CA2191584C - Manufacture of autogenous replacement body parts - Google Patents

Abstract

Disclosed are matrix materials, methods, and devices for manufacture in vivo of autogenous replacement body parts comprising plural distinct tissues. In one embodiment, the replacement body part a a skeletal joint and the new plural distinct tissues include bone and articular cartilage.

Description

Fit ld of the Invention This invention relates to materials and methods for the repair and regeneration of plural distinct tissues at a single defect site in a mammal. More particularly, the invention is concerned with materials and methods for the manufacture in vivo of autogenous replacement body pans.
including mammalian skeletal joints, comprising plural different tissues, such as ligament, anicular cartilage and bone tissues.
Background of the Invention Skeletal joinu provide a movable union of two or more bones. Svnovial joints are highly evolved articulating joints that pemtit free movement. Because mammalian lower limbs are concerned with locomotion and upper limbs provide versatility of movement, most of the joints in the extremities are of the synovial type. There are various types of syovial joints. Their classification is based upon the types of active motion that they permit (uniaxial, biaxial, and polyaxial). They are differentiated further accordins to their principal morphological features (hinge, pivot, condyloid). In contrast to fibrous and cartilaginous joints where the ends of the bones are found in continuity with intervening tissue, the ends of the bones in a svnovial joint are in contact, but separate. Because the bones are not bound internally, the integrity of a synovial joint results from its ligaments and capsule (which bind the articulation externally) and to some extent from the surrounding muscles. In synovial joints, the contiguous bony surfaces are covered with articular or, hyaline cartilage, and the joint cavity is surrounded by a fibrous capsule which segregates the joint from the surrounding vascularized environment. The inner surface of the capsule is lined by a symovial layer or "membrane" containing cells involved in secreting the viscous lubricating synovial fluid. Gray, Anatomy of the Human Bodv, pp. 312:
333-336 ( 13th ed.: C.C. Clemente, ed.. (1985)).

2~~~ ~~~~

In certain synovial joints, the joint or synovial cavity may be divided by a meniscus of fibracartilage. Synovial joints involving two bones and containirr; a single joint cavity are referred to as simple joints. Joint' drat contain a meniscus fomring two joint cavities are called composite joints. The temr compound joint is used for those articulations in which more than a single pair of articulating surfaces are present.
Joint replacement, particularly atticulating joint replacement, is a commonly performed procedure in orthopedic surgery. However, the ideal material for replacement joints remains elusive. Typically, joint reconstruction requires repair of the bony defect, the atticular cattilage and, in addition, one or more of the joining ligaments. To date. there are no satisfactory clinical 1 C! means for readily repairing both articular cartilage and bony defects within a joint which. reliably results in viable, fully-tunctianal weight-bearing joints. Prosthetic joints tvhich replace all the endo~~enous joint tissues circumvent some of these pmblenrs. However, prosthetic joirus have numerous, well documented limitations, particularly in younger and Iughly active patients. Iar addition, in some circumstances prosthetic joint replacement is not possible and repair options are 15 limited to osteochondroallaarah materials.
The anicular, or hyaline cattilage, found at the end of aniculating bones is a specialized, histologically distinct tissue and is responsible far the distribution of load resistance to compressive forces, and the smooth ~ Tiding that is part of joint function. Articular cartilage has little or no self-regenerative properties. Thus, if the atticutar cartilage is tom or wom down in thickness or is 20 otherwise damaged as a function of time, disease or trauma, its ability to protect the underlyin;
bone surface is compromised.
Other types of eattila~e in skeletal joints include fibrocartilage and elastic canilage.
Secorrrlary cartilaginous joints are formed by discs of fibrocartilage which join vertebrae in the vertebral column. In fibrocartilage, the mucopoly-saccharide network is interlaced with prominent 25 collagen bundles and the chondrocytes are more widely scattered than in hyatinc cartilage. Elastic cartilage contains collagen fibers which are histologically similar to elastin fibers. As with other connective tissues the formation of cartilaginous tissue is a complex biological process, involving the interaction of cells and collagen fibers in a tmique biochemical milieu.
Cattilage tissue, including atticular cartilage, unlike other connective tissues, lacks blood vessels, nerves, lymphatics and basement membrane. Cattilage is composed of chondrocytes which _Z_ WO 95133502 ~ ~ ~ ~ ~ ~ ~ PCTIUS95IU6724 synthesize an abundant extracellular milieu composed of water, colfa~ens, proteoglycans and noncollagenous proteins and lipids. Collagen serves to trap proteo~lycans and to provide tensile strength to the tissue. Type II collagen is tire predominant collagen in cartilage tissue. The proteoglycans are composed of a variable number of glycosaminoilycan chains, keratin sulphate, chondroitin sulphate and'or detmatan sulphate, and N-linked and O-linked oli ~osaccharides cavalently bound to a protein core. The sulfated glycosaminoglycans are negatively charged resulting in an osmotic swelling pressure that draws in water.
In contrast, certain collagens such as the fibrotic cartilaginous tissues which occur in scar tissue for example, are keloid and typical of scar-type tissue, i.e., composed of capillaries and abundant, irregular, disorganized bundles of Type I and Type 11 collagen.
Histologically, articular or hy<uine cartilage can be distinguished from other foans of cartilage, bath by its morphology and by its biochemistry. Morphologically, articular cartilage is characterized by supe~cial versus mid versus deep "zones" which show a characteristic gradation of features from the surface of the tissue to the base of the tissue adjacent to the bone. Irt the supe~cial zone, for example, chondrocytes are flattened and lie parallel to the surface embedded in an extracellular network that contains tangentially arranged collagen and few proteoglycans. In the mid zone, chondrocytes are spherical and surrounded by an extracellular network rich in proteoglycans and obliquely organized collagen fibers. In the deep zone, close to the bone, the collage fibers are vertically oriented. The keratin sulphate rich proteogly~cans increase in concentration with increasing distance from the cartilage surface. For a detailed description of articular cartilage micro-structure, see, for example, (Aydelotte and Kuettner, ( 19$$), nn. Ti ~. 18:205; Zanetti et al., (I9$5), J. Cell Biol. x:53; and Poole et al., (1984). Anat. 138:1 i.
Biochemically, articular cofta_en can be identified by the presence of Type II
and Type IX
collagen, as well as by the presence of well-characterized proteoglycans, and by the absence of Type X collagen, which is associated with endochondral bone fomtation.
In normal articular cartilage, a balance exists between synthesis and destruction of the above-described extracellular network- However, in tissue subjected to repeated Lrauma, for example due to friction between misalirtted bones in contact with one anottter, or in joint diseases characterized by net loss of articular cartilage, e.g., osteoartttaitis, an imbalance occurs between synthesis and degradation.

