CA2305866A1 - A method for directional stable transformation of eukaryotic cells - Google Patents

Abstract

The present invention is drawn to compositions and methods for introducing nucleotide sequences at preferred genomic target sites in a eukaryotic genome.
The compositions comprise transfer cassettes which are flanked by nonhomologous recombination sites. The method involves transforming eukaryotic cells containing target sites utilizing non-integrating transformation methods. The method results in efficient integration of nucleotides into predetermined genetic locations and eliminates random DNA integration.

Description

A METHOD FOR DIRECTIONAL STABLE TRANSFORMATION
OF EUKARYOTIC CELLS
The invention relates to the genetic modification of eukaryotes. Particularly, the control of gene: integration and expression in plants is provided.
Back rog and ~f the Invention Genetic modification techniques enable one to insert exogenous nucleotide sequences into an organism's genome. A number of methods have been described for the genetic modification of plants. All of these methods are based on introducing a foreign DNA, into the plant cell, isolation of those cells containing the foreign DNA integrated into the genome, followed by subsequent regeneration of a whole plant. Unfartunatel;y, such methods produce transformed cells that contain the introduced foreign DN.A inserted randomly throughout the genome and often in multiple copies.
The random insertion of introduced DNA into the genome of host cells can be lethal if the foreign DN.A happens to insert into, and thus mutate, a critically important native gene. In .addition, even if a random insertion event does not impair the functioning of a host cell gene, the expression of an inserted foreign gene may be influenced by "pos:ition effects" caused by the surrounding genomic DNA.
In some cases, the gene is inserted into sites where the position effects are strong enough to prevent the syntlhesis of an effective amount of product from the introduced gene. tn other instances, overproduction of the gene product has deleterious effects on the cell.
Transgene expression is typically governed by the sequences, including promoters and enhancers, which are physically linked to the transgene.
Currently, it is difficult to precisely rr~odify the structure of transgenes once they have been introduced iota plant cells. In many applications of transgene technology, it would be desirable to introduce the transgene in one form, and then be able to modify the transgene in a defined manner. By this means, transgenes could be activated or inactivated where' the sequences that control transgene expression can be altered by either removing s:exluences present in the original transgene or by inserting additional sequences into 'the transgene.
Therefore, it is es,cential to gain more control over foreign DNA integration into the nuclear g;enome of plant cells to expedite the efficient production of transgenic plants with stable and reliable expression of transgenic traits.
Relatively low frequency and randonnness of foreign DNA integration make genetic transformation a aabor-intensive and unpredictable procedure. Multi-copy, random integrations of transforming DNA molecules frequently lead to aberrant expression of foreign genes, affect expression of endogenous genes, and provide transgenic organisms with unstable transgenic traits. All plant transformation procedures currently in use t~~lce advantage of biochemical pathways) involving random, illegitimate recombination. to integrate foreign DNA. Illegitimate recombinations constitute the intrinsic property of a conventional genetic transformation process. As such, desired DNA integration events cannot be separated, or preferably selected for, from among any excessive random integrations, unless a different mechanism governs the integration of productive events.
One approach for gene targeting, which is extensively pursued, involves the use of DNA homologous recombination for integration of foreign DNA into pre-selected genomic locations. The process involves both productive (homologous, targeted) and non-productive (illegitimate, random) integrations. Innovative strategies have already bean proposed to reduce, or eliminate random integration of targeting vectors. They include the use of negative selection markers to eliminate random integrations by selection against actively expressed foreign genes, excisions of randomly integrated copies of foreign genes by the use of site-specific recombinations, or identification and application of specific inhibitors of non-homologous reco:mbinations such as poly-(ADP-ribosylation) inhibitors.

un:~, v nui ty~uu CA 02305866 2000-OS-17 w u~~

The basic problem with current gene targeting grocedures, however, is that tb.e efficiency of botnologous re~:ombina~xoa in somatic cells of higher eukaryotes is extremely tow being about 1,600-, 1,000,000-fnd less frequent titan illegitimate, random ,5 integrations, Taking into account that random integrations arc barely considered satisfactory in the conventioatal genetic traasfornnation procedures, routine gene targeting is presently not practical, at leatst in plant genetic transformation systems.
Therefore, methods to control targttirrg and integration of foreign genes Into the genome are needed.
Summary of the Invention Compositions and rne;thads for intTOducing nucleotide sequences only at preferred genornic target sites are provided. The compositions comprise transfer cassettes which incorporate site-specific re~cambinatiwn sequences, The method involves transforming eularyotic cells containing target sites utilizing transformation vectors which d.o not I5 integrate geaamic DNA, ar integrate at very low frequency, unless provided with a eite-speci~c integration system. 'The medxod resuhs in efficient integration of nucleotides into predetermined genetic locations and p~2inixnizes or precludes random 1~NA
itategration.
ncta.iled t)escription of the Invention 20 Compositions and methods for introducing, nucleotide sequences into predetermined genornic target sites in a plant ge~~a is provided. The methods preclude the random itltegration of DNA into the l;enomc. The methods use novel. r~tnbinatina sites in a gene targeting system which facilitates dire:ctiondi targeting of desired genes and nucleotide sequences izlto corresponding: recombination sites preYiously introduced into the target ?.5 genome. Methods for the production of transgenic plants contai.uiag spcci~c recombination sites integrated is the plant g~enamc are described In co-pending patent application enkitled "Compositions and Methods 'far Genetic Modification Qf Plants" filed concurrently herewith and herein incorporated by rE:ference. Methods for the site-specific integration of I~NA
into wild-type and mutant log: sites pl~~ced in tha plant genntnc may also be found in Albert 3 o et al. ( 1995 j The Plaru Journal 7: 549-659.
R7~141I2472228vt S~.t~STITUTE SHE>rT

