It is further possible for the pH to change during treatment of the denim fabric, for example, by the generation of a reaction product which alters the pH of the solution.
In either event, the pH of an unbuffered cellulase solution could be outside the range required for cellulolytic activity. When this occurs, undesired reduction or cessation of cellulolytic activity in the cellulase solution occurs. For example, if a cellulase having an acidic activity profile is employed in a neutral unbuffered aqueous solution, then the pH of the solution will result in lower cellulolytic activity and possibly in the cessation of cellulolytic activity. On the other hand, the use of a cellulase having a neutral or alkaline pH
W O 94/07983 2 1 4 5 8 7 3 PC-r/US93/08735 profile in a neutral unbuffered aqueous solution should initially provide significant cellulolytic activity.
In view of the above, the pH of the cellulase solution should be maintained within the range required for cellulolytic activity. One means of accomplishing this is by simply monitoring the pH of the system and adjusting the pH as required by the addition of either an acid or a base. However, in a preferred embodiment, the pH of the system is preferably maintained within the desired pH range by the use of a buffer in the cellulase solution. In general, a sufficient amount of buffer is employed so as to maintain the pH of the solution within the range wherein the employed cellulase exhibits activity. Insofar as different cellulase compositions have different pH ranges for exhibiting cellulase activity, the specific buffer employed is selected in relationship to the specific cellulase composition employed. The buffer(s) selected for use with the cellulase composition employed can be readily determined by the skilled artisan taking into account the pH range and optimum for the cellulase composition employed as well as the pH of the cellulase solution. Preferably, the buffer employed is one which is compatible with the cellulase composition and which will maintain the pH of the cellulase solution within the pH range required for optimal activity. Suitable buffers include sodium citrate, ammonium acetate, sodium acetate, disodium phosphate, and any other art recognized buffers.
-W O 94/07983 PC~r/US93/08735 81 3 ~
2. Methodolo~Y
As noted above, the present invention is an improvement over prior art methods for stonewashing denim fabrics insofar as the present invention employs a specific cellulase composition which minimizes redeposition of colorant.
It is contemplated that the methods of this invention will provide additional enhancements to the fabric such as improvements in the feel and/or appearance of the fabric, while reducing strength loss in the treated fabric.
The cellulase compositions described above are preferably employed in a final aqueous treatment solution which contains cellulase and other optional ingredients including, for example, a buffer, a surfactant, a scouring agent, and the like.
The concentration of the cellulase composition employed in this final solution is generally a concentration suf~icient for its intended purpose.
That is to say that an amount of the cellulase composition is employed to provide effective stonewashing of the denim fabric. Thus an "effective amount" of cellulase composition is that amount which will provide stonewashing. The amount of the cellulase composition employed is also dependent on the equipment employed, the process parameters employed (the temperature of the cellulase treatment solution, the exposure time to the cellulase solution, and the like), the cellulase activity (e.g., a cellulase solution will require a lower concentration of a more active cellulase composition as compared to a less active cellulase composition), and the like. The exact concentration of the W~ 94/07983 2 1 4 5 8 73 PCT/US93/08735 cellulase composition can be readily determined by the skilled artisan based on the above factors as well as the desired effect. Preferably, the concentration of the cellulase composition in the final cellulase solution employed herein is from about 5 mgs/liter of cellulase solution to about 2000 mgs/liter of cellulase solution; and more preferably, from about 10 mgs/liter of cellulase solution to about 200 mgs/liter of cellulase solution. (The cellulase concentration recited above refers to the weight of total protein).
When a buffer is employed in the cellulase treatment solution, the concentration of buffer in the aqueous cellulase treatment solution is that which is sufficient to maintain the pH of the solution within the range wherein the employed cellulase exhibits activity which, in turn, depends on the nature of the cellulase employed. The exact concentration of buffer employed will depend on several factors which the skilled artisan can readily take into account. For example, in a preferred embodiment, the buffer as well as the buffer concentration are selected so as to maintain the pH
of the final cellulase solution within the pH range required for optimal cellulase activity. In general, buffer concentration in the cellulase solution is about 0.005N and greater. Preferably, the concentration of the buffer in the cellulase solution is from about 0.01 to about 0.2N.
In addition to cellulase and a buffer, the cellulase treatment solution can optionally contain a surfactant, i.e., less than about 10,000 ppm, and preferably from about 10 ppm to about 1,000 ppm.
Suitable surfactants include any surfactant ~4~ 3 compatible with the cellulase and the fabric including, for example, anionic, non-ionic and ampholytic surfactants.
Suitable anionic surfactants for use herein include linear or branched alkylbenzenesulfonates;
alkyl or alkenyl ether sulfates having linear or branched alkyl groups or alkenyl groups; alkyl or alkenyl sulfates; olefinsulfonates; alkanesulfonates and the like. Suitable counter ions for anionic surfactants include alkali metal ions such as sodium and potassium; alkaline earth metal ions such as calcium and magnesium; ammonium ion; and alkanolamines having 1 to 3 alkanol groups of carbon number 2 or 3.
Ampholytic surfactants include quaternary ammonium salt sulfonates, betaine-type ampholytic surfactants, and the like. Such ampholytic surfactants have both the positive and negative charged groups in the same molecule.
Nonionic surfactants generally comprise polyoxyalkylene ethers, as well as higher fatty acid alkanolamides or alkylene oxide adduct thereof, fatty acid glycerine monoesters, and the like.
Mixtures of surfactants can also be employed.
In a preferred embodiment, a concentrate can be prepared for use in the methods described herein.
Such concentrates would contain concentrated amounts of the cellulase composition described above, buffer and surfactant, preferably in an aqueous solution.
When so formulated, the concentrate can readily be diluted with water so as to quickly and accurately prepare cellulase solutions having the requisite concentration of these additives. Pre~erably, such concentrates will comprise from about 0.5 to about 50 ~ 94/07983 2 ~ ~ S 8 7 3 PCT/US93/08735 weight percent of a fungal cellulase composition described above (protein); from about 1 to about 80 weight percent buffer; from about 0 to about 50 weight percent surfactant; with the balance being water. When aqueous concentrates are formulated, these concentrates can be diluted so as to arrive at the requisite concentration of the components in the cellulase solution as indicated above. As is readily apparent, such concentrates will permit facile formulation of the cellulase solutions as well as permit feasible transportation of the concentration to the location where it will be used. The concentrate can be either in the form of liquid, emulsion, gel, paste, and the like. Such forms are well known to the skilled artisan.
When a solid cellulase concentrate is employed, the cellulase composition is generally a granule, a powder, an agglomerate and the like. When granules are used, the granules are preferably formulated so as to contain a cellulase protecting agent. See, for instance, U.S. Serial No. 07/642,669, filed January 17, 1991 as Attorney Docket No. 010055-073 and entitled "GRANULES CONTAINING BOTH AN ENZYME AND AN
ENZYME PROTECTING AGENT AND DETERGENT COMPOSITIONS
CONTAINING SUCH GRANULES," which application is incorporated herein by reference in its entirety.
Likewise, the granules can be formulated so as to contain materials to reduce the rate of dissolution of the granules into the wash medium. Such materials and granules are disclosed in U.S. Serial No.
07/642,596 filed on January 17, 1991 as Attorney Docket No. GCS-171-US1 and entitled "GRANULAR
COMPOSITIONS," which application is incorporated herein by reference in its entirety.
W O 94/07983 PC~r/US93/0873~
58~3 ~
Other materials can also be used with or placed in the cellulase composition as desired, including stones, fillers, solvents, enzyme activators, other anti-redeposition agents and the like.
The liquor ratios, i.e., the ratio of weight of cellulase treatment solution to the weight of fabric, employed herein is generally an amount sufficient to achieve the desired stonewashing effect in the denim fabric and is dependent upon the process used.
Preferably, the li~uor ratios are generally from about 1:1 and greater, and more preferably greater than about 2:1. Use of liquor ratios of greater than about 20:1 are usually not preferred from an economic viewpoint.
Reaction temperatures for cellulase treatment are governed by two competing factors. ~irstly, higher temperatures generally correspond to enhanced reaction kinetics, i.e., faster reactions, which permit reduced reaction times as compared to reaction times required at lower temperatures. Accordingly, reaction temperatures are generally at least about 30OC and greater. Secondly, cellulase is a protein which loses activity beyond a given reaction temperature which temperature is dependent on the nature of the cellulase used. Thus, if the reaction temperature is permitted to go too high, then the cellulolytic activity is lost as a result of the denaturing of the cellulase. As a result, the maY;mllm reaction temperatures employed herein are generally about 65C. In view of the above, reaction temr~ratures are generally from about 30OC to about 65C; preferably, from about 35C to about 60C; and more preferably, from about 35OC to about 55C.
W 0 94/07983 21~5873 PC~r/US93/08735 Reaction times are generally from about 10 minutes to about 3 hours and, preferably, from about 20 minutes to about 1 hour.
The denim fabrics stonewashed in the methods described above using such cellulase compositions show reduced deposition of dye as compared to the same denim fabric stonewashed in the same manner with a complete cellulase composition.
The following examples are offered to illustrate the present invention and should not be construed in any way as limiting its scope.
EXP~MPLES
Examples 1 - 14 demonstrate the preparation of Trichoderma lonqibrachiatum genetically engineered so as to be incapable of producing one or more cellulase components or so as to overproduce specific cellulase components.
Selection for pyr4~ derivative~ of 2 0 Trichoderma longibrachiatum The EY~ gene encodes orotidine-5'-monophosphate decarboxylase, an enzyme required for the biosynthesis of uridine. The toxic inhibitor 5-fluoroorotic acid (FOA) is incorporated into uridine 25 by wild-type cells and thus poisons the cells.
However, cells defective in the EYE~ gene are resistant to this inhibitor but require uridine for growth. It is, therefore, possible to select for 3 ~
EYE~ derivative strains using FOA. In practice, spores of T. lonqibrachiatum (previously classified as T. reesei) strain RL-P37 (Sheir-Neiss, G. and Montenecourt, B.S., Appl. Microbiol. Biotechnol. 20, p. 46-53 (1984)) were spread on the surface of a solidified medium containing 2 mg/ml uridine and 1.2 mg/ml FOA. Spontaneous FOA-resistant colonies appeared within three to four days and it was possible to subsequently identify those FOA-resistant derivatives which required uridine for growth. In order to identify those derivatives which specifically had a defective pyr4 gene, protoplasts were generated and transformed with a plasmid containing a wild-type ~Yr4 gene (see Examples 3 and
4). Following transformation, protoplasts were plated on medium lacking uridine. Subsequent growth of transformed colonies demonstrated complementation of a defective Pyr4 gene by the plasmid-borne ~r4 gene. In this way, strain GC6s was identified as a ~Yr4~ derivative of strain RL-P37.
Preparation of CBHI Deletion Vector A cbhl gene encoding the CBHI protein was cloned from the genomic DNA of T. lonqibrachiatum strain RL-P37 by hybridization with an oligonucleotide probe designed on the basis of the published sequence for this gene using known probe synthesis methods (Shoemaker et al., 1983b). The cbhl gene resides on a 6.5 kb PstI fragment and was inserted into PstI cut pUC4K (purchased from Pharmacia Inc., Piscataway, New W094/07983 ~ 14 5 ~ ?3 PCT/US93/0873~
o Jersey) replacing the Kanr gene of this vector using techni~ues known in the art, which techniques are set forth in Sambrook et al. (1989) MOLECULA~ CLONING A
LABORATO~Y MANUAL, Cold Spring Harbor Press, and incorporated herein by reference. The resulting plasmid, pUC4K::cbhl was then cut with HindIII and the larger fragment of about 6 kb was isolated and religated to give pUC4K::cbhl~H/H (see FIG. 1). This procedure removes the entire cbhl coding sequence and approximately 1.2 kb upstream and 1.5 kb downstream of flanking sequences. Approximately, 1 kb of flanking DNA from either end of the original PstI
fragment remains.
The T. lonqibrachiatum EYE~ gene was cloned as a 6.5 kb HindIII fragment of genomic DNA in pUC18 to form pTpyr2 (Smith et al., 1991) following the methods of Sambrook et al., supra. The plasmid pUC4K::cbhI H/H was cut with HindIII and the ends were dephosphorylated with calf intestinal alkaline phosphatase. This end dephosphorylated DNA was ligated with the 6.5 kb HindIII fragment containing the T. lonqibrachiatum ~yr4 gene to give p~CBHIEyE~.
FIG. 1 illustrates the construction of this plasmid.
Digestion of pAcBHIEyE~ with EcoRI liberated a larger fragment which consisted of flanking regions of the cbhl locus at either end with the EYE~ gene replacing the cbhl coding sequence in the center.
The only DNA on this fragment which was not derived from T. lonqibrachiatum was a 21 bp fragment derived from the multiple cloning site of pUC4K.
W O 94/07983 PC~r/US93/0~735 .
EXP~MPLE 3 .
Isolation of Protoplasts Mycelium was obtained by inoculating 100 ml of YEG (0.5% yeast extract, 2% glucose) in a 500 ml flask with about 5 x 107 T. lonqibrachiatum GC69 spores (the ~vr4~ derivative strain). The flask was then incubated at 37C with shaking for about 16 hours. The mycelium was harvested by centrifugation at 2,750 x g. The harvested mycelium was further washed in a 1.2 M sorbitol solution and resuspended in 40 ml of a solution containing 5 mg/ml NovozymR
234 solution (which is the trade name for a multicomponent enzyme system containing 1,3-alpha-glucanase, 1,3-beta-glucanase, laminarinase, xylanase, chitinase and protease from Novo Biolabs, Danbury, CT); 5 mg/ml MgS0~.7H20; 0.5 mg/ml bovine serum albumin; 1.2 M sorbitol. The protoplasts were removed from the cellular debris by filtration through Miracloth (Calbiochem Corp, La Jolla, California) and collected by centrifugation at 2,000 x g. The protoplasts were washed three times in 1.2 M sorbitol and once in 1.2 M sorbitol, 50 mM
CaCl2, centrifuged and resuspended at a density of approximately 2 x lOg protoplasts per ml of 1.2 M
sorbitol, 50 mM CaCl2.
