CA2351110A1 - Helicobacter felis vaccine - Google Patents

Helicobacter felis vaccine Download PDF

Info

Publication number
CA2351110A1
CA2351110A1 CA002351110A CA2351110A CA2351110A1 CA 2351110 A1 CA2351110 A1 CA 2351110A1 CA 002351110 A CA002351110 A CA 002351110A CA 2351110 A CA2351110 A CA 2351110A CA 2351110 A1 CA2351110 A1 CA 2351110A1
Authority
CA
Canada
Prior art keywords
gly
lys
thr
val
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002351110A
Other languages
French (fr)
Inventor
Johannes Gerardus Kusters
Giovanni Cattoli
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intervet International BV
Original Assignee
Akzo Nobel N.V.
Johannes Gerardus Kusters
Giovanni Cattoli
Intervet International B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Akzo Nobel N.V., Johannes Gerardus Kusters, Giovanni Cattoli, Intervet International B.V. filed Critical Akzo Nobel N.V.
Publication of CA2351110A1 publication Critical patent/CA2351110A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Abstract

The present invention relates to novel Helicobacter felis urease subunit polypeptides and to nucleic acid sequences encoding these subunit polypeptides, to DNA
fragments and recombinant DNA molecules comprising the nucleic acid sequences encoding these subunit polypeptides, to live recombinant carriers and to host cells comprising nucleic acid sequences encoding these subunit polypeptides. Also, the invention relates to the subunit polypeptides for use in vaccines and the use in the manufacturing thereof, to vaccines comprising said subunit polypeptides and to methods for the preparation of such vaccines. Furthermore, the invention relates to diagnostic methods for the detection of Helicobacter felis specific nucleic acid sequences, Helicobacter felis antigenic material and to antibodies against Helicobacter felis.

Description

Helicobacter fells vaccine.
The present invention relates to novel Helicobacter urease subunit polypeptides, nucleic acid sequences encoding these polypeptides, to the polypeptides for use in vaccines and to the use in the manufacturing thereof, to vaccines comprising said polypeptides and to methods for the preparation of such vaccines. Further, the invention relates to diagnostic methods for the detection of the nucleic acid sequences, the polypeptides and antibodies against the polypeptides.
Several Helicobacter species are the cause of pathogenesis of the gastric epithelium.
Helicobacter pylori, and to a lesser extent H. heilmannii are known to cause gastritis, a major factor in the development of peptic ulcers and gastric lymphoma in humans.
Helicobacter fells is most likely the cause of gastric infections in both cats and dogs.
In order to survive the highly acidic environment of the stomach, members of the Helicobacterfamily produce an urease that is capable of hydrolysing the urea present in gastric juice. This hydrolysation sets free an amount of NH40H that suffices to neutralise the environment of the bacterium. It is known, that the urease plays a role in the colonisation of the bacterium as well as in its pathogenesis.
Genes encoding urease have been described and sequenced for both Helicobacter pylori (Labigne et al., J. Bacteriol. 173: 1920-1931 (1991 )) and Helicobacter fells (Ferrero et al., Molec. Microbiol. 9, 323-333 (1993)). Of the seven genes involved in urease expression and secretion, only two genes encode the two structural subunits urease A en B of the urease enzyme; ureA and urea. These two polypeptides form a polypeptide complex having urease activity.
Vaccines against infections caused by both H. pylori and fells have been made and have been the subject of i.a. International Patent Applications WO 94/09823 and WO
96/34624. Several attempt have been made, to use H. pylori urease as a vaccine component for the protection of cats against H. fells infection. Although indeed a certain level of protection can be obtained, the results are far from the 100 %
protection that would be desirable. From animal experiments published so far it becomes clear that a significant number of animals vaccinated with H. pylori is not at all protected against subsequent challenge with H. fells. Protection of cats vaccinated with purified urease from either H. fells or pylori has not been described. Vaccinating cats with H. fells whole cell lysates might theoretically be feasible but is not a practical option.
This is because in spite of many attempts for improvement, H. fells is difficult to grow.
There clearly is a need for an efficacious vaccine, based upon homologous components, and it is clear that the known H. fells urease does not confer full protection.
It is i.a. an object of the present invention to provide a H. fells urease which is able to induce protection against Helicobacter fells infection in dogs and cats. It was surprisingly found now, that in H. fells a second urease exists, of which the genes encoding the structural subunits share only low homology with the known H. fells ureA and B
genes.
The novel urease is named ureaseXY, in order to discriminate it from the known urease AB. The newly found urease has been discovered in H. fells, and is not present in H.
pylori.
The overall genetic structure of the genes encoding the two structural urease subunits, UreX and UreY is comparable to that of the known UreA and B in H. fells and H.
pylori.
The sequence homology is however surprisingly low. It was even more surprisingly found, that the homology between the ureA and B genes and the novel ureX and Y
genes in one single H. fells strain is even strikingly lower than the homology between the various ureA and B genes from the various Helicobacter species.
Table 1 a, 1 b and 1 c show the comparison of the ureX and Y gene and the polypeptides they encode form five different Helicobacter fells species, with the ureA and B genes and polypeptides from Helicobacfer fells, pylori and heilmannii.
The level of homology of the genes encoding the novel structural urease subunits X and Y and the polypeptides they encode as compared to that of known ureA and B
genes and polypeptide subunits is presented in table 1 a, b and c.
Reference molecule : H. fellsa.a. n.a.
ureX CS1 H. fells ureA 50 % 57 _ 52 % 60 H. pylori ureA

H. heilmannii ureA 54 % 62 H. fells strain Kukka ureX 100 % 91 H. fells strain Ds4 ureX 99 % 91 H. fells strain 2301 ureX 99 % 91 H. fells strain 390 ureX 99 % 91 Table 1a: amino acid and nucleic acid homology between the H. fells ureX and various ureA subunits.
Reference molecule : H. fellsa.a. n.a.
ureY CS1 H. fells urea _ 73 % 71 H. pylori urea 73 % 70 H. heilmannii urea 74 % 71 H. fells strain Kukka ureY 99 % 95 H. fells strain Ds4 ureY 98 % 94 H. fells strain 2301 ureY 99 % 95 Table 1 b: amino acid and nucleic acid homology between the H. fells ureY and various urea subunits.
Reference molecule: H. fells n.a. _ ureXY CSI

H. fe 67 lis ureAB _ _ 67 H. pylori ureAB

H. heilmannii ureAB 68 H. fells strain Kukka ureXY 94 H. fells strain Ds4 ureXY 94 H. fells strain 2301 ureXY 94 Table 1 c: nucleic acid homology between H, fells ureXY and various ureAB genes.
One embodiment of the invention thus relates to nucleic acid sequences encoding the novel urease X and Y subunits.
First of all, this embodiment of the invention relates to nucleic acid sequences encoding two subunits of a urease complex such as expressed by Helicobacter fells, that have at least 85 % homology with SEQ ID NO: 1, or parts thereof with a length of at least 40, preferably 45, more preferably 50 nucleotides encoding at least an immunogenic fragment of one of the subunits. Still even longer fragments, with a length of at least 55, 60 or 70 nucleic acids are in that order even more preferred.
A preferred form of this embodiment relates to nucleic acid sequences that encode the urease X subunit polypeptide or the urease Y subunit polypeptide and that have at least 85 % homology with SEQ ID NO: 1, or parts thereof with a length of at least 40, preferably 45, more preferably 50 nucleotides encoding at least an immunogenic fragment of the urease X subunit polypeptide or the urease Y subunit polypeptide.
Merely as an example: the nucleic acid sequence encoding the unease X subunit of Helicobacter fells strain CS1 starts at position 206/207/208 (GTG) (See figure 1 a (1 )) and stops at position 884/885/886 (TAA). the nucleic acid sequence encoding the unease Y subunit of Helicobacter fells strain CS1 starts at position 897!898/899 (ATG) and stops at position 2601/260212603 (TAG).
Still even longer fragments, with a length of at least 55, 60 or 70 nucleic acids are in that order even more preferred.
A more preferred form of this embodiment relates to nucleic acid sequences having at least 90 %, preferably 94 %, more preferably 97 % homology with SEQ ID NO: 1.
The determination of the homology percentages was done with the computer program Align Plus for Windows, available from Scientific and Educational Software, P.O.Box 72045 Durham, NC 27722-2045, USA. Settings used for the nucleic acid comparisons are indicated in figures 1 a, 1 b and 1 c.
Since the present invention discloses nucleic acid sequences encoding novel structural Helicobacter fells unease subunits, it is now for the first time possible to obtain such polypeptides in sufFcient quantities. This can e.g. be done by using expression systems to express the genes encoding the UreX and UreY subunits.
Therefore, in a more preferred embodiment, the invention relates to DNA
fragments comprising a nucleic acid sequence according to the invention. Such DNA
fragments can e.g. be plasmids, into which a nucleic acid sequence according to the invention is cloned. Such DNA fragments are useful e.g. for enhancing the amount of DNA for use as a probe, as described below.
An essential requirement for the expression of the nucleic acid sequence is an adequate promoter operably linked to the nucleic acid sequence. It is obvious to those skilled in the art that the choice of a promoter extends to any eukaryotic, prokaryotic or viral promoter capable of directing gene transcription in cells used as host cells for protein expression.
Therefore, an even more preferred form of this embodiment relates to a recombinant DNA molecule comprising a DNA fragment or a nucleic acid sequence according to the invention that is placed under the control of a functionally linked promotor.
This can be obtained by means of e.g. standard molecular biology techniques.
(Maniatis/Sambrook (Sambrook, J. Molecular cloning: a laboratory manual, 1989. ISBN 0-87969-309-6).
Functionally linked promotors are promotors that are capable of controlling the transcription of the nucleic acid sequences to which they are linked.
When the host cells are bacteria, useful expression control sequences which may be used include the Trp promoter and operator (Goeddel, et al., Nucl. Acids Res., 8, 4057, 1980); the lac promoter and operator (Chang, et al., Nature, 275, 615, 1978);
the outer membrane protein promoter (Nakamura, K. and Inouge, M., EMBO J., 1, 771-775, 1982); the bacteriophage lambda promoters and operators (Remaut, E. et al., Nucl.
Acids Res., 11, 4677-4688, 1983); the a-amylase (B. subtilis) promoter and operator, termination sequences and other expression enhancement and control sequences compatible with the seled'ted host cell.
When the host cell is yeast, useful expression control sequences include, e.g., a-mating factor. For insect cells the polyhedrin or p10 promoters of baculoviruses can be used (Smith, G.E. et al., Mol. Cell. Biol. 3, 2156-65, 1983). When the host cell is of mammalian origin illustrative useful expression control sequences include the promoter (Berman, P.W. et al., Science, 222, 524-527, 1983) or the metallothionein promoter (Brinster, R.L., Nature, 296, 39-42, 1982) or a heat shock promoter (Voellmy et al., Proc. Natl. Acad. Sci. USA, 82, 4949-53, 1985).
Bacterial, yeast, fungal, insect and mammalian cell expression systems are very frequently used systems. Such systems are well-known in the art and generally available, e.g. commercially through Clontech Laboratories, Inc. 4030 Fabian Way, Palo Alto, California 94303-4607, USA. Next to these expression systems, parasite-based expression systems are very attractive expression systems. Such systems are e.g.
described in the French Patent Application with Publication number 2 714 074, and in US NTIS Publication No US 08/043109 (Hoffman, S. and Rogers, W.: Public. Date December 1993).
Thus a still even more preferred form of this embodiment of the invention relates to Live Recombinant Carrier micro-organisms (LRCs) comprising a gene encoding the UreX
or UreY polypeptide or an immunogenic fragment thereof according to the invention. Such micro-organisms are e.g. bacteria and viruses. These LRC micro-organisms are micro-organisms in which additional genetic information, in this case a gene encoding the UreX
or UreY polypeptide or an immunogenic fragment thereof according to the invention has been cloned. Animals infected with such LRCs will produce an immunogenic response not only against the immunogens of the vector, but also against the immunogenic parts of the polypeptide(s) for which the genetic code is additionally cloned into the LRC, e.g.
the ureX or Y gene.
As an example of bacterial LRCs, attenuated Salmonella strains known in the art can attractively be used.
Live recombinant carrier parasites have i.a. been described by Vermeulen, A.
N. (Int.
Journ. Parasitol. 28: 1121-1130 (1998)) Also, LRC viruses may be used as a way of transporting the nucleic acid sequence into a target cell. Live recombinant carrier viruses are also called vector viruses. The site of integration of the gene encoding a UreX or Y polypeptide may be a site in a viral gene that is not essential to the virus, or a site in an intergenic region. Viruses often used as vectors are Vaccinia viruses (Panicali et al; Proc. Natl. Acad. Sci. USA, 79:
4927 (1982), Herpesviruses (E.P.A. 0473210A2), and Retroviruses (Valerio, D. et al; in Baum, S.J., Dicke, K.A., Lotzova, E. and Pluznik, D.H. (Eds.), Experimental Haematology today -1988. Springer Verlag, New York: pp. 92-99 (1989)).