21~~~~f WO 95f33502 PC'T/I1S95/0672J
Two types of defects are recognized in alticular surfaces, i.e., full-thickness defects and supe~cial defects. Ttxese defecu cii#~fet.riot otxiy in the extent of physical damage to the cartilage, but also in the nature of the repair response ear.h type of lesion can elicit.
Full-thiclatess defects of an articulating surface include d.~urtage to the hyaline cartilage, S the calcified cartilage layer and the subchondral bone tissue with its blood vessels and bone marrow. Full-thickness defects care cause severe pain since the bone plate contains sensory nerve endings. Such defects generally arise from severe trauma atul'or during the late stages of degenerative joint disease, such as osteoartlxritis. Full-thickness defects tray, on occasion, lead to bleeding and the induction of a repair reaction from tire subcixondral bone.
In such instances, 1 d however, the repair tissue farmed is a vascularized Fibrous type of cartiIaes with insufficient biomechanical prapenies, and does not persist on a long-term basis.
hx contrast, supe~cial defects in the atticular cartilage tissue are restricted to the cartilage tissue itself. Such defects are notorious because they do not heal and shou~
no propensity 1?nr repair reactions. Superficial defects may appear as fissures, divots, or ciefu in the surface of the I S cartilane, or they may have a "crab-meat" appearance in the affected tissue. They contain no bleeding vessels (blood spots) such as are seen in full-thickness defects.
Superficial defects may have no known cause, however, they are often the result of mechanical derangemencs which lead io a wearing down of the cartilaginous tissue. Such mechanical derangements may be caused by trauma to the joirn, e.g., a displacement of tom meniscus tissue into the joint, meniscectomy, a 20 Taxation of the joint by a tom ligament, malalignmem of joints, or bone fracture, or by hereditary diseases. Superficial defects are also characteristic of early stages of degenerative joint diseases, such as osteoarchritis. Since the cartilage tissue is not ituten~ated or vascularized, superficial defec7s do not heal and often desenerate into full-thickness defects.
Replacement with prosthetic joints is currently the preferred option far serious 2S degeneration of joint function iavolving loss of articular cartilage. It is anticipated that a means for functional reconstruction of joint complexes, including regeneration and repair of anicttlar cartilage, will have a profound effect on alloplastic joint replacement su bery and the management of degenerative joint disease.
Like atticutar cartilage, joint ligaments which serve to cottneci interacting bows in the 30 joint, have little or na self-regenerative properties. Ligaments typically are composed of WO 95133502 ~ ~~ ~ ~ '~ ~ ~ PCT/US95106724 substantially parallel bundles of white Fbrous tissue. They are pliant and flexible to allow substantially complete freedom of movement, but are inextensile to prevent over-extension of the interacting bones in the joint. Like cartilage, ligament tissue is substantially devoid of blood vessels and has little or no self-regenerative progenies. Surgical repair of tom or damaged ligament tissue to date is limited to use of autogenous grafts ar synthetic materials that are surgically attached to the articular exuemities of the bones. Allogenic ligaments typically fail mechanically, presumably due to the treatments required to render these materials biocompatible.
Similarly, tendons are rope-like structures which connect muscle fibers to bone or cartilage and which are formed from substantially parallel fibroids of white connective tissue. The synovial capsule is composed of a thin layer of hgamentous tissue which encloses the joint and allows the joint to be bathed in the lubricating synovial fluid. The interior of dte joint capsule is lined with a thin membrane of connective tissue having branched connective-tissue corpuscles defmine the synovial membrane, and which is primarily responsible far secreting symovial fluid into the cavity.
Ttte integrity of this membrane therefore, is important to maintaining a souroe for the lubricating synovial fluid. Repair of these tissues in orthopedic contexts typically is limited to resutnring of existing tissue.
Bone tissue differs significantly from the outer tissues described hercinabove, including cartila;_e tissue. Specifically, bone tissue is vascularized tissue composed both of cells and a biphasic medium which is composed of a mineralized, inorganic component (primarily hydroxyapatite crystals) and an o panic component comprised primarily of Type I collagen.
Glycosaminoglycans constitute less than 290 of this ar_anic component and less than 1 r7c of the biphasic medium itself ar of bone tissue ~ ~. >,loreaver, relative to cartila~e tissue, the collagen present in bone tissue exists in a highly-organized parallel arrangement.
Bony defects, whether from degenerative, traumatic or cancerous etiologies, pose a formidable challenge to the reconsinrctive surgeon. Particularly difficult is reconstruction or repair of skeletal pans that comprise part of a multi-tissue complex, such as occurs in mammalian joints.
Mammalian bone tissue is known to contain one or more proteinaceous materials presumably active during growth and natural bone healing which cart induce a developmental cascade of cellular events resulting in endochondral bone fotmatfon. The developmental cascade involved in endochondral bone cliffcrentiatian consists of chemotaxis of ntesenchymal cells, 2~9:~a$~ , . , .,-.
proliferation of progenitor cells into chondrocy2es and osteobt'~sts, difFer~.;ntiation of cartilaee,~
vascular invasion, hone formation, r:modeling, arid finally marrow differentiation.
True osteogenic factors capable of inducing the above-described c'3scade of events that result in endochondaal hone formation haro~e naw been identified, isolateu, utd cloned. Tltesc proteins, which occur in nahrre as disulfide-bonded dimeric prateins, are referred to ire the art as "osteogenic" proteins, "osteoinductive' proteins, and "hone morphogenetic"
proteins. 14'ttedter naturally-a;cttrring or svnthetictlly prepared, these osteogertic proteins, when imp(.~nted in a mammal typically in association with a substrate that allows the attachment, proliferation ;utd differentiation of migratory progenitor cells, are capable of inducing recruitment of accessible _ 10 progenitor cells and stimulating their proliferation, inducing differentiation into chvndrocytes and osteoblasts, and turther inducing differentiation of intermediate cartilage, vascul.3rization. bore formation, remodeling, and finally rttarrow dii~'erentiation. Those proteins arc referred to as members of the Vgr-1~'OP 1 protein ::ubfantily of the TGF(3 super gene facttily of structurally related proteins. hlentbers include tfte proteins described in the att as Of I
(13h1P-7), 0f'? (BI'1F-8), BMP2, BWP3, BMP4, BItSP~, BMP6, 60A, DPP, Vgr-1 and Vgl. See., e.g.. U,S.
5,t111,ti!~1;
U.S. 5,266,683, Ozkasnak et al. (1990) EMBO !_. 9: 2085-2093, Vr'hatton ei a1.
(1991j PNAS
~iNi;t 88:92 I4-9218), ('Ozlaynak (1992) 1-Biol. Chem_ 267.25220-25x~.27 and 17.S. i,2fi6,683); (Geleste et al. (1990) PN~~S 87:9843-9847); (Lyotu et al. (I989 ) PhAS $H:4554-4558).
These disclosures describe the amino acid and DN.4 sequences, as 4ve11 as the chetnic;al and physical characteristics of these proteins. Sec also (lVozney et al. (! 988) cicnee 242:1528-1533); BMif 9 (W09 .017432, published latiteary 7, 1993); DPP (Padgett et al. (1987) Nstuy 32x:81-84. and Vg-I (Weeks (1987j Ce3.( ~I:8fi1-867).
It is an object of the ictctant invention to provide a bioresorbahle matris and device, suitable for regenerating body parts which comprise twro or more functionally-and structurally-2S associatt;d yet distinct replacement tissues in a manuual. rlnothet object is to provide compositions and methods for the repair or complete reconstruction of a mechanically and Cunciinnally viable skeletal joint in a m-ttturatl, partictdarly ;ur articulating or synovialjoint, as well as outer body parts comprising bone and bona f de hyaline camlage, widwut relying on prosthetic devices. .Mother object is to provide materials and methods for the repair of tissue defects in art articulating mammaliaujoinL so as to faun a rnechanically and functionally viable joint comprising bone and articular u~rtii.~tge, ligament, tendon, synovial nteatbrane a nd s~zwial capsule tissue. .Mother APAEN~ED SNEEt _ 6 -W0 95133502 PCT/US95IpG724 object of the invention is to provide means far restoring functional non-mineralized tissue in a skeletal joint including the avascular tissue therein.
Summary of the Invention In accordance with the present invention, methods and devices are provided for the manufacture of a live autogenous replacement part comprising plural distinct tissues. In one aspect the replacement body part includes pan or all of a mammalian skeletal joint, including an articulating or synovial joint. As described herein below, the methods and compositions of the invention are sufficient to restore mechanical and functional viable of the tissues associated with a skeletal joint, including bane (and bane ntatrowj, anicular cartilage, ligament, tendon, synaviaI
capsule and synovial membrane tissues. Thus the invention provides methods and compositions for replacement of one or more of the plural distinct tissues that define a mammalian skeletal joint.
The invention provides, in one aspect therefore, a novel matrix for forming a mechanically and structurally functional, mammalian, replacement body part comprising piural distinct tissues.
The matrix comprises intact residues specific for or characteristic of, and/or derived from at least 1 S two distinct tissues of the replacement body pan. As will be appreciated frarn the description provided herein below, the matrix can include residues specific for four or more distinct tissues.
The matrix is biocompafible and bioresorbable. Specifically, it is sufRciently free of pathogens and antigenic stimuli that can result in draft rejection. Preferably the matrix is derived from an allagenic ar xenogenic body part. Preferably, it is derived from a manmtalian donor, such as a cadaver. The body part may be rendered inen or "devitalized" by dehydration, such as by ethanol extraction and lyophilizatian, so that na residual cellular metabolism remains, but the function of endogenous growth factors and the like can be restored upon in situ reconstitution by endogenous body fluids. The treated body part which now is substantially depleted in antigenic and pathogenic components and now is biocompatible, maintains the residues specific for the plural distinct tissues constituting the body pari sought to be replaced. These residues include those of plural distinct tissues with dimensions and structural relationships to each outer which mimic those of the body pan to be replaced.
The thus treated matrix having utility in the methods attd devices of the invention lacks significant mechanical integrity as compared with native tissue and, an its own, is not sufficient to induce regeneration of a replacement body part or tissue when implanted.
However, by 7_ ~~.;~~ ~$4.
WO 95133502 1'C'TIUS95IOd729 impregnating or otherwise infusing the interstices of,the matrix with osteogenic protein sa that the protein is disposed on or adsorbed to, the surfaces of the matrix, the device of the instant invention is formed and is sulficieni to induce formation of new tissue is viva such that regeneraticm of a mechanically and functionally viable replacement body part occurs in situ.
In one preferred embodiment, the device comprises part or all of a skeletal joint excised from a mammalian donor allagenic ar xenogenic to the donee. Treated as described herein the device comprising the allogenic or xenogenic skeletal joint ( I ) is biacampatible, namely, it is non-pathogenic and sufficiently non-antigenic to prevent graft rejeetinn ~ viva, and (2) is sufficient to induce formation of a functianaily viable autagenous replacement joint in 1'14"C~, including generating functional bane, articttlar cartilage, ligament and capsule tissue in correct relation to one another such that a structurally and mechanically functional replacement joint results.
In another enibadiment, dte invention provides a device which serves as a template for forming in vivo part ar all of a skeletal synovial joint comprising plural distinct tissues and wftich , in response to marphogenic signals, induces new tissue formation, including new articular cartilage tissue from responding cells present in the synavial enviranmtent. The newly formed tissues assume the shape and function of the original tissue in the skeletal joint.
In another aspect, the irvenuon provides methods for replacing a defective body part comprising the steps of: excising the defective body pan and implanting the device of the instant im ention. In one embodiment, the method also comprises the additional step of providing a supply 2(1 of mesenchyzttal cells to the implanted device, as by threading or otherwise providing a muscle flap prefused with a blond supply into a hollow portion of the device. In another ernbodimcltG the device is implanted at a locus in the body of ttte individual distinct from tire defect site but which allows generation of the replacement body part. The autogenaus body part thus formed then can be itttplanted at the defect site.
As will be appreciated from the description provided herein, in another aspect, the invention provides devises and methods for the functional and mechanical restaratioa of one ar more individual tissues in a mammalian skeletal joint, including the non-mineralized and avascular tissue therein. Thus, in one embodiment, the invention provides methods and devices competent for restoring, without limitation, functional articular cartilage, ligament, synovial membrane and 31.) synovial capsule tissue. The metitods and devices described herein can be used far example, to _g-WO 95133502 ~, ~ ~ ~, ~ ~5 ~ PCTIUS9510G~24 correct superftcai articular cartilage defects in a joint, to replace tom or compromised ligaments and/or tendons, and to repair defects in synaviai capsule or membrane tissue.
The devices for repairing individual skeletal joint tissue comprise asteogenic protein disposed on a matrix containing residues specific far, or derived From skeletal joint tissue of the type to be restored, including, without limitation, cartilage, ligament, tendon, symovial capsule, or synovial membrane tissue. The device can take the Fomt of a solid, or it can have the physical properties of a paste or gel. Preferably, the matrix is derived from atlogenic or xenogenic tissue, and is treated as described herein to farm a biacompatible devitalized matrix.
In another embodiment the matrix can he formulated dede novo from synthetic and/or naturally-derived components. The matrix includes both (a) residues specific for, or characteristic of. the given tissue acrd , (b) materials sufficient to create a temporan~
scaffold far infiltration cells and defining a three dimensional structure which mimics the dimensions of the desired replacement tissue.Useful such materials are described herein below. Suitable tissue-specific residues can be obtained from devitalized allogenic ar xenogenic tissue and combined with the structural ntateriais 1-5 as described herein to create the synthetic matrix. In another embodiment, the matrix comprises devitalized non-mineralized tissue. In some circumstances, as in the formation of articular cartilage on subchondral bone, a non-mineralized matrix material de&ning a three-dimensional structure which allows the attachment of infiltrating cells, can be sufficient, in combination with osteogenic protein, to induce new tissue formation.
While, as described above, in a preferred embodiment the invention contemplates a device suitable as a template for forming in vivo a replacement skeletal joint. as will be appreciated by the practioner in the art, the invention contemplates, and the disclosure enables, a device suitable us a template for forming in vivo functional replacement body pans other titan skeletal joints and which comprise plural distinct tissues.
When used in accordance with the methods of the instant invention, the devices of the invention and/or the tissues which result from their application, essentially satisfy the following criteria of a preferred grafting material:
They result in formation of mechanically and functionally viable tissues narmalfy present at the site. These tissues are of art appropriate size and have correct structural wo ~sr3ssoz ~ ~ ~ ~ ~ ~ ~ rc'r~ls~s~o67za relationships so as to result in a functional body part. In. particular, the mufti-tissue replacement part, whether produced in situ at the site of intended use of remotely, becomes incorporated.
integrating with adjacent tissues, essentially maintaining its shape, and avoiding abnormal resorption, regardless of the conditions present at the recipient site.
Weiland et al. { 1983) Qig:
Orthan, ],7487 ( 1983).
2. Tile devices are capable of being precisely contoured and shaped to exactly match any defect, whichever complex skeletal yr organ shape it is meant to replace.
3. T'tte devices virtually have unlimited supply and are relatively easy to obtain.
4. 'Ihe devices have minimal donor site morbidity.
1 f.) Furthermore, the instant invention provides practitioners with materials and methods for skeletal joint repair including the repair of the bone and articuiar cartilage present therein, and which solve problems that occur using the methods and devices of the art. For example, the fttstant invention can induce formation of )~ hyaline cartilage rather than fibtncartilage at a defect site. Using the materials and methods disclosed herein, functional hyaline cartilage forms on the 15 articulating surface of bona at a defect site and does not degenerate over time to fibre-cartilage.
By contrast, prior art methods of repairing cartilage defects generally ultimately result in development of fibrous cart6lage at the defect site. Unlike hyaline cartilage, fibrocartilage lacks the physiological ability to restore articulating joints to their full capacity.
'Thus. when the instant materials are used in accordance with the instant methods, the practitioner can substantially ?0 functionally restate a cartilage defect in an articulating joint, particularly a superficial anicular castilaae defect and substantially avoid the undesirable formation of fibrvcartilage typical of prier art methods, yr degeneration into a "full-thickness defect". The invention also provides means for repairing individual tissue of a joint not readily reparable individually using prior art methods, and which, in some cases, previously warranted replacement of the eruire joint with a prosthetic device.
25 The invention further allows use of allogenic replacement materials for repairing the avascular tissue in a skeletal jainG and which result in the formation of mechanicaity and functionally viable.
replacement tissues at a joint locus.

WO 95!33502 ~ ~ ~ ~ ~ ~ ~ PCTIU595I06724 Brief Desci~tian of the Drawings While the specification concludes with claims particularly painting out and specifically claiming the subject matter which is regarded as constituting the present invention, it is believed that the invention will be better understaotl fmm the following detailed description of preferred embodirrrenLS taken in conjunction with the accompanying drawings in which:
Fig. 1 is a fragmentary front elavational view of a mammalian knee joint with sufficient tissue removed to show the articular cartilage an the condyles of the femur, the ligaments, syrtovial membrane, joint capsule, and further showing a damaged area in the articular cartilage requiring repair, FIGS. 2A through ZD are schematic representations of the elements used to generate a viable, functional glenohumoral hemi-joint in one embodiment of the invention.
Fig. 2A depicts a lyophilized allagrafr; Fig. 2B depicts osteogenic protein for application to the lyophilized allogratt of Fig. 2A; Fig. 2C depicts a muscle flap of cutaneous maximus muscie to be threaded inside the shaft of the lyophilized allagraft; and, Fig. 2D depicts a viable, functional hemi faint resulting from the combination of elements in Figs. 2A, 2B and 2C. Fig. 2D represents one embodiment of the device of the instant invention;
FIGS. 3.4 through 3D are schematic representations of the four allografis tested in the hemi-joint ofExample 2 (5 week); and FIGS. 4A through 4D are schematic representations of the four allagrafts tested in the ZQ hemi-joint of Example 3 (6 month).
In accordance with the present invention, novel materials and methods are provided for the repair and regeneration of plural distinct tissues, including manufacture of a live autogenous replacement pan comprising plural distinct tissues. In one embodiment the replacement body part is a skeletal joint, particularly an articulating joint, and includes, without limitation, residues specific for, or derived from, bane, cartila;e, ligament, tendon, sytrovial capsule and sy~novial membrane tissue.

