CA2405750C - Protein kinase stress-related proteins and methods of use in plants - Google Patents

Abstract

A transgenic plant transformed by a Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid sequence in the plant results in increased tolerance to environmental stress as compared to a wild type variety of the plant. Also provided are agricultural products, including seeds, produced by the transgenic plants. Also provided are isolated PKSRPs, and isolated nucleic acid coding PKSRPs, and vectors and host cells containing the latter.

Description

PROTEIN KINASE STRESS-RELATED PROTEINS AND
METHODS OF USE IN PLANTS

BACKGROUND OF THE INVENTION

Field of the Invention [0001] This invention relates generally to nucleic acid sequences encoding proteins that are associated with abiotic stress responses and abiotic stress tolerance in plants. In particular, this invention relates to nucleic acid sequences encoding proteins that confer drought, cold, and/or salt tolerance to plants.
Background Art [0002] Abiotic environmental stresses, such as drought stress, salinity stress, heat stress, and cold stress, are major limiting factors of plant growth and productivity. Crop losses and crop yield losses of major crops such as rice, maize (corn) and wheat caused by these stresses represent a significant economic and political factor and contribute to food shortages in many underdeveloped countries.

[0003] Plants are typically exposed during their life cycle to conditions of reduced environmental water content. Most plants have evolved strategies to protect themselves against these conditions of desiccation. However, if the severity and duration of the drought conditions are too great, the effects on plant development, growth and yield of most crop plants are profound. Furthermore, most of the crop plants are very susceptible to higher salt concentrations in the soil. Continuous exposure to drought and high salt causes major alterations in the plant metabolism. These great changes in metabolism ultimately lead to cell death and consequently yield losses.

[0004] Developing stress-tolerant plants is a strategy that has the potential to solve or mediate at least some of these problems. However, traditional plant breeding strategies to develop new lines of plants that exhibit resistance (tolerance) to these types of stresses are relatively slow and require specific resistant lines for crossing with the desired line. Limited germplasm resources for stress tolerance and incompatibility in crosses between distantly related plant species represent significant problems encountered in conventional breeding.
Additionally, the cellular processes leading to drought, cold and salt tolerance in model, drought- and/or salt-tolerant plants are complex in nature and involve multiple mechanisms of cellular adaptation and numerous metabolic pathways. This multi-component nature of stress tolerance has not only made breeding for tolerance largely unsuccessful, but has also limited the ability to genetically engineer stress tolerance plants using biotechnological methods.

[0005] Drought, cold as well as salt stresses have a common theme important for plant growth and that is water availability. Plants are exposed during their entire life cycle to conditions of reduced environmental water content. Most plants have evolved strategies to protect themselves against these conditions of desiccation. However, if the severity an4 duration of the drought conditions are too great, the effects on plant development, growth and yield of most crop plants are profound. Since high salt content in some soils result in less available water for cell intake, its effect is similar to those observed under drought conditions. Additionally, under freezing temperatures, plant cells loose water as a result of ice formation that starts in the apoplast and withdraws water from the symplast. Commonly, a plant's molecular response mechanisms to each of these stress conditions are common and protein kinases play an essential role in these molecular mechanisms.

[0006] Protein kinases represent a super family and the members of this family catalyze the reversible transfer of a phosphate group of ATP to serine, threonine and tyrosine amino acid side chains on target proteins. Protein kinases are primary elements in signaling processes in plants and have been reported to play crucial roles in perception and transduction of signals that allow a cell (and the plant) to respond to environmental stimuli. In particular, receptor protein kinases (RPKs) represent one group of protein kinases that activate a complex array of intracellular signaling pathways in response to the extracellular environment (Van der Gear et al., 1994 Annu. Rev. Cell Biol. 10:251-337). RPKs are single-pass transmembrane proteins that contain an amino-terminal signal sequence, extracellular domains unique to each receptor, and a cytoplasmic kinase domain. Ligand binding induces homo- or hetero-dimerization of RPKs, and the resultant close proximity of the cytoplasmic domains results in kinase activation by transphosphorylation. Although plants have many proteins similar to RPKs, no ligand has been identified for these receptor-like kinases (RLKs). The majority of plant RLKs that have been identified belong to the family of Serine/Threonine (Ser/Thr) kinases, and most have extracellular Leucine-rich repeats (Becraft, PW. 1998 Trends Plant Sci. 3:384-388).

[0007] Another type of protein kinase is the Ca+-dependent protein kinase (CDPK).
This type of kinase has a calmodulin-like domain at the COOH terminus which allows response to Ca+ signals directly without calmodulin being present. Currently, CDPKs are the most prevalent Ser/Thr protein kinases found in higher plants. Although their physiological roles remain unclear, they are induced by cold, drought and abscisic acid (ABA) (Knight et al., 1991 Nature 352:524; Schroeder, 11 and Thuleau, P., 1991 Plant Cell 3:555; Bush, D.S., 1995 Annu. Rev. Plant Phys. Plant Mol. Biol. 46:95; Urao, T. et al., 1994 Mol.
Gen. Genet.
244:331).

[0008] Another type of signaling mechanism involves members of the conserved SNF1 Serine/Threonine protein kinase family. These kinases play essential roles in eukaryotic glucose and stress signaling. Plant SNF1-like kinases participate in the control of key metabolic enzymes, including HMGR, nitrate reductase, sucrose synthase, and sucrose phosphate synthase (SPS). Genetic and biochemical data indicate that sugar-dependent regulation of SNF1 kinases involves several other sensory and signaling components in yeast, plants and animals.

[0009] Additionally, members of the Mitogen¨Activated Protein Kinase (MAPK) family have been implicated in the actions of numerous environmental stresses in animals, yeasts and plants. It has been demonstrated that both MAPK-like kinase activity and mRNA
levels of the components of MAPK cascades increase in response to environmental stress and plant hormone signal transduction. MAP kinases are components of sequential kinase cascades, which are activated by phosphorylation of threonine and tyrosine residues by intermediate upstream MAP kinase kinases (MAPKKs). The MAPKKs are themselves activated by phosphorylation of serine and threonine residues by upstream kinases (MAPKKKs). A number of MAP Kinase genes have been reported in higher plants.

SUMMARY OF THE INVENTION

[0010] This invention fulfills in part the need to identify new, unique protein kinases capable of conferring stress tolerance to plants upon over-expression. The present invention provides a transgenic plant cell transformed by a Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid sequence in the plant cell results in increased tolerance to environmental stress as compared to a wild type variety of the plant cell. Namely, described herein are the protein kinases: 1) Ser/Thr Kinase and other type of kinases (PK-6, PK-7, PK-8 and PK-9); 2) Calcium dependent protein kinases (CDPK-1 and CDPK-2), 3) Casein Kinase homologs (CK-1, CK-2 and CK-3), and 4) MAP-Kinases (MPK-2, MPK-3, MPK-4 and MPK-5), all from Physcomitrella patens.

[0011] The invention provides in some embodiments that the PKSRP and coding nucleic acid are that found in members of the genus Physcomitrella. In another preferred embodiment, the nucleic acid and protein are from a Physeomitrella patens. The invention provides that the environmental stress can be salinity, drought, temperature, metal, chemical, pathogenic and oxidative stresses, or combinations thereof. In preferred embodiments, the environmental stress can be drought or cold temperature.

[0012] The invention further provides a seed produced by a transgenic plant transformed by a PKSRP coding nucleic acid, wherein the plant is true breeding for increased tolerance to environmental stress as compared to a wild type variety of the plant. The invention further provides a seed produced by a transgenic plant expressing a PKSRP, wherein the plant is true breeding for increased tolerance to environmental stress as compared to a wild type variety of the plant.

[0013] The invention further provides an agricultural product produced by any of the below-described transgenic plants, plant parts or seeds. The invention further provides an isolated PKSRP as described below. The invention further provides an isolated PKSRP
coding nucleic acid, wherein the PKSRP coding nucleic acid codes for a PKSRP
as described below.

[0014] The invention further provides an isolated recombinant expression vector comprising a PKSRP coding nucleic acid as described below, wherein expression of the vector in a host cell results in increased tolerance to environmental stress as compared to a wild type variety of the host cell. The invention further provides a host cell containing the vector and a plant containing the host cell.

[0015] The invention further provides a method of producing a transgenic plant with a PKSRP coding nucleic acid, wherein expression of the nucleic acid in the plant results in increased tolerance to environmental stress as compared to a wild type variety of the plant comprising: (a) transforming a plant cell with an expression vector comprising a PKSRP
coding nucleic acid, and (b) generating from the plant cell a transgenic plant with an increased tolerance to environmental stress as compared to a wild type variety of plant. In preferred embodiments, the PKSRP and PKSRP coding nucleic acid are as described below.

[0016] The present invention further provides a method of identifying a novel PKSRP, comprising (a) raising a specific antibody response to a PKSRP, or fragment thereof, as described below; (b) screening putative PKSRP material with the antibody, wherein specific binding of the antibody to the material indicates the presence of a potentially novel PKSRP; and (c) identifying from the bound material a novel PKSRP in comparison to known PKSRP. Alternatively, hybridization with nucleic acid probes as described below can be used to identify novel PKSRP
nucleic acids.

[0017] The present invention also provides methods of modifying stress tolerance of a plant comprising, modifying the expression of a PKSRP nucleic acid in the plant, wherein the PKSRP is as described below. The invention provides that this method can be performed such that the stress tolerance is either increased or decreased. Preferably, stress tolerance is increased in a plant via increasing expression of a PKSRP nucleic acid.
[0017a] In a broad aspect, the present invention comprehends a transgenic plant cell transformed by a Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid in the plant cell results in increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant cell, and wherein:
a) the PKSRP is a protein Kinase (PK-6) protein as defined in SEQ ID NO:27;
b) the PKSRP is a polypeptide having at least 70% sequence identity with SEQ
ID NO:27 over its entire length, or , , CA 02405750 2012-08-02 c) the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ
ID NO:14 over its entire length.
[0017b1 An aspect of the present invention provides for an isolated Protein Kinase Stress-Related Protein (PKSRP) wherein the PKSRP is:
a) a Protein Kinase-6 (PK-6) as defined in SEQ ID NO:27;
b) a polypeptide having at least 70% sequence identity with SEQ ID NO:27, or c) a polypeptide encoded by a nucleic acid that has at least 70% sequence identity with SEQ ID NO:14 over its entire length;
and wherein the PKSRP upon expression in a plant results in the plant's increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant.
[0017c] Yet further, the invention comprehends a use of the PKSRP as defined herein for increasing the tolerance of a transformed plant or plant cell and/or plant seed to drought and/or freezing stress, wherein the plant, the plant cell or the seed comprises the PKSRP.
[0017d] The invention also comprehends an isolated Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein the PKSRP coding nucleic acid:
a) is a sequence as defined in SEQ ID NO:14, b) is a sequence of at least 70% identity to SEQ ID NO:14, or c) encodes the PKSRP as defined herein, and wherein the expression in a plant increases the plant's tolerance to drought and/or freezing stress.
[0017e] Yet further, the invention comprehends a use of the isolated PKSRP
coding nucleic acid as defined herein, for increasing the tolerance of a transformed 5a plant or plant cell or plant seed to drought and/or freezing stress, wherein the plant, the plant cell or the seed comprises the PKSRP as defined herein.
[0017f] Yet further, the invention comprehends a use of the isolated PKSRP
coding nucleic acid as defined herein, for the identification or cloning of PK-homologs in other cell types and organisms.
[0017g] Yet further, the invention comprehends an isolated recombinant expression vector comprising the nucleic acid as defined herein, wherein the expression of the vector in a host cell results in increased tolerance to drought and/or freezing stress [0017h] Further still, the invention comprehends a method of producing a transgenic plant containing a Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid in the plant results in the plant's increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant, comprising, transforming a plant cell with an expression vector comprising the nucleic acid, generating from the plant cell a transgenic plant with an increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant, wherein:
a) the PKSRP is a Protein Kinase-6 (PK-6) as defined in SEQ ID NO:27;
b) the PKSRP is a polypeptide having at least 70% sequence identity with SEQ
ID NO:27 over its entire length, or c) the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ
ID NO:14 over its entire length.
[0017i] The invention further comprehends a method of modifying drought and/or freezing stress tolerance of a plant comprising, genetically modifying the 5b s CA 02405750 2012-08-02 expression of a Protein Kinase Stress-Related Protein (PKSRP) in the plant in order to obtain a transgenic plant, wherein:
a. the PKSRP is a Protein Kinase-6 (PK-6) as defined in SEQ ID NO:27;
b. the PKSRP is a polypeptide having at least 70% sequence identity with SEQ
ID NO:27 over its entire length, or c. the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ
ID NO:14 over its entire length;
and wherein the transgenic plant has an increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant.
BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figures 1(A-M) show the partial cDNA sequences of PK-6 (SEQ ID
NO:1), PK-7 (SEQ ID NO:2), PK-8 (SEQ ID NO:3), PK-9 (SEQ ID NO:4), CK-1 (SEQ
ID NO:5), CK-2 (SEQ ID NO:6), CK-3 (SEQ ID NO:7), MPK-2 (SEQ ID NO:8), MPK-3 (SEQ ID NO:9), MPK-4 (SEQ ID NO:10), MPK-5 (SEQ ID NO:11), CPK-1 (SEQ ID
NO:12) and CPK-2 (SEQ ID NO:13) from Physcomitrella patens.

[0019] Figures 2(A-M) show the full-length cDNA sequences of PK-6 (SEQ ID
NO:14), PK-7 (SEQ ID NO:15), PK-8 (SEQ ID NO:16), PK-9 (SEQ ID NO:17), CK-1 (SEQ ID NO:18), CK-2 (SEQ ID NO:19), CK-3 (SEQ ID NO:20), MPK-2 (SEQ ID
NO:21), MPK-3 (SEQ ID NO:22), MPK-4 (SEQ ID NO:23), MPK-5 (SEQ ID NO:24), CPK-1 (SEQ ID NO:25) and CPK-2 (SEQ ID NO:26) from Physcomitrella patens.

[0020] Figures 3(A-M) show the deduced amino acid sequences of PK-6 (SEQ
ID NO:27), PK-7 (SEQ ID NO:28), PK-8 (SEQ ID NO:29), PK-9 (SEQ ID NO:30), CK-1 (SEQ ID NO:31), CK-2 (SEQ ID NO:32), CK-3 (SEQ ID NO:33), MPK-2 (SEQ ID
NO:34), MPK-2 (SEQ ID NO:35), MPK-4 (SEQ ID NO:36), MPK-5 (SEQ ID NO:37), CPK-1 (SEQ ID NO:38) and CPK-2 (SEQ ID NO:39) from Physcomitrella patens.

5c [0021] Figure 4 shows a diagram of the plant expression vector pBPSSCO22 containing the super promoter driving the expression of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and 26 ("Desired Gene"). The components are:
NPTII
kanamycin 5d resistance gene (Bevan M, Nucleic Acids Res. 26: 8711-21, 1984), AtAct2-i promoter (An YQ et al., Plant J 10: 107-121 1996), OCS3 terminator (During K, Transgenic Res. 3: 138-140, 1994), NOSpA terminator (Jefferson et al., EMBO J 6:3901-7 1987).

[0022] Figure 5 shows the results of a drought stress test with over-expressing PpPK-6 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0023] Figure 6 shows the results of a drought stress test with over-expressing PpPK-7 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0024] Figure 7 shows the results of a freezing stress test with over-expressing PpPK-7 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown. =

[0025] Figure 8 shows the results of a drought stress test with over-expressing PpPK-9 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0026] Figure 9 shows the results of a freezing stress test with over-expressing PpPK-9 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0027] Figure 10 shows the results of a drought stress test with over-expressing PpCK-1 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0028] Figure 11 shows the results of a freezing stress test with over-expressing PpCK-1 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0029] Figure 12 shows the results of a drought stress test with over-expressing PpCK-2 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0030] Figure 13 shows the results of a drought stress test with over-expressing PpCK-3 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0031] Figure 14 shows the results of a drought stress test with over-expressing PpMPK-2 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0032] Figure 15 shows the results of a freezing stress test with over-expressing PpMPK-2 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0033] Figure 16 shows the results of a drought stress test with over-expressing PpMPK-3 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0034] Figure 17 shows the results of a freezing stress test with over-expressing PpMPK-3 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0035] Figure 18 shows the results of a drought stress test with over-expressing PpMPK-4 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0036] Figure 19 shows the results of a drought stress test with over-expressing PpMPK-5 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0037] Figure 20 shows the results of a drought stress test with over-expressing PpCPK-1 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

[0038] Figure 21 shows the results of a drought stress test with over-expressing PpCPK-2 transgenic plants and wild-type Arabidopsis lines. The transgenic lines display a tolerant phenotype. Individual transformant lines are shown.

DETAILED DESCRIPTION OF THE INVENTION

[0039] The present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the invention and the Examples included herein. However, before the present compounds, compositions, and methods are disclosed and described, it is to be understood that this invention is not limited to specific nucleic acids, specific polypeptides, specific cell types, specific host cells, specific conditions, or specific methods, etc., as such may, of course, vary, and the numerous modifications and variations therein will be apparent to those skilled in the art. It is also to be understood, that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting. In particular, the designation of the amino acid sequences as protein "Protein Kinase Stress-Related Proteins"
(PKSRPs), in no way limits the functionality of those sequences.

[0040] The present invention provides a transgenic plant cell transformed by a PKSRP coding nucleic acid, wherein expression of the nucleic acid sequence in the plant cell results in increased tolerance to environmental stress as compared to a wild type variety of the plant cell. The invention further provides transgenic plant parts and transgenic plants containing the plant cells described herein. Also provided is a plant seed produced by a transgenic plant transformed by a PKSRP coding nucleic acid, wherein the seed contains the PKSRP coding nucleic acid, and wherein the plant is true breeding for increased tolerance to environmental stress as compared to a wild type variety of the plant. The invention further provides a seed produced by a transgenic plant expressing a PKSRP, wherein the seed contains the PKSRP, and wherein the plant is true breeding for increased tolerance to environmental stress as compared to a wild type variety of the plant. The invention also provides an agricultural product produced by any of the below-described transgenic plants, plant parts and plant seeds.

[0041] As used herein, the term "variety" refers to a group of plants within a species that share constant characters that separate them from the typical form and from other possible varieties within that species. While possessing at least one distinctive trait, a variety is also characterized by some variation between individuals within the variety, based primarily on the Mendelian segregation of traits among the progeny of succeeding generations. A variety is considered "true breeding" for a particular trait if it is genetically homozygous for that trait to the extent that, when the true-breeding variety is self-pollinated, a significant amount of independent segregation of the trait among the progeny is not observed. In the present invention, the trait arises from the transgenic expression of one or more DNA sequences introduced into a plant variety.

[0042] The present invention describes for the first time that the Physcomitrella patens PKSRPs, PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2, are useful for increasing a plant's tolerance to environmental stress. Accordingly, the present invention provides isolated PKSRPs selected from the group consisting of PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MYK-4, MPK-5, CPK-1 and CPK-2, and homologs thereof. In preferred embodiments, the PKSRP
is selected from 1) Protein Kinase-6 (PK-6) protein as defined in SEQ ID NO:27;
2) Protein Kinase-7 (PK-7) protein as defined in SEQ ID NO:28; 3) Protein Kinase-8 (PK-8) protein as defined in SEQ ID NO:29; 4) Protein Kinase-9 (PK-9) protein as defined in SEQ
ID NO:30;
5) Casein Kinase homologue (CK-1) protein as defined in SEQ ID NO:31; 6) Casein Kinase homologue-2 (CK-2) protein as defined in SEQ ID NO:32; 7) Casein Kinase homologue-3 (CK-3) protein as defined in SEQ JD NO:33; 8) MAP Kinase-2 (MPK-2) protein as defined in SEQ ID NO:34; 9) MAP Kinase-3 (IVIPK-3) protein as defined in SEQ ID NO:35;
10) MAP Kinase-4 (MPK-4) protein as defined in SEQ lD NO:36; 11) MAP Kinase-5 (MPK-5) protein as defmed in SEQ ID NO:37, 12) Calcium dependent protein kinase-1 (CPK-1) protein as defined in SEQ ID NO:38; 13) Calcium dependent protein kinase-2 (CPK-2) protein as defined in SEQ JD NO:39; and homologs and orthologs thereof.
Homologs and orthologs of the amino acid sequences are defined below.

[0043] The PKSRPs of the present invention are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described below), the expression vector is introduced into a host cell (as described below) and the PKSRP is expressed in the host cell. The PKSRP
can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques. Alternative to recombinant expression, a PKSRP
polypeptide, or peptide can be synthesized chemically using standard peptide synthesis techniques.
Moreover, native PKSRP can be isolated from cells (e.g., Physcomitrella patens), for example using an anti-PKSRP antibody, which can be produced by standard techniques utilizing a PKSRP or fragment thereof.

[0044] The invention further provides an isolated PKSRP coding nucleic acid.
The present invention includes PKSRP coding nucleic acids that encode PKSRPs as described herein. In preferred embodiments, the PKSRP coding nucleic acid is selected from 1) Protein Kinase-6 (PK-6) nucleic acid as defined in SEQ ID NO:14; 2) Protein Kinase-7 (PK-7) nucleic acid as defined in SEQ ID NO:15; 3) Protein Kinase-8 (PK-8) nucleic acid as defmed in SEQ ID NO:16; 4) Protein Kinase-9 (PK-9) nucleic acid as defined in SEQ ID
NO:17; 5) Casein Kinase homolog (CK-1) nucleic acid as defined in SEQ ID NO:18; 6) Casein Kinase homolog-2 (CK-2) nucleic acid as defined in SEQ ID NO:19; 7) Casein Kinase homolog-3 (CK-3) nucleic acid as defined in SEQ ID NO:20; 8) MAP Kinase-2 (MPK-2) nucleic acid as defined in SEQ ID NO:21; 9) MAP Kinase-3 (MPK-3) nucleic acid as defined in SEQ ID
NO:22; 10) MAP Kinase-4 (MPK-4) nucleic acid as defined in SEQ ID NO:23; 11) MAP
Kinase-5 (MPK-5) nucleic acid as defined in SEQ JD NO:24; 12) Calcium dependent protein ldnase-1 (CPK-1) nucleic acid as defined in SEQ ID NO:25; 13) Calcium dependent protein kinase-2 (CPK-2) nucleic acid as defined in SEQ ID NO:26 and homologs and orthologs thereof. Homo logs and orthologs of the nucleotide sequences are defined below. In one preferred embodiment, the nucleic acid and protein are isolated from the plant genus Physcomitrella. In another preferred embodiment, the nucleic acid and protein are from a Physcomitrella patens (P. patens) plant.

[0045] As used herein, the term "environmental stress" refers to any sub-optimal growing condition and includes, but is not limited to, sub-optimal conditions associated with salinity, drought, temperature, metal, chemical, pathogenic and oxidative stresses, or combinations thereof. In preferred embodiments, the environmental stress can be salinity, drought, or temperature, or combinations thereof, and in particular, can be high salinity, low water content or low temperature. It is also to be understood that as used in the specification and in the claims, "a" or "an" can mean one or more, depending upon the context in which it is used. Thus, for example, reference to "a cell" can mean that at least one cell can be utilized.

[0046] As also used herein, the terms "nucleic acid" and "nucleic acid molecule" are intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA
molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
This term also encompasses untranslated sequence located at both the 3' and 5' ends of the coding region of the gene: at least about 1000 nucleotides of sequence upstream from the 5' end of the coding region and at least about 200 nucleotides of sequence downstream from the 3' end of the coding region of the gene. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.

[0047] An "isolated" nucleic acid molecule is one that is substantially separated from other nucleic acid molecules which are present in the natural source of the nucleic acid.
Preferably, an "isolated" nucleic acid is free of some of the sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated PKSRP nucleic acid molecule can contain less than about kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or. 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived (e.g., a Physcomitrella patens cell). Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be free from some of the other cellular material with which it is naturally associated, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized.

[0048] A nucleic acid molecule of the present invention, e.g., a nucleic acid molecule having a nucleotide sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID
NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, a P. patens PKSRP cDNA can be isolated from a P.
patens library using all or portion of one of the sequences of SEQ ID NO:1, SEQ ID
NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ lD NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13. Moreover, a nucleic acid molecule encompassing all or a portion of one of the sequences of SEQ ID
NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13 can be isolated by the polyrnerase chain reaction using oligonucleotide primers designed based upon this sequence. For example, mRNA can be isolated from plant cells (e.g., by the guanidinium-thiocyanate extraction procedure of Chirgwin et al., 1979 Biochemistry 18:5294-5299) and cDNA can be prepared using reverse transcriptase (e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMY
reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for polymerase chain reaction amplification can be designed based upon one of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13. A nucleic acid molecule of the invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR
amplification techniques. The nucleic acid molecule so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to a PKSRP nucleotide sequence can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
[00491 In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises one of the nucleotide sequences shown in SEQ ID NO:14, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26. These cDNAs comprise sequences encoding the PKSRPs (i.e., the "coding region", indicated in Table 1), as well as 5' untranslated sequences and 3' untranslated sequences.
It is to be understood that SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID

NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26 comprise both coding regions and 5' and 3' untranslated regions. Alternatively, the nucleic acid molecules of the present invention can comprise only the coding region of any of the sequences in SEQ ID NO:14, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID

NO:26 or can contain whole genomic fragments isolated from genomic DNA. A
coding region of these sequences is indicated as "ORF position". The present invention also includes PKSRP coding nucleic acids that encode PKSRPs as described herein.
Preferred is a PKSRP coding nucleic acid that encodes a PKSRP selected from the group consisting of, PK-6 (SEQ ID NO:27), PK-7 (SEQ ID NO:28), PK-8 (SEQ ID NO:29), PK-9 (SEQ ID
NO:30), CK-1 (SEQ ID NO:31), CK-2 (SEQ ID NO:32), CK-3 (SEQ ID NO:33), MPK-2 (SEQ ID NO:34), MPK-3 (SEQ ID NO:35), MPK-4 (SEQ ID NO:36), MPK-5 (SEQ ID
NO:37), CPK-1 (SEQ ID NO:38) and CPK-2 (SEQ ID NO:39).
[0050] Moreover, the nucleic acid molecule of the invention can comprise only a portion of the coding region of one of the sequences in SEQ ID NO:14, SEQ ID
NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26, for example, a fragment which can be used as a probe or primer or a fragment encoding a biologically active portion of a PKSRP. The nucleotide sequences determined from the cloning of the PKSRP genes from P. patens allow for the generation of probes and primers designed for use in identifying and/or cloning PKSRP homologs in other cell types and organisms, as well as PKSRP homologs from other mosses and related species.
[0051] Portions of proteins encoded by the PKSRP nucleic acid molecules of the invention are preferably biologically active portions of one of the PKSRPs described herein.
As used herein, the term "biologically active portion of' a PKSRP is intended to include a portion, e.g., a domain/motif, of a PKSRP that participates in a stress tolerance response in a plant, has an activity as set forth in Table 1, or participates in the transcription of a protein involved in a stress tolerance response in a plant. To determine whether a PKSRP, or a biologically active portion thereof, can participate in transcription of a protein involved in a stress tolerance response in a plant, or whether repression of a PKSRP results in increased stress tolerance in a plant, a stress analysis of a plant comprising the PKSRP
may be performed. Such analysis methods are well known to those skilled in the art, as detailed in Example 7. More specifically, nucleic acid fragments encoding biologically active portions of a PKSRP can be prepared by isolating a portion of one of the sequences in SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID

NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39, expressing the encoded portion of the PKSRP or peptide (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of the PKSRP or peptide.
[0052] Biologically active portions of a PKSRP are encompassed by the present invention and include peptides comprising amino acid sequences derived from the amino acid sequence of a PKSRP, e.g., an amino acid sequence of SEQ ID NO:27, SEQ ID
NO:28, SEQ
ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID
NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39, or the amino acid sequence of a protein homologous to a PKSRP, which include fewer amino acids than a full length PKSRP or the full length protein which is homologous to a PKSRP, and exhibit at least one activity of a PKSRP. Typically, biologically active portions (e.g., peptides which are, for example, 5, 10,- 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino acids in length) comprise a domain or motif with at least one activity of a PKSRP.
Moreover, other biologically active portions in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the activities described herein. Preferably, the biologically active portions of a PKSRP
include one or more selected domains/motifs or portions thereof having biological activity.
[0053] The invention also provides PKSRP chimeric or fusion proteins. As used herein, a PKSRP "chimeric protein" or "fusion protein" comprises a PKSRP
polypeptide operatively linked to a non-PKSRP polypeptide. A PKSRP polypeptide refers to a polypeptide having an amino acid sequence corresponding to a PKSRP, whereas a non-PKSRP polypeptide refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the PKSRP, e.g., a protein that is different from the PKSRP and is derived from the same or a different organism. Within the fusion protein, the term "operatively linked" is intended to indicate that the PKSRP
polypeptide and the non-PKSRP polypeptide are fused to each other so that both sequences fulfill the proposed function attributed to the sequence used. The non-PKSRP polypeptide can be fused to the N-terminus or C-terminus of the PKSRP polypeptide. For example, in one embodiment, the fusion protein is a GST-PKSRP fusion protein in which the PKSRP
sequences are fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant PKSRPs. In another embodiment, the fusion protein is a PKSRP containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), expression and/or secretion of a PKSRP can be increased through use of a heterologous signal sequence.
[0054] Preferably, a PKSRP chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR
amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, Eds. Ausubel et al. John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). A PKSRP encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the PKSRP.
[0055] In addition to fragments and fusion proteins of the PKSRPs described herein, the present invention includes homologs and analogs of naturally occurring PKSRPs and PKSRP encoding nucleic acids in a plant. "Homologs" are defined herein as two nucleic acids or proteins that have similar, or "homologous", nucleotide or amino acid sequences, respectively. Homologs include allelic variants, orthologs, paralogs, agonists and antagonists of PKSRPs as defined hereafter. The term "homolog" further encompasses nucleic acid molecules that differ from one of the nucleotide sequences shown in SEQ ID
NO:14, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ
ID NO:26 (and portions thereof) due to degeneracy of the genetic code and thus encode the same PKSRP as that encoded by the nucleotide sequences shown in SEQ ID NO:14, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID

NO:26. As used herein a "naturally occurring" PKSRP refers to a PKSRP amino acid sequence that occurs in nature. Preferably, a naturally occurring PKSRP
comprises an amino acid sequence selected from the group consisting of SEQ ID NO:27, SEQ ID
NO:28, SEQ ID

NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39.
[0056] An agonist of the PKSRP can retain substantially the same, or a subset, of the biological activities of the PKSRP. An antagonist of the PKSRP can inhibit one or more of the activities of the naturally occurring form of the PKSRP. For example, the PKSRP
antagonist can competitively bind to a downstream or upstream member of the cell membrane component metabolic cascade that includes the PKSRP, or bind to a PKSRP that mediates transport of compounds across such membranes, thereby preventing translocation from taking place.
[0057] Nucleic acid molecules corresponding to natural allelic variants and analogs, orthologs and paralogs of a PKSRP cDNA can be isolated based on their identity to the Physcomitrella patens PKSRP nucleic acids described herein using PKSRP cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. In an alternative embodiment, homologs of the PKSRP
can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the PKSRP for PKSRP agonist or antagonist activity. In one embodiment, a variegated library of PKSRP variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of PKSRP
variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential PKSRP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of PKSRP sequences therein. There are a variety of methods that can be used to produce libraries of potential PKSRP homologs from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer,. and the synthetic gene is then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential PKSRP sequences.
Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, S.A., 1983 Tetrahedron 39:3; Itakura et al., 1984 Annu. Rev. Biochem. 53:323;
Itakura et al., 1984 Science 198:1056; Ike et al., 1983 Nucleic Acid Res. 11:477).
[0058] In addition, libraries of fragments of the PKSRP coding regions can be used to generate a variegated population of PKSRP fragments for screening and subsequent selection of homologs of a PKSRP. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of a PKSRP coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA, which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with Si nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the PKSRP.
[0059] Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA
libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of PKSRP
homologs. The most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a new technique that enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify PKSRP homologs (Arkin and Yourvan, 1992 PNAS
89:7811-7815; Delgrave et al., 1993 Protein Engineering 6(3):327-331). In another embodiment, cell based assays can be exploited to analyze a variegated PKSRP library, using methods well known in the art. The present invention further provides a method of identifying a novel PKSRP, comprising (a) raising a specific antibody response to a PKSRP, or a fragment thereof, as described herein; (b) screening putative PKSRP material with the antibody, wherein specific binding of the antibody to the material indicates the presence of a potentially novel PKSRP; and (c) analyzing the bound material in comparison to known PKSRP, to determine its novelty.
[0060] To determine the percent homology of two amino acid sequences (e.g., one of the sequences of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ
ID
NO:31, SEQ NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39 and a mutant form thereof), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of one protein or nucleic acid for optimal alignment with the other protein or nucleic acid). The amino acid residues at corresponding amino acid positions or nucleotide positions are then compared. When a position in one sequence (e.g., one of the sequences of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID
NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39) is occupied by the same amino acid residue as the corresponding position in the other sequence (e.g., a mutant form of the sequence selected from the polypeptide of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID
NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ED
NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ED NO:39), then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid "homology" is equivalent to amino acid or nucleic acid "identity"). The same type of comparison can be made between two nucleic acid sequences.
[0061] The percent homology between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = numbers of identical positions/total numbers of positions x 100). Preferably, the amino acid sequences included in the present invention are at least about 50-60%, preferably at least about 60-70%, and more preferably at least about 70-80%, 80-90%, 90-95%, and most preferably at least about 96%, 97%, 98%, 99% or more homologous to an entire amino acid sequence shown in SEQ
ID
NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID
NO:38 or SEQ ID NO:39. In yet another embodiment, at least about 50-60%, preferably at least about 60-70%, and more preferably at least about 70-80%, 80-90%, 90-95%, and most preferably at least about 96%, 97%, 98%, 99% or more homologous to an entire amino acid sequence encoded by a nucleic acid sequence shown in SEQ ID NO:14, SEQ ID
NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26. In other embodiments, the preferable length of sequence comparison for proteins is at least 15 amino acid residues, more preferably at least 25 amino acid residues, and most preferably at least 35 amino acid residues.
[0062] In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which is at least about 50-60%, preferably at least about 60-70%, more preferably at least about 70-80%, 80-90%, or 90-95%, and even more preferably at least about 95%, 96%, 97%, 98%, 99% or more homologous to a nucleotide sequence shown in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ
ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID
NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26, or a portion thereof. The preferable length of sequence comparison for nucleic acids is at least 75 nucleotides, more preferably at least 100 nucleotides and most preferably the entire length of the coding region.
[0063] It is also preferable that the homologous nucleic acid molecule of the invention encodes a protein or portion thereof which includes an amino acid sequence which is sufficiently homologous to an amino acid sequence of SEQ ID NO:27, SEQ ID
NO:28, SEQ 1D NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID
NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39 such that the protein or portion thereof maintains the same or a similar function as the amino acid sequence to which it is compared. Functions of the PKSRP amino acid sequences of the present invention include the ability to participate in a stress tolerance response in a plant, or more particularly, to participate in the transcription of a protein involved in a stress tolerance response in a Physcomitrella patens plant. Examples of such activities are described in Table 1.
.[0064] In addition to the above described methods, a determination of the percent homology between two sequences can be accomplished using a mathematical algorithm. A
preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990 Proc. Natl. Mad.
Sci. USA
90:5873-5877). Such an algorithm is incorporated into the NBLAST and )(BLAST
programs of Altschul, et al. (1990 J. Mol. Biol. 215:403-410).
[0065] BLAST nucleic acid searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleic acid sequences homologous to the PKSRP
nucleic acid molecules of the invention. Additionally, BLAST protein searches can be performed with the )(BLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to PKSRPs of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997 Nucleic Acids Res. 25:3389-3402). When utilizing BLAST and Gapped BLAST
programs, the default parameters of the respective programs (e.g., )(BLAST and NBLAST) can be used.
Another preferred non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (CABIOS 1989).
Such an algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG
sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 can be used to obtain amino acid sequences homologous to the PKSRPs of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in Altschul et al. (1997 Nucleic Acids Res.
25:3389-3402).
When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. Another preferred non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (CABIOS 1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG sequence alignment software package.
When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 can be used.
[0066] Finally, homology between nucleic acid sequences can also be determined using hybridization techniques known to those of skill in the art.
Accordingly, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which hybridizes, e.g., hybridizes under stringent conditions, to one of the nucleotide sequences shown in SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID
NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:25 and SEQ ID NO:26, or a portion thereof. More particularly, an isolated nucleic acid molecule of the invention is at least 15 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ lD NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26. In other embodiments, the nucleic acid is at least 30, 50, 100, 250 or more nucleotides in length.
[0067] As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing wider which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other.
Preferably, the conditions are such that sequences at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologous to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, 6.3.1-6.3.6, John Wiley &
Sons, N.Y. (1989). A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45 C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65 C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to a sequence of SEQ ID
NO:14, SEQ ID NO:15, SEQ lD NO:16, SEQ lD NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:25 or SEQ ID NO:26 corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally occurring" nucleic acid molecule refers to an RNA or DNA
molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
In one embodiment, the nucleic acid encodes a naturally occurring Physcomitrella patens PKSRP.
[0068] Using the above-described methods, and others known to those of skill in the art, one of ordinary skill in the art can isolate homologs of the PKSRPs comprising amino acid sequences shown in SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID
NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID
NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39. One subset of these homologs are allelic variants. As used herein, the term "allelic variant" refers to a nucleotide sequence containing polymorphisms that lead to changes in the amino acid sequences of a PKSRP and that exist within a natural population (e.g., a plant species or variety).
Such natural allelic variations can typically result in 1-5% variance in a PKSRP nucleic acid.
Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different plants, which can be readily carried out by using hybridization probes to identify the same PKSRP genetic locus in those plants. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations in a PKSRP that are the result of natural allelic variation and that do not alter the functional activity of a PKSRP, are intended to be within the scope of the invention.
= [0069] Moreover, nucleic acid molecules encoding PKSRPs from the same or other species such as PKSRP analogs, orthologs and paralogs, are intended to be within the scope of the present invention. As used herein, the term "analogs" refers to two nucleic acids that have the same or similar function, but that have evolved separately in unrelated organisms.
As used herein, the term "orthologs" refers to two nucleic acids from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode proteins having the same or similar functions. As also used herein, the term "paralogs" refers to two nucleic acids that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related (Tatusov, R.L. et al.
1997 Science 278(5338):631-637). Analogs, orthologs and paralogs of a naturally occurring PKSRP can differ from the naturally occurring PKSRP by post-translational modifications, by amino acid sequence differences, or by both. Post-translational modifications include in vivo and in vitro chemical derivatization of polyp eptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation, and such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. In particular, orthologs of the invention will generally exhibit at least 80-85%, more preferably 90%, and most preferably 95%, 96%, 97%, 98% or even 99% identity or homology with all or part of a naturally occurring PKSRP amino acid sequence and will exhibit a function similar to a PKSRP.
Orthologs of the present invention are also preferably capable of participating in the stress response in plants. hi one embodiment, the PKSRP orthologs maintain the ability to participate in the metabolism of compounds necessary for the construction of cellular membranes in Physcomitrella patens, or in the transport of molecules across these membranes.
[0070] In addition to naturally-occurring variants of a PKSRP sequence that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into a nucleotide sequence of SEQ ID NO:14, SEQ JD
NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ JD NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26, thereby leading to changes in the amino acid sequence of the encoded PKSRP, without altering the functional ability of the PKSRP. For example, nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in a sequence of SEQ ID
NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ JD NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:25 or SEQ ID NO:26. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of one of the PKSRPs without altering the activity of said PKSRP, whereas an "essential" amino acid residue is required for PKSRP
activity.
Other amino acid residues, however, (e.g., those that are not conserved or only semi-conserved in the domain having PKSRP activity) may not be essential for activity and thus are likely to be amenable to alteration without altering PKSRP activity.
[0071] Accordingly, another aspect of the invention pertains to nucleic acid molecules encoding PKSRPs that contain changes in amino acid residues that are not essential for PKSRP activity. Such PKSRPs differ in amino acid sequence from a sequence contained in SEQ ID NO:27, SEQ ID NO:28, SEQ NO:29, SEQ ID NO:30, SEQ ID
NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39, yet retain at least one of the PKSRP
activities described herein. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 50% homologous to an amino acid sequence of SEQ ID
NO:27, SEQ
ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID
NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ED NO:37, SEQ ID NO:38 and SEQ
ID NO:39. Preferably, the protein encoded by the nucleic acid molecule is at least about 50-60% homologous to one of the sequences of SEQ ID NO:27, SEQ ID NO:28, SEQ ID
NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ED NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39, more preferably at least about 60-70% homologous to one of the sequences of SEQ ID
NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID
NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39, even more preferably at least about 70-80%, 80-90%, 90-95%
homologous to one of the sequences of SEQ ID NO:27, SEQ ID NO:28, SEQ ID
NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID
NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ NO:38 and SEQ ID NO:39, and most preferably at least about 96%, 97%, 98%, or 99% homologous to one of the sequences of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID
NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39. The preferred PKSRP homologs of the present invention are preferably capable of participating in the a stress tolerance response in a plant, or more particularly, participating in the transcription of a protein involved in a stress tolerance response in a Physcomitrella patens plant, or have one or more activities set forth in Table 1.
[0072] An isolated nucleic acid molecule encoding a PKSRP homologous to a protein sequence of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID
NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39 can be created by introducing one or more nucleotide substitutions, additions or deletions into a nucleotide sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into one of the sequences of SEQ ID NO:14, SEQ ED NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ
ID
NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
[0073] Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, senile, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in a PKSRP is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of a PKSRP coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for a PKSRP activity described herein to identify mutants that retain PKSRP activity. Following mutagenesis of one of the sequences of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26, the encoded protein can be expressed recombinantly and the activity of the protein can be determined by analyzing the stress tolerance of a plant expressing the protein as described in Example 7.
[0074] In addition to the nucleic acid molecules encoding the PKSRPs described above, another aspect of the invention pertains to isolated nucleic acid molecules that are antisense thereto. An "antisense" nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA
sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
The antisense nucleic acid can be complementary to an entire PKSRP coding strand, or to only a portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence encoding a PKSRP. The term "coding region" refers to the region of the nucleotide sequence comprising codons that are translated into amino acid residues (e.g., the entire coding region of õ,õ
comprises nucleotides 1 to ....). In another embodiment, the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding a PKSRP.

The term "noncoding region" refers to 5' and 3' sequences that flank the coding region that are not translated into amino acids (i.e., also referred to as 5' and 3' untranslated regions).
[0075] In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of one of the nucleotide sequences shown in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:24, SEQ ID NO:25 and SEQ ID NO:26, or a portion thereof. A nucleic acid molecule that is complementary to one of the nucleotide sequences shown in SEQ ID
NO:14, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ
ID NO:26 is one which is sufficiently complementary to one of the nucleotide sequences shown in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NCI:22, SEQ ID NO:23, SEQ ID
NO:24, SEQ ID NO:25 and SEQ ID NO:26 such that it can hybridize to one of the nucleotide sequences shown in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ

ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID
NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26, thereby forming a stable duplex.
[0076] Given the coding strand sequences encoding the PKSRPs disclosed herein (e.g., the sequences set forth in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID
NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26), antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing.
The antisense nucleic acid molecule can be complementary to the entire coding region of PKSRP mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of PKSRP mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of PKSRP mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
[0077] An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5 -io douracil, hypoxanthine, xanthine, 4-acetylcyto sine, 5-(carboxyhydroxylmethyl) uracil, 5 -carboxym ethylaminomethy1-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethy1-2-thiouracil, beta-D-mannosylqueosine, 5 '-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
[0078] The antisense nucleic acid molecules of the invention are typically administered to a cell or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a PKSRP to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. The antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong prokaryotic, viral, or eukaryotic (including plant) promoter are preferred.
[0079] In yet another embodiment, the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual 13-units, the strands run parallel to each other (Gaultier et al., 1987 Nucleic Acids. Res.
15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al., 1987 Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al., 1987 FEBS Lett. 215:327-330).
[0080] In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes described in Haselhoff and Gerlach, 1988 Nature 334:585-591) can be used to catalytically cleave PKSRP
mRNA transcripts to thereby inhibit translation of PKSRP mRNA. A ribozyme having specificity for a PKSRP-encoding nucleic acid can be designed based upon the nucleotide sequence of a PKSRP cDNA, as disclosed herein (i.e., SEQ ID NO:14, SEQ ID
NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26) or on the basis of a heterologous sequence to be isolated according to methods taught in this invention. For example, a derivative of a Tetrahymena L-19 WS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a PKSRP-encoding mRNA. See, e.g., Cech et al. U.S. Patent No.
4,987,071 and Cech et al. U.S. Patent No. 5,116,742. Alternatively, PKSRP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules.
See, e.g., Bartel, D. and Szostak, J.W., 1993 Science 261:1411-1418.
[0081] Alternatively, PKSRP gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of a PKSRP nucleotide sequence (e.g., a PKSRP promoter and/or enhancer) to form triple helical structures that prevent transcription of a PKSRP gene in target cells. See generally, Helene, C., 1991 Anticancer Drug Des.
6(6):569-84; Helene, C. et al., 1992 Ann. N.Y. Acad. Sci. 660:27-36; and Maher, L.J., 1992 Bioassays 14(12):807-15.
[0082] In addition to the PKSRP nucleic acids and proteins described above, the present invention encompasses these nucleic acids and proteins attached to a moiety. These moieties include, but are not limited to, detection moieties, hybridization moieties, purification moieties, delivery moieties, reaction moieties, binding moieties, and the like. A
typical group of nucleic acids having moieties attached are probes and primers. The probes and primers typically comprise a substantially isolated oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 40, 50 or 75 consecutive nucleotides of a sense strand of one of the sequences set forth in SEQ ID
NO:14, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ
ID NO:26, an anti-sense sequence of one of the sequences set forth in SEQ ID
NO:14, SEQ
ID NO:15, SEQ PD NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ
ID NO:26, or naturally occurring mutants thereof. Primers based on a nucleotide sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID
NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NO:26 can be used in PCR reactions to clone PKSRP
homologs.
Probes based on the PKSRP nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In preferred embodiments, the probe further comprises a label group attached thereto, e.g. the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a genomic marker test kit for identifying cells which express a PKSRP, such as by measuring a level of a PKSRP-encoding nucleic acid, in a sample of cells, e.g., detecting PKSRP mRNA levels or determining whether a genomic PKSRP gene has been mutated or deleted.
[0083] In particular, a useful method to ascertain the level of transcription of the gene (an indicator of the amount of mRNA available for translation to the gene product) is to perform a Northern blot (for reference see, for example, Ausubel et al., 1988 Current Protocols in Molecular Biology, Wiley: New York). This information at least partially demonstrates the degree of transcription of the transformed gene. Total cellular RNA can be prepared from cells, tissues or organs by several methods, all well-known in the art, such as that described in Bormann, E.R. et al., 1992 Mol. Microbiol. 6:317-326. To assess the presence or relative quantity of protein translated from this mRNA, standard techniques, such as a Western blot, may be employed. These techniques are well known to one of ordinary skill in the art. (See, for example, Ausubel et al., 1988 Current Protocols in Molecular Biology, Wiley: New York).
[0084] The invention further provides an isolated recombinant expression vector comprising a PKSRP nucleic acid as described above, wherein expression of the vector in a host cell results in increased tolerance to environmental stress as compared to a wild type variety of the host cell. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
[0085] The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/ translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals).
Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990) or see:
Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnology, eds. Glick and Thompson, Chapter 7, 89-108, CRC Press: Boca Raton, Florida, including the references therein. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells or under certain conditions. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., PKSRPs, mutant forms of PKSRPs, fusion proteins, etc.).
[0086] The recombinant expression vectors of the invention can be designed for expression of PKSRPs in prokaryotic or eukaryotic cells. For example, PKSRP
genes can be expressed in bacterial cells such as C. glutamicum, insect cells (using baculovirus expression vectors), yeast and other fungal cells (see Romanos, M.A. et al., 1992 Foreign gene expression in yeast: a review, Yeast 8:423-488; van den Hondel, C.A.M.J.J. et al., 1991 Heterologous gene expression in filamentous fungi, in: More Gene Manipulations in Fungi, J.W. Bennet & L.L. Lasure, eds., p. 396-428: Academic Press: San Diego; and van den Hondel, C.A.M.J.J. & Punt, P.J., 1991 Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J.F. et al., eds., p. 1-28, Cambridge University Press: Cambridge), algae (Falciatore et al., 1999 Marine Biotechnology 1(3):239-251), ciliates of the types: Holotrichia, Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma, Platyophrya, Potomacus, Pseudocohnilembus, Euplotes, Engelmaniella, and Stylonychia, especially of the genus Stylonychia lemnae with vectors following a transformation method as described in WO
98/01572 and multicellular plant cells (see Schmidt, R. and Willmitzer, L., 1988 High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants, Plant Cell Rep. 583-586); Plant Molecular Biology and Biotechnology, C Press, Boca Raton, Florida, chapter 6/7, S.71-119 (1993);
F.F. White, B.
Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds. Kung und R. Wu, 128-43, Academic Press: 1993; Potrykus, 1991 Annu.
Rev. Plant Physiol. Plant Molec. Biol. 42:205-225 and references cited therein) or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press: San Diego, CA (1990).
Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
100871 Expression of proteins in prokaryotes is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein but also to the C-terminus or fused within suitable regions in the proteins. Such fusion vectors typically serve three purposes: 1) to increase expression of a recombinant protein; 2) to increase the solubility of a recombinant protein; and 3) to aid in the purification of a recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase.
[0088] Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc;
Smith, D.B. and Johnson, K.S., 1988 Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. In one embodiment, the coding sequence of the PKSRP is cloned into a pGEX
expression vector to create a vector encoding a fusion protein comprising, from the N-terminus to the C-terminus, GST-thrombin cleavage site-X protein. The fusion protein can be purified by affinity chromatography using glutathione-agarose resin.
Recombinant PKSRP unfused to GST can be recovered by cleavage of the fusion protein with thrombin.
[0089] Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., 1988 Gene 69:301-315) and pET lid (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET
lid vector relies on transcription from a T7 gn10-lac fusion promoter mediated by a co-expressed viral RNA polymerase (T7 gni). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident k prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
[0090] One strategy to maximize recombinant protein expression is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in the bacterium chosen for expression, such as C. glutamicum (Wada et al., 1992 Nucleic Acids Res.
20:2111-2118).

Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
[0091] In another embodiment, the PKSRP expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari, et al., 1987 Embo J. 6:229-234), pMFa (Kutjan and Herskowitz, 1982 Cell 30:933-943), pJRY88 (Schultz et al., 1987 Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods for the construction of vectors appropriate for use in other fungi, such as the filamentous fungi, include those detailed in: van den Hondel, C.A.M.J.J. &
Punt, P.J. (1991) "Gene transfer systems and vector development for filamentous fungi, in:
Applied Molecular Genetics of Fungi, J.F. Peberdy, et al., eds., p. 1-28, Cambridge University Press: Cambridge.
[0092] Alternatively, the PKSRPs of the invention can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al., 1983 Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers, 1989 Virology 170:31-39).
[0093] In yet another embodiment, a PKSRP nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B., 1987 Nature 329:840) and pMT2PC (Kaufman et al., 1987 EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
[0094] In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al., 1987 Genes Dev.
1:268-277), lymphoid-specific promoters (Calame and Eaton, 1988 Adv. Immunol.
43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989 EIVIBO J.
8:729-733) and immunoglobulins (Banerji et al., 1983 Cell 33:729-740; Queen and Baltimore, 1983 Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989 PNAS 86:5473-5477), pancreas-specific promoters (Edlund et al., 1985 Science 230:912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No.
264,166). Developmentally-regulated promoters are also encompassed, for example, the murine hox promoters (Kessel and Grass, 1990 Science 249:374-379) and the fetoprotein promoter (Campes and Tilghman, 1989 Genes Dev. 3:537-546).
[0095] In another embodiment, the PKSRPs of the invention may be expressed in unicellular plant cells (such as algae) (see Falciatore et al., 1999 Marine Biotechnology 1(3):239-251 and references therein) and plant cells from higher plants (e.g., the spermatophytes, such as crop plants). Examples of plant expression vectors include those detailed in: Becker, D., Kemper, E., Schell, J. and Masterson, R., 1992 New plant binary vectors with selectable markers located proximal to the left border, Plant Mol. Biol. 20:
1195-1197; and Bevan, M.W., 1984 Binary Agrobacterium vectors for plant transformation, Nucl. Acid. Res. 12:8711-8721; Vectors for Gene Transfer in Higher Plants; in:
Transgenic Plants, Vol. 1, Engineering and Utilization, eds.: Kung and R. Wu, Academic Press, 1993, S.
15-38.
[0096] A plant expression cassette preferably contains regulatory sequences capable of driving gene expression in plant cells and operably linked so that each sequence can fulfill its function, for example, termination of transcription by polyadenylation signals. Preferred polyadenylation signals are those originating from Agrobacterium tumefaciens t-DNA such as the gene 3 known as octopine synthase of the Ti-plasmid pTiACH5 (Gielen et al., 1984 EMBO J. 3:835) or functional equivalents thereof but also all other terminators functionally active in plants are suitable.
[0097] As plant gene expression is very often not limited on transcriptional levels, a plant expression cassette preferably contains other operably linked sequences like translational enhancers such as the overdrive-sequence containing the 5'-untranslated leader sequence from tobacco mosaic virus enhancing the protein per RNA ratio (Gallie et al., 1987 Nucl. Acids Research 15:8693-8711).
[0098] Plant gene expression has to be operably linked to an appropriate promoter conferring gene expression in a timely, cell or tissue specific manner.
Preferred are promoters driving constitutive expression (Benfey et al., 1989 EMBO J. 8:2195-2202) like those derived from plant viruses like the 35S CAMV (Franck et al., 1980 Cell 21:285-294), the 19S CaMV (see also U.S. Patent No.. 5352605 and PCT Application No. WO
8402913) or plant promoters like those from Rubisco small subunit described in U.S.
Patent No.
4,962,028.
[0099] Other preferred sequences for use in plant gene expression cassettes are targeting-sequences necessary to direct the gene product in its appropriate cell compartment (for review see Kermode, 1996 Crit. Rev. Plant Sci. 15(4):285-423 and references cited therein) such as the vacuole, the nucleus, all types of plastids like amyloplasts, chloroplasts, chromoplasts, the extracellular space, mitochondria, the endoplasmic reticulum, oil bodies, peroxisomes and other compartments of plant cells.
[0100] Plant gene expression can also be facilitated via an inducible promoter (for review see Gatz, 1997 Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:89-108).
Chemically inducible promoters are especially suitable if gene expression is wanted to occur in a time specific manner. Examples of such promoters are a salicylic acid inducible promoter (PCT
Application No. WO 95/19443), a tetracycline inducible promoter (Gatz et al., 1992 Plant J.
2:397-404) and an ethanol inducible promoter (PCT Application No. WO
93/21334).
[0101] Also, suitable promoters responding to biotic or abiotic stress conditions are those such as the pathogen inducible PRP1-gene promoter (Ward et al., 1993 Plant. Mol.
Biol. 22:361-366), the heat inducible hsp80-promoter from tomato (U.S. Patent No.
5187267), cold inducible alpha-amylase promoter from potato (PCT Application No. WO
96/12814) or the wound-inducible pinll-promoter (European Patent No. 375091).
For other examples of drought, cold, and salt-inducible promoters, such as the RD29A
promoter, see Yamaguchi-Shinozalei et al. (1993 Mol. Gen. Genet. 236:331-340).
[0102] Especially preferred are those promoters that confer gene expression in specific tissues and organs, such as guard cells and the root hair cells.
Suitable promoters include the napin-gene promoter from rapeseed (U.S. Patent No. 5,608,152), the USP-promoter from Vicia faba (Baeumlein et al., 1991 Mol Gen Genet. 225(3):459-67), the oleosin-promoter from Arabidopsis (PCT Application No. WO 98/45461), the phaseolin-promoter from Phaseolus vulgaris (U.S. Patent No. 5,504,200), the Bce4-promoter from Brassica (PCT Application No. WO 91/13980) or the legumin B4 promoter (LeB4;
Baeumlein et al., 1992 Plant Journal, 2(2):233-9) as well as promoters conferring seed specific expression in monocot plants like maize, barley, wheat, rye, rice, etc. Suitable promoters to note are the lpt2 or lptl-gene promoter from barley (PCT
Application No. WO
95/15389 and PCT Application No. WO 95/23230) or those described in PCT
Application No. WO 99/16890 (promoters from the barley hordein7gene, rice glutelin gene, rice oryzin gene, rice prolamin gene, wheat gliadin gene, wheat glutelin gene, maize zein gene, oat glutelin gene, Sorghum kasirin-gene and rye secalin gene).
[0103] Also especially suited are promoters ,that confer plastid-specific gene expression since plastids are the compartment where lipid biosynthesis occurs.
Suitable promoters are the viral RNA-polymerase promoter described in PCT Application No. WO
95/16783 and PCT Application No. WO 97/06250 and the clpP-promoter from Arabidopsis described in PCT Application No. WO 99/46394.
[0104] The invention further provides a recombinant expression vector comprising a PKSRP DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner that allows for expression (by transcription of the DNA molecule) of an RNA
molecule that is antisense to a.PKSRP mRNA. Regulatory sequences operatively linked to a nucleic acid molecule cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types. For instance, viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus wherein antisense nucleic acids are produced under the control of a high efficiency regulatory region. The activity of the regulatory region can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986 and Mol et al., 1990 FEBS Lefters 268:427-430.
[0105] Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell"
and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but they also apply to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0106] A host cell can be any prokaryotic or eukaryotic cell. For example, a PKSRP
can be expressed in bacterial cells such as C. glutamicum, insect cells, fungal cells or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells), algae, ciliates, plant cells, fungi or other microorganisms like C. glutamicum. Other suitable host cells are known to those skilled in the art.
[0107] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation", "transfection", "conjugation" and "transduction" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, chemical-mediated transfer and electroporation. Suitable methods for transforming or transfecting host cells including plant cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2n1, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and other laboratory manuals such as Methods in Molecular Biology, 1995, Vol.
44, Agrobacterium protocols, ed: Gartland and Davey, Humana Press, Totowa, New Jersey.
As biotic and abiotic stress tolerance is a general trait wished to be inherited into a wide variety of plants like maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed and canola, manihot, pepper, sunflower and tagetes, solanaceous plants like potato, tobacco, eggplant, and tomato, Vicia species, pea, alfalfa, bushy plants (coffee, cacao, tea), Salix species, trees (oil palm, coconut), perennial grasses and forage crops, these crop plants are also preferred target plants for a genetic engineering as one further embodiment of the present invention.
[0108] In particular, the invention provides a method of producing a transgenic plant with a PKSRP coding nucleic acid, wherein expression of the nucleic acid(s) in the plant results in increased tolerance to environmental stress as compared to a wild type variety of the plant comprising: (a) transforming a plant cell with an expression vector comprising a PKSRP nucleic acid, and (b) generating from the plant cell a transgenic plant with a increased tolerance to environmental stress as compared to a wild type variety of the plant.
The invention also provides a method of increasing expression of a gene of interest within a host cell as compared to a wild type variety of the host cell, wherein the gene of interest is transcribed in response to a PKSRP, comprising: (a) transforming the host cell with an expression vector comprising a PKSRP coding nucleic acid, and (b) expressing the PKSRP
within the host cell, thereby increasing the expression of the gene transcribed in response to the PKSRP, as compared to a wild type variety of the host cell.
[0109] For such plant transformation, binary vectors such as pBinAR can be used (Hofgen and Willmitzer, 1990 Plant Science 66:221-230). Construction of the binary vectors can be performed by ligation of the cDNA in sense or antisense orientation into the T-DNA.
5-prime to the cDNA a plant promoter activates transcription of the cDNA. A
polyadenylation sequence is located 3-prime to the cDNA. Tissue-specific expression can be achieved by using a tissue specific promoter. For example, seed-specific expression can be achieved by cloning the napin or LeB4 or USP promoter 5-prime to the cDNA.
Also, any other seed specific promoter element can be used. For constitutive expression within the whole plant, the CaMV 35S promoter can be used. The expressed protein can be targeted to a cellular compartment using a signal peptide, for example for plastids, mitochondria or endoplasmic reticulum (Kermode, 1996 Crit. Rev. Plant Sci. 4(15):285-423). The signal peptide is cloned 5-prime in frame to the cDNA to archive subcellular localization of the fusion protein. Additionally, promoters that are responsive to abiotic stresses can be used with, such as the Arabidopsis promoter RD29A, the nucleic acid sequences disclosed herein.
One skilled in the art will recognize that the promoter used should be operatively linked to the nucleic acid such that the promoter causes transcription of the nucleic acid which results in the synthesis of a mRNA which encodes a polypeptide. Alternatively, the RNA
can be an antisense RNA for use in affecting subsequent expression of the same or another gene or genes.
[0110] Alternate methods of transfection include the direct transfer of DNA
into developing flowers via electroporation or Agrobacterium mediated gene transfer.
Agrobacterium mediated plant transformation can be performed using for example the GV3101(pMP90) (Koncz and Schell, 1986 Mol. Gen. Genet. 204:383-396) or LBA4404 (Clontech) Agrobacterium tumefaciens strain. Transformation can be performed by standard transformation and regeneration techniques (Deblaere et al., 1994 Nucl. Acids.
Res. 13:4777-4788; Gelvin, Stanton B. and Schilperoort, Robert A, Plant Molecular Biology Manual, 2"
Ed. - Dordrecht : Kluwer Academic Pub!., 1995. - in Sect., Ringbuc Zentrale Signatur: BT11-P ISBN 0-7923-2731-4; Glick, Bernard R.; Thompson, John E., Methods in Plant Molecular Biology and Biotechnology, Boca Raton: CRC Press, 1993. - 360 S., ISBN 0-8493-5164-2).
For example, rapeseed can be transformed via cotyledon or hypocotyl transformation (Moloney et al., 1989 Plant cell Report 8:238-242; De Block et al., 1989 Plant Physiol.
91:694-701). Use of antibiotica for Agrobacterium and plant selection depends on the binary vector and the Agrobacterium strain used for transformation. Rapeseed selection is normally performed using kanamycin as selectable plant marker. Agrobacterium mediated gene transfer to flax can be performed using, for example, a technique described by Mlynarova et al., 1994 Plant Cell Report 13:282-285. Additionally, transformation of soybean can be performed using for example a technique described in European Patent No. 0424 047, U.S.
Patent No. 5,322,783, European Patent No. 0397 687, U.S. Patent No. 5,376,543 or U.S.
Patent No. 5,169,770. Transformation of maize can be achieved by particle bombardment, polyethylene glycol mediated DNA uptake or via the silicon carbide fiber technique. (See, for example, Freeling and Walbot "The maize handbook" Springer Verlag: New York (1993) ISBN 3-540-97826-7). A specific example of maize transformation is found in U.S. Patent No. 5,990,387 and a specific example of wheat transformation can be found in PCT
Application No. WO 93/07256.
[01111 For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate or in plants that confer resistance towards a herbicide such as glypho sate or glufosinate.
Nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a PKSRP or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid molecule can be identified by, for example, drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
[0112] To create a homologous recombinant microorganism, a vector is prepared which contains at least a portion of a PKSRP gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the PKSRP gene.
Preferably, the PKSRP gene is a Physcomitrella patens PKSRP gene, but it can be a homolog from a related plant or even from a mammalian, yeast, or insect source. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous PKSRP gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a knock-out vector). Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous PKSRP gene is mutated or otherwise altered but still encodes a functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous PKSRP). To create a point mutation via homologous recombination, DNA-RNA hybrids can be used in a technique known as chimeraplasty (Cole-Strauss et al., 1999 Nucleic Acids Research 27(5):1323-1330 and Kmiec, 1999 Gene therapy American Scientist. 87(3):240-247). Homologous recombination procedures in Physcomitrella patens are also well known in the art and are contemplated for use herein.
[0113] Whereas in the homologous recombination vector, the altered portion of the PKSRP gene is flanked at its 5' and 3' ends by an additional nucleic acid molecule of the PKSRP gene to allow for homologous recombination to occur between the exogenous PKSRP gene carried by the vector and an endogenous PKSRP gene, in a microorganism or plant. The additional flanking PKSRP nucleic acid molecule is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several hundreds of base pairs up to kilobases of flanking DNA (both at the 5' and 3' ends) are included in the vector (see e.g., Thomas, K.R., and Capecchi, M.R., 1987 Cell 51:503 for a description of homologous recombination vectors or Strepp et al., 1998 PNAS, 95 (8):4368-4373 for cDNA based recombination in Physcomitrella patens). The vector is introduced into a microorganism or plant cell (e.g., via polyethylene glycol mediated DNA), and cells in which the introduced PKSRP gene has homologously recombined with the endogenous PKSRP gene are selected using art-known techniques.
[0114] In another embodiment, recombinant microorganisms can be produced that contain selected systems which allow for regulated expression of the introduced gene. For example, inclusion of a PKSRP gene on a vector placing it under control of the lac operon permits expression of the PKSRP gene only in the presence of IPTG. Such regulatory systems are well known in the art.
[0115] A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) a PKSRP. Accordingly, the invention further provides methods for producing PKSRPs using the host cells of the invention.
In. one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding a PKSRP has been introduced, or into which genome has been introduced a gene encoding a wild-type or altered PKSRP ) in a suitable medium until PKSRP is produced. In another embodiment, the method further comprises isolating PKSRPs from the medium or the host cell.
[0116] Another aspect of the invention pertains to isolated PKSRPs, and biologically active portions thereof. An "isolated" or "purified" protein or biologically active portion thereof is free of some of the cellular material when produced by recombinant DNA
techniques, or chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of PKSRP in which the protein is separated from some of the cellular components of the cells in which it is naturally or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of a PKSRP having less than about 30%
(by dry weight) of non-PKSRP material (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-PKSRP material, still more preferably less than about 10% of non-PKSRP material, and most preferably less than about 5% non-PKSRP
material.
[01171 When the PKSRP or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation. The language "substantially free of chemical precursors or other chemicals" includes preparations of PKSRP in which the protein is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. In one embodiment, the language "substantially free of chemical precursors or other chemicals" includes preparations of a PKSRP having less than about 30%
(by dry weight) of chemical precursors or non-PKSRP chemicals, more preferably less than about 20% chemical precursors or non-PKSRP chemicals, still more preferably less than about 10% chemical precursors or non-PKSRP chemicals, and most preferably less than about 5% chemical precursors or non-PKSRP chemicals. In preferred embodiments, isolated proteins, or biologically active portions thereof, lack contaminating proteins from the same organism from which the PKSRP is derived. Typically, such proteins are produced by recombinant expression of, for example, a Physcomitrella patens PKSRP in plants other than Physcomitrella patens or microorganisms such as C. glutamicum, ciliates, algae or fungi.
[0118] The nucleic acid molecules, proteins, protein homologs, fusion proteins, primers, vectors, and host cells described herein can be used in one or more of the following methods: identification of Physcomitrella patens and related organisms;
mapping of genomes of organisms related to Physcomitrella patens; identification and localization of Physcomitrella patens sequences of interest; evolutionary studies;
determination of PKSRP
regions required for function; modulation of a PKSRP activity; modulation of the metabolism of one or more cell functions; modulation of the transmembrane transport of one or more compounds; and modulation of stress resistance.
[0119] The moss Physcomitrella patens represents one member of the mosses. It is related to other mosses such as Ceratodon purpureus which is capable of growth in the absence of light. Mosses like Ceratodon and Physcomitrella share a high degree of homology on the DNA sequence and polypeptide level allowing the use of heterologous screening of DNA molecules with probes evolving from other mosses or organisms, thus enabling the derivation of a consensus sequence suitable for heterologous screening or functional annotation and prediction of gene functions in third species. The ability to identify such functions can therefore have significant relevance, e.g., prediction of substrate specificity of enzymes. Further, these nucleic acid molecules may serve as reference points for the mapping of moss genomes, or of genomes of related organisms.
[0120] The PKSRP nucleic acid molecules of the invention have a variety of uses.
Most importantly, the nucleic acid and amino acid sequences of the present invention can be used to transform plants, thereby inducing tolerance to stresses such as drought, high salinity and cold. The present invention therefore provides a transgenic plant transformed by a PKSRP nucleic acid (coding or antisense), wherein expression of the nucleic acid sequence in the plant results in increased tolerance to environmental stress as compared to a wild type variety of the plant. The transgenic plant can be a monocot or a dicot. The invention further provides that the transgenic plant can be selected from maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut, perennial grass and forage crops, for example.
[0121] In particular, the present invention describes using the expression of PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-of Physcomitrella patens to engineer drought-tolerant, salt-tolerant and/or cold-tolerant plants. This strategy has herein been demonstrated for Arabidopsis thaliana, Rapeseed/Canola, soybeans, corn and wheat but its application is not restricted to these plants. Accordingly, the invention provides a transgenic plant containing a PKSRP selected from PK-6 (SEQ ID NO:27), PK-7 (SEQ ID NO:28), PK-8 (SEQ ID NO:29), PK-9 (SEQ
ID
NO:30), CK-1 (SEQ ID NO:31), CK-2 (SEQ ID NO:32), CK-3 (SEQ ID NO:33), MPK-2 (SEQ ID NO:34), MPK-3 (SEQ ID NO:35), MPK-4 (SEQ ID NO:36), MPK-5 (SEQ ID
NO:37), CPK-1 (SEQ ID NO:38) and CPK-2 (SEQ ID NO:39), wherein the environmental stress is drought, increased salt or decreased or increased temperature. In preferred embodiments, the environmental stress is drought or decreased temperature.
[0122] The present invention also provides methods of modifying stress tolerance of a plant comprising, modifying the expression of a PKSRP in the plant. The invention provides that this method can be performed such that the stress tolerance is either increased or decreased. In particular, the present invention provides methods of producing a transgenic plant having an increased tolerance to environmental stress as compared to a wild type variety of the plant comprising increasing expression of a PKSRP in a plant.