The technique of in vivo homologous recombination, well-known in the art, can be used to introduce a recombinant nucleic acid sequence into the genome of a bacterium, parasite or virus of choice, capable of inducing expression of the inserted nucleic acid sequence according to the invention in the host animal.
Finally another form of this embodiment of the invention relates to a host cell comprising a nucleic acid sequence encoding a polypeptide according to the invention, a DNA
fragment comprising such a nucleic acid sequence or a recombinant DNA molecule comprising such a nucleic acid sequence under the control of a functionally linked promotor. This form alsor elates to a host cell containing a live recombinant carrier containing a nucleic acid molecule encoding a UreX or Y polypeptide or an immunogenic fragment thereof according to the invention.
A host cell may be a cell of bacterial origin, e.g. Escherichia coli, Bacillus subtilus and Lactobacillus species, in combination with bacteria-based plasmids as pBR322, or bacterial expression vectors as pGEX, or with bacteriophages. The host cell may also be of eukaryotic origin, e.g. yeast-cells in combination with yeast-specific vector molecules, or higher eukaryotic cells like insect cells (Luckow et al; Bio-technology 6:
47-55 (1988)) in combination with vectors or recombinant baculoviruses, plant cells in combination with e.g. Ti-plasmid based vectors or plant viral vectors (Barton, K.A. et al; Cell 32: 1033 (1983), mammalian cells like Hela cells, Chinese Hamster Ovary cells (CHO) or Crandell Feline Kidney-cells, also with appropriate vectors or recombinant viruses.
Another embodiment of the invention relates to the polypeptides encoded by the nucleic acid sequences, i.e. the urease X subunit and the urease Y subunit and to immunogenic fragments thereof according to the invention.
Therefore, this embodiment of the invention relates to the Helicobacter fells urease X
polypeptide, said polypeptide having an amino acid sequence that is at least homologous to SEQ ID NO: 2 or an immunogenic fragment of that polypeptide with a length of at least 40 amino acids that is capable of inducing an immune response against ureaseXY. Preferably, the length of that fragment is more than 40 amino acids, more preferably at least 45, 50, 55, 60 or 70 amino acids in that order or preference.
Preferably this embodiment relates to such polypeptides having a sequence homology of at least 90 %, more preferably 94 %, even more preferably 97 % homology to SEQ
ID
NO: 2, or an immunogenic fragment of that polypeptide with a length of at least 40 amino acids, more preferably at least 45, 50, 55, 60 or 70 amino acids in that order or preference that is capable of inducing an immune response against ureaseXY.
This embodiment of the invention also relates to the Helicobacfer fells urease Y
polypeptide, said polypeptide having an amino acid sequence that is at least homologous to SEQ ID NO: 3 or an immunogenic fragment of that polypeptide with a length of at least 40 amino acids that is capable of inducing an immune response against ureaseXY. Preferably, the length of that fragment is more than 40 amino acids, more preferably at least 45, 50, 55, 60 or 70 amino acids in that order or preference.
Preferably this embodiment relates to such polypeptides having a sequence homology of at least 90 %, more preferably 94 %, even more preferably 97 % homology to SEQ
ID
NO: 3, or an immunogenic fragment of that polypeptide with a length of at least 40 amino acids, more preferably at least 45, 50, 55, 60 or 70 amino acids in that order or preference that is capable of inducing an immune response against ureaseXY.
As for the nucleotide sequence comparison, the comparison between the various amino acid sequences was made using Align Plus for Windows, available from Scientific and Educational Software, P.O.Box 72045 Durham, NC 27722-2045, USA. Settings used for the amino acid comparisons are indicated in figures 1 a, 1 b and 1 c.
It will be understood that, for the particular polypeptides embraced herein, natural variations can exist between individual Helicobacter fells strains. These variations may be demonstrated by (an) amino acid differences) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acids) in said sequence. Amino acid substitutions which do not essentially alter biological and immunological activities, have been described, e.g. by Neurath et al in "The Proteins"
Academic Press New York (1979). Amino acid replacements between related amino acids or replacements which have occurred frequently in evolution are, inter alia, Ser/Ala, SerIGly, Asp/Gly, Asp/Asn, IIe/Val (see Dayhof, M.D., Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington D.C., 1978, vol. 5, suppl.
3). Other amino acid substitutions include Asp/Glu, Thr/Ser, Ala/Gly, AIa/Thr, Ser/Asn, AIa/Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/lle, Leu/Val and Ala/Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science,227, 1435-1441, 1985) and determining the functional similarity between homologous proteins. Such amino acid substitutions of the exemplary embodiments of this invention, as well as variations having deletions and/or insertions are within the scope of the invention as long as the resulting polypeptides retain their immunoreactivity.
Thus, variations not essentially influencing the immunogenicity of the polypeptide compared to the wild type polypeptide as depicted in SEQ ID NO: 2 or 3 are considered to fall within the scope of the invention. Those variations in the amino acid sequence of a certain structural subunit X or Y according to the invention that still provide a polypeptide capable of inducing an immune response against infection with H. fells or at least against the clinical manifestations of the infection are considered as "not essentially influencing the immunogenicity".
When a polypeptide is used for e.g. vaccination purposes or for raising antibodies, it is however not necessary to use the whole polypeptide. It is also possible to use a fragment of that polypeptide that is capable, as such or coupled to a carrier such as e.g.
KLH, of inducing an immune response against that polypeptide, a so-called immunogenic fragment. An "immunogenic fragment" is understood to be a fragment of the full-length polypeptide of the structural subunit X or Y, that still has retained its capability to induce an immune response in the host, i.e. comprises a B- or T-cell epitope. At this moment, a variety of techniques is available to easily identify DNA
fragments encoding antigenic fragments (determinants). The method described by Geysen et al (Patent Application WO 84/03564, Patent Application WO 86/06487, US
Patent NR. 4,833,092, Proc. Natl Acad. Sci. 81: 3998-4002 (1984), J. Imm.
Meth. 102, 259-274 (1987), the so-called PEPSCAN method is an easy to perform, quick and well-established method for the detection of epitopes; the immunologically important regions of the polypeptide. The method is used world-wide and as such well-known to man skilled in the art. This (empirical) method is especially suitable for the detection of B-cell epitopes. Also, given the sequence of the gene encoding any protein, computer algorithms are able to designate specific polypeptide fragments as the immunologically important epitopes on the basis of their sequential and/or structural agreement with epitopes that are now known. The determination of these regions is based on a combination of the hydrophilicity criteria according to Hopp and Woods (Proc.
Natl.
Acad. Sci. 78: 38248-3828 (1981 )), and the secondary structure aspects according to Chou and Fasman (Advances in Enzymology 47: 45-148 (1987) and US Patent 4,554,101). T-cell epitopes can likewise be predicted from the sequence by computer with the aid of Berzofsky's amphiphilicity criterion (Science 235, 1059-1062 (1987) and US Patent application NTIS US 07/005,885). A condensed overview is found in:
Shan Lu on common principles: Tibtech 9: 238-242 (1991 ), Good et al on Malaria epitopes;
Science 235: 1059-1062 (1987), Lu for a review; Vaccine 10: 3-7 (1992), Berzowsky for HIV-epitopes; The FASEB Journal 5:2412-2418 (1991 ).
Vaccines against e.g. He1icobacter pylori, which has only one urease, can be made on the basis of this urease, as was described above. In the specific case of Helicobacter fells however a vaccine based upon the known Helicobacter fells structural subunits ureA and B is not capable of providing sufficient protection against Helicobacter fells infection: immunity against structural subunits ureA and B allegedly does not neutralise the urease activity of the newly found heterologous structural subunits UreX
and Y.
Therefore, vaccines for the protection of animals against Helicobacter fells infection should at least be directed against the novel urease XY.
Therefore, one form of still another embodiment of the invention relates to vaccines capable of protecting mammals such as dogs and cats against Helicobacter fells infection, that comprise the structural subunit X or Y, preferably X and Y, more preferably X, Y, A and B, or an immunogenic fragment of X and/or Y according to the invention together with a pharmaceutically acceptable carrier.
Still another embodiment of the present invention relates to the polypeptides according to the invention for use in a vaccine.
Still another embodiment relates to the use of the polypeptide according to the invention in the manufacturing of a vaccine for combating Helicobacter fells infections.
One way of making a vaccine according to the invention is by biochemical purification of the ureaseXY polypeptide or its subunits from a bacterial culture. This can e.g. be done by centrifugation of the bacteria, and the use of gel-filtration columns for separation of the urease polypeptide or its subunits from other components. Further purification may e.g. be done by selective precipitation in ammonium-sulphate, followed by centrifugation, gel electrophoresis and, if desired, separation from the urease AB subunits and dissolving the pellet in a suitable buffer. This is however a time-consuming way of making the vaccine, especially where Helicobacter fells is difficult to grow.
It is therefore much more convenient to use the expression products of the genes encoding the urease X and Y subunits according to the invention in vaccines.
Such vaccines can easily be made by admixing ureaseXY or an UreX or Y subunit or an immunological fragment thereof according to the invention with a pharmaceutically acceptable carrier as described below.
Furthermore vaccines can comprise live recombinant carriers as described above, capable of expressing ureaseXY, an UreX or UreY subunit or immunogenic fragments thereof according to the invention. Such vaccines, e.g. based upon a Salmonella carrier or a viral carrier infecting the gastric epithelium have the advantage over subunit vaccines that they better mimic the natural way of infection of Helicobacfer fells.
Moreover, their self propagation is an advantage since only low amounts of the recombinant carrier are necessary for immunisation.
Vaccines described above all contribute to active vaccination, i.e. the host's immune system is triggered by the UreX and/or Y polypeptide or immunogenic fragments thereof, to make antibodies against these polypeptides.
Alternatively, such antibodies can be raised in e.g. rabbits or can be obtained from antibody-producing cell lines as described below. Such antibodies can then be administered to the host animal. This method of vaccination, passive vaccination, is the vaccination of choice when an animal is already infected, and there is no time to allow the natural immune response to be triggered. It is also the preferred method for vaccinating immune-compromised animals. Administered antibodies against Helicobacter UreX or UreY can in these cases bind directly to the urease excreted by the bacteria. This has the advantage that the unease activity is directly eliminated, thus resulting in acidification of the environment and decreased or stopped Helicobacter growth.
Therefore, one other form of this embodiment of the invention relates to vaccines comprising antibodies against Helicobacter fells unease X polypeptides that have an amino acid sequence that is at least 85 % homologous to SEQ ID NO: 2 or immunogenic fragments of that polypeptide with a length of at least 40 amino acids that are capable of inducing an immune response against ureaseXY or antibodies against Helicobacter fells unease Y polypeptides that have an amino acid sequence that is at least 85 % homologous to SEQ ID NO: 3 or immunogenic fragments of that polypeptide with a length of at least 40 amino acids that are capable of inducing an immune response against ureaseXY.
Vaccines can also be based upon host cells as described above, that comprise ureaseXY, an UreX or UreY subunit or immunogenic fragments thereof according to the invention.
An alternative and efficient way of vaccination is direct vaccination with DNA
encoding the relevant antigen. Direct vaccination with DNA encoding polypeptides has been successful for many different polypeptides. (As reviewed in e.g. Donnelly et al., The Immunologist 2: 20-26 (1993)).
This way of vaccination is very attractive for the vaccination of both cats and dogs against Helicobacter fells infection.
Therefore, still other forms of this embodiment of the invention relate to vaccines comprising nucleic acid sequences encoding a polypeptide according to the invention or immunogenic fragments thereof according to the invention, and to vaccines comprising DNA fragments that comprise such nucleic acid sequences.
Still other forms of this embodiment relate to vaccines comprising recombinant DNA
molecules according to the invention.
DNA vaccines can easily be administered through intradermal application e.g.
using a needle-less injector. This way of administration delivers the DNA directly into the cells of the animal to be vaccinated. Amount of DNA in the microgram range between 1 and 100 ~g provide very good results.
In a further embodiment, the vaccine according to the present invention also comprises antigens from other dog or cat pathogenic organisms and viruses, or genetic information encoding such antigens. Such organisms and viruses are e.g. Feline Infectious Peritonitis virus, Feline Immune deficiency virus, Canine and Feline Parvovirus, Distemper virus, Adenovirus, Calicivirus, Bordetella bronchiseptica, Bon-elia burgdorferi, Leptospira interrogans, Chlamydia and Bartonella henseli.
Also, the present invention relates to polypeptides according to the invention for use in the manufacturing of a vaccine for combating Helicobacter fells infections.
All vaccines according to the present invention comprise a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier can be e.g. sterile water or a sterile physiological salt solution. In a more complex form the carrier can e.g. be a buffer.
Vaccines according to the present invention may in a preferred presentation also contain an adjuvant. Adjuvants in general comprise substances that boost the immune response of the host in a non-specific manner. A number of different adjuvants are known in the art. Examples of adjuvants are Freunds Complete and Incomplete adjuvant, vitamin E, non-ionic block polymers, muramyldipeptides, Quill A(R), mineral oil e.g.
Bayol(R) or Markol(R), vegetable oil, and Carbopol(R) (a homopolymer), or Diluvac(R) Forte.
The vaccine may also comprise a so-called "vehicle". A vehicle is a compound to which the polypeptide adheres, without being covalently bound to it. Often used vehicle compounds are e.g. aluminium hydroxide, -phosphate or -oxide, silica, Kaolin, and Bentonite.
A special form of such a vehicle, in which the antigen is partially embedded in the vehicle, is the so-called ISCOM (EP 109.942, EP 180.564, EP 242.380) In addition, the vaccine may comprise one or more suitable surface-active compounds or emulsifiers, e.g. Span or Tween.