WO 95133502 ~ ~ ~ ~ ~ ~ ~ FCTlI199i10C>72d More particularly, in one aspect, the invention provides a device comprising an osteogettic protein disposed on the surfaces of a matrix or substrate for forming a functional, mammalian replacement body part comprisin~z plural distinct tissues.' As used herein, the term "matrix" is understood to define a stmciure having interstices-for the attachment, proliferation and differentiation of inftIUating cells. It comprises residues specific for the tissue to be replaced and'or derived from the same tissue type, and has a shape and dimension when implanted which substantially mimics that of the replacement tissue desired.
As used herein, the term '"residue" is intended to mean a constituent of a given tissue, which has specificity for, or is characteristic of, the given tissue, and which is derivable from the 1 (? non-viable constituents of the given tissue. A matrix comprising these residue(s), when combined with asteogetuc pmtein, and implanted in a mammal in an environment which mimics the tissue's local enviromnent underphysiologicaI conditions, and is sufficient for formation of specific.
mechanically and furtc3ianally viable replacement tissue.
The tetra "plural distinct tissue" is intended to mean physiologically distinguishable i S tissues, such as blochentically or ultrastructurally distinguishable tissues which reside at art anatomically similar locus. In an aniculating replacement joint device for example, the maaix can coraprise residues specific for, or derived from, bone, cartilage, ligament, tendon and synovial membrane tissue. Thus, a significant aspect of the matrix of the invention is a single structure comprising residues of plural, distinct tissues, and which, when combined with an osteogettic 2(t protein as defined herein, is suitable for inducing repair or regeneration of a body part that is mechanically and functionally viable over time y ivo.
As used herein, the tents "bone" and "articular cartilage" ate intended to mean rite following: Bone refers to a calcified (mineralized) connective tissue primarily comprising a composite of deposited calcium and phosphate in the form of hydroxyapatite, collagen 2J (predominantly Type I collagen) and bone cells, such as osteoblasts, osteocynes and osteaclasts, as well as to the bone maaow tissue which forms in the interior of true endachandral bone. Cartilage refers to a type of connective tissue that contains chondrocytes embedded in an extracellular network comprising fibrils of collagen (predontinamtiy Type II collagen along with other minor typos, e.g. Types IX arid Xl), various proteogtycans (e.g., chamdroitim sulfate, keratan sulfate, and 3i7 dctntatan sulfate proteaglycans), other proteins, and water. Articular cartilage refers to hyaline or anicular cartilage, an avascular, non-mineralized tissue which covers the articulating surfaces of WO 95133502 ~ PCTlUS951U6724 the portions of bones in joints and allow°s movement in joints writhout direct bone-to-bone contact, and thereby prevents wearing down and damage to opposing bone surfaces. Most normal healthy articular cartilage is referred to as "hyaline," i.e., having a characteristic frosted glass appearance.
Under physiological conditions, articular caailage tissue rests on the underlying, mineralized bone surface, the subchondral bone, which contains highly vascularized ossicles.
These highly vascularized ossicles can provide diffusible nutrients to the overlying cartilage, but not mesenchymal stem cells.
"Ligament" is intended to mean bath the rope-like structures of white fibrous connective tissue which attach anterior extremities of intmcting bones, as well as the tissue defuring a syrrovial 1 U capsule. "Synovial membrane" is intended to define the connective tissue membrane lining the interior of the svnovial cavity and which is involved in synovial fluid secretion. "Tendon' is intended to define the connective tissue stmcmre which joins muscle to bane.
Replacement Bodv Parts As disclosed herein, the instant invention provide methods and compositions for replacing IS and repairing a defective body part. The method comprises the steps of surgically excising the defective body part, implanting a device comprising a matrix of the type described above at the site of excision, and, as necessary, surgically repairing tissues adjacent the site of excision as described herein below. For example, for synovial joint replacement, it is desirable to repair the joint capsule, including the synavial membrane and ligaments, sa as to surgically approximate the joint ZU structure as it occurs physiological conditions, thereby recreating tire avascular envirotunent which is the synavial cavity acrd which is bathed in synaviat fluid. It also is preferable to suture ar otherwise mechanically temporarily connect the implanted device to surrounding tissue.
In one embodiment the device is constructed to replace part or all of a mammalian skeletal joint stnrcture and includes a matrix having residues for plural, distinct tissues, including two or 25 more of bone, cartilage, ligament, tendon, sy°novial capsule and/or synovial membrane tissue.
In another embodiment the device is conswcted to replace an individual tissue of a mammalian skeletal joint, including an individual avascular and/or non-mineralized tissue. As demonstrated herein, the device is competent to induce functional replacement tissue fomrarion, including articular cartilage, Pram responding cells present in tire local environment, including a synovial environment, and without requiring cellular infiltration of mesenchymal cells from a vascularized muscle flap. The matrix of this embodiment comprises residues specific for, or characteristic of, and/or derived from, tissue of the same type as the individual tissue to be replaced.
In another embodiment, the matrix comprises devitalized non-mineralized tissue. In a preferred embodiment, the replacement tissue can include articular cartilage, ligament, bone, tendon or synovial capsule tissue.
In a partial or complete joint replacement, it is preferred but not required to include in the practice of the method the additional step of threading a muscle flap into a hollow portion of the implanted device.
For example, using the method described in Khouri, U.S. 5,067,963, a muscle flap, which can itself be pretreated with osteogenic protein, can be surgically introduced into a cavity in the implanted matrix, such as the marrow cavity of devitalized bone, to provide a blood supply to expedite morphogenesis of vascularized tissue and to provide a ready supply of mesenchymal stem cells.
The matrix of instant invention has utility as an implantable device when osteogenic protein is disposed on the surfaces of the matrix, present in an amount sufficient to induce formation of each of the replacement tissues. This permits regeneration of the body part within the mammal, including plural tissues of appropriate size, interrelationship, and function. Osteogenic proteins contemplated to be useful in the instant invention are described below and have been earlier-described in, for example, U.S. Pat. Nos.
4,968,590, 5,258,499 and 5,266,683. The osteogenic protein can be, for example, any of the known bone morphogenetic proteins and/or equivalents thereof described herein and/or in the art and includes naturally sourced material, recombinant material, and any material otherwise produced which is capable of inducing tissue morphogenesis.
The methods and materials of the instant invention are especially useful for the repair and/or partial or complete replacement of mammalian body joints, including, without limitation, articulating joints, particularly joints enclosed by a ligamentous capsule and bathed in synovial fluid.
In some synovial joints, the movement is uniaxial, i.e., all movements take place around one axis:
Among these are the ginglymus or hinge joint in which the axis of movement is WO 95!33502 ~ ~ l~ ~ ~ ~ ~ PCTIUS95I06724 transverse to the axes of the bones, and the trochoid or pivot joint in which the axis is longitudinal.
ht the case of biaxial synoviai joints, movements are around two axes at a right angle or any othee angle to each other: These include the condyloid, the ellipsoid, and the saddle joints. There is a third type of symovial joint, the spheroidal or ball-and-socket joint, in which the movements are polyaxial, i.e., movements are permitted in an infurite number of axes.
Finally, there are the plane or gliding-type synovial joints.
In hinge joints, the articular surfaces are molded to each other in such a manner as to permit motion in only one plane around the transverse axis. Flexion at the eltx~w joint is an example; other examples include the interphalangeal joints of both the fingers and toes. In pivot joints, movement in a pivot joint also occurs around a single axis, however, it is the longitudinal axis. There are several pivot joints in the human L7ody, such as the proximal radioulnar articulation. In condylarjoints include, movement occurs principally in one plane. The tibiofemoral articulation of ttte knee joint is an example. In ellipsoid joint include, movement is around two principal axes which are at right angles to each other. Examples of these joints include LS the radiocarpal and metacarpophalangeal joints. In a saddle joint, the atticular end of the proximal bone is concave in one axis and convex in a perpendicular axis. These surfaces fit reciprocally into convex and concave surfaces of the distal bone. The best example of a saddle joint is the carpometacarpal joint of the thumb. A ball-and-socket joint is one in which the distal bone is capable of motion around an indefinite number of axes with ane common center.
Examples of this ZO form of articulation are found in the hip and shoulder joints. A plane or gliding-type joint allows a slight slipping or sliding of tine bane over the other. Ur>like the above-described joints, the amount of motion between the surfaces is limited by the ligaments or osseous processes that surround the articulation. This is the form present in the joints between the articular processes of certain vertebrae, the carpal joints, and the intermetatarsal joints.
25 Although it is contemplated that the present invention is usable to repair defects including bone and articular cartilage elsewhere in a mammalian body, aspects of the invention are here illustrated in connection with the articulating surfaces on the femur in a knee joint 10 illustrated in FIG. I.
FIG. 1 illustrates a knee joint 10 between the bottom of a femur 1 I and the top of a tibia 30 I2. For clarity of illustration, only portions 13 and 14 of the medial and lateral collateral ligaments which movably tie the femur 1 I to the underlyin_ tibia 12 and fibula I5, are shown in -IS-WO 95133502 ~T~~~~~'7~
FIG. 1. Similarly, the joint capsule is represented by the exterior dart:
lining 25, and the sy~novial membrane, which lines the svrrovial cavity and secretes the lubricating syarovial t3uid, is represented by the intorior dark lining 2f. hloimally uUerpos~ed between tire opposing surfaces of the femur I 1 and tibia 12 are lateral and medial meniscus cartilages 16 and I7 and anterior and posterior cruciate ligaments (not shown). Tlre convexly curved condyles 20 and 21 at the lower end of the Femur 11 are normally supponed by the meniscus cartiIages 16 and 17, respectively, an the upper end of the tibia 12. Normally, the lower end of the femur I I, including the condyles 20 and 21, are covered by a layer 22 of hyaline cartilage material, referred to as the articular cartilage 22. The articuIar cartilage 22 forms a generally resilient padding which is fixed on the surface of the lower end of the femur 11 to protect the latter from wear and mechanica:f shack. Moreover, the articutar cartilage 22, when lubricated by the synovial fluid in the knee joint 10, provides a surface which is readily slidable on the underlying surfaces of the meniscus cartilages 16 and 17 (or on the upper surface of the tibia I 2 should one or both of the meniscus cartilae_e t G and 17 be partly or totally absent) during atticuIatian of the knee joint 10.
I~ A pottion of the articular cartilage may become damaged by injury or disease, or become excessively wom. FIG. 1 illustrates an example of a dammed area 23.
Matrix Considerations As will he appreciated by the skilled artisan, provided the matrix has a three dimensional structure sufFcient to act as a scaffold for infiltrating cells, arrd includes the residues specific for, 2U or characteristic of, andlor which are derived from, the same tissue type as the tissue to be repaired, tire precise nature of the substrate Per so used for the matrices disclosed herein is twi deterrrrinative of a matrix's ultimate ability N repair and regenerate replacement tissue. Irr tire instant invention, the substrate serves as a scaffold upon which certain cellular events, mediated by an osteogenic protein, necessarily will occur. The specific responses to the osteogerric protein 2S ultimately° are dictated by the endogenous microenvironment at the implant site and the developmental potential of the responding cells. As also will be appreciated by the skilled artisan, the precise choice of substrate utilized for the matrices disclosed herein will depend, irr part, upon the type of defect to be repaired, anatomical considerations such as the extent of vascularization at the defect site, and tire like.