W094/07983 ~ 2 ~ 4 58 7 3 PCT/US93/08735 Tr~nsformation of Fungal Protoplasts with ~ACR~TDYr4 200 ~l of the protoplast suspension prepared in Example 3 was added to 20 ~l of EcoRI digested pACR~TEyE~ (prepared in Example 2) in TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA) and 50 ~l of a polyethylene glycol (PEG) solution containing 25% PEG
4000, 0.6 M KCl and 50 mM CaCl~. This mixture was incubated on ice for 20 minutes. After this incubation period 2.0 ml of the above-identified PEG
solution was added thereto, the solution was further mixed and incubated at room temperature for 5 minutes. After this second incubation, 4.0 ml of a solution containing 1.2 M sorbitol and 50 mM CaCl2 was added thereto and this solution was further mixed. The protoplast solution was then immediately added to molten aliquots of Vogel's Medium N (3 grams sodium citrate, 5 grams KH~PO" 2 grams NH4No3, 0.2 grams MgSO4.7H2O, 0.1 gram CaCl2.2H2O, 5 ~g ~-biotin, 5 mg citric acid, 5 mg ZnS0~.7H2O, 1 mg Fe(NH4)2.6H20, 0.25 mg CuS04.5H20, 50 ~g MnS0~.4H20 per liter) containing an additional 1% glucose, 1.2 M sorbitol and 1% agarose. The protoplast/medium mixture was then poured onto a solid medium containing the same Vogel's medium as stated above. No uridine was present in the medium and therefore only transformed colonies were able to grow as a result of complementation of the ~vr4 mutation of strain GC69 by the wild type ~YE~ gene insert in p~CBHIEyE~.
These colonies were subsequently transferred and purified on a solid Vogel's medium N containing as an .
2 ~ 32 -additive, 1% glucose and stable transformants were chosen for further analysis.
At this stage stable transformants were distinguished from unstable transformants by their faster growth rate and formation of circular colonies with a smooth, rather than ragged outline on solid culture medium lacking uridine. In some cases a further test of stability was made by growing the transformants on solid non-selective medium (i.e.
containing uridine), harvesting spores from this medium and determining the percentage of these spores which will subsequently germinate and grow on selective medium lacking uridine.
Analysis of the Transformants DNA was isolated from the transformants obtained in Example 4 after they were grown in liquid Vogel's medium N containing 1~ glucose. These transformant DNA samples were further cut with a PstI restriction enzyme and subjected to agarose gel electrophoresis.
The gel was then blotted onto a Nytran membrane filter and hybridized with a 32p labelled rArR~T~vr4 probe. The probe was selected to identify the native cbhl gene as a 6.5 kb PstI fragment, the native EYE~
gene and any DNA sequences derived from the transforming DNA fragment.
The radioactive bands from the hybridization were visualized by autoradiography. The autoradiograph is seen in FIG. 3. Five samples were run as described above, hence samples A, B, C, D, and W094/079~3 2145873 PCT/US93/08735 .
E. Lane E is the untransformed strain GC69 and was used as a control in the present analysis. Lanes A-D
represent transformants obtained by the methods described above. The numbers on the side of the autoradiograph represent the sizes of molecular weight markers. As can be seen from this autoradiograph, lane D does not contain the 6.5 kb CBHI band, indicating that this gene has been totally deleted in the transformant by integration of the DNA
fragment at the cbhl gene. The cbhl deleted strain is called P37PaCBHI. Figure 2 outlines the deletion of the T. lonqibrachiatum cbhl gene by integration through a double cross-over event of the larger EcoRI
fragment from paCBHI~vr4 at the cbhl locus on one of the T. lonqibrachiatum chromosomes. The other transformants analyzed appear identical to the untransformed control strain.
Analysis of the Transformants with pIntC8HI
The same procedure was used in this example as in Example 5, except that the probe used was changed to a 32p labelled pIntCBHI probe. This probe is a pUC-type plasmid containing a 2 kb BalII fragment from the cbhl locus within the region that was deleted in pUC4K::cbhlaH/H. Two samples were run in this example including a control, sample A, which is the untransformed strain GC69 and the transformant P37PACR~T, sample B. As can be seen in FIG. 4, sample A contained the cbhl gene, as indicated by the band at 6.5 kb; however the transformant, sample B, W O 94/07983 PC~r/US93/08735 ~sg~3 34 _ does not contain this 6.5 kb band and therefore does not contain the cbhl gene and does not contain any sequences derived from the pUC plasmid.
Protein Secretion by Strain P37PACBHI
Spores from the produced P37P~CBHI strain were inoculated into 50 ml of a Trichoderma basal medium containing 1% glucose, 0.14% (NH4)2S04, 0.2% KH2P04, 0.03% MgS04, 0.03% urea, 0.75% bactotryptone, 0.05%
Tween 80, 0.000016% CuS04.5H~0, 0.001% FeSO4.7H20, 0.000128% ZnS04.7H20, 0.0000054% Na2MoO4.2H2O, 0.0000007% MnCl.4H20. The medium was incubated with shaking in a 250 ml flask at 37C for about 48 hours.
The resulting mycelium was collected by filtering through Miracloth (Calbiochem Corp.) and washed two or three times with 17 mM potassium phosphate. The mycelium was finally suspended in 17 mM potassium phosphate with 1 mM sophorose and further incubated for 24 hours at 30C with shaking. The supernatant was then collected from these cultures and the mycelium was discarded. Samples of the culture supernatant were analyzed by isoelectric focusing using a Pharmacia Phastgel system and pH 3-9 precast gels according to the manufacturer's instructions.
The gel was stained with silver stain to visualize the protein bands. The band corresponding to the cbhl protein was absent from the sample derived from the strain P37P~CBHI, as shown in FIG. 5. This isoelectric focusing gel shows various proteins in different supernatant cultures of T. lonqibrachiatum.
~ 21qS873 Lane A is partially purified CBHI; Lane B is the supernatant from an untransformed T. lonqibrachiatum culture; Lane C is the supernatant from strain P37PaCBHI produced according to the methods of the present invention. The position of various cellulase components are labelled CBHI, CBHII, EGI, EGII, and EGIII. Since CBHI constitutes 50% of the total extracellular protein, it is the major secreted protein and hence is the darkest band on the gel.
This isoelectric focusing gel clearly shows depletion of the CBHI protein in the P37PACBHI strain.
Preparation of pP~CBHII
The cbh2 gene of T. lonqibrachiatum, encoding the CBHII protein, has been cloned as a 4.1 kb EcoRI
fragment of genomic DNA which is shown diagrammatically in FIG. 6A (Chen et al., 1987, BiotechnoloqY, 5:274-278). This 4.1 kb fragment was inserted between the EcoRI sites of pUC4XL. The latter plasmid is a pUC derivative (constructed by R.M. Berka, Genencor International, Inc.) which contains a multiple cloning site with a symmetrical pattern of restriction endonuclease sites arranged in the order shown here: EcoRI, BamHI, SacI, SmaI, HindIII, XhoI, BqlII, ClaI, BqlII, XhoI, HindIII, SmaI, SacI, BamHI, EcoRI. Using methods known in the art, a plasmid, pP~CBHII (FIG. 6B), has been constructed in which a 1.7 kb central region of this gene between a HindIII site (at 74 bp 3' of the CBHII
translation initiation site) and a ClaI site (at 265 bp 3' of the last codon of CBHII) has been removed W O 94/07983 PC~r/US93/08735 .
2~S~73 - 36 -and replaced by a 1.6 kb HindIII- ClaI DNA fragment containing the T. lonqibrachiatum pvr4 gene.
The T. lonqi~rachiatum ~vr4 gene was excised from pTpyr2 (see Example 2) on a 1.6 kb NheI-SPhI
fragment and inserted between the SphI and XbaI sites of pUC219 to create p219M (Smith et al., 1991, Curr.
Çenet 19 p. 27-33). The vector pUC219 is derived from pUCll9 (described by Wilson et al. (1984) Gene 77:69-78) by expanding the multiple cloning site to include restriction sites for BqlII, ClaII and XhoI.
The ~vr4 gene was removed from p219M as a HindIII-ClaI fragment having seven bp of DNA at one end and six bp of DNA at the other end derived from the pUC219 multiple cloning site and inserted into the HindIII and ClaI sites of the cbh2 gene to form the plasmid pPQCBHII (see FIG. 6B).
Digestion of this plasmid with EcoRI will liberate a fragment having 0.7 kb of flanking DNA
from the cbh2 locus at one end, 1.7 kb of flanking DNA from the cbh2 locus at the other end and the T.
lonqibrachiatum EYE~ gene in the middle.
EXAMPLE g Generation of a pyr4 Derivative of p37pAcBHI
Spores of the transformant (P37P~CBHI) which was deleted for the cbhl gene were spread onto medium containing FOA. A pyr4 derivative of this transformant was subsequently obtained using the methods of Example 1. This pyr4~ strain was designated P37P~CBHIPyr~26. Southern analysis has shown that a spontaneous deletion had occurred when W094/07983 2 14 5 ~ 7~ PCT/US93/08735 strain P37P~CBHIPyr-26 was selected. This deletion completely removed the Pvr4 gene which had integrated at the cbhl locus beyond the extent of the 6.5 kb PstI fragment of genomic DNA which was originally cloned.
EXAMPLE 1o Deletion of the cbh2 gene in a strain previously deleted for cbhl Protoplasts of strain P37P~CBHIPyr-26 were generated and transformed with EcoRI digested pPAcBHII according to the methods outlined in Examples 3 and 4.
Purified stable transformants were cultured in shaker flasks as in Example 7 and the protein in the culture supernatants was examined by isoelectric focusing. One transformant (designated P37P~CBH67) was identified which did not produce any CBHII (nor CBH I) protein. Lane D of FIG. 5 shows the supernatant from a transformant deleted for both the cbhl and cbh2 genes produced according to the methods of the present invention.
DNA was extracted from strain P37P~CBH67, digested with EcoRI and AsP718, and subjected to agarose gel electrophoresis. The DNA from this gel was blotted to a membrane filter and hybridized with 32p labelled pP~CBHII (FIG. 7). Lane A of FIG. 7 shows the hybridization pattern observed for DNA from an untransformed _. lonqibrachiatum strain. The 4.1 kb EcoRI fragment containing the wild-type cbh2 gene was observed. Lane B shows the hybridization pattern ~ 38 -observed for strain P37P~ACBH67. The single 4.1 kb band has been eliminated and replaced by two bands of approximately 0.9 and 3.1 kb. This is the expected pattern if a single copy of the EcoRI fragment from pP~CBHII had integrated precisely at the cbh2 locus.
The same DNA samples were also digested with EçoRI and Southern blot analysis was performed as above. In this Example, the probe was 32p labelled pIntCBHII. This plasmid contains a portion of the cbh2 gene coding sequence from within that segment of the cbh2 gene which was deleted in plasmid pP~CBHII.
No hybridization was seen with DNA from strain P37PAACBH67 showing that the cbh2 gene was deleted and that no sequences derived from the pUC plasmid were present in this strain.
Selection of a pyr4 null mutant of strain P37P~CBH67 Spores of the transformant (P37PAACBH67) which was deleted for both the cbhl and cbh2 genes were spread onto medium containing FOA. A Pyr4 deficient derivative of this transformant was subsequently obtained using the methods described in Example 1.
This EYE~ deficient strain was designated P37P~ACBH67Pyr-l. Southern analysis has shown that a spontaneous deletion had occurred when strain P37P~ACR~67Pyr-1 was selected. This deletion completely removed the ~yr4 gene which had integrated at the c~h2 locus beyond the extent of the 4.1 k~
EcoRI fragment of genomic DNA which was originally .
cloned. The short (6 bp and 7 bp) fragments of DNA
derived from the pUC21g multiple cloning site which were present at either end of the ~yr4 gene would also have been removed from the genome by this deletion.
Construction of pEGIpyr4 The T. lonqibrachiatum eqll gene, which encodes EGI, has been cloned as a 4.2 kb HindIII fragment of lo genomic DNA from strain RL-P37 by hybridization with oligonucleotides synthesized according to the published sequence (Penttila et al., 1986, Gene 45:253-263; van Arsdell et al., 1987, Bio/Technoloqy
Preparation of CBHI Deletion Vector A cbhl gene encoding the CBHI protein was cloned from the genomic DNA of T. lonqibrachiatum strain RL-P37 by hybridization with an oligonucleotide probe designed on the basis of the published sequence for this gene using known probe synthesis methods (Shoemaker et al., 1983b). The cbhl gene resides on a 6.5 kb PstI fragment and was inserted into PstI cut pUC4K (purchased from Pharmacia Inc., Piscataway, New W094/07983 ~ 14 5 ~ ?3 PCT/US93/0873~
o Jersey) replacing the Kanr gene of this vector using techni~ues known in the art, which techniques are set forth in Sambrook et al. (1989) MOLECULA~ CLONING A
LABORATO~Y MANUAL, Cold Spring Harbor Press, and incorporated herein by reference. The resulting plasmid, pUC4K::cbhl was then cut with HindIII and the larger fragment of about 6 kb was isolated and religated to give pUC4K::cbhl~H/H (see FIG. 1). This procedure removes the entire cbhl coding sequence and approximately 1.2 kb upstream and 1.5 kb downstream of flanking sequences. Approximately, 1 kb of flanking DNA from either end of the original PstI
fragment remains.
The T. lonqibrachiatum EYE~ gene was cloned as a 6.5 kb HindIII fragment of genomic DNA in pUC18 to form pTpyr2 (Smith et al., 1991) following the methods of Sambrook et al., supra. The plasmid pUC4K::cbhI H/H was cut with HindIII and the ends were dephosphorylated with calf intestinal alkaline phosphatase. This end dephosphorylated DNA was ligated with the 6.5 kb HindIII fragment containing the T. lonqibrachiatum ~yr4 gene to give p~CBHIEyE~.