[0123] The methods of increasing expression of PKSRPs can be used wherein the plant is either transgenic or not transgenic. In cases when the plant is transgenic, the plant can be transformed with a vector containing any of the above described PKSRP
coding nucleic acids, or the plant can be transformed with a promoter that directs expression of native PKSRP in the plant, for example. The invention provides that such a promoter can be tissue specific. Furthermore, such a promoter can be developmentally regulated.
Alternatively, non-transgenic plants can have native PKSRP expression modified by inducing a native promoter.
[0124] The expression of PK-6 (SEQ ID NO:14), PK-7 (SEQ ID NO:15), PK-8 (SEQ
ID NO:16), PK-9 (SEQ ID NO:17), CK-1 (SEQ ID NO:18), CK-2 (SEQ ID NO:19), CK-3 (SEQ ID NO:20), MPK-2 (SEQ ID NO:21), MPK-3 (SEQ ID NO:22), MPK-4 (SEQ ID
NO:23), MPK-5 (SEQ ID NO:24), CPK-1 (SEQ ID NO:25) and CPK-2 (SEQ ID NO:26) in target plants can be accomplished by, but is not limited to, one of the following examples: (a) constitutive promoter, (b) stress-inducible promoter, (c) chemical-induced promoter, and (d) engineered promoter over-expression with for example zinc-finger derived transcription factors (Greisman and Pabo, 1997 Science 275:657). The later case involves identification of the PK-6 (SEQ ID NO:27), PK-7 (SEQ ID NO:28), PK-8 (SEQ ID NO:29), PK-9 (SEQ
ID
NO:30), CK-1 (SEQ ID NO:31), CK-2 (SEQ ID NO:32), CK-3 (SEQ ID NO:33), MPK-2 (SEQ ID NO:34), MPK-3 (SEQ ID NO:35), MPK-4 (SEQ ID NO:36), MPK-5 (SEQ ID
NO:37), CPK-1 (SEQ ID NO:38) or CPK-2 (SEQ ID NO:39) homologs in the target plant as well as from its promoter. Zinc-finger-containing recombinant transcription factors are engineered to specifically interact with the PK-6 (SEQ ID NO:27), PK-7 (SEQ JD
NO:28), PK-8 (SEQ ID NO:29), PK-9 (SEQ ID NO:30), CK-1 (SEQ ID NO:31), CK-2 (SEQ ID
NO:32), CK-3 (SEQ ID NO:33), MPK-2 (SEQ ID NO:34), MPK-3 (SEQ ID NO:35), MPK-4 (SEQ ID NO:36), MPK-5 (SEQ ID NO:37), CPK-1 (SEQ ID NO:38) or CPK-2 (SEQ ID
NO:39) homolog and transcription of the corresponding gene is activated.
[0125] In addition to introducing the PKSRP nucleic acid sequences into transgenic plants, these sequences can also be used to identify an organism as being Physcomitrella patens or a close relative thereof. Also, they may be used to identify the presence of Physcomitrella patens or a relative thereof in a mixed population of microorganisms. The invention provides the nucleic acid sequences of a number of Physcomitrella patens genes;
by probing the extracted genomic DNA of a culture of a unique or mixed population of microorganisms under stringent conditions with a probe spanning a region of a Physcomitrella patens gene which is unique to this organism, one can ascertain whether this organism is present.
[0126] Further, the nucleic acid and protein molecules of the invention may serve as markers for specific regions of the genome. This has utility not only in the mapping of the genome, but also in functional studies of Physcomitrella patens proteins. For example, to identify the region of the genome to which a particular Physcomitrella patens DNA-binding protein binds, the Physcomitrella patens genome could be digested, and the fragments incubated with the DNA-binding protein. Those fragments that bind the protein may be additionally probed with the nucleic acid molecules of the invention, preferably with readily detectable labels. Binding of such a nucleic acid molecule to the genome fragment enables the localization of the fragment to the genome map of Physcomitrella patens, and, when performed multiple times with different enzymes, facilitates a rapid determination of the nucleic acid sequence to which the protein binds. Further, the nucleic acid molecules of the invention may be sufficiently homologous to the sequences of related species such that these nucleic acid molecules may serve as markers for the construction of a genomic map in related mosses.
[0127] The PKSRP nucleic acid molecules of the invention are also useful for evolutionary and protein structural studies. The metabolic and transport processes in which the molecules of the invention participate are utilized by a wide variety of prokaryotic and eukaryotic cells; by comparing the sequences of the nucleic acid molecules of the present invention to those encoding similar enzymes from other organisms, the evolutionary relatedness of the organisms can be assessed. Similarly, such a comparison permits an assessment of which regions of the sequence are conserved and which are not, which may aid in determining those regions of the protein that are essential for the functioning of the enzyme. This type of determination is of value for protein engineering studies and may give an indication of what the protein can tolerate in terms of mutagenesis without losing function.
[0128] Manipulation of the PKSRP nucleic acid molecules of the invention may result in the production of PKSRPs having functional differences from the wild-type PKSRPs. These proteins may be improved in efficiency or activity, may be present in greater numbers in the cell than is usual, or may be decreased in efficiency or activity.
[0129] There are a number of mechanisms by which the alteration of a PKSRP of the invention may directly affect stress response and/or stress tolerance. In the case of plants expressing PKSRPs, increased transport can lead to improved salt and/or solute partitioning within the plant tissue and organs. By either increasing the number or the activity of transporter molecules which export ionic molecules from the cell, it may be possible to affect the salt tolerance of the cell.
[0130] The effect of the genetic modification in plants, C. glutamicum, fungi, algae, or ciliates on stress tolerance can be assessed by growing the modified microorganism or plant under less than suitable conditions and then analyzing the growth characteristics and/or metabolism of the plant. Such analysis techniques are well known to one skilled in the art, and include dry weight, wet weight, protein synthesis, carbohydrate synthesis, lipid synthesis, evapotranspiration rates, general plant and/or crop yield, flowering, reproduction, seed setting, root growth, respiration rates, photosynthesis rates, etc.
(Applications of ITPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17;
Rehm et al., 1993 Biotechnology, vol. 3, Chapter DI Product recovery and purification, page 469-714, VCH: Weinheim; Beller, P.A. et al., 1988 Bioseparations: downstream processing for biotechnology, John Wiley and Sons; Kennedy, J.F. and Cabral, J.M.S., 1992 Recovery processes for biological materials, John Wiley and Sons; Shaeiwitz, J.A. and Henry, J.D., 1988 Biochemical separations, in: Ulmann's Encyclopedia of Industrial Chemistry, vol. B3, Chapter 11, page 1-27, VCH: Weinheim; and Dechow, F.J. (1989) Separation and purification techniques in biotechnology, Noyes Publications).
[0131] For example, yeast expression vectors comprising the nucleic acids disclosed herein, or fragments thereof, can be constructed and transformed into Saccharomyces cerevisiae using standard protocols. The resulting transgenic cells can then be assayed for fail or alteration of their tolerance to drought, salt, and temperature stress.
Similarly, plant expression vectors comprising the nucleic acids disclosed herein, or fragments thereof, can be constructed and transformed into an appropriate plant cell such as Arabidopsis, soy, rape, maize, wheat, Medicago truncatula, etc., using standard protocols. The resulting transgenic cells and/or plants derived there from can then be assayed for fail or alteration of their tolerance to drought, salt, and temperature stress.
[0132] The engineering of one or more PKSRP genes of the invention may also result in PKSRPs having altered activities which indirectly impact the stress response and/or stress tolerance of algae, plants, ciliates or fungi or other microorganisms like C.
glutamicum. For example, the normal biochemical processes of metabolism result in the production of a variety of products (e.g., hydrogen peroxide and other reactive oxygen species) which may actively interfere with these same metabolic processes (for example, peroxpitrite is known to nitrate tyrosine side chains, thereby inactivating some enzymes having tyrosine in the active site (Groves, J.T., 1999 Curr. Opin. Chem. Biol. 3(2):226-235). While these products are typically excreted, cells can be genetically altered to transport more products than is typical for a wild-type cell. By optimizing the activity of one or more PKSRPs of the invention which are involved in the export of specific molecules, such as salt molecules, it may be possible to improve the stress tolerance of the cell.
[0133] Additionally, the sequences disclosed herein, or fragments thereof, can be used to generate knockout mutations in the genomes of various organisms, such as bacteria, mammalian cells, yeast cells, and plant cells (Girke, T., 1998 The Plant Journal 15:39-48).
The resultant knockout cells can then be evaluated for their ability or capacity to tolerate various stress conditions, their response to various stress conditions, and the effect on the phenotype and/or genotype of the mutation. For other methods of gene inactivation see U.S.
Patent No. 6004804 "Non-Chimeric Mutational Vectors" and Puttaraju et al., Spliceosome-mediated RNA trans-splicing as a tool for gene therapy Nature Biotechnology 17:246-252.
[0134] The aforementioned mutagenesis strategies for PKSRPs resulting in increased stress resistance are not meant to be limiting; variations on these strategies will be readily apparent to one skilled in the art. Using such strategies, and incorporating the mechanisms disclosed herein, the nucleic acid and protein molecules of the invention may be utilized to generate algae, ciliates, plants, fungi or other microorganisms like C.
glutamicum expressing mutated PKSRP nucleic acid and protein molecules such that the stress tolerance is improved.
[0135] The present invention also provides antibodies that specifically bind to a PKSRP, or a portion thereof, as encoded by a nucleic acid described herein.
Antibodies can be made by many well-known methods (See, e.g. Harlow and Lane, "Antibodies; A
Laboratory Manual" Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1988)). Briefly, purified antigen can be injected into an animal in an amount and in intervals sufficient to elicit an immune response. Antibodies can either be purified directly, or spleen cells can be obtained from the animal. The cells can then fused with an immortal cell line and screened for antibody secretion. The antibodies can be used to screen nucleic acid clone libraries for cells secreting the antigen. Those positive clones can then be sequenced. (See, for example, Kelly et al., 1992 Bio/Technology 10:163-167; Bebbington et al., Bio/Technology 10:169-175).
[0136] The phrases "selectively binds" and "specifically binds" with the polypeptide refer to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated .. immunoassay conditions, the specified antibodies bound to a particular protein do not bind in a significant amount to other proteins present in the sample. Selective binding of an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. A variety of immunoassay formats may be used to select antibodies that selectively bind with a particular protein. For example, solid-phase ELISA
immunoassays are routinely used to select antibodies selectively immunoreactive with a protein. See Harlow and Lane "Antibodies, A Laboratory Manual" Cold Spring Harbor Publications, New York, (1988), for a description of immunoassay formats and conditions that could be used to determine selective binding.
[0137] In some instances, it is desirable to prepare monoclonal antibodies from various hosts. A description of techniques for preparing such monoclonal antibodies may be found in Stites et al., editors, "Basic and Clinical Immunology," (Lange Medical Publications, Los Altos, Calif., Fourth Edition) and references cited therein, and in Harlow and Lane ("Antibodies, A Laboratory Manual" Cold Spring Harbor Publications, New York, 1988).
[0138] Throughout this application, various publications are referenced.
The disclosures of all of these publications and those references cited within those publications in their entireties may be referred to for further details in this application in order to more fully describe the state of the art to which this invention pertains.
[0139] It should also be understood that the foregoing relates to preferred embodiments of the present invention and that numerous changes may be made therein without departing from the scope of the invention. The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations upon the scope thereof. On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof, which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims.
EXAMPLES
Example 1 Growth of Physcomitrella patens cultures [0140] For this study, plants of the species Physcomitrella patens (Hedw.) B.S.G.
from the collection of the genetic studies section of the University of Hamburg were used.

They originate from the strain 16/14 collected by H.L.K. Whitehouse in Gransden Wood, Huntingdonshire (England), which was subcultured from a spore by Engel (1968, Am. J. Bot.
55, 438-446). Proliferation of the plants was carried out by means of spores and by means of regeneration of the gametophytes. The protonema developed from the haploid spore as a chloroplast-rich chloronema and chloroplast-low caulonema, on which buds formed after approximately 12 days. These grew to give gametophores bearing antheridia and archegonia.
After fertilization, the diploid sporophyte with a short seta and the spore capsule resulted, in which the meio spores matured.
[0141] Culturing was carried out in a climatic chamber at an air temperature of 25 C
and light intensity of 55 micromols-1m2 (white light; Philips TL 65W/25 fluorescent tube) and a light/dark change of 16/8 hours. The moss was either modified in liquid culture using Knop medium according to Reski and Abel (1985, Planta 165:354-358) or cultured on Knop solid medium using 1% oxoid agar (Unipath, Basingstoke, England). The protonemas used for RNA and DNA isolation were cultured in aerated liquid cultures. The protonemas were comminuted every 9 days and transferred to fresh culture medium.

Example 2 Total DNA isolation from plants [0142] The details for the isolation of total DNA relate to the working up of one gram fresh weight of plant material. The materials used include the following buffers: CTAB
buffer: 2% (w/v) N-cethyl-N,N,N-timethylammonium bromide (CTAB); 100 mM Tris pH 8.0; 1.4 M NaCl; 20 mM EDTA; N-Laurylsarcosine buffer: 10% (w/v) N-lattylsarcosine;
100 mM Tris HC1 pH 8.0; 20 mM EDTA.
[0143] The plant material was triturated under liquid nitrogen in a mortar to give a fine powder and transferred to 2 ml Eppendorf vessels. The frozen plant material was then covered with a layer of 1 ml of decomposition buffer (1 ml CTAB buffer, 100 ill of N-laurylsarco sine buffer, 20 pl of P-mercaptoethanol and 10 1 of proteinase K
solution, 10 mg/m1) and incubated at 60 C for one hour with continuous shaking. The homogenate obtained was distributed into two Eppendorf vessels (2 ml) and extracted twice by shaking with the same volume of chlorofolin/isoamyl alcohol (24:1). For phase separation, centrifugation was carried out at 8000 x g and room temperature for 15 minutes in each case.
The DNA was then precipitated at -70 C for 30 minutes using ice-cold isopropanol. The precipitated DNA was sedimented at 4 C and 10,000 g for 30 minutes and resuspended in 180 !al of TB buffer (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6). For further purification, the DNA was treated with NaC1 (1.2 M
final concentration) and precipitated again at -70 C for 30 minutes using twice the volume of absolute ethanol. After a washing step with 70% ethanol, the DNA was dried and subsequently taken up in 50 gl of H20 + RNAse (50 mg/ml final concentration).
The DNA
was dissolved overnight at 4 C and the RNAse digestion was subsequently carried out at 37 C for 1 hour. Storage of the DNA took place at 4 C.

Example 3 Isolation of total RNA and poly-(A)+ RNA and cDNA libraly construction from Physcomitrella patens 101441 For the investigation of transcripts, both total RNA and poly-(A)+ RNA
were isolated. The total RNA was obtained from wild-type 9 day old protonemata following the GTC-method (Reski et al. 1994, Mol. Gen. Genet., 244:352-359). The Poly(A)+
RNA was isolated using Dyna BeadsR (Dynal, Oslo, Norway) following the instructions of the manufacturers protocol. After determination of the concentration of the RNA or of the poly(A)+ RNA, the RNA was precipitated by addition of 1/10 volumes of 3 M
sodium acetate pH 4.6 and 2 volumes of ethanol and stored at -70 C.
[0145] For cDNA library construction, first strand synthesis was achieved using Murine Leukemia Virus reverse transcriptase (Roche, Mannheim, Germany) and oligo-d(T)-primers, second strand synthesis by incubation with DNA polymerase I, Klenow enzyme and RNAseH digestion at 12 C (2 hours), 16 C (1 hour) and 22 C (1 hour). The reaction was stopped by incubation at 65 C (10 minutes) and subsequently transferred to ice. Double stranded DNA molecules were blunted by T4-DNA-polymerase (Roche, Mannheim) at (30 minutes). Nucleotides were removed by phenol/chloroform extraction and Sephadex G50 spin columns. EcoRI adapters (Pharmacia, Freiburg, Germany) were ligated to the cDNA
ends by T4-DNA-ligase (Roche, 12 C, overnight) and phosphorylated by incubation with polynucleotide kinase (Roche, 37 C, 30 minutes). This mixture was subjected to separation on a low melting agarose gel. DNA molecules larger than 300 base pairs were eluted from the gel, phenol extracted, concentrated on Elutip-D-columns (Schleicher and Schuell, Dassel, Germany) and were ligated to vector arms and packed into lambda ZAPII phages or lambda ZAP-Express phages using the Gigapack Gold Kit (Stratagene, Amsterdam, Netherlands) using material and following the instructions of the manufacturer.

Example 4 Sequencing and function annotation of Physcomitrella patens ESTs [0146] cDNA libraries as described in Example 3 were used for DNA sequencing according to standard methods, and in particular, by the chain termination method using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer, Weiterstadt, Germany). Random Sequencing was carried out subsequent to preparative plasmid recovery from cDNA libraries via in vivo mass excision, retransformation, and subsequent plating of DH1OB on agar plates (material and protocol details from Stratagene, Amsterdam, Netherlands. Plasmid DNA was prepared from overnight grown E. coli cultures grown in Luria-Broth medium containing ampicillin (see Sambrook et al. 1989 Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6) on a Qiagene DNA preparation robot (Qiagen, Hilden) according to the manufacturer's protocols. Sequencing primers with the following nucleotide sequences were used:

'-CAGGAAACAGCTATGACC-3 ' SEQ ID NO:40 5 '-CTAAAGGGAACAAAAGCTG-3 ' SEQ ID NO:41 5 '-TGTAAAACGACGGCCAGT-3 ' SEQ ID NO:42 [0147] Sequences were processed and annotated using the software package EST-MAX commercially provided by Bio-Max (Munich, Germany). The program incorporates practically all bioinformatics methods important for functional and structural characterization of protein sequences. For reference the website at pedant.mips.biochem.mpg.de.
The most important algorithms incorporated in EST-MAX are: FASTA: Very sensitive sequence database searches with estimates of statistical significance; Pearson W.R.
(1990) Rapid and sensitive sequence comparison with FASTP and FASTA. Methods Enzymol. 183:63-98;
BLAST: Very sensitive sequence database searches with estimates of statistical significance.
Altschul S.F., Gish W., Miller W., Myers E.W., and Lipman D.J. Basic local alignment search tool. Journal of Molecular Biology 215:403-10; PREDATOR: High-accuracy secondary structure prediction from single and multiple sequences. Frishman, D. and Argos, P. (1997) 75% accuracy in protein secondary structure prediction. Proteins, 27:329-335;
CLUSTALW: Multiple sequence alignment. Thompson, J.D., Higgins, D.G. and Gibson, T.J.
(1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Research, 22:4673-4680; TMAP: Transmembrane region prediction from multiply aligned sequences. Persson, B. and Argos, P. (1994) Prediction of transmembrane segments in proteins utilizing multiple sequence alignments. J. Mol. Biol.
237:182-192;

ALOM2: Transmembrane region prediction from single sequences. Klein, P., Kanehisa, M., and DeLisi, C. Prediction of protein function from sequence properties: A
discriminate analysis of a database. Biochim. Biophys. Acta 787:221-226 (1984). Version 2 by Dr. K.

Nakai; PROSEARCH: Detection of PROSITE protein sequence patterns. Kolakowski L.F.

Jr., Leunissen J.A.M., Smith J.E. (1992) ProSearch: fast searching of protein sequences with regular expression patterns related to protein structure and function.
Biotechniques 13, 919-921; BLIMPS: Similarity searches against a database of ungapped blocks. J.C.
Wallace and Henikoff S., (1992); PATMAT: A searching and extraction program for sequence, pattern and block queries and databases, CABIOS 8:249-254. Written by Bill Alford.

Example 5 Identification of Physcomitrella patens ORFs corresponding to PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 [0148] The Physcomitrella patens partial cDNAs (ESTs) shown in Table 1 below were identified in the Physcomitrella patens EST sequencing program using the program EST-MAX through BLAST analysis. The Sequence Identification Numbers corresponding to these ESTs are as follows: PK-6 (SEQ ID NO:1), PK-7 (SEQ ID NO:2), PK-8 (SEQ
ID

NO:3), PK-9 (SEQ ID NO:4), CK-1 (SEQ ID NO:5), CK-2 (SEQ ID NO:6), CK-3 (SEQ
ID

NO:7), MPK-2 (SEQ ID NO:8), M1PK-3 (SEQ ID NO:9), MPK-4 (SEQ ID NO:10), MPK-5 (SEQ ID NO:11), CPK-1 (SEQ ID NO:12) and CPK-2 (SEQ ID NO:13).

Table 1 Name Functional Function Sequence code ORF
categories position PpPK-6 Protein Kinase serine/threonine protein c_pp004044242r 1-474 kinase like protein PpPK-7 Protein Kinase cdc2-like protein kinase s_pp001031042f 1-267 cdc2MsF
PpPK-8 Protein Kinase protein kinase homolog c_pp004044100r 1-581 Fl3C5.120 PpPK-9 Protein Kinase protein kinase; similar to c_pp004071077r 709-137 human PKX1 PpCK-1 Protein Kinase receptor protein kinase c_pp001062017r 1160-1 PpCK-2 Protein Kinase kasein kinase c_pp004038371r 1909-1421 PpCK-3 Protein Kinase casein kinase II catalytic c_pp004076164r 2-877 -----subunit PpMPK-2 Protein Kinase mitogen-activated protein c_pp004041329r 952-293 kinase 6 PpMPK-3 Protein Kinase big MAP kinase lc c_pp004061263r 221-550 PpMPK-4 Protein Kinase protein kinase MEK1 (EC c_pp001064077r 1153-596 2.7.1.-) PpMPK-5 Protein Kinase protein kinase MEK1 c_pp004064129r 114-233 PpCPK-1 Protein Kinase protein kinase c_pp004014376r 1084-173 PpCPK-2 Protein Kinase calcium-dependent protein c_pp004038141r 422-1213 kinase PpPK-6 Protein Kinase cdc2-like protein kinase s_pp001031042f 1-267 cdc2MsF

Table 2 [0149] Degree of Amino Acid Identity and Similarity of PpPK-6 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:

0.1; score matrix: blosum62) Swiss-Prot # 081106 Q9LUL4 Q9ZQZ2 Q9MAS2 Q9LK66 Protein LEUCINE- SERINE/TH PUTATIVE PUTATIVE PROTEIN
name RICH REONINE LRR LRR KINASE-REPEAT PROTEIN RECEPTOR- RECEPTOR LIKE
TRANSME KINASE- LINKED PROTEIN PROTEIN
MBRANE LIKE PROTEIN KINASE
PROTEIN PROTEIN KINASE

Species Zea mays Arabidopsis Arabidopsis Arabidopsis Arabidopsis (Maize) thaliana thaliana thaliana thaliana (Mouse-ear (Mouse-ear (Mouse-ear (Mouse-ear cress) cress) cress) cress) Identity % 42% 42% 38% 37% 37%
Similarity % 54% 52% 50% 49% 48%

Table 3 [0150] Degree of Amino Acid Identity and Similarity of PpPK-7 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) Swiss-Prot # P25859 049120 Q38774 P93321 Q9ZVI4 Protein CELL CYCLIN- CELL CDC2 PUTATIVE
name DIVISION DEPENDENT DIVISION KINASE SERINE/THRE

Species Arabidopsis Dunaliella Antirrhinum Medicago Arabidopsis thaliana tertiolecta majus sativa thaliana (Mouse-ear (Garden (Alfalfa) (Mouse-ear cress) snapdragon) cress) Identity % 70% 68% 70% 69% 69%
Similarity % 79% 76% 81% 79% 77%

Table 4 [0151] Degree of Amino Acid Identity and Similarity of PpPK-8 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) Swiss-Prot # 082754 Q9M085 Q02779 Q05609 Q39886 Protein PUTATIVE PROTEIN MITOGEN- SERINE/THRE PROTEIN
name SERINE/THR KINASE- ACTIVATED NINE- KINASE
EONINE LIKE PROTEIN PROTEIN

KINASE

Species Arabidopsis Arabidopsis Homo sapiens Arabidopsis Glycine thaliana thaliana (Human) thaliana max (Mouse-ear (Mouse-ear (Mouse-ear (Soybean) cress) cress) cress) Identity % 25% 26% 27% 27% 26%
Similarity % 42% 40% 38% 40% 40%

Table 5 [0152] Degree of Amino Acid Identity and Similarity of PpPK-9 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:

0.1; score matrix: blosum62) Swiss-Prot # Q9SL77 P34099 Q9DCB8 P40376 Q9SXP9 Protein PUTATIVE CAMP- SERINE/ CAMP- CAMP-name CAMP- DEPENDEN THREON DEPENDENT DEPENDEN
DEPENDEN T PROTEIN INE PROTEIN T PROTEIN
T PROTEIN KINASE PROTEIN KINASE KINASE
KINASE CATALYTI KINASE CATALYTIC CATALYTI
C SUBUNIT SUBUNIT C SUBUNIT
Species Arabidopsis Dictyosteliu Dictyostel Schizosaccharo Euglena thaliana = m ium myces pombe gracilis (Mouse-ear discoideum (Fission yeast) -cress) (Slime mold) Identity % 45% 33% 32% 33% 28%
Similarity % 60% 48% 48% 50% 40%

Table 6 [0153] Degree of Amino Acid Identity and Similarity of PpCK-1 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:

0.1; score matrix: blosum62) Swiss-Prot # Q9SZI1 Q9ZUP4 P42158 Q9LW62 Q39050 Protein COL-0 PUTATIVE CASEIN. CASEIN CASEIN
name CASEIN CASEIN KINASE I, KINASE KINASE I

LIKE ISOFORM
PROTEIN LIKE
Species Arabidopsis Arabidopsis Arabidopsis Arabidopsis Arabidopsis thaliana thaliana thaliana thaliana thaliana (Mouse-ear (Mouse-ear (Mouse-ear (Mouse-ear (Mouse-ear cress) cress) cress) cress) cress) Identity % 49% 48% 48% 46% 40%
Similarity % 62% 61% 61% 58% 52%

Table 7 [0154] Degree of Amino Acid Identity and Similarity of PpCK-2 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:

0.1; score matrix: blosum62) Swiss-Prot # Q9SZI1 P42158 Q9ZWB3 Q9ZUP4 Q9LSX4 Protein COL-0 CASEIN ADK1 PUTATIVE CASEIN.
name CASEIN KINASE I CASEIN KINASE I
KINASE KINASE I
LIKE
PROTEIN
Species Arabidopsis Arabidopsis Arabidopsis Arabidopsis Arabidopsis thaliana thaliana thaliana thaliana thaliana (Mouse-ear (Mouse-ear (Mouse-ear (Mouse-ear (Mouse-ear cress) cress) cress) cress) cress) Identity % 64% 59% 60% 58% 57%
Similarity % 73% 66% 72% 67% 69%

Table 8 [0155] Degree of Amino Acid Identity and Similarity of PpCK-3 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:

0.1; score matrix: blosum62) Swiss-Prot 064816 Q9ZR52 P28523 Q9SN18 Q08466 Protein PUTATIVE CASEIN CASEIN CASEIN CASEIN
name CASEIN KINASE II KINASE II, KINASE II, KINASE
KINASE II ALPHA ALPHA ALPHA ALPHA

C SUBUNIT (CK II) Species Arabidopsis Zea mays Zea mays Arabidopsis Arabidopsis thaliana (Maize) (Maize) thaliana thaliana (Mouse-ear (Mouse-ear (Mouse-ear cress) cress) cress) Identity % 87% 89% 89% 88% 88%
Similarity 93% 94% 93% 93% 93%

Table 9 10156] Degree of Amino Acid Identity and Similarity of PpMPK-2 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) .

Swiss-Prot # Q9M136 Q40531 Q39024 Q40353 Protein MAP MITOGEN- MITOGEN- MITOGEN- MITOGEN-name KINASE 4 ACTIVATE ACTIVATE ACTIVATE ACTIVATED
D PROTEIN D PROTEIN D PROTEIN PROTEIN
KINASE KINASE KINASE KINASE
HOMOLOG HOMOLOG HOMOLOG HOMOLOG

Species Arabidopsis Nicotiana Arabidopsis Medicago Medicago thaliana tabacum thaliana sativa sativa (Mouse-ear (Common (Mouse-ear (Alfalfa) (Alfalfa) cress) tobacco) cress) Identity % 70% 69% 69% 68%
66%
Similarity % 80% 78% 80% 79%
76%

Table 10 [0157] Degree of Amino Acid Identity and Similarity of PpMPK-3 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) Swiss-Prot # Q9SUX2 P13983 Q41192 070495 Protein EXTENSIN EXTENSIN NAPRP3 PLENTY- FERULOYL-name -LIKE OF-COA
PROTEIN PROLINES- SYNTHETASE

Species Arabidopsis Nicotiana Nicotiana Mus Pseudomonas thaliana tabacum alata musculus sp.
(Mouse-ear (Common (Winged (Mouse) cress) tobacco) tobacco) (Persian =
tobacco) Identity % 12% 15% 22% 18%
11%
Similarity % 21% 22% 30% 26%
20%

Table 11 [0158] Degree of Amino Acid Identity and Similarity of PpMPK-4 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) Swiss-Prot 049975 048616 Q9M6Q9 080395 Q9S7U9 Protein PROTEIN MAP KINASE MAP KINASE MAP KINASE MAP2K
name KINASE K1NASE KINASE KJNASE 2 BETA

Species Zea mays Lycopersicon Nicotiana Arabidopsis Arabidopsis (Maize) esculentum tabacum thaliana thaliana (Tomato) (Common (Mouse-ear (Mouse-ear tobacco) cress) cress) Identity % 59% 54% 53% 50% 50%

Table 12 [0159] Degree of Amino Acid Identity and Similarity of PpMPK-5 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) Swiss-Prot # 049975 048616 Q9M6Q9 080395 Q9S7U9 Protein PROTEIN MAP MAP MAP MAP2K BETA
name KINASE KINASE KINASE KINASE PROTEIN

Species Zea mays Lycopersicon Nicotiana Arabidopsis Arabidopsis (Maize) esculentum tabacurn thaliana thaliana (Tomato) (Common (Mouse-ear (Mouse-ear tobacco) cress) cress) Identity % 59% 54% 53% 50% 50%
Similarity % 72% 66% 66% 62% 62%

Table 13 [0160] Degree of Amino Acid Identity and Similarity of PpCPK-1 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:
0.1; score matrix: blosum62) Swiss-Prot # Q9SCS2 004290 P53681 P93520 Q41792 Protein CDPK- CDPK- CDPK- CALCIUM/CAL CDPK-name RELATED RELATED RELATED MODULIN- RELATED
PROTEIN PROTEIN PROTEIN DEPENDENT PROTEIN

KINASE
HOMOLOG
Species Arabidopsis Arabidopsis Daucus Zea mays Zea mays thaliana thaliana carota (Maize) (Maize) (Mouse-ear (Mouse-ear (Carrot) cress) cress) Identity % 64% 64% 63% 63% 63%
Similarity % 76% 76% 75% 73% 74%

Table 14 [0161] Degree of Amino Acid Identity and Similarity of PpCPK-2 and Other Homologous Proteins GCG Gap program was used: gap penalty: 10; gap extension penalty:

0.1; score matrix: blosum62) Swiss-Prot # Q9S7Z4 Q42479 Q41790 081390 Q9ZPM0 Protein CALCIUM- CALCIUM- CALCIUM- CALCIUM- CA2+-name DEPENDEN DEPENDEN DEPENDEN DEPENDEN DEPENDEN
T PROTEIN T PROTEIN T PROTEIN T PROTEIN T PROTEIN
KINASE KINASE KINASE KINASE KINASE
Species Marchantia Arabidopsis Zea mays Nicotiana Mesembryant polymorpha thaliana (Maize) tab acum hemum (Liverwort) (Mouse-ear (Common crystallinum cress) tobacco) (Common ice plant) Identity % 66% 62% 59% 59% 59%
Similarity % 75% 73% 70% 68% 70%

Example 6 Cloning of the full-length Physcomitrella patens cDNA encoding for PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 [0162] To isolate the clones encoding PK-6 (SEQ ID NO:14), PK-7 (SEQ ID
NO:15), PK-8 (SEQ ID NO:16), PK-9 (SEQ ID NO:17), CK-1 (SEQ ID NO:18), CK-2 (SEQ ID
NO:19), CK-3 (SEQ ID NO:20), M1PK-2 (SEQ ID NO:21), MPK-3 (SEQ ID NO:22), MPK-(SEQ ID NO:23), MPK-5 (SEQ ID NO:24), CPK-1 (SEQ ID NO:25) and CPK-2 (SEQ ID
NO:26) from Physcomitrella patens, cDNA libraries were created with SMART RACE

cDNA Amplification kit (Clontech Laboratories) following manufacturer's instructions.
Total RNA isolated as described in Example 3 was used as the template. The cultures were treated prior to RNA isolation as follows: Salt Stress: 2, 6, 12, 24,. 48 hours with 1-M NaC1-supplemented medium; Cold Stress: 4 C for the same time points as for salt;
Drought Stress:
cultures were incubated on dry filter paper for the same time points as for salt.
5' RACE Protocol [0163] The EST sequences PK-6 (SEQ ID NO:1), PK-7 (SEQ ID NO:2), PK-8 (SEQ
ID NO:3), PK-9 (SEQ ID NO:4), CK-1 (SEQ ID NO:5), CK-2 (SEQ ID NO:6), CK-3 (SEQ
ID NO:7), MPK-2 (SEQ ID NO:8), MPK-3 (SEQ ID NO:9), MPK-4 (SEQ ID NO:10), MPK-(SEQ ID NO:11), CPK-1 (SEQ ID NO:12) and CPK-2 (SEQ ID NO:13) identified from the database search as described in Example 4 were used to design oligos for RACE
(see Table 15). The extended sequences for these genes were obtained by performing Rapid Amplification of cDNA Ends polymerase chain reaction (RACE PCR) using the Advantage 2 PCR kit (Clontech Laboratories) and the SMART RACE cDNA amplification kit (Clontech Laboratories) using a Biometra T3 Thermocycler following the manufacturer's instructions.
The sequences obtained from the RACE reactions corresponded to full-length coding regions of CC-2 and CC-3 and were used to design oligos for full-length cloning of the respective genes (see below full-length amplification).
Full-length Amplification [0164] Full-length clones corresponding PK-6 (SEQ ID NO:14), PK-7 (SEQ ID
NO:15), PK-8 (SEQ ID NO:16), PK-9 (SEQ ID NO:17), CK-1 (SEQ ID NO:18), CK-2 (SEQ
ID NO:19), CK-3 (SEQ ID NO:20), MPK-2 (SEQ ID NO:21), MPK-3 (SEQ ID NO:22), MPK-4 (SEQ ID NO:23), MPK-5 (SEQ ID NO:24), CPK-1 (SEQ ID NO:25) and CPK-2 (SEQ ID NO:26) were obtained by performing polymerase chain reaction (PCR) with gene-specific primers (see Table 15) and the original EST as the template. The conditions for the reaction were standard conditions with PWO DNA polymerase (Roche). PCR was performed according to standard conditions and to manufacturer's protocols (Sambrook et al., 1989 Molecular Cloning, A Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., Biometra T3 Thermocycler). The parameters for the reaction were: five minutes at 94 C followed by five cycles of one minute at 94 C , one minute at 50 C and 1.5 minutes at 72 C. This was followed by twenty five cycles of one minute at 94 C, one minute at 65 C and 1.5 minutes at 72 C.
[0165] The amplified fragments were extracted from agarose gel with a QIAquick Gel Extraction Kit (Qiagen) and ligated into the TOPO pCR 2.1 vector (Invitrogen) following manufacturer's instructions. Recombinant vectors were transformed into Top10 cells (Invitrogen) using standard conditions (Sambrook et al. 1989. Molecular Cloning, A
Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY). Transformed cells were selected for on LB agar containing 100 p,g/m1 carbenicillin, 0.8 mg X-gal (5-bromo-4-chloro-3-indoly1-13-D-galactoside) and 0.8 mg IPTG
(isopropylthio-P-D-galactoside) grown overnight at 37 C. White colonies were selected and used to inoculate 3 ml of liquid LB containing 100 jig/nil ampicillin and grown overnight at 37 C. Plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen) following manufacturer's instructions. Analyses of subsequent clones and restriction mapping was performed according to standard molecular biology techniques (Sambrook et al., 1989 Molecular Cloning, A
Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.).