WO h5/335U2 ~ PCTlUS9510G724 The matrix of the invention may be obtained as follows. A replacement tissue or body pan to be used as a replacement body part and witich comprises at least two distinct tissues in association to form the body part, is provided, as from a cadaver, or from a bone bank and treated, as by ethanol treatment and dehydrated by lyophilization, so that the remaining material is non-pathogenic and sufficient non-anti;enic to prevent graft rejection. As described above, the thus treated material having utility in the devices of the invention fuNler comprises the residues of the extracted tissue or tissues from which it is derived. A replacement body part matrix thus treated further is dimensioned such that the residues have a structural relationship to each other which mimic that of the body part to be replaced.
Natural-soureed Matrices Suitable allo~enic or xeno~erric matrices can be created as described herein below, using methods well known in the art. Preferably, the replacement body part or tissue is obtained fresh, from a cadaver or from a tissue bank which freezes its tissues upon harvest.
In all cases and as will be appreciated by the practitioner in the field, it is preferable to freeze any tissue upon honest, 1 S unless the tissue is to be put to immediate use. Prior to use, the tissue is treated with a suitable agent to extract the cellular non-structural components of the tissue so as to devitaIize the tissue.
The agent also should be capable of extracting any growth inhibiting components associated with the tissue, as well as to extract or otherwise destroy any pathogens. The resulting material is an acellular matrix defining interstices that can be infiltrated by cells, and is substantially depleted in non-structurally-associated components.
In a currently preferred procedure, the tissue is devitalized following a methodolo~_y such as that used in the art for fixing tissue. The tissue is exposed to a non-polar solvent, such as I009c (200 proof) ethanol, far a time sufficient to substantially replace the water content of the tissue witit ethanol and to destroy the cellular structure of tile tissue. Typically, the tissue is exposed to 200 proof ethanol for several days, at a temperature in the range of about 4° - 40°C, taking care to replace the solution with fresh etlxanal every (i-12 hours, until such time as the liquid content of the tissue comprises 70-90~7o ethanol. Typically, treatment far 3-4 days is appropriate. The volume of liquid added should be more than enough to submerge the tissue. The treated tissue then is lyophlized. The resulting, dry matrix is substantially depleted in non-structural components but retains lwth intracellular and extracellular matrix components derived from tire tissue.

~li~ BEET f t~ii~ 261 WO 95!33502 PC'C1U595106724 Numerous other methods are described in the art for extracting tissues, including mineralized tissue such as bone, and for rendering these tissues biocampatible for aIlogenic or xenagenic implants. See, for example, Sampath et al. ( 19fi3) vPl~AS $Q:6591-6595, US 5.011.691, and U.S. Patent Nos. 4,975,526 and 5,171,574. These publications describe extraction wi82 41~f guanidine-HCI, 50mM Tris-HCI, pH 7.0 far 16 hours at 4°C, and various deglycosylatin~ and collagen fibril modifying agents, including hydrogen fluoride, ttitlunrocetic acid, dichloromethane, acetonittile, isopropanol, heated, acidic aqueous solutions, and various combinations of these reagents. The disclosures of the patents is incorporated herein by reference.
As described therein and below, where the matrix is treated with a fbril-modifying agent, the treated matrix can be washed to remove any extracted components, following a fomr of the procedure set fonh below:
1. Suspend matrix preparation in TBS (Tris-buffered saiinej l g/200 ntl and stir at 4°C for 2 hrs; or in 6 Ml urea, 50 mbi Tris-I-iCl. 500 mM NaCI, pH 7.0 iU'I'BS) or water and stir at room temperature (RT) far 30 minutes tsufticient time to neutralize the pit);
2. Centrifuge and repeat wash step; and 3. Centrifu e; discard supematanr water wash residue; and then lyophilize.
Treated allogenic or xenogenic matrices are envisioned to have particular utility for creating devices for forming replacement body parts comprising plural distinct tissues, as well as for creating devices for replacing individual joint tissuas, such as ligament and articular cartilage ?0 tissue. For example, a replacement ligament device can be formulated fmm atr aLlogeniC ligament matrix and osteogerlic protein, and implanted at a skeletal joint locus following standard surgical procedures for autogenous ligament replacement. Similarly, an alloeenic articular cartilage device can be formed from devitatized cartilage tissue, or other inert, non-mineralized matri:e material and osteorertic protein, and the device laid on the subchondral bone surface as a sheet. Altemstively, a ?5 formulated device can be pulverized or otherwise mechatucalIy abraded to produce particles which can be formulated into a paste or ~eI as described herein for application to ttte bone surface.
_1g_ W0 95133302 ~ ~ ~ ~ ~ ~ ~ PCT/US95106724 Svnthetix Matrixes As an alternative to a natural-sourced matrix, or as a supplement to be used in combination with a natural-souroed matrix, a suitable matrix also can be formulated nov , using (1) residues derived from andlor characteristic of, or specific for, the same tissue type as the tissue to be repaired, and (2) one or more materialswhich serve to create a three-dimensional scaffoldins stmcmre that can be foaned or molded to take on the dimensions of the replacement tissue desired.
In some circumstances, as in the formation of articular cartilage on a subxhondral bone surface, osteogettic protein in combination with a matrix defining a three-dimensional scaffolding stmcture sufficient to allow the attachment of infiltrating cc;lls a<td camposed of a non-mineralized material can be sufficient. Any one ar combination of materials can be used to advantage, including.
without limitation, collagen; homopalymers ar copolymers of glycolic acid, lactic acid, and butyric acid, including derivatives thereof; and ceramics, such as hydraxyapatite, tricalciunt phosphate and other calcium phosphates and combinations thereof.
The tissue-specific component of a synthetic matrix readily can be obtained by devitalizing I S an altogenic or xenagenic tissue as described above and then pulerizing or otherwise mecha<icathy breaking down the insoluble mauix remaining. This particulate material then can be combined with one or morn structural materials, including those described herein.
Alternatively, tissue-specific components can be fuaher purified from the treated matrix using standard extinction procedures well characterized in the art and, using standard analysis procedures, the extracted material at each purification step can be tested for its tissue-specificity capability. See, for example. Sampath et al. ( 19$7) PNAS 7:7599-76fi3 and US 4,96$.590 for exemplary tissue extractian protocols.
A synthetic matrix may he desired where, for example, replacement artixular xartila~e is desired in an existing joint to, for example, correct a tear or limited superficial defect in the tissue, or to increase the height of tkte articular cartila~=a surface naw worn due to a~e, disease or trauma.
Such "resurfacing" of the articular cartilage layer can be achieved using the methods and campositions of the invention by, in one embadiment, treating a sheet of allogenic or xenogenic aarcular cartilage tissue as described herein, coating the resulting matrix with osteogenic protein.
ralfing up the formulated device so that it can be introduced to the joint using standard omhoscapic surgical techniques and, once provided to the site, unrolling the device as a layer onto the articular bone surface. In another embadimenG the device is formulated as a paste or injectable gel-like WO 951335(12 ~ ~ ~ ~ , ~ ~ PCTIUSgSM3G724 substance that can be injected onto the articular bone surface in the joint also using standard onhoscopic surgical techniques. In. this embodiment, the formulation may comprise a pulverized or otherwise mechanically degraded device comprising both matrix and osteogenic protein and, in addition, one or more components which serve to bind the particles into a paste-like or gel-like substance. Binding materials welt characterized in the an include, for example, cati3oxyattethylcelluLase, glycerol, polyethylene-glycol and the like.
Alternatively, the device can comprise osteogenic protein dispersed in a synthetic matrix which provides ttte desired physical properties. As an example, a sy~ntltetic matrix having tissue specificity for cattiiage and bone is described in W091/18558, published December 21, 1991 and herein below.
Briefly, the matrix 1 Q comprises a porous crasslinked strocturat polymer of biocompatible, biodegradable collagen and appropriate, tissue-specific glycosaminoglycans as tissue-specific cell attachment factors, ColIa~en derived from a number of sources can be used, inGludin~ insoluble collagen, acid-soluble collagen, collagen soluble in neutral or basic aqueous solutions, as well as those cotia5ens which are commeroially available.
IS Glycosaminoglycatts (GAGS) or mucopolysaccharides are hexosaminc-containing polysaccharides of animal origin that have a tissue specific distribution, and therefore may be used to help determine the tissue specificity of the morphogen-stimulated differentiating cells. Reaction with the GAGS also provides collagen with another valuable property, i.e., inability to provoke an immune reaction (foreign body reaction) from an animal host.
20 Chemically, GAGS are made up of residues of hexaamines gIyeosidically bottnd and alternating in a more-or-less regular manner with either hexouronic acid or hexose ntoieties (see, e.g., I7odgson et al. in Carb drate Metabolism and its Disorder (Dickens et al., eds.) Vol. 1, Academic Press ( 19b8)). Useful GAGs include hyalurotuc acid, heparin, heparin sulfate, chondroitin 6-sulfate, chondroitin 4-sulfate, dermatan sulfate, and keratin sulfate. Gther GAGS
25 also can be used for fomting the matrix described herein, and those skilled in the art will either know or be able to ascertain other suitable GAGs using no more than routine experimentation- For a mare detailed description of mucopolysaccharides, see Aspinall, P~1 e~a ' iarides. Pernamon Press, Oxford (1970).
Collagen can be reacted with a GAG in aqueous acidic solutions, preferably in diluted 3(l acetic acid solutions. By adding the GAG dropwise into the aqueous collagen dispersion, coprecipitates of tangled txallagen fibrils coated with GAG results. This tangled mass of fibers then can be homogenized to form a homogenous dispersion of fine fibers and then filtered and dried.
Insolubility of the collagen-GAG products can be raised to the desired degree by covalently cross-linking these materials, which also serves to raise the resistance to resorption of these materials. In general, any covalent cross-linking method suitable for cross-linking collagen also is suitable for cross-linking these composite materials, although cross-linking by a dehydrothermal process is preferred.
Formulation Considerations The devices of the invention can be formulated using any of the methods described in the art for formulating osteogenic devices. See, for example, U.S. Patent No. 5,266,683.
Briefly, osteogenic protein typically is dissolved in a suitable solvent and combined with the matrix. The components are allowed to associate. Typically, the combined material then is lyophilized, with the result that the osteogenic protein is disposed on, or adsorbed to the surfaces of the matrix. Useful solubilizing solvents include, without limitation, an ethanoltrifluoroacetic acid solution, e.g. 47.5% EtOH/0.01%TFA;
and acetonitrile/TFA
solution, ethanol or ethanol in water, and physiologically buffered saline solutions. Formulations in an acidic buffer can facilitate adsorption of OP1 onto the matrix surface. For the replacement body part devices of the invention, the currently preferred formulation protocol is incubation of matrix and osteogenic protein in an ethanol/TFA solution (e.g., 30-40%EtOH/0.01%TFA) for 24 hours, followed by lyophilization. This procedure is sufficient to adsorb or precipitate 70-90%
of the protein onto the matrix surface.
The quantity of osteogenic protein used will depend on the size of replacement device to be used and on the specific activity of the osteogenic protein. Typically, 0.5mg-100/10 g of matrix, dry weight, can be used to advantage.
In addition to osteogenic proteins, various growth factors, hormones, enzymes, therapeutic compositions, antibiotics, or other bioactive agents also can be adsorbed onto, or impregnated within, a substrate and released over time when implanted and the matrix slowly is absorbed. Thus various known growth factors such as EGF, PDGF, IGF, FGF, TGF-a and TGF-b can be W095l33505 ~ PCTIU99SIp672d released in vivt . The matrix can else be used to release chemotherapeutic agents, insulin, enaymes, enzyme inhibitors nr chemoiactic-chemoattractartt factors.
Protein Considerations As deFned herein, the osteagenic proteins useful in the camposi2ian and methods of the invention include the family of dimerie proteins having endochondral bone activity when implanted in a mammal in association with a matrix and which comprise a subclass of the "super family" of "TGF~i-like" proteins. The natural-sourced osteogenic protein in its mature, native fornr is a giycasylated dimer typically having an apparent molecular weight of about 30-36 kDa as determined by SDS-PAGE- When reduced, the 30 kDa protein gives rise to two glycosylated Z O peptide subuttits having apparent molecular rveimhts of about 16 kDa and 18 kDa. In the reduced state, the protein has no detectable osteo;enic activity. The unglycosylated protein, w°hich else has asteo~~enic activity, has an apparent molecular weight of about 27 k.Da. When reduced, i.he 2"r kDa protein gives rise to nvo ungiycosylated polypeptides having molecular weights of about 14 kI?a to 16 kDa capable of inducinendochondral bone formation in a mammal. Useful sequences include those comprising the C-terminal 102 amino acid sequences of DPP {from Drosophila), Vgl {from Xenopus}, Vgr-1 (from mouse), the OPl and OP2 proteins, proteins {see U.S. FaL
No. 5,011,691 and Oppemtann et al., as well as the proteins referred to as BMP2, BIvIP3.
BMP4 (see W088/00205, U. S. Patent No. 5,013,649 and W091/18098), BMPS and BMP6 (see W090,~1 I366. PCT/IJS90101630 and BMP8 and 9.
The rnembe°.rs of this family of proteins share a consewed six or seven cysteine skeleton in the C-terminal region. Sec, for example, 335-431 of Seq. ID Na. 1 and whose sequence defines the six cysteine skeleton residues referred to herein as "OPS", or residues 330-43 i of 5eq. ID No. l, comprising 102 amino acids and whose sequence defines the seven cysteine skeleton.
This family of proteins includes longer forms of a given protein, as well as phytagenetic, e.g., species artd allelic variants and biosynthetic mutants, including addition and deletion mutants and variants, such as Chase which may alter the conserved C-terminal cysteine skeleton, provided that the alteration still atlou~s the protein to form a dimeric species having a conformation capable of inducing bone formation in a mammal when implanted in the mammal in association with a matrix. In addition, the osteogenic proteins useful in devices of this invention may include fotrrts having varying glycosylation patterns and varying N-termini, may be naturally occurring or biosynthetically derived, and may be produced by' expnasion of reatmbin,un DNA
in proc;y,~utic ar eucaryotic hnst, cells. The proteins are active as a sinele species (e.g., :ts hnmodimers), or combined as a mixed species, including hetcredimers.
In one embodiment, the osteogenio protein ;:ontenrplated herein comprises OP 1 or an OP I-related sequence. Usefid Of' f sequences are recital in LIS Pat Nos.
5,011,691; 5, l (18,75 ; and 5,266,683; in Ozkaynak et al. (1!?9(7) EM1B01 <t:2t?85-~09:1, and Sampatft et al. (1993) PNrIS 9Q:
6004-6008. OP-1 relatc;d sequences include xenoganic hemologs. c.g.; 60.A, from Drosopltila, tVharton et al. (1991) PN~AS 138:9214-9218; and proteins sharing greater than fi0°~a identih cvith Of 1 in the C-terminal seven cysteine domain, preferably at Latst 65°o identity. Examples of OP-I
related sequences utcludv BMPS, BMP6 (and its species homolog Vgr-l, Lyons et al. ( 1989) fN!AS 86:4554-1;;8), Celcste. et al. ( 1990) PNAS 57:9841-9847 and PCT
international application WO!13/00432; OP-2 (Sampath et al. ( 1990,1 J.BioL Client 267: f 3198-13205) .As rvili be appreciated by those having ordinary s4:i11 in tire , rt, chim~_ric constructs readily can be created using stv~.ndard molecular bioloy and mutagenesis u;clutiques combining various porti<;ns of I 5 dif3'erent morphogenic protein sequences to create a novel sequence, and these forms of the protein also are contemplated herein.
;;?;~;
- In another preferred aspect. the invention contemplates asteogenic proteins comprising species of polypeptida chins has~ng the generic amino acid sequence herein referred to as "OPV"
which accommodates the homologies het:vaan the various idernified species of the ostcogenic OP I
ZO and OP2 proteins, and which is described bW fte amino acid sequence presented below and in Sequence TD No. ~.
Cvs Xaa !Caa His Crlu L,eu Tvr Val Ser Phc 5 I i) \a<~ :lsp Lc;tt Gly ..Crp lea Asp Trp Xaa Cle 25 15 2p :11a Pro Xaa GIy Ty-r \aa:Ala'fyr TyT Cys 25 .0 2;-AMEPdDEO SNEET