Generally, for targeted insertion of nucleotide sequences, two non-identical recombination sites are introduced into the target organism's genome establishing a target site for insertion of nucleotide sequences of interest. These recombination sites may flank other nuclE:otide sequences. Once a stable plant or cultured tissue is established a second construct, or nucleotide sequence of interest, flanked by corresponding recombinatiion sites as those flanking the target site, is introduced into the stably tra~nsformecl plant or tissues in the presence of a recombinase protein.
This process results in exchange of the nucleotide sequences between any two identical recombination sites of the target site and the transfer cassette.
It is recognized that the transformed organism may comprise multiple target sites; i. e. , sets of non-identical recombination sites. In this manner, multiple manipulations of the target: site in the transformed organism are available.
By target site in the transformed organism is intended the DNA sequence that has been inserted into the transformed organism's genome and comprises the non-identical recombination sitea.
Examples of recombination sites for use in the invention are known in the art and include FRT sites (See, for example, Schlake and Bode (1994) Biochemistry 33:12746-12751; :Huang ei' al. (1991) Nucleic Acids Research 19:443-448; Paul D.
Sadowski (1995) In Progreas in Nucleic Acid Research and Molecular Biology vol.
51, pp. 53-91; Michael M. Cox (1989) In Mobile DNA, Berg and Howe (eds) American Society of Microbiology, Washington D.C., pp. 116-670; Dixon et al.
(1995) 18:449-458; Umlau.f and Cox (1988) The EMBO Journal 7:1845-1852;
Buchholz et al. (1'996) Nucleic Acids Research 24:3118-3119; Kilby et al.
(1993) Trends Genet. 9:413-421: Rossant and Geagy (1995) Nat. Med. 1: 592-594; Lox Albert et al. (199-'i) The Plant J. 7:649-659: Bayley et al. (1992) Plant Mol.
Biol.
18:353-361; Odell et al. (1990) Mol. Gen. Genet. 223:369-378; and Dale and Ow (1991) Proc. Natl. Acad. 5~ci. USA 88:10558-105620; Qui et al. (1994) Proc.
Natl.
Acad. Sci. USA 91.:1706-1'710; Stuurman et al. (1996) Plant Mol. Biol. 32:901-913;
and Dale et al. (1990) Gene 91:79-85; all of which are herein incorporated by reference.) un:v. v mv~ iy~~
CA 02305866 2000-OS-17 i.um By "target site~ is intended a ipredetermiaed geaomic location within the nucleu9 where the integration of a sx~eci.fic tr~~nsfonned nucleotide scquen~ is to occur. The target site of the inveatinn is citaracterued by being flanked by, rLOn-identical recombination sites corresponding to the non-idssltical recombination sites freaking the nucleotide sequence to be transfortncd into the cell, (the craxtsfer cassette), and integrntexi into the eeaome, The eon-identical recombination sites in c;ornbiaation with recatnbinase activity result in a recombin9,tion event between the non-identical recombination sites of the target site and the targ$t cassette (the ittte~eratinl; sequence). This event produces an integrated aur,Ientide I 0 seQuence into the specified genomic location.
To practice the methods of the; invention, a transformed organism, particularly a plant, of interest containing a target site intcgrata3 into its geaome is needed. The target site is characterized by being flanked by eon-identical recotnbinatiori sites.
A targeting cassette is additionally required containing a nucleotide sequence flanked by corresponding non-identical recotnbiuation :sites as those sites contained in the target site of the transfotttted otganisrn. A re~:ombina:~e which recognizes the non-identical recombination sites and catalyzes site-specific recom~hination is required.
Tiy non-identical reco::nbination sites is iatcnded that the fiankiag recombination sites are not identical. That i,s, one flanking recombination site may be a F'Rf" site (SF.Q ID
NQ: 1 and 2) where the second rccarnbination site may be a mutated FRT site (SEQ TD
NOs:3, 4 and 5). The non-identical recombination sites used is the methods of the invention prevent or greatly suppress recombination between the two flanking recombination sites and excision of th.e nucleotide sequence contained therein.
,4ccordingly, it is recognized that any suitable ewn-identical recombinacin»
sites trray be utilized in the invention, including Fls!T and mutant FRT sites, FRT and lox sites, lox and mutant tox sites, as well as other recombination sites known in the art.
By suitable non-identical recombination site implies cbat in the presence of active recombinase, excision of sequences between two non-identical recombination RTnO 112072228v1 sussTrr~T>~ sx~ET