FIG. 1 illustrates the construction of this plasmid.
Digestion of pAcBHIEyE~ with EcoRI liberated a larger fragment which consisted of flanking regions of the cbhl locus at either end with the EYE~ gene replacing the cbhl coding sequence in the center.
The only DNA on this fragment which was not derived from T. lonqibrachiatum was a 21 bp fragment derived from the multiple cloning site of pUC4K.
W O 94/07983 PC~r/US93/0~735 .
EXP~MPLE 3 .
Isolation of Protoplasts Mycelium was obtained by inoculating 100 ml of YEG (0.5% yeast extract, 2% glucose) in a 500 ml flask with about 5 x 107 T. lonqibrachiatum GC69 spores (the ~vr4~ derivative strain). The flask was then incubated at 37C with shaking for about 16 hours. The mycelium was harvested by centrifugation at 2,750 x g. The harvested mycelium was further washed in a 1.2 M sorbitol solution and resuspended in 40 ml of a solution containing 5 mg/ml NovozymR
234 solution (which is the trade name for a multicomponent enzyme system containing 1,3-alpha-glucanase, 1,3-beta-glucanase, laminarinase, xylanase, chitinase and protease from Novo Biolabs, Danbury, CT); 5 mg/ml MgS0~.7H20; 0.5 mg/ml bovine serum albumin; 1.2 M sorbitol. The protoplasts were removed from the cellular debris by filtration through Miracloth (Calbiochem Corp, La Jolla, California) and collected by centrifugation at 2,000 x g. The protoplasts were washed three times in 1.2 M sorbitol and once in 1.2 M sorbitol, 50 mM
CaCl2, centrifuged and resuspended at a density of approximately 2 x lOg protoplasts per ml of 1.2 M
sorbitol, 50 mM CaCl2.
W094/07983 ~ 2 ~ 4 58 7 3 PCT/US93/08735 Tr~nsformation of Fungal Protoplasts with ~ACR~TDYr4 200 ~l of the protoplast suspension prepared in Example 3 was added to 20 ~l of EcoRI digested pACR~TEyE~ (prepared in Example 2) in TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA) and 50 ~l of a polyethylene glycol (PEG) solution containing 25% PEG
4000, 0.6 M KCl and 50 mM CaCl~. This mixture was incubated on ice for 20 minutes. After this incubation period 2.0 ml of the above-identified PEG
solution was added thereto, the solution was further mixed and incubated at room temperature for 5 minutes. After this second incubation, 4.0 ml of a solution containing 1.2 M sorbitol and 50 mM CaCl2 was added thereto and this solution was further mixed. The protoplast solution was then immediately added to molten aliquots of Vogel's Medium N (3 grams sodium citrate, 5 grams KH~PO" 2 grams NH4No3, 0.2 grams MgSO4.7H2O, 0.1 gram CaCl2.2H2O, 5 ~g ~-biotin, 5 mg citric acid, 5 mg ZnS0~.7H2O, 1 mg Fe(NH4)2.6H20, 0.25 mg CuS04.5H20, 50 ~g MnS0~.4H20 per liter) containing an additional 1% glucose, 1.2 M sorbitol and 1% agarose. The protoplast/medium mixture was then poured onto a solid medium containing the same Vogel's medium as stated above. No uridine was present in the medium and therefore only transformed colonies were able to grow as a result of complementation of the ~vr4 mutation of strain GC69 by the wild type ~YE~ gene insert in p~CBHIEyE~.
These colonies were subsequently transferred and purified on a solid Vogel's medium N containing as an .
2 ~ 32 -additive, 1% glucose and stable transformants were chosen for further analysis.
At this stage stable transformants were distinguished from unstable transformants by their faster growth rate and formation of circular colonies with a smooth, rather than ragged outline on solid culture medium lacking uridine. In some cases a further test of stability was made by growing the transformants on solid non-selective medium (i.e.
containing uridine), harvesting spores from this medium and determining the percentage of these spores which will subsequently germinate and grow on selective medium lacking uridine.
Analysis of the Transformants DNA was isolated from the transformants obtained in Example 4 after they were grown in liquid Vogel's medium N containing 1~ glucose. These transformant DNA samples were further cut with a PstI restriction enzyme and subjected to agarose gel electrophoresis.
The gel was then blotted onto a Nytran membrane filter and hybridized with a 32p labelled rArR~T~vr4 probe. The probe was selected to identify the native cbhl gene as a 6.5 kb PstI fragment, the native EYE~
gene and any DNA sequences derived from the transforming DNA fragment.
The radioactive bands from the hybridization were visualized by autoradiography. The autoradiograph is seen in FIG. 3. Five samples were run as described above, hence samples A, B, C, D, and W094/079~3 2145873 PCT/US93/08735 .
E. Lane E is the untransformed strain GC69 and was used as a control in the present analysis. Lanes A-D
represent transformants obtained by the methods described above. The numbers on the side of the autoradiograph represent the sizes of molecular weight markers. As can be seen from this autoradiograph, lane D does not contain the 6.5 kb CBHI band, indicating that this gene has been totally deleted in the transformant by integration of the DNA
fragment at the cbhl gene. The cbhl deleted strain is called P37PaCBHI. Figure 2 outlines the deletion of the T. lonqibrachiatum cbhl gene by integration through a double cross-over event of the larger EcoRI
fragment from paCBHI~vr4 at the cbhl locus on one of the T. lonqibrachiatum chromosomes. The other transformants analyzed appear identical to the untransformed control strain.
Analysis of the Transformants with pIntC8HI
The same procedure was used in this example as in Example 5, except that the probe used was changed to a 32p labelled pIntCBHI probe. This probe is a pUC-type plasmid containing a 2 kb BalII fragment from the cbhl locus within the region that was deleted in pUC4K::cbhlaH/H. Two samples were run in this example including a control, sample A, which is the untransformed strain GC69 and the transformant P37PACR~T, sample B. As can be seen in FIG. 4, sample A contained the cbhl gene, as indicated by the band at 6.5 kb; however the transformant, sample B, W O 94/07983 PC~r/US93/08735 ~sg~3 34 _ does not contain this 6.5 kb band and therefore does not contain the cbhl gene and does not contain any sequences derived from the pUC plasmid.
Protein Secretion by Strain P37PACBHI
Spores from the produced P37P~CBHI strain were inoculated into 50 ml of a Trichoderma basal medium containing 1% glucose, 0.14% (NH4)2S04, 0.2% KH2P04, 0.03% MgS04, 0.03% urea, 0.75% bactotryptone, 0.05%
Tween 80, 0.000016% CuS04.5H~0, 0.001% FeSO4.7H20, 0.000128% ZnS04.7H20, 0.0000054% Na2MoO4.2H2O, 0.0000007% MnCl.4H20. The medium was incubated with shaking in a 250 ml flask at 37C for about 48 hours.
The resulting mycelium was collected by filtering through Miracloth (Calbiochem Corp.) and washed two or three times with 17 mM potassium phosphate. The mycelium was finally suspended in 17 mM potassium phosphate with 1 mM sophorose and further incubated for 24 hours at 30C with shaking. The supernatant was then collected from these cultures and the mycelium was discarded. Samples of the culture supernatant were analyzed by isoelectric focusing using a Pharmacia Phastgel system and pH 3-9 precast gels according to the manufacturer's instructions.
The gel was stained with silver stain to visualize the protein bands. The band corresponding to the cbhl protein was absent from the sample derived from the strain P37P~CBHI, as shown in FIG. 5. This isoelectric focusing gel shows various proteins in different supernatant cultures of T. lonqibrachiatum.
~ 21qS873 Lane A is partially purified CBHI; Lane B is the supernatant from an untransformed T. lonqibrachiatum culture; Lane C is the supernatant from strain P37PaCBHI produced according to the methods of the present invention. The position of various cellulase components are labelled CBHI, CBHII, EGI, EGII, and EGIII. Since CBHI constitutes 50% of the total extracellular protein, it is the major secreted protein and hence is the darkest band on the gel.
This isoelectric focusing gel clearly shows depletion of the CBHI protein in the P37PACBHI strain.
Preparation of pP~CBHII
The cbh2 gene of T. lonqibrachiatum, encoding the CBHII protein, has been cloned as a 4.1 kb EcoRI
fragment of genomic DNA which is shown diagrammatically in FIG. 6A (Chen et al., 1987, BiotechnoloqY, 5:274-278). This 4.1 kb fragment was inserted between the EcoRI sites of pUC4XL. The latter plasmid is a pUC derivative (constructed by R.M. Berka, Genencor International, Inc.) which contains a multiple cloning site with a symmetrical pattern of restriction endonuclease sites arranged in the order shown here: EcoRI, BamHI, SacI, SmaI, HindIII, XhoI, BqlII, ClaI, BqlII, XhoI, HindIII, SmaI, SacI, BamHI, EcoRI. Using methods known in the art, a plasmid, pP~CBHII (FIG. 6B), has been constructed in which a 1.7 kb central region of this gene between a HindIII site (at 74 bp 3' of the CBHII
translation initiation site) and a ClaI site (at 265 bp 3' of the last codon of CBHII) has been removed W O 94/07983 PC~r/US93/08735 .
2~S~73 - 36 -and replaced by a 1.6 kb HindIII- ClaI DNA fragment containing the T. lonqibrachiatum pvr4 gene.
The T. lonqi~rachiatum ~vr4 gene was excised from pTpyr2 (see Example 2) on a 1.6 kb NheI-SPhI
fragment and inserted between the SphI and XbaI sites of pUC219 to create p219M (Smith et al., 1991, Curr.
Çenet 19 p. 27-33). The vector pUC219 is derived from pUCll9 (described by Wilson et al. (1984) Gene 77:69-78) by expanding the multiple cloning site to include restriction sites for BqlII, ClaII and XhoI.
The ~vr4 gene was removed from p219M as a HindIII-ClaI fragment having seven bp of DNA at one end and six bp of DNA at the other end derived from the pUC219 multiple cloning site and inserted into the HindIII and ClaI sites of the cbh2 gene to form the plasmid pPQCBHII (see FIG. 6B).
Digestion of this plasmid with EcoRI will liberate a fragment having 0.7 kb of flanking DNA
from the cbh2 locus at one end, 1.7 kb of flanking DNA from the cbh2 locus at the other end and the T.
lonqibrachiatum EYE~ gene in the middle.
EXAMPLE g Generation of a pyr4 Derivative of p37pAcBHI
Spores of the transformant (P37P~CBHI) which was deleted for the cbhl gene were spread onto medium containing FOA. A pyr4 derivative of this transformant was subsequently obtained using the methods of Example 1. This pyr4~ strain was designated P37P~CBHIPyr~26. Southern analysis has shown that a spontaneous deletion had occurred when W094/07983 2 14 5 ~ 7~ PCT/US93/08735 strain P37P~CBHIPyr-26 was selected. This deletion completely removed the Pvr4 gene which had integrated at the cbhl locus beyond the extent of the 6.5 kb PstI fragment of genomic DNA which was originally cloned.
EXAMPLE 1o Deletion of the cbh2 gene in a strain previously deleted for cbhl Protoplasts of strain P37P~CBHIPyr-26 were generated and transformed with EcoRI digested pPAcBHII according to the methods outlined in Examples 3 and 4.
Purified stable transformants were cultured in shaker flasks as in Example 7 and the protein in the culture supernatants was examined by isoelectric focusing. One transformant (designated P37P~CBH67) was identified which did not produce any CBHII (nor CBH I) protein. Lane D of FIG. 5 shows the supernatant from a transformant deleted for both the cbhl and cbh2 genes produced according to the methods of the present invention.
DNA was extracted from strain P37P~CBH67, digested with EcoRI and AsP718, and subjected to agarose gel electrophoresis. The DNA from this gel was blotted to a membrane filter and hybridized with 32p labelled pP~CBHII (FIG. 7). Lane A of FIG. 7 shows the hybridization pattern observed for DNA from an untransformed _. lonqibrachiatum strain. The 4.1 kb EcoRI fragment containing the wild-type cbh2 gene was observed. Lane B shows the hybridization pattern ~ 38 -observed for strain P37P~ACBH67. The single 4.1 kb band has been eliminated and replaced by two bands of approximately 0.9 and 3.1 kb. This is the expected pattern if a single copy of the EcoRI fragment from pP~CBHII had integrated precisely at the cbh2 locus.
The same DNA samples were also digested with EçoRI and Southern blot analysis was performed as above. In this Example, the probe was 32p labelled pIntCBHII. This plasmid contains a portion of the cbh2 gene coding sequence from within that segment of the cbh2 gene which was deleted in plasmid pP~CBHII.
No hybridization was seen with DNA from strain P37PAACBH67 showing that the cbh2 gene was deleted and that no sequences derived from the pUC plasmid were present in this strain.
Selection of a pyr4 null mutant of strain P37P~CBH67 Spores of the transformant (P37PAACBH67) which was deleted for both the cbhl and cbh2 genes were spread onto medium containing FOA. A Pyr4 deficient derivative of this transformant was subsequently obtained using the methods described in Example 1.
This EYE~ deficient strain was designated P37P~ACBH67Pyr-l. Southern analysis has shown that a spontaneous deletion had occurred when strain P37P~ACR~67Pyr-1 was selected. This deletion completely removed the ~yr4 gene which had integrated at the c~h2 locus beyond the extent of the 4.1 k~
EcoRI fragment of genomic DNA which was originally .
cloned. The short (6 bp and 7 bp) fragments of DNA
derived from the pUC21g multiple cloning site which were present at either end of the ~yr4 gene would also have been removed from the genome by this deletion.