Table 15 [0166] Scheme and primers used for cloning of full-length clones Gene Final Isolation Primers Race Primers RT-PCR
product Method PpPK-6 XmaI/Hpa 5' RACE and RC782: Sites RC858:
RT-PCR for (SEQ ID NO:43) (SEQ ID NO:46) Full-length CCACGGTCTTCGG ATCCCGGGTGAGT
clone CTGCTGGTCGTG ATCACTTACGGTG
GCGA
RC783:
(SEQ ID NO:44) RC859:
GCAGCACAGCAC (SEQ ID NO:47) CACCAGCGGCTAT GCGTTAACTCGAC
CAAGGTCACTATT
= NVT:
CCAAGCA
(SEQ ID NO:45) GCGCCCAGTGAG
TAGCTCCAGCATT
PpPK-7 Xmal/Hpa 5' RACE and RC250:

RC590:
RT-PCR for (SEQ ID NO:48) (SEQ ID NO:49) Full-length CGGTGCCCACCTC ATCCCGGGAGTGG
clone GTTCCTGTGGTT GTGGTTGGACTGT
AAGGA

RC591:
(SEQ ID NO:50) GCGTTAACCTTCG
TCTTGGACAGGTA
= GAGGTTAC

PpPK-8 XmaI/Hpa 5' RACE and (SEQ ID NO:51) RC1016:
RT-PCR for GACTCAGCCCCGT (SEQ ID NO:52) Full-length AATCCTTCAACA ATCCCGGGCAACG
clone AGAAGCATTCGAG
ATGGC

RC1021:
(SEQ ID NO:53) GCGTTAACGAGCA
TCACGATACTCGG
TGATTTC
PpPK-9 XmaI/SacI 5' RACE and RC263: RC831:
RT-PCR for (SEQ ID NO:54) (SEQ ID NO:55) Full-length CGACGGCTAATA ATCCCGGGCTGTG
clone CCACGTTGGCGAC ATGTCGGTGTGGT
CA GCTCTGC

RC832:
(SEQ ID NO:56) GCGAGCTCGCACC
ACTGAATGATGGA
GACTCAGG
PpCK-1 XmaI/Hpa 5' RACE and NVT: RC614:
RT-PCR for (SEQ ID NO:57) (SEQ ID NO:58) Full-length CGACCGCAGCCC ATCCCGGGCTCAC
clone ATGAGGAAGTTAT GTAGTGCACTGAA
CTCTGTC

RC615:
(SEQ ID NO:59) GCGTTAACATGCC
CATCTTCTCATACT
CAGACC

PpCK-2 XmaI/Hpa 5' RACE and NVT: RC1012:
RT-PCR for (SEQ ID NO:60) (SEQ ID NO:61) Full-length CTCGCCTACCAAG ATCCCGGGTTGTC
clone CCCCATTAGAAA GAGGACGGAGAG
AGAAGAG

RC1015 :
(SEQ ID NO:62) GCGTTAACCTTAG
GAATCGTATGGCA
GAGAGCT
PpCK-3 HpaI/SacI 5' RACE and NVT: RC640:
RT-PCR for (SEQ lD NO:63) (SEQ ID NO:64) Full-length GCTTCACAATGTT GCGTTAACGGGAG
clone GGGCCCTCCACA GAAGGTCGGGGGA
AGAGACG

RC641:
(SEQ ID NO:65) GCGAGCTCAGCGC
TTCGCACAACTGA
GAAACCT
PpMPK-2 Xmal/Hpa 5' RACE and NVT: RC664:
RT-PCR for (SEQ ID NO:66) (SEQ ID NO:67) Full-length ACGAGAAGGTTG ATCCCGGGCGAGC
clone GTGGGCTTCAAGT CATGGCGCCACTT
GCTT

RC665:
(SEQ ID NO:68) GCGTTAACGCCGA
GCAACAATGTCTG
CTGGATG

PpMPK-3 XmaI/Hpa 5' RACE and RC268: RC662:
RT-PCR for (SEQ ID NO:69) (SEQ ID NO:70) Full-length CCCGGTAAGCCAT ATCCCGGGCTTGT
clone CGGAGTGTGGAA ATTGGCTCGGATA
ATTT

RC663:
(SEQ ID NO:71) GCGTTAACGGCAA
= TATCTGCACAGCC
GTTCACT
PpMPK-4 Xmal/SacI 5' RACE and NVT: RC1001:
RT-PCR for (SEQ ID NO:72) (SEQ ID NO:73) Full-length GTGTCTCGCTGGG ATCCCGGGCGGTC
clone CCAAGGAATGAA GAGTCGTATTAGG
TGTTGTTTC

RC1005:
(SEQ ID NO:74) GAGCTCCGGTAGG
= TCCGACCTCTTCA
ATTG
PpMPK-5 XmaI/SacI 5' RACE. and RC266: RC572:
RT-PCR for (SEQ ID NO:75) (SEQ ID NO:76) Full-length GACGACGCGAAG ATCCCGGGAGAGG
clone CCCGGTGTGGTTG CTGATCTGATGCT
A ACAGT

RC573:
(SEQ , ID NO:77) ATGAGCTCTGGCG
GATTGGCGAGGTA
GTTCGAC

PpCPK-1 XmaI/Hpa 5' RACE and RC526: RC817:
RT-PCR for (SEQ ID NO:78) (SEQ lD NO:82) Full-length CGGCGCAACGTA ATCCCGGGTGTAG
clone GTATGCGCTTCCA GCGGGCGAGGTTC
GATGC
RC723N:
(SEQ 'ID NO:79) RC818:
CGCGGTGAACAA (SEQ ID NO:83) CACCTTGCAGGTG GCGTTAACGACAA
AC CCGGAGTAGAACG
GCAGTCCA
RC767:
(SEQ ID NO:80) GCTCGGGTCAGCC
CTCAACACCGCA

NVT:
(SEQ ID NO:81) GTTAAAGCTTGTG
CAGCAGTCATGC
PpCPK-2 XmaI/Hpa 5' RACE and NVT: RC703:
RT-PCR for (SEQ ID NO:84) (SEQ ID NO:85) Full-length AGAAGCGAGGAA ATCCCGGGCGAAC
clone TGGGCAGGGACG TGCGATCTGAGAT
A TCCAAC

RC704:
(SEQ ID NO:86) GCGTTAACGAGAT
CCAACCGAAGCCA
TCCTACGA

Example 7 Engineering stress-tolerant Arabidopsis plants by over-expressing the genes PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 Binary vector construction: kanamycin [0167] The plasmid construct pACGH101 was digested with PstI (Roche) and FseI

(NEB) according to manufacturers' instructions. The fragment was purified by agarose gel and extracted via the Qiaex II DNA Extraction kit (Qiagen). This resulted in a vector fragment with the Arabidopsis Actin2 promoter with internal intron and the terminator. Primers for PCR amplification of the NPTII gene were designed as follows:
'NPT-Pst:
GCG-CTG-CAG-ATT-TCA-TTT-GGA-GAG-GAC-ACG (SEQ BD NO: 87) 3 'NPT-Fse:
CGC-GGC-CGG-CCT-CAG-AAG-AAC-TCG-TCA-AGA-AGG-CG (SEQ ID NO: 88).

[0168] The 0.9 kilobase NPTII gene was amplified via PCR from pCambia 2301 plasmid DNA [94oC 60sec, {94oC 60sec, 61oC (-0.1oC per cycle) 60sec, 72oC
2min} x 25 cycles, 72oC 10min on Biometra T-Gradient machine], and purified via the Qiaquick PCR
Extraction kit (Qiagen) as' per manufacturer's instructions. The PCR DNA was then subcloned into the pCR-Bluntlil TOPO vector (Invitrogen) pursuant to the manufacturer's instructions (NPT-Topo construct). These ligations were transformed into Top10 cells (Invitrogen) and grown on LB plates with 5Oug/nal kanamycin sulfate overnight at 37oC.
Colonies were then used to inoculate 2m1 LB media with 5Oug/m1 kanamycin sulfate and grown overnight at 37oC, Plasmid DNA was recovered using the Qiaprep Spin Miniprep kit (Qiagen) and sequenced in both the 5' and 3' directions using standard conditions.
Subsequent analysis of the sequence data using VectorNTI software revealed no PCR errors present in the NPTII gene sequence.
[0169] The NPT-Topo construct was then digested with PstI (Roche) and FseI
(NEB) according to manufacturers' instructions. The 0.9 kilobase fragment was purified on agarose gel and extracted by Qiaex II DNA Extraction kit (Qiagen). The Pst/Fse insert fragment from NPT-Topo and the Pst/Fse vector fragment from pACGH101 were then ligated together using T4 DNA Ligase (Roche) following manufacturer's instructions. The ligation was then transformed into Top10 cells (Invitrogen) under standard conditions, creating pBPSsc019 construct. Colonies were selected on LB plates with 50 ug/ml kanamycin sulfate and grown overnight at 37 C. These colonies were then used to inoculate 2m1 LB media with 50 ug/ml kanamycin sulfate and grown overnight at 37 C. Plasmid DNA was recovered using the Qiaprep Spin Miniprep kit (Qiagen) following the manufacturer's instructions.
[0170] The pBPSSC019 construct was digested with KpnI and BsaI (Roche) according to manufacturer's instructions. The fragment was purified via agarose gel and then extracted via the Qiaex II DNA Extraction kit (Qiagen) as per its instructions, resulting in a 3 kilobase Act-NPT cassette, which included the Arabidopsis Actin2 promoter with internal intron, the NPTII gene and the OCS3 terminator.
[0171] The pBPSJHOO1 vector was digested with SpeI and ApaI (Roche) and blunt-end filled with Klenow enzyme and 0.1mM dNTPs (Roche) according to manufacture's instructions. This produced a 10.1 kilobase vector fragment minus the Gentamycin cassette, which was recircularized by self-ligating with T4 DNA Ligase (Roche), and transformed into Top10 cells (Invitrogen) via standard conditions. Transformed cells were selected for on LB
agar containing 50 g/m1 kanmycin sulfate and grown overnight at 37 C. Colonies were then used to inoculate 2m1 of liquid LB containing 50 g/m1 kanamycin sulfate and grown overnight at 37 C. Plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen) following manufacture's instructions. The recircularized plasmid was then digested with Kpnl (Roche) and extracted from agarose gel via the Qiaex II DNA
Extraction kit (Qiagen) as per manufacturer's instructions.
[0172] The Act-NPT Kpn-cut insert and the Kpn-cut pBPSJHOO1 recircularized vector were then ligated together using T4 DNA Ligase (Roche) and transformed into Top10 cells (Invitrogen) as per manufacturers' instructions. The resulting construct, pBPSsc022, now contained the Super Promoter, the GUS gene, the NOS terminator, and the Act-NPT
cassette. Transformed cells were selected for on LB agar containing 501ag/m1 kanmycin sulfate and grown overnight at 37 C. Colonies were then used to inoculate 2m1 of liquid LB
containing 50iug/m1 kanamycin sulfate and grown overnight at 37 C. Plasmid DNA
was extracted using the QIAprep Spin Miniprep Kit (Qiagen) following manufacturer's instructions. After confirmation of ligation success via restriction digests, pBPSsc022 plasmid DNA was further propigated and recovered using the Plasmid Midiprep Kit (Qiagen) following the manufacturer's instructions.
Subcloning of PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 into the binary vector [0173] The fragments containing the different Physcomitrella patens protein kinases were subcloned from the recombinant PCR2.1 TOPO vectors by double digestion with restriction enzymes (see Table 16) according to manufacturer's instructions.
The subsequence fragment was excised from agarose gel with a QIAquick Gel Extraction Kit (QIAgen) according to manufacture's instructions and ligated into the binary vectors pGMSG, cleaved with XmaI and Ec113611 and dephosphorylated prior to ligation.
The resulting recombinant pGMSG contained the corresponding transcription factor in the sense orientation under the constitutive super promoter.

Table 16 [0174] Listed are the names of the various constructs of the Physcomitrella patens transcription factors used for plant transformation Gene Enzymes used to Enzymes used to Binary Vector generate gene restrict pBPSJHOO1 Construct fragment PpPK-6 XmaI/HpaI XrnaI/SacI pBPSJyw022 PpPK-7 XmaI/HpaI XmaI/Ec1136 pBPSJyw012 PpPK-8 XmaI/HpaI )(mai/Eel 1 36 pBPSJYWO30 PpPK-9 XmaI/SacI XmaI/SacI PBPSERG010 PpCK-1 XmaI/HpaI Xmanc1136 pBPSSY012 PpCK-2 XmaI/HpaI XmaI/Ecl 1 36 pBPSJyw034 PpCK-3 HpaI/SacI SmaI/SacI pBPSSY011 PpMPK-2 )(mai/Hp aI Xmanc1136 pBPSSY016 PpMPK-3 XmaI/HpaI Xmanc1136 pBPSJyw014 PpMPK-4 XmaI/SacI XmaI/SacI pBPSJyw025 PpMPK-5 )(mai/Sad )(mai/Sad PBPSERG009 PpCPK-1 XmaI/HpaI Xmanc1136 PBPSERG019 PpCPK-2 XmaI/HpaI XmaI/Ecl 1 36 pBPSJyw008 Agrobacterium Transformation [0175] The recombinant vectors were transformed into Agrobacterium tumefaciens C58C1 and PMP90 according to standard conditions (Hoefgen and Willmitzer, 1990).

Plant Transformation [0176] Arabidopsis thaliana ecotype C24 were grown and transformed according to standard conditions (Bechtold 1993, Acad. Sci. Paris. 316:1194-1199; Bent et al. 1994, Science 265:1856-1860).
Screening of Transformed Plants [0177] Ti 'seeds were sterilized according to standard protocols (Xiong et al. 1999, Plant Molecular Biology Reporter 17: 159-170). Seeds were plated on 1/2 Murashige and Skoog media (MS) (Sigma-Aldrich) pH 5.7 with KOH, 0.6% agar and supplemented with 1%
sucrose, 0.5 g/L 2[N-Morpholinojethansulfonic acid (MES) (Sigma-Aldrich), 50 Ag/m1 kanamycin (Sigma-Aldrich), 500 g/m1 carbenicillan (Sigma-Aldrich) and 2 gg/m1 benomyl (Sigma-Aldrich). Seeds on plates were vernalized for four days at 4 C. The seeds were germinated in a climatic chamber at an air temperature of 22 C and light intensity of 40 micromols-11112 (white light; Philips TL 65W/25 fluorescent tube) and 16 hours light and 8 hours dark day length cycle. Transformed seedlings were selected after 14 days and transferred to Y2 MS media pH 5.7 with KOH 0.6% agar plates supplemented with 0.6% agar, 1% sucrose, 0.5 g/L MES (Sigma-Aldrich), and 2 g/ml benomyl (Sigma-Aldrich) and allowed to recover for five-seven days.
Drought Tolerance Screening [0178] Ti seedlings were transferred to dry, sterile filter paper in a petri dish and allowed to desiccate for two hours at 80% RH (relative humidity) in a Percieval Growth Cabinet MLR-350H, micromols4m2 (white light; Philips TL 65W/25 fluorescent tube). The RH was then decreased to 60% and the seedlings were desiccated further for eight hours.
Seedlings were then removed and placed on 1/2 MS 0.6% agar plates supplemented with 2m/m1 benomyl (Sigma-Aldrich) and 0.5g/L MES (Sigma-Aldrich) and scored after five days.
[0179] Under drought stress conditions, PpPK-6 over-expressing Arabidopsis thaliana plants showed a 95% (20 survivors from 21 stressed plants) survival rate to the stress screening; PpPK-8, 40% (2 survivors from 5 stressed plants), PpPK-9, 78% (38 survivors from 49 stressed plants), PpCK-1, 50% (5 survivors from 10 stressed plants), PpCK-2, 52% (16 survivors from 31 stressed plants), PpCK-3, 60% (3 survivors from 5 stressed plants), PpMPK-2, 100% (52 survivors from 52 stressed plants), PpMPK-3, 98% (44 survivors from 45 stressed plants), PpMPK-4, 92% (11 survivors from 12 stressed plants), PpMPK-5, 100% (9 survivors from 9 stressed plants), PpCPK-1, 60% (12 survivors from 20 stressed plants), PpCPK-2, 89% (17 survivors from 19 stressed plants), whereas the untransformed control only showed a 11% survival rate (1 survivor from 9 stressed plants).
It is noteworthy that the analyses of these transgenic lines were performed with Ti plants, and therefore, the results will be better when a homozygous, strong expresser is found.

Table 17 [0180] Summary of the drought stress tests Gene Name Drought Stress Test Number of Total number of Percentage of survivors plants survivors PpPK-6 20 21 95%
PpPK-8 2 5 40%
PpPK-9 38 49 78%
PpCK-1 5 10 50%
Pp CK-2 16 31 52%
PpCK-3 3 5 60%
PpMPK-2 52 52 100%
PpMPK-3 44 45 98%
PpMPK-4 11 12 92%
PpMPK-5 9 9 100%

Freezing Tolerance Screening [0181] Seedlings were moved to petri dishes containing 1/2 MS 0.6% agar supplemented with 2% sucrose and 2 lig/m1 benomyl. After four days, the seedlings were incubated at 4 C for 1 hour and then covered with shaved ice. The seedlings were then placed in an Environmental Specialist ES2000 Environmental Chamber and incubated for 3.5 hours beginning at ¨1.0 C decreasing ¨1 C hour. The seedlings were then incubated at ¨5.0 C for 24 hours and then allowed to thaw at 5 C for 12 hours. The water was poured off and the seedlings were scored after 5 days.
[0182] Under freezing stress conditions, PpPK-7 over-expressing Arabidopsis thaliana plants showed a 73% (8 survivors from 11 stressed plants) survival rate to the stress screening; PpPK-9, 100% (45 survivors from 45 stressed plants), PpCK-1, 100%
(14 survivors from 14 stressed plants), PpMPK-2, 68% (36 survivors from 53 stressed plants), PpMPK-3, 92% (24 survivors from 26 stressed plants), PpCPK-2, 64% (7 survivors from 11 stressed plants), whereas the untransformed control only showed a 2% survival rate (1 survivor from 48 stressed plants). It is noteworthy that the analyses of these transgenic lines were performed with Ti plants, and therefore, the results will be better when a homozygous, strong expresser is found. =
Table 18 [0183] Summary of the freezing stress tests Gene Name Freezing Stress Test Number of survivors Total number of Percentage of plants survivors PpPK-7 8 11 73%
PpPK-9 45 45 100%
PpCK-1 14 14 100%
PpMPK-2 36 53 68%
PpMPK-3 24 26 92%
PpCPK-2 7 11 64%
Control 1 48 2%

Salt Tolerance Screening [0184] Seedlings were transferred to filter paper soaked in 1/2 MS and placed on Y2 MS 0.6% agar supplemented with 2 1,tg/m1 benomyl the night before the salt tolerance screening. For the salt tolerance screening, the filter paper with the seedlings was moved to stacks of sterile filter paper, soaked in 50 mM NaCl, in a petri dish. After two hours, the filter paper with the seedlings was moved to stacks of sterile filter paper, soaked with 200 mM
NaCl, in a petri dish. After two hours, the filter paper with the seedlings was moved to stacks of sterile filter paper, soaked in 600mM NaCl, in a petri dish. After 10 hours, the seedlings were moved to petri dishes containing JAMS 0.6% agar supplemented with 2 [tg/m1 benomyl.
The seedlings were scored after 5 days.

[0185] The transgenic plants are screened for their improved salt tolerance demonstrating that transgene expression confers salt tolerance.

Example 8 Detection of the PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 transgenes in the transgenic Arabidopsis lines [0186] One leaf from a wild type and a transgenic Arabidopsis plant was homogenized in 250 1 Hexadecyltrimethyl ammonium bromide (CTAB) buffer (2%
CTAB, 1.4 M NaC1, 8mM EDTA and 20mM Tris pH 8.0) and 1 1 P-mercaptoethanol. The samples were incubated at 60-65 C for 30 minutes and 250 1 of Chloroform was then added to each sample. The samples were vortexed for 3 minutes and centrifuged for 5 minutes at 18,000 x g. The supernatant was taken from each sample and 150 1 isopropanol was added. The samples were incubated at room temperature for 15 minutes, and centrifuged for 10 minutes at 18,000 x g. Each pellet was washed with 70% ethanol, dried, and resuspended in 20 [a TE.
4 I of above suspension was used in a 20 1 PCR reaction using Tag DNA
polyrnerase (Roche Molecular Biochemicals) according to the manufacturer's instructions.
[0187] Binary vector plasmid with each gene cloned in was used as positive control, and the wild-type C24 genomic DNA was used as negative control in the PCR
reactions. 10 1PCR reaction was analyzed on 0.8% agarose - ethidium bromide gel.

[0188] PpPk-6: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACTCGACCAAGGTCACTATTCCAAGCA (SEQ ID NO:90) [0189] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 2.8 kb fragment was produced from the positive control and the transgenic plants.

[0190] PpPk-7: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACCTTCGTCTTGGACAGGTAGAGGTTAC (SEQ ID NO:91) [0191] The primers were used in the first round of reactions with the following program: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by minutes at 72 C. A 1.1 kb fragment was generated from the positive control and the Ti transgenic plants.

[0192] PpPK-8: The primers used in the reactions were:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACGAGCATCACGATACTCGGTGATTTC (SEQ ID NO:92) [0193] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.6 kb fragment was produced from the positive control and the transgenic plants.

[0194] PpPK-9: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ JD NO:89) GCGAGCTCGCACCACTGAATGATGGAGACTCAGG (SEQ lD NO:93) [0195] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.4 kb fragment was produced from the positive control and the transgenic plants.

[0196] PpCK-1: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACATGCCCATCTTCTCATACTCAGACC (SEQ ID NO:94) [0197] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.7 kb fragment was produced from the positive control and the transgenic plants., [0198] PpCK-2: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ lD NO:89) GCGTTAACCTTAGGAATCGTATGGCAGAGAGCT (SEQ ID NO:95) [0199] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.9 kb fragment was produced from the positive control and the transgenic plants.

[0200] PpCK-3: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ 1D NO:89) GCGAGCTCAGCGCTTCGCACAACTGAGAAACCT (SEQ ID NO:96) [0201] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.2 kb fragment was produced from the positive control and the transgenic plants.

[0202] PpMPK-2: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACGGCAATATCTGCACAGCCGTTCACT (SEQ ED NO:97) [0203] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.7 kb fragment was produced from the positive control and the transgenic plants.

[0204] PpMPK-3: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACGGCAATATCTGCACAGCCGTTCACT (SEQ ID NO:98) [0205] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 2.2 kb fragment was produced from the positive control and the transgenic plants.

[0206] PpMPK-4: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GAGCTCCGGTAGGTCCGACCTCTTCAATTG (SEQ ID NO:99) [0207] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.7 kb fragment was produced from the positive control and the transgenic plants.

[0208] PpMPK-5: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) ATGAGCTCTGGCGGATTGGCGAGGTAGTTCGAC (SEQ ID NO:100) [0209] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 1.4 kb fragment was produced from the positive control and the transgenic plants.

[0210] PpCPK-1: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACGACAACCGGAGTAGAACGGCAGTCCA (SEQ ID NO:101) [0211] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 2.3 kb fragment was produced from the positive control and the transgenic plants.

[0212] PpCPK-2: The primers used in the reactions are:
GCTGACACGCCAAGCCTCGCTAGTC (SEQ ID NO:89) GCGTTAACGAGATCCAACCGAAGCCATCCTACGA (SEQ ID NO:102) [0213] The PCR program was as following: 30 cycles of 1 minute at 94 C, 1 minute at 62 C and 4 minutes at 72 C, followed by 10 minutes at 72 C. A 2.2 kb fragment was produced from the positive control and the transgenic plants.

[0214] The transgenes were successfully amplified from the Ti transgenic lines, but not from the wild type C24. This result indicates that the T1 transgenic plants contain at least one copy of the transgenes. There was no indication of existence of either identical or very similar genes in the untransformed Arabidopsis thaliana control which could be amplified by this method.

Example 9 Detection of the PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 transgene mRNA in transgenic Arabidopsis lines [0215] Transgene expression was detected using RT-PCR. Total RNA was isolated from stress-treated plants using a procedure adapted from (Verwoerd et al., 17:2362). Leaf samples (50-100 mg) were collected and ground to a fine powder in liquid nitrogen. Ground tissue was resuspended in 500 1 of a 80 C, 1:1 mixture, of phenol to extraction buffer (100mM LiC1, 100 mM Tris pH8, 10 mM EDTA, 1% SDS), followed by brief vortexing to mix. After the addition of 250 1 of chloroform, each sample was vortexed briefly. Samples were then centrifuged for 5 minutes at 12,000 x g. The upper aqueous phase was removed to a fresh eppendorf tube. RNA was precipitated by adding 1110th volume 3M
sodium acetate and 2 volumes 95% ethanol. Samples were mixed by inversion and placed on ice for 30 minutes. RNA was pelleted by centrifugation at 12,000 x g for 10 minutes. The supernatant was removed and pellets briefly air-dried. RNA sample pellets were resuspended in 10 1 DEPC treated water. To remove contaminating DNA from the samples, each was treated with RNase-free DNase (Roche) according to the manufacturer's recommendations.
cDNA was synthesized from total RNA using the 1st Strand cDNA synthesis kit (Boehringer Mannheim) following manufacturer's recommendations.
[0216] PCR amplification of a gene-specific fragment from the synthesized cDNA

was performed using Taq DNA polymerase (Roche) and gene-specific primers (see Table 15 for primers) in the following reaction: 1X PCR buffer, 1.5mM MgCl2, 0.2 !AM
each primer, 0.2 M dNTPs, 1 unit polymerase, 5 1 cDNA from synthesis reaction.
Amplification was performed under the following conditions: Denaturation, 95 C, 1 minute;
annealing, 62 C, 30 seconds; extension, 72 C, 1 minute, 35 cycles; extension, 72 C, 5 minutes;
hold, 4 C, forever. PCR products were run on a 1% agarose gel, stained with ethidium bromide, and visualized under UV light using the Quantity-One gel documentation system (Bio-Rad).
[0217] Expression of the transgenes was detected in the Ti transgenic line.
This result indicated that the transgenes are expressed in the transgenic lines and strongly suggested that their gene product improved plant stress tolerance in the transgenic line. On the other hand, no expression of identical or very similar endogenous genes could be detected by this method. These results are in agreement with the data from Example 7.
This greatly supports our statement that the observed stress tolerance is due to the introduced transgene.

[0218] PpPK-6 CCCAGTAATAGCAGGGTTGGAGGAA (SEQ ID NO:103) GGCTGCCTGAAGATCCGCTACAGAG (SEQ ID NO:104) [0219] PpPK-7 CGTCAGGCTACTTTGCGTGGAGCAC (SEQ ID NO:105) CGGTGCTGGCTAACACCAGGCCAGA (SEQ ID NO:106) [0220] PpPK-8 ATCCCGGGCAACGAGAAGCATTCGAGATGGC (SEQ ID NO:107) GCGTTAACGAGCATCACGATACTCGGTGATTTC (SEQ ID NO:108) [0221] PpPK-9 CGTGGCATCTCTCCCGATGTTCTTA (SEQ ID NO:109) GGCCAACTGAAGGCGTGTCATGATC (SEQ ID NO:110) [0222] PpCK-1 CTCGAGGGCTCGTTCACCGTGACCT (SEQ ID NO:111) CGGAGGTAACAGTAGTCAGGCTGCTC (SEQ ID NO:112) [0223] PpCK-2 CCGCGACCCTTCCACGCATCAGCAT (SEQ ID NO:113) CCTCCAGGAAGCCTGCGCCGAGAAG (SEQ ID NO:114) [0224] PpCK-3 GGACATTGTCCGTGATCAGCAATCGA (SEQ ID NO:115) CAGCCTCTGGAACAACCAGACGCTG (SEQ ID NO:116) [0225] PpMPK-2 GTCACCGCGAGGTACAAGCCACCAC (SEQ ID NO:117) GCAGCTCTGGAGCTCTGTACCACCT (SEQ ID NO:118) [0226] PpMPK-3 ACGGCCACGTCGAGAATCTGAGCAA (SEQ ID NO:119) CGAAGTGCTCGCAAGCAATGCCGAA (SEQ ID NO:120) [0227] PpMPK-4 ATCCCGGGCGGTCGAGTCGTATTAGGTGTTGTTTC (SEQ ID NO:121) GAGCTCCGGTAGGTCCGACCTCTTCAATTG (SEQ ID NO:122) [0228] PpMPK-5 GGGCAACTGTCAATAGCAGACCTGGA(SEQ ID NO:123) GCAAGTCCCAACGAACGTGTCTCGCT (SEQ ID NO:124) [0229] PpCPK-1 GCGAAGATGACGACTGCTATTGCGA (SEQ ID NO:125) CGTGATGACTCCAATGCTCCATACG (SEQ ID NO:126) [0230] PpCPK-2 GCCAGCATCGAGGTCAGTATCCGGTGT (SEQ ID NO:127) GTCTGTGGCCTTCAGAGGCGCATCCTC (SEQ ID NO:128) [0231] Amplification was performed under the following conditions:
Denaturation, 95 C, 1 minute; annealing, 62 C, 30 seconds; extension, 72 C, 1 minute, 35 cycles;
extension, 72 C, 5 minutes; hold, 4 C, forever. PCR products were run on a 1%
agarose gel, stained with ethidium bromide, and visualized under UV light using the Quantity-One gel documentation system (Bio-Rad).
[0232] Expression of the transgenes was detected in the Ti transgenic line.
These results indicated that the transgenes are expressed in the transgenic lines and strongly suggested that their gene product improved plant stress tolerance in the transgenic lines. In agreement with the previous statement, no expression of identical or very similar endogenous genes could be detected by this method. These results are in agreement with the data from Example 7.

Example 10 Engineering stress-tolerant soybean plants by over-expressing the PK-6, PK-7, PK-8, PK-9, CK-I, GK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 gene [0233] The constructs pBPSJyw022, pBPSJyw012, pBPSJYWO30, PBPSERG010, pBPSSY012, pBPSJyw034, pBPSSY011, pBPSSY016, pBPSJyw014, pBPSJyw025, PBPSERG009, PBPSERG019 and pBPSJyw008 were used to transform soybean as described below.