sites occurs, if at all, with an efficiency considerably lower than the recombinationally-mediated exchange targeting arrangement of nucleotide sequences into the plant genome. Thus, suitable non-identical sites for use in the invention include those sites where the efficiency of recombination between the sites is low;
for example, where the efficiency is less than about 30 to about 50%, preferably less than about 10 to about 30 % , more preferably less than about 5 to about 10 % , even more preferably less than about 1 % . .
As noted above, the; recombination sites in the targeting cassette correspond to those in the target site of the transformed organism. That is, if the target site of the transformed organism contains flanking non-identical recombination sites of FRT
and a mutant FRT, the targeting cassette will contain the same FRT and mutant FRT
non-identical recombination sites.
It is furthermore recognized that the recombinase, which is used in the invention, will depend upon the recombination sites in the target site of the 1 S transformed organism and the targeting cassette. That is, if FRT sites are utilized, the FLP recombinase will be needed. In the same manner, where lox sites are utilized, the Cre re;combinause is required. If the non-identical recombination sites comprise both a FRT and a lox site, both the FLP and Cre recombinase will be required in the plant cell.
The present invention utilizes nonintegrating vectors and methods of introducing transfer cassettes into the genome of the organism of interest. In this manner, efficient site specific integration of exogenous nucleotide sequences is promoted and randlom insertion is avoided. By efficient site specific DNA
integration is intended the maximization of recombination events between the introduced integrating sequence and the predetermined genomic target sites of transformed cells. That is, the methods prevent random DNA integration and insertion of DNA into sites. other than the intended target site within the eukaryotic genome. Prevention of random integration is accomplished through the utilization of non-integrating nucleic acid molecules in association with the gene targeting method set forth in the copending application disclosed above.

The methods of the invention can be used to target nucleotide sequences into any eulcaryote. By eukaryote is intended to mean any higher eulcaryotic organism, more specifically plants and even more specifically monocotyledonous plants.
Transient transformation methods for plants are available in the art and include DNA delivery systems which are capable of introducing nucleotide sequences into a eukaryotic: cell, where these sequences either contain no homology to the genomic sequence of the target cell or have been modified in a way that precludes their own recombination or integration into the genome. Such non-integrative DNA delivery systems include the use of Agrobacterium for monocot, modified Agrobact~erium-mediated T-DNA transfer for dicots, and viral vectors.
These systems can effectively deliver DNA into plant cells without random integration. Thus, the nucl',eotide sequences are only or preferably able to insert at predetermined target sites and under suitable conditions such as those provided in copending application "Cornpositions and Methods for Genetic Modification of Plants". Thus, by non-integrating methods are intended methods of introducing nucleotide sequences into a cell without subsequent random integration or with minimum random integration. Random integration refers to integration or insertion of the nucleotide sequences at sites other than at corresponding target sites.
The development of plant virus gene vectors for expression of foreign genes in plants provides a means to provide high levels of gene expression within a short time. The benefits of virus.-based transient RNA and DNA replicons include rapid and convenient engineering; coupled with flexibility for expeditious application in various plant species. In tlis manner, autonomously replicating viruses offer numerous advantages for use as vehicles for transient expression of foreign genes, including their characteristiic high levels of multiplication and concomitant levels of transient gene expression . Such viruses include but are not limited to Bromovirus, Caulimovirus, Furovirus, (ieminivirus, Hordeivirus, Potexvirus, Tobamovirus, Tobravirus, Tombusvirus, Potyvirus, Comovirus, Alfamovirus, Dianthovirus, etc.
See, for example, Ugaki et al. (1991) Nucleic Acids Res. 19:371-377;
Timmermans et al. ( 1992) Nucleic Acids Res. 20:4047-4054; Louie, Raymond ( 1995) Phytopathology 8:1:139-143; Scholthof et al. (1996) Annu. Rev.
Phytopathol.34:299-323, and the references cited therein, all of which are herein incorporated by reference.
Viral methods use viral vectors that replicate as extrachromosomal DNA, or RNA molecules. Shuttle vectors may be constructed that contain viral sequences critical to replication. Such vectors can be used to introduce transfer cassettes containing nucleotide seqwences into plants and plant cells. Such vectors, which have included viral genomic DNA from the geminiviruses (wheat dwarf virus or maize streak virus) can be transformed into monocotyledonous plants and propagate in the plant cell nucleus to high copy numbers (Timmermans et al. (1992) Nucleic Acids Res. 20:4047-4054) . Once viral particles are in the plant cell, they can accumulate to high copy numbers which will increase the probability that a recombination event will occur between the non-identical recombination sites flanking the target sequence, leading to a successful integration of the nucleotide 1 S sequence of interest.
Agrobactenum-mediated gene transfer exploits the natural ability of Agrobacterium turnefaciens to transfer DNA into plant cells. Agrobacterium is a plant pathogen that transfers a set of genes encoded in a region called T-DNA
of the Ti plasmid into plant cells at wound sites. The typical result of gene transfer is a tumorous growth called a crown gall in which the T-DNA is stably integrated into a host chromosome. The ability to cause crown gall disease can be removed by deletion of the genes conferring tumorigenesis in the T-DNA without loss of DNA
transfer and integration. Tlhe DNA to be transferred is attached to border sequences that define the endi points of an integrated T-DNA.
Agrobactenum-based transformation methods may also be used in the invention. The Ai;robacteoum system can be used to introduce transfer cassettes into monocotyledonous plaint cells to take advantage of the inability of T-DNA
to efficiently integral:e into the genome of monocot plants. It is known that in nature Agrobacterium does not transform monocots. Thus, supervirulent strains of Agrobacterium have been developed to utilize Agrobacterium as a vector to _g_ transform monoco~ts. The present invention takes advantage of the ability of the Agrobacterium sy;>tem to vntroduce transfer cassettes into monocot cells without the ability to direct im.~.orporati.on of the transferred sequence into the monocot genome.
It has been demonstrated that the Agrobacterium system can be used to transfer DNA from the bacteria to the plant cell. See, for example Grimsley et al.
(1988) BioTechnology 6: l'.85-189; Dasgupta et al. ( 1991) J. Gen. Virol. 72:1215-1221;
and the references cited therein.
It is further recognized that Agrobacterium based transfer systems may be modified such that the Agrobacterium directs introduction and transient expression of the transferred :DNA (in this instance the transfer cassette), but is unable to direct efficient integration of T-DANA into the genome of the plant. Such modified Agrobacterium systems are: available in the art. See, for example, Narasimhulu et al. ( 1996) The Plant Cell 8:873-886, herein incorporated by reference.
Narasimhulu et al. demonstrate that the C-terminal nuclear localization signal of the VirD2 protein is not essential for nuclear uptake of T-DNA and further show that the ~s domain of VirD2 is required for efficient integration of T-DNA into the plant genome. Thus, mutations into this region will allow introduction and transient expression of the transfer cassette but avoid unwanted random insertion. For example, a nonpolar transp~oson insertion into the C-terminal coding region of virD2 resulted in only slightly decreased production of mRNA, although this insertion resulted in the loss of the nuclear localization sequence the t~f region from VirD2 protein and rendered the bacterium avirulent. Thus, the modified Agrobacterium is particularly beneficial for use in dicots.
The non-integrating; transformation methods can be used to introduce the transfer cassettes into any plant cell. In this manner, genetically modified plants, plant cells, plant tiissue, sec;d, and the like can be obtained.
Transformation protocols may vary depending on the type of plant or plant cell, i.e. monocot or dicot, targeted for transformation.
Once the transfer cassettes have been introduced into the plant, the flanking non-identical recombination sites of transfer cassettes recombine with corresponding WO 99/25854 PGT/US98/24b09 sites of the target vvithin thE; plant genome. The cells having a modified genome may be grown into plants in accordance with conventional approaches. See, for example, McCormick et al. (1986) Plant Cell Reports, 5:81-84. These regenerated plants may then be pollinatE;d with either the same transformed strain or different strains, and the resulting hybrid having the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that the subject phenotypic charact~~risdc is stably maintained and inherited and then seeds harvested to ensure the desired phenotype or other property has been achieved.
Because of the use o~f non-integrating means of introducing transfer cassettes provided herein, th.e plants of the invention may be distinguishable from other transformation methods as t:he modified plants of the invention will contain nucleotide sequences of interest inserted into the plant genome only or substantially at target sites. By substantially at target sites, is intended that target cassettes are inserted into the genome only about five times at non-target sites, preferably less than about three times, more preferable about one time or less.
It is recogniized that the methods of the invention can additionally be used in other eukaryotic cells for efficient insertion of nucleotide sequences of interest, including mammalian cells. In this manner, target sites can be introduced into a cell line and non-integrating methods used to introduce transfer cassettes into the cells.
This provides an efficient means of introducing genes of interest into animals, particularly agricultural aniLmals.
Viral mean;e of introducing DNA into mammalian cells are known in the art.
In particular, a number of 'vector systems are known for the introduction of foreign or native genes into mammalian cells. These include SV40 virus (See, e.g., Okayama et al. (19'85) Molnc. Cell Biol. 5:1136-1142); Bovine papilloma virus (See, e.g., DiMaio et al. (1982) Proc. Natl. Acad. Sci. USA 79:4030-4034);
adenovirus (See, e.g., Moriin et al. (1987) Proc. Natl. Acad. Sci. USA
84:4626;
Yifan et al. (1995) Proc. Natl. Acad. Sci. USA 92:1401-1405; Yang et al.
(1996) Gene Ther. 3:137-a44; Tripathy et al. (1996) Nat. Med. 2:545-550; Quantin et al.
(1992) Proc. Natl. Acad. S~~i. USA 89:2581-2584; Rosenfeld et al. (1991) Science WO 99/25854 PCTNS98/2461)9 252:431-434; Wag;ner (1992) Proc. Natl. Acad. Sci. USA 89:6099-6103; Curiel et al. (1992) Human Gene Therapy 3:147-154; Curiel (1991) Proc. Natl. Acad. Sci.
USA 88:8850-8854; LeGal LaSalle et al. (1993) Science 259:590-599); Kass-Eisler et al. (1993) Proc. Natl. Acad. Sci. USA 90:11498-11502); adeno-associated virus (See, e.g., Muzyc::ka et al. (1994) J. Clin. Invest. 94:1351; Xiao et al.
(1996) J.
Virol. 70:8098-8108); herpes simplex virus (See, e.g., Geller et al. (1988) Science 241:1667; Huard et al. (19'95) Gene Therapy 2:385-392; U.S. Patent No.