Construction of pEGIpyr4 The T. lonqibrachiatum eqll gene, which encodes EGI, has been cloned as a 4.2 kb HindIII fragment of lo genomic DNA from strain RL-P37 by hybridization with oligonucleotides synthesized according to the published sequence (Penttila et al., 1986, Gene 45:253-263; van Arsdell et al., 1987, Bio/Technoloqy
5:60-64). A 3.6 kb HindIII-BamHI fragment was taken from this clone and ligated with a 1.6 kb HindIII-BamHI fragment containing the T. longibrachiatum pyr4 gene obtained from pTpyr2 (see Example 2) and pUC218 (identical to pUC219, see Example 8, but with the multiple cloning site in the opposite orientation) cut with ~ndIII to give the plasmid pEGI~y~ by standard molecular techniques as outlined in Sambrook et al. (1989), supra (FIG. 8). Digestion of pEGI~Yr4 with HindIII would liberate a fragment of DNA
containing only T. lonqibrachiatum genomic DNA (the eall and EYE~ genes) except for 24 bp of sequenced, synthetic DNA between the two genes and 6 bp of sequenced, synthetic DNA at one end (see FIG. 8).
Both these pieces of synthetic DNA were obtained from the multiple cloning site of pUC-type ~ectors.
W O 94~07983 PC~r/US93/08735 ~ 3 40 -Construction of the EGI expression vector pTEX-EGl The plasmid, pTEX-EGI was constructed following the methods of Sambrook et al. (1989), supra, and is illustrated in FIG. 9. This plasmid has been designed as a multi-purpose expression vector for use in the filamentous fungus Trichoderma reesei. The expression cassette has several unique features that make it useful for this function. Transcription is regulated using the strong CBHI gene promoter and terminator sequences for T. reesei. Between the CBHI
promoter and terminator there are unique PmeI and Sst I restriction sites that are ,used to insert the gene to be expressed. The T. reesei ~YE~ selectable marker gene has been inserted into the CBHI
terminator and the whole expression cassette (CBHI
promoter-insertion sites-CBHI terminator-~yr4 gene-CBHI terminator) can be excised utilizing the unique NotI restriction site or the unique NotI and NheI
restriction sites.
This vector is based on the bacterial vector, pSL1180 (Pharmacia Inc., Piscataway, New Jersey), which is a pUC-type vector with an extended multiple cloning site. pTEX was digested with SstII and PmeI
and then ligated with a synthetic DNA linker designed to join the cbhl promoter with the eall coding sequence and with an approximately 2 kb SfiI - Sc~I
fragment of T. lonqibrachiatum DNA containing most of the,eall coding sequence and the terminator region.
This ligation produced the vector pTEX-EGI. This vector was digested with NotI and NheI to release the W094/07983 2 1 4 ~ 8 7 3 PCT/US93/og735 expression cassette which comprised the following components:
a) 11 bp of linker DNA derived from the multiple cloning site of pSL1180.
b) An approximately 2.2 kb PstI-SstII fragment of T. lonqibrachiatum DNA from the promoter region of the cbhl gene. The SstII site is at a position 15 bp 5' of the translation initiation codon (ATG).
c) A synthetic DNA linker used to join the cbhl promoter with the eall coding sequence, having single-stranded overhanging ends compatible with SstII and SfiI digested DNA, and having the following sequence:
***
5' GGACTGGCATCATGGCGCCCTCA~TTACACTGCCGTTGACCACGGCCATCC 3' 3' CGCCTGACCGTAGTACCGCGGGAGTCAATGTGACGGCAACTGGTGCCGGT 5' tSEQ ID NO: 4) The asterisks mark the translation initiation codon (ATG) of the eqll gene coding region. The DNA sequence 5~ to the ATG codon is exactly the same as that found in this region of the cbhl gene. The DNA sequence 3' of the ATG codon is exactly the same as that found in this region of the eqll gene.
d) An approximately 2 kb SfiI-ScaI fragment of T. lonqibrachiatum DNA containing the eqll coding sequence, starting at an SfiI site 30 bp after the first ATG codon, and approximately 300 bp of 3' flanking DNA containing the transcription termination and polyadenylation signals.
e) An approximately 1 kb SmaI-~qlII fragment of T. lonqibrachiatum DNA from the 3' flanking region of the cbhl gene with a PmeI restriction site added adjacent to the SmaI site using the syhthetic linker DNA shown in FIG. 9 (SEQ ID NO:1).
.
f) The T. lonqibrachiatum pvr4 gene on a 1.6 kb ~glII fragment which has 13 bp on one end and 17 bp on the other end of synthetic linker DNA. Both linkers were derived from the multiple cloning site of the pUC219 vector. The latter synthetic linker was additionally modified by insertion of a ~g~II
site at the HindIII site using the linker shown in FIG. 9 (SEQ ID NO:3). Oligonucleotide directed mutagenesis (Sambrook et al. (1989) Molecular Cloning a Laboratory Manual, Cold Spring Harbor Press) was used to change a single nucleotide within the EYE~
coding region (SEQ ID NO:2 of FIG. 9). The third nucleotide of the codon coding for the arginine residue at amino acid position 251 of the protein was changed from a C nucleotide to an A nucleotide by this method. This alteration would not change the amino acid sequence of the orotidine 5' monophosphate decarboxylase produced but destroyed an SstII site in the DNA sequence and thus facilitated construction of the plasmid.
g) An approximately 0.5 kb BqlII-NheI fragment of T. lonqibrachiatum DNA from the 3' flanking region of the cbhl gene.
It would be possible to construct plasmids similar to pTEX-EGI but with any other T.
lon~ibrachiatum gene replacing the eall gene. In this way, over-expression of other genes and simultaneous deletion of the cbhl gene could be achieved.
Construction of EG I over-expression strains The linear fragment of DNA containing the eall and EYE~ genes released from pEGIPvr4 by digestion with HindIII, was purified from an agarose gel.
Similarly, the linear fragment of DNA containing the ~311, EYE~ genes and flanking regions of the cbhl gene was purified from pTEX-EGI after digestion with NotI and NheI. These fragments of DNA were used in separate experiments to transform T. lonqibrachiatum strain P37P~CBH67Pyr-1 by the method of Examples 3 and 4. Several transformants were obtained with each DNA fragment which transformants produced elevated levels of EGI compared to the parent strain. Total DNA was isolated from these transformants, digested with PstI, subjected to agarose gel electrophoresis and blotted to a membrane filter. Southern blot analysis using radiolabelled pUCEGI (a pUC plasmid containing the eqll gene on a 4.2 kb HindIII fragment of genomic DNA) showed that each transformant contained multiple copies of the eqll gene integrated at sites within the genome which could not be determined.
Similar Southern analysis was also performed using a pUC vector as a probe. This analysis revealed that the pUC plasmid fragment of either pEGI~vr4 or pTEX-EGI had not been incorporated by any of these strains.
Transformants of strain P37P~CB~67Pyr~1 obtained with either pEGIPvr4 or pTEX-EGI as described above were inoculated into 50 ml shake flask cultures in order to determine the amount of secreted endoglucanase produced. The liquid medium ~ 44 -used for these experiments had the following composition: alpha-lactose, 30 g/l; (NH4)~SO4, 6.5 g/l; KH2PO4, 2.0 g/l; MgSO4.7H70, 0.3 g/l; CaCl2, 0.2 g/l; lOOOx trace salt solution, 1.0 ml/l; 10 % Tween 80, 2.0 ml/l; Proflo, 22.5 g/l; CaC03, 0.72g/1.
Source for Tween 80 and Proflo. The lOOOx trace salt solution had the following composition: FeSO4.7H2O, 5.0 g/l; MnSO4.H2O, 1.6 g/l; ZnSO~, 1.4 g/l. These shake flask cultures were incubated with shaking for seven days at 30C. Samples of the supernatant were taken from these cultures and assays designed to measure the endoglucanase activity were performed as described below.
The endoglucanase assay relied on the release of soluble, dyed oligosaccharides from Remazol Brilliant Blue-carboxymethylcellulose (RBB-CMC, obtained from MegaZyme, North Rocks, NSW, Australia). The substrate was prepared by adding 2 g of dry RBB-CMC
to 80 ml of just boiled deionized water with vigorous stirring. When cooled to room temperature, 5 ml of 2 M sodium acetate buffer (pH 4.8) was added and the pH
adjusted to 4.5. The volume was finally adjusted to 100 ml with deionized water and sodium azide added to a final concentration of 0.02~. Aliquots of T.
lonqibrachiatum control culture, pEGI~yE~ or pTEX-EGI
transformant culture supernatants or 0.1 M sodium acetate as a blank (10-20 ~1) were placed in tubes, 250 ~1 of substrate was added and the tubes were incubated for 30 minutes at 37C. The tubes were placed on ice for 10 minutes and 1 ml of cold precipitant (3.3% sodium acetate, 0.4% zinc acetate, pH 5 with HCl, 76% ethanol) was then added. The tubes were vortexed and allowed to sit-for five minutes before centrifuging for three minutes at W094/07983 ~ 2 1 9 5 8 7 3 PCT/US93/08735 approximately 13,000 x g. The optical density was measured spectrophotometrically at a wavelength of 590-600 nm.
The results of the endoglucanase assay performed on triplicate cultures of 5 different transformants obtained with pEGIEyE~ DNA and on cultures of the parental strain P37PA~CBH67 are given in Table 1 below. It is apparent that the transformants produced significantly more secreted endoglucanase activity compared to the parental strain described above, are shown in Table l.
Secreted Endoglucanase Activity of T . longibrachia tum Transformants T~ANSFORMANT RBB-CMC U~ITS/ML
P37 EPl 5.7 14.3 14.1 11.4 P37 EP8 11.0 3.8 6.1 7.0 P37 EP9 3.4 11.5 14.9 9.9 P37 EP10 7.0 9.1 5.0 7.0 P37 EP11 5.0 5.5 lO.0 6.9 parental P37P~CBH673.0 2.8 5.5 l.l3.1 The above results are presented for the purpose of demonstrating the overproduction of the EGI
component and not for the purpose of demonstrating the extent of overproduction. In this regard, the extent of overproduction is expected to vary with each experiment.
Similar shake flask cultures and endoglucanase assays were performed with transformants obtained ~ ~5~ ~
with pTEX-EGI and those transformants which over-produced endoglucanase activity were identified.
The methods of this example could be used to produce T. lonqibrachiatum strains which would over-produce any of the other EG components.
It would also be possible to transform ~YE~
derivative strains of T. lonqibrachiatum which had previously been deleted for other genes in addition to CBHI and CBHII, eg. for EGII, with pEGI~y~ or pTEX-EGI to construct transformants which would, for example, produce no exocellobiohydrolases or EGII and overexpress EGI.
EX~MPLE 15 Purification of Cytolase 123 Cellulase into Cellulase components CYTOLASE 123 cellulase was fractionated in the following manner. The normal distribution of cellulase components in this cellulase system is as follows:
CBH I45-55 weight percent CBH II13-15 weight percent EG I11-13 weight percent EG II8-10 weight percent EG III1-4 weight percent BG0.5-1 weight percent.
The fractionation was done using columns containing the following resins: Sephadex G-25 gel filtration resin from Sigma Chemical Company (St.
Louis, Mo), QA Trisacryl M anion exchange resin and SP Trisacryl M cation exchange resin from IBF
Biotechnics (Savage, Maryland). CYTOLASE 123 W O 94/07983 PC~r/US93/08735 ~lg5873 cellulase, 0.5g, was desalted using a column of 3 liters of Sephadex G-25 gel filtration resin with 10 mM sodium phosphate buffer at pH 6.8. The desalted solution, was then loaded onto a column of 20 ml of QA Trisacryl M anion exchange resin. The fraction bound on this column contained CBH I and EG I. These components were separated by gradient elution using an aqueous gradient containing from 0 to about 500 mM
sodium chloride. The fraction not bound on this column contained CBH II and EG II. These fractions were desalted using a column of Sephadex G-25 gel filtration resin equilibrated with 10 mM sodium citrate, pH 3.3. This solution, 200 ml, was then loaded onto a column of 20 ml of SP Trisacryl M
cation exchange resin. CBH II and EG II were eluted separately using an aqueous gradient containing from 0 to about 200 mM sodium chloride.
Following procedures similar to that of Example 13 above, other cellulase systems which can be separated into their components include CELLUCAST
(available from Novo Industry, Copenhagen, Denmark), RAPIDASE (available from Gist Brocades, N.V., Delft, Holland), and cellulase systems derived from Trichoderma koninqii, Penicillum sp. and the like.
Purification of EG III from Cytolase 123 Cellulase Example 22 above demonstrated the isolation of several components from Cytolase 123 Cellulase.
However, because EG III is present in very small quantities in Cytolase 123 Cellulase, the following W O 94/07983 PC~r/US93/08735 ~5~
procedures were employed to isolate this component.
See also U.S. Serial No. 07/862,846 filed April 3, 1992 and entitled ~METHODS FOR PRODUCING
SUBSTANTIALLY PURE EG III CELLULASE USING
POLYETHYLENE GLYCOL", which is incorporated herein in its entirety by reference.
A. ~rqe 8cale Extraction of EG III Cellulase EnzYnne one hundred liters of cell free cellulase filtrate were heated to about 30C. The heated material was made about 4~ wt/vol PEG 8000 (polyethylene glycol, MW of about 8000) and about 10 wt/vol anhydrous sodium sulfate. The mixture formed a two phase liquid mixture. The phases were separated using an SA-1 disk stack centrifuge. The phases were analyzed using silver staining isoelectric focusing gels. Separation was obtained for EG III and xylanase. The recovered composition contained about 20 to 50 weight percent of EG III.
Regarding the above procedure, use of a polyethylene glycol having a molecular weight of less than about 8000 gave inadequate separation; whereas, use of polyethylene glycol having a molecular weight of greater than about 8000 resulted in the exclusion of desired enzymes in the recovered composition.
With regard to the amount of sodium sulfate, sodium sulfate levels greater than about 10% wt/vol caused precipitation problems; whereas, sodium sulfate levels less than about 10~ wt/vol gave poor separation or the solution remained in a single phase.