[0234] Seeds of soybean were surface sterilized with 70% ethanol for 4 minutes at room temperature with continuous shaking, followed by 20% (v/v) Clorox supplemented with 0.05% (v/v) Tween for 20 minutes with continuous shaking. Then, the seeds were rinsed 4 times with distilled water and placed on moistened sterile filter paper in a Petri dish at room temperature for 6 to 39 hours. The seed coats were peeled off, and cotyledons are detached from the embryo axis. The embryo axis was examined to make sure that the meristematic region is not damaged. The excised embryo axes were collected in a half-open sterile Petri dish and air-dried to a moisture content less than 20% (fresh weight) in a sealed Petri dish until further use.
[0235] Agrobacterium tumefaciens culture was prepared from a single colony in LB
solid medium plus appropriate antibiotics (e.g. 100 mg/1 streptomycin, 50 mg/1 kanamycin) followed by growth of the single colony in liquid LB medium to an optical density at 600 nm of 0.8. Then, the bacteria culture was pelleted at 7000 rpm for 7 minutes at room temperature, and resuspended in MS (Murashige and Skoog, 1962) medium supplemented with 100 pM
acetosyringone. Bacteria cultures were incubated in this pre-induction medium for 2 hours at room temperature before use. The axis of soybean zygotic seed embryos at approximately 15% moisture content were imbibed for 2 hours at room temperature with the pre-induced Agrobacterium suspension culture. The embryos are removed from the imbibition culture and were transferred to Petri dishes containing solid MS medium supplemented with 2% sucrose and incubated for 2 days, in the dark at room temperature. Alternatively, the embryos were placed on top of moistened (liquid MS medium) sterile filter paper in a Petri dish and incubated under the same conditions described above. After this period, the embryos were transferred to either solid or liquid MS medium supplemented with 500 mg/L
carbenicillin or 300mg/L cefotaxime to kill the agrobacteria. The liquid medium was used to moisten the sterile filter paper. The embryos were incubated during 4 weeks at 25 C, under 150 iAmol m-2seb-1 and 12 hours photoperiod. Once the seedlings produced roots, they were transferred to sterile metromix soil. The medium of the in vitro plants was washed off before transferring the plants to soil. The plants were kept under a plastic cover for 1 week to favor the acclimatization process. Then the plants were transferred to a growth room where they were incubated at 25 C, under 150 pmol m-2sec-1 light intensity and 12 hours photoperiod for about 80 days.
[0236] The transgenic plants were then screened for their improved drought, salt and/or cold tolerance according to the screening method described in Example 7 demonstrating that transgene expression confers stress tolerance.

Example 11 Engineering stress-tolerant Rapeseed/Canola plants by over-expressing the PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 genes [0237] The constructs pBPSJyw022, pBPSJyw012, pBPSJYWO30, PBPSERG010, pBPSSY012, pBPSJyw034, pBPSSY011, pBPSSY016, pBPSJyw014, pBPSJyw025, PBPSERG009, PBPSERG019 and pBPSJyw008 were used to transform rapseed/canola as described below.
[0238] The method of plant transformation described herein is also applicable to Brassica and other crops. Seeds of canola are surface sterilized with 70%
ethanol for 4 minutes at room temperature with continuous shaking, followed by 20% (v/v) Clorox supplemented with 0.05 % (v/v) Tween for 20 minutes, at room temperature with continuous shaking. Then, the seeds are rinsed 4 times with distilled water and placed on moistened sterile filter paper in a Petri dish at room temperature for 18 hours. Then the seed coats are removed and the seeds are air dried overnight in a half-open sterile Petri dish. During this period, the seeds lose approx. 85% of its water content. The seeds are then stored at room temperature in a sealed Petri dish until further use. DNA constructs and embryo imbibition are as described in Example 10. Samples of the primary transgenic plants (TO) are analyzed by PCR to confirm the presence of T-DNA. These results are confirmed by Southern hybridization in which DNA is electrophoresed on a 1% agarose gel and transferred to a positively charged nylon membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit (Roche Diagnostics) is used to prepare a digoxigenin-labelled probe by PCR, and used as recommended by the manufacturer.
[0239] The transgenic plants are then screened for their improved stress tolerance according to the screening method described in Example 7 demonstrating that transgene expression confers drought tolerance.

Example 12 Engineering stress-tolerant corn plants by over-expressing the PK-6, PK-7, PK-8, PK-9, CK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2genes [0240] The constructs pBPSJyvv022, pBPSJyw012, pBPSJYWO30, PBPSERG010, pBPSSY012, pBPSJyw034, pBPSSY011, pBPSSY016, pBPSJyw014, pBPSJyw025, PBPSER0009, PBPSERG019 and pBPSJyw008 were used to transform corn as described below.

[0241] Transformation of maize (Zea Mays L.) is performed with the method described by Ishida et al. 1996. Nature Biotch 14745-50. Immature embryos are co-cultivated with Agrobacterium tumefaciens that carry "super binary" vectors, and transgenic plants are recovered through organogenesis. This procedure provides a transformation efficiency of between 2.5% and 20%. The transgenic plants are then screened for their improved drought, salt and/or cold tolerance according to the screening method described in Example 7 demonstrating that transgene expression confers stress tolerance.

Example 13 Engineering stress-tolerant wheat plants by over-expressing the PK-6, PK-7, PK-8, PK-9, GK-1, CK-2, CK-3, MPK-2, MPK-3, MPK-4, MPK-5, CPK-1 and CPK-2 [0242] The constructs pBPSJyw022, pBPSJyw012, pBPSJYWO30, PBPSERG010, pBPSSY012, pBPSJyvv034, pBPSSY011, pBPSSY016, pBPSJyw014, pBPSJyw025, PBPSERG009, PBPSERG019 and pBPSJyw008 were used to transform wheat as described below.
[0243] Transformation of wheat is performed with the method described by Ishida et al. 1996 Nature Biotch. 14745-50. Immature embryos are co-cultivated with Agrobacterium tumefaciens that carry "super binary" vectors, and transgenic plants are recovered through organogenesis. This procedure provides a transformation efficiency between 2.5% and 20%.
The transgenic plants are then screened for their improved stress tolerance according to the screening method described in Example 7 demonstrating that transgene expression confers drought tolerance.

Example 14 Identification of Homologous and Heterologous Genes [0244] Gene sequences can be used to identify homologous or heterologous genes from cDNA or genomic libraries. Homologous genes (e. g. full-length cDNA
clones) can be isolated via nucleic acid hybridization using for example cDNA libraries.
Depending on the abundance of the gene of interest, 100,000 up to 1,000,000 recombinant bacteriophages are plated and transferred to nylon membranes. After denaturation with alkali, DNA
is immobilized on the membrane by e. g. UV cross linking. Hybridization is carried out at high stringency conditions. In aqueous solution hybridization and washing is performed at an ionic strength of 1 M NaC1 and a temperature of 68 C. Hybridization probes are generated by e. g.

radioactive (32P) nick transcription labeling (High Prime, Roche, Mannheim, Germany).
Signals are detected by autoradiography.
[0245] Partially homologous or heterologous genes that are related but not identical can be identified in a manner analogous to the above-described procedure using low stringency hybridization and washing conditions. For aqueous hybridization, the ionic strength is normally kept at 1 M NaCl while the temperature is progressively lowered from 68 to 42 C.
[0246] Isolation of gene sequences with homologies (or sequence identity/similarity) only in a distinct domain of (for example 10-20 amino acids) can be carried out by using synthetic radio labeled oligonucleotide probes. Radio labeled oligonucleotides are prepared by phosphorylation of the 5-prime end of two complementary oligonucleotides with T4 polynucleotide kinase. The complementary oligonucleotides are annealed and ligated to form concatemers. The double stranded concatemers are than radiolabeled by, for example, nick transcription. Hybridization is normally performed at low stringency conditions using high oligonucleotide concentrations.

Oligonucleotide hybridization solution:
6 x SSC
0.01 M sodium phosphate 1 mM EDTA (pH 8) 0.5 SDS
100 g/ml denatured salmon sperm DNA
0.1 % nonfat dried milk [0247] During hybridization, temperature is lowered stepwise to 5-10 C below the estimated oligonucleotide Tm or down to room temperature followed by washing steps and autoradiography. Washing is performed with low stringency such as 3 washing steps using 4 x SSC. Further details are described by Sambrook, J. et al. (1989), "Molecular Cloning: A
Laboratory Manual", Cold Spring Harbor Laboratory Press or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John Wiley & Sons.

Example 15 IdentOcation of Homologous Genes by Screening Expression Libraries with Antibodies [0248] c-DNA clones can be used to produce recombinant protein for example in E.
coli (e. g. Qiagen QIAexpress pQE system). Recombinant proteins are then normally affinity -purified via Ni-NTA affinity chromatography (Qiagen). Recombinant proteins are then used to produce specific antibodies for example by using standard techniques for rabbit immunization. Antibodies are affinity purified using a Ni-NTA column saturated with the recombinant antigen as described by Gu et al., 1994 BioTechniques 17:257-262.
The antibody can than be used to screen expression cDNA libraries to identify homologous or heterologous genes via an immunological screening (Sambrook, J. et al. (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press or Ausubel, F.M. et aL (1994) "Current Protocols in Molecular Biology", John Wiley & Sons). , Example 16 In vivo Mutagenesis [0249] In vivo mutagenesis of microorganisms can be performed by passage of plasmid (or other vector) DNA through E. coli or other microorganisms (e.g.
Bacillus spp. or yeasts such as Saccharomyces cerevisiae) which are impaired in their capabilities to maintain the integrity of their genetic information. Typical mutator strains have mutations in the genes for the DNA repair system (e.g., mutHLS, mutD, mutT, etc.; for reference, see Rupp, W.D.
(1996) DNA repair mechanisms, in: Escherichia coli and Salmonella, p. 2277-2294, ASM:
Washington.) Such strains are well known to those skilled in the art. The use of such strains is illustrated, for example, in Greener, A. and Callahan, M. (1994) Strategies 7: 32-34.
Transfer of mutated DNA molecules into plants is preferably done after selection and testing in microorganisms. Transgenic plants are generated according to various examples within the exemplification of this document.

Example 17 In vitro Analysis of the Function of Physcomitrella Genes in Transgenic Organisms [0250] The determination of activities and kinetic parameters of enzymes is well established in the art. Experiments to determine the activity of any given altered enzyme must be tailored to the specific activity of the wild-type enzyme, which is well within the ability of one skilled in the art. Overviews about enzymes in general, as well as specific details concerning structure, kinetics, principles, methods, applications and examples for the determination of many enzyme activities may be found, for example, in the following references: Dixon, M., and Webb, E.C., (1979) Enzymes. Longmans: London;
Fersht, (1985) Enzyme Structure and Mechanism. Freeman: New York; Walsh, (1979) Enzymatic Reaction Mechanisms. Freeman: San Francisco; Price, N.C., Stevens, L. (1982) Fundamentals of Enzymology. Oxford Univ. Press: Oxford; Boyer, P.D., ed. (1983) The Enzymes, 3rd ed.
Academic Press: New York; Bisswanger, H., (1994) Enzymkinetik, 2nd ed. VCH:
Weinheim (ISBN 3527300325); Bergmeyer, H.U., Bergmeyer, J., Grain, M., eds. (1983-1986) Methods of Enzymatic Analysis, 3rd ed., vol. I-X1d, Verlag Chemie: Weinheim; and Ullmann's Encyclopedia of Industrial Chemistry (1987) vol. A9, Enzymes. VCH: Weinheim, p. 352-363.
[0251] The activity of proteins which bind to DNA can be measured by several well-established methods, such as DNA band-shift assays (also called gel retardation assays). The effect of such proteins on the expression of other molecules can be measured using reporter gene assays (such as that described in Kolmar, H. et al. (1995) EMBO J. 14:
3895-3904 and references cited therein). Reporter gene test systems are well known and established for applications in both pro- and eukaryotic cells, using enzymes such as 13-galactosidase, green fluorescent protein, and several others.
[0252] The determination of activity of membrane-transport proteins can be performed according to techniques such as those described in Genius, R.B.
Pores, Channels and Transporters, in Biomembranes, Molecular Structure and Function, pp. 85-137, 199-234 and 270-322, Springer: Heidelberg (1989).

Example 18 Purification of the Desired Product from Transformed Organisms [0253] Recovery of the desired product from plant material (i.e., Physcomitrella patents or Arabidopsis thaliana), fungi, algae, ciliates, C. glutamicum cells, or other bacterial cells transformed with the nucleic acid sequences described herein, or the supernatant of the above-described cultures can be performed by various methods well known in the art. If the desired product is not secreted from the cells, can be harvested from the culture by low-speed centrifugation, the cells can be lysed by standard techniques, such as mechanical force or sonification. Organs of plants can be separated mechanically from other tissue or organs.
Following homogenization cellular debris is removed by centrifugation, and the supernatant fraction containing the soluble proteins is retained for further purification of the desired compound. If the product is secreted from desired cells, then the cells are removed from the culture by low-speed centrifugation, and the supernate fraction is retained for further purification.
[0254] The supernatant fraction from either purification method is subjected to chromatography with a suitable resin, in which the desired molecule is either retained on a chromatography resin while many of the impurities in the sample are not, or where the impurities are retained by the resin while the sample is not. Such chromatography steps may be repeated as necessary, using the same or different chromatography resins.
One skilled in the art would be well-versed in the selection of appropriate chromatography resins and in their most efficacious application for a particular molecule to be purified.
The purified product may be concentrated by filtration or ultrafiltration, and stored at a temperature at which the stability of the product is maximized.
[0255] There is a wide array of purification methods known to the art and the preceding method of purification is not meant to be limiting. Such purification techniques are described, for example, in Bailey, J.E. & 011is, D.F. Biochemical Engineering Fundamentals, McGraw-Hill: New York (1986). Additionally, the identity and purity of the isolated compounds may be assessed by techniques standard in the art. These include high-performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin layer chromatography, NIRS, enzymatic assay, or microbiologically. Such analysis methods are reviewed in: Patek et al., 1994 Appl. Environ. Microbiol. 60:133-140;
Malakhova et al., 1996 Biotekhnologiya 11:27-32; and Schmidt et al., 1998 Bioprocess Engineer.
19:67-70.
Ulmann's Encyclopedia of Industrial Chemistry, (1996) vol. A27, VCH: Weinheim, p. 89-90, p. 521-540, p. 540-547, p. 559-566, 575-581 and p. 581-587; Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons;
Fallon, A. et al. (1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17.

, CA 02405750 2003-04-03 SEQUENCE LISTING

<110> BASF PLANT SCIENCE GMBH

<120> PROTEIN KINASE STRESS-RELATED PROTEINS AND METHODS OF
USE IN PLANTS

<130> 16313-0036 <140> PCT/US01/11435 <141> 2001-04-06 <150> 60/196,001 <151> 2000-04-07 <160> 128 <170> PatentIn Ver. 2.1 <210> 1 <211> 695 <212> DNA
<213> Physcomitrella patens <220>
<221> modified base <222> (636) <223> a, t, c, g, other or unknown <220>
<221> modified_base <222> (680) <223> a, t, c, g, other or unknown <400> 1 gcacgagctc aatcctcatg tttcggactg tggactagct gcccttgcac catctggttc 60 tgaacgccag gtgtcggcac aaatgttggg ctctttcggt tacagtgccc ctgagtacgc 120 catgtctgga acctataccg tgaagagtga cgtctacagc ttcggtgttg taatgctgga 180 gctactcact gggcgcaagc ctttagacag ctcaagacca cgatccgagc aatctttggt 240 acgatgggcc acacctcaat tgcacgacat cgacgccctt gcacgaatgg tggatccgtc 300 gttgaagggc atctaccctg ctaaatcact ctctcggttt gctgatatag tcgccctttg 360 cgtccagccg gagcccgagt tccgaccccc gatgtctgaa gtggtgcagg cacttgtaag 420 gctgatgcag cgtgcgagtc tgagcaaacg cagatcggag tccgctgttg ggaattgagt 480 cgaacgagcc atctgagact tcacctttga gagtactgaa gcgcccacta gcctaatcgt 540 gcatctttgg ccatctcgtt tctgagtgga acacaaagct gggtatattc tttggtggtt 600 aagcaaccat ttgtcccaat ttgaacttcc gctggngaag gtctgtatgt tgagaaacga 660 tgcaaagcgt tcgcgtggtn tgcttgaact tcaaa 695 <210> 2 <211> 512 <212> DNA
<213> Physcomitrella patens <400> 2 ggcacgagcc gaacttcagc agcttcttca catcttcagg ttgcttggca ccccgaatga 60 gacaatctgg cctggtgtta gccagcaccg tgattggcac gagtttcctc aatggagacc 120 acaagatctg tcccttgctg ttcccggact cagcgcggtt ggcttagacc ttctcgccaa 180 aatgttggta ttcgagccct caaagagaat ctctgccaaa gccgccttga gccatactta 240 tttcgctgat gttgataaga cagcaaccta aacacaacag aacaattcaa gagaaccagg 300 taacctctac ctgtccaaga cgaaggacat ctaactcttc agtcaaactt ggccaatcat 360 gctgattggg aattgaacca caggaacgag gtgggcaccg tggttcgctg tagcatacaa 420 agtagtctgg aagacttgac atcgttagct ggcaatgcag tattttggaa atacaatttt 480 tcattaaaaa tctcctaaag attcaatatt tg 512 <210> 3 <211> 651 <212> DNA
<213> Physcomitrella patens <220>
<221> modified base <222> (608) <223> a, t, c, g, other or unknown <400> 3 gcaccagact atgacaagcg cacgcccttg cacatcgccg cgtccctgga ttgtgtccct 60 gttgctaaag tcctgcttgc ggaaggagca gagttgaatg caaaagacag gtgggggaaa 120 tctccgagag gcgaggcgga gagtgcagga tacatggaga tggtaaagct gttgaaggat 180 tacggggctg agtcacacgc aggtgccccg aggggccacg ttgagagtct gattcaggtt 240 gcccctccgt tgccttctaa ccgcgactgg gagatcgctc cgtcggagat tgaacttgat 300 accagcgagc tcatcggcaa aggctccttt ggagagattc ggaaggcgct ttggcgcggc 360 acacccgtcg ctgtgaagac aatcagacct tctctgtcca acgacagaat ggtcatcaag 420 gacttccagc acgaggtgca attgctcgta aaggttcggc acccaaacat tgtgcagttc 480 ctcggggctg ttacccgtca aagacctctc atgttagtca ccgagtttct ggcagggggg 540 cgatttgcat cagttgctga ggagcaccct aaatttggct cctgaccgca tcgtgaagta 600 tgccctcnac atagctcgcg gcatgtctta cttcaccatc ggagcagccc a 651 <210> 4 <211> 710 <212> DNA
<213> Physcomitrella patens <220>
<221> modified_base <222> (54) <223> a, t, c, g, other or unknown <400> 4 tccagcccat ttggttggcc acacacagct gttcatgagt cacccgcttc aggntgaact 60 gaagaaacgt aactccgtac ggctatttta ccaaattttc aagctcgttg tcccgccatg 120 atccaaatgg aagctcagtt tgcaacatga agtacattga acacacctac cgcccaccag 180 tcagaagcca ggccatgacc ttgtccttga atgatctcgg gtgctaagaa atcagccatg 240 ccacagactg tgaaagtgcg ctcatccgac atttgctttg caaaccgaaa atcaaccagc 300 tgaagtcgtc ctttccgatc tatcataaga acatcgggag agatgccacg atatacaacg 360 ccatccttgt gcagaagttc gacggctaat accacgttgg cgaccagaaa acgagctgag 420 ttctcgtcta aaggtgaccg aagtagaagt tctagaggcc cagctaacac acaattaaga 480 acgagtgcca cattgtcact gtcaataggg gtggccaaga gatgcggcac gaatggggaa 540 ggcctcagtt gcttgaaaag agttctctcc aataggactt ggccctcccg accgagtctc 600 tgaactttac gtctctggta ccttttcatg cttatgacgt catctgattt cttgcagagc 660 accacaccga catcacagca atcggttgaa tagacctggt gccgattcct 710 <210> 5 <211> 1271 <212> DNA
<213> Physcomitrella patens <220>
<221> modified base <222> (619) <223> a, t, c, g, other or unknown <400> 5 tatgcccatc ttctcatact cagaccagat cctctatttc aattacagaa gaaagttgct 60 tgtgcaacgt attgaaatca tcaccgtcat gggctttccg agtaaaaatt cttgtaatgg 120 ataaagtcat ttctagtctg atccatacaa gctaccgaca caatgctaga agccttgatt 180 tacacactac acactagaga gtctacaact cttttcctac actctgctta gttgcctcat 240 cctcaactcc ataaaccccc attcacaatc atgtaagact tgagagaggg aaacagtaag 300 caaccttgtg ctattttagt accagagcag aggatgaacc actagtcctc ccaacgtaag 360 ccctaattcg ccgcaacaac ctcacgacgg aactccgact tggtcaaggg tggacaatat 420 gatacattcg aaggtcgatt ttgcaaatgg gacgaagcag cggaattctg gctgcgcact 480 gattgcagag agccattctg ggggagttga gtatacacag tccagtcgta cacatggtcg 540 agctggaatt ttttctgaat gaaaagatca cggaacaagc ttcggaggta cagtagtcag 600 gctgctcgta aaaacctana cttcgcggcg tggtgcaaaa agtcggcaaa ttgactggga 660 tacccatcac aaagctcctc ccacagtggg ggtcatcttg attttgttgt gcatgtactc 720 gtgttgcttc tggtcagtga gggcgttgcc cgcccttccc ttgccatggc aaattgcctc 780 ttagaaagta cataagaatg taacccaagt gattctatgt catctcttct actgtgctcg 840 attcctctgt gctgattcct actagcgtac cgtgccgtcc ctgtgaagct cttcctatct 900 cggtaaggga tatgccttcg tgttgccggg tccatgtact cctttgccaa gccaaaatct 960 ataatgaaca cttggtttcc ttgccgaccg cagcccatga ggaagttatc cggcttcagg 1020 tcacggtgaa cgagccctcg agaatgcacg tattccaccc ggtcaatcat ttggtaaccg 1080 agcataatca cggtcttcaa cgaaaacctt agcccacaca ccttaaagag gtgcaacagg 1140 ttcggcccca ataggtctag caccatcaca ttgtagtctt ctgctgcttt tccgaaccat 1200 ctcatgttgg gcactccctt cccaccccgc aatatgttgt acaagcgcga ctcgtgcatt 1260 aactctcgtg c 1271 <210> 6 <211> 1910 <212> DNA
<213> Physcomitrella patens <400> 6 tttttttttt ccaatagatt tgcattacat aactccaagt tatgatatgt acaggttagc 60 aacaagctaa tggctgcaag cagtgaacat actaccaagg gagagattct cactccctag 120 acttcatcct cgtacgttac ttggcaagga ttatggttta gtgataaaaa gcttcacaag 180 ccggcaagca tgctggttgc ttctgctgca atctaatgat tatttcctta ggaatcgtat 240 ggcagagagc taccacacaa agcactgaca atggtttgat ggtaacaaga tagagatcca 300 ttcattccta agtatgagag acctgtagtc ttagcaccat tgtaggacag aaccaccgtt 360 ttcccctcaa tcaggctgtt gccaaatgta gagcaactct catcaacata acaagagggt 420 ttgatagaag acagagcccg gctatataac cacaagccct gcgcctacct tataacggct 480 tggatccacc tcaacagaaa gtgattcaac tcccttgata ccggctttcg taaatcctca 540 agttggcaga tggcggttgt ggatggcggc tagatatccg ctttgggtcc gaagtaactg 600 gagagctcct ctgcatccct gctgacgacc gtaagctggt gggaccaagc ttactgctcc 660 ctgttcgaga ggaatctacg acttctgctg atgcccctga gggcctgctg ctagatagga 720 cagctcgcct ggaggaagaa cccccccgag ttgcatacga agatgtatgc atgcgctctg 780 gttctgacac aacagcaaga gcagaatcct tagcagattc atcaagtcca ggacttttgt 840 gcttagatga gtccaaagca tttgcgaccc cggagccatt tgctcctcca ggaagcctgc 900 gccgagaagg atccattggt tcggtgggcc gctgcaggtc tcggcttcct gtagccccag 960 ttccaagtgc accactggtt tgccctgcag aagcacccag tcgagttgaa ctgccaccgg 1020 aaatttgtga ctgctggtac ttcagaattg tccagtcaaa aacgtagtca aattgaaaac 1080 ctgtaaaact atttccagtt taggcaaaca gaagtggcac tgtaataaac tgaaaatcat 1140 caaacattca caaactatct gttcgttgat agagcatagt aaagtctgcg cttaggatca 1200 agtcttgata cattacaatg cccaagcaag agtgaaacct acaaaagtta cagttttcat 1260 accctcacga ataaagaggt cacggaagat tcttttcaaa tatgcatagt cgggtttgtc 1320 atcaaaacgc aaggaccggc agtagtggaa gtacgctcgt gcgaattctg aaggataatt 1380 tttacaaagg acctcaatgg gcgtggacat ttgttttctc actgatcttc tcgtacttct 1440 gcttcttggt tcccgctttc agtccttgcc catggaagac tgcctctcag gaagtacatg 1500 agcacatatc caagagattc caaatcatct cgtctgcttt gctcaatacc aagatgagtg 1560 ttgatgcttg cataccgagc agtccctgtc agatttttgt tctccctgta gggaatatgc 1620 tgatgcgtgg aagggtcgcg gtacttcttg gcaagaccaa aatcaataat gtagacctgg 1680 tttgctcgcc taccaagccc cattagaaaa ttatcaggct tgatgtctct atgaagaaag 1740 cttttcgcat gcacatactc cactctgttg atcagctggt cagcaagcat gagaacagtc 1800 tttaaagaga acttccggct gcagaagttg aaaaggtctt cgagacttgg ccccaacaga 1860 tccagaacca agacattgta gtctccttct atcccgaacc atcctcgtgc 1910 <210> 7 <211> 720 <212> DNA
<213> Physcomitrella patens <220>
<221> modified_base <222> (58) <223> a, t, c, g, other or unknown <220>
<221> modified_base <222> (612) <223> a, t, c, g, other or unknown <400> 7 cggtggggcg ctccccaata ttttatcccc ggggctgcag ggaatccggc gaccagtntt 60 tgaaggtgtc aacgccgtga atagtgagcg ttgcgttatg aagattttga agccagtaaa 120 gaaaaaaaag atcaaaagag agatcaagat tctgcaaaac ctttgtggag ggcccaacat 180 tgtgaagctt ctggacattg tccgtgatca gcaatcgaag acacccagcc taatttttga 240 gtatgtgaac aatactgatt tcaaagtgct ctaccccact cttacagact ttgatatccg 300 atactacatt catgagctgc tcaaggcttt ggactattgc cattctcaag ggattatgca 360 cagggatgtg aagccacaca acgtgatgat tgaccatgag cagcggaagc ttaggcttat 420 tgactgggga cttgccgaat tctatcatcc tggcaaagag tataatgtgc gtgttgcctc 480 taggtacttc aagggtcctg agctgctggt tgatcttcaa gattatgatt actctctcga 540 catgtggagc tctggggtgc atgtttgccg gcatgatatt tcggaaggag ccattctttt 600 atgggcatga canttcatga tcaacttggt gaagatcgct aaggtgttgg gaacttgatg 660 aattgaattc ctatctaaca aataccgcta agtggacccc attggagcac ctggtggggg 720 <210> 8 <211> 953 <212> DNA
<213> Physcomitrella patens <400> 8 gcacgaggaa ctaacgaatt gtcattctat aatccaatag tgtaatcaca cgggggggaa 60 taagttgcaa aaccatacaa cgccgggata gcgttgtagc cacctaaaga attgagagta 120 ggccttacaa cttgagatga agtgtgaagt ggtactgcac catatcatca ggacctaagc 180 tgcaatccag agcctccctc caaatgagat ccctgatagg ctcctccgag atagagggct 240 cctcgaagcc aaactcgaag ggagataccg agccaggctc atcgttgatg tcatgaagtg 300 aagcttaaat aagggtgcgc caaggcagct tccactgtga ttcttttcgc tggatcaaag 360 accagcatct tttcaacaag atcaagagca gaacgattaa tgcctctgaa cttctgggtt 420 aagggaatag gcgactgtcg aggcaggtgc ttgatatacc gcctagcatt gtcgcttctc 480 aaaaacccaa gatccctatc ttcaggagtt ccgatgagtt ctgtaattag gcggagctga 540 tgcacatagt ctctcccagg gaacaacgca gatcggttaa gcaactccat gaagatgcac 600 cccacagacc aaatgtcaat agctgcagtg tatgctgaac aattcaggag cagctctgga 660 gctctgtacc acctcgttac aacatactca gtcatgaaat ccgtttcaga gagagtgcgt 720 gccaagccaa aatctgcgat tttcaaatcg caattggcat tgacgagaag gttggtgggc 780 ttcaagtccc ggtgcaagac gttcgccgaa tggatgtact tcaagccccg caagatttga 840 tacagaaaat actgacagtg gtcttctgtg agagcttgat ttgaacgaat gatctggtgt 900 aggtccgtat ccatcaactc gtatacaatg tacacgtcgt tgaaatctcg tgc 953 <210> 9 <211> 683 <212> DNA
<213> Physcomitrella patens <220>
<221> modified_base <222> (603) <223> a, t, c, g, other or unknown <220>
<221> modified_base <222> (610) <223> a, t, c, g, other or unknown <400> 9 cggcaccagc ctcgctggag accgaccatc gaagcacctt aagctcgttt tcattcggca 60 ttgcttgcga gcacttcgac ttcctagaat ttcaatagac ctaatggaat cgccactccc 120 taatctttcc ggagaggcct tatcgccgac ggcaactgcc gaagacgaga ttactcagat 180 gatactaaaa agtgccgcaa ggtccgaatt aggaatgtat gtttcgaaga gacaggaatt 240 ctatcttcga agagcgcgga ggcggcgtaa gtttgcgtgg aagccggttt tgcagagcat 300 ctccgagatg aagcctgtca tggaattcca cactccgatg gcttaccggg atagtgggtc 360 tccgccgaag aacgcctcta ccccatcctt acctggcccg aagaacattt caccgccacg 420 acaagtgagt gtcccgcaaa ggagcagtcc tccgccgaag aacgtctcac cacctcccca 480 gcccggcatt ttgtagcgcg gactgcgatc gaagtattct gctgcatctc agcaagttca 540 acgaaatcga gggcaacgcg aaatctcttt tatatggcgt agtttgtgtc tccgactgga 600 ctcctatcta tccccatcga gataactgat tcggtggata atttctccaa attttggcta 660 acncaagaan ctcaagggcg aat 683 <210> 10 <211> 1156 <212> DNA
<213> Physcomitrella patens <220>
<221> modified_base <222> (923) <223> a, t, c, g, other or unknown <220>
<221> modified_base <222> (1143) <223> a, t, c, g, other or unknown <400> 10 gcacgaggtt ggtgtaagtt attgatagtg ctgtgcaatt cacagttttg ctactccggt 60 aggtccgacc tcttcaattg tcagtttaaa aactctaaaa acatttgaga aaagtgttga 120 aaaatctccg tgaggaaatt ccttgtcgca agacgtgaaa aaaagaagaa agaagatgga 180 aatattgttt tgggtatcga agaagtgttc gatgctgtgc aataaggaaa gaaaaagtgc 240 aggtaacata aaaagctagc atggtgatga taatataaga ccccgattaa cacacttatg 300 gattgtttca tgagctgcac gttctcagcg acaaatgggg ctcattgaga aaactccact 360 ttctataagg ttgggaaacg agcgtttttt ttttgaagat gttttttccg tcaatctgat 420 ttgatatcgt tctcaacttg accacatatg actatataag gaaaaggcat tgagaaagtg 480 gcggattggc gaggtagttc gaccatgctt ttggtaaagt cccttgaagt tcagtggtgg 540 atcaggcttg tggtagtgac agtctctgca cgccatgcga ggctaacttt aagttacaaa 600 atcttgctca aatggtactc ttcctcgttg tacttttgca ggaacggatg tttaagtaaa 660 tcagtagttg atggtcgttc actgggacat ttccggatgc aggattcaat aaaagaacaa 720 aattcggggg agaatttgtc aggggatgcg gctgcggggg gttgattaac tatacattcc 780 atgaggatga agaaattttg ccaaccctct tccattccag ctggtttgta tgggaaggta 840 cccaacgcac actccaaaag agtcaatcct aaactccata ggtcactgtc gtatgcatac 900 gaacgcccct gaaggcgttc tgncgacata tatgtgcaag tcccaacgaa cgtgtctcgc 960 tgggccaagg aatgaaccaa cacagcactg acaccaaaat cagatatttt gacctcaccc 1020 ttgtgattga tgaggaggtt ggagggcttt atatcacgat gtatgatgtg cctgacttgg 1080 tgtaggtatt ccaatccctt cagaacttga ctagcaatga cggccaaata cggctcaggt 1140 atntgctttc tggtgc 1156 <210> 11 <211> 629 <212> DNA
<213> Physcomitrella patens <400> 11 tccccgggct gaggaattcg gcacgagcgg ttgatcctca cccttgggaa ggaccctgga 60 attgagtagc gtgcggaagc tgcatcgatc cggaagagac gatgagtagg agagtgagaa 120 ggggaggtct tcgcgtcgcg gtgccgaagc aagagactcc cgtcagcaaa tttttgactg 180 ccagtggaac tttccaggat gatgatatca agctcaacca caccgggctt cgcgtcgtct 240 cttcagaacc taaccttcct acgcagacgc agtctagctc cccagatggg caactgtcaa 300 tagcagacct ggagttagtg cggttcttag gaaagggtgc gggtggaacc ggtgcagctt 360 ggtccggcac aaatggacca atgtcaatta tgcactgaag gcgatacaaa tgaatatcaa 420 cgaaacagtg aggaagcaga ttgttcagga gctgaaaatc aaccaagtga cgcaccagca 480 gtgcccttat atcgtggaat gcttccactc cttctaccac aacggcgtca tatccatgat 540 cctagagtac atggacaggg gctcgttgtc cgacattatt aagcaacaaa agcagatacc 600 tgagccgtat ttggccgtca ttgctagtc 629 <210> 12 <211> 514 <212> DNA
<213> Physcomitrella patens <400> 12 gcaccagccg agtcgggcat ttttcgtgcg gtgttgaggg ctgacccgag ctttgaagaa 60 gccccttggc cttccatctc tcccgaagcc aaggatttcg tgaagcgtct cctgaataag 120 gatatgcgga aacgcatgac tgctgcacaa gctttaactc atccatggat tcgaagtaac 180 aacgtgaaga tacctctgga tatcttagtg tacagacttg tgaggaatta tcttcgtgca 240 tcatccatga gaaaggctgc tttgaaggcc ctgtcaaaga ctttaaccga agacgagact 300 ttttatctac gtactcaatt tatgctgcta gaaccaagta acaacggtcg tgttactttt 360 gagaatttca gacaggcact gctgaaaaat tcaacagagg ccatgaaaga gtcacgggtt 420 tttgaaattc tggaatcgat ggatggtctt catttcaaga aaatggactt ttcagagttc 480 tgtgcagcgg ccattagtgt tctccagtta gaag 514 <210> 13 <211> 1387 <212> DNA
<213> Physcomitrella patens <220>
<221> modified_base <222> (1385) <223> a, t, c, g, other or unknown <400> 13 gcacgagctc ctgcatctcc ccctccttct cctcctcatc attctggagc ccagcgaact 60 gcgatctgag attccaactt ggaagggcct cgcgtaagca ccggagctcg tttcttacgc 120 ttttgcgcct cgcgatattt gtacattgtt tcctctggtt ttattcgatt ccgcctctga 180 aaatgtgaac gggctgcaag cttggttttg gagcaacgtt ggagcattga agggttgcgc 240 tcgtccctgc ccattcctcg cttctgctct ggcctatgtc atgacgacgt gaaggagagg 300 atttgagggt tttgcaagtg atataatcct ccccgaggag atttctgtga gttgattaac 360 ttggatcagc gacatgggga acactagttc gaggggatcg aggaagtcca ctcggcaggt 420 gaatcaggga gtcgggtctc aagacacccg agagaagaat gatagcgtca atccaaagac 480 gagacagggt ggtagcgttg gcgcaaacaa ctatggcgga aagcacaagc agtggtgctc 540 aggccggaga acgatccacc tctgcgcccg ctgctctgcc gaggccgaag ccagcatcga 600 ggtcagtatc cggtgttttg ggtaagccgc tgtcagatat tcgtcaatct tacatcctgg 660 gacgggagct tggccgaggg cagttcggag tgacttactt gtgtactgac aagatgacga 720 atgaggcgta cgcgtgcaag agcatcgcca aacggaaact gaccagtaag gaggatatcg 780 aggatgttaa gcgggaggtt cagattatgc atcacctgtc ggggacaccc aatatcgtgg 840 tgttaaagga tgtgttcgag gacaagcatt ccgtgcatct tgtgatggag ctctgtgcag 900 gtggcgagct cttcgatcgc atcattgcca aggggcatta cagtgagcgc gccgctgccg 960 atatgtgcag agtcatcgtc aatgtggtgc acagatgcca ctcattaggg gtcttccatc 1020 gggatctcaa gccagagaat tttctgttgg ccagcaaggc tgaggatgcg cctctgaagg 1080 ccacagactt cggtctgtca actttcttta agccaggaga tgtgttccag gatattgttg 1140 gaagtgcgta ttacgtggcc cctgaagttt tgaagagaag ttatggtcct gagctgatgt 1200 ttggagtgca ggcgtgattg tgtacattct gctgtgtggt gtacccccct tctgggctga 1260 aactgagcag ggtatctttg acgctgtgct caaagggcac atagacttcg agaacgagtc 1320 catggccgaa aatctccaac ggggctaagg atttggtgag gaaaatgcta aaccctaacg 1380 tgaanat 1387 <210> 14 <211> 2784 <212> DNA
<213> Physcomitrella patens <400> 14 atcccgggtg agtatcactt acggtggcga gggatggcct ttggggtagg agctggtata 60 tgcggagtcc aacagaagct tgtgcaggac tcttgagttg tgcgtgcgag ggctgagtgc 120 cggaaaggta ttttccgacg aagagtcaat gtgggcgtgg acaaacgttt gaagagatgg 180 gtgtggatat gaaggctccg gctaagcagt cgctgggagt cggactgctc ctgtgctctg 240 tagtgatcct ctcggtggtg agctctgtgt atggccaagt tcagacagat ccagtggata 300 ctacaggctt aatttccatg tggtatgact taaaacagag tcaatctctc acggggtgga 360 ctcaaaatgc ttctaaccct tgtgggcagc agtggtacgg cgttgtatgt gatggctctt 420 ctgtcacgga aatcaaaatt ggaagtcggg gtttgaatgg aaattttaat ccttcgtact 480 ttcaaaacgc ttttaaaaag cttcgaattt ttgatgctag taacaacaac atcgaaggaa 540 atattcctca acagtttcct acgtctctta ctcaaatgat attgaacaac aataaattga 600 ccggaggtct cccacagttt gatcaattgg gcgccttgac agtcgtaaac ttgagcaaca 660 acaatctgac cggcaacatg aaccccaact atttcaatgt gatcgtgaat gtggaaacct 720 tcgatgtttc ctataaccaa cttgaaggca ctcttcccga ctccattcta aacctggcca 780 agcttcgttt cttgaatttg cagaacaata aatttaatgg taaacttccc gacgatttct 840 ctcggctgaa gaatttgcag actttcaaca ttgagaacga tcagttcacg ggtaattatc 900 catcaggttt acccagtaat agcagggttg gaggaaatcg tcttacattt cccccacctc 960 cagcccccgg cacacctgct cccaggactc cttctccttc aggaacatcg aatggatcat 1020 cgtcgcatct ccctctaggg gcgatcattg gaatagccgc tggtggtgct gtgctgcttt 1080 tattactagc actcggcatc tgtttgtgtt gtcgtaagcg gtccaagaaa gcattgggcg 1140 atccagaggc cacgaccagc agccgaagac cgtggttcac acctcccctc tccgcaaaga 1200 gccagagtga tcccagcaag agcatagaca aaacgacgaa acgcaacatc tttggcagca 1260 gtaagagtga gaagaaaagt tcaaagcaca gagtatttga gccagctcct cttgacaaag 1320 gagcagccga cgaaccagtg gtgaaggcgt ctccgcccgt caaggtactg aaggctcctc 1380 cttcatttaa gggtatcagc ggcctgggtg ctggacattc gaaagcaaca attggcaagg 1440 tgaacaagag caatattgca gccaccccat tctctgtagc ggatcttcag gcagccacaa 1500 acagcttctc ccaggataat ctgattggag aagggagcat gggtcgcgtg tatcgtgccg 1560 agtttcccaa cggccaggtc ttggccgtga agaagatcga cagcagcgcg tcgatggtgc 1620 agaatgagga tgacttcttg agtgtagtag acagtttggc tcgcctgcag catgctaata 1680 cggctgagct tgtgggttac tgtattgaac atgaccaacg gctgttggtg tacgagtacg 1740 tgagtcgtgg aaccctgaac gaattgctcc atttctcggg tgaaaacacc aaggccctgt 1800 cctggaatgt ccgcattaag attgctttgg gatccgcgcg tgctctggag tacttgcacg 1860 aagtctgtgc acctcccgtg gttcaccaca acttcaaatc tgccaatatt ctgctagacg 1920 atgagctcaa tcctcatgtt tcggactgtg gactagctgc ccttgcacca tctggttctg 1980 aacgccaggt gtcggcacaa atgttgggct ctttcggtta cagtgcccct gagtacgcca 2040 tgtctggaac ctataccgtg aagagtgacg tctacagctt cggtgttgta atgctggagc 2100 tactcactgg gcgcaagtct ttagacagct caagaccacg atccgagcaa tctttggtac 2160 gatgggccac acctcaattg cacgacatcg acgcccttgc acgaatggtg gatccgtcgt 2220 tgaagggcat ctaccctgct aaatcactct ctcggtttgc tgatatagtc gccctttgcg 2280 tccagccgga gcccgagttc cgacccccga tgtctgaagt ggtgcaggca cttgtaaggc 2340 tgatgcagcg tgcgagtctg agcaaacgca gatcggagtc cgctgttgga attgagtcga 2400 acgagccatc tgagacttca ctttgagagt actgaagcgc ccactagcct aatcgtgcat 2460 ctttggccat ctcgtttctg agtggaacac aagctgggta tattctttgg tggttaagca 2520 acattttgtc acaatttgaa cttcagctgg agaagggtct gtagtgttga agaaaacgaa 2580 tgcaaagcgt ttcggcgtgg atgtgctttg agaacttaca aaactcatca agactttgaa 2640 gatctttgta ttgcatcgaa tcctttcaat cagtctcggg taggatcagt tcctctgtat 2700 cggataccct tttcatccta acatgggacc cttttaatcc agaggatgga gtgcttggaa 2760 tagtgacctt ggtcgagtta acgc 2784 <210> 15 <211> 1088 <212> DNA
<213> Physcomitrella patens <400> 15 atcccgggag tgggtggttg gactgtaagg agctagcgtt ttagagctac agtgcggttt 60 gctgtgtgag tgagtgagtg agtgagtgcg tgagtgagga tgtctgtttc tggtatggac 120 aactatgaga agctggagaa ggtaggagag gggacttacg gaaaggtgta taaggcccgt 180 gataaacgct ccgggcagct ggtggcgctc aagaagacta ggttggagat ggaggaagaa 240 ggcgtccctt ccaccgcttt gcgcgaagtt tcgttgctac aaatgctctc ccacagcatg 300 tatatcgtca ggctactttg cgtggagcac gtcgagaaag gcagcaagcc catgctctac 360 ttggtctttg aatatatgga cactgatctt aagaagtata ttgacttgca cggtcgtggt 420 ccgagcggga agcctctgcc tcccaaagtg gtccagagtt tcatgtatca attgtgcaca 480 gggcttgccc actgtcatgg ccacggagta atgcacaggg atctgaaacc ccagaatttg 540 ctcgtcgaca agcaaacccg tcgtcttaag attgccgacc ttggtctcgg tcgggcattc 600 acagtgccaa tgaagagtta cacacacgag attgttactc tatggtaccg agctcctgaa 660 gttcttcttg gagcgaccca ctactctcta cctgtggata tctggtctgt tgggtgcatc 720 ttcgctgaac tcgtccggaa aatgccgctc ttcactggag actccgaact tcagcagctt 780 cttcacatct tcaggttgct tggcaccccg aatgagacaa tctggcctgg tgttagccag 840 ots .61voqq3eq6 wei-4615.46 6yq.66356.61 61.py.6.431-4 366.4335B-4v oq.56.ev3R5B
ogt veoqzeolvE, v6333va5eq qoqq.zeblob Bzeobblaw qfieovolqw vaBobv.64E6 ozt 634.6wevea6 yvya6-4.41SE. 31441y6qqb 643Bypqqou BorMyre.6.6 oqybyze.64-e 09E qqpq.45.4-ebo powwqrob 6.4.63.4p4eqb qqba6.6ze.6.5 vvora6.43.4q.
ovvfolboof=
opE elqvq65.45D vvo353q66q 3qqq.463q36 vowEs6v.63 vftqlqpoep qbfoqqaeqo otz qq3vv5v43.4. po6.65.4obvq. 1.6q64.611ve 1.13.4zEowv a661.6wevae BqfeeprEqqv 08/ 33oov336.6 qqaqolvofo obqboqleoo 0311.3366e6 loyeafteol 11-43qovvbe oi 554e333 16.evo3666v 6653663 v6e6v3ll6e velbovbefee povq.6.6veve 09 fteobeezeo lbovEtzefieo qvve5v23.6.4 D436.455161 .6.6oz5Te.616 -4055.6pooze LT <00t>