5,501,979); retrovirus-based vectors (See, for example, Curran et al. (1982) J.
Virol. 44:674-682; Gazit et al. (1986) J. Virol. 60:19-28; Miller, A.D. (1992) Curr. Top. Microbiol. Immunol. 158:1-24; Cavanaugh et al. (1994) Proc. Natl.
Acad. Sci. USA 91:7071-7CI75; Smith et al. (1990) Molecular and Cellular Biology 10:3268-3271); herein incorporated by reference. See also, Wu et al. (1991) J.
Biol. Chem. 266:1.4338-14342; Wu and Wu (J. Biol Chem. (1988)) 263:14621-14624; Wu et al. (1989) J. Biol. Chem. 264:16985-16987; Zenke et al. (1990) Proc. Natl. Acad. ,Sci. USA 87:3655-3659; Wagner et al. (1990) 87:3410-3414.
Standard techniques for the construction of the vectors of the present invention are well-known to those of ordinary skill in the art and can be found in such references as Sambrook et al. , Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Hfarbor, New York, 1989). A variety of strategies are available for ligating fragments of DIVA, the choice of which depends on the nature of the termini of the DNA fragments and which choices can be readily made by those of skill in the art.
The following examples are offered by way of illustration not by way of limitation.
Example 1. Creation of novel non-identical FRT sites DNA fragments containing novel FRT sequences are constructed either by synthesizing, anne~~ling and. ligating complementary oligonucleotides or by creating primers for PCR amplification of a DNA product containing the new FRT sequence near the 5' end of the PCR product. The newly constructed FRT product includes flanking restriction sites useful for cloning into plant expression units. In general, the 5' end is flanked by an NheI site and a terminal NcoI site. The NcoI site includes the bases .ATG, which are advantageously used in newly developed vector constructs as the re;cognitio:n sequence to initiate an open reading frame. In sequence-based constructs designated noATG/FRT, the NheI site is used for cloning thereby eliminating; the ups»ream ATG in the process. At the 3' end of the FRT
sequence, a restriction site :is included enabling unique identification of the individual spacer sequences. As specific examples, the wild type FRT site (designated FRTI here, SEQ ID NO: 2) is cloned with a flanking BgIII site, the FRTS site (spacer TTCAAAAG) has a ScaI site, the FRT16 site (SEQ ID NO: 4, spacer TTCAAAAA) has an AatII site, and the FRT7 site (SEQ ID NO: 5) spacer TTCAATAA) has .an SpeI site. The outermost flanking restriction site is an XhoI
site and is used to I:lone a gene of interest into the open reading frame.
The structures and sequences of the FRT sites as designed and/or used in the present invention example acre depicted below with positions of restriction sites, repeats and spacer regions indicated.
~FRTl (SE(,~ ID NO: 2~
NcoI Nhel Repeat 1 Repeat 2 Spacer Inverted Repeat BgIII XhoI
5' CCATGGCTAGC GAAGTT(:CTATTCC GAAGTTCCTATTC TCTAGAAA GTATAGGAACTTC AGATCTCGAG
FRTS (,~~0 ID NO: 3~
NcoI N6eI Repeat 1 Repeat 2 Spacer Inverted Repeat ScaI XtaI
5' CCATGGCTAGC GAAGTT(:CTATTCC GAAGTTCCTATTC TTCAAAAG GTATAGGAACTTC AGTACTCGAG
FRTi~!G~E~ Il2 ~~: ~~
NcoI NheI Repeat 1 Repeat 2 Spacer Inverted Repeat AatIl XhoI
5' CCATGGCTAGC GAAGTT<:CTATTCC GAAGTTCCTATTC TTCAAAAA GTATAGGAACTTC
AGACGTCCTCGAG
~RT7 (SE ID NO: 5~
NcoI NheI Repeat 1 Repeat 2 Spacer Inverted Repeat Spel XhoI