Alternatively, EG III cellulase may be extracted by the method described in U.S. Serial-No. 07/862,641 filed April 3, 1992 which is entitled "METHODS FOR
W O 94/07983 PC~r/US93/08735 PRODUCING SUBSTANTIALLY PURE EG III CELLULASE USING
ALCOHOL," which reference is incorporated herein in its entirety.
B. Purification of EG III Via Fractionation The purification of EG III is conducted by fractionation from a complete fungal cellulase composition (CYTOLASE 123 cellulase, commercially available from Genencor International, South San Francisco, California) which is produced by wild type Trichoderma lonqibrachiatum. Specifically, the fractionation is done using columns containing the following resins: Sephadex G-25 gel filtration resin from Sigma Chemical Company (St. Louis, MIssouri), QA
Trisacryl M anion exchange resin and SP Trisacryl M
cation exchange resin from IBF Biotechnics (Savage, Maryland). CYTOLASE 123 cellulase, 0.5g, is desalted using a column of 3 liters of Sephadex G-25 gel filtration resin with 10 mM sodium phosphate buffer at pH 6.8. The desalted solution, is then loaded onto a column of 20 ml of QA Trisacryl M anion exchange resin. The fraction bound on this column contained CBH I and EG I. The fraction not bound on this column contains CBH II, EG II and EG III. These fractions are desalted using a column of Sephadex G-25 gel filtration resin equilibrated with 10 mM
sodium citrate, pH 4.5. This solution, 200 ml, is then loaded onto a column of 20 ml of SP Trisacryl M
cation exchange resin. The EG III was eluted with 100 mL of an aqueous solution of 200 mM sodium chloride.
In order to enhance the efficiency of the isolation of EG III, it may be desirable to employ Trichoderma longibrachiatum genetically modified so as to be incapable of producing one or more of EG I, EG II, CBH I and/or CBH II. The absence of one or more of such components will necessarily lead to more efficient isolation of EG III.
Likewise, it may be desirable for the EG III
compositions described above to be further purified to provide for substantially pure EG III
compositions, i.e., compositions containing EG III at greater than about 80 weight percent of protein. For example, such a substantially pure EG III protein can be obtained by utilizing material obtained from procedure A in procedure B or vice versa. One particular method for further purifying EG III is by further fractionation of an EG III sample obtained in part b) of this Example 14. The further fraction was done on a FPLC system using a Mono-S-HR 5/5 column (available from Pharmacia LKB Biotechnology, Piscataway, NJ). The FPLC system consists of a liquid chromatography controller, 2 pumps, a dual path monitor, a fraction collector and a chart recorder (all of which are available from Pharmacia LKB Biotechnology, Piscataway, NJ). The fractionation was conducted by desalting 5 ml of the EG III sample prepared in part b) of this Example 14 with a 20 ml Sephadex G-25 column which had been previously equilibrated with 10 mM sodium citrate pH 4. The column was then eluted with 0-200 mM
aqueous gradient of NaCl at a rate of 0.5 ml/minute with samples collected in 1 ml fractions. EG III was recovered in fractions 10 and 11 and was determined to be greater than 90% pure by SDS gel electrophoresis. EG III of this purity is suitable for determining the N-terminal amino acid sequence by known techniques.
W O 94/0~983 ~^ 2 1 A 58 7 3 PC~r/US93/08735 Substantially pure EG III as well as EG I and EG II components purified in Example 16 above can be used singularly or in mixtures in the methods of this invention. These EG components have the following characteristics:
MW PI PH optimum EG I 47-49 kD 4.7 -5 EG II -35 kD s.5 ~5 EG III~25-28 kD 7.4 -5.5-6.0 0 1. pH optimum determined by RBB-CMC activity as per Example 17 below.
Activity of Cellulase Compositions over a pH Range The following procedure was employed to determine the pH profiles of two different cellulase compositions. The first cellulase composition was a CBH I and II deleted cellulase composition prepared from Trichoderma lonaibrachiatum genetically modified in a manner similar to that described above so as to be unable to produce CBH I and CBH II components.
Insofar as this cellulase composition does not contain CBH I and CBH II which generally comprise from about 58 to 70 percent of a cellulase composition derived from Trichoderma lonqibrachiatum, this cellulase composition is necessarily substantially free of CBH I type and CBH II type cellulase components and accordingly, is enriched in EG components, i.e., EG I, EG II, EG III, and the like.
The second cellulase composition was an approximately 20 to 40% pure fraction of EG III
isolated from a cellulase composition derived from Trichoderma lonqibrachiatum via purification methods similar to part b) of Example 16.
The activity of these cellulase compositions was determined at 40C and the determinations were made using the following procedures.
Add 5 to 20 ~l of an appropriate enzyme solution at a concentration sufficient to provide the requisite amount of enzyme in the final solution.
Add 250 ~l of 2 weight percent RBB-CMC (Remazol Brilliant Blue R-Carboxymethylcellulose --commercially available from MegaZyme, 6 Altona Place, North Rocks, N.S.W. 2151, Australia) in 0.05M
citrate/phosphate buffer at pH 4, 5, 5.5, 6, 6.5, 7, 7.5 and 8.
Vortex and incubate at 40C for 30 minutes.
Chill in an ice bath for 5 to 10 minutes. Add 1000 ~l of methyl cellosolve containing 0.3M sodium acetate and 0.02M zinc acetate. Vortex and let sit for 5-10 minutes. Centrifuge and pour supernatant into cuvets. Measure the optical density (OD) of the solution in each cuvet at 590 nm. Higher levels of optical density correspond to higher levels of enzyme activity.
The results of this analysis are set forth in FIG. 10 which illustrates the relative activity of the CBH I and II deleted cellulase composition compared to the EG III cellulase composition. From this figure, it is seen that the cellulase composition deleted in CBH I and CBH II possesses W094/07983 21q 58 73 PCT/US93tO8735 .
optimum cellulolytic activity against RBB-CMC at near pH 5.5 and has some activity at alkaline pHs, i.e., at pHs from above 7 to 8. On the other hand, the cellulase composition enriched in EG III possesses optimum cellulolytic activity at pH 5.5 - 6 and possesses significant activity at alkaline pHs.
From the above example, one skilled in the art would merely need to adjust and maintain the pH of the aqueous textile composition so that the cellulase composition is active and preferably, possesses optimum activity. As noted above, such adjustments and maintenance may involve the use of a suitable buffer.
Stonewashed Appearance This example demonstrates that the presence of CBH type components is not essential for imparting a stonewashed appearance to denim fabrics.
Specifically, this example employs a cellulase composition derived from Trichoderma lonqibrachiatum genetically engineered in the manner described above so as to be incapable of producing any CBH type components (i.e., incapable of producing CBH I and II
components) as well as a complete cellulase composition derived from Trichoderma lonqibrachiatum and which is available as Cytolase 123 cellulase from Genencor International, South San Francisco, California.
These cellulase compositions were tested for their ability to impart a stonewashed appearance to W O 94/07983 ~ 3 PC~r/US93/08735 dyed denim denims pants. Specifically, the samples were prepared using an industrial washer and dryer under the following conditions:
10 mM citrate/phosphate buffer pH 5 40 L total volume Four pair of denim pants 1 hour run time 50 ppm CBH I and II deleted cellulase or 100 ppm whole cellulase (i.e., at approximately equal EG concentrations) Samples were evaluated for their stonewashed appearance, but not the level of redeposition of dye, by 8 panelists. All eight panelists choose 100 ppm whole cellulase over non-enzyme treated pants as having the better stonewashed look. Four of the 8 panelists choose the CBH I and II deleted cellulase treated pants over whole cellulase as having the better stonewashed look; whereas the other four panelists choose the whole cellulase treated pants as having the better stonewashed look. These results indicate that the CBH I and II deleted cellulase treated pants were indistinguishable from whole cellulase treated pants and that CBH I and/or CBH II
are not essential for imparting a stonewashed appearance to denim fabrics.
Reduced Redeposition of dye This example demonstrates that the use of EG
type components substantially free of CBH type components results in a reduced redeposition of dye onto the fabric during stonewashing.
W O 94/07983 2 1 4 5~ 7 3 PC~r/US93/08735 .
Specifically, this example employs the following cellulase compositions:
a) a complete cellulase composition derived from Trichoderma lonqibrachiatum and which is available as Cytolase 123 cellulase from Genencor International, South San Francisco, California.
b) a cellulase composition from Trichoderma lonqibrachiatum genetically engineered in the manner described above so as to be incapable of producing any CBH type components (i.e., incapable of producing CBH I and II components);
c) CBH I purified by the method of Example 15;
d) EG I purified by the method of Example 15;
e) EG II purified by the method of Example 15;
and f) EG III purified by the method of Example 16.
These cellulase compositions were tested for their ability to impart a stonewashed appearance to dyed denim pants and their ability to prevent the redeposition of dye onto the fabric.
Specifically, the samples were prepared using an industrial washer and dryer under the following conditions:
20 mM citrate/phosphate buffer pH 4.9 40 L total volume 3.8 kg of desized indigo dyed denim pants l hour run time at 36 rpms 35 ppm CBH I and II deleted cellulase or 70 ppm whole cellulase or 15-30 ppm of purified EGI, EGII or EGIII
cellulase The garments were rinsed according to a standardized protocol in three consecutive cycles of clean liquor. Rinse #1 -- 24 gallons hot water, ~sa~ 56 -approximately 50C, plus ~100 grams standard detergent WOR (from American Association of Textile Chemists and Colorists [AATCC], WOB - without brighteners). Agitation was for 12 minutes at 36 rpms. The bath was dropped. Rinse #2 -- 24 gallons warm water, -40C, with no additional detergents, agitated for 5 minutes. The bath was dropped. Rinse #3 -- 24 gallons cold water, ~30C, with no additional detergents, agitated for 5 minutes. The bath was dropped. Garments were extracted and dried in a standard electric clothes dryer.
FIG. 11 shows that results obtained with the different cellulase compositions.
The results indicate that EG III gave the least redeposition of dye on the fabric. However, purified EG I, EG II and CBHI/II deleted cellulase also gave a satisfactory stonewashed appearance with less redeposition as compared to that obtained with whole cellulase. Although CBH I alone did not produce redeposition, it also did not generate a stonewashed effect.
The presence of substantial amounts of CBH type components in the cellulase composition appears to result in an increase in the redeposition of dye onto the fabric.
Cellulase compositions derived from microorganisms which produce redepositing whole cellulase compositions, other than Trichoderma lon~ibrachiatum, that are substantially free of CBH
type components could be used in place of the cellulase compositions described in this example. In particular, the source of the cellulase composition containing the EG type components is nQt important to this invention and any cellulase composition W094/07983 ~ 21 A S8 73 PCT/US93/0873s containing one or more EG type components and substantially free of all CBH-type components can be used herein. For example, fungal cellulases for use in preparing the fungal cellulase compositions used in this invention can be obtained from Trichoderma viride, Trichoderma koninqii, Pencillium s~., and the like or commercially available cellulases can be used, i.e., CELLUCAST (available from Novo Industry, Copenhagen, Denmark), RAPIDASE (available from Gist Brocades, N.V., Delft, Holland), and the like.
containing only T. lonqibrachiatum genomic DNA (the eall and EYE~ genes) except for 24 bp of sequenced, synthetic DNA between the two genes and 6 bp of sequenced, synthetic DNA at one end (see FIG. 8).
Both these pieces of synthetic DNA were obtained from the multiple cloning site of pUC-type ~ectors.
W O 94~07983 PC~r/US93/08735 ~ 3 40 -Construction of the EGI expression vector pTEX-EGl The plasmid, pTEX-EGI was constructed following the methods of Sambrook et al. (1989), supra, and is illustrated in FIG. 9. This plasmid has been designed as a multi-purpose expression vector for use in the filamentous fungus Trichoderma reesei. The expression cassette has several unique features that make it useful for this function. Transcription is regulated using the strong CBHI gene promoter and terminator sequences for T. reesei. Between the CBHI
promoter and terminator there are unique PmeI and Sst I restriction sites that are ,used to insert the gene to be expressed. The T. reesei ~YE~ selectable marker gene has been inserted into the CBHI
terminator and the whole expression cassette (CBHI
promoter-insertion sites-CBHI terminator-~yr4 gene-CBHI terminator) can be excised utilizing the unique NotI restriction site or the unique NotI and NheI
restriction sites.
This vector is based on the bacterial vector, pSL1180 (Pharmacia Inc., Piscataway, New Jersey), which is a pUC-type vector with an extended multiple cloning site. pTEX was digested with SstII and PmeI
and then ligated with a synthetic DNA linker designed to join the cbhl promoter with the eall coding sequence and with an approximately 2 kb SfiI - Sc~I
fragment of T. lonqibrachiatum DNA containing most of the,eall coding sequence and the terminator region.
This ligation produced the vector pTEX-EGI. This vector was digested with NotI and NheI to release the W094/07983 2 1 4 ~ 8 7 3 PCT/US93/og735 expression cassette which comprised the following components:
a) 11 bp of linker DNA derived from the multiple cloning site of pSL1180.
b) An approximately 2.2 kb PstI-SstII fragment of T. lonqibrachiatum DNA from the promoter region of the cbhl gene. The SstII site is at a position 15 bp 5' of the translation initiation codon (ATG).
c) A synthetic DNA linker used to join the cbhl promoter with the eall coding sequence, having single-stranded overhanging ends compatible with SstII and SfiI digested DNA, and having the following sequence:
***
5' GGACTGGCATCATGGCGCCCTCA~TTACACTGCCGTTGACCACGGCCATCC 3' 3' CGCCTGACCGTAGTACCGCGGGAGTCAATGTGACGGCAACTGGTGCCGGT 5' tSEQ ID NO: 4) The asterisks mark the translation initiation codon (ATG) of the eqll gene coding region. The DNA sequence 5~ to the ATG codon is exactly the same as that found in this region of the cbhl gene. The DNA sequence 3' of the ATG codon is exactly the same as that found in this region of the eqll gene.
d) An approximately 2 kb SfiI-ScaI fragment of T. lonqibrachiatum DNA containing the eqll coding sequence, starting at an SfiI site 30 bp after the first ATG codon, and approximately 300 bp of 3' flanking DNA containing the transcription termination and polyadenylation signals.
e) An approximately 1 kb SmaI-~qlII fragment of T. lonqibrachiatum DNA from the 3' flanking region of the cbhl gene with a PmeI restriction site added adjacent to the SmaI site using the syhthetic linker DNA shown in FIG. 9 (SEQ ID NO:1).