sued vIT ailTwoosAqd <ETz>
Vaa <ZTZ>
TttT <TTZ>
LT <OTZ>

LZ9T obovvqq.
0z9/ 53wbze.6.45 oTeqftboop pqrveftvq.4 aeozeobqa6 Bzeva63.4.4q opftwqqa6 09s/ voovpqqqoq ozeb1.46.6vo .63.43-4Bova6 qqoa6s6.4.64 3.6.4qqabqvp vqoq.66.4vo5 00s/ 5ve5el5q.e5 51.4q3vEmpo eofte5.4voe Boblzepeop Efoeboowq wqq-Teva61 ott/ Boopoovfor esftooBefie 33qa.413643 .431.4e6.613v 616ev3q156 qvqobblze5 09E/ voefoofooq pobeolTeep 31646.43/eqq 33.6172e3lae 1.6.e.eq3wevo Tebqpfeebzl.
ozE/ w3ve336.66 3we64Te615 3l3viee36q3 olveoborbo qloqva5.4qo Teovba633.4 09z/ 3Te3.4.63463 ovfievv3336 TTeSe6.4.4pq 43.61q.e.65.eb zeq&Tevq.65 v63.4overve 00z/ voq6olvevb ogboqqloae porSoberfo 3popze1.633 v31E6436'44 e6Emb3qefi1 otrE we35.6-we6qv evovooppoq vq.63.evv3o3 5e5eBze5e.6 vooftEobveq pbovBeEmqo 0601 .61.45.eq3v3g op.643.63s63 vqv36ze65 v3R6.6.e.64q.4 633.4363.463 65evbqq161 ozo/ vaebqeweqq vwe6lev.6.64 .41=114164 Bov.63q633.4 eeeoefiaelo opevolvove 096 665 133.63.6.6.4v3 vwe5eoelq6 e66613e66.6 6566 &45 vpovq.615.4.9 006 6Te36q.eql3 6eeel6ae63 werwfteo6 v6-4.ov.6.6oqq os60653.46B Ep5qa6vEze 0t8 35v6ve63vE. .5.1.6v4polvo verbopoort. rowlvbabo prooTeoqvo 336v36v6E.
ogL ogyvoyoggo 3vq43.45-ze3 56ofogo6eq porBoiappE Tegbpp64,53 qroBoovEgo ozL 3wb.5.41zep q3p3ev35.6 BRE.10.6.44.6e ogypEsqqwe6 ob6.6.6.6e3BE .431-4zEm53a 099 v3z6v.41.6.4v 3:1 3e6 g3q5333el4 B.4365E6343 3.4.4.6v35.4.61 qvaeeepoov 009 3.5.63z455se eq63.43.6.41e v3616.6s63e 3633lq3v.6 5ev3iv3q66 qve6v3e63e ots vooqblowq looeftoqpe 3eEme61633 .63.4.633ovov 365363E611. lo6a66-evE6 ogt 34qvfm6e65 qq.4336356v vva663ivoq oft.636voov qs6.1.1ovefiq qe5eE6ol.63 ozt owfogybef. Mweboboo velolloa61 q63oloo=6 qq66volqv5 qoz6vae5lq 09E 53y33.6.656y 530336155e obovoyoqft 5136.65.63-eq le5Emv541E. loftveq.E.Bq 00E vbebBlvoeq v.65r3Bl5v5 e6.6o.656..63.6 5e5rEp33q evv5.6E551.6 Bvp.e&weevo otz 5zet.51.4.5.e5 vaBefees.BB 36 3533 5vveq36445 4333.4.61611 e5&1330.4B3 061 63o.63.4v3e3 .6.4.4333.63v3 636 36:1e q3e663.6q35 q.e.e6163w5 vofievoebve oz/ efigebqoqqy 33e5.6veq4B la6.65B1Boe BoBeqbefift 64643668.43 v36wev.663 09 v363643635 5wev6Em85 ve.6361vEm3 6EeTeee634.4 voftrftboe v3565333qt.
91 <00t>

suaqvd vvreal.TwoosAtid <ETZ>
<ZTZ>
LZ9T <TIE>
91 <OTZ>

8801 oboveqqb 0801 6ve63v6ev3 3.4.6q33elal o3et.155e3o vefteevoqq vvovvEepre peovveqopv OZOT v35v3v6veq 26.41.6q126.43 Boqzzelwe Tepo&ehlqo oboofievvoo 6.43q3zweft 096 5evv343336 e53lTe1.66q q.6.4.wese336 owqqopeft 4'4366'41653 Bobeowebn 006 o33lq54361 .4.333.4.613qv 6ev3r33v6v Sbzweolool. qlfeeBov36.6 11e6q6ope3 0-170-00Z OgLg017Z0 VD

ttgcaaactg agcttccatt tggatcatgg cgggacaacg agcttgaaat ttttggtaga 600 atagcccgtc ggcagcttac gtttccttca agtttcagcc ctgaagcggt tgacctcatt 660 gacaagctgc tggtggtgga cccaaccaag agactgggct gtgacagcca tggatcgctt 720 gccataaggg aacatccttg gttccgaggt ataaactggg acaagcacct cgattgcagt 780 gtggaagttc cttcagagat catgacacgc cttcagttgg ccatagactt tcttcccgtg 840 gatgatagtt atcaagtgtt tgatctccaa cccgatgaag acgatccacc atggcttgat 900 ggctggtgat agcttgatgg ctcgtagatc ccccttctcc aagcatcaat ggcacagtac 960 cgaatggcta taacagaaga tgcacattaa gtgctccatg aacagatacc gtagcgctta 1020 ggatttttcg gtcgtcacaa atgacggctc tcttgtgagg ttcgaatgtt gtgtcacccg 1080 atgatctcta ctggcacaaa cctccaggct gaatcttaag gccagctgtt ttaggtgaga 1140 cgtttacctt ggttcgaact cacgctcgtg ttgttaagcg cgagtcgatg atgtatgaaa 1200 tgacggtgtt ccttgaaagt cttgaaaggc aatcaattcg cttatgtgtg tcccttccat 1260 gtggtcatta gggaagggaa ccgctgcact agtcagtaaa cgaacatggc ttcaattgta 1320 tagcatagcg gtagaggttt cgtacgaaat gtggttgcag tcggtgatta taggcgcatt 1380 tctctgaaca tgcacgagaa tcgtgctcct gagtctccat cattcagtgg tgcgagctcg 1440 <210> 18 <211> 1736 <212> DNA
<213> Physcomitrella patens <400> 18 atcccgggct cacgtagtgc actgaactct gtctgaattt taggggatga gaggtagatt 60 tgaagaatac tggtgtctaa ttttctgtta atttttcacc cttgaggtag ctcatggatt 120 tgggaggtga tcgcatgaga gctcctcaga ggcagtctcg agaatatcaa tatagatcat 180 tggacgtctt cacagagcag cacgagcagt tgcaaaagca gcagcagcaa gatgagtatc 240 agagaacaga attgaagctc gagacactgc caaaaatgtt aagcaatgcg accgtgtcat 300 cttcccctcg aagcagtccg gatggacgta gactacgtac agtcgcgaat aagtatgctg 360 tggaaggtat ggttgggagt ggcgcattct gcaaggtgta tcagggctcc gatttgacga 420 accacgaggt tgtgggcatc aagctggagg atacgagaac tgagcacgct cagttaatgc 480 acgagtcgcg cttgtacaac atattgcggg gtgggaaggg agtgcccaac atgagatggt 540 tcggaaaaga gcaagactac aatgtgatgg tgctagacct attggggccg aacctgttgc 600 acctctttaa ggtgtgtggg ctaaggtttt cgttgaagac cgtgattatg ctcggttacc 660 aaatgattga ccgggtggaa tacgtgcatt ctcgagggct cgttcaccgt gacctgaagc 720 cggataactt cctcatgggc tgcggtcggc aaggaaacca agtgttcatt atagattttg 780 gcttggcaaa ggagtacatg gacccggcaa cacgaaggca tatcccttac cgagatagga 840 agagcttcac agggacggca cggtacgcta gtaggaatca gcacagagga atcgagcaca 900 gtagaagaga tgacatagaa tcacttggtt acattcttat gtactttcta agaggcaatt 960 tgccatggca agggaagggc gggcaacgcc tcactgacca gaagcaacac gagtacatgc 1020 acaacaaaat caagatgaac accactgtgg aggagctttg tgatgggtat cccagtcaat 1080 ttgccgactt tttgcaccac gcgcgaagtc taggtttcta cgagcagcct gactactgtt 1140 acctccgaag cttgttccgt gatcttttca ttcagaaaaa attccagctc gaccatgtgt 1200 acgactggac tgtgtatact caactccccc agaatggctc tctgcaatca gtgcgcagcc 1260 agaattccgc tgcttcgtcc catttgcaaa atcgaccttc gaatgtatca tattgtccac 1320 ccttgaccaa gtcggagttc cgtcgtgagg ttgttgcggc gaattagggc ttacgttggg 1380 aggactagtg gttcatcctc tgctctggta ctaaaatagc acaaggttgc ttactgtttc 1440 cctctctcaa gtcttacatg attgtgaatg ggggtttatg gagttgagga tgaggcaact 1500 aagcagagtg taggaaaaga gttgtagact ctctagtgtg tagtgtgtaa atcaaggctt 1560 ctagcattgt gtcggtagct tgtatggatc agactagaaa tgactttatc cattacaaga 1620 atttttactc ggaaagccca tgacggtgat gatttcaata cgttgcacaa gcaactttct 1680 tctgtaattg aaatagagga tctggtctga gtatgagaag atgggcatgt taacgc 1736 <210> 19 <211> 1900 <212> DNA

<213> Physcomitrella patens <400> 19 atcccgggtt gtcgaggacg gagagagaag agagagagag agagagagag aggtgttgtt 60 taggggaggc atgcgggagc aggattggtg ttaagttcgt aaggagaagg gagtacatgc 120 aagtgcgtgc ttgtcggata tcggacagct ggatttgtaa ataagcggag aggagggtcg 180 gtaatcaggg gcgtacatcg atggagccgc gtgtgggaaa caagtatcgg ctgggacgga 240 aaattgggag cggttccttt ggggagatct atcttgggac caatgttcag accaatgagg 300 aggtcggaat aaagctggaa agcatcaaga cgaagcatcc acaattgctg tacgagtcca 360 agctctaccg gatactacaa ggaggaactg ggattcccaa tatcagatgg ttcgggatag 420 aaggagacta caatgtcttg gttctggatc tgttggggcc aagtctcgaa gaccttttca 480 acttctgcag ccggaagttc tctttaaaga ctgttctcat gcttgctgac cagctgatca 540 acagagtgga gtatgtgcat gcgaaaagct ttcttcatag agacatcaag cctgataatt 600 ttctaatggg gcttggtagg cgagcaaacc aggtctacat tattgatttt ggtcttgcca 660 agaagtaccg cgacccttcc acgcatcagc atattcccta cagggagaac aaaaatctga 720 cagggactgc tcggtatgca agcatcaaca ctcatcttgg tattgagcaa agcagacgag 780 atgatttgga atctcttgga tatgtgctca tgtacttcct gagaggcagt cttccatggc 840 aaggactgaa agcgggaacc aagaagcaga agtacgagaa gatcagtgag aaaaaaatgt 900 ccacgcccat tgaggtcctt tgtaaaaatt atccttcaga attcgcctcg tacttccact 960 actgccggtc cttgcgtttt gatgacaaac ccgactatgc atatttgaaa agaatcttcc 1020 gtgacctctt tattcgtgag ggttttcaat ttgactacgt ttttgactgg acaattctga 1080 agtaccagca gtcacaaatt tccggtggca gttcaactcg actgggtgct tctgcagggc 1140 aaaccagtgg tgcacttgga actggggcta caggaagccg agacctgcag cggcccaccg 1200 aaccaatgga tccttctcgg cgcaggcttc ctggaggagc aaatggctcc ggggtcgcaa 1260 atgctttgga ctcatctaag cacaaaagtc ctggacttga tgaatctgct aaggattctg 1320 ctcttgctgt tgtgtcagaa ccagagcgca tgcatacatc ttcgtatgca actcgggggg 1380 gttcttcctc caggcgagct gtcctatcta gcagcaggcc ctcaggggca tcagcagaag 1440 tcgtagattc ctctcgaaca gggagcagta agcttggtcc caccagctta cggtcgtcag 1500 cagggatgca gaggagctct ccagttactt cggacccaaa gcggatatct agccgccatc 1560 cacaaccgcc atctgccaac ttgaggattt acgaagccgc tatcaaggga gttgaatcac 1620 tttctgttga ggtggatcaa agccgttata agtaggccca ggcttgtggt tatatagccg 1680 ggctctgtct tctatcaaac cctcttgtta tgtagatgag agttgctcta catttggcaa 1740 cagcctgatt gaggggaaaa cggtggttct gtcctacaat ggtgctaaga ctacaggtct 1800 ctcatactta ggaatgaatg gatctctatc ttgttaccat caaaccattg tcagtgcttt 1860 gtgtggtagc tctctgccat acgattccta aggttaacgc 1900 <210> 20 <211> 1217 <212> DNA
<213> Physcomitrella patens <400> 20 gcgttaacgg gaggaaggtc gggggaagag acgcttgagg ctgctgaaag gggattcact 60 cagcgtcccc acccattcgt caatctggcg cagaagatcg gaaaatcggt ccgacggcca 120 ggtgttatgt ccaaggcccg ggtttacaca gatgtgaatg tccaacgtcc gaaagattat 180 tgggactacg aggccctcac cgtccaatgg ggggaccaag acgattacga ggtagtgcgt 240 aaggtggggc gagggaaata cagtgaggtt tttgaaggtg tcaacgccgt gaatagtgag 300 cgttgcgtta tgaagatttt gaagccagta aagaaaaaaa agatcaaaag agagatcaag 360 attctgcaaa acctttgtgg agggcccaac attgtgaagc ttctggacat tgtccgtgat 420 cagcaatcga agacacccag cctaattttt gagtatgtga acaatactga tttcaaagtg 480 ctctacccca ctcttacaga ctttgatatc cgatactaca ttcatgagct gctcaaggct 540 ttggactatt gccattctca agggattatg cacagggatg tgaagccaca caacgtgatg 600 attgaccatg agcagcggaa gcttaggctt attgactggg gacttgccga attctatcat 660 cctggcaaag agtataatgt gcgtgttgcc tctaggtact tcaagggtcc tgagctgctg 720 gttgatcttc aagattatga ttactctctc gacatgtgga gcttggggtg catgtttgcc 780 ggcatgatat ttcggaagga gccattcttt tatgggcatg acaattatga tcaacttgtg 840 aagattgcta aggtgttggg aactgatgaa ttgaattcct atctaaacaa ataccgccta 900 gagctggacc cccatttgga agcactggtt ggcaggcata gcaggaaacc ttggtcaaag 960 ttcatcaatg ctgataatca gcgtctggtt gttccagagg ctgtggattt tttggataag 1020 cttctacgct acgatcatca agacaggctg actgcgaagg aagctatggc acatccctat 1080 ttttatcccg tgaaggtgtc ggaggttagc aaccgtcgca gtgcttgata tgaattgata 1140 tatctcatat gggctttctt gtgattacgt cccacccggc taccaggttt ctcagttgtg 1200 cgaagcgctg agctcgc 1217 <210> 21 <211> 1718 <212> DNA
<213> Physcomitrella patens <400> 21 atcccgggcg agccatggcg ccacttgctt cggcgaatgg gactgtttga cttcttcgct 60 tcgcccccgc ctcgcccttc accctcctct gttcttgtca cagcctcctc ctccgtctct 120 gtctgttggc tgggtaagtt ttgggagtga ggaggacgtg gtcatggaag aagagccccc 180 ctcttttgta gtggactgtc ggtaaattgg acctggagcc tgccggctca tcgcgtttgc 240 ttagattgtg ggcgggtgct gttgaaattc cttgaacttg ctactggtcg gaaacgctcg 300 aattgcgact ttgattgaag gtctggttgt tgctgcggtc gggatcttac tcagtctctt 360 caataggacc tctgaagcag tatggagact agcagtggaa ctccagaatt gaaagttata 420 agtactccga cctacggagg tcattacgtg aaatatgttg tggcgggaac tgatttcgaa 480 gtcaccgcga ggtacaagcc accacttcgt ccgattgggc gcggagctta tggaatcgtc 540 tgttcactct ttgataccgt tacgggtgag gaggtggcgg tcaaaaagat tggaaacgcc 600 ttcgacaaca ggatcgatgc gaagcgaaca ctgcgtgaaa taaaactcct ccggcatatg 660 gatcatgaaa acgtcgttgc cattacagac atcattcgtc ccccaactag ggagaatttc 720 aacgacgtgt acattgtata cgagttgatg gatacggacc tacaccagat cattcgttca 780 aatcaagctc tcacagaaga ccactgtcag tattttctgt atcaaatctt gcggggcttg 840 aagtacatcc attcggcgaa cgtcttgcac cgggacttga agcccaccaa ccttctcgtc 900 aatgccaatt gcgatttgaa aatcgcagat tttggcttgg cacgcactct ctctgaaacg 960 gatttcatga ctgagtatgt tgtaacgagg tggtacagag ctccagagct gctcctgaat 1020 tgttcagcat acactgcagc tattgacatt tggtctgtgg ggtgcatctt catggagttg 1080 cttaaccgat ctgcgttgtt ccctgggaga gactatgtgc atcagctccg cctaattaca 1140 gaactcatcg gaactcctga agatagggat cttgggtttt tgagaagcga caatgctagg 1200 cggtatatca agcacctgcc tcgacagtcg cctattccct taacccagaa gttcagaggc 1260 attaatcgtt ctgctcttga tcttgttgaa aagatgctgg tctttgatcc agcgaaaaga 1320 atcacagtgg aagctgcctt ggcgcaccct tatttagctt cacttcatga catcaacgat 1380 gagcctgcct cggtatctcc cttcgagttt gacttcgagg agccccctat ctcggaggag 1440 catatcaagg atctcatttg gagggaggct ctggattgca gcttaggtcc tgatgatatg 1500 gtgcagtaac ttcacacttc atctcaagtt gtaaggccta ctctcaattc tttaggtggc 1560 tacaacgcta tcccggcgtt gtatggtttt gcaacttatt cccccccgtg tgattacact 1620 attggattat agaatgacaa ttcgttagtt cttttccctg gcgctatatc tttgtctgca 1680 catttcatcc agcagacatt gttgctcggc gttaacgc 1718 <210> 22 <211> 2177 <212> DNA
<213> Physcomitrella patens <400> 22 atcccgggct tgtattggct cggataattt atgttgacaa ttgatttgtg aggcttcgta 60 ttgagtcagc gagcaggctg agagttcggc agcgaagtta cactcgacct ggctgaaatt 120 tggaattgaa gcgcgtgaag cttcatctgt gattttggag gttgtttgac tgatgagaag 180 aggtctctga gctgagaatg tttgcaattt aggggcacca ccggtttgtt ggagtccctt 240 gccacttatt acaattgttg gtttacaagc tcgacgagtt tcaatcgaac gtagagtttt 300 agtcgggtcg aggatctatg tatccgctca gcggagaaga gagcctgatg ttgccgaagc 360 gatcgtgtgg gatttgacta gaaagaggtg gaccgcatca gaactattta ttccttgtga 420 gggaaggatc gaggttccaa tgggtctcac tccgttttct tgtgtcacgg ttcaaggtta 480 tgtccgggtg gtctaccccg acggccacgt cgagaatctg agcaaatctt gtagcgtgca 540 cgatcttctt ctgggtaatc cagactacta tgtctgcggt agcacccctt acacaatcac 600 caatcgtatg gcagcggaag aggtgctcga gtatggggtg acctacttcg tttgcgcaac 660 gccaaatgcc caacctttct tagaacgtca gccgaaggta gtacatcgag gatccaagat 720 tttgccacga ttttccaaac atggggtcca tgtgcgggag ttgcgaagcc cgacgcatgg 780 gagccaacag tcacggaagg tttttgatta tcattcagta acgatgcagc agcttgaatc 840 catacgaaac gagggcccag agcctcacct cgctggagac cgaccatcga agcaccttaa 900 gctcgttttc attcggcatt gcttgcgagc acttcgactt cctagaattt caatagacct 960 aatggaatcg ccactcccta atctttccgg agaggcctta tcgccgacgg caactgccaa 1020 agacgagatt actcagatga tactaaaaag tgccgcaagg tccgaattag gaatgtatgt 1080 ttcgaagaga caggaattct atcttcgaag agcgcgtagg cggcgtaagt ttgcgtggaa 1140 gccggttttg cagagcatct ccgagatgaa gcctgtcatg gaattccaca ctccgatggc 1200 ttaccgggat agtgggtctc cgccgaagaa cgcctctacc ccatccttac ctggcccgaa 1260 gaacatttca ccgccacgac aagtgagtgt cccgcaaagg agcagtcctc cgccgaagaa 1320 cgtctcacca cctccccagc ccgcatttgt agcgcggact gcgtcgaagt attctgctgc 1380 atctcagcaa gttcaacgaa atcgaggcaa cgcgaaatct ctttatatgg cgtagtttgt 1440 gtctcgactg aactcctatc tattccccca tcgagataac tgcattcgtt ggataaattt 1500 ctccaacatt tttgctcttc atcctcaagc agctcctcaa tggccagtaa tatgttacga 1560 cattgtgcac aactccaatt acgtagcgtt attctgtaac ccacgttcat cgaggtatca 1620 aggaatggcg cagtaagcac tgctactttg tgctttggta tcccgttgtg acgagatgtc 1680 atgtcgcacc gtgcctatca gtgggatttt cttgagcgca gatcttgctt ccgcagtttg 1740 tttcataacg ttttggttcg tagggggcct agacggtact atcaagcaat gagaagtgtg 1800 ctggtgtgga tttgacagca atcttttgga ggattgtctt tcctatgtag aacatagcga 1860 ggacacttgc gcctggtggg cacatcccat agaacatagt gcttcacttc tgggttgttc 1920 accactagga tcatatgacc ttctcatcta ttttcgggct ttgtttc gag ctcatgtacc 1980 atcgactagc gtcactttga ctgcggtgat aatcgtttgt caatttagtg gagctttgta 2040 gatgatagat gccatttgta cagtagcttg gatgctgttt acaagatagc ggcagctaga 2100 agccttaaac ctttagctac catgtattat ttaaacctat atgaagtgaa cggctgtgca 2160 gatattgccg ttaacgc 2177 <210> 23 <211> 1731 <212> DNA
<213> Physcomitrella patens <400> 23 atcccgggcg gtcgagtcgt attaggtgtt gtttcattgt aagggttcgg aagcacgggg 60 cacggcgtat ataccgttcc ccttgaacgt tgatctcacc tttggaagac ctgaattgag 120 tagcgtgcgg aagctgcatc gatccggaag agacgatgag taggagagtg agaaggggag 180 gtcttcgcgt cgcggtgccg aagcaagaga ctcccgtcag caaatttttg actgccagtg 240 gaactttcca ggatgatgat atcaagctca accacaccgg gcttcgcgtc gtctcttcag 300 aacctaacct tcctacgcag acgcagtcta gctccccaga tgggcaactg tcaatagcag 360 acctggagtt agtgcggttc ttgggaaagg gtgcgggtgg aaccgtgcag cttgtccggc 420 acaaatggac caatgtcaat tatgcactga aggcgataca aatgaatatc aacgaaacag 480 tgaggaagca gattgttcag gagctgaaaa tcaaccaagt gacgcaccag cagtgccctt 540 atatcgtgga atgcttccac tccttctacc acaacggcgt catatccatg atcctagagt 600 acatggacag gggctcgttg tccgacatta ttaagcaaca aaagcagata cctgagccgt 660 atttggccgt cattgctagt caagttctga agggattgga atacctacac caagtcaggc 720 acatcataca tcgtgatata aagccctcca acctcctcat caatcacaag ggtgaggtca 780 aaatatctga ttttggtgtc agtgctgtgt tggttcattc cttggcccag cgagacacgt 840 tcgttgggac ttgcacatat atgtcgccag aacgccttca ggggcgttcg tatgcatacg 900 acagtgacct atggagttta ggattgactc ttttggagtg tgcgttgggt accttcccat 960 acaaaccagc tggaatggaa gagggttggc aaaatttctt catcctcatg gaatgtatag 1020 ttaatcaacc ccccgcagcc gcatcccctg acaaattctc ccccgaattt tgttctttta 1080 ttgaatcctg catccggaaa tgtcccagtg aacgaccatc aactactgat ttacttaaac 1140 atccgttcct gcaaaagtac aacgaggaag agtaccattt gagcaagatt ttgtaactta 1200 aagttagcct cgcatggcgt gcagagactg tcactaccac aagcctgatc caccactgaa 1260 cttcaaggga ctttaccaaa agcatggtcg aactacctcg ccaatccgcc actttctcaa 1320 tgccttttcc ttatatagtc atatgtggtc aagttgagaa cgatatcaaa tcagattgac 1380 ggaaaaaaca tcttcaacgc cgtttcccaa ccttatagaa agtggagttt tctcaatgag 1440 ccccatttgt cgctgagaac gtgcagctca tgaaacaatc cataagtgtg ttaatcgggg 1500 tcttatatta tcatcaccat gctagctttt tatgttacct gcactttttc tttccttatt 1560 gcacagcatc gaacacttct tcgataccca aaacaatatt tccatcttct ttcttctttt 1620 tttcacgtct tgcgacaagg aatttcctca cggagatttt tcaacacttt tctcaaatgt 1680 ttttagagtt tttaaactga caattgaaga ggtcggacct accggactcg c 1731 <210> 24 <211> 1407 <212> DNA
<213> Physcomitrella patens <400> 24 atcccgggag aggctgatct gatgctacag tttcgtgtgc agctagtctt tagagattcg 60 ggcaacgcac ttgttgaaga tcggaaactt tcaaaatcgg tcgagtcgta ttaggtgttg 120 tttcattgta agggttcgga agcacggggc acggcgtata taccgttccc cttgaacgtt 180 gatctcacct ttggaagacc tgaattgagt agcgtgcgga agctgcatcg atccggaaga 240 gacgatgagt aggagagtga gaaggggagg tcttcgcgtc gcggtgccga agcaagagac 300 tcccgtcagc aaatttttga ctgccagtgg aactttccag gatgatgata tcaagctcaa 360 ccacaccggg cttcgcgtcg tctcttcaga acctaacctt cctacgcaga cgcagtctag 420 ctccccagat gggcaactgt caatagcaga cctggagtta gtgcggttct taggaaaggg 480 tgcgggtgga accgtgcagc ttgtccggca caaatggacc aatgtcaatt atgcactgaa 540 ggcgatacaa atgaatatca acgaaacagt gaggaagcag attgttcagg agctgaaaat 600 caaccaagtg acgcaccagc agtgccctta tatcgtggaa tgcttccact ccttctacca 660 caacggcgtc atatccatga tcctagagta catggacagg ggctcgttgt ccgacattat 720 taagcaacaa aagcagatac ctgagccgta tctggccgtc attgctagtc aagttctgaa 780 gggattggaa tacctacacc aagtcaggca catcatacat cgtgatataa agccctccaa 840 cctcctcatc aatcacaagg gtgaggtcaa aatatctgat tttggtgtca gtgctgtgtt 900 ggttcattcc ttggcccagc gagacacgtt cgttgggact tgcacatata tgtcgccaga 960 acgccttcag gggcgttcgt atgcatacga cagtgaccta tggagtttag gattgactct 1020 tttggagtgt gcgttgggta ccttcccata caaaccagct ggaatggaag agggttggca 1080 aaatttcttc atcctcatgg aatgtatagt taatcaaccc cccgcagccg catcccctga 1140 caaattctcc cccgaatttt gttcttttat tgaatcctgc atccggaaat gtcccagtga 1200 acgaccatca actactgatt tacttaaaca tccgttcctg caaaagtaca acgaggaaga 1260 gtaccatttg agcaagattt tgtaacttaa agttagcctc gcatggcgtg cagagactgt 1320 cactaccaca agcctgatcc accactgaac ttcaagggac tttaccaaaa gcatggtcga 1380 actacctcgc caatccgcca gagctca 1407 <210> 25 <211> 2253 <212> DNA
<213> Physcomitrella patens <400> 25 atcccgggtg taggcgggcg aggttcgatg caatggggca gtgttatgga aagtttgatg 60 atggaggcga aggggaggat ttgtttgagc ggcagaaagt gcaggtttct aggacgccaa 120 agcatggatc gtggagcaat agcaaccgag ggagcttcaa caatggcggg ggggcctcgc 180 ctatgagagc caagacgtcg ttcgggagca gccatccgtc cccgcggcat ccctcagcta 240 gtccgctccc tcactacacg agctccccag cgccttcgac cccgcgacgg aacattttca 300 aaaggccttt tcctcctcct tctcccgcga agcacattca gtccagtctc gtgaaacggc 360 atggcgcgaa gccgaaagaa ggaggggcga tccctgaggc tgtcgatggt gagaagccct 420 tggataagca tttcggctat cacaagaact tcgctactaa gtatgagctg gggcatgaag 480 tcggtcgcgg gcacttcggt cacacatgtt acgcgaaagt acggaagggc gagcataagg 540 091 lovErezeovo .6.66-evr3.435 1.6q363e5.4q .431.eqb66o 6e513eve64 355613qq3p pozt 3p33elb1.65 46.4.6.43.5.43q Tepv.45.4.61.4 v.6.453.6.6.ea5 45-e65-44-45.4 v6.435e.e.6.43 otrr oq561.eqlEr r5v6ve5114 15.e.e.6.43333 .6.515aelleq 53 6b6 q.6.4wele55 0801 33 6&5 ebbv33.6vel qqoqqqaeep qbqoqbBoqq pebeovoof6 evbqoqopbo ozoi Bzeb&e.6.43.6 5vo5rooE5 1.4613'41-4.4p vfrefrepaftv 3.43.4.e6.663.4 vooqq3-4.555 096 BeTTe3qopo oBze5e3p36 .4.66.46.Tevol 5olvoz6v5e 36el6zelp.63 3513533535 006 3by6q5y3el zeo6656eep 3.614e34e35 3gE.63.4q333 .6e5355155.e. 3.54.6q3q35 lots 5.6.4e51.6113 leoblbooll eoBve3e6.6y bogg6gbq.e5 5eve.4.46-465 1Bowelvepo 081. 3e3v.6.5.653.4 .6.400yogeo5 qvqq.e5e3qq 56e55535ve qq.61R65253 zeze6ft56-e eqftope.5.43 seR5,63vey3 353 O55 r35c4S3E3yq 555 ae5gy5eepe 099 .5.43v1.6q5T4 opqlov.61.5e 553.11.5e356 ftboa6.61q3 5v56.63v556 looTeaeqlo 009 zevozBolze zefto4.6./35 opBeel.665q qq1.6.45633.4 elEvoz6.6e5 oqvoSepaft ots R633.66e6a3 .6.43q3Bq353 pobaBqoqoa ypozefogrEs yb533bEe34 3fq.654.6-e36 08t evoo5ve56 365.4e13vv3 vev3535BT4 536v-4E6.456 bv3e5gBov6 erepozevoq ozt Bobyze&Tee 5etee65op ovovfievoqo q5663q5e5.6 By3Tey.6155 vo.653.43e33 09E qbevB5e53-1. e5558.e534.4 Bvqoyoyebb 6.6qr3ebo5e oze6Eqqaet, qq.ef.4.4.6vbq 00E EsqpqqweEmB ftEoppoqpo zeylegy.6.4.6 vv151.4q456 ft.6qqq.e.6.6y By55v.6.453 otz eboy5zeoz6 qvq33.65131 3.6.434.43534 =1423336.4 pooqbpqa63 BT4.655vebq 081 qr35e5541.5 3e 5S5 qq.56qqp5vp 3.613.66.6apv .61.6weve.61 owoBooggy OZI 504qP4q445 610400qqq5 lqeorlfe441 vqvB0B0400 53.644q40.50 e604 09 ozebBooeft r.4.6363433.6 5.6ve661.43e eoplqv5v61. 34v6a5gove 3.555opoze 9Z <O0t>