5' CCATGGCTACiC GAAGTT'CCTATTCC GAAGTTCCTATTCTTCAATAA
GTATAGGAACfTCACTAGTTCTCGAG
Example 2. Creation of Agrobacterium plant transformation vectors contiuning novel non-identical FRT sites for dicots.
Bacterial Strains and Growth Conditions Escherichia coli strains are grown at 37 ° C on Lucia-Bertani medium (Maniatis, et al.(1~982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, N'~: Cold ;Spring Harbor Laboratory)) and Agrobacterium tumefaciens strains at 30°C; on AB-sucrose minimal medium (Lichtenstein, et al. (1986) Genetic engineering of plants, in DNA cloning: A Practical_ ~,gproach, Vol. 2, D.M. Glover, ed. (Oxford, UK: IRL Press), pp. 67-119) containing the appropriate .antibiotics. Antibiotic concentrations (~.cg/mL) are as follows: ampicillin, 100; kanamycin, 20 for E. coli; carbenicillin, 100;
kanamycin, 10(?; spectinomycin, 100; rifampicin, 10 for Agrobacterium.
Construction of pFtISNl anal Its Derivatives To construct the transferred (T)-DNA binary vectors, one can clone an EcoRI-SaII fragment of pCNL65 (Liu et al. (1992) Plant Mol. Biol. 20:1071-1087), containing .a ~i-glucuronidase gusA gene with the ST-LS1 second intron (Vancanneyt et al. (1990) ~l~lol. Gen. Genet. 220:245-250), into pBluescript SK+
(Stratagene). This plasmid is digested with Xhol (upstream of the gusA gene), the overhanging ends :filled in, using the Klenow fragment of DNA polymerase I and nucleotide triphoslrhates, and the gusA-intron gene using Sacl is released.
The gusA
gene (lacking an intron) from pE1120 (Ni et al. (1995) Plant J. 7:661-676) is removed by using Smal and Sacl and replaced with the gusA-intron gene fragment described above. 'The final. plasmid will contain T-DNA border repeat sequences, a nopaline synthase-neomycun phosphotransferase II gene for selection of kanamycin-resistant transgenic: plants, and a gusA-intron gene under the regulation of the promoter from pE 1120.