.
f) The T. lonqibrachiatum pvr4 gene on a 1.6 kb ~glII fragment which has 13 bp on one end and 17 bp on the other end of synthetic linker DNA. Both linkers were derived from the multiple cloning site of the pUC219 vector. The latter synthetic linker was additionally modified by insertion of a ~g~II
site at the HindIII site using the linker shown in FIG. 9 (SEQ ID NO:3). Oligonucleotide directed mutagenesis (Sambrook et al. (1989) Molecular Cloning a Laboratory Manual, Cold Spring Harbor Press) was used to change a single nucleotide within the EYE~
coding region (SEQ ID NO:2 of FIG. 9). The third nucleotide of the codon coding for the arginine residue at amino acid position 251 of the protein was changed from a C nucleotide to an A nucleotide by this method. This alteration would not change the amino acid sequence of the orotidine 5' monophosphate decarboxylase produced but destroyed an SstII site in the DNA sequence and thus facilitated construction of the plasmid.
g) An approximately 0.5 kb BqlII-NheI fragment of T. lonqibrachiatum DNA from the 3' flanking region of the cbhl gene.
It would be possible to construct plasmids similar to pTEX-EGI but with any other T.
lon~ibrachiatum gene replacing the eall gene. In this way, over-expression of other genes and simultaneous deletion of the cbhl gene could be achieved.
Construction of EG I over-expression strains The linear fragment of DNA containing the eall and EYE~ genes released from pEGIPvr4 by digestion with HindIII, was purified from an agarose gel.
Similarly, the linear fragment of DNA containing the ~311, EYE~ genes and flanking regions of the cbhl gene was purified from pTEX-EGI after digestion with NotI and NheI. These fragments of DNA were used in separate experiments to transform T. lonqibrachiatum strain P37P~CBH67Pyr-1 by the method of Examples 3 and 4. Several transformants were obtained with each DNA fragment which transformants produced elevated levels of EGI compared to the parent strain. Total DNA was isolated from these transformants, digested with PstI, subjected to agarose gel electrophoresis and blotted to a membrane filter. Southern blot analysis using radiolabelled pUCEGI (a pUC plasmid containing the eqll gene on a 4.2 kb HindIII fragment of genomic DNA) showed that each transformant contained multiple copies of the eqll gene integrated at sites within the genome which could not be determined.
Similar Southern analysis was also performed using a pUC vector as a probe. This analysis revealed that the pUC plasmid fragment of either pEGI~vr4 or pTEX-EGI had not been incorporated by any of these strains.
Transformants of strain P37P~CB~67Pyr~1 obtained with either pEGIPvr4 or pTEX-EGI as described above were inoculated into 50 ml shake flask cultures in order to determine the amount of secreted endoglucanase produced. The liquid medium ~ 44 -used for these experiments had the following composition: alpha-lactose, 30 g/l; (NH4)~SO4, 6.5 g/l; KH2PO4, 2.0 g/l; MgSO4.7H70, 0.3 g/l; CaCl2, 0.2 g/l; lOOOx trace salt solution, 1.0 ml/l; 10 % Tween 80, 2.0 ml/l; Proflo, 22.5 g/l; CaC03, 0.72g/1.
Source for Tween 80 and Proflo. The lOOOx trace salt solution had the following composition: FeSO4.7H2O, 5.0 g/l; MnSO4.H2O, 1.6 g/l; ZnSO~, 1.4 g/l. These shake flask cultures were incubated with shaking for seven days at 30C. Samples of the supernatant were taken from these cultures and assays designed to measure the endoglucanase activity were performed as described below.
The endoglucanase assay relied on the release of soluble, dyed oligosaccharides from Remazol Brilliant Blue-carboxymethylcellulose (RBB-CMC, obtained from MegaZyme, North Rocks, NSW, Australia). The substrate was prepared by adding 2 g of dry RBB-CMC
to 80 ml of just boiled deionized water with vigorous stirring. When cooled to room temperature, 5 ml of 2 M sodium acetate buffer (pH 4.8) was added and the pH
adjusted to 4.5. The volume was finally adjusted to 100 ml with deionized water and sodium azide added to a final concentration of 0.02~. Aliquots of T.
lonqibrachiatum control culture, pEGI~yE~ or pTEX-EGI
transformant culture supernatants or 0.1 M sodium acetate as a blank (10-20 ~1) were placed in tubes, 250 ~1 of substrate was added and the tubes were incubated for 30 minutes at 37C. The tubes were placed on ice for 10 minutes and 1 ml of cold precipitant (3.3% sodium acetate, 0.4% zinc acetate, pH 5 with HCl, 76% ethanol) was then added. The tubes were vortexed and allowed to sit-for five minutes before centrifuging for three minutes at W094/07983 ~ 2 1 9 5 8 7 3 PCT/US93/08735 approximately 13,000 x g. The optical density was measured spectrophotometrically at a wavelength of 590-600 nm.
The results of the endoglucanase assay performed on triplicate cultures of 5 different transformants obtained with pEGIEyE~ DNA and on cultures of the parental strain P37PA~CBH67 are given in Table 1 below. It is apparent that the transformants produced significantly more secreted endoglucanase activity compared to the parental strain described above, are shown in Table l.
Secreted Endoglucanase Activity of T . longibrachia tum Transformants T~ANSFORMANT RBB-CMC U~ITS/ML
P37 EPl 5.7 14.3 14.1 11.4 P37 EP8 11.0 3.8 6.1 7.0 P37 EP9 3.4 11.5 14.9 9.9 P37 EP10 7.0 9.1 5.0 7.0 P37 EP11 5.0 5.5 lO.0 6.9 parental P37P~CBH673.0 2.8 5.5 l.l3.1 The above results are presented for the purpose of demonstrating the overproduction of the EGI
component and not for the purpose of demonstrating the extent of overproduction. In this regard, the extent of overproduction is expected to vary with each experiment.
Similar shake flask cultures and endoglucanase assays were performed with transformants obtained ~ ~5~ ~
with pTEX-EGI and those transformants which over-produced endoglucanase activity were identified.
The methods of this example could be used to produce T. lonqibrachiatum strains which would over-produce any of the other EG components.
It would also be possible to transform ~YE~
derivative strains of T. lonqibrachiatum which had previously been deleted for other genes in addition to CBHI and CBHII, eg. for EGII, with pEGI~y~ or pTEX-EGI to construct transformants which would, for example, produce no exocellobiohydrolases or EGII and overexpress EGI.
EX~MPLE 15 Purification of Cytolase 123 Cellulase into Cellulase components CYTOLASE 123 cellulase was fractionated in the following manner. The normal distribution of cellulase components in this cellulase system is as follows:
CBH I45-55 weight percent CBH II13-15 weight percent EG I11-13 weight percent EG II8-10 weight percent EG III1-4 weight percent BG0.5-1 weight percent.
The fractionation was done using columns containing the following resins: Sephadex G-25 gel filtration resin from Sigma Chemical Company (St.
Louis, Mo), QA Trisacryl M anion exchange resin and SP Trisacryl M cation exchange resin from IBF
Biotechnics (Savage, Maryland). CYTOLASE 123 W O 94/07983 PC~r/US93/08735 ~lg5873 cellulase, 0.5g, was desalted using a column of 3 liters of Sephadex G-25 gel filtration resin with 10 mM sodium phosphate buffer at pH 6.8. The desalted solution, was then loaded onto a column of 20 ml of QA Trisacryl M anion exchange resin. The fraction bound on this column contained CBH I and EG I. These components were separated by gradient elution using an aqueous gradient containing from 0 to about 500 mM
sodium chloride. The fraction not bound on this column contained CBH II and EG II. These fractions were desalted using a column of Sephadex G-25 gel filtration resin equilibrated with 10 mM sodium citrate, pH 3.3. This solution, 200 ml, was then loaded onto a column of 20 ml of SP Trisacryl M
cation exchange resin. CBH II and EG II were eluted separately using an aqueous gradient containing from 0 to about 200 mM sodium chloride.
Following procedures similar to that of Example 13 above, other cellulase systems which can be separated into their components include CELLUCAST
(available from Novo Industry, Copenhagen, Denmark), RAPIDASE (available from Gist Brocades, N.V., Delft, Holland), and cellulase systems derived from Trichoderma koninqii, Penicillum sp. and the like.
Purification of EG III from Cytolase 123 Cellulase Example 22 above demonstrated the isolation of several components from Cytolase 123 Cellulase.
However, because EG III is present in very small quantities in Cytolase 123 Cellulase, the following W O 94/07983 PC~r/US93/08735 ~5~
procedures were employed to isolate this component.
See also U.S. Serial No. 07/862,846 filed April 3, 1992 and entitled ~METHODS FOR PRODUCING
SUBSTANTIALLY PURE EG III CELLULASE USING
POLYETHYLENE GLYCOL", which is incorporated herein in its entirety by reference.
A. ~rqe 8cale Extraction of EG III Cellulase EnzYnne one hundred liters of cell free cellulase filtrate were heated to about 30C. The heated material was made about 4~ wt/vol PEG 8000 (polyethylene glycol, MW of about 8000) and about 10 wt/vol anhydrous sodium sulfate. The mixture formed a two phase liquid mixture. The phases were separated using an SA-1 disk stack centrifuge. The phases were analyzed using silver staining isoelectric focusing gels. Separation was obtained for EG III and xylanase. The recovered composition contained about 20 to 50 weight percent of EG III.
Regarding the above procedure, use of a polyethylene glycol having a molecular weight of less than about 8000 gave inadequate separation; whereas, use of polyethylene glycol having a molecular weight of greater than about 8000 resulted in the exclusion of desired enzymes in the recovered composition.
With regard to the amount of sodium sulfate, sodium sulfate levels greater than about 10% wt/vol caused precipitation problems; whereas, sodium sulfate levels less than about 10~ wt/vol gave poor separation or the solution remained in a single phase.
Alternatively, EG III cellulase may be extracted by the method described in U.S. Serial-No. 07/862,641 filed April 3, 1992 which is entitled "METHODS FOR
W O 94/07983 PC~r/US93/08735 PRODUCING SUBSTANTIALLY PURE EG III CELLULASE USING
ALCOHOL," which reference is incorporated herein in its entirety.
B. Purification of EG III Via Fractionation The purification of EG III is conducted by fractionation from a complete fungal cellulase composition (CYTOLASE 123 cellulase, commercially available from Genencor International, South San Francisco, California) which is produced by wild type Trichoderma lonqibrachiatum. Specifically, the fractionation is done using columns containing the following resins: Sephadex G-25 gel filtration resin from Sigma Chemical Company (St. Louis, MIssouri), QA
Trisacryl M anion exchange resin and SP Trisacryl M
cation exchange resin from IBF Biotechnics (Savage, Maryland). CYTOLASE 123 cellulase, 0.5g, is desalted using a column of 3 liters of Sephadex G-25 gel filtration resin with 10 mM sodium phosphate buffer at pH 6.8. The desalted solution, is then loaded onto a column of 20 ml of QA Trisacryl M anion exchange resin. The fraction bound on this column contained CBH I and EG I. The fraction not bound on this column contains CBH II, EG II and EG III. These fractions are desalted using a column of Sephadex G-25 gel filtration resin equilibrated with 10 mM
sodium citrate, pH 4.5. This solution, 200 ml, is then loaded onto a column of 20 ml of SP Trisacryl M
cation exchange resin. The EG III was eluted with 100 mL of an aqueous solution of 200 mM sodium chloride.
In order to enhance the efficiency of the isolation of EG III, it may be desirable to employ Trichoderma longibrachiatum genetically modified so as to be incapable of producing one or more of EG I, EG II, CBH I and/or CBH II. The absence of one or more of such components will necessarily lead to more efficient isolation of EG III.
Likewise, it may be desirable for the EG III
compositions described above to be further purified to provide for substantially pure EG III
compositions, i.e., compositions containing EG III at greater than about 80 weight percent of protein. For example, such a substantially pure EG III protein can be obtained by utilizing material obtained from procedure A in procedure B or vice versa. One particular method for further purifying EG III is by further fractionation of an EG III sample obtained in part b) of this Example 14. The further fraction was done on a FPLC system using a Mono-S-HR 5/5 column (available from Pharmacia LKB Biotechnology, Piscataway, NJ). The FPLC system consists of a liquid chromatography controller, 2 pumps, a dual path monitor, a fraction collector and a chart recorder (all of which are available from Pharmacia LKB Biotechnology, Piscataway, NJ). The fractionation was conducted by desalting 5 ml of the EG III sample prepared in part b) of this Example 14 with a 20 ml Sephadex G-25 column which had been previously equilibrated with 10 mM sodium citrate pH 4. The column was then eluted with 0-200 mM
aqueous gradient of NaCl at a rate of 0.5 ml/minute with samples collected in 1 ml fractions. EG III was recovered in fractions 10 and 11 and was determined to be greater than 90% pure by SDS gel electrophoresis. EG III of this purity is suitable for determining the N-terminal amino acid sequence by known techniques.
W O 94/0~983 ~^ 2 1 A 58 7 3 PC~r/US93/08735 Substantially pure EG III as well as EG I and EG II components purified in Example 16 above can be used singularly or in mixtures in the methods of this invention. These EG components have the following characteristics:
MW PI PH optimum EG I 47-49 kD 4.7 -5 EG II -35 kD s.5 ~5 EG III~25-28 kD 7.4 -5.5-6.0 0 1. pH optimum determined by RBB-CMC activity as per Example 17 below.