sued eTTailTwoosAqd <Eta>
vNa <ZTZ>
OEZz <TTz>
9Z <OTZ>

ESZZ 3.63 ve.4.4.63q.614 5.633.43e.431 g533643e.65 ozzz 4.4v3ze5q5 yqqa5zeTeo .55.43e5yzeq .6.4.ev56.4.6y5 e5eo5ee5qe .431.66.6.ev55 09-m 5ee33.4115.4 s6wee5Eze ze5qlo-44.e. rEbqqpiqqq. .4354.5E611r ovae35.6.eq4 ooTz 3v35.66e3i wevoqfieqe Devl6vp5ve oep4.6.4.1eqv Emq3.6.64ey5 byvevbobve otoz vevoqvfmoo qfieebeqbqv qqqvgge5.6.4 qq.eqweogq .43-m65431p 3.666oqbvq.4 0861 vov3q33v3q .6q1.4e.615.ex, .643Bqqqqqr oBoweepeo Bzezeafteo qozeq635eq 0z61 e.6q543.6e5.4 3131634335 314361353 ev3q434.633 qqavoqqqbe qqq.43q35y 0981 qqqqq5e.E6.4 ev.553115e3 vl53Te35.4.4 .43qqv5q.6e3 ftooloweve veoqeq36.4.6 0081 paftoollze v66ze3vq35 qaftropeol 156.6.43e3.41 -45e613.6631 .6.61.e5q3.4.6.e 0T7L1 3e5E43p554 warewqqqb qbevoopfto 3e453eev33 ep5eq3vE0E6 Tebeftvefo 0891 5ll3ve5ze5 w3lp.411.ep q5e53oreq.6 .65v5ere5e5 1.41z4e3r53 vqq36v353.6 0z91 3.436.4v35v3 5.e.655qt.5ov tee3e3357e Reqq&eopqo .446.45e44e3 3.6835v3.6.4.5 0991 1.3445e.6e3q qqq3p.65zwe ve5ee3qq4e pq434.55.4e5 5q.eB3zee55 q3qq.eve541 0091 41.4.6553v3.4 5e5evv.61v3 3.65e5e3ve3 1Teveve.6.43 5we356.e3v .6.e3q4zee5.
otti Bqqqqprqq8 1.63z6.6peep erq5ee33ve .6eq35wfvwe qqwee3ww4 63eq3qvqq.4 06E1 4.43.e6e.53E5 eefooeeqqg 3r6eve3q.6.4 033.65-evbqq wbqobblese Embgeopzep ozET qv364.631q3 TeqwefiftEs .45113e5re3t. qE.1.6v1-4.3q.e Te56.43133v weBve.6.453v 09zT v3veq5ee.63 14e5.6Tepoq voweeqqqo 5ev3e3.6136 webqvpfov rebbobzele 00zI 5.5veqpr5qo 3wq5.35ey5 .453.4q4v5Em p335e5333 qoqoTepogg 33.65qq3333 otIT .6ve.5-ev.6.41-4 35e6po3rbq 365.6-e5q151 .653.5153.4T4 qqy365531.6 .2.630e56353 0801 5554.441.633 e531.5eq.6.6.4 5le.4.46T4.44 e32453-eple 3.4.6.e.664.4e3 5e66.4e4Boe 001 .613EmEE.E.Te yoqqyzeqqb Emzeo5qq.eq 55ebboo63.6 41E3el3ygy ofo5m6.6-4.4 096 53qvq.e63ve 5wv5eve6.4 vbpoovevol v3qq1r5v3q 5qq.e.6.6.411q. s64.4-e33.6.6e 006 vq435P343.6 zewrire5Te6.6 ze53e33elq 1.5.4.34.411vv 5v5.4.335evq q3qr6e5o3v ()Kt 3qq.541.8056 erobworpq .54q.44.63.614 Bq4.50.6e51,4 qze5y36605 .4514.54465e 081, v3353p5.e.6 5e563q3vq.6 er6.66v55.6.6 owiBqqqqe v53qr564-ze Twe61.65-e5 0u, Bes6.461.eqq yy5.6.4.eqq54 qv0vq5151-e re43we33e6 5-e5o5w3qq. vBaelpqq-eb 099 31,15641zwe ae33e3vE6E1 ov5.4313.6.5e sElqqqq.ev.we .61.6weEm53r .6.6.6.4.53-eb5v 009 53le53.6qqv q3b43.e.53.e6 leftsBoBev s63.43.4vewe 5veB15.ea66 15p35vos6 0-170-00Z OgLg017Z0 VD =

tcgagaacga tccatggccg aaaatctcca acggggctaa ggatttggtg aggaaaatgc 1320 taaaccctaa cgtgaagata cgtctgacgg cacagcaggt gttgaaccat ccatggatga 1380 aggaagatgg tgatgctcca gacgtgccac tcgacaatgc ggtgttgacc agactgaaaa 1440 atttctcagc cgccaacaag atgaaaaagc tggcgctgaa ggtgattgca gagagtctgt 1500 cggaggaaga gatcgtgggg ttgagggaga tgttcaaatc catagataca gacaacagcg 1560 gcacggtgac gttcgaggag cttaaggaag ggttgctgaa gcagggctca aaacttaatg 1620 aatcggacat caggaaacta atggaagctg cagatgtcga tggaaacggc aagatcgact 1680 tcaacgagtt catatcggca acaatgcaca tgaacaagac ggagaaagag gatcaccttt 1740 gggcagcatt catgcatttc gacacggaca atagcgggta tatcaccatc gacgagcttc 1800 aggaagcaat ggagaagaat ggaatgggag atcctgagac catccaagag atcatcagcg 1860 aggtggacac agacaacgac ggaagaatag actacgacga gttcgtagcc atgatgcgca 1920 agggcaatcc tggcgctgaa aacggaggaa cggtgaacaa gcccagacac aggtagtagc 1980 tcctggttgc caatttgacg acgggtttgg caaggcaaca gtagttgttg ttagctttca 2040 gattcaggtt cggtattgtt catgccctcc tttgtctcga acaatggact ctaggccttt 2100 ccaatggaaa agctattcca acagggtttg cataacgtgt agtagaatga aagcattgcc 2160 tggggggtgt acagtgcctg tgatcttgtg gagttctcgt aggatggctt cggttggatc 2220 tcgttaacgc 2230 <210> 27 <211> 749 <212> PRT
<213> Physcomitrella patens <400> 27 Met Gly Val Asp Met Lys Ala Pro Ala Lys Gin Ser Leu Gly Val Gly Leu Leu Leu Cys Ser Val Val Ile Leu Ser Val Val Ser Ser Val Tyr Gly Gin Val Gin Thr Asp Pro Val Asp Thr Thr Gly Leu Ile Ser Met Trp Tyr Asp Leu Lys Gin Ser Gin Ser Leu Thr Gly Trp Thr Gin Asn Ala Ser Asn Pro Cys Gly Gin Gin Trp Tyr Gly Val Val Cys Asp Gly Ser Ser Val Thr Glu Ile Lys Ile Gly Ser Arg Gly Leu Asn Gly Asn Phe Asn Pro Ser Tyr Phe Gin Asn Ala Phe Lys Lys Leu Arg Ile Phe Asp Ala Ser Asn Asn Asn Ile Glu Gly Asn Ile Pro Gin Gin Phe Pro Thr Ser Leu Thr Gin Met Ile Leu Asn Asn Asn Lys Leu Thr Gly Gly Leu Pro Gin Phe Asp Gin Leu Gly Ala Leu Thr Val Val Asn Leu Ser Asn Asn Asn Leu Thr Gly Asn Met Asn Pro Asn Tyr Phe Asn Val Ile Val Asn Val Glu Thr Phe Asp Val Ser Tyr Asn Gin Leu Glu Gly Thr Leu Pro Asp Ser Ile Leu Asn Leu Ala Lys Leu Arg Phe Leu Asn Leu Gin Asn Asn Lys Phe Asn Gly Lys Leu Pro Asp Asp Phe Ser Arg Leu Lys Asn Leu Gin Thr Phe Asn Ile Glu Asn Asp Gin Phe Thr Gly Asn Tyr Pro Ser Gly Leu Pro Ser Asn Ser Arg Val Gly Gly Asn Arg Leu Thr Phe Pro Pro Pro Pro Ala Pro Gly Thr Pro Ala Pro Arg Thr Pro Ser Pro Ser Gly Thr Ser Asn Gly Ser Ser Ser His Leu Pro Leu Gly Ala Ile Ile Gly Ile Ala Ala Gly Gly Ala Val Leu Leu Leu Leu Leu Ala Leu Gly Ile Cys Leu Cys Cys Arg Lys Arg Ser Lys Lys Ala Leu Gly Asp Pro Glu Ala Thr Thr Ser Ser Arg Arg Pro Trp Phe Thr Pro Pro Leu Ser Ala Lys Ser Gin Ser Asp Pro Ser Lys Ser Ile Asp Lys Thr Thr Lys Arg Asn Ile Phe Gly Ser Ser Lys Ser Glu Lys Lys Ser Ser Lys His Arg Val Phe Glu Pro Ala Pro Leu Asp Lys Gly Ala Ala Asp Glu Pro Val Val Lys Ala Ser Pro Pro Val Lys Val Leu Lys Ala Pro Pro Ser Phe Lys Gly Ile Ser Gly Leu Gly Ala Gly His Ser Lys Ala Thr Ile Gly Lys Val Asn Lys Ser Asn Ile Ala Ala Thr Pro Phe Ser Val Ala Asp Leu Gin Ala Ala Thr Asn Ser Phe Ser Gin Asp Asn Leu Ile Gly Glu Gly Ser Met Gly Arg Val Tyr Arg Ala Glu Phe Pro Asn Gly Gin Val Leu Ala Val Lys Lys Ile Asp Ser Ser Ala Ser Met Val Gin Asn Glu Asp Asp Phe Leu Ser Val Val Asp Ser Leu Ala Arg Leu Gin His Ala Asn Thr Ala Glu Leu Val Gly Tyr Cys Ile Glu His Asp Gin Arg Leu Leu Val Tyr Glu Tyr Val Ser Arg Gly Thr Leu Asn Glu Leu Leu His Phe Ser Gly Glu Asn Thr Lys Ala Leu Ser Trp Asn Val Arg Ile Lys Ile Ala Leu Gly Ser Ala Arg Ala Leu Glu Tyr Leu His Glu Val Cys Ala Pro Pro Val Val His His Asn Phe Lys Ser Ala Asn Ile Leu Leu Asp Asp Glu Leu Asn Pro His Val Ser Asp Cys Gly Leu Ala Ala Leu Ala Pro Ser Gly Ser Glu Arg Gin Val Ser Ala Gin Met Leu Gly Ser Phe Gly Tyr Ser Ala Pro Glu Tyr Ala Met Ser Gly Thr Tyr Thr Val Lys Ser Asp Val Tyr Ser Phe Gly Val Val Met Leu Glu Leu Leu Thr Gly Arg Lys Ser Leu Asp Ser Ser Arg Pro Arg Ser Glu Gin Ser Leu Val Arg Trp Ala Thr Pro Gln Leu His Asp Ile Asp Ala Leu Ala Arg Met Val Asp Pro Ser Leu Lys Gly Ile Tyr Pro Ala Lys Ser Leu Ser Arg Phe Ala Asp Ile Val Ala Leu Cys Val Gin Pro Glu Pro Glu Phe Arg Pro Pro Met Ser Glu Val Val Gin Ala Leu Val Arg Leu Met Gin Arg Ala Ser Leu Ser Lys Arg Arg Ser Glu Ser Ala Val Gly Ile Glu Ser Asn Glu Pro Ser Glu Thr Ser Leu <210> 28 <211> 308 <212> PRT
<213> Physcomitrella patens , CA 02405750 2003-04-03 <400> 28 Met Ser Val Ser Gly Met Asp Asn Tyr Glu Lys Leu Glu Lys Val Gly Glu Gly Thr Tyr Gly Lys Val Tyr Lys Ala Arg Asp Lys Arg Ser Gly Gin Leu Val Ala Leu Lys Lys Thr Arg Leu Glu Met Glu Glu Glu Gly Val Pro Ser Thr Ala Leu Arg Glu Val Ser Leu Leu Gin Met Leu Ser His Ser Met Tyr Ile Val Arg Leu Leu Cys Val Glu His Val Glu Lys Gly Ser Lys Pro Met Leu Tyr Leu Val Phe Glu Tyr Met Asp Thr Asp Leu Lys Lys Tyr Ile Asp Leu His Gly Arg Gly Pro Ser Gly Lys Pro Leu Pro Pro Lys Val Val Gin Ser Phe Met Tyr Gin Leu Cys Thr Gly Leu Ala His Cys His Gly His Gly Val Met His Arg Asp Leu Lys Pro Gin Asn Leu Leu Val Asp Lys Gin Thr Arg Arg Leu Lys Ile Ala Asp Leu Gly Leu Gly Arg Ala Phe Thr Val Pro Met Lys Ser Tyr Thr His Glu Ile Val Thr Leu Trp Tyr Arg Ala Pro Glu Val Leu Leu Gly Ala Thr His Tyr Ser Leu Pro Val Asp Ile Trp Ser Val Gly Cys Ile Phe Ala Glu Leu Val Arg Lys Met Pro Leu Phe Thr Gly Asp Ser Glu Leu Gin Gin Leu Leu His Ile Phe Arg Leu Leu Gly Thr Pro Asn Glu Thr Ile Trp Pro Gly Val Ser Gin His Arg Asp Trp His Glu Phe Pro Gin Trp Arg Pro Gin Asp Leu Ser Leu Ala Val Pro Gly Leu Ser Ala Val Gly Leu Asp Leu Leu Ala Lys Met Leu Val Phe Glu Pro Ser Lys Arg Ile Ser Ala Lys Ala Ala Leu Ser His Thr Tyr Phe Ala Asp Val Asp Lys Thr Ala Thr <210> 29 <211> 425 <212> PRT
<213> Physcomitrella patens <400> 29 Met Ala Asp Ala Lys Glu Glu Leu Ala Leu Arg Thr Glu Met His Trp Ala Val Arg Ser Asn Asp Val Gly Leu Leu Arg Thr Ile Leu Lys Lys Asp Lys Gin Leu Val Asn Ala Ala Asp Tyr Asp Lys Arg Thr Pro Leu His Ile Ala Ala Ser Leu Asp Cys Val Pro Val Ala Lys Val Leu Leu Ala Glu Gly Ala Glu Leu Asn Ala Lys Asp Arg Trp Gly Lys Ser Pro Arg Gly Glu Ala Glu Ser Ala Gly Tyr Met Glu Met Val Lys Leu Leu Lys Asp Tyr Gly Ala Glu Ser His Ala Gly Ala Pro Arg Gly His Val Glu Ser Leu Ile Gin Val Ala Pro Pro Leu Pro Ser Asn Arg Asp Trp Glu Ile Ala Pro Ser Glu Ile Glu Leu Asp Thr Ser Glu Leu Ile Gly Lys Gly Ala Phe Gly Glu Ile Arg Lys Ala Leu Trp Arg Gly Thr Pro Val Ala Val Lys Thr Ile Arg Pro Ser Leu Ser Asn Asp Arg Met Val Ile Lys Asp Phe Gin His Glu Val Gin Leu Leu Val Lys Val Arg His Pro Asn Ile Val Gin Phe Leu Gly Ala Val Thr Arg Gin Arg Pro Leu Met Leu Val Thr Glu Phe Leu Ala Gly Gly Asp Leu His Gin Leu Leu Arg Ser Asn Pro Asn Leu Ala Pro Asp Arg Ile Val Lys Tyr Ala Leu Asp Ile Ala Arg Gly Met Ser Tyr Leu His Asn Arg Ser Lys Pro Ile *

Ile His Arg Asp Leu Lys Pro Arg Asn Ile Ile Val Asp Glu Glu His Glu Leu Lys Val Gly Asp Phe Gly Leu Ser Lys Leu Ile Asp Val Lys Leu Met His Asp Val Tyr Lys Met Thr Gly Gly Thr Gly Ser Tyr Arg Tyr Met Ala Pro Glu Val Phe Glu His Gin Pro Tyr Asp Lys Ser Val Asp Val Phe Ser Phe Gly Met Ile Leu Tyr Glu Met Phe Glu Gly Val Ala Pro Phe Glu Asp Lys Asp Ala Tyr Asp Ala Ala Thr Leu Val Ala Arg Asp Asp Lys Arg Pro Glu Met Arg Ala Gin Thr Tyr Pro Pro Gin Met Lys Ala Leu Ile Glu Asp Cys Trp Ser Pro Tyr Thr Pro Lys Arg Pro Pro Phe Val Glu Ile Val Lys Lys Leu Glu Val Met Tyr Glu Asp Cys Leu Leu Arg Leu Pro Lys Asp Arg Arg His Leu Arg Asp Ile Leu His Leu Arg Arg Asn Pro Ala Asp Ser <210> 30 <211> 283 <212> PRT
<213> Physcomitrella patens <400> 30 Met Lys Arg Tyr Gin Arg Arg Lys Val Gin Arg Leu Gly Arg Glu Gly Gin Val Leu Leu Glu Arg Thr Leu Phe Lys Gin Leu Arg Pro Ser Pro Phe Val Pro His Leu Leu Ala Thr Pro Ile Asp Ser Asp Asn Val Ala Leu Val Leu Asn Cys Val Leu Ala Gly Pro Leu Glu Leu Leu Leu Arg Ser Pro Leu Asp Glu Asn Ser Ala Arg Phe Leu Val Ala Asn Val Val Leu Ala Val Glu Leu Leu His Lys Asp Gly Val Val Tyr Arg Gly Ile Ser Pro Asp Val Leu Met Ile Asp Arg Lys Gly Arg Leu Gin Leu Val Asp Phe Arg Phe Ala Lys Gin Met Ser Asp Glu Arg Thr Phe Thr Val Cys Gly Met Ala Asp Phe Leu Ala Pro Glu Ile Ile Gin Gly Gin Gly His Gly Leu Ala Ser Asp Trp Trp Ala Val Gly Val Leu Met Tyr Phe Met Leu Gin Thr Glu Leu Pro Phe Gly Ser Trp Arg Asp Asn Glu Leu Glu Ile Phe Gly Arg Ile Ala Arg Arg Gin Leu Thr Phe Pro Ser Ser Phe Ser Pro Glu Ala Val Asp Leu Ile Asp Lys Leu Leu Val Val Asp Pro Thr Lys Arg Leu Gly Cys Asp Ser His Gly Ser Leu Ala Ile Arg Glu His Pro Trp Phe Arg Gly Ile Asn Trp Asp Lys His Leu Asp Cys Ser Val Glu Val Pro Ser Glu Ile Met Thr Arg Leu Gin Leu Ala Ile Asp Phe Leu Pro Val Asp Asp Ser Tyr Gin Val Phe Asp Leu Gin Pro Asp Glu Asp Asp Pro Pro Trp Leu Asp Gly Trp275 <210> 31 <211> 417 <212> PRT
<213> Physcomitrella patens <400> 31 Met Asp Leu Gly Gly Asp Arg Met Arg Ala Pro Gin Arg Gin Ser Arg Glu Tyr Gin Tyr Arg Ser Leu Asp Val Phe Thr Glu Gin His Glu Gin 20 Leu Gin Lys Gin Gin Gin Gin Asp Glu Tyr Gin Arg Thr Glu Leu Lys Leu Glu Thr Leu Pro Lys Met Leu Ser Asn Ala Thr Val Ser Ser Ser Pro Arg Ser Ser Pro Asp Gly Arg Arg Leu Arg Thr Val Ala Asn Lys Tyr Ala Val Glu Gly Met Val Gly Ser Gly Ala Phe Cys Lys Val Tyr Gin Gly Ser Asp Leu Thr Asn His Glu Val Val Gly Ile Lys Leu Glu Asp Thr Arg Thr Glu His Ala Gin Leu Met His Glu Ser Arg Leu Tyr Ann Ile Leu Arg Gly Gly Lys Gly Val Pro Asn Met Arg Trp Phe Gly Lys Glu Gin Asp Tyr Asn Val Met Val Leu Asp Leu Leu Gly Pro Asn Leu Leu His Leu Phe Lys Val Cys Gly Leu Arg Phe Ser Leu Lys Thr Val Ile Met Leu Gly Tyr Gin Met Ile Asp Arg Val Glu Tyr Val His Ser Arg Gly Leu Val His Arg Asp Leu Lys Pro Asp Asn Phe Leu Met Gly Cys Gly Arg Gin Gly Asn Gin Val Phe Ile Ile Asp Phe Gly Leu Ala Lys Glu Tyr Met Asp Pro Ala Thr Arg Arg His Ile Pro Tyr Arg Asp Arg Lys Ser Phe Thr Gly Thr Ala Arg Tyr Ala Ser Arg Asn Gin His Arg Gly Ile Glu His Ser Arg Arg Asp Asp Ile Glu Ser Leu Gly Tyr Ile Leu Met Tyr Phe Leu Arg Gly Asn Leu Pro Trp Gin Gly Lys Gly Gly Gin Arg Leu Thr Asp Gin Lys Gin His Glu Tyr Met His Asn Lys Ile Lys Met Asn Thr Thr Val Glu Glu Leu Cys Asp Gly Tyr Pro Ser Gin Phe Ala Asp Phe Leu His His Ala Arg Ser Leu Gly Phe Tyr Glu Gin Pro Asp Tyr Cys Tyr Leu Arg Ser Leu Phe Arg Asp Leu Phe Ile Gin Lys Lys Phe Gin Leu Asp His Val Tyr Asp Trp Thr Val Tyr Thr Gin Leu Pro Gin Asn Gly Ser Leu Gin Ser Val Arg Ser Gin Asn Ser Ala Ala Ser Ser His Leu Gin Asn Arg Pro Ser Asn Val Ser Tyr Cys Pro Pro Leu Thr Lys Ser Glu Phe Arg Arg Glu Val Val Ala Ala Asn <210> 32 <211> 484 <212> PRT
<213> Physcomitrella patens <400> 32 Met Glu Pro Arg Val Gly Asn Lys Tyr Arg Leu Gly Arg Lys Ile Gly Ser Gly Ser Phe Gly Glu Ile Tyr Leu Gly Thr Asn Val Gin Thr Asn Glu Glu Val Gly Ile Lys Leu Glu Ser Ile Lys Thr Lys His Pro Gin Leu Leu Tyr Glu Ser Lys Leu Tyr Arg Ile Leu Gin Gly Gly Thr Gly Ile Pro Asn Ile Arg Trp Phe Gly Ile Glu Gly Asp Tyr Asn Val Leu Val Leu Asp Leu Leu Gly Pro Ser Leu Glu Asp Leu Phe Asn Phe Cys Ser Arg Lys Phe Ser Leu Lys Thr Val Leu Met Leu Ala Asp Gin Leu Ile Asn Arg Val Glu Tyr Val His Ala Lys Ser Phe Leu His Arg Asp Ile Lys Pro Asp Asn Phe Leu Met Gly Leu Gly Arg Arg Ala Asn Gin Val Tyr Ile Ile Asp Phe Gly Leu Ala Lys Lys Tyr Arg Asp Pro Ser Thr His Gin His Ile Pro Tyr Arg Glu Asn Lys Asn Leu Thr Gly Thr Ala Arg Tyr Ala Ser Ile Asn Thr His Leu Gly Ile Glu Gin Ser Arg Arg Asp Asp Leu Glu Ser Leu Gly Tyr Val Leu Met Tyr Phe Leu Arg Gly Ser Leu Pro Trp Gin Gly Leu Lys Ala Gly Thr Lys Lys Gin Lys Tyr Glu Lys Ile Ser Glu Lys Lys Met Ser Thr Pro Ile Glu Val Leu Cys Lys Asn Tyr Pro Ser Glu Phe Ala Ser Tyr Phe His Tyr Cys Arg Ser Leu Arg Phe Asp Asp Lys Pro Asp Tyr Ala Tyr Leu Lys Arg Ile Phe Arg Asp Leu Phe Ile Arg Glu Gly Phe Gin Phe Asp Tyr Val Phe Asp Trp Thr Ile Leu Lys Tyr Gin Gin Ser Gin Ile Ser Gly Gly Ser Ser Thr Arg Leu Gly Ala Ser Ala Gly Gin Thr Ser Gly Ala Leu Gly Thr Gly Ala Thr Gly Ser Arg Asp Leu Gin Arg Pro Thr Glu Pro Met Asp Pro Ser Arg Arg Arg Leu Pro Gly Gly Ala Asn Gly Ser Gly Val Ala Asn Ala Leu Asp Ser Ser Lys His Lys Ser Pro Gly Leu Asp Glu Ser Ala Lys Asp Ser Ala Leu Ala Val Val Ser Glu Pro Glu Arg Met His Thr Ser Ser Tyr Ala Thr Arg Gly Gly Ser Ser Ser Arg Arg Ala Val Leu Ser Ser Ser Arg Pro Ser Gly Ala Ser Ala Glu Val Val Asp Ser Ser Arg Thr Gly Ser Ser Lys Leu Gly Pro Thr Ser Leu Arg Ser Ser Ala Gly Met Gin Arg Ser Ser Pro Val Thr Ser Asp Pro Lys Arg Ile Ser Ser Arg His Pro Gin Pro Pro Ser Ala Asn Leu Arg Ile Tyr Glu Ala Ala Ile Lys Gly Val Glu Ser Leu Ser Val Glu Val Asp Gin Ser Arg Tyr Lys <210> 33 <211> 333 <212> PRT
<213> Physcomitrella patens <400> 33 Met Ser Lys Ala Arg Val Tyr Thr Asp Val Asn Val Gin Arg Pro Lys Asp Tyr Trp Asp Tyr Glu Ala Leu Thr Val Gin Trp Gly Asp Gin Asp Asp Tyr Glu Val Val Arg Lys Val Gly Arg Gly Lys Tyr Ser Glu Val Phe Glu Gly Val Asn Ala Val Asn Ser Glu Arg Cys Val Met Lys Ile Leu Lys Pro Val Lys Lys Lys Lys Ile Lys Arg Glu Ile Lys Ile Leu Gin Asn Leu Cys Gly Gly Pro Asn Ile Val Lys Leu Leu Asp Ile Val Arg Asp Gin Gin Ser Lys Thr Pro Ser Leu Ile Phe Glu Tyr Val Asn Asn Thr Asp Phe Lys Val Leu Tyr Pro Thr Leu Thr Asp Phe Asp Ile Arg Tyr Tyr Ile His Glu Leu Leu Lys Ala Leu Asp Tyr Cys His Ser Gin Gly Ile Met His Arg Asp Val Lys Pro His Asn Val Met Ile Asp His Glu Gin Arg Lys Leu Arg Leu Ile Asp Trp Gly Leu Ala Glu Phe Tyr His Pro Gly Lys Glu Tyr Asn Val Arg Val Ala Ser Arg Tyr Phe Lys Gly Pro Glu Leu Leu Val Asp Leu Gin Asp Tyr Asp Tyr Ser Leu Asp Met Trp Ser Leu Gly Cys Met Phe Ala Gly Met Ile Phe Arg Lys Glu Pro Phe Phe Tyr Gly His Asp Asn Tyr Asp Gin Leu Val Lys Ile Ala Lys Val Leu Gly Thr Asp Glu Leu Asn Ser Tyr Leu Asn Lys Tyr Arg Leu Glu Leu Asp Pro His Leu Glu Ala Leu Val Gly Arg His Ser Arg Lys Pro Trp Ser Lys Phe Ile Asn Ala Asp Asn Gin Arg Leu Val Val Pro Glu Ala Val Asp Phe Leu Asp Lys Leu Leu Arg Tyr Asp His Gin Asp Arg Leu Thr Ala Lys Glu Ala Met Ala His Pro Tyr Phe Tyr Pro Val Lys Val Ser Glu Val Ser Asn Arg Arg Ser Ala <210> 34 <211> 375 <212> PRT
<213> Physcomitrella patens <400> 34 Met Glu Thr Ser Ser Gly Thr Pro Glu Leu Lys Val Ile Ser Thr Pro Thr Tyr Gly Gly His Tyr Val Lys Tyr Val Val Ala Gly Thr Asp Phe Glu Val Thr Ala Arg Tyr Lys Pro Pro Leu Arg Pro Ile Gly Arg Gly Ala Tyr Gly Ile Val Cys Ser Leu Phe Asp Thr Val Thr Gly Glu Glu Val Ala Val Lys Lys Ile Gly Asn Ala Phe Asp Asn Arg Ile Asp Ala Lys Arg Thr Leu Arg Glu Ile Lys Leu Leu Arg His Met Asp His Glu Asn Val Val Ala Ile Thr Asp Ile Ile Arg Pro Pro Thr Arg Glu Asn Phe Asn Asp Val Tyr Ile Val Tyr Glu Leu Met Asp Thr Asp Leu His Gin Ile Ile Arg Ser Asn Gin Ala Leu Thr Glu Asp His Cys Gin Tyr Phe Leu Tyr Gin Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Asn Val Leu His Arg Asp Leu Lys Pro Thr Asn Leu Leu Val Asn Ala Asn Cys Asp Leu Lys Ile Ala Asp Phe Gly Leu Ala Arg Thr Leu Ser Glu Thr Asp Phe Met Thr Glu Tyr Val Val Thr Arg Trp Tyr Arg Ala Pro Glu Leu Leu Leu Asn Cys Ser Ala Tyr Thr Ala Ala Ile Asp Ile Trp Ser Val Gly Cys Ile Phe Met Glu Leu Leu Asn Arg Ser Ala Leu Phe Pro Gly Arg Asp Tyr Val His Gin Leu Arg Leu Ile Thr Glu Leu Ile Gly Thr Pro Glu Asp Arg Asp Leu Gly Phe Leu Arg Ser Asp Asn Ala Arg Arg Tyr Ile Lys His Leu Pro Arg Gin Ser Pro Ile Pro Leu Thr Gin Lys Phe Arg Gly Ile Asn Arg Ser Ala Leu Asp Leu Val Glu Lys Met Leu Val Phe Asp Pro Ala Lys Arg Ile Thr Val Glu Ala Ala Leu Ala His Pro Tyr Leu Ala Ser Leu His Asp Ile Asn Asp Glu Pro Ala Ser Val Ser Pro Phe Glu Phe Asp Phe Glu Glu Pro Pro Ile Ser Glu Glu His Ile Lys Asp Leu Ile Trp Arg Glu Ala Leu Asp Cys Ser Leu Gly Pro Asp Asp Met Val Gin <210> 35 <211> 331 <212> PRT
<213> Physcomitrella patens <400> 35 Met Gly Leu Thr Pro Phe Ser Cys Val Thr Val Gin Gly Tyr Val Arg Val Val Tyr Pro Asp Gly His Val Glu Asn Leu Ser Lys Ser Cys Ser Val His Asp Leu Leu Leu Gly Asn Pro Asp Tyr Tyr Val Cys Gly Ser Thr Pro Tyr Thr Ile Thr Asn Arg Met Ala Ala Glu Glu Val Leu Glu Tyr Gly Val Thr Tyr Phe Val Cys Ala Thr Pro Asn Ala Gin Pro Phe Leu Glu Arg Gin Pro Lys Val Val His Arg Gly Ser Lys Ile Leu Pro85 Arg Phe Ser Lys His Gly Val His Val Arg Glu Leu Arg Ser Pro Thr His Gly Ser Gin Gin Ser Arg Lys Val Phe Asp Tyr His Ser Val Thr Met Gin Gin Leu Glu Ser Ile Arg Asn Glu Gly Pro Glu Pro His Leu Ala Gly Asp Arg Pro Ser Lys His Leu Lys Leu Val Phe Ile Arg His Cys Leu Arg Ala Leu Arg Leu Pro Arg Ile Ser Ile Asp Leu Met Glu Ser Pro Leu Pro Asn Leu Ser Gly Glu Ala Leu Ser Pro Thr Ala Thr Ala Lys Asp Glu Ile Thr Gin Met Ile Leu Lys Ser Ala Ala Arg Ser Glu Leu Gly Met Tyr Val Ser Lys Arg Gin Glu Phe Tyr Leu Arg Arg Ala Arg Arg Arg Arg Lys Phe Ala Trp Lys Pro Val Leu Gin Ser Ile Ser Glu Met Lys Pro Val Met Glu Phe His Thr Pro Met Ala Tyr Arg Asp Ser Gly Ser Pro Pro Lys Asn Ala Ser Thr Pro Ser Leu Pro Gly Pro Lys Asn Ile Ser Pro Pro Arg Gin Val Ser Val Pro Gin Arg Ser Ser Pro Pro Pro Lys Asn Val Ser Pro Pro Pro Gin Pro Ala Phe Val Ala Arg Thr Ala Ser Lys Tyr Ser Ala Ala Ser Gin Gin Val Gin Arg Asn Arg Gly Asn Ala Lys Ser Leu Tyr Met Ala <210> 36 <211> 346 <212> PRT