Based on tt~e design. of FRT sites as described above, various methods such as PCR, mutagenesis and/or other standard cloning protocols can be used to introduce the FRT sites into desired locations in the plasmid above during the vextor creation process. :Example methods are described in a co-pending patent application entitled "Compositions and. Methods for Genetic Modification of Plants" filed concurrently herev~rith and Therein incorporated by reference.
The plasmi~d described above is placed into an Incur replicon as described by Narisasimhulu et al. (1996) The Plant Cell 8:873-886, herein incorporated by reference.
The plasmi~d is mobilized into Agrobacterium strains, using a triparental mating procedure (Figurski and Helinski ( 1979) Proc. Natl. Acad. Sci. USA
76:1648-1652) and. the mobilizing plasmid pRK2013 (Ditty et al. ( 1980) Proc.
Natl.
Acad. Sci. USA 77:7347-7351). The trans-conjugants are selected on AB-sucrose minimal medium containing; rifampicin and kanamycin or rifampicin and spectinomycin. Al.ternative:ly, the Agrobacterium binary system as described by Bevan, M. (1984) Nucl. Acids Res. 12:8711-8721; herein incorporated by reference.
Growth and infection of Plant Cells and Determination of GUS Activity Nicotiana tabacum 1BY-2 cells are propagated in Murashige and Skoog medium (Gibco BF,L) conW fining 3 % sucrose, 1 ~cg/mL thiamine, 0.2 ,ug/mL 2,4-D, and 370 ~cg/mL KI32P04. ~'ea mays Black. Mexican Sweet (BMS) cells are propagated in Murashige and Skoog medium containing 2% sucrose, 2 ~g/mL 2,4-D, 0.2 mg/mL my~oinositol, 0.13 mg/mL L-asparagine, 0.13 ,ug/mL nicotinic acid, and 0.25 ~cg/mL each of thiiamine, pyridoxine, and pantothenic acid. The cultures are shaken at 140 ipm at 2-'i°C in continuous light.
To infect pliant cells, virulence (vir) gene activity is induced in Agrobacterium with acetosyringone. Agrobacterium cells are grown to a density of 2 x 10 9 cells per mL, (A = 100, using a Klett-Summerson spectrophotometer, red filter) in AB-sucrose medium. The cells are centrifuged at 10,000g, suspended at a concentration of 1 x 10 9 cE;lls per mL (A = 50) in induction medium (AB
salts, 0.5 % glucose, 2mM sodiwm phosphate, 50 mM Mes, pH 5.6, SO~cM
acetosyringone), and incubated with gentle shaking at 25°C for 14 to 18 hr. After washing the bacterial cells in plant culture medium, plant cells are inoculated with induced Agrobacte~rium (--20 bacterial cells per plant cell, except where noted otherwise) and cocultivatedl at 25 °C with shaking at 140 rpm for various periods of time. Most of the bacteria is washed off by centrifugation of the cocultivation mixture at 300 rpm (model GLC-2 clinical centrifuge; Beckman Sorvall, Newtown, CT) for 2 min. The plant cell pellet is suspended and washed once more in plant culture medium and then reauspended in culture containing either 100 ,ug/mL
timentin or 200 ,ug;/mL cefotaxime. To collect plant cells for isolation of RNA, the cells are washed three times, as described above, in plant culture medium. RNA
is extracted from these cells either directly after harvesting (either of the two methods listed below) or after freezing in liquid nitrogen and storage at -70°C
(TRIzoI
reagent [Gibco BRL] extracaion method).
The percentage of cells expressing GUS activity is determined by incubating the cells in GUS h:istochemical staining solution (50 mM NaH2P04, 10 mM Na2;
EDTA, 0.3 M mamutol, 20 % methanol, and 1 mM 5-bromo-4-chloro-3-indolyl ~3-D-glucuronic acid [X-glucJ overnight at 37°C (Kosuge et al.(1990) Plant Sci.
70:133-140).