WO 95!33502 ~,, ~ ~ ~ ) ~ ~ PCTIUS95l06724 Glu GIy Glu Cys Xaa Phe Pro Leu Xaa Ser Xaa Met Asn Ala Thr Asn His Ala Lie Xaa Gln Xaa Leu Val His Xaa Xaa Xaa Fro Xaa Xaa Val Pro Lys Xaa Cys Cys Ala Pn Thr Xaa Leu Xaa Ala Xaa Ser Val Leu Tyr Xaa Asp Xaa Ser Xaa Asn Val Ile Leu Xaa Lys Xaa Arg Asn Met Val Val Xaa Ala Cys Gly 1~ Cys His, and wherein Xaa at res. 2 = (Lys or Arg); Xaa at res. 3 = (Lys or Ark); Xaa at res, i I = (Arg or Gln): Xaa at res. 16 = (Gln or Leu}; Xaa at res. 19 = (lle or Val); Xaa at res. 23 = (Glu or Gln);
Xaa at res. 26 = (Ala or Ser); Xaa at res. 35 = (Ala ar Ser}; Xaa at res. 39 =
(Asn or Asp); Xaa at res. 41 = (Ty~r or Cys): Xaa at res. 50 = ( Val or Leu): Xaa at res. 52 = (Ser or Tlir); Xau at res. 56 = (Phe or Leu}; Xaa at res. 57 = (Ile or Met); Xaa at res. 58 = (Asn or Lys);
Xaa at res. 60 = (Glu, Asp or Asn); Xaa at res. 61 = (Tttr. Ala or Val); Xaa at res. 65 = (Pro or Ala}; Xaa at res. 71 =
(Gln or Lys); Xaa at res. 73 = (Asn or Ser); Xaa at res. 75 = (Ile or Thr):
Xaa at res. 80 = (Phe or _24_ Tyr); Xaa at res. 82=(Asp or Ser); Xaa at res. 84=(Ser or Asn); Xaa at res.
89=(Lys or Arg); Xaa at res.
91=(Tyr or His); and Xaa at res. 97=(Arg or Lys).
In still another preferred aspect, one or both of the polypeptide chain subunits of the osteogenerically active dimer is encoded by nucleic acids which hybridize to DNA or RNA sequences encoding the active region of OP1 under stringent hybridization conditions. As used herein, stringent hybridization conditions are defined as hybridization in 40% formamide, 5 X
SSPE, 5 X Denhardt's Solution, and 0.1% SDS at 37°C overnight, and washing in 0.1 X SSPE, 0.1% SDS at 50°C.
Given the foregoing amino acid and DNA sequence information, the level of skill in the art, and the disclosures of numerous publications on osteogenic proteins, including U.S. Patent 5,011,691 and published PCT specification US 89/01469, published as WO 89/09788, published October 19, 1989, various DNAs can be constructed which encode at least the active domain of an osteogenic protein useful in the devices of this invention, and various analogs thereof (including species and allelic variants and those containing genetically engineered mutations), as well as fusion proteins, truncated forms of the mature proteins, deletion and addition mutants, and similar constructs which can be used in the devices and methods of the invention. Moreover, DNA hybridization probes can be constructed from fragments of any of these proteins, or designed de novo from the generic sequence. These probes then can be used to screen different genomic and cDNA libraries to identify additional osteogenic proteins useful in the prosthetic devices of this invention.
The DNAs can be produced by those skilled in the art using well known DNA
manipulation techniques involving genomic and cDNA isolation, construction of synthetic DNA
from synthesized oligonucleotides, and cassette mutagenesis techniques. 15-100mer oligonucloetides may be synthesized on a DNA synthesizer, and purified by polyacrylamide gel electrophoresis (PAGE) in Tris-Borate-EDTA
buffer. The DNA then may be electroeluted from the gel. Overlapping oligomers may be phosphorylated by T4 polynucleotide kinase and ligated into larger blocks which may also be purified by PAGE.
The DNA from appropriately identified clones then can be isolated, subcloned (preferably into an expression vector), and sequenced. Plasmids containing sequences of interest then can be transfected into an appropriate host cell for protein expression and further characterization.
The host may be a procaryotic or eurcaryotic cell since the former's inability to glycosylate protein will not destroy the protein's morphogenic activity. Useful host cells include E.
Vii, Saccharom cee, the insect/baculovirus cell system, myeloma cells. CHO cells and various other mammalian cells.
The vectors additionally may encode various sequences to promote correct expression of the recombinant protein, including transcription promoter and termination sequences. enhancer S sequences, preferred ribosome binding site sequences, preferred mRIv'A
leader sequences, preferred signal sequences for protein secretion, and the like.
The DNA sequence encoding the gene of interest also may be manipulated to remove potentially inhibiting sequences or to minimize unwanted secondary structure formation. The recombinant osteogenic protein also may be expressed as a fusion protein.
After being translated.
the protein may be purified from the cells themselves or recovered from die culture medium. All biologically active protein forms comprise dimeric species joined by disulfide bonds or otherwise associated, produced by folding and oxidizing one or more of the various recombinant polypeptide chains within an appropriate eucaryotic cell or in vitro after expression of individual subunics. A
detailed description of osteogenic proteins expressed from recombinant DNA in E. coli and in numerous different mammalian cells is disclosed in U.S. Patent No. 5.266.963.
Alternatively, osteogenic polypeptide chains can be synthesized chemically using conventional peptide synthesis techniques well known to those having ordinary skill in the art. For example, the proteins may be synthesized intact or in pans on a solid phase peptide synthesizer, using standard operating procedures. Completed chains then are deprotected and purified by HPLC (high pressure liquid chromatography). If the protein is synthesized in parts. the parts may be peptide bonded using standara methodologies to form the intact protein. In general, the manner in which the osteogenic proteins are made can be conventional and does not form a part of this invention.
Exemplification The means for making and using the matrices and devices of the invention, as well as other material aspects concemin~ the nature and utility of these compositions, including how to make and how to use the subject matter claimed, will be further understood from the following, which constitutes the best mode currently contemplated for practicing the invention.
It will be ~~.9~.~8~
appreciated that the invention is not limited to such exemplary work or to the specific details set forth in these examples.
In the exemglification, a hemi-joint reconswction of an articulating synoviai joint is resected into an existing joint locus. As will be agpreciated by those havinS
ordinary skill in the art, the methods and compositions of the invention equally can be apglied to the formation of replacement body parts other than skeletal joints, as well as to skeletal joints other than articulating or synovial joints. Moreover, if desired, a replacement autogenous joint can be constructed in the recipient first by placing the device of the invention at another convenient locus distal to tile defect site, for a time sufficient to induce formation of tire replacement body part, and the autogenous body part thus formed then sutured into the joint locus for use.
Examgl~ Reconstruction of a n4ammalian Hemi-Joint New Zealand white rabbits were used as the experimental model. Standard orthopedic surgical equipment and grocedures were used.
As depicted in Fig. ?.A, joint defects were created irr a recipient by surgically resectin, the entire gleno-hrrmerat hemiarticular complex with the proximal two-thirds of the humerus. ' Allograft-s for implantation were prepared from hemi-joints excised from a donor attimal with tile articular surface of the glenohumoral joint. All allografts were extracted in ethanol and lyoptrilized using standard procedures, and as described herein above, to destroy the palhogetricity and antigenicity of tire material. Sgecifically, intact joint complexes were excised, demarraowcd and ethanol treated by exposure to 200m1-500m1 of 200 grcrof etiranol for 72 hours at 40 C. Fresh ethanol was provided every fi-8 hours. Fallowin, ethanol treatment, the matrix was lyophilized and rehydrated in ethanoInPA, with or without asteagenic protein. The treated hemi-joints comprised devitalized bone, articular cartilage, ligament, tendon, synovialcapsule and synovial membrane tissue.
As illustrated in Fig. 213, all lyophilized, osteo~~enic protein-treated allografts were coated with OP-I as described in U.S. 5.011,691. Specifically, mature, dimeric recombinant OP-1 (rhOPl ) was solubllized in an acetonitrile trifiuoro-acetic acid solution, combined with the lyophilized alJogmft, and implanted. 15-20 mg gtntein/8-10 g matrix, dry weight, was used. The distal bone portions of all allografts were secured in place with a four hole titanium miniglate. A

tllltE SdEEt 1~1~ 261 meticulous surgical reconstruction of the joint capsule was performed by suturing the lyophilized capsule ends to the endogenous capsule using standard surgical procedures well established in the art using standard surgical procedures well established in the art. 'Ibis recreated an intact capsule and synovial lining, thereby restoring the synovial milieu of the grafted articular surface. Motion was permitted almost immediately after surgery, again to restore normal joint conditions.
In some animals, local muscle flaps (cutaneous maximus muscle; Fig. 2C) were incorporated into the region of the defect by threading muscle into the marrow cavity of the allograft as depicted in Fig. 2D using the method of Khouri as described in U.S. 5,067,963.
Briefly, vascularized and convenient muscle flaps were dissected using standard procedures well ~o~ to the practitioner in reconstructive surgery, so as to maintain a perfusing blood supply, and threaded inside the bone marrow cavities of the allografts.
Preliminary evaluations of the reconstructed hemi-joints were obtained by serial weekly radiographs using X-ray, and/or magnetic resonance imaging (MRI). Histological and mechanical confitmatory evaluations were conducted upon sacrifice at 5 weeks and 6 months after surgery.
Mechanical evaluations involved standard range of motion (ROM) measurements obtained serially until sacrifice. Histolo~ical evaluations involved staining sagital sections through the harvested allografts using standard techniques.
Briefly, identification of na fide articular cartilage can be accomplished using ultrastruciural and/or biochemical parameters. For example. articular cartila=a forms a continuous layer of cartila=e tissue possessing identifiable zones. The superficial zone is characterized by chondrocytes having a flattened morphology and an extracellular network which does not stain, or stains poorly, with toluidine blue, indicating the relative absence of sulphated proteoglycans.
Chondrocytes in the mid and deep zones have a spherical appearance and the matrix contains abundant sulphated proteoglycans, as evidenced by staining with toluidine blue. Collagen fibers are present diffusely throughout the matrix. The chondrocytes possess abundant rough endoplasmic reticulum and are surrounded by extracellular network. The pericellular network contains numerous thin non-banded collagen fibers. The collagen in the interterritorial network is less compacted and embedded in electron translucent amorphous material, similar to articular 28 .