Activity of Cellulase Compositions over a pH Range The following procedure was employed to determine the pH profiles of two different cellulase compositions. The first cellulase composition was a CBH I and II deleted cellulase composition prepared from Trichoderma lonaibrachiatum genetically modified in a manner similar to that described above so as to be unable to produce CBH I and CBH II components.
Insofar as this cellulase composition does not contain CBH I and CBH II which generally comprise from about 58 to 70 percent of a cellulase composition derived from Trichoderma lonqibrachiatum, this cellulase composition is necessarily substantially free of CBH I type and CBH II type cellulase components and accordingly, is enriched in EG components, i.e., EG I, EG II, EG III, and the like.
The second cellulase composition was an approximately 20 to 40% pure fraction of EG III
isolated from a cellulase composition derived from Trichoderma lonqibrachiatum via purification methods similar to part b) of Example 16.
The activity of these cellulase compositions was determined at 40C and the determinations were made using the following procedures.
Add 5 to 20 ~l of an appropriate enzyme solution at a concentration sufficient to provide the requisite amount of enzyme in the final solution.
Add 250 ~l of 2 weight percent RBB-CMC (Remazol Brilliant Blue R-Carboxymethylcellulose --commercially available from MegaZyme, 6 Altona Place, North Rocks, N.S.W. 2151, Australia) in 0.05M
citrate/phosphate buffer at pH 4, 5, 5.5, 6, 6.5, 7, 7.5 and 8.
Vortex and incubate at 40C for 30 minutes.
Chill in an ice bath for 5 to 10 minutes. Add 1000 ~l of methyl cellosolve containing 0.3M sodium acetate and 0.02M zinc acetate. Vortex and let sit for 5-10 minutes. Centrifuge and pour supernatant into cuvets. Measure the optical density (OD) of the solution in each cuvet at 590 nm. Higher levels of optical density correspond to higher levels of enzyme activity.
The results of this analysis are set forth in FIG. 10 which illustrates the relative activity of the CBH I and II deleted cellulase composition compared to the EG III cellulase composition. From this figure, it is seen that the cellulase composition deleted in CBH I and CBH II possesses W094/07983 21q 58 73 PCT/US93tO8735 .
optimum cellulolytic activity against RBB-CMC at near pH 5.5 and has some activity at alkaline pHs, i.e., at pHs from above 7 to 8. On the other hand, the cellulase composition enriched in EG III possesses optimum cellulolytic activity at pH 5.5 - 6 and possesses significant activity at alkaline pHs.
From the above example, one skilled in the art would merely need to adjust and maintain the pH of the aqueous textile composition so that the cellulase composition is active and preferably, possesses optimum activity. As noted above, such adjustments and maintenance may involve the use of a suitable buffer.
Stonewashed Appearance This example demonstrates that the presence of CBH type components is not essential for imparting a stonewashed appearance to denim fabrics.
Specifically, this example employs a cellulase composition derived from Trichoderma lonqibrachiatum genetically engineered in the manner described above so as to be incapable of producing any CBH type components (i.e., incapable of producing CBH I and II
components) as well as a complete cellulase composition derived from Trichoderma lonqibrachiatum and which is available as Cytolase 123 cellulase from Genencor International, South San Francisco, California.
These cellulase compositions were tested for their ability to impart a stonewashed appearance to W O 94/07983 ~ 3 PC~r/US93/08735 dyed denim denims pants. Specifically, the samples were prepared using an industrial washer and dryer under the following conditions:
10 mM citrate/phosphate buffer pH 5 40 L total volume Four pair of denim pants 1 hour run time 50 ppm CBH I and II deleted cellulase or 100 ppm whole cellulase (i.e., at approximately equal EG concentrations) Samples were evaluated for their stonewashed appearance, but not the level of redeposition of dye, by 8 panelists. All eight panelists choose 100 ppm whole cellulase over non-enzyme treated pants as having the better stonewashed look. Four of the 8 panelists choose the CBH I and II deleted cellulase treated pants over whole cellulase as having the better stonewashed look; whereas the other four panelists choose the whole cellulase treated pants as having the better stonewashed look. These results indicate that the CBH I and II deleted cellulase treated pants were indistinguishable from whole cellulase treated pants and that CBH I and/or CBH II
are not essential for imparting a stonewashed appearance to denim fabrics.
Reduced Redeposition of dye This example demonstrates that the use of EG
type components substantially free of CBH type components results in a reduced redeposition of dye onto the fabric during stonewashing.
W O 94/07983 2 1 4 5~ 7 3 PC~r/US93/08735 .
Specifically, this example employs the following cellulase compositions:
a) a complete cellulase composition derived from Trichoderma lonqibrachiatum and which is available as Cytolase 123 cellulase from Genencor International, South San Francisco, California.
b) a cellulase composition from Trichoderma lonqibrachiatum genetically engineered in the manner described above so as to be incapable of producing any CBH type components (i.e., incapable of producing CBH I and II components);
c) CBH I purified by the method of Example 15;
d) EG I purified by the method of Example 15;
e) EG II purified by the method of Example 15;
and f) EG III purified by the method of Example 16.
These cellulase compositions were tested for their ability to impart a stonewashed appearance to dyed denim pants and their ability to prevent the redeposition of dye onto the fabric.
Specifically, the samples were prepared using an industrial washer and dryer under the following conditions:
20 mM citrate/phosphate buffer pH 4.9 40 L total volume 3.8 kg of desized indigo dyed denim pants l hour run time at 36 rpms 35 ppm CBH I and II deleted cellulase or 70 ppm whole cellulase or 15-30 ppm of purified EGI, EGII or EGIII
cellulase The garments were rinsed according to a standardized protocol in three consecutive cycles of clean liquor. Rinse #1 -- 24 gallons hot water, ~sa~ 56 -approximately 50C, plus ~100 grams standard detergent WOR (from American Association of Textile Chemists and Colorists [AATCC], WOB - without brighteners). Agitation was for 12 minutes at 36 rpms. The bath was dropped. Rinse #2 -- 24 gallons warm water, -40C, with no additional detergents, agitated for 5 minutes. The bath was dropped. Rinse #3 -- 24 gallons cold water, ~30C, with no additional detergents, agitated for 5 minutes. The bath was dropped. Garments were extracted and dried in a standard electric clothes dryer.
FIG. 11 shows that results obtained with the different cellulase compositions.
The results indicate that EG III gave the least redeposition of dye on the fabric. However, purified EG I, EG II and CBHI/II deleted cellulase also gave a satisfactory stonewashed appearance with less redeposition as compared to that obtained with whole cellulase. Although CBH I alone did not produce redeposition, it also did not generate a stonewashed effect.
The presence of substantial amounts of CBH type components in the cellulase composition appears to result in an increase in the redeposition of dye onto the fabric.
Cellulase compositions derived from microorganisms which produce redepositing whole cellulase compositions, other than Trichoderma lon~ibrachiatum, that are substantially free of CBH
type components could be used in place of the cellulase compositions described in this example. In particular, the source of the cellulase composition containing the EG type components is nQt important to this invention and any cellulase composition W094/07983 ~ 21 A S8 73 PCT/US93/0873s containing one or more EG type components and substantially free of all CBH-type components can be used herein. For example, fungal cellulases for use in preparing the fungal cellulase compositions used in this invention can be obtained from Trichoderma viride, Trichoderma koninqii, Pencillium s~., and the like or commercially available cellulases can be used, i.e., CELLUCAST (available from Novo Industry, Copenhagen, Denmark), RAPIDASE (available from Gist Brocades, N.V., Delft, Holland), and the like.
Claims (13)
1) A method for reducing colorant redeposition during the stonewashing of colored fabrics which method comprises contacting the fabric with an effective amount of a fungal cellulase composition derived from a redepositing whole fungal cellulase composition under conditions sufficient to impart a stone-washed appearance to the fabric wherein said cellulase composition is substantially free of CBH
type components.
type components.
2) The method according to Claim 1 wherein said fungal cellulase composition comprises at least about 40 weight percent of EG components based on the total weight of cellulase protein.
3) The method according to Claim 1 wherein said cellulase composition comprises at least about 80 weight percent of EG components based on the total weight of cellulase protein.
4) The method according to Claim 1 wherein said cellulase composition further comprises a surfactant.
5) The method according to Claim 1 wherein said cellulase composition further comprises a buffer.
6) The method according to Claim 1 wherein said cellulase composition comprises a cellulase composition from Trichoderma sp.
7) The method according to Claim 1 wherein said cellulase composition comprises a dry granular product.
8) The method according to Claim 1 wherein said cellulase composition comprises an aqueous solution.
9) The method according to Claim 1 further comprising contacting the denim with pumice stones.
10) A method for reducing colorant redeposition during the stonewashing of colored fabrics which method comprises contacting the fabric with an effective amount of a fungal cellulase composition derived from a redepositing whole fungal cellulase composition under conditions sufficient to impart a stone-washed appearance to the fabric wherein said cellulase composition comprises substantially pure EG
type component.
11) The method of Claim 10 wherein said EG type component is EG I component.
12) The method of Claim 10 wherein said EG type component is EG II component.
13) The method of Claim 10 wherein said EG type component is EG III component.
14) The method according to Claim 10 wherein said fungal cellulase composition comprises at least about 80 weight percent of pure EG type component based on the total weight of cellulase protein.
15) The method according to Claim 10 wherein said cellulase composition further comprises a surfactant.
16) The method according to Claim 10 wherein said cellulase composition further comprises a buffer.
17) The method according to Claim 10 wherein said component is from Trichoderma sp.
18) The method according to Claim 10 wherein said cellulase composition comprises a dry granular product.
19) The method according to Claim 10 wherein said cellulase composition comprises an aqueous solution.
20) The method according to Claim 10 further comprising contacting the denim with pumice stones.
21) A fabric treated by the method defined in Claim 1.
22) A fabric treated by the method defined in
10) A method for reducing colorant redeposition during the stonewashing of colored fabrics which method comprises contacting the fabric with an effective amount of a fungal cellulase composition derived from a redepositing whole fungal cellulase composition under conditions sufficient to impart a stone-washed appearance to the fabric wherein said cellulase composition comprises substantially pure EG
type component.
11) The method of Claim 10 wherein said EG type component is EG I component.
12) The method of Claim 10 wherein said EG type component is EG II component.
13) The method of Claim 10 wherein said EG type component is EG III component.
14) The method according to Claim 10 wherein said fungal cellulase composition comprises at least about 80 weight percent of pure EG type component based on the total weight of cellulase protein.
15) The method according to Claim 10 wherein said cellulase composition further comprises a surfactant.
16) The method according to Claim 10 wherein said cellulase composition further comprises a buffer.
17) The method according to Claim 10 wherein said component is from Trichoderma sp.
18) The method according to Claim 10 wherein said cellulase composition comprises a dry granular product.
19) The method according to Claim 10 wherein said cellulase composition comprises an aqueous solution.
20) The method according to Claim 10 further comprising contacting the denim with pumice stones.
21) A fabric treated by the method defined in Claim 1.
22) A fabric treated by the method defined in
Claim 10.
23) A fabric treated by the method defined in
23) A fabric treated by the method defined in
Claim 11.
24) A fabric treated by the method defined in
24) A fabric treated by the method defined in
Claim 12.