Example 3. Creation of Agrobacterium plant transformation vectors containing novel non-identical FRT sites for monocots.
Agrobacterium-mediiated DNA transfer to maize is roughly as efficient as it is to dicotyledenou;s plants i.n different, but functionally equivalent agroinfection systems. See, Grirnsley et al. ( 1987) Agroinfection, p. 87-107. In: Plant DNA
Infectious Agents. Hohn anal Schell (Eds.)Springer, New York and Vienna. This observation questions the dE:finition of the host/parasite interaction, since the steps up to and including DNA transfer do seem to occur in a plant that does not produce tumors.
EXPERIMENTAL PROTOCOL
Plasmid constructions, bacterial strains and media. Construction of the transferred (T)-DNA binary vectors including incorporation of FRT sites is essentially as described in Example 2. Plasmids are maintained in Escherichia coli strain DHl (Maniatis and Saunbrook (1982) Molecular Cloning: A Laboratory Manual. {Cold Spring Harbor, NY: Cold Spring Harbor Laboratory)) at 37°C or in A. tumefaciens strain C58 (Holsters et al. (1980) Plasmid 3:212-230) at 28°C. The strain C58(pTiC58,pEAP37) carrying a dimer of MSV genomes in the T-DNA of a binary vector has been described (Grimsley et al. (1987) Nature 325:177-179).
C58(pGV3850::pEAP25) is constructed by (i) cutting pMSV 12 (Grimsley et al.
(1987) supra) at its unique ;ialI site, (ii) cutting pEAPl, a 7.6kb large mobilizable plasmid encoding bacterial resistances for ampicillin and kanamycin and a kanamycin resistance gene f;xpressed in plants with SaII, (iii) ligating (i) +
(ii) to produce a plasmid, PHMI, which could be selected in E. coli by ampicillin, kanamycin and chloramphenicol resistance, and (iv) mobilization (Rogers et al.(1986) Meth. En.rymol. 118:627-640) of the plasmid PHMI to C58(pGV3850) (Zambryski et al. (1983) ENlBO J. 2:2143-2150) producing C58(pGV3850::PHMI).
Restriction enzym<; digestions and ligations are done under conditions recommended by ttie manufacturer (Biofmex, Switzerland). Prior to inoculation, strains of Agrobact~erium are streaked out on YEB (Grimsley et al. ( 1986) Proc.
Natl. Acad. Sci. U;iA, 83:3282-3286) plates solidified with 1.5 % agar and WO 99/25854 PG"f/US98/24609 supplemented with 100~cg/ml rifampicin and 25,ug/ml kanamycin and allowed to grow for 48h. A single colony is used to inoculate 10 ml of liquid YEB medium in a 100m1 Erlenmeyer flask supplemented with antibiotics as previously. Growth is continued with shaking at 2;00 r.p.m. for 24h, then SOO,uI of this culture is used to inoculate a similar flask and growth continued for a further 20h. This procedure yields a final density of viable Agrobacterium cells in the region of 109/ml (estimated by plati:ng). Thc; cells are then harvested by centrifugation and resuspended in an equal volume of lOmM MgS04 without antibiotics; such a suspension is subsequently referred to as undiluted or 10° dilution;
for experiments involving a dilution series IOmM MgS04 was also used as the diluent.
Growth of lplants: rvlaize seeds for 10-day old plants are sown in pots in a phytotron in a 12 hour light/dark cycle at 25°C in a light intensity of about 10000 lux (Sylvania 215W fluorescent lamps type F96T12/CW/VHO) then moved to the BL3 containment I;aborator~ immediately prior to inoculation; subsequent growth conditions have been described (Grimsley et al.(1987) Nature 325:177-179).
Three-day old seedllings are: prepared by (ii) sterilization by stirring for 20min in 0.7 % calcium hypochlorite solution, (ii) washing three times (stirring for 20min each time) in sterile distilled water (iii) preparing 9cm diameter presterilized Petri dishes with 3 sheets of steriile 8.Scm diameter Macherey-Nagel (Germany) filter paper in the bottom and ca. lOml of sterile water per dish, (iv) putting ca.
20 seeds into each geraniums dish, arid (v) incubating in the dark at 28°C for 3 days, or until the distance between the sc~utellar node and the apical tip of the coleoptiles is 1-2 cm.
Inoculation of plant;>: For injections, a SO~cI or a 100,u1 Hamilton syringe fitted with a 0.4mrn diameter disposable needle is loaded with the bacterial suspension avoiding trapped air bubbles. Between inoculations with different bacterial strains the needle is discarded and the syringe flushed out 3 times with 100% ethanol and 3 times with sterile distilled water. 10-day old plants are inoculated by (i) abrasion o~f an upper leaf, applying 20~c1 of suspension, and rubbing in with ca~rborundu~m powder until the leaf appears wet all over, (ii) injection of l0,ul of bacterial suspension into the centxal part of the plant either just above the first leaf' blade, or lcm below the first leaf blade, or at the base of the plant, in the meristematic region where adventitious roots later begin to appear.
Three-day old seedlings arf; injected with l0,ul of bacterial suspension in different ways by (i) pushing the needle down through the apical tip of the coleoptile to the coleoptilar node, (:ii) injecting 2mm below the apical tip of the coleoptile, (iii) 2 mm above the coleoptilar node, (iv) at the coleoptilar node, (iv) 2mm below the coleoptilar node, (v) at the scutellar node, and by pushing the needle up through the primary root to a region close to the scutellar node. Ten ~cl is used as a standard inoculum of bacterial suspension, but only 1-2,u1 routinely remains in the inoculation site, the rest is forced out, usually coming out from the point of entxy of the inoculating needle. Following inoculation seedlings are planted immediately in damp soil, incubated as before (Grimsley et al.(1987) Nature 325:177-179), and observed daily for the appearance of symptoms of viral infection, characterized by the appearance of yellow spots and/or stripes at the base of new leaves.
Histology: Plant pieces containing the site of injection are collected, fixed in Carnoy's fluid (60'% ethanol, 30% chloroform, 10% glacial acetic acid) overnight, dehydrated in a series of SOi % , 75 % and 100 % ethanol, and then prepared for the infiltration of parai~fin wax in a series of 25 % , 50 % , 75 % and 100 %
xylene in ethanol (at least 30 min is allowed for each of the serial steps). Finally they are embedded in paraflFin at 65"C and cut with a microtome into slices of 15-35,um depending upon thc: size of the plant pieces. All procedures are carried out according to Sass (Sass, J.:E. (1958). Botanical Microtechnique, p. 14-54. The Iowa State University Press, Ames, Iowa.).
All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains.
All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated t~o be incorporated by reference.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changfa and modifications may be practiced within the scope of the appended claims.