Often, the vaccine is mixed with stabilisers, e.g. to protect degradation-prone polypeptides from being degraded, to enhance the shelf-life of the vaccine, or to improve freeze-drying efficiency. Useful stabilisers are i.a. SPGA (Bovarnik et al; J.
Bacteriology 59: 509 (1950)), carbohydrates e.g. sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, proteins such as albumin or casein or degradation products thereof, and buffers, such as alkali metal phosphates.
In addition, the vaccine may be suspended in a physiologically acceptable diluent.
It goes without saying, that other ways of adjuvating, adding vehicle compounds or diluents, emulsifying or stabilising a polypeptide are also embodied in the present invention.
Vaccines according to the invention that comprise the UreX or UreY subunit polypeptide can very suitably be administered in amounts ranging between 1 and 100 micrograms, although smaller doses can in principle be used. A dose exceeding 100 micrograms will, although immunologically very suitable, be less attractive for commercial reasons.
Vaccines based upon live attenuated recombinant carriers, such as the LRC-viruses and bacteria described above can be administered in much lower doses, because they multiply themselves during the infection. Therefore, very suitable amounts would range between 103 and 109 CFU/PFU for respectively bacteria and viruses.
Many ways of administration can be applied. Intranasal application is a frequently used way of administrating a vaccine. Oral application is also an attractive way of administration, because the infection is often located in the upper digestive tract. A
preferred way of oral administration is the packaging of the vaccine in capsules, known and frequently used in the art, that only disintegrate in the highly acidic environment of the stomach. Also, the vaccine could be mixed with compounds known in the art for temporarily enhancing the pH of the stomach.
Systemic application is also suitable, e.g. by intramuscular application of the vaccine. If this route is followed, standard procedures known in the art for systemic application are 5 well-suited.
Another embodiment of the invention relates to diagnostic tests for the detection of H.
fells infection. It is known that several Helicobacter species such as H.
bizzozeronii, H.
fells and H. salomonis are capable of infecting both cats and dogs. Of these three, H.
10 fells is the species suspected to cause most of the pathology, although it is often outnumbered by H. bizzozeronii and H. salomonis. Thus, a quick and correct diagnosis of disease, in both cats and dogs, caused by Helicobacter fells is important.
It has however been very difficult to discriminate between these three species due to the fact that they are so very closely related.
Therefore it is another objective of this invention to provide such diagnostic tools suitable for discriminating H. fells from other Helicobacter species.
On the basis of the novel urease polypeptides and the genes encoding the urease polypeptides, at least three different diagnostic tests, specifically suitable for the discrimination of H. fells from other members of the Helicobacter family were developed:
1 ) a diagnostic test based upon the presence or absence of DNA encoding the specific UreX and UreY structural subunits 2) a diagnostic test based upon the detection of antibodies against the specific UreX and UreY structural subunits 3) a diagnostic test based upon the detection of antigenic material of the specific UreX
and UreY structural subunits A diagnostic test according to 1 ) is e.g. based upon the reaction of bacterial DNA
isolated from the animal to be tested, with specific probes or PCR-primers based upon the sequence of ureX or Y genes. If H. fells DNA is present in the animal, this will e.g.
specifically bind to ureX or Y specific PCR-primers and will subsequently become amplified in PCR-reaction. The PCR-reaction product can then easily be detected in DNA gel electrophoresis.
The DNA can most easily be isolated from the micro-organisms present in swabs of the upper digestive tract or in the saliva of the animal to be tested. Specific primers can easily be selected from the many regions of the ureX and ureY coding sequences and the non-coding intergenic sequence that differ in sequence from the comparable regions in the ureAB coding sequences. One of the many algorithms suitable for the determination of the level of nucleic acid homology and for comparison of nucleotide sequences in general is known as "Clustal W". It has been described by Thompson et al., in Nucleic Acid Research 22: 4673-4680 (1994). The program can be found at several sites on Internet. An more recent alternative for this program is e.g.
Align Plus for Windows, available from Scientific and Educational Software, P.O.Box 72045 Durham, NC 27722-2045, USA.
As follows from figure 1, a large number of possible PCR-primers can be found that are specific for ureX or ureY. An extremely specific pair of PCR-probes is e.g.
formed by the 5'-located sequence CATGCACTTTTTGAAAAAAGA (SEQ ID NO: 16) and the 3'-located sequence TATGGTGGTCTTCTCT (SEQ ID NO: 17). Of course many other sequences that are specific for ureX or Y or the intergenic region are suitable. Standard PCR-textbooks give methods for determining the suitability of the probes for selective PCR-reactions with ureX or ureY. PCR-techniques are extensively described in (Dieffenbach & Dreksler; PCR primers, a laboratory manual. ISBN 0-87969-447-5 ( 1995)).
Another DNA-based test is based upon growth of bacterial material obtained from the swab, followed by classical DNA purification followed by classical hybridisation with radioactively or colour-labelled ureXY-specific DNA-fragments. Given the very low homology between the ureXY-coding regions and the ureAB coding regions of both H.
fells and other Helicobacter species, hybridisation unambiguously indicates the presence or absence of H. fells. Both PCR-reactions and hybridisation reactions are well-known in the art and are i.a. described in Maniatis/Sambrook (Sambrook, J. et al.
Molecular cloning: a laboratory manual. ISBN 0-87969-309-6).
Selective detection with PCR-primers or with classical hybridisation with ureXY-specific DNA-fragments can be done with fragments that preferably are short, but for practical reasons preferably consist of a stretch of at least 10 contiguous nucleotides of SEQ ID
NO: 1. It is clear that for hybridisation experiments a probe needs to be selected that has a higher homology to SEQ ID NO: 1, than to sequences encoding the Helicobacter ureA
or urea subunit. Such a probe can very easily be selected with the help of the Align Plus for Windows program or the Clustal W program as discussed above. In a comparative hybridisation experiment the DNA to be diagnosed can be tested next to e.g. H.
pylori DNA. The probe according to the invention, having a higher homology to SEQ ID
NO: 1 than to a gene encoding ureAB, would bind better to H. fells DNA (if present in the sample) than to DNA of other Helicobacter species thus specifically revealing the presence of H. fells DNA in the sample to be tested. The sequences SEQ ID NO:
16 or 17 mentioned above are merely examples of probes very suitable for labelling and subsequent use in the H. fells-specific hybridisation assays as described.
Thus, one embodiment of the invention relates to a diagnostic test for the detection of DNA encoding the specific Helicobacter UreX and UreY subunit polypeptides.
Such a test comprises a nucleic acid sequence according to the invention or a fragment thereof that is specific for the DNA encoding UreX and UreY or the intergenic region between UreX and UreY. A fragment that is specific for that DNA is a fragment that binds better to the DNA encoding UreX and UreY or the intergenic region between UreX and UreY
than to the DNA encoding UreA and Urea or the intergenic region between UreA and Urea.
Methods for the detection of Helicobacter fells DNA comprise hybridisation of the DNA to be tested with UreX or Y DNA, or PCR-reaction of the DNA to be tested with UreX or Y
DNA specific probes.
A diagnostic test according to 2) for the detection of Helicobacter fells antibodies in sera can be e.g. a simple sandwich-ELISA-test in which purified UreX or UreY
subunit polypeptides or antigenic fragments thereof according to the invention are coated to the wall of the wells of an ELISA-plate. A method for the detection of such antibodies is e.g.
Incubation of purified UreX or Y polypeptide with serum from mammals to be tested, followed by e.g. incubation with a labelled antibody against the relevant mammalian antibody. A colour reaction can then reveal the presence or absence of antibodies against Helicobacter fells urease XY. Depending on the labelled antibodies used, the selectivity of this system can be improved by pre-incubation of the serum to be tested with urease AB followed by spinning down the precipitate, in order to avoid non-XY-specific reactions.
If antigenic fragments of the UreX or UreY structural subunits according to the invention are used for coating, this pre-incubation step can be skipped.
Another example of a diagnostic test system is e.g. the incubation of a Western blot comprising UreX or UreY polypeptide or an antigenic fragment thereof according to the invention, with serum of mammals to be tested, followed by analysis of the blot.
The purified UreX and UreY structural subunits or antigenic fragments thereof according to the invention, suitable for the coating of ELISA plates or for Western blotting can easily be obtained by expression of the ureX and ureY gene as was described by Ferrero for ureA and B (Ferrero et al., Molec. Microbiol. 9, 323-333 (1993)).
Also, the invention relates to methods for the detection in serum of antibodies against Helicobacfer fells antibodies in which the method comprises the incubation of serum with UreX or UreY polypeptide or an antigenic fragment thereof according to the invention.
A diagnostic test according to 3) based upon the detection of antigenic material of the specific UreX and UreY structural subunits of Helicobacter fells antigens and therefore suitable for the detection of Helicobacter fells infection can e.g. also be a standard ELISA test. In one example of such a test the walls of the wells of an ELISA
plate are coated with antibodies directed against the specific UreX and UreY structural subunits of Helicobacter fells. The antigenic material to be tested can if necessary be pre-incubated with antibodies against UreA and B. This will leave the UreX and Y specific epitopes uncovered and therefore the pre-incubated Helicobacter species will bind to the ELISA
plate only if it comprises UreX or Y, i.e. if it specifically is Helicobacter fells.
The use of monoclonal antibodies specific for UreX or Y and not reacting with UreA or B
are the preferred antibodies in such tests, because they make the pre-incubation step superfluous. Such monoclonal antibodies can easily be obtained by immunising inbred mice with immunising fragments of UreX or Y according to the invention, by techniques also known in the art (See below: Kohler and Milstein).
The polypeptides or immunogenic fragments thereof according to the invention expressed as characterised above can be used to produce antibodies, which may be polyclonal, monospecific or monoclonal (or derivatives thereof). If polyclonal antibodies are desired, techniques for producing and processing polyclonal sera are well-known in the art (e.g. Mayer and Walter, eds. lmmunochemical Methods in Cell and Molecular Biology, Academic Press, London, 1987).
Monoclonal antibodies, reactive against the polypeptide according to the invention (or variants or fragments thereof) according to the present invention, can be prepared by immunising inbred mice by techniques also known in the art (Kohler and Milstein, Nature, 256, 495-497, 1975).
Finally, the invention relates to methods for the detection of antigenic material from Helicobacter fells in which the method comprises the incubation of serum, tissue of body fluids with antibodies against UreX or UreY polypeptide or an antigenic fragment thereof according to the invention.
Examale 1 The ureX and ureY genes of Helicobacter fells strain CS1: cloning and expression in Escherichia coli.
The ureX and ureY genes of H. fells strain CS1 were cloned as an operon into an E. coli T7 expression vector, pET3a, as follows:
For proper expression of the UreX and Y proteins in pET3a (Novagen, 601 Science Drive, Madison WI, USA) the genes were cloned as a Ndel-BamHl DNA fragment into the Ndel-BamHl sites of this vector. The ureaseXYoperon contains an internal Ndel site that was mutated by overlap-extension PCR of 2 PCR fragments. For that purpose two PCR fragments (the 5' and the 3' products) were amplified using chromosomal DNA of H. fells CS1 as the template. The 5' PCR product contained the complete ureX
gene and the first part of the ureY gene. The forward primer contained a Ndel restriction site and the start codon of ureX (GGAGTAACATATGAAACTCACA CCCAAAGAGC) (SEQ ID
NO: 18), and the reverse primer contains a point mutation (CACACCC
ACGACCATGTGAGGGCTTAC) (SEQ ID NO: 19). The second, 3' PCR product consisted of the 3' end of the ureY gene. This forward primer is complementary to the reverse primer of the first PCR product and also contained the same point mutation (GTAAGCC CTCACATGGTCGTGGGTGTG) (SEQ ID NO: 20), and the reverse primer contained a BamHl restriction site just downstream of the stopcodon of the ureY gene (CGAATT CGGATCCTAGAAGAAAGTGTAGCGCTGG) (SEQ ID NO: 21 ). The mutation in the complementary primers is made to delete the internal Ndel site in ureY, it replaces the CATATG (His- Met) by CACATG (His-Met).
After amplification of both PCR products, the complete operon was obtained by overlap-extension-PCR with the forward primer of the ureX and the reverse primer of the ureY
using both PCR products as templates. The resulting PCR product was cloned into PCR-bluntll-TOPO (Invitrogen, P.O.Box 2312, 9704 CH Groningen, The Netherlands) and transformed into E. coli TOP10F' cells (Invitrogen). Positive clones were isolated and the ureaseXY genes were sub-cloned into pET3a with Ndel-8amHl. The obtained plasmid was called pUreXY-1 and was transformed into the expression strain HMS174(DE3)/pLysS (Novagen).
The ureX and ureY genes of pUreXY-1 were expressed in HMS174(DE3)/pLysS as follows: an overnight culture was diluted 1/100 into TB Amp'°°
Cam25; this culture was incubated for 3 h at 37°C at 200 rpm; the culture was induced by adding 1 mM of IPTG
and incubated for another 3 h at 37°C at 200 rpm. The induction was done twice, once in a small scale and once in a large scale.
The induced samples were analysed on a SDS-PAGE gel (fig. 2). As can be clearly seen from lane 9, expression of UreX and UreY, when induced provides the two structural subunits as polypeptide bands with a molecular weight of 25 kDa for the UreX
subunit and 62 kDa for the UreY subunit.
Legend to the figures Figure 1a: Comparison of the nucleic acid sequence encoding UreX and Y, including a short non-coding region bridging the two coding sequences, from Helicobacter fells species CS1, Kukka, Ds4, 2301 and 390 with the nucleic acid sequence encoding UreA
and B, including a short non-coding region bridging the two coding sequences, from Helicobacter fells, pylori and heilmannii Figure 1 b: Comparison of the amino acid sequence of UreX from Helicobacter fells species CS1, Kukka, Ds4, 2301 and 390 with the amino acid sequence encoding UreA
from Helicobacter fells, pylori and heilmannii Figure 1 c: Comparison of the amino acid sequence of UreY from Helicobacter fells species CS1, Kukka, Ds4, 2301 and 390 with the amino acid sequence encoding Urea from Helicobacter fells, pylori and heilmannii Figure 2: Polyacrylamide gel of the expression products UreX and UreY
Lane 7 : Biorad broad range marker Lane 8 : Complete cell culture before induction (small scale culture) Lane 9 : Complete cell culture after induction (small scale culture) Lane 10 : Complete cell culture after induction (large scale culture) Lane 11 : Supernatant after induction (large scale culture).