cartilage. Collagen fibers in the interterritorial region of the network exhibit the periodic banding characteristic of collagen fibers in the interterritorial zone of cartilage tissue.
Biochemically, the presence of Type II and Type IX collagen in the cartilage tissue is indicative of the differentiated phenotype of chondrocytes. The presence of Type II and/or Type IX collagen can be determined by standard gel electrophoresis. Western blot analysis and/or immunohisto-chemical staining using, for example, commercially available antibody. Other biochemical markers include hematoxylin, eosin. Goldner's Trichrome and Safranin-O.
Articular cartila_e regeneration was evaluated histologically in the examples described herein using glycosaminoglycan-specific stains and techniques well-known in the art. For the initial histologic evaluation, the defect sites were bisected lengthwise through the center of the defect. The resulting halves and surrounding tissue were embedded in paraffin and sectioned across the center of the defect. One half of each defect was utilized for histolo~ical staining with toluidine blue and/or hematoxlin and eosin. Goldner's Trichrome and Safranin-O. The other half was used in preparing sections for immunostaining. Histological evaluations involved assessment of: glycosaminoglycan content in the repair cartilage; cartila_e and chondroc~~te morphology; and.
structural integrity and morphology at the defect interface. The morphology of the repair cartilage was exhibited for the type of cartilage formed: articular vs. fibrotic by evaluating glycosaminoglycan content, degree of cartilage deposition, and the like.
Histological evaluations using standard methodologies well characterized in the art also 2C? allows assessment of new bone and bone marrow formation. See, for example, U.S. Pat. No.
5,266,683. Similarly, ligament and synovial capsule integrity can be monitored by MRI, as well as by histology upon sacrifice Example 2 Five Weeks Duration (Short Term) For the 5 week study, four groups with 10 rabbits per group were implanted with lyophilized allografu. See Figs. 3A, 3B, 3C, and 3D. In Group I, control lyophilized allogr~aft 30 free of osteogertic protein, was implanted (Fig. 3A). In Group 2, experimental lyophilized allograft 31 was impregnated with OP-1 prior to implantation (Fig. 3B). In Group 3, control lyophilized allograft 30 free of osteogenic protein, was implanted, with muscle flap 32 threaded into marrow cavity 33 (Fig. 3C). In Group 4, experimental lyophilized allograft 31 was impregnated with OP-1 W 0 95I335ti2 PCTIUS95f06724 ~~~IaB~
prior io implantation, and muscle flap 32 was threaded within the marrow cavity 33 (Fig. 3I7).
As stated above, graft healing was followed non-invasively with serial X-mys and standard IslR1 (magnetic resonance imaging). By X-ray assessment, allografts treated with osteongie protein had a noticeably thickened cortex by 1 week post-operative, as compared with control allografts (Groups I, 3) which evidenced only a Thin egg-shed-like conex. By four weeks the majority control allografts had fractured and were unstable. In contrast, OP-1 treated alIografts (Groups 2, 4) remained stable.
MRI also was used as a non-invasive means for following reformation of atticular cartilage fn the allografrs. A dark signal graduced by MRI represents absent or nonviable 1() cartilage, while a btighi signal indicates live, viable cartilage. Controd allografLS produced only a dark signal, when tested at i , 3 and 5 weeks post-operative. These MRI
findings were confirmed by histalogical analysis perfumted at 5 weeks post-operative. Sagital sectionin4 through control allografts showed a degenerated articuiar surface with no live cells.
By contrast, the MRI findings of the articular caps from OP-1-treated allagrafts showed a 15 bright signal by week 3 gust-operative, indicating regeneration of viable articular cartilage.
Histalogi~I analysis of the OP-1-treated allagrafts at week 5 revealed a layer of newly generated articular cat2ilage on top of the alIograft matrix. The allografts of Group 4 showed somewhat thicker canilaae layers titan those of Group 2, suggesting that the addition of the muscle flap may further enhance the mte ai-joint regeneration 2Q Additionally, joints regenerated with the OP-I-treated allozrafrs regained near notntat range of motion by the time they were harvested at 5 weeks post-reconstruction. The near normal range of motion also is itu7icative of the presence of lubricating synovial fluid. By contrast, the harvested control allografts were stiff and contracted at harvest. Thus, hemf-joint replacement devices of the invention succeeded in forming mechanically and functionally viable replacement 25 joints, with an intact capsule, and synovium, and functioning ligament, bone and articular cartilage tissue, In the absence of osteogenic protein, the allografts, white not rejected by the donor, are insufficient an their own to generate a functional, weight bearing joint.

~1~~.~$~
Example 3 Six h4anths Duration - lLon~ Term) For the 6 month study, the variable of shaving off the ald cartilaginous cap in the lyophilized allografts was introduced. Briefly, this was accomplished by mechanically sharing the articular cartilage cap of the joint surface.
The following groups were used with 4 rabbits per group: in Group 5, lyophilized allograft 34 with shaved articular surface, and muscle flap 32 were implanted (see Fig.
4A); in Group 6, control lyophilized allograft 30 with non-shaved anicular surface, and muscle flap 32 were implanted (see Fia. 4B); in Group 7, lyopMlized allograft 35 with shaved articular surface and OP-1, and muscle flap 36 treated with OP-1 were implanted (see Fi~_. 4C); and, in Group S, lyophilized allograft 37 with a non-shaved anicular surface and OP-1, and muscle flap 36 treated with OP-I
were implanted (see Fig. 4D). Grafrs in Groups 5-S were harvested at 6 months after suruen~.
Based upon pre-harvest imaging studies, the results collected by 3 months post-operative are consistent with the above-described results collected at 5 weeks. Intact allografts treated with OP-I (Group S) regenerated a live cartilaginous anicular surface by 3 weeks when evaluated using MRI. This anicular cap is still present and even better developed at 3 months.
~fithout OP-1 treatment of the allagraft, (Group 6) there was negligible cartilage regeneration relative to the OP-1 treated groups.
Similarly, Group 8 rabbits (allograft + OPI, non-shaved) regained near normal ranee of motion (greater than S09c) in Ute rcconstntcted joint. Group 7 rabbits (allograft + OPI, shaved'1 achieved only SO~o range of motion, and Groups 5 and 6 (no OPI) achieved less than 300.
As determined by histology, the devices of the invention were competent to induce and maintain both bone and articular cartilage forxnatian in the appropriate context to one another in a long temt study(greater than 6 months). Specifically, the rabbits of Group S, demonstrated articular cartilage formation on the surface of bone, as evidenced morphologically by die presence of resting, central and deeper zone chondrocynes. By contrast, in groups treated only with muscle flap, (Group 5 and 6) muscle was replaced witty soar tissue. In the groups treated with shaved bone matrices, no significant cartilage regeneration was identified, demonstrating the requirement for cartilage-specific residues in anicular cartilage formation in a non-vasculatizcd mileiu.

WO 9513351!2 ~ ~ ~ ~ ) ~ I~ PCTIUS95108724 In both the short terat and long term study, mechanically and functionally viable sy~navial joints resulted from the reconstructed hemijoints treated with osteogendc protein, as evidenced by morphology and biochemistry. In addition, new tissue formed, including articular cartilage, corresponding in shape, kind and snucturai relationship to the residues itr the devitalizecl tissue which formed the matrix of the device. Collectively, these examples demorvstrate Brat a device comprising osteogenic protein and an off the-shelf, non-viable lyophilized, devitalized matrix cart be transformed into aviable, mechanically and structurally functional replacement body part structure comprising plural distinct newly farmed tissues which assume rite shape and function of the original tissue. Tire device cart restore normal function to a destroyed body part, including a I CI destroyed skeletal joins, restoring mechanically and functionally viable plural disftrtct tissues, including bane and bane marrcnv, anicular cartilage, ligament, tendon, synovial capsule and sytrovial membrane tissue. btoreover, these tissues are restored under substantially physiological conditionsincluding, for example, from responding cells present in a sy~ttavial environment, and without exposure to avascularized muscle #lap.
I S A device comprising osteogettic protein-treated matrices, including lyophilized allografcs or xetmarafts as disclosed herein can lead to the formation of a new, mechanically, structurally and functionally viable replacement tissue, and to replacement body parts comprising plural distinct tissues, populated by the host cells, and without any of the limitations of prosthetic materials.
(hose skilled in the art wiB know, or be able to ascertain using no mare than routine 21) experimentation, many equivalents to the specific embodiments of the invention described herein.
These and all outer equivalents are intended to be encompasmd by the folluwin~= claims.

WO 95!33502 PCTIUS95l0672d 2I~1. ~8~
S SEQUENCE LISTING
(1) GENERAL ItIFORMATION:
IO (i) APPLICANT:
(A) NAME: CRErITI~'E BIOMOLCULES, INC
(B) STREET: 45 SOUTH STREET
(C) CITY: HOPKINTON
IS (D) STATE: MA
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 01748 (G) TELEPHONE: (50$)-435-9001 (H) TELEFAX: (508)-435-0992 2O (I) TELEX:
(ii) TITLE OF INVELSTION: MANUFACTURE OF AUTOGENOUS REPLACEMENT
BODY PARTS
2S (iii) NUMBER OF SEQUENCES: 3 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: PATENT ADMINISTRATOR, TESTA, HURWZTZ &
THIBEAULT
3O (B) STREET: 53 STATE STREET
(C) CITY: BOSTON
(D) STATE: MA
(E) COUNTRY: USA
(F) ZIP: 02109 3S (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
4O (D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US
(H) FILING DATE:
4S (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION t,7UtiBER:
(B) FILING DATE:
SO (viii) ATTORNEY/AGENT It~IFORMATION:
(A) NAME: KELLEY, ROBIN D.
(B) REGISTRATION NUMBER: 34,637 (C) REFER~NCE/DOCK~T NUMEER: CRPIO1PC
SS (ix) TELECOMMUNICATIOI9 INFORMATION:
(A) TELEPHONE: 617/248-7000 (B) TELEFAX: 617/248-7100 EO (2) IIQFORMATICN FOR SEQ ID N0:1:
(i) SEQUEt4CE CHARACTERISTICS:
(A) LENGTH: 1822 base pairs 6S (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

5~1~' ~il~T l~iE~ ~'J~It1 W0 )5133502 PCT/US9RlOfi724 (i.ii9 HYPOTHETICAL: td0 (iv) ANTI-SENSE: NO

IO (vi) OAIGIPdAL SOURCE:

(A) ORGANISM: HOMO SAPIENS

(F) TISSUE TYPE: HIPPOCAMPUS

(ix) FEATURE:

IS (A) NAME/&EY: CDS

(B) LOCATION: 49..1341 (C) IDEPtTIFICATION METHOD: experimental (DD OTHER IPdFORMATION: /function= "OSTEOGENIC
PROTEIN"

/product= "OP3"

Jevidence= EXPERIMENTAL

/standard_name= "OP1~

2$ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Met His Va1 CTG

Arg SerLeu ArgAlaAla AlaProHisSer PheValAla LeuTrpAla Pro LeuPhe LeuLeuArg SerAlaLeuAla AspFheSer LeuAspAsn 4~ Glu ValHis SerSerPhe ZleHisArgArg LeuArgSer G1nGluArg CGG GAGATG CAGCGCGAG FiTCCTCTCCATT TTGGGCT3'GCCCCACCGC 249 Arg GluMet GlnArgGlu IleLeuSerIle LeuGlyLeu ProHisArg Pro A.rgPro HisLeuGln G1yLysHisAsn SerAlaPro MetPheMet $~

Leu AspLeu TyrAsnAla MetAlaValGlu GluGlyGly GlyProGly S$ GGC CAGGGC TTCTCCTAC CCCTACRAGGCC GTCTTCAGT ACCCAGGGC 393 G1y GlnGly PheSerTyr ProTyrLysAla ValPheSer ThrGlnGly CCC CCTCTG GCCAGCCTG CP.AGATAGCCAT TTCCTCACC GACGCCGAC 441 f7~Pro ProLeu AlaSerLeu GlnAspSerHis PheLeuThr AspAlaAsp P.TGGTCATG AGCTTCGTC ARCCTCGTGGAR CATGACRAG GARTTCTTC 489 Met ValhietSerPheVal AsnLeuValGlu HisAspLys GluPhePhe f~$ 135 140 14S

His ProArg TyrHisHis ArgGluPheArg PheAspLeu SerLysIle W 0 951335Q2 PCTlUS95/06724 GAA GCT GTC TAC GAC
ACG GCA GCC I1e Lys GAA TTC CGG Tyr Asp Pro Glu GIy Glu Ala Val Thr Ala Ala Glu Phe Arg TAC fiTC CGG TTC CGGFTCAGC GTT 633 GAA CGC TTC Phe ArgIleSer TAT
GAC AAT GAG 190 Val ACG Tyr Tyr Ile Arg 195 Glu Arg Phe Asp Asn G1u Thr IS CAG GTG CTC CACTTG AGGGAATCG GA2'CTCTTC CTGCTC 681 CAG GAG HisGGC ArgGluSer AspLeuPhe LeuLeu Gln Val Leu Leu 205 210 Gln Glu Gly 2~ ACC Leu TrpAlaSer GluGluGly TrpLeuVal PheAsp Asp Ser Arg 220 225 Thr ATC ACA GCC AGC AACCAC'IGGGTGGTCAAT CCGCGGCAC AACCTG 777 2S ACC Ser AsnHisTrp ValValAsn ProfirgHis AsnLeu Ile Thr Ala 235 240 Thr 30 CTC Ser ValGluThr LeuAspGly GlnSerI1e AsnPro Gly Leu Gln 2so 2s5 Leu 24s AAG TTG GCG CTG ATTGGGCGG CACGGGCCC CAGAACAAG CfiGCCC 873 GGC Leu IleGlyArg HisGlyPra GlnAsnLys GlnPro Lys Leu Ala 265 270 275 Gly GCT Phe PheLysAla .ThrGluVal HisPheArg SerIle Phe Met Val 280 285 290 Ala CGG TCC ACG AGC AAACAGCGC AGCCAGA~1CCGCTCCAAG ACGCCC 969 4~ GGG Ser LysGlnArg SerGlnAsn ArgSerLys ThrPro Arg Ser Thr 300 305 Gly '~SGAA Ala LeuArgMet AlaAsnVal AlaGluAsn SerSer Lys Asn Gln 315 320 Glu AGG Gln filaCysLys LysHisGlu LeuTyrVa1 SerPhe so Ser Asp G1n 330 335 Arg GGC Trp GlnAspTrp I1eIleAla ProGluGly TyrA1a Arg Asp Leu 345 350, 355 Gly TGT Glu GlyGluCys AlaPhePra LeuAsnSer 2"yrMet fila Tyr Tyr 360 365 370 Cys fiAC GCC fiCC CAC GCCATCGTG CAGACGCTG GTCCACTTC ATCAAC 1209 6~ AAC His AlaIleVal GlnThrLeu ValHisPhe I1eAsn Asn Ala Thr 380 385 Asn 6S GTG Pro LysProCys CysAlaPro ThrGlnLeu AsnAla Pro Glu Thr 395 400 VaI

CTC TTC AspAsp SerSerAsn ValIleLeu LysLys , I1e Ser Val Tyr Leu Phe VV~ 95133:Sf12 ~ ~ ~ ~~ ~ ~ PCTlUS95/06724 $ 405 410 415 TAC AGA C ATG TGT GGC CAC. TAGCTCCTCC 1351 AA GTG GTC TGC
CGG GCC

Tyr Arg n Met Cys Gly His As Val Val Cys Arg Ala 420 425 43D '.

GAACCAGCAGACCAACTGCCTTTTGTGAGACCTTCCCCTCCCTATCCCCAACTTTnAAGG1471 ~S 'SGTGAGAGTATTAGGAAACATGAGCAGCATA'mGCTTTTGATCAGTTTT'I'CAGTGGCAGCI53I

ATCCAA'IGAACAAGATCCTACAAGCTGTGCACGCAAAACCTAGCAGGAAAAAAAAACAAC1591 ~S CTGTAATAAATGTCACAATAAAACGAATGAATGAAAAAAAAAAAA~;A.AAAA 1822 (2) INFpRMATION FOR SEQ ID N0:2:
(1) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 431 amino acids (F3) TYPE: amino acid {D) TOPOLpGY: linear {ii) MGLECULE TYPE: protein (rci) SEQUENCE DESCRIPTIOfI: SEQ ID N0:2:
4~ Met His Val Arg Ser Leu Arg Ala Ala Ala Pro His 5er Phe Val Ala 1 s to is Leu Trp Ala Pro Leu. Pha Leu Leu Arg Ser Ala Lau Ala Asp Phe Ser 45 2° 25 3D
Leu Asp Asn Glu Val His Ser Ser Phe Ile His Arg Arg Lau Arg Ser Gln Glu Arg Arg Glu Met Gln Arg Glu. Ile Leu Ser Ile Leu Gly Leu Pro His Arg Pro Arg Pro His Leu Gln Gly Lys His Asn Ser A1a pro SS Met Phe Met Leu Asp Leu Tyr Asn Ala hSet Ala Val Glu Glu Gly Gly Gly Pro Gly Gly Gln G1y Phe Ser Tyr Pro Tyr Lys AIa Val Fhe Ser dO 1D0 1D5 110 Thr Gln Gly Pro Pro Leu Ala Ser Leu Gln Asp Ser His Phe Leu Thr Asp Al.a Asp Met Val Met Ser Phe Val Asn Leu Va1 G1u His Asp Lys ~S 130 135 140 Glu Phe Phe FFis Pra Arg Tyr His His Rrg Glu Pha Arg Phe Asp Leu R'O 95133502 PCTN595t06724 ~19158~:
Ser Lys Ile Pro Glu Gly Glu Rla Val Thr Ala Ala Glu Phe Arg Ile to Tyr Lys Rsp Tyr Ile Arg G1u Arg Phe Asp Rsn Glu Thr Phe Arg Ile Ser Val Tyr Gln Val Leu Gln Glu His Leu Gly Arg Glu Ser Asp Leu 1°5 240 245 Phe Leu Leu Asp Ser Arg Thr Lau Trp Ala Ser Glu G1u Gly Trp Leu Val Phe Rsp Ile Thr Ala Thr Ser Asn His Trp Val Va1 Asn Pro Arg His Asn Leu Gly Leu Gln Leu Ser Val Glu Thr Leu Asp Gly Gln Ser I1e Asn Pro Lys Leu Ala Gly Leu Ile Gly Arg His Gly Pro Gln Asn Lys Gln Pro Phe Met Val Rla Phe Phe Lys Ala Thr Glu Val His Phe 3~ Arg Ser Ile Arg Ser Thr Gly Ser Lys Gln Arg Ser G1n Asn Arg Ser Lys Thr Pro Lys Asn G1n Glu Ala Leu Arg Met Ala Asn Val A13 Glu Asn Ser Ser Ser Asp Gln Arg Gln Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp Gln Rsp Trp I1e Ile AIa Pro Glu 4~ 340 345 350 Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pra Leu Asn Ser Tyr Met Asn Ala Thr Rsn His Ala Ile Val Gln Thr Leu Val His Phe Ile Asn Pro Glu Thr Val Pro Lys Pro Cys Cys A1a Pro Thr Gln Leu Asn Ala I1e Ser VaI Leu T,.r Phe Rsp Asp Ser Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Va1 Val Arg Ala Cys Gly Cys His I2) INFORMATION FOR SEQ ID N0:3c EO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 142 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE:

~~1~l~ESI~T IR111 ~ 9~1 (A) NA.ME/KEY: Frotein (B) LOCATSGN: 1..102 (D) OTHER IfIFORMATIGfd: /latxl= GPX
/note=. 'Y:HEREIN ERCH XAR IS INDEPENDENTLY SELECTED
FROM A GROUP OF ONE OR MGRE SPECIFIED P.MINO ACIDS
LO AS DEFINED IN THE SPECIFICP.TION' (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
1S Cys Xaa Xaa His Glu Leu 'tyr Val Xaa Phe Xaa Asp Leu Gly Trp Xaa Asp Trp Xaa Ile Ala Pro Xaa Gly Tyr Xaa Ala Tyr Tyr Cys Glu Gly Glu Cys Xaa Phe Pro Leu Xaa Ser Xaa Met Asn Ala Thr Asn His Rl.a.

Ile Xaa Gln Xaa Leu Val His Xaa Xaa Xaa Pro Xaa Xaa Val Pro Lys ~5 SG SS 60 Xaa Cys Cys Ala Pre Thr Xaa Leu Xaa A1a Xaa Ser Va1 Leu Tyr Xaa 3~ Asp Xaa Ser Xaa Asn Val Xaa Leu Xaa Lys Xaa Arg Asn 24et Val Va1 Xaa Ala Cys Gly Cys His lno '~~

Claims (65)

The embodiments of the invention in which exclusive property or privilege is claimed are defined as follows:

1. A device for implantation in a mammal which serves as a template to form in vivo a functional replacement skeletal joint comprising plural distinct tissues, wherein at least one of said plural distinct tissue is a non-mineralized tissue, the device comprising:
(a) a biocompatible, biodegradable matrix defining a single structure allowing the attachment of infiltrating cells and comprising residues having specificity for, or derived from plural distinct tissues of a skeletal joint, at least one of said tissues being a non-mineralized tissue; and having dimensions and shape which mimic that of the skeletal joint to be replaced; and disposed on the surface of said matrix, (b) an osteogenic protein in an amount sufficient to induce formation of new said plural distinct tissues having dimensions and shape which mimic the skeletal joint to be replaced, at least one of said new tissues being a non-mineralized tissue, thereby to permit regeneration of a functional skeletal joint.

2. The device of claim 1 wherein said matrix comprises devitalized tissue from a mammalian donor.

3. The device of claim 1 wherein said matrix comprises residues of articular cartilage and of bone.

4. The device of claim 1 wherein the matrix comprises dehydrated mammalian tissue.

5. The device of claim 1 wherein said replacement non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, tendon, menisci, intervertebral discs, synovial capsule and synovial membrane tissue.

6. The device of claim 1 wherein said skeletal joint defines a synovial or articulating joint.

7. The device of claim 1 wherein said device defines a devitalized intact skeletal joint structure.

8. A device for implantation in a mammal forming in vivo articular cartilage replacement tissue in a skeletal joint, the device comprising:
exogenous osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix said matrix comprising plural distinct tissues derived from a joint including articular cartilage, said tissues defining a unitary structure which allows the attachment of infiltrating cells thereby to permit regeneration of said articular cartilage in said skeletal joint.