SEQUENCE LISTING
<110> Baszczynski, Christopher L.
Lyznik, Leszek A.
Gordon-Kamm, William J,.
<120> A Method for Directional Stable Transformation of Eukaryotic Cellfc <130> 035718-158699 <140>
<141>
<150> 60/065,613 <151> 1997-11-18 <160> 5 <170> PatentIn Ver. 2.0 <210> 1 <211> 34 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism:Constructed by synthesizing, ar~nealinc~ and ligating complementary oligonucleotides or by creating primers for PCR
amplification <400> 1 gaagttccta ttctctagaa agtatac~gaa cttc 34 <210> 2 <211> 69 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism:Constructed by synthesizing, an.nealing~ and ligating complementary oligonucleotides or by creating primers for PCR
amplification <400> 2 ccatggctag cgaagttcct attccga.agt tcctattctc tagaaagtat aggaacttca 60 gatctcgag 69 <210> 3 <211> 69 <212> DNA
<213> Unknown <220>

<223> Description of Lrnknown Organism:Constructed-by synthesizing, ar.~nealinc~ and ligating complementary oligonucleotidea. or by creating primers for PCR
amplification <400> 3 ccatggctag cgaagttcct attccga,agt tcctattctt caaaaggtat aggaacttca 60 gtactcgag 69 <210> 4 <211> 72 <212> DNA
<213> Unknown <220>
<223> Description of Unknown Organism:Constructed by synthesizing, annealingv and ligating complementary oligonucleotides or by creating primers for PCR
amplification <400> 4 ccatggctag cgaagttcct attccga.agt tcctattctt caaaaagtat aggaacttca 60 gacgtcctcg ag 72 <210> 5 <211> 72 <212> DNA
<213> Unknown <220>
<223> Description of ~Jnknown Organism:Constructed by synthesizing, armealim3 and ligating complementary oligonucleotide~a or by creating primers for PCR
amplification <400> 5 ccatggctag cgaagttcct attccgaagt tcctattctt caataagtat aggaacttca 60 ctagttctcg ag 72

Claims (38)

What is claimed is:

1. A method for targeting the insertion of nucleotide sequences of interest to a specific chromosomal site within the genome of a plant cell, said method comprising:
transforming said plant cell with a transfer cassette, said transfer cassette comprising said nucleotide sequence of interest and said transfer cassette is flanked by or comprises non-identical recombination sites;
wherein said plant genome comprising a target site comprising non-identical recombination sites which correspond to the flanking sifts of said transfer cassette; and, providing a recombinase that recognizes and implements recombination at the non-identical recombination sites; wherein said transfer cassettes are introduced into said plant cell by a non-integrating transformation method.

2. The method of claim 1, wherein said nucleotide sequence of interest is flanked by said non-identical recombination sites.

3. The method of Claim 1, wherein said non-integrating transformation method is an Agrobacterium-mediated method.

4. The method of Claim 1, wherein said plant cell is a monocotyledonous cell.

5. The method of Claim 4, wherein said monocotyladonous cell is maize cell.

6. A modified plant made by the method of Claim 4.

7. Seed of the plant of Claim 6.

8. A modified plant made by the method of Claim 5.

9. Seed of the plant of Claim 8.

10. The method of Claim 1, wherein said non-integrative transformation method comprises a modified Agrobacterium-mediated method.

11. The method of Claim 10, wherein said Agrobacterium-mediated method contains a modified VirD2 gene.

12. The method of Claim 11, wherein said plant cell is a dicotyledonous plant cell.

13. A modified plant made by the method of Claim 12.

14. Seed of the plant of Claim 13.

15. The method of Claim 1, wherein said non-integrating transformation method is a virus based method.

16. The method of Claim 1, wherein said non-identical recombination sites are selected from the group consisting of FRT, mutant FRT, LOX, and mutant LOX
sites.

17. The method of Claim 1, wherein said sires are a FRT site and a mutated FRT site.

18. The method of Claim 1 wherein said recombinase is provided by genetically transforming said plant with an expression cassette containing a nucleotide sequence encoding said recombinase.

19. The method of Claim 18, wherein said recombinase is FLP.

20. The method of Claim 19, wherein said FLP has lien synthesized using maize preferred colons.

21. The method of Claim 17, wherein said mutant FRT site is FRT5 (SEQ ID
NO: 3), FRT 6 (SEQ ID NO: 4) or FRT 7 (SEQ ID NO: 5).

22. A plant whose genome has been modified by introducing into said plant a transfer cassette, said transfer cassette comprising a nucleotide sequence of interest and said transfer cassette is flanked by or comprises non-identical recombination sites;
wherein said plant genome comprises a target site comprising non-identical recombination sites which correspond to the non-identical recombination sites of said transfer cassette; and, providing a recombinase that recognizes and implements recombination at the non-identical recombination sites; wherein said transfer cassette is introduced into said plant cell by a non-integrating transformation methods.

23. The plant of claim 22, wherein said nucleotide sequence of interest is flanked by said non-identical recombination sites.

24. The plant of Claim 22, wherein said non-integrating transformation method is an Agrobacterium-mediated method.

25. The plant of Claim 24, wherein said plant cell is a monocotyledonous cell.

26. The plant of Claim 25, wherein said monocotyledonous cell is a maize cell.

27. Seed of the plant of Claim 22.

28. Seed of the plant of Claim 24.

29. Seed of the plant of Claim 25.

30. Seed of the plant of Claim 26.

31. The plant of Claim 25, wherein said Agrobacterium-mediated method contains a modified VirD2 gene.

32. The plant of Claim 31, wherein said plant cell is a dicotyledonous plant cell.

33. Seed of the plant of Claim 32.

34. The plant of Claim 2, wherein said non-integrating transformation method is a virus based method.

35. The plant of Claim 22, wherein said non-identical recombination sites are selected from the group consisting of FRT, mutant FRT, LOX, and mutant LOX
sites.

36. The plant of Claim 22, wherein said non-identical recombination sites are a FRT site and a mutated FRT site.

37. The plant of Claim 22, wherein said recombinase is provided by genetically transforming said plant with an expression cassette containing a nucleotide sequence encoding said recombinase.

38. The plant of Claim 37, wherein said recombinase is FLP.