Lane 12 : Biorad pre-stained marker SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: AKZO NOBEL N.V.
(ii} TITLE OF INVENTION: HELICOBACTER FELIS VACCINE
(iii} NUMBER OF SEQUENCES: 21 (iv} CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: FETHERSTONHAUGH & CO.
10 (B) STREET: P.O. BOX 2999, STATION D
(C) CITY: OTTAWA
(D) STATE: ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA
(B) FILING DATE: 03-JUL-2001 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FETHERSTONHAUGH & C0.
(B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 23804-613 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)-235-4373 {B) TELEFAX: (613)-232-8440 (2} INFORMATION FOR SEQ ID NO.: 1:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2883 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (206) . . (886) (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (897}..(2603}
(xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 1:

ACTTGTTAAT RCTATTATTA ATTTTTTAAT AATTACTTAT TATCA'rATAT AATAATATTA 120 TTACTTATAT TAAAAAGTTA ATAAAAAGTA ACGAAATTAG GACTA'rAATC CCATTGCCTT 180 TAAAATTTAA CACAAGGAGT AATAG GTG AAA CTC ACA CCC Ai'-~A GAG CAA GAA 232 VaI Lys Leu Thr Pro Lys Glu Gln Glu AAG TTC TTG TTA TAT TAT GCG GGC GAA GTG GCT AGA Ai~G CGC AAA GCA 280 Lys Phe Leu Leu Tyr Tyr AIa Gly Glu Val Ala Arg L~~s Arg Lys Ala GAG GGC TTA AAG CTC AAC CAA CCC GAA GCC ATT GCT Ti~C ATT AGT GCC 328 Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala T~~r Ile Ser Ala CAT ATT ATG GAC GAA GCG CGC CGT GGA AAA AAA ACC G'rT GCC CAG CTT 376 10 His Ile Met Asp Glu Ala Arg Arg Gly Lys Lys Thr Val Ala Gln Leu ATG GAA GAG TGC ATG CAC TTT TTG AAA AAA GAT GAA G'rA ATG CCC GGG 424 Met Glu Glu Cys Met His Phe Leu Lys Lys Asp Glu Val Met Pro Gly 60 65 '70 Val Gly Asn Met Val Pro Asp Leu Gly Val Glu Ala Tlar Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro I1e Glu P:ro Asp Glu His Phe Lys Ala Gly Glu Val Lys Phe Gly Cys Asp Lys Aap Ile Glu Leu AAT GCA GGC AAA GAA GTA ACC GAA CTT GAG GTT ACT Ai~T GAA GGG CCT 616 Asn Ala Gly Lys Glu Val Thr Glu Leu Glu Val Thr A:an Glu Gly Pro AAA TCC TTG CAT GTG GGT AGC CAT TTC CAC TTC TTT Gi~A GCT AAC AAG 664 Lys Ser Leu His Val Gly Ser His Phe His Phe Phe G.Lu Ala Asn Lys 140 145 1!50 GCA CTA AAA TTC GAT CGT GAA AAA GCC TAT GGC AAA C(3C CTA GAT ATT 712 Ala Leu Lys Phe Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly Asn Thr Leu Arg Ile Gly Ala Gly Gln Thr Arg Lys Val CAG TTG ATT CCT CTT GGT GGC AGT AAA AAA GTG ATT G(zC ATG AAC GGG 808 Gln Leu Ile Pro Leu Gly Gly Ser Lys Lys Val Ile Gly Met Asn Gly CTT GTG AAT AAC ATC GCG GAT GAA CGC CAT AAA CAT AAP. GCG CTT GAC 856 Leu Val Asn Asn Ile Ala Asp Glu Arg His Lys His L~rs Ala Leu Asp Lys Ala Lys Ser His Gly Phe Ile Lys Met Lys Met AAA AAA CAA GAA TAT GTA AAT ACC TAC GGA CCC ACC A~~.A GGC GAT AAA 953 Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Lys Gly Asp Lys s GTG CGC TTA GGA GAT ACC GAT CTT TGG GCA GAA GTA Gi~A CAT GAC TAT 1001 Val Arg Leu Gly Asp Thr Asp Leu Trp Ala Glu Val G:Lu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly L~~rs Thr Ile Arg 265 270 2'75 Glu Gly Met Gly Gln Ser Asn Ser Pro Asp Glu Asn Tlzr Leu Asp Leu GTC ATC ACT AAC GCG ATG ATT ATC GAC TAC ACC GGG A'L'T TAC AAA GCC 1145 Val Ile Thr Asn Ala Met Ile Ile Asp Tyr Thr Gly I:Le Tyr Lys Ala GAC ATT GGG ATT AAA AAC GGC AAA ATC CAT GGC ATT G(3C AAG GCA GGA 1193 Asp IIe Gly Ile Lys Asn Gly Lys Ile His Gly Ile G:Ly Lys Ala Gly AAC AAG GAC ATG CAA GAT GGC GTA AGC CCT CAT ATG G'CC GTG GGT GTG 1241 Asn Lys Asp Met Gln Asp GIy Val Ser Pro His Met V<~1 Val Gly VaI

GIy Thr Glu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly Gly ATC GAT TCA CAC ACC CAC TTC CTT TCT CCA CAA CAA T'CC CCT ACC GCT 1337 Ile Asp Ser His Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe Gly Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His CGC ATG TTG CGC GCA GCA GAA GAG TAT TCT ATG AAT G'.CG GGC TTT TTG 1481 Arg Met Leu Arg Ala Ala Glu Glu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys Gln Leu Val G7Lu Gln Val Glu GCG GGC GCG ATT GGT TTT AAA TTG CAT GAA GAC TGG GCiC ACA ACA CCA 1577 Ala Gly Ala IIe Gly Phe Lys Leu His GIu Asp Trp G7_y Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val Ala Asp Glu Tyr Asp VaI Gln Val Cys Ile His Thr Asp Thr Val Asn Glu Ala Gly Tyr Val Asp Asp ' F