9. A device for implantation in a mammal for forming in vivo replacement non-mineralized tissue in a skeletal joint, the device comprising:
exogenous osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix, said matrix comprising plural distinct tissues derived from a joint including at least one non-mineralized tissue corresponding in kind to said tissue to be replaced, said matrix defining a unitary structure which allows the attachment of infiltrating cells thereby to permit regeneration of non-mineralized tissue in a skeletal joint.

10. The device of claim 9 wherein said non-mineralized tissue is an avascular tissue.

11. The device of claim 9 wherein said non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, tendon, menisci, intervertebral discs, synovial membrane and synovial capsule tissue.

12. The device of any one of claims 1, 8 or 9 wherein said matrix comprises devitalized allogenic or xenogenic tissues.

13. The device of any one of claims 1, 8 or 9 wherein said matrix comprises a material selected from the group consisting of: collagen, polymers comprising monomers of lactic acid, glycolic acid, butyric acid and combinations thereof, hydroxyapatite, tricalcium phosphate, and mixtures thereof.

14. The device of claim 13 further comprising a material suitable for binding particulate matter to form a moldable solid.

15. The device of any one of claims 1, 8 or 9 wherein said osteogenic protein comprises homodimers or heterodimers of OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX, or functional equivalents thereof.

16. A use of a device in the formation of an autologous replacement skeletal joint comprising plural distinct tissues wherein at least one of said plural distinct tissues is a non-mineralized tissue, by implanting said device at a locus in a mammal, thereby to induce formation of a functional skeletal joint, said device comprising exogenous osteogenic protein disposed on the surface of a bioresorbable, biocompatible matrix, said matrix defining a single structure allowing the attachment of infiltrating cells and comprising residues having specificity for, or derived from said plural distinct tissues of a skeletal joint, at least one of said tissue being a non-mineralized tissue, and having dimensions and shape which mimic that of the skeletal joint to be replaced, at least on for said new tissues being a non-mineralized tissue.

17. The use of claim 16 wherein said locus in said mammal defines an endogenous body part to be replaced.

18. The use of claim 16 or 17 wherein said matrix further comprises residues which are dimensioned to correspond in shape and structural relation to said plural distinct tissues to be replaced.

19. The use of any one of claims 16 to 18 wherein at least one non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, tendon, joint capsule, menisci, intervertebral discs, and synovial membrane tissue.

20. The use of any one of claims 16 to 19 wherein said matrix comprises devitalized allogenic or xenogenic tissue.

21. The use of any one of claims 16 to 20 wherein one of said plural distinct tissues is an avascular tissue.

22. A use of a device for repairing in vivo articular cartilage on the surface of a bone by providing to said bone surface at a locus in a mammal said device, wherein said device comprises an exogenous osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix, said matrix comprising residues specific for, or derived from cartilage, and defining a structure which allows the attachment of infiltrating cells.

23. The use of claim 22 wherein said locus occurs in a synovial cavity.

24. A use of a device for restoring a non-mineralized tissue in a skeletal joint in a mammal by providing to said skeletal joint said device wherein said device comprises an exogenous osteogenic protein disposed on the surface of a biocompatible, bioresorbable matrix, said matrix comprising residues specific for, or derived from tissue corresponding in kind to said non-mineralized tissue to be replaced, and defining a structure which allows the attachment of infiltrating cells.

25. The use of claim 24 wherein said non-mineralized tissue to be restored comprises avascular tissue.

26. The use of claim 24 wherein said non-mineralized tissue to be restored is selected from the group consisting of articular cartilage, tendon, ligament, joint capsule, menisci, intervertebral discs, and synovial membrane tissue.

27. The use of claim 22 or 24 wherein said matrix is derived from allogenic or xenogenic articular cartilage.

28. The use of claim 22 or 24 wherein said device comprises a moldable solid.

29. The use of claim 22 or 24 wherein said device comprises a flexible sheet.

30. The use of claim 22 or 24 wherein said device comprises collagen, polymers comprising lactic acid, butyric glycollic acid or mixtures thereof;
hydroxyapatite and combinations thereof.

31. The use of claims 16, 22 or 24 wherein said exogenous osteogenic protein comprises homodimers or heterodimers of OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX, or functional equivalents thereof.

32. A matrix for forming a stable, functional, replacement skeletal joint that comprises articular cartilage and bone tissues at a skeletal joint defect site in a mammal, said matrix comprising:
(i) a biocompatible bioresorbable support material excised from a mammalian donor skeletal joint wherein said material includes bone and associated articular cartilage tissues capable of essentially maintaining their shape and interrelationships of tissues when used as a replacement joint and wherein said bone and associated articular cartilage tissues have dimensions and structural relationships to each other which correspond anatomically to those of the skeletal joint to be replaced; and (ii) substantially pure exogenous osteogenic protein disposed on the surface of said matrix in an amount sufficient to induce formation of new bone and associated articular cartilage tissues thereby permitting the regeneration of a functional replacement skeletal joint at the defect site.

33. The matrix according to claim 32 wherein the exogenous osteogenic protein is selected from the group consisting of: OP-l, OP-2, BMP5, BMP6, BMP2, BMP3, BMP4, BMP9, DPP, Vg-1, 60A, Vgr-1 or a naturally-sourced or recombinant derivative thereof.

34. The matrix according to claim 32 wherein the exogenous osteogenic protein is selected from the group consisting o~ OP-1, OP-2, BMP3, BMP4, BMP5, BMP6 or a naturally-sourced or recombinant derivative thereof.

35. The matrix according to claim 34 wherein the exogenous osteogenic protein is OP-1 or a related osteogenic protein.

36. The matrix according to claim 35 wherein the exogenous osteogenic protein is OP-1.

37. The matrix according to any one of claims 32 to 36 wherein the bone and associated articular cartilage tissues are devitalized by dehydration.

38. The matrix according to any one of claims 32 to 37 further comprising a particulate, resorbable carrier associated with the exogenous osteogenic protein and disposed within a hollow portion of said matrix.

39. A use of the matrix according to any one of claims 1, 8, 9 or 32 to 38 for implanting at a site where a defective skeletal joint has been excised.

40. The use according to claim 39 further comprising implanting a muscle flap into a hollow portion of the matrix.

41. The device according to any one of claims 1, 8 or 9 wherein the exogenous osteogenic protein is selected from the group consisting o~ OP-1, OP-2, OPX, BMP5, BMP6, BMP2, BMP3, BMP4, BMP9, DPP, Vg-1, 60A, Vgr-1 or a naturally-sourced or recombinant derivative thereof.

42. The device according to claim 1 wherein the exogenous osteogenic protein is OP-1 or a related osteogenic protein or a homodimer or a heterodimer thereof.

43. The device according to claim 42 wherein the exogenous osteogenic protein is OP-1 or a homodiner or a heterodimer thereof.

44. The device according to claim 8 wherein the exogenous osteogenic protein is selected from the group consisting of: OP-1, OP-2, OPX, BMP5, BMP6, BMP2, BMP3, BMP4, BMP9, DPP, Vg-1, 60A, Vgr-1 or a naturally-sourced or recombinant derivative thereof.

45. The device according to claim 8 wherein the exogenous osteogenic protein comprises a protein selected from the group consisting of: OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX or a naturally-sourced or recombinant or biosynthetic derivative thereof or a homodimer or heterodimer of any one or more of said proteins.

46. The device according to claim 45 wherein the exogenous osteogenic protein is OP-1 or a related osteogenic protein or a homodimer or a heterodimer thereof.

47. The device according to claim 46 wherein the exogenous osteogenic protein is OP-1 or a homodimer or a heterodimer thereof.

48. The device according to claim 9 wherein the exogenous osteogenic protein is selected from the group consisting of: OP-1, OP-2, OPX, BMP5, BMP6, BMP2, BMP3, BMP4, BMP9, DPP, Vg-1, 60A, Vgr-1 or a naturally-sourced or recombinant derivative thereof.

49. The device according to claim 48 wherein the exogenous osteogenic protein comprises a protein selected from the group consisting of:
OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX or a naturally-sourced or recombinant or biosynthetic derivative thereof or a homodimer or heterodimer of any one or more of said proteins.

50. The device according to claim 49 wherein the exogenous osteogenic protein is OP-1 or a related osteogenic protein or a homodimer or a heterodimer thereof.

51. The device according to claim 50 wherein the exogenous osteogenic protein is OP-1 or a homodimer or a heterodimer thereof.

52. A device for forming a stable, functional, vitalized articulating skeletal joint at a joint defect site in a mammal, wherein said device comprises:
(a) a biocompatible bioresorbable matrix excised from a mammalian donor articulating skeletal joint wherein said matrix comprises:
(i) an articulating surface; and (ii) plural distinct tissues including at least one non-mineralized tissue, wherein said tissues are capable of~
essentially maintaining their shape and relationships when used as a replacement joint and have dimensions and structural relationships to each other which correspond anatomically to the articulating skeletal joint to be replaced;
and (b) substantially pure exogenous osteogenic protein disposed on or within said matrix in an amount sufficient to induce the formation of a new vitalized articulating surface and new vitalized plural distinct tissues thereby permitting the regeneration of a stable, functional, vitalized articulating skeletal joint at said defect site.

53. The device according to claim 52 wherein the exogenous osteogenic protein is selected from the group consisting of: OP-1, OP-2, OPX, BMP5, BMP6, BMP2, BMP3, BMP4, BMP9, DPP, Vg-1, 60A, Vgr-1 or a naturally-sourced or recombinant derivative thereof.

54. The device according to claim 53 wherein the exogenous osteogenic protein comprises a protein selected from the group consisting of:
OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX or a naturally-sourced or recombinant or biosynthetic derivative thereof or a homodimer or heterodimer of any one or more of said proteins.

55. The device according to claim 54 wherein the exogenous osteogenic protein is OP-1 or a related osteogenic protein or a homodimer or a heterodimer thereof.

56. The device according to claim 55 wherein the exogenous osteogenic protein is OP-1 or a homodimer or a heterodimer thereof.

57. The device according to claim 52 wherein the non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, tendon, joint capsule, menisci, intervertebral disc and synovial membrane tissue.

58. The device according to claim 52 further comprising a material selected from the group consisting o~ collagen, polymers comprising lactic acid, glycolic acid, butyric acid or combinations thereof, and ceramics, hydroxyapatite, tricalcium phosphate or mixtures thereof.

59. A device for forming plural distinct non-mineralized tissues in a stable, functional vitalized articulating skeletal joint in vivo, wherein said device comprises:
(a) a biocompatible bioresorbable matrix excised from a mammalian donor articulating skeletal joint wherein said matrix comprises:
(i) an articulating surface; and (ii) plural distinct non-mineralized tissues capable of essentially maintaining their shape and relationships when used as a replacement joint and having dimensions and structural relationships to each other which correspond anatomically to the articulating skeletal joint to be replaced;
and (b) substantially pure exogenous osteogenic protein disposed on or within said matrix in an amount sufficient to induce the formation of a new articulating surface and new plural distinct non-mineralized tissues thereby permitting the regeneration of a stable, functional, vitalized articulating skeletal joint at said defect site.

60. The device according to claim 59 wherein the exogenous osteogenic protein is selected from the group consisting of OP-1, OP-2, OPX, BMP5, BMP6, BMP2, BMP3, BMP4, BMP9, DPP, VG-1, 60A, Vgr-1, or a naturally-sourced or recombinant derivative thereof.

61. The device according to claim 60 wherein the exogenous osteogenic protein comprises a protein selected from the group consisting of:
OP-1, OP-2, BMP2, BMP3, BMP4, BMP5, BMP6, OPX or a naturally-sourced or recombinant or biosynthetic thereof or a homodimer or heterodimer of any one or more of said proteins.

62. The device according to claim 61 wherein the exogenous osteogenic protein is OP-1 or a related osteogenic protein or a homodimer or a heterodimer thereof.

63. The device according to claim 62 wherein the exogenous osteogenic protein is OP-1 or a homodimer or a heterodimer thereof.

64. The device according to claim 59 wherein the non-mineralized tissue is selected from the group consisting of articular cartilage, ligament, tendon, joint capsule, menisci, intervertebral disc and synovial membrane tissue.

65. The device according to claim 59 further comprising a material selected from the group consisting of: collagen, polymers comprising lactic acid, glycolic acid, butyric acid or combinations thereof, and ceramics, hydroxyapatite, tricalcium phosphate or mixtures thereof.