25) A fabric treated by the method defined in
25) A fabric treated by the method defined in
Claim 13.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US07/954,113 US5650322A (en) | 1990-10-05 | 1992-09-30 | Methods for stonewashing fabrics using endoglucanases |
US07/954,113 | 1992-09-30 |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2145873A1 true CA2145873A1 (en) | 1994-04-14 |
Family
ID=25494943
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002145873A Abandoned CA2145873A1 (en) | 1992-09-30 | 1993-09-15 | Methods for stonewashing fabrics using endoglucanases |
Country Status (9)
Country | Link |
---|---|
US (1) | US5650322A (en) |
EP (1) | EP0663004A1 (en) |
JP (1) | JP3554322B2 (en) |
AU (1) | AU4924793A (en) |
BR (1) | BR9307136A (en) |
CA (1) | CA2145873A1 (en) |
MX (1) | MX9305945A (en) |
TW (1) | TW284810B (en) |
WO (1) | WO1994007983A1 (en) |
Families Citing this family (44)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5525507A (en) * | 1990-10-05 | 1996-06-11 | Genencor International, Inc. | Methods for treating cotton-containing fabric with cellulase composition containing endoglucanase component and which is free of all CBH I component |
US5290474A (en) * | 1990-10-05 | 1994-03-01 | Genencor International, Inc. | Detergent composition for treating cotton-containing fabrics containing a surfactant and a cellulase composition containing endolucanase III from trichoderma ssp |
CA2093422C (en) * | 1990-10-05 | 2001-04-03 | Detergent compositions containing cellulase compositions deficient in cbh i type components | |
US6268196B1 (en) * | 1993-12-17 | 2001-07-31 | Genencor International, Inc. | Method and compositions for treating cellulose containing fabrics using truncated cellulase enzyme compositions |
US5861271A (en) * | 1993-12-17 | 1999-01-19 | Fowler; Timothy | Cellulase enzymes and systems for their expressions |
US7005128B1 (en) | 1993-12-17 | 2006-02-28 | Genencor International, Inc. | Enzyme feed additive and animal feed including it |
IL113714A0 (en) * | 1994-06-22 | 1995-08-31 | Ivax Ind Inc | Method of treating dyed cellulosic fabric |
JPH10507073A (en) * | 1994-10-06 | 1998-07-14 | ノボ ノルディスク アクティーゼルスカブ | Enzymes having endoglucanase activity and enzyme preparations |
US5958083A (en) * | 1995-09-08 | 1999-09-28 | Novo Nordisk A/A | Prevention of back-staining in stone washing |
DE69628311T3 (en) * | 1995-09-08 | 2012-05-16 | Novozymes A/S | PREVENTION OF STORMING WHEN STONE WASHING |
US6723549B2 (en) * | 1995-10-17 | 2004-04-20 | Ab Enzymes Oy | Cellulases, the genes encoding them and uses thereof |
US6184019B1 (en) | 1995-10-17 | 2001-02-06 | Röhm Enzyme Finland OY | Cellulases, the genes encoding them and uses thereof |
AU7620796A (en) | 1995-11-15 | 1997-06-05 | Novo Nordisk A/S | A process for combined desizing and "stone-washing" of dyed denim |
US5908472A (en) * | 1996-01-12 | 1999-06-01 | Novo Nordisk A/S | Fabric treated with cellulase and oxidoreductase |
US6017870A (en) * | 1996-10-09 | 2000-01-25 | Genencor International, Inc. | Purified cellulase and method of producing |
FI964691A0 (en) * | 1996-11-25 | 1996-11-25 | Primalco Ltd | Cellulose weaving process |
FI964692A0 (en) * | 1996-11-25 | 1996-11-25 | Primalco Ltd | Cellulose-based cellulose processing |
US5989899A (en) * | 1996-12-23 | 1999-11-23 | Genencor International, Inc. | Oversized cellulase compositions for use in detergent compositions and in the treatment of textiles |
US5866407A (en) * | 1997-03-18 | 1999-02-02 | Iogen Corporation | Method and enzyme mixture for improved depilling of cotton goods |
US6146428A (en) * | 1998-04-03 | 2000-11-14 | Novo Nordisk A/S | Enzymatic treatment of denim |
AU2001263777A1 (en) | 2000-06-02 | 2001-12-11 | Novozymes A/S | Redeposition or backstain inhibition during stonewashing process |
CN1172053C (en) * | 2001-02-09 | 2004-10-20 | 广东溢达纺织有限公司 | Technology for knitting washing-resistant cotton fabric without ironing |
DK2305800T3 (en) * | 2002-08-16 | 2015-08-24 | Danisco Us Inc | NOVEL Hypocrea JECORINA CBH CELLULASEVARIANTER |
EP2261326B1 (en) * | 2003-05-29 | 2017-03-29 | Danisco US Inc. | Novel Trichoderma genes |
SI1685244T1 (en) * | 2003-11-21 | 2012-06-29 | Danisco Us Inc | Expression of granular starch hydrolyzing enzymes in trichoderma and process for producing glucose from granular starch substrates |
CA2567570C (en) * | 2004-05-27 | 2014-07-08 | Genencor International, Inc. | Aspergillus kawachi acid-stable alpha amylase and applications in granular starch hydrolysis |
KR101222413B1 (en) * | 2004-05-27 | 2013-01-16 | 다니스코 유에스 인크. | Heterologous expression of an aspergillus kawachi acid-stable alpha amylase and applications in granular starch hydrolysis |
EP2292747B1 (en) | 2004-12-30 | 2017-01-25 | Danisco US Inc. | Variant hypocrea jecorina cbh2 cellulases |
US7361487B2 (en) | 2006-04-13 | 2008-04-22 | Ab Enzymes Oy | Enzyme fusion proteins and their use |
US8143046B2 (en) | 2007-02-07 | 2012-03-27 | Danisco Us Inc., Genencor Division | Variant Buttiauxella sp. phytases having altered properties |
US20080220498A1 (en) | 2007-03-06 | 2008-09-11 | Cervin Marguerite A | Variant Buttiauxella sp. phytases having altered properties |
ES2376064T3 (en) * | 2007-03-14 | 2012-03-08 | Danisco Us Inc. | THE A-AMYLASE OF TRICHODERMA REESEI PROMOTES THE SACARIFICATION OF ALMIDÓN DE MA�? Z. |
US8093016B2 (en) * | 2007-05-21 | 2012-01-10 | Danisco Us Inc. | Use of an aspartic protease (NS24) signal sequence for heterologous protein expression |
DK2268806T3 (en) * | 2008-02-11 | 2013-07-15 | Danisco Us Inc | Enzyme with microbial light activity from Trichoderma reesei |
CA2726357A1 (en) | 2008-06-06 | 2009-12-10 | Danisco Us Inc. | Compositions and methods comprising cellulase variants with reduced affinity to non-cellulosic materials |
WO2010141779A1 (en) | 2009-06-03 | 2010-12-09 | Danisco Us Inc. | Cellulase variants with improved expression, activity and/or stability, and use thereof |
EP2278063A1 (en) * | 2009-07-24 | 2011-01-26 | Universität Innsbruck | Method for enzymatic treatment of textiles containing cellulose |
CN103068264A (en) | 2010-08-24 | 2013-04-24 | 丹尼斯科美国公司 | A food product comprising a low temperature rice protein concentrate |
RU2013122800A (en) | 2010-10-20 | 2014-11-27 | ДАНИСКО ЮЭс ИНК. | THERMOSTABLE CELLULASE FROM TRICHODERMA |
JP6105590B2 (en) | 2011-09-22 | 2017-03-29 | ダニスコ・ユーエス・インク | Endogenous DNase activity that reduces DNA content |
MX2015007234A (en) | 2012-12-12 | 2015-10-29 | Danisco Us Inc | Variants of cellobiohydrolases. |
WO2014142325A1 (en) * | 2013-03-15 | 2014-09-18 | 国立大学法人長岡技術科学大学 | Variant of cellulase-producing fungus, cellulase manufacturing method, and cello-oligosaccharide manufacturing method |
US11339516B2 (en) * | 2018-09-27 | 2022-05-24 | Sanko Tekstil Isletmeleri San. Ve Tic. A.S. | Dyed fabric finishing process |
WO2023039358A1 (en) | 2021-09-09 | 2023-03-16 | Dupont Nutrition Biosciences Aps | Over expression of foldases and chaperones improves protein production |
Family Cites Families (34)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB1368599A (en) * | 1970-09-29 | 1974-10-02 | Unilever Ltd | Softening compositions |
US4275163A (en) * | 1978-11-20 | 1981-06-23 | The United States Of America As Represented By The Secretary Of The Army | Cellulase-producing microorganism |
DK187280A (en) * | 1980-04-30 | 1981-10-31 | Novo Industri As | RUIT REDUCING AGENT FOR A COMPLETE LAUNDRY |
GB2094826B (en) * | 1981-03-05 | 1985-06-12 | Kao Corp | Cellulase enzyme detergent composition |
GB2095275B (en) * | 1981-03-05 | 1985-08-07 | Kao Corp | Enzyme detergent composition |
JPS5836217A (en) * | 1981-08-25 | 1983-03-03 | Asahi Chem Ind Co Ltd | Production of cellulosic fiber with improved touch |
JPS5854082A (en) * | 1981-09-22 | 1983-03-30 | 倉敷紡績株式会社 | Modification of cellulosic fiber |
US4487831A (en) * | 1982-05-19 | 1984-12-11 | Research Corporation | Process for the conversion of cellulose to glucose |
GB8306645D0 (en) * | 1983-03-10 | 1983-04-13 | Unilever Plc | Detergent compositions |
US4472504A (en) * | 1983-03-28 | 1984-09-18 | The United States Of America As Represented By The Secretary Of The Army | Hyperproducing cellulase microorganism |
CA1338400C (en) * | 1983-08-31 | 1996-06-18 | David H. Gelfand | Recombinant fungal cellulases |
US4797361A (en) * | 1983-10-24 | 1989-01-10 | Lehigh University | Microorganism and process |
FR2555603B1 (en) * | 1983-11-29 | 1986-10-03 | Inst Francais Du Petrole | PROCESS FOR PRODUCING CELLULOLYTIC ENZYMES |
FI841500A0 (en) * | 1984-04-13 | 1984-04-13 | Valtion Teknillinen | FOERFARANDE FOER UPPBYGNANDE AV CELLULOLYTISKA JAESTSTAMMAR. |
GB8421801D0 (en) * | 1984-08-29 | 1984-10-03 | Unilever Plc | Detergent composition |
GB8421800D0 (en) * | 1984-08-29 | 1984-10-03 | Unilever Plc | Detergent compositions |
DK163591C (en) * | 1985-10-08 | 1992-08-24 | Novo Nordisk As | PROCEDURE FOR TREATING A TEXTILE SUBSTANCE WITH A CELLULASE |
US4725544A (en) * | 1986-04-25 | 1988-02-16 | Tan Larry U | Method for purifying xylanase |
GB8610600D0 (en) * | 1986-04-30 | 1986-06-04 | Novo Industri As | Transformation of trichoderma |
DE3787866T2 (en) * | 1986-10-28 | 1994-05-19 | Kao Corp | Alkaline cellulases and microorganisms for their production. |
US4822516A (en) * | 1986-12-08 | 1989-04-18 | Kao Corporation | Detergent composition for clothing incorporating a cellulase |
US4832864A (en) * | 1987-09-15 | 1989-05-23 | Ecolab Inc. | Compositions and methods that introduce variations in color density into cellulosic fabrics, particularly indigo dyed denim |
EP0406314B1 (en) * | 1988-03-24 | 1993-12-01 | Novo Nordisk A/S | A cellulase preparation |
JP2652871B2 (en) * | 1988-04-25 | 1997-09-10 | 花王株式会社 | Alkaline cellulase and method for producing the same |
US4952505A (en) * | 1988-08-08 | 1990-08-28 | Florida State University | Fermentation of trichoderma reesei and apparatus therefor |
US5006126A (en) * | 1988-09-15 | 1991-04-09 | Ecolab Inc. | Cellulase compositions and methods that introduce variations in color density into cellulosic fabrics, particularly indigo dyed denim |
US5122159A (en) * | 1988-09-15 | 1992-06-16 | Ecolab Inc. | Cellulase compositions and methods that introduce variations in color density into cellulosic fabrics, particularly indigo dyed denim |
DK0496783T3 (en) * | 1989-10-19 | 1996-03-04 | Genencor Int | Degradation resistant detergent mixtures |
US5120463A (en) * | 1989-10-19 | 1992-06-09 | Genencor International, Inc. | Degradation resistant detergent compositions based on cellulase enzymes |
DK16490D0 (en) * | 1990-01-19 | 1990-01-19 | Novo Nordisk As | ENZYME |
EP0517762B1 (en) * | 1990-03-01 | 1993-12-08 | Novo Nordisk A/S | Process for treatment of textiles |
BR9106435A (en) * | 1990-05-09 | 1993-05-04 | Novo Nordisk As | CELLULLASE PREPARATION, ENZYME DEMONSTRATING ANDDOGLUCANASE ACTIVITY, ENDOGLUCANASE ENZYME, DNA CONSTRUCTION, CELL EXPRESSION VECTOR, PROCESS FOR PRODUCING AN ENDOGLUCANASE ENZYME, ADDITIVE DETERGENT COMPOSITION, AND PROCESS TO REDUCE THE RATE AT WHICH CELLULOSE CONTAINING TISSUES BECOME ROUGH, PROVIDE COLOR LIGHTENING OF TISSUES CONTAINING COLORED CELLULOSE, PROVIDES A LOCAL COLOR VARIATION OF TISSUES CONTAINING COLORED, AND IMPROVES PULP DRAINAGE PROPERTIES |
WO1992006221A1 (en) * | 1990-10-05 | 1992-04-16 | Genencor International, Inc. | Methods for treating cotton-containing fabrics with cellulase |
US5290474A (en) * | 1990-10-05 | 1994-03-01 | Genencor International, Inc. | Detergent composition for treating cotton-containing fabrics containing a surfactant and a cellulase composition containing endolucanase III from trichoderma ssp |
-
1992
- 1992-09-30 US US07/954,113 patent/US5650322A/en not_active Expired - Lifetime
-
1993
- 1993-09-15 BR BR9307136-1A patent/BR9307136A/en not_active IP Right Cessation
- 1993-09-15 EP EP93921613A patent/EP0663004A1/en not_active Withdrawn
- 1993-09-15 JP JP50909394A patent/JP3554322B2/en not_active Expired - Lifetime
- 1993-09-15 AU AU49247/93A patent/AU4924793A/en not_active Abandoned
- 1993-09-15 WO PCT/US1993/008735 patent/WO1994007983A1/en not_active Application Discontinuation
- 1993-09-15 CA CA002145873A patent/CA2145873A1/en not_active Abandoned
- 1993-09-16 TW TW082107658A patent/TW284810B/zh active
- 1993-09-27 MX MX9305945A patent/MX9305945A/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
AU4924793A (en) | 1994-04-26 |
MX9305945A (en) | 1994-07-29 |
BR9307136A (en) | 1999-03-30 |
JPH08502101A (en) | 1996-03-05 |
WO1994007983A1 (en) | 1994-04-14 |
TW284810B (en) | 1996-09-01 |
EP0663004A1 (en) | 1995-07-19 |
JP3554322B2 (en) | 2004-08-18 |
US5650322A (en) | 1997-07-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5650322A (en) | Methods for stonewashing fabrics using endoglucanases | |
CA2093428C (en) | Methods for treating cotton-containing fabrics with cellulase | |
US5246853A (en) | Method for treating cotton-containing fabric with a cellulase composition containing endoglucanase components and which composition is free of exo-cellobiohydrolase I | |
EP1009810B1 (en) | Mutant thermomonospora spp. cellulase | |
WO1992006221A1 (en) | Methods for treating cotton-containing fabrics with cellulase | |
AU4902696A (en) | Method and compositions for treating cellulose containing fabrics using truncated cellulase enzyme compositions | |
WO1992006183A1 (en) | Methods for treating cotton-containing fabrics with cellulase | |
WO1992017574A1 (en) | Methods for treating cotton-containing fabrics with cellulase | |
US5668009A (en) | Methods for treating cotton-containing fabrics with CBH I enriched cellulase | |
EP0692041A1 (en) | Method for reducing lint generation during treatment of cotton-containing and non-cotton-containing cellulosic fabrics | |
US5525507A (en) | Methods for treating cotton-containing fabric with cellulase composition containing endoglucanase component and which is free of all CBH I component | |
WO1992017572A1 (en) | Methods for treating cotton-containing fabrics with cellulase | |
US5654193A (en) | Methods for treating cotton containing fabrics with cellulase | |
EP0699249B1 (en) | Methods for treating non-cotton-containing fabrics with cellulase |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
FZDE | Discontinued |