ACC CTA AAT GCA ATG AAC GGG CGC GCC ATC CAT GCC T.AC CAC ATT GAG 1721 Thr Leu Asn Ala Met Asn Gly Arg Ala Ile His Ala Tyr His Ile Glu GGA GCG GGT GGA GGA CAC TCA CCT GAT GTT ATC ACC A'rG GCA GGC GAG 1769 Gly Ala Gly Gly Gly His Ser Pro Asp Val Ile Thr Met Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Leu Met Thr Cys His His Leu Asp Lys Arg IIe Arg Glu Asp Leu Gln Phe Ser Gln S~er Arg Ile Arg CCC GGC TCT ATC GCG GCT GAA GAT GTG CTC CAT GAT A'rG GGT GTG ATC 1961 Pro Gly Ser Ile Ala Ala Glu Asp Val Leu His Asp Met Gly Val Ile GCG ATG ACA AGC TCG GAT TCG CAA GCA ATG GGG CGT G~~A GGC GAA GTG 2009 Ala Met Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Ala Gly Glu Val ATT CCT CGA ACT TGG CAG ACT GCG GAT AAG AAT AAA A;?~A GAA TTT GGT 2057 Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly Lys Asp Asn Asp Asn Phe A:rg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro Ala Leu Thr H.is Gly Val Ser GIu Tyr Ile Gly Ser Val Glu Glu Gly Lys Ile Ala Asp Leu Val Val TGG AAT CCT GCC TTT TTT GGC GTA AAA CCC AAA ATC G'rG ATC AAA GGC 2249 Trp Asn Pro Ala Phe Phe Gly Val Lys Pro Lys Ile Va 1 Ile Lys Gly 665 670 6'75 Gly Met Val Val Phe Ser Glu Met Gly Asp Ser Asn A:la Ser Val Pro ACT CCC CAA CCG GTT TAT TAC CGC GAA ATG TTT GGG Ci~T CAC GGC AAG 2345 Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met Phe Gly H:is His GIy Lys GCG AAA TTT GAC ACC AGC ATC ACT TTT GTT TCC AAA G'CC GCC TAT GAA 2393 Ala Lys Phe Asp Thr Ser Ile Thr Phe Val Ser Lys Val Ala Tyr Glu a s t Asn Gly Val Lys Glu Lys Leu Gly Leu Glu Arg Gln Val Leu Pro Val Lys Asn Cys Arg Asn Ile Thr Lys Lys Asp Phe Lys Phe Asn Asp Lys Thr Ala Lys Ile Thr Val Asp Pro Lys Thr Phe Glu Val Phe Val Asp Gly Lys Leu Cys Thr Ser Lys Pro Thr Ser Gln Val Pro Leu Ala Gln Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 2:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 226 (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 2:
Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala Arg 35 40 ~45 Arg Gly Lys Lys Thr Val Ala Gln Leu Met Glu Glu Cys Met His Phe 50 Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro Asp Leu Gly Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro IIe Glu Pro Asp Glu His Phe Lys Ala G:Ly Glu Val Lys Phe Gly Cys Asp Lys Asp Ile Glu Leu Asn Ala Gly L~~rs Glu Val Thr Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu His Val Gly Ser His Phe His Phe Phe Glu Ala Asn Lys Ala Leu Lys P:he Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly Asn Thr Leu Arg 10 Ile Gly Ala Gly Gln Thr Arg Lys Val Gln Leu Ile Pro Leu Gly Gly Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn Asn Ile Ala Asp Glu Arg His Lys His Lys Ala Leu Asp Lys Ala Lys Ser His Gly Phe Ile Lys (2) INFORMATION FOR SEQ ID NO.: 3:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 568 (B) TYPE: amino acid (C) STRANDEDNESS:
fD) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 3:
Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Lys Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp Ala Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met Gly Gln Ser Asn Ser Pro Asp Glu Asn Thr Leu Asp Leu Val Ile Thr Asn Ala Met Ile Ile Asp T~yr Thr Gly Ile Tyr Lys Ala Asp Ile Gly Ile Lys Asn Gly Lys Ile H.is Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Val Ser P:ro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly Me t Ile Ile Thr 115 12 0 l:Z 5 Ala Gly Gly Ile Asp Ser His Thr His Phe Leu Ser P:ro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe G:ly Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr Thr Ile Thr P:ro Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala Glu Glu Tyr S~'r Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys G:ln Leu Val Glu 195 200 2~D5 Gln Val Glu Ala Gly Ala Ile Gly Phe Lys Leu His G:lu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val A:la Asp Glu Tyr Asp Val GIn Val Cys Ile His Thr Asp Thr Val Asn G:lu Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn Gly Arg Ala I:le His Ala Tyr His Ile GIu Gly Ala Gly Gly Gly His Ser Pro Asp V;al Ile Thr Met 275 280 2.85 Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr P:ro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met L.°u Met Thr Cys His His Leu Asp Lys Arg Ile Arg Glu Asp Leu Gln Plhe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Leu His Asp Met Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Me°t Gly Arg Ala Gly Glu Val Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly Lys Asp Asn Aap Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro A:La Leu Thr His Gly Val Ser Glu Tyr Ile GIy Ser Val Glu Glu Gly Lys Ile Ala Asp Leu Val Val Trp Asn Pro Ala Phe Phe Gly VaI Lys Pogo Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser Glu Met Gly Asp Ser Asn Ala Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Val Ser Lys Val Ala Tyr Glu Asn Gly Val Lys Glu Lys Leu Gly Leu Glu Arg Gln Val Leu Pro VaI Lys Asn Cys Arg Asn Ile Thr Lys Lys Asp Phe Lys Phe Asn Asp Lys Thr Ala Lys Ile Thr Val Asp Pro Lys Thr Phe Glu Val Phe Val Asp Gly Lys Leu Cys Thr Ser Lys Pro Thr Ser Gln Val Pro Leu Ala Gln Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2405 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (1)..(681) (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (692)..(2398) (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 4:

Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln CCC GAA GCC ATT GCC TAC ATT AGT GCC CAT ATT ATG G.AC GAG GCG CGC 144 Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala Arg Arg Gly Lys Lys Thr Val Ala Glu Leu Met Glu Glu Cys Met His Phe TTG AAA AAA GAT GAG GTG ATG CCC GGT GTG GGG AAT A'rG GTC CCT GAT 240 Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro Asp TTG GGC GTA GAA GCC ACT TTC CCC GAT GGC ACC AAA C'TC GTA ACC GTG 288 Leu Gly Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val AAT TGG CCC ATT GAA CCT GAT GAA CAC TTT AAA GCC G'~GT GAA GTG AAA 336 Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala Gly Glu Val Lys TTT GGC TGT GAT AAA GAC ATT GAG CTC AAC GCG GGT A,AG GAA GTT ACC 384 Phe Gly Cys Asp Lys Asp Ile Glu Leu Asn Ala Gly L~ys Glu Val Thr GAG CTT GAA GTT ACC AAC GAA GGA CCT AAA TCC TTG C'AT GTG GGT AGC 432 Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu F3:is Val Gly Ser His Phe His Phe Phe Glu Thr Asn Lys Ala Leu Lys F'he Asp Arg Glu AAA GCC TAT GGC AAA CGC CTA GAT ATT CCC TCT GGC pAC ACG CTA CGC 528 Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly A.sn Thr Leu Arg ATT GGG GCA GGA CAA ACC CGT AAA GTG CAG TTA ATC C'CT CTT GGC GGT 576 Ile Gly Ala GIy Gln Thr Arg Lys Val Gln Leu Ile Fro Leu Gly Gly AGT AAA AAA GTG ATT GGC ATG AAC GGG CTT GTG AAT A,AT ATT GCG GAC 624 Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn A.sn Ile Ala Asp Glu Arg His Lys His Lys Ala Leu Asp Lys Ala Lys Ser His Gly Phe ATC AAG TAA GGAGACTCCC ATG AAA ATG AAA AAA CAA GA.G TAT GTA AAC 721 Ile Lys Met Lys Met Lys Lys Gln Glu Tyr Val Asn ACC TAC GGA CCC ACC ACA GGC GAT AAA GTG CGC TTA G'~GA GAT ACC GAT 769 Thr Tyr Gly Pro Thr Thr Gly Asp Lys Val Arg Leu G!ly Asp Thr Asp Leu Trp Ala Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met Gly Gln Ser Asn Ser Pro Asp Glu Asn Thr Leu Asp Leu Val Ile Thr A.sn Ala Met Ile Ile Asp Tyr Thr Gly Ile Tyr Lys Ala Asp Ile Gly Ile Lys Asn Gly a a t P

Lys Ile His Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Val Ser Pro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly Gly Ile Asp Ser H:is Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe Gly Gly Gly Thr Gly Pro Val Asp Gly Thr A.sn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu A.rg Ala Ala Glu Glu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly A.sn Ser Ser Ser AAA AAA CAA CTC GTA GAA CAA GTA GAA GCG GGC GCG A.TT GGC TTT AAA 1345 Lys Lys Gln Leu Val Glu Gln Val Glu Ala Gly Ala Ile Gly Phe Lys Leu His Glu Asp Trp Gly Thr Thr Pro Ser Ala Ile A.sp His Cys Leu Ser Val Ala Asp Glu Tyr Asp Val Gln Val Cys Ile His Thr Asp Thr Val Asn Glu Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn Gly Arg Ala Ile His Ala Tyr His Ile Glu Gly Ala Gly Gly Gly His Ser Pro Asp Val Ile Thr Met Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Leu Met Thr Cys His His Leu Asp Lys Arg Ile Arg Glu Asp CTC CAG TTT TCC CAA AGC CGT ATC CGC CCC GGC TCT A'L'T GCC GCT GAA 1729 Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser I:Le Ala AIa Glu 560 565 5'70 GAT GTG CTC CAT GAT ATT GGC GTG ATC GCG ATG ACA A(3C TCG GAT TCG 1777 Asp Val Leu His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser 10 Gln Ala Met Gly Arg Ala Gly Glu Val Ile Pro Arg Tllr Trp Gln Thr GCA GAC AAG AAT AAA AAA GAA TTT GGT AAG CTT CCT Gi'~A GAT GGT GCA 1873 AIa Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro G:Lu Asp Gly Ala GAT AAT GAC AAC TTC CGC ATC AAA CGC TAT ATC TCC Ai'~A TAC ACC ATT 1921 Asp Asn Asp Asn Phe Arg Ile Lys Arg Tyr Ile Ser L~~s Tyr Thr Ile Asn Pro Ala Leu Thr His Gly Val Ser Glu Tyr Ile G.Ly Ser Val Glu Glu Gly Lys Ile Ala Asp Leu Val Val Trp Asn Pro A:La Phe Phe Gly GTA AAA CCC AAA ATC GTG ATC AAA GGC GGT ATG GTG G'rG TTC TCT GAA 2065 Val Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val VaI Phe Ser Glu Met Gly Asp Ser Asn Ala Ser Val Pro Thr Pro Gln P:ro Val Tyr Tyr CGC GAA ATG TTT GGG CAT CAC GGC AAG GCG AAA TTT Gi3C ACC AGC ATC 2161 Arg Glu Met Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Val Ser Lys Val Ala Tyr Glu Asn Gly Val Lys Glu Lys Leu 720 725 7:30 GGC TTA GAG CGC AAG GTG CTA CCC GTG AAA AAC TGC C(3C AAC ATC ACT 2257 Gly Leu Glu Arg Lys Val Leu Pro Val Lys Asn Cys Arg Asn Ile Thr AAG AAA GAC TTC AAA TTC AAC AAC AAG ACG GCG CAT A'.CC ACT GTC GAT 2305 Lys Lys Asp Phe Lys Phe Asn Asn Lys Thr Ala His I:Le Thr Val Asp CCT AAA ACC TTC GAG GTC TTT GTA GAT GGC AAA CTC T(3C ACC TCT AAA 2353 Pro Lys Thr Phe Glu Val Phe Val Asp Gly Lys Leu C;rs Thr Ser Lys Pro Ala Ser Glu Val Pro Leu Ala Gln Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 5:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 226 (B) TYPE: amino acid (C} STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 5:
Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met A.sp Glu Ala Arg Arg Gly Lys Lys Thr Val Ala Glu Leu Met Glu Glu Cys Met His Phe Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro Asp Leu G1y Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala Gly Glu Val Lys Phe Gly Cys Asp Lys Asp Ile Glu Leu Asn Ala Gly Lys Glu Val Thr Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu His Val Gly Ser His Phe His Phe Phe Glu Thr Asn Lys Ala Leu Lys Phe Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly Asn Thr Leu Arg Ile Gly Ala Gly Gln Thr Arg Lys Val Gln Leu Ile Pro Leu Gly Gly Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn Asn Ile Ala Asp Glu Arg His Lys His Lys Ala Leu Asp Lys Ala Lys Ser His Gly Phe Ile Lys (2) INFORMATION FOR SEQ ID NO.: 6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 568 (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 6:
Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Thr GIy Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp A.la Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met Gly Gln Ser Asn Ser Pro A.sp Glu Asn Thr Leu Asp Leu Val Ile Thr Asn Ala Met Ile Ile Asp T'yr Thr Gly Ile Tyr Lys Ala Asp Ile Gly Ile Lys Asn Gly Lys Ile H:is Gly Ile Gly Lys AIa Gly Asn Lys Asp Met Gln Asp Gly Val Ser Pro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly Gly Ile Asp Ser His Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe G'~ly Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala Glu GIu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys Gln Leu Val Glu Gln Val Glu Ala Gly Ala Ile Gly Phe Lys Leu His Glu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val A.la Asp Glu Tyr Asp VaI Gln Val Cys Ile His Thr Asp Thr Val Asn Glu Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn Gly Arg Ala Ile His Ala Tyr 260 265 2?0 His Ile Glu Gly Ala Gly Gly Gly His Ser Pro Asp Val Ile Thr Met Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr IIe Asn Thr Val Ala Glu His Leu Asp Met Leu Met Thr Cys His His Leu Asp Lys Arg Ile Arg Glu Asp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Leu His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Ala Gly Glu Val Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly Ala Asp Asn A.sp Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro A.la Leu Thr His Gly Val Ser Glu Tyr IIe Gly Ser Val Glu Glu Gly Lays Ile Ala Asp Leu Val Val Trp Asn Pro Ala Phe Phe Gly Val Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser Glu Met Gly A.sp Ser Asn Ala Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Miet Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe V'al Ser Lys Val Ala Tyr Glu Asn Gly Val Lys Glu Lys Leu Gly Leu Glu Arg Lys Val Leu Pro Val Lys Asn Cys Arg Asn Ile Thr Lys Lys A.sp Phe Lys Phe Asn Asn Lys Thr Ala His Ile Thr Val Asp Pro Lys Thr Phe Glu Val Phe Val Asp Gly Lys Leu Cys Thr Ser Lys Pro Ala Ser Glu Val Pro Leu Ala Gln Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2183 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (3)..(683) (ix} FEATURE
(A} NAME/KEY: CDS
(B) LOCATION: (694)..(2181) (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 7:

Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala CGC CGT GGC AAA AAA ACC GTT GCT GAA CTT ATG GAA G.AA TGT ATG CAC 191 Arg Arg Gly Lys Lys Thr Val AIa Glu Leu Met Glu Glu Cys Met His Phe Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro Asp Leu Gly Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala Gly Glu Val 50 Lys Phe Gly Cys Asp Lys Asp IIe Glu Leu Asn Val Gly Lys Glu Val Thr Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu His Val Gly Ser His Phe His Phe Phe Glu Thr Asn Lys Ala Leu Lys Phe Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp IIe Pro Ser G:Ly Asn Thr Leu CGC ATT GGG GCA GGA CAA ACC CGT AAA GTG CAG TTA A'rC CCT CTT GGC 575 Arg Ile Gly Ala Gly Gln Thr Arg Lys Val Gln Leu I:Le Pro Leu Gly 10 Gly Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn Asn IIe Ala GAC GAA CGC CAT AAA CAC AAA GCA CTA GAC AAG GCA Ai'~A TCT CAC GGA 671 Asp Glu Arg His Lys His Lys Ala Leu Asp Lys Ala Lys Ser His Gly 210 215 2:~0 TTC ATC AAG TAA GGAGACTCCC ATG AAA ATG AAA AAA CAi'~ GAG TAT GTA 720 Phe Ile Lys Met Lys Met Lys Lys Gln Glu Tyr Val AAC ACC TAC GGA CCC ACC ACA GGC GAT AAA GTG CGC T'rA GGA GAT ACC 768 Asn Thr Tyr Gly Pro Thr Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp Ala Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu CTC AAA TTT GGC GCG GGT AAA ACT ATC CGT GAG GGT A'rG GGT CAG AGC 864 Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met Gly Gln Ser Asn Ser Pro Asp Glu Asn Thr Leu Asp Leu Val Ile Tlhr Asn Ala Met Ile Ile Asp Tyr Thr Gly Ile Tyr Lys Ala Asp Ile G:ly Ile Lys Asn Gly Lys Ile His Gly Ile Gly Lys Ala Gly Asn Lys A;sp Met Gln Asp Gly Val Ser Pro His Met Val Val Gly Val Gly Thr G:Lu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly Gly Ile Asp Se>r His Thr His TTC CTC TCT CCC CAA CAA TTC CCT ACC GCT CTA GCC Ai'~T GGT GTT ACA 1152 Phe Leu Ser Pro Gln Gln Phe Fro Thr Ala Leu Ala A:an Gly Val Thr Thr Met Phe Gly Gly Gly Thr GIy Pro Val Asp Gly Tlzr Asn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala Glu GIu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys Gln Leu Val Glu Gln Val Glu Ala Gly Ala Ile Gly Phe Lys Leu His Glu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val Ala Asp Glu Tyr Asp Val Gln Val Cys Ile His Thr Asp Thr Val Asn Glu Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn GIy Arg Ala Ile His Ala Tyr His Ile Glu Gly Ala Gly Gly Gly His TCA CCT GAT GTT ATC ACC ATG GCA GGC GAG CTC AAT A.TT CTA CCC TCC 1584 Ser Pro Asp Val Ile Thr Met Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Leu Met Thr Cys His His Leu Asp Lys A.rg Ile Arg Glu Asp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Leu His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Ala Gly Glu Val Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly Ala Asp Asn Asp Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr ATT AAT CCC GCT TTG ACC CAT GGC GTG AGC GAG TAT A'TC GGC TCT GTG 1968 Ile Asn Pro Ala Leu Thr His Gly Val Ser Glu Tyr Ile Gly Ser Val Glu Glu Gly Lys Ile Ala Asp Leu Val Val Trp Asn Pro Ala Phe Phe GGC GTG AAA CCT AAG ATT GTG ATT AAA GGT GGC ATG G'TG GTC TTC TCT 2064 Gly Val Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser GAA ATG GGC GAT TCT AAC GCG TCC GTG CCC ACG CCT C.AG CCG GTT TAT 2112 Glu Met Gly Asp Ser Asn Ala Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Arg Val Ser Ser (2) INFORMATION FOR SEQ ID NO.: 8:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 226 (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 8:
Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala Arg Arg Gly Lys Lys Thr Val Ala Glu Leu Met Glu Glu Cys Met His Phe Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro Asp Leu Gly Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala Gly Glu Val Lys Phe Gly Cys Asp Lys Asp Ile Glu Leu Asn Val Gly Lys Glu Val Thr Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu His Val Gly Ser His Phe His Phe Phe Glu Thr Asn Lys Ala Leu Lys Phe Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly Asn Thr Leu Arg Ile Gly Ala Gly Gln Thr Arg Lys Val GIn Leu Ile Pro Leu Gly Gly Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn Asn Ile Ala Asp Glu Arg His Lys His Lys Ala Leu Asp Lys Ala Lys Se r His Gly Phe Ile Lys (2) INFORMATION FOR SEQ ID NO.: 9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 496 (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter fells (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 9:
Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp A7_a Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys 35 40 9':5 Thr Ile Arg Glu Gly Met Gly Gln Ser Asn Ser Pro A:;p Glu Asn Thr Leu Asp Leu Val Ile Thr Asn Ala Met Ile Ile Asp T~~r Thr Gly Ile Tyr Lys Ala Asp Ile Gly Ile Lys Asn Gly Lys Ile His Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Val Ser Pro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly Gly Ile Asp Ser His Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe Gly Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala Glu Glu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys G.ln Leu Val Glu Gln Val Glu Ala Gly Ala Ile Gly Phe Lys Leu His G.lu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val A:La Asp Glu Tyr Asp Val Gln Val Cys Ile His Thr Asp Thr Val Asn G.Lu Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn Gly Arg Ala Ile His Ala Tyr His Ile Glu Gly Ala Gly Gly Gly His Ser Pro Asp VaI Ile Thr Met Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Le:u Met Thr Cys His His Leu Asp Lys Arg Ile Arg Glu Asp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Le:u His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Mea Gly Arg Ala 355 360 36.5 Gly Glu Val Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly Ala Asp Asn Asp Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro Ala Leu Thr His Gly Val Ser Glu Tyr Ile Gly Ser Val Glu Glu Gly Lys Ile AIa Asp Leu Val Val Trp Asn Pro Ala Phe Phe Gly Val Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser Glu Met Gly As:p Ser Asn Ala A
Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Arg Val Ser Ser (2) INFORMATION FOR SEQ ID NO.: 10:
(i) SEQUENCE CHARACTERISTICS
10 (A) LENGTH: 2407 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (2)..(682) 20 (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (693)..(2399) (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 10:

Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln CCC GAA GCC ATT GCC TAC ATT AGT GCC CAT ATT ATG G.AC GAG GCG CGC 145 Pro Glu Ala Ile Ala Tyr IIe Ser Ala His Ile Met Asp Glu Ala Arg 35 40 ~45 Arg Gly Lys Lys Thr Val Ala Glu Leu Met Glu Glu Cys Met His Phe TTG AAA AAA GAC GAG GTG ATG CCC GGT GTG GGG AAT A'rG GTC CCT GAT 241 Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Ms~t Val Pro Asp TTA GGC GTG GAA GCT ACT TTT CCC GAT GGC ACC AAA C'CC GTA ACC GTG 289 Leu Gly Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val AAT TGG CCC ATC GAA CCC GAT GAA CAC TTC AAA GCG GCiC GAA GTC AAA 337 Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala G_Ly Glu Val Lys Phe Gly Cys Asp Lys Asp Ile Glu Leu Asn Ala Gly Lys Glu Val Thr 115 120 1~!5 Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu Hi.s Val Gly Ser His Phe His Phe Phe Glu Ala Asn Lys Ala Leu Lys Phe Asp Arg Glu AAA GCC TAT GGC AAA CGC CTA GAT ATT CCC TCT GGC P,AC ACG CTA CGC 529 Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly F,sn Thr Leu Arg ATT GGG GCA GGA CAA ACC CGT AAA GTG CAG TTA ATC C'CT CTT GGC GGC 577 Ile Gly Ala Gly Gln Thr Arg Lys Val Gln Leu Ile Fro Leu Gly Gly Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn A.sn Ile AIa Asp Glu Arg His Lys His Lys Ala Leu Glu Lys Ala Lys Ser His Gly Phe Ile Lys Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp Ala Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met G:Iy Gln Ser Asn AGT CCA GAT GAA AAC ACC CTA GAT TTA GTC.' ATC ACC AAC GCG ATG ATT 914 Ser Pro Asp Glu Asn Thr Leu Asp Leu Val Ile Thr Aan Ala Met Ile ATT GAC TAC ACC GGG ATT TAC AAA GCC GAC ATT GGC A'CT AAA AAT GGC 962 Ile Asp Tyr Thr Gly Ile Tyr Lys Ala Asp Ile Gly IIe Lys Asn GIy AAA ATC CAT GGC ATT GGC AAG GCA GGA AAC AAG GAC A':L'G CAA GAT GGC 1010 Lys Ile His Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Val Ser Pro His Met Val Val Gly Val Gly Thr GIu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly Gly Ile Asp Ser Hi.s Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr m s ATG TTT GGC GGT GGC ACA GGT CCG GTA GAT GGC ACG A.AT GCG ACT ACC 1202 Met Phe Gly Gly Gly Thr GIy Pro Val Asp Gly Thr A.sn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu A.rg Ala Ala Glu Glu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys Gln Leu Val Glu Gln Ile G1u Ala Gly Ala Ile Gly Phe Lys TTG CAT GAA GAC TGG GGC ACA ACT CCA AGT GCA ATC G.AT CAC TGC TTG 1394 Leu His Glu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu AGC GTA GCA GAT GAA TAC GAT GTG CAA GTT TGT ATC C:~C ACC GAT ACG 1442 Ser Val Ala Asp Glu Tyr Asp Val Gln Val Cys Ile H.is Thr Asp Thr Val Asn Glu Ala Gly Tyr Val Asp Asp Thr Leu Asn A:La Met Asn GIy 480 485 4'.a0 CGC GCC ATC CAT GCC TAC CAC ATT GAG GGA GCG GGC GczA GGA CAC TCA 1538 Arg Ala Ile His Ala Tyr His IIe Glu Gly Ala Gly GIy Gly His Ser CCT GAT GTT ATC ACC ATG GCA GGC GAG CTC AAT ATT C'.CA CCC TCC TCC 1586 Pro Asp Val Ile Thr Met Ala Gly Glu Leu Asn Ile Le:u Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Leu Met Thr Cys His His Leu Asp Lys Arg Il.e Arg Glu Asp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser ILe AIa Ala Glu Asp VaI Leu His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Met GIy Arg Ala Gly Glu Val Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Ser Ala Asp Asn Asp Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro Ala Leu Thr His Gly Val Ser Glu Tyr Ile Gly Ser Val Glu 640 645 6.50 Glu Gly Lys Ile Ala Asp Leu Val Val Trp Asn Pro A.la Phe Phe Gly Val Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser Glu Met Gly Asp Ser Asn Ala Ser VaI Pro Thr Pro Gln Pro Val Tyr Tyr CGC GAA ATG TTT GGG CAT CAC GGC AAG GCG AAA TTT G.AC ACC AGC ATC 2162 Arg Glu Met Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Val Ser Lys Val Ala Tyr Glu Asn Gly Val Lays Glu Lys Leu 720 725 7:30 Gly Leu Glu Arg Lys Val Leu Pro Val Lys Asn Cys A:rg Asn Ile Thr AAG AAA GAC TTC AAA TTC AAC AAC AAG ACG GCG CAT A'CC ACT GTC GAT 2306 Lys Lys Asp Phe Lys Phe Asn Asn Lys Thr Ala His Ile Thr Val Asp Pro Lys Thr Phe Glu Val Phe Val Asp Gly Lys Leu Cys Thr Ser Lys CCC GCC TCT GAA GTG CCT CTA GCC CAG CGC TAC ACT T7.'C TTC TAG 2399 Pro Ala Ser Glu Val Pro Leu Ala Gln Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 11:
(i) SEQUENCE CHARACTERISTICS
(A} LENGTH: 226 (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi} ORIGINAL SOURCE:
(A} ORGANISM: Helicobacter fells (xi} SEQUENCE DESCRIPTION: SEQ ID NO.: 11:
Val Lys Leu Thr Pro Lys GIu Gln Glu Lys Phe Leu Leu Tyr Tyr Ala Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala Arg Arg Gly Lys Lys Thr Val Ala Glu Leu Met Glu Glu C".ys Met His Phe Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro Asp 65 70 ?5 80 Leu Gly Val Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala Gly Glu Val Lys Phe Gly Cys Asp Lys Asp Ile Glu Leu Asn Ala Gly L~ys Glu Val Thr Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu T3:is Val Gly Ser His Phe His Phe Phe Glu Ala Asn Lys Ala Leu Lys Phe Asp Arg Glu Lys Ala Tyr GIy Lys Arg Leu Asp Ile Pro Ser Gly Asn Thr Leu Arg 165 1?0 175 Ile Gly Ala Gly Gln Thr Arg Lys Val Gln Leu Ile Pro Leu Gly GIy Ser Lys Lys VaI Ile Gly Met Asn Gly Leu Val Asn Asn Ile AIa Asp Glu Arg His Lys His Lys Ala Leu Glu Lys Ala Lys Ser His Gly Phe Ile Lys (2) INFORMATION FOR SEQ ID NO.: 12:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 568 (B} TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A} ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 12:
Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp AT.a Glu Val Glu m m His Asp Tyr Thr Thr Tyr Gly Glu GIu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met Gly Gln Ser Asn Ser Pro Asp Glu Asn Thr Leu Asp Leu Val Ile Thr Asn Ala Met Ile Ile Asp 'I'yr Thr Gly Ile 10 Tyr Lys Ala Asp Ile Gly Ile Lys Asn Gly Lys Ile His Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Val Ser Fro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly M:et Ile Ile Thr Ala Gly Gly Ile Asp Ser His Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe Gly Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala Glu Glu Tyr Ser Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys Gln Leu Val Glu Gln Ile Glu Ala Gly Ala Ile Gly Phe Lys Leu His G:lu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val A:La Asp Glu Tyr Asp Val Gln Val Cys Ile His Thr Asp Thr Val Asn G:Lu Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn Gly Arg Ala I:Le His Ala Tyr His Ile Glu Gly Ala Gly Gly Gly His Ser Pro Asp Val Ile Thr Met Ala Gly Glu Leu Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Le:u Met Thr Cys His His Leu Asp Lys Arg Ile Arg Glu Asp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Le:u His Asp Ile a Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Ala 355 360 ~t65 Gly Glu Val Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Ser Ala Asp Asn Asp Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro F~la Leu Thr His Gly Val Ser Glu Tyr Ile Gly Ser Val Glu Glu Gly L~ys Ile Ala Asp Leu Val Val Trp Asn Pro Ala Phe Phe Gly Val Lys Fro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser Glu Met Gly A.sp Ser Asn Ala Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met Phe Gly His 465 470 475 4gp His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Val Ser Lys Val Ala Tyr Glu Asn Gly Val Lys Glu Lys Leu Gly Leu Glu Arg Lys Val Leu Pro Val Lys Asn Cys Arg Asn Ile Thr Lys Lys Asp Phe Lys Phe Asn Asn Lys Thr Ala His Ile Thr Val Asp Pro Lys T:hr Phe Glu Val Phe Val Asp Gly Lys Leu Cys Thr Ser Lys Pro Ala Ser Glu Val Pro Leu Ala Gln Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 13:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2452 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: (48) . . (728) (ix) FEATURE
(A) NAME/KEY: CDS
(B} LOCATION: (739}..(2445) m (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 13:

Val Lys Leu ACA CCC AAA GAG CAA GAA AAG TTC TTG TTA TAT TAT G'CG GGC GAA GTG 104 Thr Pro Lys Glu Gln Glu Lys Phe Leu Leu Tyr Tyr A.la Gly Glu Val Ala Arg Lys Arg Lys Ala Glu Gly Leu Lys Leu Asn Gln Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala Arg Arg Gly Lys AAA ACC GTT GCG GAA CTT ATG GAA GAG TGT ATG CAC T'TT TTG AAA AAA 248 Lys Thr Val Ala Glu Leu Met Glu Glu Cys Met His P:he Leu Lys Lys GAC GAG GTG ATG CCC GGG GTG GGG AAT ATG GTC CCT Gi'~T TTG GGC GTG 296 Asp Glu Val Met Pro Gly Val Gly Asn Met Val Pro A:ap Leu Gly Val GAA GCC ACT TTC CCC GAT GGC ACC AAA CTC GTA ACT G':CG AAT TGG CCC 344 Glu Ala Thr Phe Pro Asp Gly Thr Lys Leu Val Thr Val Asn Trp Pro Ile Glu Pro Asp Glu His Phe Lys Ala Gly Glu Val Lys Phe Gly Cys GAT AAA GAC ATT GAA CTC AAC GCA GGT AAG GAA GTT AC'.C GAA CTA GAA 440 Asp Lys Asp Ile Glu Leu Asn Ala Gly Lys Glu Val Thr Glu Leu Glu Val Thr Asn Glu Gly Pro Lys Ser Leu His Val Gly Se:r His Phe His Phe Phe Glu Ala Asn Lys Ala Leu Lys Phe Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly Asn Thr Leu Arg Ile Gly Ala GGA CAA ACC CGT AAA GTG CAG TTA ATC CCT CTT GGC GG'T AGT AAA AAA 632 Gly Gln Thr Arg Lys Val Gln Leu Ile Pro Leu Gly Gly Ser Lys Lys Val Ile Gly Met Asn Gly Leu Val Asn Asn Ile Ala Asp Glu Arg His AAA CAC AAA GCG CTA GAC AAA GCA AAA TCT CAC GGA TT'.C ATC AAG TAA 728 Lys His Lys Ala Leu Asp Lys Ala Lys Ser His Gly Phe~ Ile Lys a c Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gly Pro Thr Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp Ala GAA GTA GAA CAT GAC TAT ACC ACC TAT GGC GAA GAA C;TC AAA TTC GGT 873 Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met Gly Gln Ser P,sn Ser Pro Asp GAA AAC ACC TTA GAT TTA GTG ATC ACC AAC GCG ATG F,TT ATT GAC TAC 969 Glu Asn Thr Leu Asp Leu Val Ile Thr Asn Ala Met Ile Ile Asp Tyr Thr Gly Ile Tyr Lys Ala Asp Ile Gly Ile Lys Asn Gly Lys Ile His Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Val Ser Pro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly Met Ile Ile Thr Ala Gly GIy Ile Asp Ser His Thr His Phe Leu Ser Pro Gln Gln Phe Pro Thr Ala Leu Ala Asn Gly Val Thr T:hr Met Phe Gly 370 375 3g0 Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr T~hr Ile Thr Pro GGC AAA TGG AAC TTG CAC CGC ATG TTG CGC GCA GCA GA.A GAG TAT TCT 1305 Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala G:Lu Glu Tyr Ser ATG AAT GTG GGC TTT TTG GGC AAA GGC AAT AGC TCT A<sT AAA AAA CAA 1353 Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Seer Lys Lys Gln Leu Val Glu Gln Val Glu Ala Gly Ala Ile Gly Phe Lys Leu His Glu 435 440 4~E5 Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Le:u Ser Val Ala *' s b Asp Glu Tyr Asp Val Gln Val Cys IIe His Thr Asp Thr Val Asn Glu GCA GGT TAT GTA GAT GAC ACC CTA AAT GCA ATG AAC CiGG CGC GCC ATC 1545 Ala Gly Tyr Val Asp Asp Thr Leu Asn Ala Met Asn G:ly Arg Ala Ile His Ala Tyr His Ile Glu Gly Ala Gly Gly Gly His ~~er Pro Asp Val ATC ACC ATG GCA GGC GAA GTG AAT ATT CTA CCC TCC T'CC ACA ACC CCT 1641 Ile Thr Met Ala Gly Glu Val Asn Ile Leu Pro Ser S'er Thr Thr Pro ACT ATC CCC TAT ACC ATT AAT ACG GTT GCA GAA CAC T'TA GAC ATG CTT 1689 Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met Leu Met Thr Cys His His Leu Asp Lys Arg Ile Arg Glu A.sp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Leu His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Ala Gly Glu Val Ile Pro Arg Thr Trp Gln T:hr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly A:la Asp Asn Asp AAC TTC CGC ATC AAA CGC TAT ATC TCC AAA TAC ACC A'rT AAT CCC GCT 1977 Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr I:Le Asn Pro Ala Leu Thr His Gly Val Ser Glu Tyr Ile Gly Ser Val Glu Glu Gly Lys Ile Ala Asp Leu Val Val Trp Asn Pro Ala Phe Phe Gly VaI Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser G7.u Met Gly Asp Ser Asn Ala Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met s Phe GIy His His Gly Lys Ala Lys Phe Asp Thr Ser I:le Thr Phe Val TCC AAA GTC GCC TAT GAA AAT GGT GTG AAA GAA AAA C.'TA GGT TTA GAG 2265 Ser Lys Val Ala Tyr Glu Asn Gly Val Lys Glu Lys I~eu Gly Leu Glu CGC AAG GTG CTC CCC GTG AAA AAC TGC CGT AAC ATC A.CC AAG AAG GAC 2313 10 Arg Lys Val Leu Pro Val Lys Asn Cys Arg Asn Ile Thr Lys Lys Asp Phe Lys Phe Asn Asp Lys Thr Ala Lys Ile Thr Val A.sp Pro Lys Thr Phe Glu Val Plie Val Asp Gly Lys Leu Cys Thr Ser Lys Pro Thr Ser Glu Val Pro Leu Ala GIn Arg Tyr Thr Phe Phe (2) INFORMATION FOR SEQ ID NO.: 14:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 226 (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 14:
Val Lys Leu Thr Pro Lys Glu Gln Glu Lys Phe Leu Lf°u Tyr Tyr AIa Gly Glu Val Ala Arg Lys Arg Lys Ala Glu GIy Leu L~,rs Leu Asn Gln 20 25 ~ 30 Pro Glu Ala Ile Ala Tyr Ile Ser Ala His Ile Met Asp Glu Ala Arg Arg Gly Lys Lys Thr Val Ala Glu Leu Met Glu Glu Cys Met His Phe Leu Lys Lys Asp Glu Val Met Pro Gly Val Gly Asn Meat Val Pro Asp Leu Gly Val GIu AIa Thr Phe Pro Asp Gly Thr Lys Le;u Val Thr Val Asn Trp Pro Ile Glu Pro Asp Glu His Fhe Lys Ala Gl.y Glu Val Lys Phe GIy Cys Asp Lys Asp IIe Glu Leu Asn Ala Gly Lys Glu VaI Thr ', at r Glu Leu Glu Val Thr Asn Glu GIy Pro Lys Ser Leu hfis Val Gly Ser His Phe His Phe Phe Glu Ala Asn Lys Ala Leu Lys F~he Asp Arg Glu Lys Ala Tyr Gly Lys Arg Leu Asp Ile Pro Ser Gly A.sn Thr Leu Arg Ile Gly Ala Gly Gln Thr Arg Lys Val Gln Leu Ile Pro Leu Gly Gly Ser Lys Lys VaI Ile Gly Met Asn Gly Leu Val Asn Asn Ile Ala Asp Glu Arg His Lys His Lys AIa Leu Asp Lys Ala Lys S~er His GIy Phe Ile Lys (2) INFORMATION FOR SEQ ID NO.: 15:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 568 (B} TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: polypeptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 15:
Met Lys Met Lys Lys Gln Glu Tyr Val Asn Thr Tyr Gl.y Pro Thr Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Trp Ala Glu Val Glu His Asp Tyr Thr Thr Tyr Gly Glu Glu Leu Lys Phe Gly Ala Gly Lys Thr Ile Arg Glu Gly Met GIy Gln Ser Asn Ser Pro Asp Glu Asn Thr Leu Asp Leu Val Ile Thr Asn Ala Met IIe Ile Asp Tyr Thr Gly Ile Tyr Lys AIa Asp Ile Gly Ile Lys Asn Gly Lys Ile Hiss Gly Ile Gly Lys Ala Gly Asn Lys Asp Met Gln Asp Gly Va1 Ser Pro His Met Val Val Gly Val Gly Thr Glu Ala Leu Ala Gly Glu Gly Mei: Ile Ile Thr ~ I5 12 0 12 Ei Ala Gly Gly Ile Asp Ser His Thr His Phe Leu Ser Pro Gln Gln Phe a a a.