<213> Physcomitrella patens <400> 36 Met Ser Arg Arg Val Arg Arg Gly Gly Leu Arg Val Ala Val Pro Lys Gin Glu Thr Pro Val Ser Lys Phe Leu Thr Ala Ser Gly Thr Phe Gin Asp Asp Asp Ile Lys Leu Asn His Thr Gly Leu Arg Val Val Ser Ser Glu Pro Asn Leu Pro Thr Gin Thr Gin Ser Ser Ser Pro Asp Gly Gin Leu Ser Ile Ala Asp Leu Glu Leu Val Arg Phe Leu Gly Lys Gly Ala Gly Gly Thr Val Gin Leu Val Arg His Lys Trp Thr Asn Val Asn Tyr Ala Leu Lys Ala Ile Gin Met Asn Ile Asn Glu Thr Val Arg Lys Gin Ile Val Gin Glu Leu Lys Ile Asn Gin Val Thr His Gin Gin Cys Pro Tyr Ile Val Glu Cys Phe His Ser Phe Tyr His Asn Gly Val Ile Ser Met Ile Leu Glu Tyr Met Asp Arg Gly Ser Leu Ser Asp Ile Ile Lys Gin Gin Lys Gin Ile Pro Glu Pro Tyr Leu Ala Val Ile Ala Ser Gin Val Leu Lys Gly Leu Glu Tyr Leu His Gin Val Arg His Ile Ile His Arg Asp Ile Lys Pro Ser Asn Leu Leu Ile Asn His Lys Gly Glu Val Lys Ile Ser Asp Phe Gly Val Ser Ala Val Leu Val His Ser Leu Ala Gin Arg Asp Thr Phe Val Gly Thr Cys Thr Tyr Met Ser Pro Glu Arg Leu Gin Gly Arg Ser Tyr Ala Tyr Asp Ser Asp Leu Trp Ser Leu Gly Leu Thr Leu Leu Glu Cys Ala Leu Gly Thr Phe Pro Tyr Lys Pro Ala Gly Met Glu Glu Gly Trp Gin Asn Phe Phe Ile Leu Met Glu Cys Ile Val Asn Gin Pro Pro Ala Ala Ala Ser Pro Asp Lys Phe Ser Pro Glu Phe Cys Ser Phe Ile Glu Ser Cys Ile Arg Lys Cys Pro Ser Glu Arg Pro Ser Thr Thr Asp Leu Leu Lys His Pro Phe Leu Gin Lys Tyr Asn325 Glu Glu Glu Tyr His Leu Ser Lys Ile Leu <210> 37 <211> 346 <212> PRT

<213> Physcomitrella patens <400> 37 Met Ser Arg Arg Val Arg Arg Gly Gly Leu Arg Val Ala Val Pro Lys Gin Glu Thr Pro Val Ser Lys Phe Leu Thr Ala Ser Gly Thr Phe Gin Asp Asp Asp Ile Lys Leu Asn His Thr Gly Leu Arg Val Val Ser Ser Glu Pro Asn Leu Pro Thr Gin Thr Gin Ser Ser Ser Pro Asp Gly Gin Leu Ser Ile Ala Asp Leu Glu Leu Val Arg Phe Leu Gly Lys Gly Ala Gly Gly Thr Val Gin Leu Val Arg His Lys Trp Thr Asn Val Asn Tyr Ala Leu Lys Ala Ile Gin Met Asn Ile Asn Glu Thr Val Arg Lys Gin Ile Val Gin Glu Leu Lys Ile Asn Gin Val Thr His Gin Gin Cys Pro Tyr Ile Val Glu Cys Phe His Ser Phe Tyr His Asn Gly Val Ile Ser Met Ile Leu Glu Tyr Met Asp Arg Gly Ser Leu Ser Asp Ile Ile Lys Gin Gin Lys Gin Ile Pro Glu Pro Tyr Leu Ala Val Ile Ala Ser Gin Val Leu Lys Gly Leu Glu Tyr Leu His Gin Val Arg His Ile Ile His Arg Asp Ile Lys Pro Ser Asn Leu Leu Ile Asn His Lys Gly Glu Val Lys Ile Ser Asp Phe Gly Val Ser Ala Val Leu Val His Ser Leu Ala Gin Arg Asp Thr Phe Val Gly Thr Cys Thr Tyr Met Ser Pro Glu Arg Leu Gin Gly Arg Ser Tyr Ala Tyr Asp Ser Asp Leu Trp Ser Leu Gly Leu Thr Leu Leu Glu Cys Ala Leu Gly Thr Phe Pro Tyr Lys Pro Ala Gly Met Glu Glu Gly Trp Gin Asn Phe Phe Ile Leu Met Glu Cys Ile Val Asn Gin Pro Pro Ala Ala Ala Ser Pro Asp Lys Phe Ser Pro Glu Phe Cys Ser Phe Ile Glu Ser Cys Ile Arg Lys Cys Pro Ser Glu Arg Pro Ser Thr Thr Asp Leu Leu Lys His Pro Phe Leu Gin Lys Tyr Asn Glu Glu Glu Tyr His Leu Ser Lys Ile Leu <210> 38 <211> 597 <212> PRT
<213> Physcomitrella patens <400> 38 Met Gly Gin Cys Tyr Gly Lys Phe Asp Asp Gly Gly Glu Gly Glu Asp Leu Phe Glu Arg Gin Lys Val Gin Val Ser Arg Thr Pro Lys His Gly Ser Trp Ser Asn Ser Asn Arg Gly Ser Phe Asn Asn Gly Gly Gly Ala Ser Pro Met Arg Ala Lys Thr Ser Phe Gly Ser Ser His Pro Ser Pro Arg His Pro Ser Ala Ser Pro Leu Pro His Tyr Thr Ser Ser Pro Ala Pro Ser Thr Pro Arg Arg Asn Ile Phe Lys Arg Pro Phe Pro Pro Pro Ser Pro Ala Lys His Ile Gin Ser Ser Leu Val Lys Arg His Gly Ala Lys Pro Lys Glu Gly Gly Ala Ile Pro Glu Ala Val Asp Gly Glu Lys Pro Leu Asp Lys His Phe Gly Tyr His Lys Asn Phe Ala Thr Lys Tyr Glu Leu Gly His Glu Val Gly Arg Gly His Phe Gly His Thr Cys Tyr Ala Lys Val Arg Lys Gly Glu His Lys Gly Gin Ala Val Ala Val Lys Ile Ile Ser Lys Ala Lys Met Thr Thr Ala Ile Ala Ile Glu Asp Val Gly Arg Glu Val Lys Ile Leu Lys Ala Leu Thr Gly His Gin Asn Leu Val Arg Phe Tyr Asp Ser Cys Glu Asp His Leu Asn Val Tyr Ile Val Met Glu Leu Cys Glu Gly Gly Glu Leu Leu Asp Arg Ile Leu Ser Arg Gly Gly Lys Tyr Ser Glu Glu Asp Ala Lys Val Val Val Arg Gin Ile Leu Ser Val Val Ala Phe Cys His Leu Gin Gly Val Val His Arg Asp Leu Lys Pro Glu Asn Phe Leu Phe Thr Thr Lys Asp Glu Tyr Ala Gin Leu Lys Ala Ile Asp Phe Gly Leu Ser Asp Phe Ile Lys Pro Asp Glu Arg Leu Asn Asp Ile Val Gly Ser Ala Tyr Tyr Val Ala Pro Glu Val Leu His Arg Leu Tyr Ser Met Glu Ala Asp Val Trp Ser Ile Gly Val Ile Thr Tyr Ile Leu Leu Cys Gly Ser Arg Pro Phe Trp Ala Arg Thr Glu Ser Gly Ile Phe Arg Ala Val Leu Arg Ala Asp Pro Ser Phe Glu Glu Ala Pro Trp Pro Ser Ile Ser Pro Glu Ala Lys Asp Phe Val Lys Arg Leu Leu Asn Lys Asp Met Arg Lys Arg Met Thr Ala Ala Gin Ala Leu Thr His Pro Trp Ile Arg Ser Asn Asn Val Lys Ile Pro Leu Asp Ile Leu Val Tyr Arg Leu Val Arg Asn Tyr Leu Arg Ala Ser Ser Met Arg Lys Ala Ala Leu Lys Ala Leu Ser Lys Thr Leu Thr Glu Asp Glu Thr Phe Tyr Leu Arg Thr Gin Phe Met Leu Leu Glu Pro Ser Asn Asn Gly Arg Val Thr Phe Glu Asn Phe Arg Gin Ala Leu Leu Lys Asn Ser Thr Glu Ala Met Lys Glu Ser Arg Val Phe Glu Ile Leu Glu Ser Met Asp Gly Leu His Phe Lys Lys Met Asp Phe Ser Glu Phe Cys Ala Ala Ala Ile Ser Val Leu Gin Leu Glu Ala Thr Glu Arg Trp Glu Gin His Ala Arg Ala Ala Tyr Asp Ile Phe Glu Lys Glu Gly Asn Arg Val Ile Tyr Pro Asp Glu Leu Ala Lys Glu Met Gly Leu Ala Pro Asn Val Pro Ala Gin Val Phe Leu Asp Trp Ile Arg Gin Ser Asp Gly Arg Leu Ser Phe Thr Gly Phe Thr Lys Leu Leu His Gly Ile Ser Ser Arg Ala Ile Lys Asn Leu Gin Gin <210> 39 <211> 549 <212> PRT
<213> Physcomitrella patens <400> 39 Met Gly Asn Thr Ser Ser Arg Gly Ser Arg Lys Ser Thr Arg Gin Val Asn Gin Gly Val Gly Ser Gin Asp Thr Arg Glu Lys Asn Asp Ser Val Asn Pro Lys Thr Arg Gin Gly Gly Ser Val Gly Ala Asn Asn Tyr Gly Gly Lys Pro Ser Ser Gly Ala Gin Ala Gly Glu Arg Ser Thr Ser Ala Pro Ala Ala Leu Pro Arg Pro Lys Pro Ala Ser Arg Ser Val Ser Gly Val Leu Gly Lys Pro Leu Ser Asp Ile Arg Gin Ser Tyr Ile Leu Gly Arg Glu Leu Gly Arg Gly Gin Phe Gly Val Thr Tyr Leu Cys Thr Asp Lys Met Thr Asn Glu Ala Tyr Ala Cys Lys Ser Ile Ala Lys Arg Lys Leu Thr Ser Lys Glu Asp Ile Glu Asp Val Lys Arg Glu Val Gin Ile Met His His Leu Ser Gly Thr Pro Asn Ile Val Val Leu Lys Asp Val Phe Glu Asp Lys His Ser Val His Leu Val Met Glu Leu Cys Ala Gly Gly Glu Leu Phe Asp Arg Ile Ile Ala Lys Gly His Tyr Ser Glu Arg Ala Ala Ala Asp Met Cys Arg Val Ile Val Asn Val Val His Arg Cys His Ser Leu Gly Val Phe His Arg Asp Leu Lys Pro Glu Asn Phe Leu Leu Ala Ser Lys Ala Glu Asp Ala Pro Leu Lys Ala Thr Asp Phe Gly Leu Ser Thr Phe Phe Lys Pro Gly Asp Val Phe Gin Asp Ile Val Gly Ser Ala Tyr Tyr Val Ala Pro Glu Val Leu Lys Arg Ser Tyr Gly Pro Glu Ala Asp Val Trp Ser Ala Gly Val Ile Val Tyr Ile Leu Leu Cys Gly Val Pro Pro Phe Trp Ala Glu Thr Glu Gin Gly Ile Phe Asp Ala Val Leu Lys Gly His Ile Asp Phe Glu Asn Asp Pro Trp Pro Lys Ile Ser Asn Gly Ala Lys Asp Leu Val Arg Lys Met Leu Asn Pro Asn Val Lys Ile Arg Leu Thr Ala Gin Gin Val Leu Asn His Pro Trp Met Lys Glu Asp Gly Asp Ala Pro Asp Val Pro Leu Asp Asn Ala Val Leu Thr Arg Leu Lys Asn Phe Ser Ala Ala Asn Lys Met Lys Lys Leu Ala Leu Lys Val Ile Ala Glu Ser Leu Ser Glu Glu Glu Ile Val Gly Leu Arg Glu Met Phe Lys Ser Ile Asp Thr Asp Asn Ser Gly Thr Val Thr Phe Glu Glu Leu Lys Glu Gly Leu Leu Lys Gin Gly Ser Lys Leu Asn Glu Ser Asp Ile Arg Lys Leu Met Glu Ala Ala Asp Val Asp Gly Asn Gly Lys Ile Asp Phe Asn Glu Phe Ile Ser Ala Thr Met His Met Asn Lys Thr Glu Lys Glu Asp His Leu Trp Ala Ala Phe Met His Phe Asp Thr Asp Asn Ser Gly Tyr Ile Thr Ile Asp Glu Leu Gin Glu Ala Met Glu Lys Asn Gly Met Gly Asp Pro Glu Thr Ile Gin Glu Ile Ile Ser Glu Val Asp Thr Asp Asn Asp Gly Arg Ile Asp Tyr Asp Glu Phe Val Ala Met Met Arg Lys Gly Asn Pro Gly Ala Glu Asn Gly Gly Thr Val Asn Lys Pro Arg His Arg <210> 40 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 40 caggaaacag ctatgacc 18 <210> 41 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 41 ctaaagggaa caaaagctg 19 <210> 42 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 42 tgtaaaacga cggccagt 18 <210> 43 <211> 25 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Primer <400> 43 ccacggtctt cggctgctgg tcgtg 25 <210> 44 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 44 gcagcacagc accaccagcg gctat 25 <210> 45 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 45 gcgcccagtg agtagctcca gcatt 25 <210> 46 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 46 atcccgggtg agtatcactt acggtggcga 30 <210> 47 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 47 gcgttaactc gaccaaggtc actattccaa gca 33 <210> 48 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 48 cggtgcccac ctcgttcctg tggtt 25 <210> 49 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 49 atcccgggag tgggtggttg gactgtaagg a 31 <210> 50 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 50 gcgttaacct tcgtcttgga caggtagagg ttac 34 <210> 51 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 51 gactcagccc cgtaatcctt caaca 25 <210> 52 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 52 atcccgggca acgagaagca ttcgagatgg c 31 <210> 53 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 53 gcgttaacga gcatcacgat actcggtgat ttc 33 <210> 54 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 54 cgacggctaa taccacgttg gcgacca 27 <210> 55 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 55 atcccgggct gtgatgtcgg tgtggtgctc tgc 33 <210> 56 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 56 gcgagctcgc accactgaat gatggagact cagg 34 <210> 57 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 57 cgaccgcagc ccatgaggaa gttat 25 <210> 58 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 58 atcccgggct cacgtagtgc actgaactct gtc 33 <210> 59 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 59 gcgttaacat gcccatcttc tcatactcag acc 33 <210> 60 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 60 ctcgcctacc aagccccatt agaaa 25 <210> 61 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 61 atcccgggtt gtcgaggacg gagagagaag ag 32 <210> 62 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 62 gcgttaacct taggaatcgt atggcagaga gct 33 <210> 63 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 63 gcttcacaat gttgggccct ccaca 25 <210> 64 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 64 gcgttaacgg gaggaaggtc gggggaagag acg 33 <210> 65 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 65 gcgagctcag cgcttcgcac aactgagaaa cct 33 <210> 66 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 66 acgagaaggt tggtgggctt caagt 25 <210> 67 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 67 atcccgggcg agccatggcg ccacttgctt 30 <210> 68 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 68 gcgttaacgc cgagcaacaa tgtctgctgg atg 33 <210> 69 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 69 cccggtaagc catcggagtg tggaa 25 <210> 70 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 70 atcccgggct tgtattggct cggataattt 30 <210> 71 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 71 gcgttaacgg caatatctgc acagccgttc act 33 <210> 72 <211> 25 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Primer <400> 72 gtgtctcgct gggccaagga atgaa 25 <210> 73 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 73 atcccgggcg gtcgagtcgt attaggtgtt gtttc 35 <210> 74 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 74 gagctccggt aggtccgacc tcttcaattg 30 <210> 75 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 75 gacgacgcga agcccggtgt ggttga 26 <210> 76 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 76 atcccgggag aggctgatct gatgctacag t 31 <210> 77 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 77 atgagctctg gcggattggc gaggtagttc gac 33 <210> 78 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 78 cggcgcaacg tagtatgcgc ttcca 25 <210> 79 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 79 cgcggtgaac aacaccttgc aggtgac 27 <210> 80 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 80 gctcgggtca gccctcaaca ccgca 25 <210> 81 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 81 gttaaagctt gtgcagcagt catgc 25 <210> 82 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 82 atcccgggtg taggcgggcg aggttcgatg c 31 <210> 83 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 83 gcgttaacga caaccggagt agaacggcag tcca 34 <210> 84 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 84 agaagcgagg aatgggcagg gacga 25 <210> 85 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 85 atcccgggcg aactgcgatc tgagattcca ac 32 <210> 86 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 86 gcgttaacga gatccaaccg aagccatcct acga 34 <210> 87 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 87 gcgctgcaga tttcatttgg agaggacacg 30 <210> 88 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 88 cgcggccggc ctcagaagaa ctcgtcaaga aggcg 35 <210> 89 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 89 gctgacacgc caagcctcgc tagtc 25 <210> 90 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 90 gcgttaactc gaccaaggtc actattccaa gca 33 <210> 91 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 91 gcgttaacct tcgtcttgga caggtagagg ttac 34 <210> 92 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 92 gcgttaacga gcatcacgat actcggtgat ttc 33 <210> 93 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 93 gcgagctcgc accactgaat gatggagact cagg 34 <210> 94 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 94 gcgttaacat gcccatcttc tcatactcag acc 33 <210> 95 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 95 gcgttaacct taggaatcgt atggcagaga gct 33 <210> 96 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 96 gcgagctcag cgcttcgcac aactgagaaa cct 33 <210> 97 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 97 gcgttaacgg caatatctgc acagccgttc act 33 <210> 98 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 98 gcgttaacgg caatatctgc acagccgttc act 33 <210> 99 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 99 gagctccggt aggtccgacc tcttcaattg 30 <210> 100 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 100 atgagctctg gcggattggc gaggtagttc gac 33 <210> 101 <211> 34 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Primer <400> 101 gcgttaacga caaccggagt agaacggcag tcca 34 <210> 102 <211> 34 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 102 gcgttaacga gatccaaccg aagccatcct acga 34 <210> 103 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 103 cccagtaata gcagggttgg aggaa 25 <210> 104 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 104 ggctgcctga agatccgcta cagag 25 <210> 105 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 105 cgtcaggcta ctttgcgtgg agcac 25 <210> 106 <211> 25 <212> DNA
<213> Artificial Sequence _ <220>
<223> Description of Artificial Sequence: Primer <400> 106 cggtgctggc taacaccagg ccaga 25 <210> 107 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 107 atcccgggca acgagaagca ttcgagatgg c 31 <210> 108 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 108 gcgttaacga gcatcacgat actcggtgat ttc 33 <210> 109 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 109 cgtggcatct ctcccgatgt tctta 25 <210> 110 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 110 ggccaactga aggcgtgtca tgatc 25 <210> 111 <211> 25 = CA 02405750 2003-04-03 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 111 ctcgagggct cgttcaccgt gacct 25 <210> 112 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 112 cggaggtaac agtagtcagg ctgctc 26 <210> 113 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 113 ccgcgaccct tccacgcatc agcat 25 <210> 114 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 114 cctccaggaa gcctgcgccg agaag 25 <210> 115 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 115 ggacattgtc cgtgatcagc aatcga 26 <210> 116 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 116 cagcctctgg aacaaccaga cgctg 25 <210> 117 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 117 gtcaccgcga ggtacaagcc accac 25 <210> 118 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 118 gcagctctgg agctctgtac cacct 25 <210> 119 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 119 acggccacgt cgagaatctg agcaa 25 <210> 120 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 120 cgaagtgctc gcaagcaatg ccgaa 25 = CA 02405750 2003-04-03 <210> 121 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 121 atcccgggcg gtcgagtcgt attaggtgtt gtttc 35 <210> 122 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 122 gagctccggt aggtccgacc tcttcaattg 30 <210> 123 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 123 gggcaactgt caatagcaga cctgga 26 <210> 124 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 124 gcaagtccca acgaacgtgt ctcgct 26 <210> 125 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 125 gcgaagatga cgactgctat tgcga 25 <210> 126 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 126 cgtgatgact ccaatgctcc atacg 25 <210> 127 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 127 gccagcatcg aggtcagtat ccggtgt 27 <210> 128 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 128 gtctgtggcc ttcagaggcg catcctc 27

Claims (27)

WHAT IS CLAIMED IS:

1. A transgenic plant cell transformed by a Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid in the plant cell results in increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant cell, and wherein:
a. the PKSRP is a protein Kinase (PK-6) protein as defined in SEQ ID NO:27;
b. the PKSRP is a polypeptide having at least 70% sequence identity with SEQ ID NO:27 over its entire length, or c. the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ ID NO:14 over its entire length.

2. The transgenic plant cell of claim 1, wherein the PKSRP is a PK-6 as defined in SEQ ID NO:27.

3. The transgenic plant cell of claim 1, wherein the PKSRP coding nucleic acid is PK-6 as defined in SEQ ID NO:14.

4. The transgenic plant cell of claim 1, wherein the tolerance to drought stress is increased.

5. The transgenic plant cell of claim 1, wherein the plant is a monocot.

6. The transgenic plant cell of claim 1, wherein the plant is a dicot.

7. The transgenic plant cell of claim 1, wherein the plant is maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut, perennial grass or forage crops.

8. An isolated Protein Kinase Stress-Related Protein (PKSRP) wherein the PKSRP is:
a. a Protein Kinase-6 (PK-6) as defined in SEQ ID NO:27;
b. a polypeptide having at least 70% sequence identity with SEQ ID
NO:27, or c. a polypeptide encoded by a nucleic acid that has at least 70%
sequence identity with SEQ ID NO:14 over its entire length;
and wherein the PKSRP upon expression in a plant results in the plant's increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant.

9. Use of the PKSRP as defined in claim 8, for increasing the tolerance of a transformed plant or plant cell or plant seed to drought and/or freezing stress, wherein the plant, the plant cell or the seed comprises the PKSRP.

10. The isolated PKSRP of claim 8, wherein the PKSRP has at least 70%
sequence identity with SEQ ID NO:27.

11. An isolated Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein the PKSRP coding nucleic acid:
a. is a sequence as defined in SEQ ID NO:14, b. is a sequence of at least 70% identity to SEQ ID NO:14, or c. encodes the PKSRP as defined in claim 8, and wherein the expression in a plant increases the plant's tolerance to drought and/or freezing stress.

12. The isolated PKSRP coding nucleic acid of claim 11, wherein the coding nucleic acid is defined in SEQ ID NO:14 or is a sequence of at least 70%
identity to SEQ ID NO:14.

13. The isolated PKSRP coding nucleic acid of claim 11, wherein the PKSRP
coding nucleic acid encodes a polypeptide as defined in SEQ ID NO:27.

14. Use of the isolated PKSRP coding nucleic acid of any one of claims 11 to 13, for increasing the tolerance of a transformed plant or plant cell or plant seed to drought and/or freezing stress, wherein the plant, the plant cell or the seed comprises the PKSRP as defined in claim 8.

15. Use of the isolated PKSRP coding nucleic acid of any one of claims 11 to 13, for the identification or cloning of PK-6 homologs in other cell types and organisms.

16. An isolated recombinant expression vector comprising the nucleic acid of any one of claims 11 to 13, wherein the expression of the vector in a host cell results in increased tolerance to drought and/or freezing stress.

17. A method of producing a transgenic plant containing a Protein Kinase Stress-Related Protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid in the plant results in the plant's increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant, comprising, transforming a plant cell with an expression vector comprising the nucleic acid, generating from the plant cell a transgenic plant with an increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant, wherein:
a. the PKSRP is a Protein Kinase-6 (PK-6) as defined in SEQ ID NO:27;
b. the PKSRP is a polypeptide having at least 70% sequence identity with SEQ ID NO:27 over its entire length, or c. the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ ID NO:14 over its entire length.

18. The method of claim 17, wherein the PKSRP is a polypeptide having at least 70% sequence identity with SEQ ID NO:27 over its entire length.

19. The method of claim 17, wherein the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ ID NO:14 over its entire length.

20. A method of modifying drought and/or freezing stress tolerance of a plant comprising, genetically modifying the expression of a Protein Kinase Stress-Related Protein (PKSRP) in the plant in order to obtain a transgenic plant, wherein:
a. the PKSRP is a Protein Kinase-6 (PK-6) as defined in SEQ ID NO:27;
b. the PKSRP is a polypeptide having at least 70% sequence identity with SEQ ID NO:27 over its entire length, or c. the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ ID NO:14 over its entire length;
and wherein the transgenic plant has an increased tolerance to drought and/or freezing stress as compared to a wild type variety of the plant.

21. The method of claim 20, wherein the PKSRP is defined in SEQ ID NO:27.

22. The method of claim 20, wherein the PKSRP is a polypeptide having at least 70% sequence identity with SEQ ID NO:27 over its entire length.

23. The method of claim 20, wherein the PKSRP coding nucleic acid has at least 70% sequence identity with SEQ ID NO:14 over its entire length.

24. The method of claim 20, wherein the plant is transformed with a promoter that directs expression of the PKSRP.

25. The method of claim 24, wherein the promoter is tissue specific.

26. The method of claim 24, wherein the promoter is developmentally regulated.

27. The method of claim 20, wherein PKSRP expression is modified by administration of an antisense molecule that inhibits expression of PKSRP.