Pro Thr Ala Leu Ala Asn Gly Val Thr Thr Met Phe Gly Gly Gly Thr Gly Pro Val Asp Gly Thr Asn Ala Thr Thr Ile Thr Pro Gly Lys Trp Asn Leu His Arg Met Leu Arg Ala Ala Glu Glu Tyr ~~er Met Asn Val Gly Phe Leu Gly Lys Gly Asn Ser Ser Ser Lys Lys Gln Leu Val Glu Gln Val Glu Ala GIy Ala Ile Gly Phe Lys Leu His Glu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asp His Cys Leu Ser Val A.la Asp Glu Tyr Asp Val GIn Val Cys Ile His Thr Asp Thr VaI Asn Glu Ala Gly Tyr Val Asp Asp Thr Leu Asn AIa Met Asn Gly Arg Ala IIe His Ala Tyr His Ile Glu Gly Ala Gly Gly Gly His Ser Pro Asp Val Ile Thr Met Ala Gly Glu Val Asn Ile Leu Pro Ser Ser Thr Thr Pro Thr Ile Pro Tyr Thr Ile Asn Thr Val Ala Glu His Leu Asp Met L~eu Met Thr Cys His His Leu Asp Lys Arg Ile Arg GIu Asp Leu Gln Phe Ser Gln Ser Arg Ile Arg Pro Gly Ser Ile Ala Ala Glu Asp Val Leu His Asp Ile Gly Val Ile Ala Met Thr Ser Ser Asp Ser Gln Ala Most GIy Arg Ala 355 360 3Ei5 Gly Glu VaI Ile Pro Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu Phe Gly Lys Leu Pro Glu Asp Gly Ala Asp Asn A:ap Asn Phe Arg Ile Lys Arg Tyr Ile Ser Lys Tyr Thr Ile Asn Pro Al.a Leu Thr His Gly Val Ser Glu Tyr Ile Gly Ser Val Glu Glu Gly L~~s Ile Ala Asp Leu Val Val Trp Asn Pro Ala Phe Phe Gly Val Lys Pro Lys Ile Val Ile Lys Gly Gly Met Val Val Phe Ser Glu Met Gly Asp Ser Asn Ala Ser Val Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Nfet Phe Gly His His Gly Lys Ala Lys Phe Asp Thr Ser Ile Thr Phe Val Ser Lys Val Ala Tyr Glu Asn Gly Val Lys Glu Lys Leu Gly Leu Glu Arg Lys Val Leu Pro Val Lys Asn Cys Arg Asn Ile Thr Lys Lys A.sp Phe Lys Phe Asn Asp Lys Thr Ala Lys Ile Thr Val Asp Pro Lys Thr Phe Glu Val Phe Val Asp GIy Lys Leu Cys Thr Ser Lys Pro Thr Ser GIu Val Pro Leu Ala Gln Arg Tyr Thr Phe Fhe (2) INFORMATION FOR SEQ ID NO.: 16:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 16:

(2) INFORMATION FOR SEQ ID NO.: 17:
{i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 16 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 17:

(2) INFORMATION FOR SEQ ID NO.: 18:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 32 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 18:

.__ _._..-._._.___m. .._..~"~..,~~,~,,~~", ~~~, ,~",. _ .~~_._-__..

(2) INFORMATION FOR SEQ ID NO.: 19:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 19:

(2) INFORMATION FOR SEQ ID NO.: 20:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 20:

(2) INFORMATION FOR SEQ ID NO.: 21:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 34 (B) TYPE: nucleic acid (C) STRANDEDNESS:
(D) TOPOLOGY:
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Helicobacter felis (xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 21:

w

Claims (22)

1) Nucleic acid sequence encoding two subunit polypeptides of a urease complex such as expressed by Helicobacter felis, said nucleic acid sequence having at least 85%
homology with SEQ ID NO: 1, or a part thereof encoding at feast an immunogenic fragment of one of said subunits, said part having a length of at least 40, preferably 45, more preferably 50 nucleotides.
2) Nucleic acid sequence according to claim 1, characterised in that it encodes the urease X subunit polypeptide or the urease Y subunit polypeptide.
3) Nucleic acid sequence according to claim 1 or 2, characterised in that the sequence has at least 90 %, preferably 94 %, more preferably 97 % homology with SEQ ID
NO: 1.
4) DNA fragment comprising a nucleic acid sequence according to claims 1-3
5) Recombinant DNA molecule comprising a nucleic acid sequence according to claims 1-3 or a DNA fragment according to claim 4, under the control of a functionally linked promoter.
6) Live recombinant carrier comprising a recombinant DNA molecule according to claim
7) Host cell comprising a nucleic acid sequence according to claims 1-3, a DNA
fragment according to claim 4, a recombinant DNA molecule according to claim 5 or a live recombinant carrier according to claim 6.
8) Helicobacter felis urease X subunit polypeptide, said polypeptide having an amino acid sequence that is at least 85 % homologous to SEQ ID NO: 2 or an immunogenic fragment of said polypeptide with a length of at least 40, preferably 45, more preferably 50 amino acids said immunogenic fragment being capable of inducing an immune response against ureaseXY.
9) Polypeptide according to claim 8, having a sequence homology of at least 90 %, preferably 94 %, more preferably 97 % homology to SEQ ID NO: 2, or an immunogenic fragment of said polypeptide capable of inducing an immune response against ureaseXY.
10) Helicobacter felis urease Y subunit polypeptide, said polypeptide having an amino acid sequence that is at least 85 % homologous to SEQ ID NO: 3 or an immunogenic fragment of said polypeptide with a length of at least 40, preferably 45, more preferably 50 amino acids said immunogenic fragment being capable of inducing an immune response against ureaseXY.
11 ) Polypeptide according to claim 10, having a sequence homology of at least 90 %, preferably 94 %, more preferably 97 % homology to SEQ ID NO: 3, or an immunogenic fragment of said polypeptide capable of inducing an immune response against ureaseXY.
12) Polypeptide according to claims 8-11 for use in a vaccine
13) Use of a polypeptide according to claims 8-11 in the manufacturing of a vaccine for combating Helicobacter felis infections.
14) Vaccine for combating Helicobacter felis infections, characterised in that it comprises a nucleic acid sequence according to claims 1-3, a DNA fragment according to claim 4, a recombinant DNA molecule according to claim 5, a live recombinant carrier according to claim 6, a host cell according to claim 7 or a polypeptide according to claims 8-11, and a pharmaceutically acceptable carrier.
15) Vaccine according to claim 14, characterised in that it comprises an adjuvant.
16) Vaccine according to claim 14 or 15, characterised in that it comprises an additional antigen derived from a virus or micro-organism pathogenic to mammals or genetic information encoding said antigen.
17) Vaccine according to claim 16, characterised in that said virus or micro-organism pathogenic to mammals is selected from the group of Feline Infectious Peritonitis virus, Feline Immune deficiency virus, Canine and Feline Parvovirus, Distemper virus, Adenovirus, Calicivirus, Bordetella bronchiseptica, Borrelia burgdorferi, Leptospira interrogans, Chlamydia and Bartonella henseli.
18) Vaccine for combating Helicobacter felis infections, characterised in that it comprises antibodies against a polypeptide according to claims 8-11.
19) Method for the preparation of a vaccine according to claims 14-17, said method comprising the admixing of a polypeptide according to claims 8-11 and a pharmaceutically acceptable carrier.
20) Diagnostic test for the detection of Helicobacter felis specific DNA
characterised in that the test comprises a nucleic acid sequence according to claims 1-3, or a fragment thereof.
21) Diagnostic test for the detection of antibodies against Helicobacter felis, characterised in that said test comprises a polypeptide or a fragment thereof as described in claims 8-11.
22) Diagnostic test for the detection of antigenic material of Helicobacter felis, characterised in that said test comprises antibodies against a polypeptide or a fragment thereof as described in claims 8-11.
CA002351110A 2000-07-17 2001-07-03 Helicobacter felis vaccine Abandoned CA2351110A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP00202565 2000-07-17
NL00202565.8 2000-07-17

Publications (1)

Publication Number Publication Date
CA2351110A1 true CA2351110A1 (en) 2002-01-17

Family

ID=8171823

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002351110A Abandoned CA2351110A1 (en) 2000-07-17 2001-07-03 Helicobacter felis vaccine

Country Status (10)

Country Link
US (1) US7514547B2 (en)
EP (1) EP1176192B1 (en)
JP (1) JP2002355054A (en)
AT (1) ATE251215T1 (en)
AU (1) AU782172B2 (en)
CA (1) CA2351110A1 (en)
DE (1) DE60100879T2 (en)
DK (1) DK1176192T3 (en)
ES (1) ES2208519T3 (en)
PT (1) PT1176192E (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8029777B2 (en) 2004-08-13 2011-10-04 Marshall Barry J Helicobacter system and uses thereof
JP2008509168A (en) * 2004-08-13 2008-03-27 マーシャル，バリー，ジェー． Bacteria delivery system

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6290962B1 (en) * 1992-11-03 2001-09-18 Oravax, Inc. Urease-based vaccine and treatment for helicobacter infection
US6258359B1 (en) * 1993-05-19 2001-07-10 Institut Pasteur Immunogenic compositions against helicobacter infection, polypeptides for use in the compositions, and nucleic acid sequences encoding said polypeptides
WO1995014093A1 (en) * 1993-05-19 1995-05-26 Institut Pasteur Immunogenic compositions against helicobacter infection, polypeptides for use in the compositions and nucleic acid sequences encoding said polypeptides
US5610060A (en) * 1994-06-24 1997-03-11 The United States Of America As Represented By The Department Of Health And Human Services Isolated Helicobacter hepaticus
WO1996033220A1 (en) * 1995-04-21 1996-10-24 Csl Limited Protective helicobacter antigens
JP3007037B2 (en) * 1995-07-19 2000-02-07 秀実 高橋 Helicobacter pylori urease protein-derived artificial antigen and antibody induced by the artificial antigen
GB2307987A (en) * 1995-12-06 1997-06-11 Univ Manchester Epitopes of the urease of Helicobacter pylori as dignostic agents; pharmaceuticals comprising such epitopes or the antibodies thereto
JP3430853B2 (en) * 1997-04-11 2003-07-28 株式会社ゲン・コーポレーション Preventive and therapeutic agents for gastritis, gastric ulcer and duodenal ulcer
US20030158396A1 (en) * 1997-07-29 2003-08-21 Harold Kleanthous Identification of polynucleotides encoding novel helicobacter polypeptides in the helicobacter genome
US5985631A (en) * 1997-09-12 1999-11-16 Oravax-Merieux Co. Method for preventing the activation of inactive, recombinant Helicobacter pylori apourease
EP1278768B1 (en) * 2000-04-27 2006-11-15 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Method for identifying helicobacter antigens

Also Published As

Publication number Publication date
JP2002355054A (en) 2002-12-10
ATE251215T1 (en) 2003-10-15
DK1176192T3 (en) 2004-02-02
EP1176192A2 (en) 2002-01-30
DE60100879T2 (en) 2004-05-19
US7514547B2 (en) 2009-04-07
ES2208519T3 (en) 2004-06-16
US20040005325A1 (en) 2004-01-08
AU5432101A (en) 2002-01-24
EP1176192A3 (en) 2002-02-06
DE60100879D1 (en) 2003-11-06
PT1176192E (en) 2004-01-30
AU782172B2 (en) 2005-07-07
EP1176192B1 (en) 2003-10-01

Similar Documents

Publication Publication Date Title
US7491401B2 (en) Lawsonia intracellularis vaccine
AU2005206291B2 (en) Lawsonia intracellularis subunit vaccines
US20090017048A1 (en) Novel Brachyspira hyodysenteriae vaccine
EP1664100B1 (en) Lawsonia intracellularis subunit vaccine
US20070212373A1 (en) Lawsonia Intracellularis 26 Kd Subunit Vaccine
EP1176192B1 (en) Helicobacter felis vaccine
EP1532253B1 (en) Streptococcus uberis protein, nucleic acid sequence encoding the same and its use in a mastitis vaccine
US7090849B2 (en) Babesia canis vaccine
CA2548750A1 (en) Lawsonia intracellularis 26 kd subunit vaccine

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued