CA2407523A1 - Isolation and characterization of the csa operon (etec-cs4 pili) and methods of using same - Google Patents

Abstract

Compositions comprising products of the csa operon, an isolated nucleic acid encoding the csa operon or functional fragments thereof, purified polypeptid e products of the csa operon or functional fragments thereof, methods of eliciting an immune response to these products, and methods of producing products of the csa operon are disclosed herein.

Description

ISOLATION AND CHARACTERIZATION OF THE csa OPERON (ETEC-CS4 Pll1) AND METHODS
OF USING SAME
Backnround of the Invention Field of the Invention The disclosed invention relates to the isolation and characterization of the csa operon, which encodes the CS4 pili and its use as an immunogenic agent with utility in preventing ETEC
colonization of a subject.
Descriution of the Related Art Human ETEC strains are a major cause of diarrhea in infants and young children in developing countries (Black et al., Lancet, I: 141-143 (1981); Levine, J. Infect, Dis., 155:377-389 (1987); Qadri, et al., J. Clin. Microbial., 38:27-31 (2000)), which account for a high rate of infantile morbidity and mortality. Human ETEC strains are also a major cause of travelers' diarrhea. (Black, Rev. Infect. Dis., 8S:S131-S135 (1986); DuPont et al., N. EngL J. Med, 285:1520-1521 (19761; Hyams et al., N. EngL J. Med, 325:1423-1428 (1991);
Merson, et al., N. EngL J. Med, 294:1299-1305 (1976)). ETEC infection is characterized by watery diarrhea often accompanied by low-grade fever, abdominal cramps, malaise and vomiting.
ETEC strains colonize the small bowel lumen by means of surface pili called colonization factor antigens (CFA), and coli surface antigens (CS), and cause diarrhea through the action of heat labile (LT) andlor heat stable (ST) enterotoxins. ETEG fimbriae are proteinaceous filaments exhibiting different morphologies such as rigid rod like shapes of 2-7 nm in diameter, fibrilar thin flexible wiry structures, or bundles. (Gaastra et al., Trends. MicrobioL, 4:444-452 (1996)).
Human ETEC strains display a variety of over 20 serologically distinct pili on their cell surfaces. The most common human ETEC strains express CFAh, CFAIII and CFAllll (Levine, et al., "Fimbrial vaccines," /n P. Klemm led.), Fimbriae: adhesion, biopenics, genetics and vaccines, Boca Raton: CRC Press, 1994; McConnell, et al., EpidemiaL
Infect,, 106: 477-484 (1991)). CFAII produces a single type of fimbriae, while CFAIII and CFAIIU strains produce several types of coli surface antigens. CFAIII strains express CS1, CS2 and CS3; and CFAIIV strains (originally called PCF8775) express the nonpilus antigen CS6 either alone or together with CS4 or CS5 fimbria. (McConnell, et al., Infect. lmmun., 56:1974-1980 (1988); McConnell, et al., fEMSMicrobioL Lett., 52:105-108 (1989); Svennerholm, et al., Infect. lmmun., 56:523-528 (1988); Thomas, et al., J, hen. MicrobioL, 131:2319-2326 (1985)1. The occurrence of CS4+CS6'~ producing strains is restricted to serotype 025:H42. (McConnell, et al., Infect. lmmun., 56:1974 1980 (1988); Willshaw, et al., fEMS MicrvbioL Lett., 49:473-478 (1988);
Willshaw, et al., fEMS MicrobioL Lett., 56:255-260 (1990); Wiilshaw, et al., fEMSMicrobiol. Lett., 66:125-129 (1991)).
The CS4 pili is rigid, 7 nm in diameter, and is composed of subunits with a molecular mass of 17.0 kDa.
(Knutton, et al., Infect. lmmun., 57:3364-3371 (1989); McConnell, et al., Infect. lmmun., 56:1974-1980 (1988); Wolf, et al., Infect. lmmun., 57:164-173 (1989)). Because of their epidemiological importance and due to the fact that cross protection does not occur between strains of ETEC expressing different fimbriae, at least these CFAII and CS1-CS6 fimbrial types must be included in a broad spectrum ETEC vaccine, (Gaastra et al., Trends. MicrobioL, 4:444-452 (1996); Levine, J. Pediatr. Gastroenterol. Nuts, In Press (2000); Levine, et al., "Fimbrial vaccines," /n P. Klemm (ed.), Fimbriae: adhesion, bio enq ics, genetics and vaccines, Boca Raton: CRC Press, 1994). Of these seven important fimbriae, only the genes encoding CS4 have not been cloned and sequenced.
The genes that are required for the expression of functional pili are characteristically linked in gene clusters (Sakellaris and Scott, MoL MicrobioL, 30:681-687 (1998)), and consist of the structural genes, assembly cassette genes and regulatory genes. The assembly cassette genes include chaperone and usher genes. The chaperone protein is thought to bind to fimbrial subunit proteins in the periplasmic space and prevent premature folding and degradation.
The usher proteins are outer membrane proteins that serve as pores for the transport and assembly of the fimbriae.
The structural gene encodes for the pilin protein that forms the fimbriae that is composed of repeated subunits of the pilin protein. Some fimbriae such as, CFAJI, CS1 and CS2, contain a minor pilin protein which is associated with the pili tip, that is probably involved in the attachment of the bacteria to the cell receptors. (Sakellaris, et al., Proc. Nat/.
Acad Sci. U.S.A., 96:12828-12832 (1999)). Fimbria expression is controlled by genes such as rns and cfaD that are similar to the araC family of transcriptional regulators that positively regulate transcription. (Grewal et al., Vaccine, 11:221-226 (1993); de Haan et al., fEMS MicrobioL Lett., 67:341-346 (1991);
19, 21, Savelkoul, et al., Microb.
Pathog., 8:91-99 (1990)).
Genes encoding ETEC fimbriae have been located on large plasmids [CFAII, (Homers et al., Microb. Pathog., 6:297-309 (1989); 20); CS1, (Froehlich et al., MaL MicrobioL, 12:387-401 (1994)); CS3, (Jalajakumari, et al., MoL
MicrobioL, 3:1685-1695 (1989), Manning, et al., MoL Gen. Genet., 200:322-327 (1985)1; CSS, (Duthy, et al., J.
BacterioL, 181:5847-5851 (1999)) and CS6, (Wolf, et al., fEMS Microbiol, Lett., 148:35-42 (1997))], or on the chromosome [CS2, (Froehlich et al., MoL Microbial., 12:387-401 (1994), Froehlich et al., Infect. lmmun., 63:4849-4856 (1995))]. Early experiments to locate the CS4 encoding genes revealed disparate results without conclusive localization, (Sommerfelt, et al" Microb. Pathog., 11:297-304'(1991);
Sommerfelt, et al., Infect. lmmun., 60:3799-3806 (1992); Sommerfelt, et al., J. Clin. MicrobioL, 30:1823-1828 (1992);
Willshaw, et al., FEMS MicrobioL Lett., 56:255-260 (1990); Wolf, et al., Infect. lmmun., 57:164-173 (1989)).
Because the attachment of ETEC strains to intestinal cells is crucial for establishment of infection, the prevention of disease is based mainly upon immune responses against the pill that interfere with the attachment process. Studies performed with 14 healthy human volunteers who ingested 5x108 E, coli E24377A (0139:N28), a CS1 and CS3 producing strain, showed that all 14 became colonized, 9 developed a typical diarrheal syndrome, and 6 of these ill persons manifested a significant increase in serum IgG antibody to purified CS1 and CS3 antigens. Levine, M.M., et al., Infect. lmmun., 44:409-420 (1984). These results suggest that the fimbria play a role in pathogenesis, and stimulate an immune response.
Passive protection against ETEC infection was demonstrated in a clinical trial done at the University of Maryland, which demonstrated that oral prophylaxis with hyperimmune anti CFAII
immunoglobulin provided 90%
protection against diarrhea caused by oral challenge with 109 cfu of ETEC
strain H10407, a CFAII producing strain.
Tacket, et al., N. Eng. J. Med., 318: 1240 (1988). In another study oral immunization with purified CS1 and CS3 -Z-antigens encapsulated in biodegradable polymer microspheres were used to induce the development of IgA anti CS
ASC (Antibody Secreting Cells) and jejunal fluid secretory IgA anti CS in 50%
of the vaccinees. Levine, et al., Fimbriae (pill) adhesions as vaccines, in Protein-Carbohydrate Interactions in Bio%gical Systems. The mo%cular Biology of MicrobialPathogenicity, Lark, et al., Eds., Academic Press, London, p 154, 1986. This exposure also protected 30%
of vaccinees from diarrhea following challenge with the virulent ETEC E24377A
(CS1+CS3+LT+ST+) strain. A
protective efficacy of 75% was demonstrated by immunization with the attenuated ETEC strain. Feeding volunteers with 5x10'° live E. coil E1392-75-2A (06;H16) a CS1+ CS3+ LT- ST' strain, induced significant rise in intestinal fluid secretory IgA antibodies to CS1 and CS3 fimbria, and conferred protection to 9112 volunteers that were challenged with a virulent heterologous serotype strain ETEC E24377A (0139:H28).
Another approach to develop an ETEC vaccine is to immunize with killed mixed ETEC strains. This type of vaccine is based on the fact that prior infection with an ETEC strain elicits protective immunity against a clinical illness that might be caused from subsequent exposure to the homologous strain. Oral immunization of children and adult volunteers with such a vaccine resulted in significant intestinal IgA
responses against the CFA and CS
components of the various strains. The vaccine induced high level of intestinal IgA antibody, IgA antibody ASC in the blood, and serum antibodies towards the colonization factor antigens.
Jertborn, et al., Vaccine 16:255 (1997). Those results indicate that antibodies towards ETEC pills provide protection against diarrhea caused by ETEC strains.
A combined vaccine against diarrheal disease caused by Shigella, Salmonella and ETEC has been proposed.
These vaccines are composed of live attenuated Shigella or Salmonella strains that express ETEC fimbriae. The recombinant bacteria colonize the intestine and induced the mucosal and systemic immune response against the bacteria and the pill. Noriega et al., (infect. lmmun., 64:23-27 (1996)) co-expressed CFAII and CS3 in Shigella CVD1203, immunized guinea pigs and mice, and showed that the immunized animals developed high titer of tears secreted IgA (similar to mucosal slgA), and serum 1gG antibodies, towards the Shigella LPS and the fimbrial antigens.
The ETEC human recombinant LT (K63) gene was expressed in Shigella CVD1204, a guanine dependent strain, and showed production of slgA and serum IgG toward the Shigella LPS as well as towards the LT-A and LT-B subunits of the LT enterotoxin, following immunization of guinea pigs. Koprowski, et al., (infect. lmmun., 68:4884-92 /2000)) co-expressed in CVD1204 the CFAII and LT (K63) antigens, and demonstrates production of antibodies of the slgA and serum IgG toward the Shigella LPS, the CFAII pill antigens and the LT
antigens. Altboum et al, (Attenuated Shigella flexneri 2a ~guaBA strain CUD 1204 expressing ETEC CS2 and CS3 fimbriae as a live mucosal vaccine against Shigella and enterotoxigenic Escherichia toll infection, In press) immunized guinea pigs with a mixture of CVD1204 strains expressing ETEC CS2 and CS3 fimbria. All the immunized animals developed tears slgA and serum IgG
antibodies against Shigella LPS, CS2 and CS3 antigens, agglutinating antibodies against Shigella and ETEC CS2 and CS3 strains, and were protected against keratoconjunctivitis caused by eye challenge with the virulent S. flexneri 2a 2457T strain. Those results indicate that a combined immunization with live attenuated Shigella strains expressing ETEC fimbria might induce protection against Shigellosis and ETEC infection.

Summary of the Invention The disclosed invention relates to compositions and methods of using csa operon products and the nucleotide and amino acid sequences encoded thereby. One embodiment relates to an immunogenic composition comprising a recombinant product of a csa operon and a carrier. Various aspects of this embodiment relate to compositions in which the recombinant product of the csa operon is CsaA, CsaB, CsaC, CsaD, CsaE, or a product that is at least 95% homologous to anyone of these csa operon products.
Additionally, the recombinant product of the csa operon can comprise the csa operon itself.
Another embodiment relates to an isolated nucleotide sequence comprising a csa operon or a functional fragment thereof. Another embodiments relates to a purified polypeptide sequence expressed from a recombinant csa operon.
Also disclosed are various methods of using the csa operon, products, and fragments thereof. One embodiment teaches a method of generating an immune response, comprising providing an immunogenic composition to a subject, wherein the immunogenic composition comprises a csa operon, a functional fragment thereof, or product thereof, and contacting the subject with the immunogenic composition, whereby an immune response is generated in the subject.
Another embodiment relates to a method of producing a polypeptide product from a csa operon or functional fragment thereof, comprising providing the csa operon in an expression vector, introducing the expression vector into a host cell, such that a recombinant host cell is produced, and subjecting the recombinant host cell to conditions such a protein from the csa operon is expressed.
Additional embodiment encompass cells containing recombinant the csa operon or fragments thereof and vectors comprising the csa operon or fragments thereof.
Brief Descriution of the Drawinq_s FIGURE 1 . Plasmid constructs containing the entire csa operon. Plasmid pKS-CSA-I contains the csaB, csaC, csaE, csaD' genes, and IS1 element, (1A). Plasmid pKS-CSA-II contains the csaA genes and upstream sequences flanked with IS21 element.(1 B). Schematic representation of the csa operon, (1 C).
FIGURE 2. The CS4 fimbriae expression plasmid. Schematic description of the stabilized plasmid pGA2, (Fig,2A), that is maintained with 15 copies per cell, and contained the the hok-sok post-segregational killing system, the parA and parts plasmid partitioning system; the aph allele for resistance to kanamycin, and multiple cloning sites.
Fig. 2B, Plasmid pGA2-CS4 that contained the cloned CS4 fimbriae encoding genes, csaA , csaB, csaC, and csaE.
FIGURE 3. Alignment of the amino acid sequence of CsaE to other homologous proteins. The predicted amino acid sequence of CsaE (SEO ID N0:28) based on the gene sequence was used in a BLAST search for other homologous proteins. CfaE (SEQ ID N0:29) is the tip adhesion moiety of CS2;
Coop (SEO ID N0:30) is the tip adhesion moiety of CS1; and TsaD (SEQ ID N0:31) is the adhesion protein from Salmonella typhi. CotD (SEO ID
N0:32) is the spore coat protein of Bacillus subtilis.

FIGURE 4. Alignment of the amino acid sequence of CsaB to other ETEC fimbrial subunit proteins. The predicted amino acid sequence of CsaB (SEQ ID N0:33) based on the DNA sequence was used in a BLAST search to identify homologous proteins. The other fimbrial subunits were CfaA (SEQ ID
N0:34), CooA (SEQ ID N0:35), CotA
(SEQ ID N0:36), CsuA1 (SEQ ID N0:37), CsuA2 (SEQ ID N0:38), CsdA (SEQ ID
N0:39), and CsbA (SEQ ID N0:40).
Detailed Description of the Preferred Embodiments The description below relates to the csa operon, which encodes the proteins required for the production of CS4 antigen, and the generation of immunogenic compositions containing products or fragments of the csa operon.
Methods of making and using the disclosed immunogenic compositions are also described.
To generate the disclosed immunogenic compositions, the csa operon has been sequenced and cloned into an expression vector. The genes of the csa operon have been expressed in Shigella C11D1204, resulting in the production of CS4 in this recombinant organism. Preliminary results from immunization of guinea pigs with this recombinant strain indicate the development of an immune response against both Shigella and the CS4 pili. Accordingly, the work described herein relating to the csa operon is applicable to the formulation and administration of immunogenic compositions with activity against a variety of diseases.
Oraanization of the csa Oueron The csa operon is located on a DNA fragment of approximately ten (10) kilobases in length. The operon comprises 5 genes that are flanked on bath sides by insertion elements. This structure is similar to the pathogenicity island described in FIGURE 1.
From the entire fragment, 7245 base pairs were sequenced on both strands and the data are presented in FIGURE 2. The size of the csa operon was found to be approximately 6099 base pairs in length and encompasses five open reading frames.
Sequence homology to genes encoding the subunits of other ETEC fimbriae for which biochemical analysis is available indicates the following functions for each of the open reading frames. The csaA gene encodes the CsaA
protein, which is hypothesized to be a periplasmic chaperon-like protein. The csa8 gene encodes the CsaB protein, which is hypothesized to be the major pilin subunit. Amino terminal sequence analysis of the CS4 pilin subunit confirms the role for this gene. The csaC gene encodes the CsaC protein is hypothesized to be a membrane usher protein. The csaD gene encodes a truncated CsaD, which is hypothesized to be a regulatory protein. The csaE gene encodes the CsaE protein, which is hypothesized to be a tip-associated pilin protein. The amino acid sequences of the CsaA-E proteins are described in FIGURE 3.
The location of the individual genes in the csa operon, and the properties of the CsaA-E proteins, are described in Table 1.

Properties of the csa operon.
Gene Location PRO properties ns:
of the protei (bp) No. CalculatedTheoreticalSignal peptide, of MW p! No. of AA
AA

csaA 286-1002 CsaA 238 27305.6 9.29 19 csaB 1058-1534 CsaB 167 17343.9 6.56 23 csaC 1592-4195 CsaC 867 97686.93 8.42 22 csaE 4199-5284 CsaE 361 40102.4 8.75 23 csaD 5793-6099 CsaD 100 Missing to the N-terminal 109 48 amino acids.

The amino acid sequences of the CsaA-E proteins share homology to similar proteins from other ETEC
fimbriae. A comparison of protein homologies is shown in Table 2.

Homology of CsaA-E proteins to other ETEC fimbriae proteins.
CS4 Homologyto:

Pro Pili ProteinNCBI Identities Positive Gaps no.

CsaA CFAh CfaA M55661 2081238 (87%)2181238 (91 %) CS1 CooB P25731 1241221 (56%)1611221 (72%)41221 (1%) CS2 CotB S57934 1111238 (46%)157!238 (65%)3)238 (1%) CsaB CS4 CsfA X97493 1091134 (81 1101134 (81 %) %) CFAh CfaB P02971 991170 (58%)1221170 (71 31170 %) (1 %) CS14 CsuA1 X97491 951164 (57%)1161164 (69%) CS1 CooA P25730 851168 (50%)1081168 (63%)41168 (2%) CS2 CotA S57935 761167 (45%)1051167 (62%)31167 (1%) CS14 CsuA2 X97492 671132 (50%)841132 (62%)11132 (1 %) CS19 CsdA X97494 561131 (42%)751131 (56%)1)132 (0%) CS17 CsbA X97495 541132 (40%)751132 (55%)11132 (0%) CsaC CFAh CfaC P25733 8001868 (92%)8211868 (94%) CS1 CooC S49538 5311841 (63%)6591841 (78%)31841 (0%) CS2 CotC 557936 4691839 (55%)6101839 (71 31839 %) (0%) CsaE CFAh CfaE P25734 2681361 (74%)2931361 (80%)11361 (0%) CS1 Coop S49539 1771329 (59%)224)329 (67%)111329 3%) CS2 CotD S57937 1611339 (47%)2181339 (63%)7)339 (2%) CsaD CFAII CfaD P25393 901101 (89%)981101 (96%) RNS P16114 891101 (88%)981101 (96%) CSIIR P3460 751103 (72%)881103 (84%) AAFII AGGR P43464 571101 (56%) The csa operon encodes the synthesis of ETEC CS4 fimbriae. This operon was cloned from ETEC E11881A, a CS4 producer strain. A nucleic acid fragment comprising 7239 base pairs was sequenced (in both directions). The results indicate that the csa operon is located on a nucleic acid fragment 6095 base pairs in length. (Accession No.
AF296132).
The sequence of the csa operon was analyzed. The analysis of the operon indicated that the csa operon encodes five proteins. These proteins are the fimbriae structural protein (CsaB), the tip associated protein (CsaE), a chaperon-like protein (CsaA), a usher-like protein (CsaC), and a truncated regulatory protein (CsaD).
The CsaB protein consist of 167 amino acids, (23 of which comprise a signal peptide), producing an ~ 17 kDa peptide. The amino acid sequence of the CsaB protein shares homology with other ETEC fimbriae proteins. For example, CsaB is 71 % homologous to the CfaB protein of CFAII, 69% and 62%
homologous to the two CS14 structural proteins, 63% homologous to the CS1 structural protein, 62%
homologous to the CS2 structural protein, 56% homologous to the CS19 structural protein, and 55% homologous to the CS17 structural protein.
The CsaE protein is believed to be a tip associated protein based on its homology to known tip proteins of other ETEC fimbriae. It is a protein of 361 amino acids, 23 amino acids of which are cleaved to produce a globular ~40 kDa protein. The amino acid sequence of the CsaE protein shares homology to CFAII, CS1 and CS2 pili tip proteins, of 80%, 67% and 63%, respectively. The fimbrial assembly proteins CsaA and CsaC share homology to similar proteins from CFA~I, CS1 and CS2 pili.
Csa is believed to be a regulatory protein based on its homology to other known ETEC regulatory proteins.
Its 48 terminal amino acids were deleted as a result of an insertion of an IS1 element. In addition, two frame shift mutations following 100 amino acids resulted in a stop colon. ETEC CFAh strain E7473 contains a truncated CfaD' like protein (144 amino acids out of 265), which also contains a stop colon and various frame shift mutations. (Jordi, et al., DNA Seg., 2:257-263 (1992)). The position of the frame shift mutation in cfaD' (Accession AAC41418) is at the same region as in csaD
Upstream to the csaA gene (approximately 3.5 kb) there is an additional IS21 element, rendering the csa operon flanked between the two insertion elements, which is characteristic of a mobile structure. The size of this pathogenicity island-like structure is about 10,500 base pairs and its G+C
ratio is lower than that of E. coii (38.8%
versus 50.8%).
Other ETEC fimbrial operons are carried on similar mobile structures. The CS1 operon contains IS sequences on both sides (1S150 (Accession: X62495), and IS2 (Accession No.:
X76908)(Froehlich, et al., Mol. MicrobioL, 12:387-401 (1994)). The CS2 operon contains at its upstream site IS3 and IS1 DNA sequences, (Accession No.:
Z47800)(Froehlich, et al., Infect, immun., 63:4849-4856 (1995)). The CS6 pili contains IS elements, upstream IS91 and IS102, and downstream IS629 and IS3, (Accession U04844)(Wolf, et al., fEMS
Micrabiol, Lett., 148:35-42 (1997)). The CS5 pili operon contains IS1 sequences at the upstream position that are 99% homologous to the IS1 sequences of the csa operon, and at its downstream site, IS30 sequences.
(Accession AJ224079)(Duthy, et al., J.
BacterioL, 181:5847-5851 (1999)).

The CS4 major fimbrial protein shares a high degree of amino acid sequence homology to CFAIi, CS1 and CS2 fimbrial proteins. Cross-reaction between antibodies against CS4 and CFAII. CS1, CS2, and CS17 fimbriae were described by McCannell et al 1989. (McConnell, et al., fEMSMicrobiol. Lett., 52:105-108 (1989)).
The high homology between the structural proteins of CS4 and CFAII fimbriae resulted in antibodies that cross-reacted with both fimbriae. Monoclonal antibodies against CFAII cross reacted with CS4 and inhibited the binding of both fimbriae containing strains to human jejunal enterocytes and to Caco-2 cells. These antibodies also inhibited hemagglutination and conferred passive protections against fluid accumulation in rabbit ileal loops caused by infection of both ETEC strains. (Rudin, et al., Microb. Pathog., 21:35-45 (1996)). Moreover, it has been hypothesized that immunization with purified CFAh and CS4 fimbriae may prime and boost immune response against the homologous and heterologous fimbriae. (Rudin and Svennerholm, Microb. Pathog., 16:131-139 (1994); Rudin, et al., Epidemiol. infect.,119:391-393 (1997)1.
Nucleotide Senuences relating to the csa operon Having identified the csa operon and the genes encoded thereby, this knowledge has been used to produce useful immunogenic compositions. As is discussed more fully in the Examples below, the genes of the csa operon were cloned, sequenced and expressed. Polynucleotide molecules encoding the proteins of the csa operon and their sequences are provided below.
Representative polynucleotide molecules encoding the proteins of the csa operon (SEO ID. NO.: 27) include sequences comprising csaA (SEO. ID. NO.: 1 ), csa8 (SEO. ID. NO.: 3), csaC
(SEO. ID. NO.: 5), csaD (SEO. ID. NO.: 7), and csaE(SEO. ID. NO.: 9). Polynucleotide molecules encoding the proteins of the csa operon include those sequences resulting in minor genetic polymorphisms, differences between strains, and those that contain amino acid substitutions, additions, andlor deletions.
In some instances, one can employ such changes in the sequence of a recombinant csa operon-encoded protein to substantially decrease or increase the biological activity of a particular csa operon-encoded protein relative to the activity of the corresponding wild-type csa operon-encoded protein.
Such changes can also be directed towards an endogenous csa operon encoded sequence using, for example, various molecular biological techniques to alter the endogenous gene and therefore its protein product.
Nucleotide sequences encoding csa operon proteins can be used to identify polynucleotide molecules encoding other proteins with biological functions similar to that of the csa operon. Complementary DNA molecules encoding csa operon-like proteins can be obtained by constructing a cDNA
library from mRNA from eukaryotic cells or a DNA library from other prokaryotic organisms. DNA molecules encoding csa operon-like proteins can be isolated from such a library using the sequences disclosed herein with standard hybridization techniques or by the amplification of sequences using polymerase chain reaction (PCR) amplification.
In a similar manner, genomic DNA encoding csa operon protein homologs can be obtained using probes designed from the sequences disclosed herein. Suitable probes for use in identifying csa operon produced protein homologue sequences can be obtained from csa operon-specific sequences.
Alternatively, oligonucleotides containing -g-specific DNA sequences from a csa operon-coding region can be used to identify related csa clones. One of ordinary skill in the art will appreciate that the regulatory regions of the csa operon and homologous genes and operons can be obtained using similar methods.
csa operon homologous polynucleotide molecules can be isolated using standard hybridization techniques with probes of at least about 7 nucleotides in length and up to and including the full coding sequence. Homologous csa operon sequences can be identified using degenerate oligonucleotides capable of hybridization based on the sequences disclosed herein for use PCR amplification or by hybridization at moderate or greater stringency. The term, "capable of hybridization" as used herein means that the subject nucleic acid molecules (whether DNA or RNA) anneal to an oligonucleotide of 15 or more contiguous nucleotides of SEO. ID. NOs: 1, 3, 5, 7, and 9.
The choice of hybridization conditions will be evident to one skilled in the art and will generally be guided by the purpose of the hybridization, the type of hybridization (DNA-DNA or DNA-RNA), and the level of desired relatedness between the sequences. Methods for hybridization are well established in the literature. One of ordinary skill in the art realizes that the stability of nucleic acid duplexes will decrease with an increased number and location of mismatched bases; thus, the stringency of hybridization can be used to maximize or minimize the stability of such duplexes. Hybridization stringency can be altered by: adjusting the temperature of hybridization; adjusting the percentage of helix-destabilizing agents, such as formamide, in the hybridization mix; and adjusting the temperature and salt concentration of the wash solutions. In general, the stringency of hybridization is adjusted during the post-hybridization washes by varying the salt concentration andlor the temperature, resulting in progressively higher stringency conditions.
An example of progressively higher stringency conditions is as follows: 2 x SSCI0.1 % SDS at about room temperature (hybridization conditions); 0.2 x SSCI0.1 % SDS at about room temperature (low stringency conditions);
0.2 x SSCI0.1 % SDS at about 42°C (moderate stringency conditions); and 0.1 x SSC at about 68°C (high stringency conditions). Washing can be carried out using only one of these conditions, e.g., high stringency conditions, or each of the conditions can be used, e.g., for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed. As mentioned above, however, optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically. In general, conditions of high stringency are used for the hybridization of the probe of interest.
Alternatively, polynucleotides having substantially the same nucleotide sequence set forth in SEO. ID. NOs:
1, 3, 5, 7, and 9 or functional fragments thereof, or nucleotide sequences that are substantially identical to SEQ. ID.
NOs: 1, 3, 5, 7, and 9, can represent members of a csa-like operon. By "substantially the same" or "substantially identical" is meant a nucleic acid or polypeptide exhibiting at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homology to a reference nucleic acid. For nucleotide sequences, the length of comparison sequences will generally be at least 10 to 500 nucleotides in length. More specifically, the length of comparison will be at least 50 nucleotides, at least 60 nucleotides, at least 75 nucleotides, and at least 110 nucleotides in length.
9_ One embodiment of the invention provides isolated and purified polynucleotide molecules encoding one or more csa operon proteins, wherein the polynucleotide molecules that are capable of hybridizing under moderate to stringent conditions to an oligonucleotide of 15 or more contiguous nucleotides of SED. ID. NOs: 1, 3, 5, 7, and 9, including complementary strands thereto.
DNA sequences of the invention can be obtained by several methods. For example, the DNA can be isolated using hybridization or computer-based techniques which are well known in the art. Such techniques include, but are not limited to: 1) hybridization of genomic or cDNA libraries with probes to detect homologous nucleotide sequences;
2) antibody screening of expression libraries to detect cloned DNA fragments with shared structural features; 3) polymerase chain reaction (PCR) on genomic DNA or cDNA using primers capable of annealing to the DNA sequence of interest; 4) computer searches of sequence databases for similar sequences;
and 5) differential screening of a subtracted DNA library.
Screening procedures which rely on nucleic acid hybridization make it possible to isolate any gene sequence from any organism, provided the appropriate probe is available.
Oligonucleotide probes, which correspond to a part of csa operon sequences provided herein and encoding a Csa protein, can be synthesized chemically. This synthesis requires that short, oligo-peptide stretches of the amino acid sequence be known. The DNA sequence encoding the protein can be deduced from the genetic code, however, the degeneracy of the code must be taken into account. It is possible to perform a mixed addition reaction when the sequence is degenerate, This includes a heterogeneous mixture of denatured double-stranded DNA. For such screening, hybridization is preferably performed on either single-stranded DNA or denatured double-stranded DNA. Hybridization is particularly useful in the detection of cDNA clones derived from sources where an extremely low amount of mRNA sequences relating to the polypeptide of interest are present. In other words, by using stringent hybridization conditions directed to avoid non-specific binding, it is possible, for example, to allow the autoradiographic visualization of a specific cDNA or DNA clone by the hybridization of the target DNA to that single probe in the mixture that is its complete complement. (Wallace, et al., Nucl. Acid Res., 9:879, 1981). Alternatively, a subtractive library is useful for elimination of non-specific cDNA clones.
Among the standard procedures for isolating DNA sequences of interest is the formation of plasmid- or phage-carrying genomic libraries which include total DNA from the organism of interest. When used in combination with polymerase chain reaction technology, even rare expression products can be cloned. In those cases where significant portions of the amino acid sequence of the polypeptide are known, the production of labeled single or double-stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target DNA can be employed in DNAIDNA hybridization procedures which are carried out on cloned copies of the DNA which have been denatured into a single-stranded form (Jay, et al., Nucl. Acid Res , 11:2325, 1983).
The nucleotide sequences of the disclosed herein have a myriad of applications. Representative uses of the nucleotide sequences of the invention include the construction of DNA and oligonucleotide probes useful in Northern, Southern, and dot-blot assays for identifying and quantifying the level of expression of csa operon encoded proteins in a cell. csa operon encoded proteins have a variety of uses, for example, as antigens with which to elicit an immune response.
In addition, considering the important role the CS4 pili plays in ETEC
attachment and colonization, it is thought highly likely that compositions containing the CS4 pill or compositions with activity against the same can result from expression of the csa operon. In this case, the proteins of the csa operon can prove highly useful in the generation of immunogenic compositions that can be used to generate an immune response in a subject.
Similarly, csa operon nucleotide sequences can be employed for the construction of recombinant cell lines, recombinant organisms, expression vectors, and the like. Such recombinant constructs can be used to express recombinant csa operon proteins. In one embodiment, the recombinant constructs can be used to screen for candidate therapeutic agents capable of altering the pathology of a CS4 antigen-expressing organism. In another embodiment, the proteins of the csa operon present an attractive set of proteins with which to create immunogenic compositions.
For example, the CS4 pili can be expressed, purified, and used to prepare an immunogenic subunit composition. In another embodiment, recombinant CS4 pill can be expressed in an organism, and the whole organism can be formulated into an immunogenic composition.
When the coding regions of the csa operon are used in the construction of various types of vectors, the csa sequences are often inserted into the coding region of the vector under the control of a promoter. Additionally, other elements, including regulatory elements, which are commonly found in vectors suitable for use in various molecular biology techniques, can also be included.
In one embodiment, a vector comprising a DNA molecule encoding a Csa protein is provided. Preferably, a DNA molecule including a csaA, csaB, csaC, csaD, or csaE gene, or a combination of these genes is inserted into a suitable expression vector, which is in turn used to transfect or transform a suitable host cell. Exemplary expression vectors include a promoter capable of directing the transcription of a polynucleotide molecule of interest in a host cell.
Representative expression vectors include both plasmid andlor viral vector sequences. Suitable vectors include retroviral vectors, vaccinia viral vectors, CMV viral vectors, BLUESCRIPT
(Stratagene, San Diego, CA? vectors, bacculovirus vectors, and the like. In another embodiment, promoters capable of directing the transcription of a cloned gene or cDNA can be inducible or constitutive promoters and include viral and cellular promoters.
In some embodiments, it can be preferable to use a selectable marker to identify cells that contain the cloned DNA. Selectable markers are generally introduced into the cells along with the cloned DNA molecules and include genes that confer resistance to drugs, such as ampicillin, neomycin, hygromycin, and methotrexate.
Selectable markers can also complement auxotrophies in the host cell. Other selectable markers provide detectable signals, such as beta-galactosidase to identify cells containing the cloned DNA molecules.
Antisense Antisense csa nucleotide sequences can be used to block csa expression.
Suitable antisense oligonucleotides are at least 11 nucleotides in length and can include untranslated (upstream/ and associated coding sequences. As will be evident to one skilled in the art, the optimal length of an antisense oligonucleotide depends on the strength of the interaction between the antisense oligonucleotide and the complementary mRNA, the temperature and ionic environment in which translation takes place, the base sequence of the antisense oligonucleotide, and the presence of secondary and tertiary structure in the mRNA andlor in the antisense oligonucleotide. Suitable target sequences for antisense oligonucleotides include promoter regions, ribosome binding sites, and sites that interfere with ribosome progression.
Antisense oligonucleotides can be prepared, for example, by the insertion of a DNA molecule containing the target DNA sequence into a suitable expression vector such that the DNA
molecule is inserted downstream of a promoter in a reverse orientation as compared to the particular csa gene itself. The expression vector can then be transduced, transformed or transfected into a suitable cell resulting in the expression of antisense oligonucleotides.
Alternatively, antisense oligonucleotides can be synthesized using standard manual or automated synthesis techniques. Synthesized oligonucleotides are introduced into suitable cells by a variety of means including electroporation, calcium phosphate precipitation, or microinjection. The selection of a suitable antisense oligonucleotide administration method will be evident to one skilled in the art.
With respect to synthesized oligonucleotides, the stability of antisense oligonucleotide-mRNA hybrids is advantageously increased by the addition of stabilizing agents to the oligonucleotide. Stabilizing agents include intercalating agents that are covalently attached to either or both ends of the oligonucleotide. In preferred embodiments, the oligonucleotides are made resistant to nucleases by, for example, modifications to the phosphodiester backbone by the introduction of phosphotriesters, phosphonates, phosphorothioates, phosphoroselenoates, phosphoramidates, phosphorodithioates, or morpholino rings.
Amino Acids The identification of the csa operon and the proteins encoded thereby is described. Representative polypeptides produced from the genes of the csa operon include sequences comprising CsaA (SEQ. ID. NO.: 2), CsaB
(SEO. ID. NO.: 4), CsaC ISEO. ID. NO.: 6), CsaD (SEO. ID. NO.: 8), and CsaE
(SEO. ID. NO.: 10). Variants of the csa operon encoded proteins include those amino acid sequences resulting from in minor genetic polymorphisms, differences between strains, and those that confiain amino acid substitutions, additions, andlor deletions.
The csa operon encoded proteins, as described herein, encompass the whole proteins encoded by the operon, as well as fragments of csa proteins that are functionally active. csa operon encoded proteins purified from naturally occurring materials and closely related, functionally similar proteins retrieved by antisera specific to the csa proteins, and recombinantly expressed proteins encoded by genetic materials (DNA, RNA, cDNA) retrieved on the basis of their similarity to regions in the csa operon sequences are also encompassed by the present description.
According to the present description, polynucleotide molecules encoding csa operon encoded proteins encompass those molecules that encode csa proteins or peptides that share identity with the sequences shown in SEO. ID. NOs.: 2, 4, 6, 8, and 10. Such molecules preferably share greater than 30% identity at the amino acid level with the disclosed sequences in csa. In preferred embodiments, the polynucleotide molecules can share greater identity at the amino acid level across highly conserved regions.

It is contemplated that amino acid sequences substantially the same as the sequences set forth in SEO. ID.
NOs.: 2, 4, 6, 8, and 10, are encompassed by the present description. A
preferred embodiment includes polypeptides having substantially the same sequence of amino acids as the amino acid sequence set forth in SEO ID NOs.: 2, 4, 6, 8, and 10, or functional fragments thereof, or amino acid sequences that are substantially identical to SEO ID NOs.: 2, 4, 6, 8, and 10. By "substantially the same" or "substantially identical" is meant a polypeptide exhibiting at least 80%, 85%, 90%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 999'°, or 100% homology to a reference amino acid sequence. For polypeptides, the length of comparison sequences will generally be at least 16 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably 35 amino acids.
Homology is often measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center,1710 University Avenue, Madison, WI
53705 or the NCBI BLAST program). Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, substitutions, and other modifications.
The term "functional fragments" include those fragments of SEO ID NOs.: 2, 4, 6, 8, and 10, or other proteins that have a similar amino acid sequence as that of the csa operon encoded proteins, that retain the function or activity of the various csa proteins. One of skill in the art can screen for the functionality of a fragment by using the examples provided herein, where full-length csa operon encoded proteins are described. It is also envisioned that fragments of various csa operon encoded proteins can be identified in a similar manner.
By "substantially identical" is also meant an amino acid sequence which differs only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the protein assayed, (e.g.. as described herein).
Preferably, such a sequence is at least 859'°, and more preferably from 90%, 91 %, 92%, 93%, 94%, 959'°, 96%, 97%, 98%, 99%, to 100% homologous at the amino acid level to SEO ID NOs:2, 4, 6, 8, or 10.
By a "substantially pure polypeptide" is meant a csa operon encoded protein that has been separated from components that naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60%, by weight, free from the proteins and other naturally occurring molecules with which it is typically associated.
Preferably, the preparation is at least 75%, 80%, 90%, 95%, and most preferably at least 99%, by weight, csa operon encoded protein. A substantially pure csa operon encoded polypeptide can be obtained, for example, by extraction from a natural source; by expression of a recombinant nucleic acid encoding a csa operon encoded polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, eg., column chromatography, polyacrylamide gel electrophoresis, or by HPLC
analysis.
A protein is substantially free of naturally associated components when it is separated from those contaminants that accompany it in its natural state. Thus, a protein that is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components. Accordingly, substantially pure polypeptides include those derived from eukaryotic organisms but synthesized in E. cvli or other prokaryotes.
As would be evident to one skilled in the art, the polynucleotide molecules of the present disclosure can be expressed in a variety of prokaryotic and eucaryotic cells using regulatory sequences, vectors, and methods well established in the literature.
csa operon encoded proteins produced according to the present description can be purified using a number of established methods such as affinity chromatography using an anti-Csa protein antibodies coupled to a solid support.
Fusion proteins of an antigenic tag and a csa operon encoded protein can be purified using antibodies to the tag.
Optionally, additional purification is achieved using conventional purification means such as liquid chromatography, gradient centrifugation, and gel electrophoresis, among others. Methods of protein purification are known in the art and can be applied to the purification of recombinant csa operon encoded proteins described herein. Purification of csa operon products is discussed more completely below.
Construction of csa operon encoded fusion proteins is also contemplated.
Fusion proteins will typically contain additions, substitutions, or replacements of one or more contiguous amino acids of the native csa operon encoded protein with amino acids) from a suitable fusion protein partner. Such fusion proteins are obtained using recombinant DNA techniques well known by one of skill in the art. Briefly, DNA
molecules encoding the hybrid csa operon encoded proteins of interest are prepared using generally available methods such as PCR mutagenesis, site-directed mutagenesis, andlor restriction digestion and ligation. The hybrid DNA is then inserted into expression vectors and introduced into suitable host cells.
One embodiment of the present invention involves the isolation of proteins that interact with csa operon encoded proteins or are receptors for CS4 pili. csa operon encoded proteins can be used in immunoprecipitation to isolate interacting factors or used for the screening of interactors using different methods of two hybrid screening.
Isolated interactors of csa operon encoded proteins can be used to modify or block CS4 mediated binding to a host cell.
Synthetic peptides, recombinantly derived peptides, fusion proteins, chiral proteins (stereochemical isomers, racemates, enantiomers, and o-isomers) and the like are provided which include a portion of a csa operon encoded protein or the entire protein. The subject peptides have an amino acid sequence encoded by a nucleic acid which hybridizes under stringent conditions with an oligonucleotide of 15 or more contiguous nucleotides of SEO. ID. NOs: 1, 3, 5, 7, and 9. Representative amino acid sequences of the subject peptides are disclosed in SEO. ID. NOs: 2, 4, 6, 8, and 10. The subject peptides find a variety of uses, including preparation of specific antibodies and preparation of antagonists of CS4 binding.
Antibodies As noted above, the described teachings provide antibodies that bind to csa operon encoded proteins. The production of non-human antisera or monoclonal antibodies (e.g., murine, lagomorph, porcine, equine) is well known and can be accomplished by, for example, immunizing an animal with a csa operon encoded protein or peptides. Far the production of monoclonal antibodies, antibody producing cells are obtained from immunized animals, immortalized and screened, or screened first for the production of the antibody that binds to the particular csa operon encoded protein or peptides and then immortalized. It can be desirable to transfer the antigen binding regions (e.g., F(ab')2 or hypervariable regions) of non-human antibodies into the framework of a human antibody by recombinant DNA
techniques to produce a substantially human molecule.
Following synthesis or expression and isolation or purification of a csa operon encoded protein or a portion thereof, the isolated or purified protein can be used to generate antibodies and tools for identifying agents that interact with the csa operon encoded protein and fragments of interest. Depending on the context, the term "antibodies" can encompass polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library. Antibodies that recognize csa operon encoded proteins and fragments thereof have many uses including, but not limited to, biotechnological applications, therapeutic~prophylactic applications, and diagnostic applications.
For the production of antibodies, various hosts including goats, rabbits, rats, mice, etc., can be immunized by injection with csa operon encoded proteins or any portion, fragment or oligopeptide that retains immunogenic properties. Depending on the host species, various adjuvants can be used to increase immunological response. Such adjuvants include, but are not limited to, detoxified heat labile toxin from E. cvli, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. BCG (Bacillus Calmette-Guerin) and Corynebacterium parvum are also potentially useful adjuvants.
Peptides used to induce specific antibodies can have an amino acid sequence consisting of at least three amino acids, and preferably at least 10 to 15 amino acids. Preferably, short stretches of amino acids encoding fragments of csa operon encoded proteins are fused with those of another protein such as keyhole limpet hemocyanin such that an antibody is produced against the chimeric molecule. While antibodies capable of specifically recognizing csa operon encoded proteins can be generated by injecting synthetic 3-mer, 10-mer, and 15-mer peptides that correspond to a protein sequence of the csa operon encoded protein or proteins of interest into mice, a more diverse set of antibodies can be generated by using recombinant csa operon encoded proteins, purified csa operon encoded proteins, or fragments of csa operon encoded proteins.
To generate antibodies to csa operon encoded proteins and fragments thereof, a substantially pure csa operon encoded protein or a fragment thereof is isolated from a transfected or transformed cell or the wildtype ETEC organism.
The concentration of the polypeptide in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few microgramslml. Monoclonal or polyclonal antibody to the polypeptide of interest can then be prepared as follows:
Monoclonal antibodies to csa operon encoded proteins or a fragment thereof can be prepared using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique originally described by Koehler and Milstein (Nature 256:495-497 (1975), the human B-cell hybridoma technique (Kosbor et al. lmmunol Today 4:72 (1983);
Cote et al Proc Nat/. Acad Sci 80:2026-2030 (1983), and the EBV-hybridoma technique Cole et al. Monoclonal Antibodies and Cancer Therapy, Alan R. liss Inc, New York N.Y., pp 77-96 (1985). In addition, techniques developed for the production of "chimeric antibodies", the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used. (Morrison et al. Proc Nat/. Acad. Sci 81:6851-6855 (1984);
Neuberger et al. Nature 312:604-608(1984); Takeda et al. Nature 314:452-454(1985). Alternatively, techniques described for the production.of single chain antibodies (U.S. Pat. No.
4,946,778) can be adapted to produce csa operon encoded protein-specific single chain antibodies. Antibodies can also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobulin libraries or panels of highly specific binding reagents as disclosed in Orlandi et al., Proc Nat/. Acad Sci 86: 3833-3837 (19891, and Winter G. and Milstein C; Nature 349:293-299 (1991 ).
Antibody fragments that contain specific binding sites for csa operon encoded proteins can also be generated. For example, such fragments include, but are not limited to, the F(ab')2 fragments that can be produced by pepsin digestion of the antibody molecule and the Fab fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries can be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (Huse W. D. et al. Science 256:1275-1281 (1989)).
By one approach, monoclonal antibodies to csa operon encoded proteins or fragments thereof are made as follows. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein or peptides derived therefrom, over a period of a few weeks. The mouse is then sacrificed, and the antibody producing cells of the spleen isolated. The spleen cells are fused in the presence of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ElISA, as originally described by Engvall, E., Meth. Enzymol, 70:419 (19801, and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Davis, L. et al. Basic Methods in Molecular Biolony Elsevier, New York. Section 21-2.
Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein or peptides derived therefrom described above, which can be unmodified or modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and can require the use of carriers and adjuvant. Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera.
Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis, J. et al. J, Ciin. Endocrinol. Metab. 33:988-991 (1971 ).

Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony, 0. et al., Chap. 19 in: Handbook of Exuerimental Immunology D.
Wier led) Blackwell (1973). Plateau concentration of antibody is usually in the range of 0.1 to 0.2 mglml of serum (about 12 M). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher, D., Chap. 42 in: Manual of Clinical Immunology, 2d Ed.
(Rose and Friedman, Eds.) Amer. Soc. For Microbiol., Washington, D.C. (1980). Antibody preparations prepared according to either protocol are useful in quantitative immunoassays that determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively (e.g., in diagnostic embodiments that identify the presence of a csa operon encoded protein in biological samples). It is also contemplated that various methods of molecular modeling and rational drug design can be applied to identify compounds that resemble a csa operon encoded protein, fragment, or derivative thereof, and molecules that interact with csa operon encoded proteins and, thereby modulate their function.
ExpressionVectors Recombinant gene expression vectors comprising the csa operon, or portions thereof, can be constructed in a variety of forms well-known in the art. Preferred expression vectors include plasmids and cosmids. Expression vectors include one or more fragments of the csa operon. Typically, an expression vector will comprise one or more genes of csa operon. In one embodiment, an expression vector will comprise and operatively encode the csaA, csa8, csaC, csaE, and csaD coding regions. Alternative embodiments of the described expression vectors can have various combinations of the coding regions csa operon. For example, an expression can comprise the csaB, the csaE coding regions, or a combination of both.
As used herein, the phrase "operatively encode" refers to one or more protein coding regions associated with those regulatory sequences required for expression of the polypeptide encoded by the coding region. Examples of such regulatory regions including promoter binding sites, enhancer elements, ribosome binding sites, and the like. Those of ordinary skill in the art will be able to select regulatory sequences and incorporate them into the recombinant expression vectors described herein without undue experimentation. For example, suitable regulatory sequences for use in various eukaryotic and prokaryotic systems are described in Ausubel, et al., Short Protocols in Molecular Biolouy, 3'd ed., John Wiley & Sons, Inc, New York, 1997.
Expression vectors for use with the csa operon will typically contain regulatory sequences derived from a compatible species for expression in the desired host cell. For example, when E, coli is the host cell, the host cell population can be typically transformed using pBR322, a plasmid derived from an E. cvli species. (Bolivar, et al., Gene, 2:95, 1977). pBR322 contains genes for ampicillin (AMPR) and tetracycline resistance and thus provides easy means for identifying transformed cells.
Promoters suitable for use with prokaryotic hosts illustratively include the beta-lactamase and lactose promoter systems (Chang, et al., Nature, 275:615, 1978; and Goeddel, et al., Nature, 281:544, 1979), alkaline phosphatase, the tryptophan (trp) promoter system (Goeddel, Nucleic Acids Res., 8:4057, 1980) and hybrid promoters such as the tag promoter (de Boer, et al., Proc. Natl. Acad. Sci. USA, 80:21-25, 1983). Other functional bacterial promoters are also suitable. Their nucleotide sequences are generally known in the art, thereby enabling a skilled worker to ligate them to a polynucleotide which encodes the peptide of interest (Siebenlist, et af., Ceil, 20:269, 1980) using tinkers or adapters to supply any required restriction sites.
In addition to prokaryotes, eukaryotic microbes such as yeast cultures can also be used as source for the regulatory sequences. Saccharomyces cerevisiae is a commonly used eukaryotic host microorganism. Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (Nitzeman, et al., J. Biol. Chem., 255:2073, 1980) or other glycolytic enzymes (Hess, et al. J.
Adv. Enzyme Reg. 7:149, 1968; and Holland, Biochemistry, 17:4900, 1978) such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degraded enzymes associated with nitrogen metabolism, metallothionine, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.
Yeast enhancers also are advantageously used with yeast promoters.
In another embodiment, a recombinant virus is used as the expression vector.
Exemplary viruses include the adenoviruses, adeno-associated viruses, herpes viruses, vaccinia, or an RNA
virus such as a retrovirus or an alphavirus. Preferably, the retroviral vector is a derivative of a murine or avian retrovirus. Preferably the alphavirus vector is derived from Sindbis or Semliki Forest Virus. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated.
By inserting one or more sequences of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target specific. Retroviral vectors can be made target specific by inserting, for example, a polynucleotide encoding a sugar, a glycolipid, or a protein.
Preferred targeting is accomplished by using an antibody to target the retroviral vector, such as to the vicinity of a mucosal inductor site, using a MALT-specific antibody. Those of ski!! in the art will know of, or can readily ascertain without undue experimentation, specific polynucleotide sequences which can be inserted into the retroviral genome to allow target specific delivery of the retroviral vector containing the polynucleotides of interest.
It will be appreciated that the same techniques that are utilized to incorporate the nucleotide sequences of the csa operon and optionally other immunostimulatory polynucleotides into viral gene expression vectors can be used to incorporate the sequences into live and attenuated live viruses for use as immunogenic compositions.
Targeting of mucosal tissues can be performed by exploiting inherent biological properties of the lymphoid bed which is to be targeted. These include the crypt architecture of the tonsillar pillars which can be used to entrap particles, and also include the M cells of Peyer's patches in the gut, which M
cells specifically endocytose a wide variety of particles including lipid particles and other small particulates.
Therefore, those skilled in the art can prepare a wide variety of molecular particulate preparations which, if provided to intestine, will lodge within the crypt portions of intestinal Peyer's patches and be endocytosed by M cells. If such particles provide for delivery of a biologically active polynucleotide to M cells, then such particles will enable the stimulation or modulation of mucosal immune response induction by the Peyer's patch lymphoid tissue to which the M cell traffics.
Construction of suitable vectors containing desired coding, non-coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and re-ligated in the form desired to construct the plasmids required.
For example, for analysis to confirm correct sequences in piasmids constructed, the ligation mixtures can be used to transform a host cell and successful transformants selected by antibiotic resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by restriction andlor sequenced by, for example, the method of Messing, et al., (Nucleic Acids Res., 9:309, 19811, the method of Maxam, et al., (Methods in Enzymology, 65:499, 1980), or other suitable methods which will be known to those skilled in the art. Size separation of cleaved fragments is performed using conventional gel electrophoresis as described, for example, by Maniatis, et al., (Molecular Cloning, pp. 133-134, 1982).
Host cells can be transformed with the expression vectors described herein and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
Purification The purification of one or more of the products of the csa operon is disclosed below. Steps involved in the purification of csa operon products include (1) solubilization of the desired protein, (2) the development of one or more isolation and concentration procedures, (3) stabilization of the protein following purification, and (4) development of a suitable assay to determine the presence of the desired protein. Various aspects of protein isolation and purification are discussed in detail in Cooper, T. G., "The Tools of Biochemistry," John Wiley & Sons, New York, 1977. As the techniques of protein isolation and purification are notoriously well known in the art, this disclosure will refrain from discussing them in detail. Nevertheless, elements of the cited reference are summarized and discussed below.
Solubilization is required of most proteins to be purified, as most isolation procedures commonly used operate in aqueous solutions. In some cases solubilization can be achieved by merely lysing a host cell within which a desired protein has been expressed. In other situations, additional steps, such as extracting the desired protein from a subcellular organelle may be required. Osmotic lysis, grinding, the use of blenders, ultrasonic waves, presses, and other well known techniques of protein solubilization are contemplated for use with the methods disclosed herein.
Regarding the isolation and concentration of csa operon products, there are variety of techniques available that are well known in the art. These techniques include (1 ) differential solubility, (2) ion exchange chromatography, (3) absorption chromatography, (4) molecular sieve techniques, (5) affinity chromatography, (6) electrophoresis, and (7) electrofocusing. Each of these techniques can be useful in the purification of one or more csa operon products. An immunogenic purification methodology for the purification of the CS4 pill is described in Wolf, et al., "Characterization of CS4 and CS6 antigenic components of PCF8775, a putative colonization factor complex from enterotoxigenic Escherichia cvli E8775," Infect lmmun. 57(1):164-73 (1989). For purifying intact CS4 fimbriae, use the methods described in Hall, et al., J. Bacteriol. 171:6372 (1989).
Stabilizing and maintaining a purified product of the csa operon in a functional state warrants attention to a number of different conditions. These conditions include (1) pH, (2) degree of oxidation, (3) heavy metal concentration, (4) medium polarity, (5) protease concentration, and (6) temperature. One of ordinary skill in the art would readily know which of the available techniques to use to maintain purified csa operon products in an active form without undue experimentation.
Developing one or more assays with which to determine the presence and functionality of the purified product of the csa operon will hinge on the individual proteins themselves.
Perhaps the most useful assay to develop involves the generation of one or more antibodies with which to identify the various products of the csa operon. The generation of antibodies is discussed herein. Because the nucleotide and amino acid sequences of each of the csa operon encoded gene sequences is known, it would be trivial for one of ordinary skill in the art to generate suitable antibodies for the detect of Csa proteins, using techniques that are notoriously well known.
Compositions The proteins encoded by the csa operon can be used to formulate immunogenic compositions that facilitate an immune response. Examples of a typical immune response include a mucosal immune response and a systemic immune response, A variety of embodiments utilizing the proteins of the csa operon are envisioned.
Recombinant or anq isms In one embodiment, a nucleotide sequence comprising the csa operon or a functional fragment thereof is introduced into an exogenous organism using standard molecular biology techniques well known to those of ordinary skill in the art. Exemplary techniques are discussed in Ausubel, et al., "Short Protocols in Molecular Biology." The resulting recombinant organism can then be used as an immunogen against which an immune response may be engendered. In a preferred embodiment, an attenuated pathogenic organism serves as the exogenous organism. It is contemplated that an entire recombinant organism or a functional fragment thereof, such as an isolated membrane fraction, liposome, or the like, can be used to generate an immunogenic composition.
For example, one application of the discoveries described herein is directed to the development of a multivalent hybrid vaccine to prevent both Shigella dysentery and ETEC
diarrhea, (Altboum, Z., et al., Attenuated Shigella flexneri 2a 4guaBA strain CVD 1204 expressing ETEC CS2 and CS3 fimbriae as a live mucosal vaccine against Shigella and enterotoxigenic Escherichia toll infection, In press;
Koprowski, et al., Infect. lmmun., 68:4884-92 (2000); Kotloff, et al., 1/accine, 13:495-502 (1995); Levine, et al., "Fimbrial vaccines," /n P. Klemm (ed.), Fimbriae:
adhesion. biogenics, genetics and vaccines, Boca Raton: CRC Press, 1994;
Noriega, et al., Infect. lmmun., 64:23-27 (1996)). United States Patent No. 6,190,669, to Noriega, et al., entitled "Attenuated mutants of salmonella which constitutively express the Vi antigen," contains additional teaching relating to the generation of such chimeric organisms suitable for use in the preparation of an immunogenic composition containing the CS4 pili.
In a preferred embodiment, the ETEC-CS4 fimbrial encoding genes of the csa operon are isolated and used to construct an efficient multivalent Shigella- ETEC immunogenic composition that will protect from diarrhea caused by either Shigella and CS4 expressing ETEC strains. One aspect of this embodiment is directed to creating an immunogenic composition capable of generating an immune response against LTh, the LT variant found in human ETEC
strains. The immunogenic properties of cloned CFAh, CS2, CS3 and LThK63 encoding genes in S. flexneri 2a strain CVO 1204 have been reported. This work has been expanded by including the expression of the CS4 pili as an intact fimbriae in both E.coli and Shigella strains.
Other multivalent immunogenic compositions effective against enteric bacteria are contemplated. For example, a multivalent immunogenic composition against Salmonella spp.;
Clostridium spp., such as Clostridium botulinum; Staphylococcus spp , such as S. aureus; Campylobacter spp., such as C, jejuni; Yersinia spp., such as Y.
enterocolitica and Y, pseudotuberculosis; Listeria spp., such as L.
monocytogenes; various (librio spp., including V.
cho%rae 01, 1/. cho%rae non-01, fl, parahaemolyticus, 1/, vulnificus;
Clostridium spp., such as C, perfringens; Bacillus spp., such as B. cereus; Aeromonas spp., such as A, hydrophila; Plesiomonas spp., such as P. shigel%ides; Shigella spp.; Streptococcus spp.; various miscellaneous enterics such as Klebsiella spp.; Enterobacter spp.; Proteus spp.;
Citrobacter spp.; Aerobacter spp.; Providencia spp.; Serratia spp.; and members of the enterovirulent Escherichia coli Group (EEC Group) which comprises, enterotoxigenic Escherichia coli (ETEC), enteropathogenic Escherichia coli (EPEC), enterohemorrhagic Escherichia coli (EHEC) such as Escherichia coli 0157:H7, and enteroinvasive Escherichia coli (EIEC).
Subunit vaccines Another embodiment described herein relates to the generation of immunogenic compositions comprising distinct immunogenic proteins or fragments thereof, or functional fragments of organisms of interest. Such immunogenic compositions are referred to here as subunit immunogenic composition because at least one of the components of the composition is a subunit of an organism, rather than an entire organism. Typically, a subunit immunogenic composition as described herein comprises one or more immunogenic components.
In a preferred embodiment, the subunit immunogenic composition described herein comprise a carrier component and an immunogenic component. Typically, the carrier component will function as a binding moiety with which the originating organism uses to bind to and gain entrance into the host organism. One example of such a carrier component is the CS4 antigen, which is encoded by the csa operon. The CS4 antigen allows ETEC strains expressing this protein complex to bind to the mucosa of a human host. In a preferred embodiment the CsaB andlor the CsaE proteins can function as carrier components.
Although not wishing to be bound by theory, it is hypothesized that the subunit immunogenic composition described herein function by exposing the immunogenic component of the subunit immunogenic composition to the mucosa, and various immune system components present there. In one theory, the generation of a desired immune response by the subunit immunogenic compositions described herein occurs by increasing the exposure of the immunogenic compositions to the target tissue. The presence of both a carrier component and an immunogenic component are theorized to achieve this goal.
Any protein, peptide, or amino acid sequence that elicits an immune response can be used as the immunogenic component in the subunit immunogenic compositions described herein.
The carrier components of the described subunit immunogenic compositions can also possess immunogenic characteristics themselves. Typically, adjuvants are used in immunogenic compositions to enhance the immune response directed against the immunogenic component of the immunogenic compositions disclosed. Carrier components that possess both mucosa binding characteristics and immunogenic characteristics can be used. For example, in one embodiment, the CsaB andlor the CsaE proteins can function both as the carrier component and the immunogenic component.
For the carrier components described above, the entire molecule can be used as the carrier component, or a functionally active fragment of the molecule can be used. Mutagenized forms of these molecules can also be used as carrier components.
In one embodiment, one or more Csa proteins are isolated and purified. The one or more Csa proteins can be mixed or coupled with one or more immunogenic compounds. For example, in one embodiment, CsaB can be expressed, purified, and cross-linked to a toxin, toxoid (an attenuated toxin), or some other immunogenic compound for use in a subunit immunogenic compositions.
In another embodiment, expressed Csa proteins or fragments thereof, or whole CS4 antigen complexes can be cross-linked to an immunogenic component. The immunogenic component can also be an isolated protein, functional fragment thereof, whole organism (such as a bacterium or a virus), or functional fragment thereof, that is isolated either in part or as is used as a whole pathogenic organism. The Csa proteins can be isolated from the bacterium itself or it can be produced using recombinant DNA techniques well known in the art.
In accordance with one aspect of the present invention, the smaller fragments of expression product of the csa operon are used to provide an immunogenic composition. Specifically, these fragments will comprise an immunogenic region of such expression product, typically from about 5, 6, 8, 10 or 12 amino acids to about 20, 22, 24, 30, or more amino acids. Suitable fragments or immunogenic regions can be readily ascertained using as screening procedures the techniques set forth in Examples 1-4. In one embodiment of a suitable screening procedure, a large number of candidate fragments are more or less randomly produced and used to immunize guinea pigs or other suitable models. Alternatively, full-length polypeptides shown to be active in the present invention can be truncated and screened in an iterative process to isolate the immunogenic and protective activity to a minimal fragment. Such screening can be readily carried out without undue experimentation and the active fragments are within the contemplation of the present invention.
The Csa proteins used to form the immunogenic compositions of this embodiment can be the whole protein, such as the CsaB or CsaE proteins, an immunogenic fragment of a Csa protein, a mutagenized form of a Csa protein, or a fusion protein comprising a Csa protein or a fragment thereof and a suitable fusion partner. A suitable fusion partner for such a Csa fusion protein or a fragment thereof might be any protein, peptide or amino acid sequence that facilitates the expression andlor purification of the Csa fusion protein using recombinant DNA techniques known in the art. Alternatively, one or more additional immunogens can serve as the fusion partner in a Csa fusion protein.
Nucleotide Immunogenic Gompositions -In another embodimenfi, an immune response can be elicited using nucleotide-containing compositions. In one aspect of this embodiment, a mucosal or systemic immune response is elicited in a host by administering an antigen encoding polynucleotide preparation, comprising DNA or RNA, which encodes an antigenic epitope to the host. In a preferred embodiment, the nucleotide-containing composition is administered to a mucosal inductor site in the mucosal tissue of the host.
Naked DNA may be administered directly to mucosa, for instance in saline drops, or in a recombinant gene expression vector. Preferably, the recombinant gene expression vectors are not capable of replication or dissemination. Nucleotide-containing immunogenic compositions also comprise live viral immunogenic compositions wherein the viruses include immunostimulatory polynucleotides. According to a preferred method of the invention, a target protein antigen is administered through its expression by a recombinant gene expression vector.
U.S. Patent No. 6,110,898, to Malone, et al., entitled, "DNA vaccines for eliciting a mucosal immune response," provides detailed teaching for the generation of such immunogenic compositions.
Formulations and Administration The immunogenic compositions described herein can be formulated in a variety of useful formats for administration by a variety of routes. Concentrations of the immunogenic components in the formulations described will be such that an effective dose of the immunogenic components are included in the formulation. Determination of such a concentration would be readily apparent to those of ordinary skill in the art.
Administration of the immunogenic compositions can be by nasal application, by inhalation, ophthalmically, orally, rectally, vaginally, or by any other mode that results in the immunogenic contacting the mucosal tissues.
In one embodiment, the immunogenic composition exists as an atomized dispersion for use in delivery by inhalation. The atomized dispersion of the immunogenic components will typically contain carriers for atomized or aerosolized dispersions, such as buffered saline and other compounds well known to those of skill in the art. The delivery of the described immunogenic compositions via inhalation has the effect of rapid dispersion to a large area of mucosal tissues, as well as absorption by the blood for circulation of the immunogenic components. One example of a method of preparing an atomized dispersion is found in U.S. Patent 6,187,344, entitled, "Powdered Pharmaceutical Formulations Having Improved Dispersibility."
The immunogenic compositions described herein can also be formulated in the form of a suppository, whether rectal or vaginal. Typical carriers for formulation of the inactive portion of a suppository include polyethylene glycol, glycerine, cocoa butter and other compounds well known to those of skill in the art. Other suppository formulations suitable for delivery of the described immunogenic compositions are also contemplated. Delivery of the described immunogenic compositions via suppository it hypothesized to have the effect of contacting a mucosal surface with the immunogenic compositions for release to proximal mucosal tissues. Distal mucosal tissues also receive the immunogenic compositions by diffusion.
Additionally, immunogenic compositions are contemplated as existing in a liquid form. The liquid can be for oral dosage, for ophthalmic or nasal dosage as drops, or for use as an enema or douche. When the immunogenic compositions is formulated as a liquid, the liquid can be either a solution or a suspension of the immunogenic compositions.
A colloidal dispersion system may be used for targeted delivery of nucleic acid-containing immunogenic compositions. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system is a lipid preparation including unilamaller and multilamellar liposomes.
Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 ~m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci., 6:77, 1981). In addition to mammalian cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells. In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the genes encoding the polynucleotides at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) .
accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 19881. In addition to such LUV structures, multilamellar and small unilamellar lipid preparations that incorporate various cationic lipid amphiphiles can also be mixed with anionic polynucleotides to form nucleolipidic particles which are often also referred to as liposomes (Felgner, et al, Proc Natl. Acad. Sci. U.S.A. 84 (211: 7413 1987) and used to deliver the nucleic acids into cells. .
The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. The appropriate composition and preparation of cationic lipid amphiphile:polynucleotide formulations are known to those skilled in the art, and a number of references which provide this information are available (e.g., Bennett, et al, J. Liposome Res. 6(3):545).
Examples of lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides. Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine. Examples of cationic amphiphilic lipids useful in formulation of nucleolipid particles for polynucleotide delivery include the monovalent lipids DOTAP, DOTMA, and DC-Chol, the polyvalent lipids LipofectAMINE, DOGS, Transfectam and other amphiphilic polyamines. These agents may be prepared with helper lipids (such as Dioleoyl Phosphatidyl Ethanolamine) or with various carrier compositions, including various adjuvants, such as cholera-derived molecules including cholera toxin.
The targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specific.
Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs that contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.
The surface of the targeted delivery system may be modified in a variety of ways. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand.
There are a variety of suitable formulations for the solution or suspension well known to those of skill in the art, depending on the intended use thereof.
Delivery of the described immunogenic compositions in liquid form via oral dosage has the aim of exposing the mucosa of the gastrointestinal and urogenital tracts to the immunogenic compositions. A suitable dose, stabilized to resist the pH extremes of the stomach, would deliver the immunogenic compositions to all parts of the gastrointestinal tract, especially the upper portions thereof. All means of stabilizing the immunogenic compositions in a liquid oral dosage such that the effective delivery of the composition is distributed along the gastrointestinal tract are contemplated for use with the immunogenic compositions described herein.
Delivery of the described immunogenic compositions in liquid form via ophthalmic drops has the aim of exposing the mucosa of the eyes and associated tissues to the immunogenic compositions. A typical liquid carrier for eye drops is buffered and contains other compounds well known to those of skill in the art.
Delivery of the described immunogenic compositions in liquid form via nasal drops has the aim of exposing the mucosa of the nose and sinuses and associated tissues to the immunogenic compositions. Liquid carriers for nasal drops are typically various forms of buffered saline.
Administration of the compounds discussed above can be practiced in vitro or in viva. When practiced in vitro, any sterile, non-toxic route of administration may be used. When practiced in vivo, administration of the compounds discussed above may be achieved advantageously by subcutaneous, intravenous, intramuscular, intraocular, oral, transmucosal, or transdermal routes, far example by injection or by means of a controlled release mechanism. Examples of controlled release mechanisms include polymers, gels, microspheres, liposomes, tablets, capsules, suppositories, pumps, syringes, ocular inserts, transdermal formulations, lotions, creams, transnasal sprays, hydrophilic gums, microcapsules, inhalants, and colloidal drug delivery systems.
The compositions described herein are administered in a pharmaceutically acceptable form and in substantially non-toxic quantities. A variety of forms of the compounds administered are contemplated. The compounds may be administered in water with or without a surfactant such as hydroxypropyl cellulose. Dispersions are also contemplated, such as those utilizing glycerol, liquid polyethylene glycols, and oils. Antimicrobial compounds may also be added to the preparations. Injectable preparations may include sterile aqueous solutions or dispersions and powders, which may be diluted or suspended in a sterile environment prior to use. Carriers such as solvents or dispersion media contain water, ethanol polyols, vegetable oils and the like may also be added to the compounds described herein.
Coatings such as lecithins and surfactants may be used to maintain the proper fluidity of the composition. Isotonic agents such as sugars or sodium chloride may be added, as well as products intended to delay absorption of the active compounds such as aluminum monostearate and gelatin. Sterile injectable solutions are prepared according to methods well known to those of skill in the art and can be filtered prior to storage andlor use. Sterile powders may be vacuum or freeze dried from a solution or suspension. Sustained-release preparations and formulations are also contemplated. Any material used in the composition described herein should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
Although in some of the experiments that follow the compounds are used at a single concentration, it should be understood that in the clinical setting, the compounds may be administered in multiple doses over prolonged periods of time. Typically, the compounds may be administered for periods up to about one week, and even for extended periods longer than one month or one year. In some instances, administration of the compounds may be discontinued and then resumed at a later time.
All compound preparations may he provided in dosage unit forms for uniform dosage and ease of administration.
Each dosage unit form contains a predetermined quantity of active ingredient calculated to produce a desired effect in association with an amount of pharmaceutically acceptable carrier. Such a dosage would therefore define an effective amount of a particular compound.
Tho immunogenic compositions described herein can be administered in amounts appropriate to those individual compounds to produce an immune response. Appropriate doses for each can readily be determined by techniques well known to those of ordinary skill in the art. Such a determination will be based, in part, on the tolerability and efficacy of a particular dose using techniques similar to those used to determine proper chemotherapeutic doses.
Additionally, a kit comprising the necessary components of a immunogenic composition that elicit an immune response to a selected immunogenic component are also contemplated.

Isolation and Characterization of the csa oueron The csa operon that encodes the synthesis of ETEC-CS4 pill was isolated from strain E11881A, cloned and sequenced. The csa operon consist of 5 contiguous genes encoding CsaA-CsaE
proteins, which share homology to other pili assembly proteins, and especially to CFAII. The csa operon was expressed in an attenuated Shigella strain, CVD1204 guaBA, constructing the Shigella expressing CS4 fimbriae vaccine strain CVD1204 (pGA2-CS4).
Immunization of guinea-pigs with CVD1204 (pGA2-CS4) elicited the production of anti-CS4 antibodies that reacted with CS4 producing strains and prevented biological activities mediated by ETEC strains. This work contributes to previously reported results regarding the on expression of CFAII, CS2, CS3 and LT in attenuated Shigella, emphasizing the feasibility of constructing an efficient multivalent Shigella -based oral ETEC vaccine.
The genes that encode the synthesis of ETEC CS4 fimbriae, csaA,B,C,D,E,D; (the csa operon), were isolated from strain E11881A. The csa operon encodes a 17kDa major fimbrial subunit (CsaB), a 40 kDa tip associated protein (CsaE), a 27 kDa chaperon like protein (CsaA), a 97 kDa usher protein (CsaC), and for a deleted regulatory protein (CsaD') containing 100 amino acids out of 265. The csa operon is flanked by IS1 E that inserted into the csaD' gene, and IS21 sequences upstream to the csaA. The csa operon is located on the large virulence plasmid that carries the LT genes.
A BLAST search of the predicted amino acid sequences indicated high homology of the CS4 proteins to structural and assembly proteins of CFAII in particular, and to CS1 and CS2 fimbriae proteins. The csaA,B,C,E operon was cloned on a 15 copy number stabilized plasmid down stream from an osmotically regulated ompC promoter.
Plasmid pGA2-CS4 directs in both DHSa and Shigella flexneri 2a strains the production of CS4 fimbriae, as detected by western blot analysis and bacterial agglutination using anti-CS4 fimbriae immune sera. Electron microscopic examination of Shigella expressing the CS4 fimbriae indicated the production of lots of rod like shape extensions.
Immunization of guinea pigs with S, flexneri 2a CVD1204 (pGA2-CS4) elicited the production of anti-CS4 antibodies that bind to CS4 fimbrial proteins, agglutinates CS4 producing strains, inhibits hemagglutination by ETEC strains and prevented the adhesion of ETEC strains to human mucosal cell line Caco-2.
Isolation of the csa operon Genomic DNA of strain E11881A was isolated using GNOME DNA KIT (B10 101, Carlsbad, CA) protocol.
The DNA was partially digested with Sau3Al, the DNA fragments with size of 5-> 20 kilobase pairs were isolated from agarose gels and ligated into vector pKS that was digested with BamHl and treated with shrimp alkaline phosphatase. The ligation mix was transformed into DHSa. DHSa transformants were grown in LB in the presence of carbenicillin at 50 ~glml or kanamycin at 50 ~,glml.
The resulting transformants were harvested into 96 well microtiter plates, and assayed for the csa operon by PCR tests, based on the published sequence of the csfA gene, (the structural gene of the CS4 fimbriae, NCBI
Accession number X97493). Based on that sequence, two primers were constructed which amplified 319 base pair fragment. The primers are: CS44 by 1 to 29: GTTGACCCTACAATTGATATTTTGCAAGC (SEO
ID N0:11) CS45 by 378 to 348 : CGACCCCACTATAATTCCCGCCGTTGGTGC (SEO ID N0:12). Pools of 1200 colonies were analyzed and 2 colonies were positive in the PCR test. Both colonies were found to contain the same plasmid, pKS-CSA-I, (FIGURE
1A). Sequencing of the cloned DNA fragment, indicated that plasmid pKS-CSA-I
contains most of the csa operon, missing 430 by from the 5' end of the csaA gene. DNA sequencing of the csa operon revealed a high degree of homology to the DNA sequences of the CFAII operon (Table 2).
Based on that homology, two new primers were designed for screening the genomic library for the 5' end by PCR. Primer CS433 is based on the csaA sequences at by 718, and primer CS434 is based on the CFAII sequences from by 878. CS433: GTGATATGTTTTGTTCACTTGGTAAAGATC (SEQ ID N0:13) CS434:
CTCATGGCTCCATTTGTTGCAAATGCAAACTTTATG (SEO 1D N0:14). PCR assays using these primers amplified a 429 by DNA fragment from the genomic DNA of strain E118811A. By screening the DNA library, a positive clone that contained the entire csaA gene together with upstream DNA sequences was isolated. The clone contains the 8000 base pair plasmid pKS-CSA-II, (FIGURE 1 B).
DNA seJc uence analysis DNA sequences of the CS4 encoding genes in plasmids pKS-CSA-I and pKS-CSA-II
were determined in both strands. The sequencing primers were synthesized on Perkin Elmer DNA
Synthesizer model 3948 at the 40nM
synthesis scale. The sequencing was performed using a Perkin Elmer DNA
Synthesizer 373, with the Dye Terminators from the BIGDYE KIT, Perkin Elmer (Boston, MA). The sequencing results identified the csa operon and its flanking genes, as is schematically described in FIGURE 1 C.
Construction of uGA2 The vector used for expression of the CS4 encoding genes in Shigella, pGA2, was derived from plasmid pEX01 by replacing fihe gfp encoding gene (751 by DNA, flanked by the restriction enzymes C/al and Nhel), with an 87 by linker that contains multiple cloning sites (mcs), that was constructed by PCR, as indicated. pEX01 is an expression plasmid derived from pGEN222. (Galen, et al., Infect. lmmun., 67:6424-6433 (1999)). Plasmid pGEN222 carries a two-component plasmid maintenance system comprised of the hok-sok post-segregational killing system plus the parA plasmid partitioning system. these two components have been shown to work in concert to minimize plasmid loss from a population of actively growing bacteria and to lyse any bacteria from which plasmids have segregated.
pEX01 was created from pGEN222 by replacing the bla gene, encoding (3-lactamase, with an engineered aph allele encoding reduced levels of resistance to kanamycin (Blomfield, et al., Mol.
Microbiol., 5:1447-1457 (1991)). It was observed that expression of the wildtype aph allele within attenuated S. typhi vaccine strains lead to plasmid instability. Therefore, transcription of this aph allele was modified by PCR
such that the separation of the -35 and -10 regions within the promoter was increased from 18 to 19 base pairs; this re-engineered allele was then introduced as an Nhe I fragment into pGEN222 cleaved with Xba I and Spe I to replace the bla gene.
The PCR fragment encoding for mcs was used as a Cla I - Nhe 1 restriction fragment to replace the Cla I-Nhe I restriction fragment within pEX01 encoding the gfpuv allele, creating pGA2.
pGA2 is therefore expected to be present at approximately 15 copies per chromosomal equivalent, and to drive expression of CS4 encoding genes from the osmotically responsive ompC promoter.
The mcs was constructed by PCR using the following primers: Primer 4a:
GGGATCGATCCCGGGGCGGCCGCGGGCCCGGTACCAGGCCTTCTAGAAAGCTTGACGTCG (SEO ID N0: 15);
primer 4b:
CCCGCTAGCGGCGCGCCTCGCGAGGATCCGTCGACGACGTCAAGCTTTCT AGA AGGCCTGG (SEO ID N0:
16); Primer 4c: AAGCTTGACGTCGTCGACGG (SEQ ID N0: 17); Primer 4d: CCCGCTAGC GGCGCGCCTCGCG
(SEQ ID N0: 18).
Construction of the CS4 encoding plasmid Plasmid pGA2-CS4 (FIGURE 2B1, was constructed in three steps. The 5' end of the csaA gene was cloned from plasmid pKS-CSA-II on a 710 by Hpal I Xbal fragment, into pKS Smal I
Xbal. The Hpal site is located 241 by upstream the ATG colon for the csaA gene. The DNA fragment was then further cloned as a Kpnl I Xbal fragment into pGA2 Kpnl I Xbal, to construct pGA2-~csaA plasmid. The remaining CS4 encoding genes, (the 3' end of csaA, csaB, csaC, and csaE) were cloned from pKS-CSA-I as a 4526 by Xbal fragment.
The two Xbal sites are located in the csaA gene, and in the stop colon of the csaE gene. The DNA fragment was ligated to pGA2-~csaA Xbal site, to construct plasmid pGA2-CS4.
Additional DNA urimers for PCR assays For location of different genes by PCR assays, the following primers were constructed. For LT gene (AB011677, G! 3062900): LTA hp 162:CCGTGCTGACTCTACACCCCCAGATG ISEQ ID N0: 19) and LTB by 895:GCACATAGAGAGGATAGTAACGCCG (SEQ ID N0:20). For gyrA gene (X57174, GI
41641): GYRA bp.
347:CGGTCATTGTTGGCCGTGCGCTGCC (SEQ ID N0:21) and GYRA by 1147;CACGCAGCGCGCTGATGCCTTCCACGCG (SEO ID N0:22). For csaD gene: CS4D3 : from csa operon by 5540-5564, and cfaD (GI 145505) by 1236-1260. CATATTTGATATCTGAGATATCTGG (SEO ID
N0:23) CS4D2: From csa operon by 6005- 60030, and cfaD by 771-794, TGTTGCATTCAGATTGAACGGAG (SEO ID
N0:24). CS4D1: From cfaD by 606-629, at similar region to rns. This DNA region is missing in csa operon TATTATGATTCATAAATACACTGT (SEO ID N0:25). PCR assays using primers CS4D21CS4D3 is expected to amplify a 476 by DNA, and with primers CS4D11CS4D3, a 646 by DNA.
Transformation of ShiQella strains Shigella strains were grown in trypticase soy agar (TSA) agar plates containing 0.1 % Congo red and 10 ~,glml guanine. Competent cells of S. flexneri 2a CVD1204 were prepared by growing the cells in L broth supplemented with guanine to OD600 nm of 0.6. The cells were precipitated, washed twice with cold H20, once with cold 10% glycerol and resuspended in the same buffer at 11100 of the original volume. A mixture of 150 ~,I cells and plasmid DNA were electroporated in a 0.2 cm curettes in a Gene Pulser (BioRad Laboratories, Hercules, CA) using 2.5 kV, 20052, 25 ~F, or 1.75kV, 60052, 25 ~,F. Transformants were selected on kanamycin, guanine and Congo red containing TSA plates. ' Detection of pili synthesis ETEC strains were grown on CFA (Hamers, et al., Microb. Pathog., 6:297-309 (1989)) plates at 37°C, and the bacteria was resuspended in phosphate buffered saline (PBS). Shigeiia strains that contain the plasmid pGA2-CS4 were grown in TS broth, [Trypton (Difco), 1.5°l°; Soyton (Difco), 0.5%)], containing 0, 50, 150 and 300 mM NaCI to a logarithmic phase growth. The bacteria were assayed for pill production by bacterial agglutination assays, and by immunoblotting of cell extracts. For immunoblotting the bacterial cultures were adjusted to OD600nm°10 and boiled for 10 minutes in Laemnli sample buffer (BioRad). The cell extracts proteins were separated on SDS-PAGE (15%), transferred to nitrocellulose filters (MSI) and probed with anti-CS4 serum.
The specific anti-CS4 antiserum was produced in rabbits by immunization with ETEC strain E11881A (a CS4+ CS6+
producer strain), and absorption of the sera on EIISSIC (a CS4-CS6+ strain).
Hemagy lutq ination For hemagglutination tests (Willshaw, et al., FEMSMicrobioL Lett., 49:473-478 (1988)), ETEC and Shigeiia strains were grown overnight on CFA or TSAI CRlguanine I kanamycin containing plates, respectively, and were resuspended in PBS to ODsoo °m of 10. The slide hemagglutination tests, were performed as described by Sakellaris, et al 1999 (Sakellaris, et al., Proc. Nat/. Acad. Sci. U.SA., 96:12828-12832 (1999)), by mixing 20 ~I bacterial suspension with 20,1 PBS containing 0.1M D-mannose and 20 w1 washed human erythrocytes of group A. For hemagglutination inhibition assays, the bacterial suspensions were incubated with four-fold diluted antibodies for 1 hour at 37°C prior to the hemagglutination tests.
Adhesion and inhibition of adhesion to Caco-2 cells Caco-2 cells were grown for 15 days in 8 chamber slides in Dulbecco's modified Eagels medium containing fetal calf serum (2O%) and glutamine (1%). Adhesion assays were performed by incubating washed cells with bacterial concentrations of 10' and 1081m1, for 2 and 3 hours in DMEM
containing 0.1 M D-mannose, (Viboud, et al., Microb. Pathog" 21:139-147 (1996)). In the inhibition of adhesion assays, the bacterial cultures were incubated with antibodies for 1 hour, at 37°C prior to their addition to the washed Caco-2 cells. Following the incubation, the Caco-2 cells were washed 5 times with PBS, fixed with methanol and stained with Giemsa (10%).
Immunization Guinea pigs, anesthetized subcutaneously with ketamine HCL (40mglkg) and xylazine (5mglkg), were inoculated intranasal administration twice on days 0 and 14, with ~ 2x109 bacteria (0.1 ml of 400D600nm) that grew on TSA 1 Congo red l guanine containing plates and harvested in PBS. Two groups of animals were immunized:
group I with CVD1204 (pGA2), and group II with CVD1204 (pGA2-CS4), a CS4 producing strain. Sera were obtained on days 0,14 and 30 by anterior vena cava puncture of anesthetized animals.
Results Cloning and sequencing of the CS4 fimbriae encoding genes The csa operon that encode the synthesis of the CS4 fimbriae, was isolated from a genomic DNA library of strain E11881A, as described above. Most of the csa operon was cloned on plasmid pKS- CSA-I that contains the carboxy terminal part of the csaA gene, the csaB, csaC, csaE genes and a disrupted csaD' gene. The csaD' was disrupted by integration of an IS1 element, creating a deletion of the amino terminal 48 amino acids, and a frame shift mutation that resulted in stop colon. Agglutinations assays of DHSa, (pKS-CSA-I) strains with rabbit serum anti E11881A (that was absorbed on strain E11881C) were positive, which indicated expression of the CS4 fimbriae.
Western blot tests indicated the presence of two fimbrial bands, the mature 17 kDa protein, and a higher MW protein, probably the pre cleaved form. By further screening of the CS4 library plasmid pKS-CSA-II was isolated. The plasmid contains the csa promoter site, the csaA gene and the amino terminal region of csa8. Up stream of the csaA gene is an IS 21 element. The csa operon is located on a ~ 10,500 by DNA fragment that is flanked by insertion elements, similar to a pathogenicity island, as schematically described in FIGURE 1 C.
7,239 by of the CS4 pathogenicity island was sequenced in both directions, indicating a 34.88% G+C
region. The csa operon is located between by 1 and 6,095 bp. It contains 5 ORF, 4 genes, csaA, csaB, csaC, and csaE are transcribed in the same direction down stream from a predicted promoter site, and csaD' from the antiparallel strand. The location of each gene is described in Table 1, and schematically presented in FIGURE 1 C. A BLAST
search for homology of the csa DNA sequence (bases 1 to 6096) to other genes indicated homology to CFAII. CS1 and CS2 ETEC fimbriae encoding genes, to the structural genes of CS4 and CS14, and to fimbriae regulatory genes cfaD, rns, csvR and aggR, as presented in Table 2. The results of the BLAST search indicate that the csa operon has a high DNA similarity to cfal operon; 5,420 by oufi of 6,069 by are > 91 % similar.
Comparing the DNA sequence of each gene to other fimbriae encoding genes indicate the following results:
csaA: 93% of the 717 by of the csaA DNA sequences are identical to 716 by of cfaA
M55661.1), and 44 by from its 5' end are 90% identical to csoA and cov8 713 by genes ( X62879.1 and X62495.1 ).
csa8: 402 by of csfA (X97493.1 ), the published DNA sequence of the CS4 structural gene, are 99% identical to 501 by of the csa8 DNA sequences. Of the 512 by of cfa8, (M55661.1), the sequence of 107 by is 93% identical to csa8. 93 bases from the 5' end of csuA1504 bp, ( X9749.1), the structural gene for CS14 fimbriae, are 89% identical to csa8 . 35 by from the 5' end of cvtA
512 by gene (Z47800.1) is 94% identical to csaB.
csaC : 2601 by of csaC gene share 96% DNA sequences similarity to 2507 by of cfaC
(M55661.1), 80% homology to 391 by out of 2618 by of cooC (X76908.1), and 85%
homology to 124 by out of 2597 by of cotC (Z47800.1 ) genes.
csaE : 1086 by of the csaE DNA sequences are >_ 84% identical to 999 by out of 1082 by of cfaE
(M55661.1), and 32 by out of 1091 by of covD (X76908.1) are 90% identical to csaE.
csaD' : csaD' DNA sequence is similar to cfaD' (CFAII), cfaD, rns and csvR
from ETEC strains, and aggR from EHEC fimbriae. DNA sequence similarity between csaD', cfaD and rns is of 7511817 by (91 %) for cfaD, and 7211787 (91 %) for rns.
Comparing the regions of similarity in both genes indicated that csaD' gene is missing 143 by from its 5'-end because of an insertion of an IS element. Blast search for DNA sequences downstream the csa operon indicated that from base 6096 to 6870 there is homology to IS1 E sequences, (NCBI
X52537, identities = 7651769, 99%), from by 6892 to 7054, there is homology to EPEC strain plasmid pB171 (GI 6009376), between by 16240 and 16471.
And from by 7062-7239 there is homology to Shigella sannei strain P9 plasmid collb (GI 4512437) between by 4895 and 5568.
Promoter site The promoter site for the csa operon was predicted using the "Promoter Prediction By Neural Network", and it is proposed to be located between by 145 to 194, 89 by upstream the ATG
colon for csaA gene. The predicted promoter sequences is as follow:
TGTGGGTATTTGTTTGGACATCGCAGCATTAAATATAAAAATAGCACAGG (SED ID
N0:26). The large underline "A" is the predicted transcription start, and the shaded nucleotides are the possible -10 and -35 sequences. A BLAST search indicated a 28131 by (90°l°) homology to the CFAII fimbrial operon, at between by 687 to 717, 131 by upstream to the cfaA gene.
CS4 pili structural and assemble proteins. The csa operon encodes the synthesis of five proteins: CsaA, CsaB, CsaC, CsaE and CsaD. The location of the genes and the size of the putative proteins are described in Table 1.
According to sequence similarity of the CsaA-E proteins to other ETEC fimbriae proteins, the predicted functions of the CsaA-E proteins is as follow:
CsaA function as a periplasmic chaperon like protein. PSORT analysis indicate that the putative protein is a bacterial periplasmic space protein (certainty of 0.939). CsaB is the major pilin subunit. CsaC is a membrane usher protein. A PSORT analysis predicted an outer membrane location (certainty of 0.926). CsaE is assumed to be at the fimbriae tip. A PHDsec analysis (for the prediction of secondary structure) indicated that the protein is a compact protein as a globular domain. CsaD' is a fimbriae regulatory protein. The CsaD' protein contains 100 amino acids from the carboxy terminal part of the protein, missing the first 48 amino acids (based on homology to cfaD gene from CFAII pili), because of an insertion of an IS1E element. Following the 100 amino acid is a frame shift mutation that encodes for a stop colon.
Homolony of the CsaA-E proteins to other fimbriae uroteins A BLAST search with the putative amino acid sequence of CsaA-E proteins indicated homology to fimbriae proteins from ETEC strains and Salmonella typhi as described in Table 3. The amino acid sequence of the structural and assemble proteins of the CS4 fimbria have similarity to ETEC proteins producing the CFAII, CS1 and CS2 fimbriae, and to the Salmonella fimbria. In addition, the CS4 structural proteins have amino acid sequences similar to the structural proteins of CS14, CS17, CS19 and B. cepacia. The CS4 fimbriae structural protein CsaB and the tip-associated protein CsaE are responsible for the fimbrial structure and for the bacterial attachment to intestine cells.
An alignment of the amino acids sequences of the fimbrial proteins that are similar to CsaB and CsaE is described in FIGURES 3 and 4.

Similarity in AA sequences between ETEC CsaA-E proteins and other fimbrial proteins CS4 Pili Protein#aminoIdentities regionregion Gene in in protein acids CS4 comparedno.

proteinsprotein CsaA CFAII CfaA 238 2081238(87%) 1-238 1-238 gi 145508 CS1 CooB 238 124)221(56%) 1-219 1-219 gi 95719 CS2 CotB 238 1111238(46%) 2-238 2-238 gi 897726 TsaA' 236 601194(30%) 17-20722-204 gi 5640159 CS5 25.9KD 224 521218(23%) ~ P33792 CsaB CS4 CsfA 134 1091134(81 34-1601-134 gi 1304302 %) CFAII CfaB 170 991170(58%) 1-167 1-170 GI145509 CS14 CsuA1 168 951164(57%) 1-164 1-164 gi 1304304 CS1 CooA 171 851168(50%) 1-164 1-168 gi 78442 CSZ CotA 170 761167(45%) 1-164 1-167 gi 897727 CS14 CsuA2 142 67)132(50%) 34-1641-132 gi 1304306 CS19 CsdA 133 561131(42%) 34-1641-130 gi 1304300 CS17 CsbA 135 541132(40%) 34-1641-132 gi 1304298 TsaB' 191 581169(34%) 1-166 22-187 gi 5640160 Cable CbIAz 184 501150(33%) 20-16713-159 gi 606843 CsaC CFAII CfaC 869 8001868(92%) 16-8832-869 gi 2121079 CS1 CooC 872 5311841(63%) 40-88031-868 gi 488736 CS2 CotC 866 4691839(55%) 40-87829-864 gi 897728 CS6 CssD 1201549(21 P53513 %) TsaC' 895 2601867(29%) 42-87225-882 gi 5381204 AtfC3 843 1111491(22%) 211-670207-665 gi 1504107 CafIA4 833 1001511(19%) 209-685205-661 gi 3883097 CsaE CFAII CfaE 360 288)361(74%) 2-362 1-360 gi 2121080 CS1 Coop 363 1771329(59%) 41-36239-363 gi 488737 CS2 CotD 364 1611339[47%) 29-36228-364 gi 897729 TsaD' 359 901303(29%) 71-36179-358 gi 5640162 rfbFS 187 19166 (28%) 146-21155-114 gi 48590 CsaD CFAII CfaD 265 901101(89%) 9-109 49-149 gi 145506 CFAII CfaD' 144 901101(89%) 9-104 49-144 gi 145508 RNS 265 891101(88%) 9-104 49-149 gi 145512 CSIIR 305 751103(72%) 9-104 49-151 gi 95726 AAFIi AGGR 265 57)101(56%) 9-109 49-149 gi 420983 ' Salmonella typhi Z Burkhvlderia cepacia 3 Prvteus mirabilis outer membrane usher protein 4 Yersiniapestis F1 capsule anchoring protein 5 Yersinia enterocvlitica Localization of the csa operon in strain E11881A
In order to identify the location of the csa operon, total genomic DNA was isolated from strain E11881A, and was subjected to agarose gel electrophoresis. Tho electrophoresis results indicated the presence of 3 plasmids: a large plasmid located above the chromosomal band, and two smaller plasmids located under the chromosomal DNA
band. The plasmids and the chromosomal bands were gel eluted and tested by PCR
assays for the presence of the csa operon, using primers GS441CS45 for amplification of the csaB gene. These results indicated that the csa operon was located on the large plasmid. The location of the LT gene was detected by PCR
assays using primers LTA1621LTB895 (for amplification of a 708 by DNA), indicating the LT encoding genes were located on the large plasmid. Amplification of the gyrA gene, using primers GYRA3471GYRA1147 (for amplification of a 748bp DNA ) indicated a chromosomal location. In order to see whether strain E11881A
contained a complete csaD gene, PCR
assays were performed with primers that are homologous to csaD'gene (CS4D2 and CS4D3), and with primer CS4D1 that is homologous to cfaD and rns genes (CSD411CSD43). The results indicates that strain E11881A does not contain the complete cfaD gene. Primers CS4D21CS4D3 amplified the expected 476 DNA fragment, while primers CS4D11CS4D3, did not amplified an expected 646 bp. Strains EII881E, DS9-1 H10407, and C91f, contained the complete gene.
E~x ression of the CS4 pill in DHSa and CVD1204 The expression of the CS4 fimbriae was detected following cloning of 5281 by of the csa operon in vector pGA2, to construct the plasmid pGA2- CS4, (FIGURE 2B). The cloned csa operon contained 240 by of the promoter region up stream the ATG colon for csaA gene, the csaA, csa8, csaC and csaE
genes. The csa operon was cloned downstream of the ompC promoter, which is osmotically regulated. Plasmid pGA2-CS4 was transferred to E.coli DHSa and Shigella CVD1204 strains. CS4 fimbriae production by strains DHSa (pGA2-CS4) and CVD1204 (pGA2 CS4) strains was detected by agglutination assays using rabbit serum against the CS4 fimbriae and western blot of cell extracts. Western blot results indicates that the cloned csaABCE gene cluster encodes for a 17 kDa band that correspond to the CS4 fimbriae.
Antibody response of guinea-nig_s to CVD1204 (oGA2-CS41 To test whether the cloned csa operon could induce an immune response against ETEC-CS4, guinea pigs were immunized by two intranasal administrations of 2x109 live CVD1204 (pGA2-CS4), and as control with CVD1204~
(pGA2) strain. The immunized animals were tested for bacterial agglutination, immunoblotting, and inhibition of hemagglutination and adherence of CS4 expressing strains to Caco-2 cells.
Ag~glutination assays Bacterial agglutination assays done with immune guinea pigs indicated that immunized animals with CVD1204 (pGA2-CS4) developed antibodies that agglutinates all CS4 producing strains, and especially the high fimbriae producing strains DS 9-1, DHSa(pGA2-CS4) and CVD1204(pGA2-CS4), as described in Table 4. The end point of serum dilution that agglutinates DS 9-1 and DHSa(pGA2-CS4) strains is > 1:100 and > 1:1000, respectively. The control sera from animals immunized with CVD1204 (pGA2) strain, agglutinate CVD1204 strains.
Bacterial agglutination assays using rabbit anti-CS4 antiserum were also performed and the data from these assays is presented in Table 5.

Bacterial agglutination assays by rabbit anti CS4 antiserum Strain NaCI End point dilution of the antibody that result in Induction mM bacterial agglutination factor CUD1204(pGA2-CS4) 0 1:400 50 1:800 2 150 1:1600 4 300 1:800 2 CIID1204(pGA2) 0 < 1:10 150 < 1:10 none Bacterial agglutination assays by immune guinea pigs serum Intensity of bacterial agglutination by immune guinea pigs Tested strain' Relevant sera2 against:

phenotype C11D1204 CVD1204 (pGA2-CS4) (pGA2) E11881A CS4+CS6' + -E11881E CS4+ CS6+ + -E11881 C CS4~ CS6+ - -E11881JG28 CS4~ CS6~ - -DS9-1 CS4+ CS6+ ++++ -DHSa(pGA2-CS4) CS4+ ++++ -DH5_a CS4~ - -CIID 1204(pGA2-CS4)CS4+ + + + + +

CUD 1204 CS4- + + +

' ETEC and Shigella strains were grown on CFA and TSA, guanine, Km plates, respectively;
and resuspended to ODsoonm of 5.

2 The assays were performed with antibodies dilution of 1:10 and higher.

Immunoblottinn assays The immunized guinea pigs were tested in immunoblotting experiments to bind to CS4 fimbriae proteins. The assays were performed by probing CS4 producing strains with the guinea pig immune serum and rabbit anti-CS4 serum. Cell extract were isolated from ETEC strains E11881A and DS 9-1, that grew on CFA plates at 37°C and 22°C
(a condition that suppresses fimbriae production), from DHSa (pGA2-CS4) and CVD1204 (pGA2-CS4) strains that grew in LB broth in the presence of Km. The immunoblotting results showed that guinea pigs serum from CS4 immunized animals reacted with a 17 kDa band protein which is the CS4 fimbrial structural protein. ETEC strains produced a 17 kDa band at 37°C but not at 22°C. E.coli and Shigella strains that contains the plasmid pGA2-CS4 produced 17 kDa protein bands, which was not produced in the corresponding untransformed cells.

Inhibition of hemagplutination ETEC strains that produce the CS4 fimbriae cause a mannose resistant agglutination of human red blood cells type A. The ability of ETEC-CS4 strains, DHSa, and a CVD1204 strain that contains the cloned CS4 encoding genes, were tested for hemagglutination. The results are presented in Table 6.
The hemagglutination assays indicated that all CS4 pili producing strains caused hemagglutination. ETEC-CS4 strains demonstrate a more intense hemagglutination than strains expressing the cloned csa operon. Non CS4 producing strains did not caused any hemagglutination.

Efficiency of bacterial induced hemagglutination Tested strains Relevant phenotype Hemagglutination E11881A CS4+ CS6+ ++

E 11881 E CS4+ CS6+ + + +

a EII881 C CS4' CS6+

DS 9-1 (37C~) CS4+ CS6+ ++++

DS 9-1 (22C~) CS4' -DHSa(pGA2-CS4) CS4+ +

DHSa CS4- -CVD1204(pGA2-CS4) CS4+ +

CVD1204(pGA2) CS4' -~" Temperature of growth.
The guinea pigs anti-CS4 antiserum was tested for inhibition of hemagglutination. ETEC-CS4 strains were incubated with various antibody dilutions prior to their addition to the red blood cells suspension. The results that are presented in Table 7 indicates that the guinea pigs anti-CS4 antibodies inhibits the hemagglutination, while the control immune serum against the Shigella has no effect on the ETEC-CS4 induced hemagglutination.

Efficiency of inhibition of bacterial induced hemagglutination by guinea pigs anti-CS4 antibodies Tested End point dilution of antibodies that inhibit bacterial strains induced hemagglutination. Antibodies were from guinea nips immunized with:
E11881A 1:256 < 1:2 DS 9-1 1:32 < 1:2 inhibition of adherence of ETEC-CS4 strains to Caco 2 cells ETEC-CS4 producing strains have the ability to adhere to human carcinoma cell line Caco-2. The adhesion of ETEC strain DS 9-1to the Caco-2 cells, and the effect of the guinea-pigs anti-CS4 antibodies on this adhesion were tested. The results indicate'that ~ 10-100 bacteria adhere to the Caco-2 cells. As a control, the adhesion of DHSa bacteria was tested, and only very few bacteria were found to adhere.
Preincubation of the ETEC DS 9-1 with guinea pigs anti-CS4 serum (1:10 dilutions), totally inhibit the adherence of the bacterial cells to the Caco-2 cells.

Construction of an Attenuated S. typhi Strain that Constitutively Expresses In order to change the expression of CS4 in pGA2-CS4 from osmotically regulated to constitutive, a strong promoter, eg., P,a~, is used. The promoter Pta~ is constitutively active in Salmonella spp., as these organisms lack laql.
Accordingly, constitutive CS4-expressor derivatives of CVD 915 are constructed in the manner described below.
First, the ompC promoter is removed from the pGA2-CS4 construct and replaced with the P,a~ Promoter, resulting in the creation of pGAZtac-CS4. After confirming the presence of the P~a~ promoter in pGA2tac-CS4, the construct is introduced into S. typhi strain CUD-915, using standard molecular biology techniques.
Constitutive expression of the CS4 antigen is assessed by the agglutination assay described in Example 1.
Using wild-type S. typhi strain Ty2 as the positive control, and untransformed CVD-915 (CUD 915') as the negative control, expression of the CS4 antigen is found to be strong, constitutive, and not regulated by changes in osmolarity.

Immune Resuonse Auainst Constitutively Ex~~ressed CS4 Groups of ten 6 weeks old Balblc mice are immunized intranasally with 1.0x10'° cfu of strain CVD 915 with pGA2tac-CS4 (CUD 915+) or CUD 915 without pGA2tac-CS4 (CVD 915-). Mice are bled prior and 30 days after their immunization, and their serum is stored at -20°C until use. Antibodies present in the serum against S, typhi LPS, H
(flagella) and CS4 antigens are determined by ELISA. The results indicate that immunization with strain CUD 915+
elicits antibody levels against the CS4 antigen that are significantly higher than those obtained with strain CVD 915'.
The immune responses against other S typhi antigens (LPS and H) are similar between both immunized groups. The results demonstrate that the constitutive expression of the CS4 antigen enhances the immune response against this antigen without interfering with the immune response against other somatic S.
typhi antigens.

Immune Resuonse Against Constitutively Expressed CS4 The enterotoxic E. coil strain expressing the CS4 antigen (ETEC-CS4) from Example 1 is formulated into an immunogenic composition for nasal administration into a human subject (ETEC-CS4). Approximately 1.0x10'° cfu of the recombinant bacteria ETEC-CS4 is nasally administered to a human subject.
A booster is administered two weeks subsequent to the first administration. Blood is subsequently drawn from the subject and assayed for the presence of anti-ETEC-CS4 and anti-CS4 antibodies. Such antibodies are found in the blood sample.
Although the invention has been described with reference to embodiments and examples, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

SEQUENCE LISTING
<110> UNIVERSITY OF MARYLAND, BALTIMORE
ALTBOUM, Zeev BARRY, Eileen M.
LEVINE, Myron M.
<120> ISOLATION AND CHARACTERIZATION OF THE CSA
OPERON (ETEC-CS4 PILI) AND METHODS OF USING SAME
<130> UOFMD.006VPC
<150> US 60/198,626 <151> 2000-04-20 <160> 40 <170> FastSEQ for Windows Version 4.0 <zlo> 1 <211> 717 <212> DNA
<213> E. coli <220>
<221> CDS
<222> (1) . . . (717) <400> 1 atg cat aaa tta ttt tgt tta cta agt tta ctc ata act cca ttt gtt 48 Met His Lys Leu Phe Cys Leu Leu Ser Leu Leu Ile Thr Pro Phe Val gca aat gca aac ttt atg ata tat cca ata tca aaa gat tta aag aat 96 Ala Asn Ala Asn Phe Met Ile Tyr Pro Ile Ser Lys Asp Leu Lys Asn gga aat agc gag tta att cgt gtt tat tca aaa tca aaa gag ata caa 144 Gly Asn Ser Glu Leu Ile Arg Val Tyr Ser Lys Ser Lys Glu Ile Gln tat ata aaa ata tat aca aaa aag att att aat ccc ggc aca act gaa 192 Tyr Ile Lys Ile Tyr Thr Lys Lys Ile Ile Asn Pro Gly Thr Thr Glu gaa cat gaa gtt gat atg ccc aat tgg gat ggt ggg ttt gta gtt act 240 Glu His Glu Val Asp Met Pro Asn Trp Asp Gly Gly Phe Val Val Thr cct caa aaa gtt att ctt cct gca gga ggg agt aaa tca ata cgt tta 288 Pro Gln Lys VaI Ile Leu Pro Ala Gly Gly Ser Lys~Ser Ile Arg Leu act caa ttt aga ata cca aaa aaa gag gaa att tat aga gta tat ttt 336 Thr Gln Phe Arg Ile Pro Lys Lys Glu Glu Ile Tyr Arg Val Tyr Phe gag gcg gta aaa eca gat agc aaa gaa aat gta att gat aat aaa aaa 384 Glu A1a Val Lys Pro Asp Ser~Lys Glu Asn Val Ile Asp Asn Lys Lys 1l5 120 125 cta aca aca gag eta tct gtt aat ata att tat gcg get cta atc aga 432 Leu Thr Thr Glu Leu Ser Val Asn Ile Ile Tyr Ala Ala Leu Ile Arg tct tta cca agt gaa caa aac ata tea cta aac att tct aga aat gca 480 Ser Leu Pro Ser Glu Gln Asn Ile Ser Leu Asn Ile Ser Arg Asn Ala aga aaa aat ata att att tat aat aat ggg aat gtt aga gca ggt gtt 528 Arg Lys Asn Ile Ile Ile Tyr Asn Asn Gly Asn Val Arg Ala Gly Val aaa gat att tat ttt tgt aag tca tet aat atc gat gat agc tgt gta 576 Lys Asp Ile Tyr Phe Cys Lys Ser Ser Asn Ile Asp Asp Ser Cys Val aaa aaa acg cat aac aag aat ata tat cca gaa aag tca ttt gat acg 624 Lys Lys Thr His Asn Lys Asn Ile Tyr Pro Glu Lys Ser Phe Asp Thr ctg gtt aat aac aat ttt tct tat gtt ttc att aaa tta aac cat gaa 672 Leu Val Asn Asn Asn Phe Ser Tyr Val Phe Ile Lys Leu Asn His Glu gac ata gaa aaa gag caa gga cta ata caa tta aaa gtt ect tga 717 Asp Ile Glu Lys Glu Gln Gly Leu Ile Gln Leu Lys Val Pro <210> 2 <211> 238 <212> PRT
<213> E. coli <400> 2 Met His Lys Leu Phe Cys Leu Leu Ser Leu Leu Ile Thr Pro Phe Val Ala Asn Ala Asn Phe Met Ile Tyr Pro Ile Ser Lys Asp Leu Lys Asn Gly Asn Ser Glu Leu Ile Arg Val Tyr Ser Lys Ser Lys Glu Ile Gln Tyr Ile Lys Ile Tyr Thr Lys Lys Ile Ile Asn Pro Gly Thr Thr Glu Glu His Glu Val Asp Met Pro Asn Trp Asp Gly Gly Phe Val Val Thr Pro Gln Lys Val Ile Leu Pro Ala Gly Gly Ser Lys Ser Ile Arg Leu Thr Gln Phe Arg Ile Pro Lys Lys Glu Glu Ile Tyr Arg Val Tyr Phe Glu Ala Val Lys Pro Asp Ser Lys Glu Asn Val Ile Asp Asn Lys Lys Leu Thr Thr Glu Leu Ser Val Asn Ile Ile Tyr Ala Ala Leu Ile Arg Ser Leu Pro Ser Glu Gln Asn Ile Ser Leu Asn Ile Ser Arg Asn Ala Arg Lys Asn Ile Ile Ile Tyr Asn Asn Gly Asn Val Arg Ala Gly Val Lys Asp Ile Tyr Phe Cys Lys Ser Sex Asn Ile Asp Asp Ser Cys Val Lys Lys Thr His Asn Lys Asn Ile Tyr Pro Glu Lys Ser Phe Asp Thr Leu Val Asn Asn Asn Phe Ser Tyr Val Phe Ile Lys Leu Asn His Glu Asp Ile Glu Lys Glu Gln Gly Leu Ile Gln Leu Lys Val Pro <210> 3 <211> 504 <212> DNA
<213> E. coli <220>
<221> CDS
<222> (1)...(504) <400> 3 atg aaa tta aaa aaa act att ggt gca atg gca ctg acc aca atg ttt 48 Met Lys Leu Lys Lys Thr Ile Gly Ala Met Ala Leu Thr Thr Met Phe gta get atg agt get tct gca gta gag aaa aat atc act gta aca get 96 Val Ala Met Ser Ala Ser Ala Val Glu Lys Asn Ile Thr Val Thr Ala agt gtt gat cct aca att gat att ttg caa get gat ggt agt agt tta 144 Ser Val Asp Pro Thr Ile Asp Ile Leu Gln Ala Asp Gly Ser Ser Leu cct act get gta gaa tta ace tat tca cct gcg gca agt cgt ttt gaa 192 Pro Thr Ala Val Glu Leu Thr Tyr Ser Pro Ala Ala Ser Arg Phe Glu aat tat aaa ate gca act aaa gtt oat aca aat gtt ata aat aaa aat 240 Asn Tyr Lys Ile Ala Thr Lys Val His Thr Asn Val Ile Asn Lys Asn gta cta gtt aag ctt gta aat gat eca aaa ctt aca aat gtt ttg gat 288 Val Leu Val Lys Leu Val Asn Asp Pro Lys Leu Thr Asn Val Leu Asp tct aca aaa caa ctc ccc att act gta tca tat gga gga aag act cta 336 Ser Thr Lys Gln Leu Pro Ile Thr Val Ser Tyr Gly Gly Lys Thr Leu tca acc gca gat gtg act ttt gaa cct gca gaa tta aat ttt gga aeg 384 Ser Thr Ala Asp Val Thr Phe Glu Pro Ala Glu Leu Asn Phe Gly Thr tca ggt gta act ggt gta tct tct tcc caa gat tta gtg att ggt gcg 432 Ser Gly Val Thr Gly Val Ser Ser Ser Gln Asp Leu Val Ile Gly Ala act aca gca caa gca cca acg gcg gga aat tat agt ggg gtc gtt tct 480 Thr Thr Ala Gln Ala Pro Thr Ala Gly Asn Tyr Ser Gly Val Val Ser ate tta atg acc tta gca tca taa 504 Ile Leu Met Thr Leu Ala Ser <210> 4 <211> 167 <212> PRT
<213> E. coli <400> 4 Met Lys Leu Lys Lys Thr Ile Gly Ala Met Ala Leu Thr Thr Met Phe Val Ala Met Ser Ala Ser Ala Val Glu Lys Asn Ile Thr Val Thr Ala Ser Val Asp Pro Thr Ile Asp Ile Leu Gln Ala Asp Gly Ser Ser Leu Pro Thr Ala Val Glu Leu Thr Tyr Ser Pro Ala Ala Ser Arg Phe Glu Asn Tyr Lys Ile Ala Thr Lys Val His Thr Asn Val Ile Asn Lys Asn Val Leu Val Lys Leu Val Asn Asp Pro Lys Leu Thr Asn Val Leu Asp Ser Thr Lys Gln Leu Pro Ile Thr Val Ser Tyr Gly Gly Lys Thr Leu Ser Thr Ala Asp Val Thr Phe Glu Pro Ala Glu Leu Asn Phe Gly Thr Ser Gly Val Thr Gly Val Ser Ser Ser Gln Asp Leu Val Ile Gly Ala Thr Thr Ala Gln Ala Pro Thr Ala Gly Asn Tyr Ser Gly Val Val Ser Ile Leu Met Thr Leu Ala Ser <210> 5 <211> 2604 <212> DNA
<213> E. coli <220>
<221> CDS
<222> (1)...(2604) <400> 5 atg aca aaa aaa aat aca tta tat ata acg atc atc gca atg cta act 48 Met Thr Lys Lys Asn Thr Leu Tyr Ile Thr Ile Ile Ala Met Leu Thr cca tat tca gtt ttt tcc gga gat ata ccc aac tct ttc cgt gat tta 96 Pro Tyr Ser Val Phe Ser Gly Asp Ile Pro Asn Ser Phe Arg Asp Leu tgg gga gaa caa gat gaa ttt tat gaa gta aaa cta tat gga caa act 144 Trp Gly Glu Gln Asp Glu Phe Tyr Glu Val Lys Leu Tyr Gly Gln Thr cta gga ata cat cga att aaa aca acc cca aca cat att aag ttt tat 192 Leu Gly Ile His Arg Ile Lys Thr Thr Pro Thr His Ile Lys Phe Tyr tca ccc gaa agc att tta gat aaa ata aat gta aaa aaa gaa aag gaa 240 Ser Pro Glu Ser Ile Leu Asp Lys Ile Asn Val Lys Lys Glu Lys Glu aagaaattgagt gttttg ttcactaat tctttttca agaaatggc aat 288 LysLysLeuSer ValLeu PheThrAsn SerPheSer ArgAsnGly Asn atgagttgtcag gggaat getactata cagtataac tgcaattac att 336 MetSerCysGln GlyAsn AlaThrIle GlnTyrAsn CysAsnTyr Ile aaaacaaaatca gtagat gtcatcgtt gatgatgtt gataatgtt gtt 384 LysThrLysSer ValAsp ValIleVal AspAspVal AspAsnVal Val aacctttttata ggtaat gaatttctg gattctgaa gcacacaat gat 432 AsnLeuPheIle GlyAsn GluPheLeu AspSerGlu AlaHisAsn Asp gaatatcat caattatca cgaaatgta aaaaaaget tttatacaa ago 480 GluTyrHis GlnLeuSer ArgAsnVal LysLysAla PheIleGln Ser cagacaatt aatgtctca gattctggg aagtataaa agtttgtct gtt 528 GlnThrIle AsnValSer AspSerGly LysTyrLys SerLeuSer Val tcagggaat agcgcgetg ggtattaca gatacaagt tatgetgtc tta 576 SerGlyAsn SerAlaLeu GlyIleThr AspThrSer TyrAlaVal Leu aattggtgg atgaattac aataaattt aatggttac agcaacaac gaa 624 AsnTrpTrp MetAsnTyr AsnLysPhe AsnGlyTyr SerAsnAsn Glu agaacaatc aatagtttg tactttaga catgattta gataagaga tat 672 ArgThrIle AsnSerLeu TyrPheArg HisAspLeu AspLysArg Tyr tattatcaa tttggacga atggatcgt acagatttg tcacaaagt att 720 TyrTyrGln PheGlyArg MetAspArg ThrAspLeu SerGlnSer Ile agogggaac tttaatttt aacttactt CCtttaCCC gatattgat ggt 768 SerGlyAsn PheAsnPhe AsnLeuLeu ProLeuPro AspIleAsp Gly ataaggaca ggaaccaca caatcttat ateaaaaat acagataag ttt 816 IleArgThr GlyThrThr GlnSerTyr IleLysAsn ThrAspLys Phe atcgcatcc cctgtaact gttatgtta actaatttt tccagagtg gaa 864 IleAlaSer ProValThr ValMetLeu ThrAsnPhe SerArgVal Glu gettttcgc aataatcaa ttattgggc gtatggtat ttagattct gga 912 AlaPheArg AsnAsnGln LeuLeuGly ValTrpTyr LeuAspSer Gly gtaaatgaa ttagataca getcgttta ccttatggt agttacgat ctt 960 ValAsnGlu LeuAspThr AlaArgLeu ProTyrGly SerTyrAsp Leu aaa tta aaa att ttt gaa aat act cag tta gtt cgt gaa gaa ata att 1008 Lys Leu Lys Ile Phe Glu Asn Thr Gln Leu Val Arg Glu Glu Ile Ile cct ttt aat aaa ggg aga agt tct att ggt gat atg caa tgg gac gtt 1056 Pro Phe Asn Lys Gly Arg Ser Ser Ile Gly Asp Met Gln Trp Asp Val ttc att cag gga ggg aat att att aat gac aag gat cgt tac ata gaa 1104 Phe Ile Gln GIy Gly Asn Ile Ile Asn Asp Lys Asp Arg Tyr Ile Glu aaa caa aat aat cat aag tca tca gtt aat get ggg cta cgt tta cca 1152 Lys Gln Asn Asn His Lys Ser Ser Val Asn Ala Gly Leu Arg Leu Pro att acg aaa aat atc tct gtt caa caa gga gca tct gtt ata gat aat 1200 Ile Thr Lys Asn Ile Ser Val Gln Gln Gly Ala Ser Val Ile Asp Asn aaa aat tat tat gaa ggg agt ctc aaa tgg aat tcc ggc att ctg tct 1248 Lys Asn Tyr Tyr Glu Gly Ser Leu Lys Trp Asn Ser Gly Ile Leu Ser ggc tca cta aat agt gag ttc agt ttt ctt tgg gga gat aat gca aaa 1296 Gly Ser Leu Asn Ser Glu Phe Ser Phe Leu Trp Gly Asp Asn Ala Lys ggt aat tat caa agt atc tcg tat acc gat gga ttt agt tta tca ttt 1344 Gly Asn Tyr Gln Ser Ile Ser Tyr Thr Asp Gly Phe Ser Leu Ser Phe tat cat aat gat aag cgg gtc gat aat tgt gga aga aat tac aat get 1392 Tyr His Asn Asp Lys Arg Val Asp Asn Cys Gly Arg Asn Tyr Asn Ala ggt tgg agt gga tgc tae gaa tca tat tcg gca tct tta agt att cct 1440 Gly Trp Ser Gly Cys Tyr Glu Ser Tyr Ser Ala Ser Leu Ser Ile Pro tta ttg gga tgg aca agt act ctg gga tat agt gac act tat agt gaa 1488 Leu Leu Gly Trp Thr Sex Thr Leu Gly Tyr Ser Asp Thr Tyr Ser Glu tca gtt tat aaa aac cat att ctt tct gaa tat ggt ttt tat aat caa 1536 Ser Val Tyr Lys Asn His Ile Leu Ser Glu Tyr Gly Phe Tyr Asn Gln aac ata tat aaa ggg aga acc caa aga tgg caa ctg act tcg tcc acc 1584 Asn Ile Tyr Lys Gly Arg Thr Gln Arg Trp Gln Leu Thr Ser Ser Thr tct tta aaa tgg atg gat tat aat ttt atg cca gca att gga ata tat 1632 Ser Leu Lys Trp Met Asp Tyr Asn Phe Met Pro Ala Ile Gly Ile Tyr aac agt gag caa aga caa ctg act gat aaa ggc gga tat ata tct gta 1680 Asn Ser Glu Gln Arg Gln Leu Thr Asp Lys Gly Gly Tyr Ile Ser Val act ctc acc cga gcc agc aga gaa aat tca tta aac gca ggg tat tct 1728 Thr Leu Thr Arg Ala Ser Arg Glu Asn Ser Leu Asn Ala Gly Tyr Ser tac aac tat tcc aga gga aag tat tct tct aac gaa tta ttt gtt gat 1776 Tyr Asn Tyr Ser Arg Gly Lys Tyr Ser Ser Asn Glu Leu Phe Val Asp gga tat atg aca tca aca aat aat ggt gac tat cat gag gta aga atg 1824 Gly Tyr Met Thr Ser Thr Asn Asn Gly Asp Tyr His Glu Val Arg Met cgt ttt aat aaa aat aga cat aat gca gaa ggt aga ctt tca ggt cgt 1872 Arg Phe Asn Lys Asn Arg His Asn Ala Glu Gly Arg Leu Ser Gly Arg ata aac aat cga ttt gga gat tta aat ggt tca ttc agc atg aat aaa 1920 Ile Asn Asn Arg Phe Gly Asp Leu Asn Gly Ser Phe Ser Met Asn Lys aac aga aac acc aac agt agc aat cat tct ctc act ggt ggt tat aat 1968 Asn Arg Asn Thr Asn Ser Ser Asn His Ser Leu Thr Gly Gly Tyr Asn tcc tca ttt get ctt aca agt gat gga ttt tac tgg gga gga agt gca 2016 Ser Ser Phe Ala Leu Thr Ser Asp Gly Phe Tyr Trp Gly Gly Ser Ala tct ggt ttg aca aaa eta get ggc ggt att atc aag gtt aaa tca aac 2064 Ser Gly Leu Thr Lys Leu Ala Gly Gly Ile Ile Lys Val Lys Ser Asn gat act aaa aaa aat ctg gta aaa gtg act ggg gca ttg tac ggt gat 2112 Asp Thr Lys Lys Asn Leu Val Lys Val Thr Gly Ala Leu Tyr Gly Asp tat tcg cta ggg agc aac gat aat get ttt att cct gta cca gca tta 2160 Tyr Ser Leu Gly Ser Asn Asp Asn Ala Phe Ile Pro Val Pro Ala Leu act cca gcc agt tta att att gaa gat aat aat tat ggt gac aag aat 2208 Thr Pro Ala Ser Leu Ile Ile Glu Asp Asn Asn Tyr Gly Asp Lys Asn att tct gta ctt gca cca acg aac aac gat atg ttt ata ttg ccg ggt 2256 Ile Ser Val Leu Ala Pro Thr Asn Asn Asp Met Phe Ile Leu Pro Gly aat gtt tat cct gtt gaa att gaa acc aaa gta agt gtt tct tat att 2304 Asn Val Tyr Pro Val Glu Ile Glu Thr Lys Val Ser Val Ser Tyr Ile ggt aga ggt ttt gac aaa aac ggc acg cca ctt tct ggc gca cat gtt 2352 Gly Arg Gly Phe Asp Lys Asn Gly Thr Pro Leu Sex Gly Ala His Val ttg aat gaa cca cat gtt atc ctg gat gag gac ggt gga ttt tcg ttt 2400 Leu Asn Glu Pro His Val Ile Leu Asp Glu Asp Gly Gly Phe Ser Phe gaa tat aca ggt aat gag aaa aca ctt ttt tta tta aag ggc aga act 2448 Glu Tyr Thr Gly Asn Glu Lys Thr Leu Phe Leu Leu Lys Gly Arg Thr att tat aca tgt caa ctg ggg aaa aat aaa gtt cac aaa ggc att gtt 2496 Ile Tyr Thr Cys Gln Leu Gly Lys Asn Lys Val His Lys Gly Ile Val ttc gtc gga gat gtt ata tgt gat gtt aat agc aca agt tcc tta cca 2544 Phe Val Gly Asp Val Ile Cys Asp Val Asn Ser Thr Ser Ser Leu Pro gat gaa ttt gta aag aac cca cgt gtg cag gat ttg ctg gca aag aat 2592 Asp Glu Phe Val Lys Asn Pro Arg Val Gln Asp Leu Leu Ala Lys Asn gat aaa gga taa 2604 Asp Lys Gly <2l0> 6 <211> 867 <212> PRT
<213> E. coli <400> 6 Met Thr Lys Lys Asn Thr Leu Tyr Ile Thr Ile Ile Ala Met Leu Thr Pro Tyr Ser Val Phe Ser Gly Asp Ile Pro Asn Ser Phe Arg Asp Leu Trp Gly Glu Gln Asp Glu Phe Tyr Glu Val Lys Leu Tyr Gly Gln Thr Leu Gly Ile His Arg Ile Lys Thr Thr Pro Thr His Ile Lys Phe Tyr Ser Pro Glu Ser Ile Leu Asp Lys Ile Asn Val Lys Lys Glu Lys Glu Lys Lys Leu Ser Val Leu Phe Thr Asn Ser Phe Ser Arg Asn Gly Asn Met Ser Cys Gln Gly Asn Ala Thr Ile Gln Tyr Asn Cys Asn Tyr Ile Lys Thr Lys Ser Val Asp Val Ile Val Asp Asp Val Asp Asn Val Val Asn Leu Phe Ile Gly Asn Glu Phe Leu Asp Ser Glu Ala His Asn Asp Glu Tyr His Gln Leu Ser Arg Asn Val Lys Lys Ala Phe Ile Gln Ser Gln Thr Ile Asn Val Ser Asp Ser Gly Lys Tyr Lys Ser Leu Ser Val Ser Gly Asn Ser Ala Leu Gly Ile Thr Asp Thr Sex Tyr Ala Val Leu Asn Trp Trp Met Asn Tyr Asn Lys Phe Asn Gly Tyr Ser Asn Asn Glu Arg Thr Ile Asn Sex Leu Tyr Phe Arg His Asp Leu Asp Lys Arg Tyr Tyr Tyr Gln Phe Gly Arg Met Asp Arg Thr Asp Leu Ser Gln Ser Ile Ser Gly Asn Phe Asn Phe Asn Leu Leu Pro Leu Pro Asp Ile Asp Gly Ile Arg Thr Gly Thr Thr Gln Ser Tyr Ile Lys Asn Thr Asp Lys Phe Ile Ala Ser Pro Val Thr Val Met Leu Thr Asn Phe Ser Arg Val Glu _g_ Ala Phe Arg Asn Asn Gln Leu Leu Gly Val Trp Tyr Leu Asp Ser Gly Val Asn Glu Leu Asp Thr Ala Arg Leu Pro Tyr Gly Ser Tyr Asp Leu Lys Leu Lys Ile Phe Glu Asn Thr Gln Leu Val Arg Glu Glu Ile Ile Pro Phe Asn Lys Gly Arg Ser Ser Ile Gly Asp Met Gln Trp Asp Val Phe Ile Gln Gly Gly Asn Ile Ile Asn Asp Lys Asp Arg Tyr Ile Glu Lys Gln Asn Asn His Lys Ser Ser Val Asn Ala Gly Leu Arg Leu Pro Ile Thr Lys Asn Ile Ser Val Gln Gln Gly Ala Ser Val Ile Asp Asn Lys Asn Tyr Tyr Glu Gly Ser Leu Lys Trp Asn Ser Gly Ile Leu Ser Gly Ser Leu Asn Ser Glu Phe Ser Phe Leu Trp Gly Asp Asn Ala Lys Gly Asn Tyr Gln Ser Ile Ser Tyr Thr Asp Gly Phe Ser Leu Ser Phe Tyr His Asn Asp Lys Arg Val Asp Asn Cys Gly Arg Asn Tyr Asn Ala Gly Trp Ser Gly Cys Tyr Glu Ser Tyr Ser Ala Ser Leu Ser Ile Pro Leu Leu Gly Trp Thr Ser Thr Leu Gly Tyr Ser Asp Thr Tyr Ser Glu Ser Val Tyr Lys Asn His Ile Leu Ser Glu Tyr Gly Phe Tyr Asn Gln Asn Ile Tyr Lys Gly Arg Thr Gln Arg Trp Gln Leu Thr Ser Ser Thr Ser Leu Lys Trp Met Asp Tyr Asn Phe Met Pro Ala Ile Gly Ile Tyr Asn Ser Glu Gln Arg Gln Leu Thr Asp Lys Gly Gly Tyr Ile Ser Val Thr Leu Thr Arg Ala Ser Arg Glu Asn Ser Leu Asn Ala Gly Tyr Ser Tyr Asn Tyr Ser Arg Gly Lys Tyr Ser Ser Asn Glu Leu Phe Val Asp Gly Tyr Met Thr Ser Thr Asn Asn Gly Asp Tyr His Glu Val Arg Met Arg Phe Asn Lys Asn Arg His Asn Ala Glu Gly Arg Leu Ser Gly Arg Ile Asn Asn Arg Phe Gly Asp Leu Asn Gly Ser Phe Ser Met Asn Lys Asn Arg Asn Thr Asn Ser Ser Asn His Ser Leu Thr Gly Gly Tyr Asn Ser Ser Phe Ala Leu Thr Ser Asp Gly Phe Tyr Trp Gly Gly Ser Ala Ser Gly Leu Thr Lys Leu Ala Gly Gly Ile Ile Lys Val Lys Ser Asn Asp Thr Lys Lys Asn Leu Val Lys Val Thr Gly Ala Leu Tyr Gly Asp Tyr Ser Leu Gly Ser Asn Asp Asn Ala Phe Ile Pro Val Pro Ala Leu Thr Pro Ala Ser Leu Ile Ile Glu Asp Asn Asn Tyr Gly Asp Lys Asn Ile Ser Val Leu Ala Pro Thr Asn Asn Asp Met Phe Ile Leu Pro Gly Asn Val Tyr Pro Val Glu Ile Glu Thr Lys Val Ser Val Ser Tyr Ile Gly Arg Gly Phe Asp Lys Asn Gly Thr Pro Leu Ser Gly Ala His Val Leu Asn Glu Pro His Val Ile Leu Asp Glu Asp Gly Gly Phe Ser Phe Glu Tyr Thr Gly Asn Glu Lys Thr Leu Phe Leu Leu Lys Gly Arg Thr Ile Tyr Thr Cys Gln Leu Gly Lys Asn Lys Val His Lys Gly Ile Val Phe Val Gly Asp Val Ile Cys Asp Val Asn Ser Thr Ser Ser Leu Pro Asp Glu Phe Val Lys Asn Pro Arg Val Gln Asp Leu Leu Ala Lys Asn Asp Lys Gly <21O> 7 <211> 330 <212> DNA
<213> E. coli <220>
<221> CDS
<222> (1)...(330) <400> 7 atc agt aag ttg gca gca tca cct gta ttt ctt gaa aga ggg gtg aat 48 Ile Ser Lys Leu Ala Ala Ser Pro Val Phe Leu Glu Arg Gly Val Asn ata tct gta aga ata cag aag caa att tta tca gaa aaa cca tat gtt 96 Ile Ser Val Arg Ile Gln Lys Gln Ile Leu Ser Glu Lys Pro Tyr Val gca ttc aga ttg aac gga gac ata cta aga cat tta aag gat gca ttg 144 Ala Phe Arg Leu Asn Gly Asp Ile Leu Arg His Leu Lys Asp Ala Leu atg ata ata tat ggt atg tca aaa ata gat acc aat gat tgt aga aat 192 Met Ile Ile Tyr Gly Met Ser Lys Ile Asp Thr Asn Asp Cys Arg Asn atg tca agg aaa ata atg aaa aca gaa gtg gat aaa acc tta ctg gat 240 Met Ser Arg Lys Ile Met Lys Thr Glu Val Asp Lys Thr Leu Leu Asp gta tta aaa aat ata aat agc tat gat gac tca get ttt ata tct aat 288 Val Leu Lys Asn Ile Asn Ser Tyr Asp Asp Ser Ala Phe Ile Ser Asn ttg ata tat tta att tca aag atc gag aat aat aaa aaa taa 330 Leu Ile Tyr Leu Ile Ser Lys Ile Glu Asn Asn Lys Lys <210> 8 <211> 109 <212> PRT
<213> E. coli <400> 8 Ile Ser Lys Leu Ala Ala Ser Pro Val Phe Leu Glu Arg Gly Val Asn Ile Ser Val Arg Ile Gln Lys Gln Ile Leu Ser Glu Lys Pro Tyr Val Ala Phe Arg Leu Asn Gly Asp Ile Leu Arg His Leu Lys Asp Ala Leu Met Ile Ile Tyr Gly Met Ser Lys Ile Asp Thr Asn Asp Cys Arg Asn Met Ser Arg Lys Ile Met Lys Thr Glu Val Asp Lys Thr Leu Leu Asp Val Leu Lys Asn Ile Asn Ser Tyr Asp Asp Ser Ala Phe Ile Ser Asn Leu Ile Tyr Leu Ile Ser Lys Ile Glu Asn Asn Lys Lys <210> 9 <211> 1086 <212> DNA
<213> E. coli <220>
<221> CDS
<222> (1)...(1086) <400> 9 atg aat aag att tta ttt att ttt aca ttg ttt ttc tct tca gta ctt 48 Met Asn Lys Ile Leu Phe Ile Phe Thr Leu Phe Phe Ser Ser Val Leu ttt aca ttt get gta tcg gca gat aaa att ccc gga gat gaa agc ata 96 Phe Thr Phe Ala Val Ser Ala Asp Lys Ile Pro Gly Asp Glu Ser Ile act aat att ttt ggc ccg cgt gac agg aac gaa tct tcc ccc aaa cat 144 Thr Asn Ile Phe Gly Pro Arg Asp Arg Asn Glu Ser Ser Pro Lys His aat ata tta aat aac cat att aca gca tac agt gaa agt cat act ctg 192 Asn Ile Leu Asn Asn His Ile Thr Ala Tyr Ser Glu Ser His Thr Leu tat gat agg atg act ttt tta tgt ttg tct tct cac aat aca ctt aat 240 Tyr Asp Arg Met Thr Phe Leu Cys Leu Ser Ser His Asn Thr Leu Asn gga gca tgt cca acc agt gag aat cct agc agt tca tcg gtc agc ggt 288 Gly Ala Cys Pro Thr Ser Glu Asn Pro Ser Ser Ser Ser Val Ser Gly gaa aca aat ata aca tta caa ttt acg gaa aaa aga agt tta ata aaa 336 Glu Thr Asn Ile Thr Leu Gln Phe Thr Glu Lys Arg Ser Leu Ile Lys aga gag cta caa att aaa ggc tat aaa caa tta ttg ttc aaa agt gtt 384 Arg Glu Leu Gln Ile Lys Gly Tyr Lys Gln Leu Leu Phe Lys Ser Val aac tgc cca tcc ggc cta aca ctt aac tca get cat ttt aac tgt aat 432 Asn Cys Pro Ser Gly Leu Thr Leu Asn Ser Ala His Phe Asn Cys Asn aaa aac gcg get tca ggt gca agt tta tat tta tat att cct get ggc 480 Lys Asn Ala Ala Ser Gly Ala Ser Leu Tyr Leu Tyr Ile Pro Ala Gly gaa cta aaa aat ttg cct ttt ggt ggt atc tgg gat get act ctg aag 528 Glu Leu Lys Asn Leu Pro Phe Gly Gly Ile Trp Asp Ala Thr Leu Lys tta aga gta aaa aga cga tat agt gag acc tat gga act tac act ata 576 Leu Arg Val Lys Arg Arg Tyr Ser Glu Thr Tyr Gly Thr Tyr Thr Ile aat atc act att aaa tta act gat aag gga aat att cag ata tgg tta 624 Asn Ile Thr Ile Lys Leu Thr Asp Lys GIy Asn Ile Gln IIe Trp Leu cct cag ttc aaa agt gac get cgc gtc gat ctt aac ttg cgt cca act 672 Pro Gln Phe Lys Ser Asp Ala Arg Val Asp Leu Asn Leu Arg Pro Thr ggt ggg ggc aca tat att gga aga aat tct gtt gat atg tgc ttt tat 720 Gly Gly Gly Thr Tyr Ile Gly Arg Asn Ser Val Asp Met Cys Phe Tyr gat gga tat agt act aac agc agc tct ttg gag ata aga ttt cag gat 768 Asp Gly Tyr Ser Thr Asn Ser Ser Ser Leu Glu Ile Arg Phe Gln Asp aac. aat cct aaa tct gat ggg aaa ttt tat cta agg aaa ata aat gat 816 Asn Asn Pro Lys Ser Asp Gly Lys Phe Tyr Leu Arg Lys Ile Asn Asp gac acc aaa gaa att gca tat act ttg tca ctt ctc ttg gcg ggt aaa 864 Asp Thr Lys Glu Ile Ala Tyr Thr Leu Ser Leu Leu Leu Ala Gly Lys agt tta act cca aca aat gga acg tca tta aat att get gac gca get 912 Ser Leu Thr Pro Thr Asn Gly Thr Ser Leu Asn Ile Ala Asp Ala Ala tct ctg gaa aca aac tgg aat aga att aca get gtc acc atg cca gaa 960 Ser Leu Glu Thr Asn Trp Asn Arg Ile Thr Ala Val Thr Met Pro Glu atc agt gtt ccg gtg ttg tgt tgg cct gga cgt ttg caa ttg gat gca 1008 Ile Ser Val Pro Val Leu Cys Trp Pro Gly Arg Leu Gln Leu Asp Ala aaa gtg gaa aat ccc gag get gga caa tat atg ggt aat att aat gtt 1056 Lys Val Glu Asn Pro Glu Ala Gly Gln Tyr Met Gly Asn Ile Asn Val act ttc aca cca agt agt caa aca ctc tag 1086 Thr Phe Thr Pro Ser Ser Gln Thr Leu <210> 10 <211> 361 <212> PRT

<213> E. coli <400> 10 Met Asn Lys Ile Leu Phe Ile Phe Thr Leu Phe Phe Ser Ser Val Leu Phe Thr Phe Ala Val Ser Ala Asp Lys Ile Pro Gly Asp Glu Ser Ile Thr Asn Ile Phe Gly Pro Arg Asp Arg Asn Glu Ser Ser Pro Lys His Asn Ile Leu Asn Asn His Ile Thr Ala Tyr Ser Glu Ser His Thr Leu Tyr Asp Arg Met Thr Phe Leu Cys Leu Ser Ser His Asn Thr Leu Asn Gly Ala Cys Pro Thr Ser Glu Asn Pro Ser Ser Ser Ser Val Ser Gly Glu Thr Asn Ile Thr Leu Gln Phe Thr Glu Lys Arg Ser Leu Ile Lys Arg Glu Leu Gln Ile Lys Gly Tyr Lys Gln Leu Leu Phe Lys Ser Val Asn Cys Pro Ser Gly Leu Thr Leu Asn Ser Ala His Phe Asn Cys Asn Lys Asn Ala Ala Ser Gly Ala Ser Leu Tyr Leu Tyr Ile Pro Ala Gly Glu Leu Lys Asn Leu Pro Phe Gly Gly Ile Trp Asp Ala Thr Leu Lys Leu Arg Val Lys Arg Arg Tyr Ser Glu Thr Tyr Gly Thr Tyr Thr Ile Asn Ile Thr Ile Lys Leu Thr Asp Lys Gly Asn Ile Gln Ile Trp Leu Pro Gln Phe Lys Ser Asp Ala Arg Val Asp Leu Asn Leu Arg Pro Thr Gly Gly Gly Thr Tyr Tle Gly Arg Asn Ser Val Asp Met Cys Phe Tyr Asp Gly Tyr Ser Thr Asn Ser Ser Ser Leu Glu Ile Arg Phe Gln Asp Asn Asn Pro Lys Ser Asp Gly Lys Phe Tyr Leu Arg Lys Ile Asn Asp Asp Thr Lys Glu Ile Ala Tyr Thr Leu Ser Leu Leu Leu Ala Gly Lys Ser Leu Thr Pro Thr Asn Gly Thr Ser Leu Asn Ile Ala Asp Ala Ala Ser Leu Glu Thr Asn Trp Asn Arg Ile Thr Ala Val Thr Met Pro Glu Ile Ser Val Pro Val Leu Cys Trp Pro Gly Arg Leu Gln Leu Asp Ala Lys Val Glu Asn Pro Glu Ala Gly Gln Tyr Met Gly Asn Ile Asn Val Thr Phe Thr Pro Ser Ser Gln Thr Leu <210> 11 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 11 gttgacccta caattgatat tttgcaagc 29 <210> 12 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 12 cgaccccact ataattcccg ccgttggtgc 30 <210> 13 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 13 gtgatatgtt ttgttcactt ggtaaagatc 30 <210> 14 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 14 ctcatggctc catttgttgc aaatgcaaac tttatg 36 <210> 15 <211> 60 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 15 gggatcgatc ccggggcggc cgcgggcccg gtaccaggcc ttctagaaag cttgacgtcg 60 <210> 16 <211> 61 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 16 cccgctagcg gcgcgectcg cgaggatccg tcgacgacgt caagctttct agaaggcctg 60 g 61 <210> 17 <211> 20 <212> DNA

<213> Artificial Sequence <220>
<223> PCR Primer <400> 17 aagcttgacg tcgtcgacgg 20 <210> 18 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 18 cccgctagcg gcgcgcctcg cg 22 <210> 19 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 19 CCgtgCtgaC tctacacccc cagatg 26 <210> 20 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 20 gcacatagag aggatagtaa cgccg 25 <210> 21 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 21 cggtcattgt tggecgtgcg ctgcc 25 <210> 22 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 22 cacgcagcgc gctgatgcct tccacgcg 28 <210> 23 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 23 catatttgat atctgagata tctgg 25 <210> 24 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 24 tgttgcattc agattgaacg gag 23 <210> 25 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 25 tattatgatt cataaataca ctgt 24 <210> 26 <211> 50 <212> DNA
<213> Artificial Sequence <220>
<223> PCR Primer <400> 26 tgtgggtatt tgtttggaca tcgcagcatt aaatataaaa atagcacagg 50 <210> 27 <211> 7239 <212> DNA
<213> E. coli <220>
<221> CDS
<222> (283)...(999) <221> CDS
<222> (1028)...(1531) <22l> CDS
<222> (1589)...(4192) -z~-<221> CDS
<222> (4196)...(5281) <221> CDS
<222> (5790)...(6119) <400> 27 atatatctta ttgaggaata tcggtgtcat tgagtaccgt taacttaaga taaagaatct 60 gtctggaaat cgcaggacca agaactctca gtacatctgt ggcgataata ttatcgcttc 120 ttatacattc caatatgcag ttcttgtggg tatttgtttg gacatcgcag cattaaatat 180 aaaaatagca caggaggcat aattatttgt ttttactgtc ttattttttt atcccatttt 240 tttttgtttt gatttatctt tgatgaaagc tcaggaggga atatg cat aaa tta ttt 297 His Lys Leu Phe tgt tta cta agt tta ctc ata act cca ttt gtt gca aat gca aac ttt 345 Cys Leu Leu Ser Leu Leu Ile Thr Pro Phe Val Ala Asn Ala Asn Phe atg ata tat cca ata tca aaa gat tta aag aat gga aat agc gag tta 393 Met Ile Tyr Pro Ile Ser Lys Asp Leu Lys Asn Gly Asn Ser Glu Leu att cgt gtt tat tca aaa tca aaa gag ata caa tat ata aaa ata tat 441 Ile Arg Val Tyr Ser Lys Ser Lys Glu Ile Gln Tyr Ile Lys Ile Tyr aca aaa aag att att aat ccc ggc aca act gaa gaa cat gaa gtt gat 489 Thr Lys Lys Ile Ile Asn Pro Gly Thr Thr Glu Glu His Glu Val Asp atg ccc aat tgg gat ggt ggg ttt gta gtt act cct caa aaa gtt att 537 Met Pro Asn Trp Asp Gly Gly Phe Val Val Thr Pro Gln Lys VaI Ile ctt cct gca gga ggg agt aaa tca ata cgt tta act caa ttt aga ata 585 Leu Pro Ala Gly Gly Ser Lys Ser Ile Arg Leu Thr Gln Phe Arg Ile cca aaa aaa gag gaa att tat aga gta tat ttt gag gcg gta aaa cca 633 Pro Lys Lys Glu Glu Tle Tyr Arg Val Tyr Phe Glu Ala Val Lys Pro gat agc aaa gaa aat gta att gat aat aaa aaa cta aca aca gag cta 681 Asp Ser Lys Glu Asn Val Ile Asp Asn Lys Lys Leu Thr Thr Glu Leu tct gtt aat ata att tat gcg get cta atc aga tct tta cca agt gaa 729 Ser Val Asn Ile Ile Tyr Ala Ala Leu Ile Arg Ser Leu Pro Ser Glu caa aac ata tca cta aac att tct aga aat gca aga aaa aat ata att 777 Gln Asn Ile Ser Leu Asn Ile Ser Arg Asn Ala Arg Lys Asn Ile Tle att tat aat aat ggg aat gtt aga gca ggt gtt aaa gat att tat ttt 825 Ile Tyr Asn Asn Gly Asn Val Arg Ala Gly Val Lys Asp Ile Tyr Phe tgt aag tca tct aat atc gat gat agc tgt gta aaa aaa acg cat aac 873 Cys Lys Ser Ser Asn Ile Asp Asp Ser Cys Val Lys Lys Thr His Asn aag aat ata tat cca gaa aag tca ttt gat acg ctg gtt aat aac aat 921 Lys Asn Ile Tyr Pro Glu Lys Ser Phe Asp Thr Leu Val Asn Asn Asn ttt tet tat gtt ttc att aaa tta aac cat gaa gac ata gaa aaa gag 969 Phe Ser Tyr val Phe Ile Lys Leu Asn His Glu Asp Ile Glu Lys Glu caa gga cta ata caa tta aaa gtt cct tga tta ctcatctata tactaaggag 1022 Gln Gly Leu Ile Gln Leu Lys Val Pro * Leu ttctaatgaa attaaaaaaa actattggtg caatg gca ctg acc aca atg ttt 1075 Ala Leu Thr Thr Met Phe gta get atg agt get tct gca gta gag aaa aat atc act gta aca get 1123 Val Ala Met Ser Ala Ser Ala Val Glu Lys Asn Ile Thr Val Thr Ala agt gtt gat cct aca att gat att ttg caa get gat ggt agt agt tta 1171 Ser Val Asp Pro Thr Ile Asp Ile Leu Gln Ala Asp Gly Ser Ser Leu cct act get gta gaa tta acc tat tca cct gcg gca agt cgt ttt gaa 1219 Pro Thr Ala Val Glu Leu Thr Tyr Ser Pro Ala Ala Ser Arg Phe Glu aat tat aaa atc gca act aaa gtt cat aca aat gtt ata aat aaa aat 1267 Asn Tyr Lys Ile Ala Thr Lys Val His Thr Asn Val Ile Asn Lys Asn gta cta gtt aag ctt gta aat gat cca aaa ctt aca aat gtt ttg gat 1315 Val Leu Val Lys Leu Val Asn Asp Pro Lys Leu Thr Asn Val Leu Asp tct aca aaa caa etc ccc att act gta tca tat gga gga aag act cta 1363 Ser Thr Lys Gln Leu Pro Ile Thr Val Ser Tyr Gly Gly Lys Thr Leu tca acc gca gat gtg act ttt gaa cct gca gaa tta aat ttt gga acg 1411 Ser Thr Ala Asp Val Thr Phe Glu Pro Ala Glu Leu Asn Phe Gly Thr tca ggt gta act ggt gta tCt tCt tCC Caa gat tta gtg att ggt gcg 1459 Ser Gly Val Thr Gly Val Ser Ser Ser Gln Asp Leu Val Ile Gly Ala act aca gca caa gca cca acg gcg gga aat tat agt ggg gtc gtt tct 1507 Thr Thr Ala Gln Ala Pro Thr Ala Gly Asn Tyr Ser Gly Val Val Ser atc tta atg ace tta gca tca taa ata ttttaatata taaaggagca 1554 Ile Leu Met Thr Leu Ala Ser * Ile ggcacactgc tccttattat atggcaataa taaaatg aca aaa aaa aat aca tta 1609 Thr Lys Lys Asn Thr Leu tat ata acg atc atc gca atg cta act cca tat tca gtt ttt tcc gga 1657 Tyr Ile Thr Ile Ile Ala Met Leu Thr Pro Tyr Ser Val Phe Ser Gly gat ata ccc aac tct ttc cgt gat tta tgg gga gaa caa gat gaa ttt 1705 Asp Ile Pro Asn Ser Phe Arg Asp Leu Trp Gly Glu Gln Asp Glu Phe tat gaa gta aaa cta tat gga caa act cta gga ata cat cga att aaa 1753 Tyr Glu Val Lys Leu Tyr Gly Gln Thr Leu Gly Ile His Arg Ile Lys aca acc cca aca cat att aag ttt tat tca ccc gaa agc att tta gat 1801 Thr Thr Pro Thr His Ile Lys Phe Tyr Ser Pro Glu Ser Ile Leu Asp aaa ata aat gta aaa aaa gaa aag gaa aag aaa ttg agt gtt ttg ttc 1849 Lys Ile Asn Val Lys Lys Glu Lys Glu Lys Lys Leu Ser Val Leu Phe act aat tct ttt tca aga aat ggc aat atg agt tgt cag ggg aat get 1897 Thr Asn Ser Phe Ser Arg Asn Gly Asn Met Ser Cys Gln Gly Asn Ala act ata cag tat aac tgc aat tac att aaa aca aaa tca gta gat gtc 1945 Thr Ile Gln Tyr Asn Cys Asn Tyr Ile Lys Thr Lys Ser Val Asp Val atc gtt gat gat gtt gat aat gtt gtt aac ctt ttt ata ggt aat gaa 1993 Ile Val Asp Asp Val Asp Asn Val Val Asn Leu Phe Ile Gly Asn Glu ttt ctg gat tct gaa gca cac aat gat gaa tat cat caa tta tca cga 2041 Phe Leu Asp Ser Glu Ala His Asn Asp Glu Tyr His Gln Leu Ser Arg aat gta aaa aaa get ttt ata caa agc cag aca att aat gtc tca gat 2089 Asn Val Lys Lys Ala Phe Ile Gln Ser Gln Thr Ile Asn Val Ser Asp tct ggg aag tat aaa agt ttg tct gtt tca ggg aat agc gcg ctg ggt 2137 Ser Gly Lys Tyr Lys Ser Leu Ser Val Ser Gly Asn Ser Ala Leu Gly att aca gat aca agt tat get gtc tta aat tgg tgg atg aat tac aat 2185 Ile Thr Asp Thr Ser Tyr Ala Val Leu Asn Trp Trp Met Asn Tyr Asn aaa ttt aat ggt tac agc aac aac gaa aga aca atc aat agt ttg tac 2233 Lys Phe Asn Gly Tyr Ser Asn Asn Glu Arg Thr Ile Asn Ser Leu Tyr ttt aga cat gat tta gat aag, aga tat tat tat caa ttt gga cga atg 2281 Phe Arg His Asp Leu Asp Lys Arg Tyr Tyr Tyr Gln Phe Gly Arg Met gat cgt aca gat ttg tea caa agt att agc ggg aac ttt aat ttt aac 2329 Asp Arg Thr Asp Leu Ser Gln Ser Ile Ser Gly Asn Phe Asn Phe Asn tta ett ect tta ccc gat att gat ggt ata agg aca gga ace aca caa 2377 Leu Leu Pro Leu Pro Asp Ile Asp Gly Ile Arg Thr Gly Thr Thr Gln tct tat atc aaa aat aca gat aag ttt atc gca tcc cct gta act gtt 2425 Ser Tyr Ile Lys Asn Thr Asp Lys Phe Ile Ala Ser Pro Val Thr Va1 atg tta act aat ttt tcc aga gtg gaa get ttt cgc aat aat caa tta 2473 Met Leu Thr Asn Phe Ser Arg Val Glu Ala Phe Arg Asn Asn Gln Leu ttg ggc gta tgg tat tta gat tct gga gta aat gaa tta gat aca get 2521 Leu Gly Val Trp Tyr Leu Asp Ser Gly Val Asn Glu Leu Asp Thr Ala cgt tta cct tat ggt agt tac gat ctt aaa tta aaa att ttt gaa aat 2569 Arg Leu Pro Tyr Gly Ser Tyr Asp Leu Lys Leu Lys Ile Phe Glu Asn act cag tta gtt cgt gaa gaa ata att cct ttt aat aaa ggg aga agt 2617 Thr Gln Leu Val Arg Glu Glu Ile Ile Pro Phe Asn Lys Gly Arg Ser tct att ggt gat atg caa tgg gac gtt ttc att cag gga ggg aat att 2665 Ser Ile Gly Asp Met Gln Trp Asp Val Phe Ile Gln Gly Gly Asn Ile att aat gac aag gat cgt tac ata gaa aaa caa aat aat cat aag tca 2713 Ile Asn Asp Lys Asp Arg Tyr Ile Glu Lys Gln Asn Asn His Lys Ser tca gtt aat get ggg eta cgt tta cca att acg aaa aat ate tct gtt 2761 Ser Val Asn Ala Gly Leu Arg Leu Pro Ile Thr Lys Asn Ile Ser Val caa caa gga gca tct gtt ata gat aat aaa aat tat tat gaa ggg agt 2809 Gln Gln Gly Ala Ser Val Ile Asp Asn Lys Asn Tyr Tyr Glu Gly Ser ctc aaa tgg aat tcc ggc att ctg tct ggc tca cta aat agt gag ttc 2857 Leu Lys Trp Asn Ser Gly Ile Leu Ser Gly Ser Leu Asn Ser Glu Phe agt ttt ctt tgg gga gat aat gca aaa ggt aat tat caa agt atc tcg 2905 Ser Phe Leu Trp Gly Asp Asn Ala Lys Gly Asn Tyr Gln Ser Ile Ser tat ace gat gga ttt agt tta tca ttt tat cat aat gat aag cgg gtc 2953 Tyr Thr Asp Gly Phe Ser Leu Ser Phe Tyr His Asn Asp Lys Arg Val gat aat tgt gga aga aat tac aat get ggt tgg agt gga tgc tac gaa 3001 Asp Asn Cys Gly Arg Asn Tyr Asn Ala Gly Trp Ser Gly Cys Tyr Glu tca tat tcg gca tct tta agt att cct tta ttg gga tgg aca agt act 3049 Ser Tyr Ser Ala Ser Leu Ser Ile Pro Leu Leu Gly Trp Thr Ser Thr ctg gga tat agt gac act tat agt gaa tca gtt tat aaa aac cat att 3097 Leu Gly Tyr Ser Asp Thr Tyr Ser Glu Ser Val Tyr Lys Asn His Ile ctt tct gaa tat ggt ttt tat aat caa aac ata tat aaa ggg aga acc 3145 Leu Ser Glu Tyr Gly Phe Tyr Asn Gln Asn Ile Tyr Lys Gly Arg Thr caa aga tgg caa ctg act tcg tcc aCC tct tta aaa tgg atg gat tat 3193 Gln Arg Trp Gln Leu Thr Ser Ser Thr Ser Leu Lys Trp Met Asp Tyr aat ttt atg cca gca att gga ata tat aac agt gag caa aga caa ctg 3241 Asn Phe Met Pro Ala Ile Gly Ile Tyr Asn Ser Glu Gln Arg Gln Leu act gat aaa ggc gga tat ata tct gta act ctc acc cga gcc agc aga 3289 Thr Asp Lys Gly Gly Tyr Ile Ser Val Thr Leu Thr Arg Ala Ser Arg gaa aat tca tta aac gca ggg tat tct tac aac tat tcc aga gga aag 3337 Glu Asn Ser Leu Asn Ala Gly Tyr Ser Tyr Asn Tyr Ser Arg Gly Lys tat tct tct aac gaa tta ttt gtt gat gga tat atg aca tca aca aat 3385 Tyr Ser Ser Asn Glu Leu Phe Val Asp Gly Tyr Met Thr Ser Thr Asn aat ggt gac tat cat gag gta aga atg cgt ttt aat aaa aat aga cat 3433 Asn Gly Asp Tyr His Glu Val Arg Met Arg Phe Asn Lys Asn Arg His aat gca gaa ggt aga ctt tca ggt cgt ata aac aat cga ttt gga gat 3481 Asn Ala Glu Gly Arg Leu Ser Gly Arg Ile Asn Asn Arg Phe Gly Asp tta aat ggt tca ttc agc atg aat aaa aac aga aac acc aac agt agc 3529 Leu Asn Gly Ser Phe Ser Met Asn Lys Asn Arg Asn Thr Asn Ser Ser , aat cat tct ctc act ggt ggt tat aat tcc tca ttt get ctt aca agt 3577 Asn His Ser Leu Thr Gly Gly Tyr Asn Ser Ser Phe Ala Leu Thr Ser gat gga ttt tac tgg gga gga agt gca tct ggt ttg aca aaa cta get 3625 Asp Gly Phe Tyr Trp Gly Gly Ser Ala Ser Gly Leu Thr Lys Leu Ala ggc ggt att atc aag gtt aaa tca aac gat act aaa aaa aat ctg gta 3673 Gly Gly Ile Ile Lys Val Lys Ser Asn Asp Thr Lys Lys Asn Leu Val aaa gtg act ggg gca ttg tac ggt gat tat tcg cta ggg agc aac gat 3721 Lys Val Thr Gly Ala Leu Tyr Gly Asp Tyr Ser Leu Gly Ser Asn Asp aat get ttt att cct gta cca gca tta act cca gcc agt tta att att 3769 Asn Ala Phe Ile Pro Val Pro Ala Leu Thr Pro Ala Ser Leu Ile Ile gaa gat aat aat tat ggt gac aag aat att tct gta ctt gca cca acg 3817 Glu Asp Asn Asn Tyr Gly Asp Lys Asn Ile Ser Val Leu Ala Pro Thr aac aac gat atg ttt ata ttg ccg ggt aat gtt tat cct gtt gaa att 3865 Asn Asn Asp Met Phe Ile Leu Pro Gly Asn Val Tyr Pro Val Glu Ile gaa acc aaa gta agt gtt tct tat att ggt aga ggt ttt gac aaa aac 3913 Glu Thr Lys Val Ser Val Ser Tyr Ile Gly Arg Gly Phe Asp Lys Asn ggc acg cca ctt tct ggc gca cat gtt ttg aat gaa cca cat gtt atc 3961 Gly Thr Pro Leu Ser Gly Ala His Val Leu Asn Glu Pro His Val Ile ctg gat gag gac ggt gga ttt tcg ttt gaa tat aca ggt aat gag aaa 4009 Leu Asp Glu Asp Gly Gly Phe Ser Phe Glu Tyr Thr Gly Asn Glu Lys aca ett ttt tta tta aag ggc aga act att tat aca tgt caa ctg ggg 4057 Thr Leu Phe Leu Leu Lys Gly Arg Thr Ile Tyr Thr Cys Gln Leu Gly aaa aat aaa gtt cac aaa ggc att gtt ttc gtc gga gat gtt ata tgt 4105 Lys Asn Lys Val His Lys Gly Ile Val Phe Val Gly Asp Val Ile Cys gat gtt aat agc aca agt tcc tta cca gat gaa ttt gta aag aac cca 4153 Asp Val Asn Ser Thr Ser Ser Leu Pro Asp Glu Phe Val Lys Asn Pro cgt gtg cag gat ttg ctg gca aag aat gat aaa gga taa acg 4195 Arg Val Gln Asp Leu Leu Ala Lys Asn Asp Lys Gly * Thr atg aat aag att tta ttt att ttt aca ttg ttt ttc tet tca gta ctt 4243 Asn Lys Ile Leu Phe Ile Phe Thr Leu Phe Phe Ser Ser Val Leu ttt aca ttt get gta tcg gca gat aaa att ccc gga gat gaa agc ata 4291 Phe Thr Phe Ala Val Ser Ala Asp Lys Ile Pro Gly Asp Glu Ser Ile act aat att ttt ggc ccg cgt gac agg aac gaa tct tcc ccc aaa cat 4339 Thr Asn Ile Phe Gly Pro Arg Asp Arg Asn Glu Ser Ser Pro Lys His aat ata tta aat aac cat att aca gca tac agt gaa agt cat act ctg 4387 Asn Ile Leu Asn Asn His Ile Thr Ala Tyr Ser Glu Ser His Thr Leu tat gat agg atg act ttt tta tgt ttg tct tct cac aat aca ctt aat 4435 Tyr Asp Arg Met Thr Phe Leu Cys Leu Ser Ser His Asn Thr Leu Asn gga gca tgt cca acc agt gag aat cct agc agt tca tcg gtc agc ggt 4483 Gly Ala Cys Pro Thr Ser Glu Asn Pro Ser Ser Ser Ser Val Ser Gly gaa aca aat ata aca tta caa ttt acg gaa aaa aga agt tta ata aaa 4531 Glu Thr Asn Tle Thr Leu Gln Phe Thr Glu Lys Arg Ser Leu Ile Lys aga gag cta caa att aaa ggc tat aaa caa tta ttg ttc aaa agt gtt 4579 Arg Glu Leu Gln Ile Lys Gly Tyr Lys Gln Leu Leu Phe Lys Ser Val aac tgc cca tcc ggc cta aca ctt aac tca get cat ttt aac tgt aat 4627 Asn Cys Pro Ser Gly Leu Thr Leu Asn Ser Ala His Phe Asn Cys Asn aaa aac gcg get tca ggt gca agt tta tat tta tat att cct get ggc 4675 Lys Asn Ala Ala Ser Gly AIa Ser Leu Tyr Leu Tyr IIe Pro Ala Gly gaa cta aaa aat ttg cct ttt ggt ggt atc tgg gat get act ctg aag 4723 Glu Leu Lys Asn Leu Pro Phe Gly Gly Ile Trp Asp Ala Thr Leu Lys tta aga gta aaa aga cga tat agt gag acc tat gga act tac act ata 4771 Leu Arg Val Lys Arg Arg Tyr Ser Glu Thr Tyr Gly Thr Tyr Thr Ile aat atc act att aaa tta act gat aag gga aat att cag ata tgg tta 4819 Asn Ile Thr Ile Lys Leu Thr Asp Lys Gly Asn Ile Gln Ile Trp Leu cct cag ttc aaa agt gac get cgc gtc gat ctt aac ttg cgt cca act 4867 Pro Gln Phe Lys Ser Asp Ala Arg Val Asp Leu Asn Leu Arg Pro Thr ggt ggg ggc aca tat att gga aga aat tct gtt gat atg tgc ttt tat 4915 Gly Gly Gly Thr Tyr Ile Gly Arg Asn Ser Val Asp Met Cys Phe Tyr gat gga tat agt act aac agc agc tct ttg gag ata aga ttt cag gat 4963 Asp Gly Tyr Ser Thr Asn Ser Ser Ser Leu Glu Ile Arg Phe Gln Asp aac aat cct aaa tct gat ggg aaa ttt tat cta agg aaa ata aat gat 5011 Asn Asn Pro Lys Ser Asp Gly Lys Phe Tyr Leu Arg Lys Tle Asn Asp gac acc aaa gaa att gca tat act ttg tca ctt ctc ttg gcg ggt aaa 5059 Asp Thr Lys Glu Ile Ala Tyr Thr Leu Ser Leu Leu Leu Ala Gly Lys agt tta act cca aca aat gga acg tca tta aat att get gac gca get 5107 Ser Leu Thr Pro Thr Asn Gly Thr Ser Leu Asn Ile Ala Asp Ala Ala tct ctg gaa aca aac tgg aat aga att aca get gtc acc atg cca gaa 5155 Ser Leu Glu Thr Asn Trp Asn Arg Ile Thr Ala Val Thr Met Pro Glu atc agt gtt ccg gtg ttg tgt tgg cct gga cgt ttg caa ttg gat gca 5203 Ile Ser Val Pro Val Leu Cys Trp Pro Gly Arg Leu Gln Leu Asp Ala aaa gtg gaa aat ccc gag get gga caa tat atg ggt aat att aat gtt 5251 Lys Val GIu Asn Pro Glu Ala Gly Gln Tyr Met Gly Asn Ile Asn Val act ttc aca cca agt agt caa aca ctc tag ata acaacaatat tggcgctatt 5304 Thr Phe Thr Pro Ser Ser Gln Thr Leu * Ile gcgcgccaat attgtaaagg ggtaatctgt ttgttaacaa aacattttgt ttcaattcag 5364 tttgcatcgc aataaatctc tactagagac atttttatac agcatagtat tatacaacac 5424 attcaaaata aggatatttt tatccacctt taaaataagt aaaaaactgc tttggtataa 5484 caccataatg tttattaaaa accctaataa aataagatgt actggaaatt ccaatcatat 5544 ttgatatctg agatatctgg tatgaatttt caagtagtaa taacgctgcc ttgctcattc 5604 tcaattgcat taagaactgg ttaaaattag tattctcaga ttctagtctt tttctgatgg 5664 ttatttctga ttcattaaac atatctgcaa tgatagccag tgtccatttt ctggatagat 5724 ctttttcgat aatatttctg accttgtcag aaaaaaattc acagatgata tataaattga 5784 ttctatta ttt ttt att att ctc gat ctt tga aat taa ata tat caa att 5834 Phe Phe Ile Ile Leu Asp Leu * Asn * Ile Tyr Gln Ile aga tat aaa agc tga gtc atc ata get att tat att ttt taa tac atc 5882 Arg Tyr Lys Ser * Val Ile Ile Ala Tle Tyr Ile Phe * Tyr Ile cag taa ggt ttt atc cac ttc tgt ttt cat tat ttt cct tga cat att 5930 Gln * Gly Phe Ile His Phe Cys Phe His Tyr Phe Pro * His Ile tct aca atc att ggt atc tat ttt tga cat acc ata tat tat cat caa 5978 Ser Thr Ile Ile Gly Ile Tyr Phe * His Thr Ile Tyr Tyr His Gln tgc atc ctt taa atg tct tag tat gtc tcc gtt caa tct gaa tgc aac 6026 Cys Ile Leu * Met Ser * Tyr Val Ser Val Gln Ser Glu Cys Asn ata tgg ttt ttc tga taa aat ttg ctt ctg tat tct tac aga tat att 6074 Ile Trp Phe Phe * * Asn Leu Leu Leu Tyr Ser Tyr Arg Tyr Ile cac ccc tct ttc aag aaa tac agg t gatgctgcca acttactgat 6119 His Pro Ser Phe Lys Lys Tyr Arg ttagtgtatg atggtgtttt tgaggtgctc cagtggcttc tgtttctatc agctgtccct 6179 cctgttcagc tactgacggg gtggtgcgta acggcaaaag cactgccgga catcagcgct 6239 atctctgctc tcactgccgt aaaacatggc aactgcagtt cacttacact gcttctcaac 6299 ccggtacgca ccagaaaatc attgatatgg ccatgaatgg cgttggatgc cgggcaacag 6359 cccgcattat gggcgttggc ctcaacacga ttttacgtca cttaaaaaac tcaggccgca 6419 gtcggtaacc tcgcgcatac agccgggcag tgacgtcatc gtctgcgcgg aaatggacga 6479 acagtggggc tatgtcgggg ctaaatcgcg ccagcgctgg ctgttttacg cgtatgacag 6539 gctccggaag acggttgttg cgcacgtatt cggtgaacgc actatggcga cgctggggcg 6599 tcttatgagc ctgctgtcac cctttgacgt ggtgatatgg atgacggatg gctggccgct 6659 gtatgaatcc cgcctgaagg gaaagctgca cgtaatcagc aagcgatata cgcagcgaat 6719 tgagcggcat aacctgaatc tgaggcagca cctggcacgg ctgggacgga agtcgctgtc 6779 gttctcaaaa tcggtggagc tgcatgacaa agtcatcggg cattatctga acataaaaca 6839 ctatcaataa gttagagtca ttacctggtt cacgtattat tatccgtgac tctttcctgg 6899 taactcccgc ataataacct cacttttcca gtattccaga agatgatgtt ttttcctcga 6959 taataaaaat gtgccaatat ggaaataaga aatcggattt tttatcagca tacgcaaatt 7019 ttcagataac aatgaataca gatgtatttt atatacacag ataaaaccgc gcaacagaca 7079 taaatatgac agtagcatga aaaagcagag agagacaggg tgatacagaa aagtaactat 7139 ttttttagct atagtattat tggttttacc tattttcgtg attgtgtttc tgtatatttg 7199 acaatgagtc tctcagaatc ggtttctcga agtgacgagc 7239 <210> 28 <211> 361 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 28 Thr Met Asn Lys Ile Leu Phe Ile Phe Thr Leu Phe Phe Ser Ser Val Leu Phe Thr Phe Ala Val Ser Ala Asp Lys Ile Pro Gly Asp Glu Ser Ile Thr Asn Ile Phe Gly Pro Arg Asp Arg Asn Glu Ser Ser Pro Lys His Asn Ile Leu Asn Asn His Ile Thr Ala Tyr Ser Glu Ser His Thr Leu Tyr Asp Arg Met Thr Phe Leu Cys Leu Ser Ser His Asn Thr Leu Asn Gly Ala Cys Pro Thr Ser Glu Asn Pro Ser Ser Ser Ser Val Ser Gly Glu Thr Asn Ile Thr Leu Gln Phe Thr Glu Lys Arg Ser Leu Ile Lys Arg Glu Leu Gln Ile Lys Gly Tyr Lys Gln Leu Leu Phe Lys Ser Val Asn Cys Pro Ser Gly Leu Thr Leu Asn Ser Ala His Phe Asn Cys Asn Lys Asn Ala Ala Ser Gly Ala Ser Leu Tyr Leu Tyr Ile Pro Ala Gly Glu Leu Lys Asn Leu Pro Phe Gly Gly Ile Trp Asp Ala Thr Leu Lys Leu Arg Val Lys Arg Arg Tyr Ser Glu Thr Tyr Gly Thr Tyr Thr Ile Asn Tle Thr Ile Lys Leu Thr Asp Lys Gly Asn Ile Gln Ile Trp Leu Pro Gln Phe Lys Ser Asp Ala Arg Val Asp Leu Asn Leu Arg Pro Thr Gly Gly Gly Thr Tyr Ile Gly Arg Asn Ser Val Asp Met Cys Phe Tyr Asp Gly Tyr Ser Thr Asn Ser Ser Ser Leu Glu Ile Arg Phe Gln Asp Asn Asn Pro Lys Ser Asp Gly Lys Phe Tyr Leu Arg Lys Ile Asn Asp Asp Thr Lys Glu Ile Ala Tyr Thr Leu Ser Leu Leu Leu Ala Gly Ser Leu Thr Pro Thr Asn Gly Thr Ser Leu Asn Ile Ala Asp Ala Ala Ser Leu Phe Thr Asn Trp Asn Arg Ile Thr Ala Val Thr Met Pro Glu Ile Ser Val Pro Val Leu Cys Trp Pro Gly Arg Leu Gln Leu Asp Ala Lys Val Glu Asn Pro Glu Ala Gly Gln Tyr Met Gly Asn Ile Asn Val Thr Phe Thr Pro Ser Ser Gln Thr Leu <210> 29 <211> 359 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 29 Met Asn Lys Ile Leu Phe Ile Phe Thr Leu Phe Phe Ser Ser Gly Phe Phe Thr Phe Ala Val Ser Ala Asp Lys Asn Pro Gly Ser Glu Asn Met Thr Asn Thr Ile Gly Pro His Asp Arg Gly Gly Ser Ser Pro Ile Tyr Asn Ile Leu Asn Ser Tyr Leu Thr Ala Tyr Asn Gly Ser His His Leu Tyr Asp Arg Met Ser Phe Leu Cys Leu Ser Ser Gln Asn Thr Leu Asn &5 70 75 80 Gly Ala Cys Pro Ser Ser Asp AIa Pro Gly Thr AIa Thr Ile Asp Gly Glu Thr Asn IIe Thr Leu Gln Phe Thr Glu Lys Arg Ser Leu Ile Lys Arg Glu Leu Gln Ile Lys Gly Tyr Lys Gln Phe Leu Phe Lys Asn Ala Asn Cys Pro Ser Lys Leu Ala Leu Asn Ser Ser His Phe Gln Cys Asn Arg Glu Gln Ala Ser Gly Ala Thr Leu Ser Leu Tyr Ile Pro Ala Gly Glu Leu Asn Lys Leu Pro Phe Gly Gly Val Trp Asn Ala Val Leu Lys Leu Asn Val Lys Arg Arg Tyr Thr Thr Tyr Gly Thr Tyr Thr Ile Asn Ile Thr Val Asn Leu Thr Asp Lys Gly Asn Ile Gln Ile Trp Leu Pro Gln Phe Lys Ser Asn Ala Arg Val Asp Leu Asn Leu Arg Pro Thr Gly Gly Gly Thr Tyr Ile Gly Arg Asn Ser Val Asp Met Cys Phe Tyr Asp Gly Tyr Ser Thr Met Ser Ser Ser Leu Glu Ile Arg Phe Gln Asp Asp Asn Ser Lys Ser Asp Gly Lys Phe Tyr Leu Lys Lys Ile Asn Asp Asp Ser Lys Glu Leu Val Tyr Thr Leu Ser Leu Leu Leu Ala Gly Lys Asn Leu Thr Pro Thr Asn Gly Gln Ala Leu Asn Ile Asn Thr Ala Ser Leu Glu Thr Asn Trp Asn Arg Tle Thr Ala Val Thr Met Pro Glu Ile Ser Val Pro Val Leu Cys Trp Pro Gly Arg Leu Gln Leu Asp Ala Lys Val Lys Asn Pro Glu Ala Gly Gln Tyr Met Gly Asn Ile Lys Ile Thr Phe Thr Pro Ser Ser Gln Thr Leu <210> 30 <211> 364 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 30 Met Lys Lys Val Ile Phe Val Leu Ser Met Phe Leu Cys Ser Gln Val Tyr Gly Gln Sex Trp His Thr Asn Val Glu Ala Gly Ser Ile Asn Lys Thr Phe Ser Ile Gly Pro Ile Asp Arg Ser Ala Ala Ala Ser Tyr Pro Ala His Tyr Ile Phe His Glu Asx Val Ala Gly Tyr Asn Lys Asp His Ser Leu Phe Asp Arg Met Thr Phe Leu Cys Met Ser Ser Thr Asp Ala Ser Lys Gly Ala Cys Pro Thr Gly Glu Asn Ser Lys Ser Sex Gln Gly Glu Thr Asn Ile Lys Leu Ile Phe Thr Glu Lys Lys Ser Leu Ala Arg Lys Thr Leu Asn Leu Lys Gly Tyr Lys Arg Phe Leu Tyr Glu Ser Asp Arg Cys Ile His Tyr Val Asp Lys Met Asn Leu Asn Ser His Thr Val Lys Cys Val Gly Ser Phe Thr Arg Gly Val Asp Phe Thr Leu Tyr Ile Pro Gln Gly Glu Ile Asp Gly Leu Leu Thr Gly Gly Ile Trp Lys Ala Thr Leu Glu Leu Arg Val Lys Arg His Tyr Asp Tyr Asn His Gly Thr Tyr Lys Val Asn Ile Thr Val Asp Leu Thr Asp Lys Gly Asn Ile Gln Val Trp Thr Pro Lys Phe His Ser Asp Pro Arg Ile Asp Leu Asn Leu Arg Pro Glu Gly Asn Gly Lys Tyr Ser Gly Ser Asn Val Leu Glu Met Cys Leu Tyr Asp Gly Tyr Ser Thr His Ser Gln Ser Ile Glu Met Arg Phe Gln Asp Asp Ser Gln Thr Gly Asn Asn Glu Tyr Asn Leu Ile Lys Thr Gly Glu Pro Leu Lys Lys Leu Pro Tyr Lys Leu Ser Leu Leu Leu Gly Gly Arg Glu Phe Tyr Pro Asn Asn Gly Lys Ala Phe Thr Ile Asn Asp Thr Ser Ser Leu Phe Ile Asn Trp Asn Arg Ile Lys Ser Val Ser Leu Pro Gln Ile Ser Ile Pro Val Leu Cys Trp Pro Ala Asn Leu Thr Phe Met Ser Glu Leu Asn Asn Pro Glu Ala Gly Glu Tyr Ser Gly Ile Leu Asn Val Thr Phe Thr Pro Ser Ser Ser Ser Leu <210> 31 <211> 362 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 31 Met Lys Lys Ile Phe Ile Phe Leu Ser Ile Ile Phe Ser Ala Val Val Ser Ala Gly Arg Tyr Pro Glu Thr Thr Val Gly Asn Leu Thr Lys Ser Phe Gln Ala Pro Arg Leu Asp Arg Ser Val Gln Ser Pro Ile Tyr Asn Ile Phe Thr Asn His Val Ala Gly Tyr Ser Leu Ser His Ser Leu Tyr Asp Arg Ile Val Phe Leu Cys Thr Ser Ser Ser Asn Pro Val Asn Gly Ala Cys Pro Thr Ile Gly Thr Sex Gly Val Gln Tyr Gly Thr Thr Thr Ile Thr Leu Gln Phe Thr Glu Lys Arg Ser Leu Ile Lys Arg Asn Ile Asn Ile Ala Gly Asn Lys Lys Pro Ile Trp Glu Asn Gln Ser Cys Asp Phe Ser Asn Ile Met Val Leu Asn Ser Lys Ser Trp Ser Cys Gly Ala His Gly Asn Ala Asn Gly Thr Ile Leu Asn Leu Tyr Ile Pro Ala Gly Glu Ile Asn Lys Leu Pro Phe Gly Gly Ile Trp Glu Ala Thr Leu Ile Leu Arg Leu Ser Arg Tyr GIy Glu Val Ser Ser Thr His Tyr GIy Asn Tyr Thr Val Asn Ile Thr Val Asp Leu Thr Asp Lys Gly Asn Ile Gln Val Trp Leu Pro Gly Phe His Ser Asn Pro Arg Val Asp Leu Asn Leu Arg Pro Ile Gly Asn Tyr Lys Tyr Ser Gly Ser Asn Ser Leu Asp Met Cys Phe Tyr Asp Gly Tyr Sex Thr Asn Ser Asp Ser Met Val Ile Lys Phe Gln Asp Asp Asn Pro Thr Asn Ser Ser Glu Tyr Asn Leu Tyr Lys Ile GIy Gly Thr Glu Lys Leu Pro Tyr Ala Val Ser Leu Ile Gly Glu Lys Ile Phe Tyr Pro Val Asn Gly Gln Ser Phe Thr Ile Asn Asp Ser Ser Val Leu Glu Thr Asn Trp Asn Arg Val Thr Ala Val Ala Met Pro Glu Val Asn Val Pro Val Leu Cys Trp Pro Ala Arg Leu Leu Leu Asn Ala Asp Val Asn Ala Pro Asp Ala Gly Gln Tyr Ser Gly Gln Ile Tyr Ile Thr Phe Thr Pro Ser Val Glu Asn Leu <210> 32 <211> 353 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 32 Met Ser Asn Ile Cys Lys Trp Thr Ser Met Thr Ala His Trp Ser Ala Ile Ile Asn Phe Ile Arg Lys Tyr Val Tyr Pro Ala Arg Ile Ile Ala Ile Leu Ala Gly Ala Thr Leu Pro Gln Val Ala Asp Ala Ile Thr Val Asp Leu Asn Tyr Asp Lys Asn Asn Val Ala Val Ile Thr Pro Val Trp Ser Gln Glu Trp Ser Val Ala Asn Val Leu Gly Gly Trp Val Cys Arg Ser Asn Arg Asn Glu Asn Glu Gly Cys Glu Glu Thr His Leu Val Trp Trp Tyr Ala Phe Gly Ala Tyr Ser Ile Arg Leu Arg Phe Arg Glu Gln Ile Ser His Ala Glu Ile Thr Leu Ile Leu Leu Gly Ser Val Arg Asp Ala Cys Thr Gly Val Ile Asn Met Asn Ala Ala Ala Cys Gln Trp Gly Arg Ser Leu Lys Leu Arg Ile Pro Ser Glu Glu Leu Ala Lys Ile Pro Thr Ser Gly Thr Trp Lys Ala Thr Leu Val Leu Asp Tyr Leu Gln Trp Gly Gly Asp Asp Pro Leu Gly Thr Ser Thr Thr Asp Ile Thr Leu Asn Val Thr Asp His Phe Ala Glu Asn Ala Ala Ile Tyr Phe Pro Gln Phe Gly Thr Ala Thr Pro Arg Val Asp Leu Asn Leu His Arg Met Asn Ala Ser Gln Met Ser Gly Arg Ala Asn Leu Asp Met Cys Leu Tyr Asp Gly Gly Val Lys Ala Arg Ser Leu Gln Met Met Glu Gly Ser Asn Lys Ser Gly Thr Gly Phe Gln Val Ile Lys Ser Asp Ser Ala Asp Thr Ile Asp Tyr Ala Val Ser Met Asn Tyr Gly Gly Arg Ser Ile Pro Val Thr Arg Gly Val Glu Phe Ser Leu Asp Asn Val Asp Lys Ala Ala Thr Arg Pro Val Val Leu Pro Gly Gln Arg Gln Ala Val Arg Cys Val Pro Val Pro Leu Thr Leu Thr Thr Gln Pro Phe Asn Tle Arg Glu Lys Arg Ser Gly Glu Tyr Gln Gly Thr Leu Thr Va1 Thr Met Leu Met Gly Thr Gln Thr Pro <210> 33 <211> 165 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 33 Met Lys Leu Lys Lys Thr Ile Gly Ala Met Ala Leu Thr Thr Met Phe Val Ala Met Ser Ala Ser Ala Val Glu Lys Asn Ile Thr Val Thr Ala Ser Val Asp Pro Thr Tle Asp Ile Leu Gln Ala Asp Gly Ser Ser Leu Pro Thr Ala Val Glu Leu Thr Tyr Ser Pro Ala Ala Ser Arg Phe Glu Asn Tyr Lys Ile Ala Thr Lys Val His Thr Asn Val Tle Asn Lys Asn Val Leu Val Lys Leu Val Asn Asp Pro Lys Leu Thr Asn Val Leu Asp Ser Thr Lys Gln Leu Pro Ile Thr val Ser Tyr Gly Gly Lys Leu Ser Thr Ala Asp Val Thr Phe Glu Pro Ala Glu Leu Asn Phe Gly Thr Ser Gly Val Thr Gly Val Ser Ser Ser Gln Asp Leu Val Ile Gly Ala Thr Thr Ala Gln Ala Pro Ser Ala Asn Tyr Ser Gly Val Val Ser Ile Leu Met Thr Leu Ala Ser <210> 34 <211> 168 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 34 Met Lys Phe Lys Lys Thr Ile Gly Ala Met Ala Leu Thr Thr Met Phe Val Ala Val Ser Ala Ser Ala Val Glu Lys Asn Ile Thr Val Thr Ala Ser Val Asp Pro Ala Ile Asp Leu Leu Gln Ala Asp Gly Asn Ala Leu Pro Ser Val Lys Leu Ala Tyr Ser Pro Ala Ser Lys Ile Phe Glu Ser Tyr Arg Val Met Thr Gln Val His Thr Asn Asp Ala Thr Lys Lys Val Ile Val Lys Leu Ala Asp Thr Pro Gln Leu Thr Asp Val Leu Asn Ser Thr Val Gln Met Pro Ile Ser Val Ser Trp Gly Gly Val Leu Ser Thr Thr Ala Lys Glu Phe Glu Ala Ala Ala Leu Gly Tyr Ser Ala Ser Gly Val Asn Gly Val Ser Ser Ser Gln Glu Leu Val Ile Ser Ala Ala Pro Lys Thr Ala Gly Thr Ala Pro Thr Ala Gly Asn Tyr Ser Gly Val Val 145 150 155 l60 Ser Leu Val Met Thr Leu Gly Ser <210> 35 <211> 170 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 35 Met Lys Leu Lys Lys Thr Ile Gly Ala Met Ala Leu Ala Thr Leu Phe Ala Thr Met Gly Ala Ser Ala Val Glu Lys Thr Ile Ser Val Thr Ala Ser Val Asp Pro Thr Val Asp Leu Leu Gln Ser Asp Gly Ser Ala Leu Pro Asn Val Ala Leu Thr Tyr Ser Pro Ala Val Asn Asn Phe Glu Ala His Thr Ile Asn Thr Val Val His Thr Asn Asp Ser Asp Lys Gly Val Val Val Lys Leu Ser Ala Asp Pro Val Leu Ser Asn Val Leu Asn Pro Thr Leu Gln Ile Pro Val Ser Val Asn Phe Ala Gly Lys Pro Leu Ser Thr Thr Gly Ile Thr Ile Asp Ser Asn Asp Leu Asn Phe Ala Ser Ser Gly Val Asn Tyr Val Ser Ser Thr Gln Lys Leu Ser Ile His Ala Asp Ala Thr Arg Val Thr Gly Gly Ala Leu Thr Ala Gly Gln Tyr Gln Gly Leu Val Ser Ile Ile Leu Thr Lys Ser Thr <210> 36 <211> 170 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein. Homology Sequence <400> 36 Met Lys Leu Asn Lys Ile Ile Gly Ala Leu Val Leu Ser Ser Thr Phe Val Ser Met Gly Ala Ser Ala Ala Glu Lys Asn Ile Thr Val Thr Ala Ser Val Asp Pro Thr Ile Asp Leu Met Gln Ser Asp Gly Thr Ala Leu Pro Ser Ala Val Asn Ile Ala Tyr Leu Pro Gly Glu Lys Arg Phe Glu Ser Ala Arg Ile Asn Thr Gln Val His Thr Asn Asn Lys Thr Lys Gly Ile Gln Ile Lys Leu Thr Asn Asp Asn Val Val Met Thr Asn Leu Ser Asp Pro Ser Lys Thr Tle Pro Leu Glu Val Ser Phe Ala Gly Thr Lys Leu Ser Thr Ala Ala Thr Ser Ile Thr Ala Asp Gln Leu Asn Phe Gly Ala Ala Gly Val Glu Thr Val Ser Ala Thr Lys Glu Leu Val Ile Asn Ala Gly Ser Thr Gln Gln Thr Asn Ile Val Ala Gly Asn Tyr Gln Gly Leu Val Ser Ile Val Leu Thr Gln Glu Pro <210> 37 <211> 168 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 37 Met Lys Leu Lys Tyr Thr Ile Gly Ala Met Ala Leu Ser Thr Ile Phe 1 5 10 l5 Val Ala Val Ser Ala Ser Ala Val Glu Lys Asn Ile Thr Val Thr Ala Ser Val Asp Pro Thr Ile Asp Ile Leu Gln Ala Asn Gly Ser Ala Leu Pro Thr Ala Val Asp Leu Thr Tyr Leu Pro Gly Ala Lys Thr Phe Glu Asn Tyr Ser Val Leu Thr Gln Ile Tyr Thr Asn Asp Pro Ser Lys Gly Leu Asp Val Arg Leu Val Asp Thr Pro Lys Leu Thr Asn Ile Leu Gln Pro Thr Ser Thr Ile Pro Leu Thr Val Ser Trp Ala Gly Arg Thr Leu Ser Thr Ser Ala Gln Lys IIe Ala Val Gly Asp Leu Gly Phe Gly Ser Thr Gly Thr Ala Gly Val Ser Asn Ser Lys Glu Leu Val Ile Gly Ala Thr Thr Ser Gly Lys Pro Ser Ala Gly Lys Tyr Gln Gly Val Val Ser Ile Val Met Thr Gln Ser Thr Asn <210> 38 <211> 142 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 38 Val Asp Pro Thr Ile Asp Ile Leu Gln Ala Asn Gly Ser Ala Leu Pro Thr Ala Val Asp Leu Thr Tyr Leu Pro Gly Ala Lys Thr Phe Glu Asn Tyr Ser Val Leu Thr Gln Ile Tyr Thr Asn Asp Pro Ser Lys Gly Leu Asp Val Arg Leu Val Asp Thr Pro Lys Leu Thr Asn Ile Leu Gln Pro Thr Ser Thr Ile Pro Leu Thr Val Ser Trp Ala Gly Lys Thr Leu Ser Thr Ser Ala Gln Lys Ile Ala Val Gly Asp Leu Gly Phe Gly Ser Thr Gly Thr Ala Gly Val Ser Asn Ser Lys Glu Leu Val Ile Gly Ala Thr Thr Ser Gly Thr Ala Pro Ser Ala Gly Lys Tyr Gln Gly Val Val Ser Ile Val Met Thr Gln Ser Thr Asp Thr Ala Ala Pro Val Pro <210> 39 <211> 133 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 39 Val Asp Pro Lys Leu Asp Leu Leu Gln Ala Asp Gly Thr Ser Leu Pro Asp Ser Ile Ala Leu Thr Tyr Ser Ser Ala Ser Asn Asn Phe Glu Val Tyr Ser Leu Asn Thr Ala Ile His Thr Asn Asp Lys Thr Lys Ala Val Val Val Lys Leu Ser Ala Pro Ala Val Leu Ser Asn Ile Met Lys Pro Ser Ser Gln Ile Pro Met Lys Val Thr Leu Gly Gly Lys Thr Leu Ser Thr Ala Asp Ala Glu Phe Ala Ala Asp Thr Leu Asn Phe Gly Ala Ser Gly Val Glu Asn Val Ser Ser Val Gln Gln Leu Thr Ile His Ala Glu Ala Ala Pro Pro Glu Ala Gly Asn Tyr Gln Gly Val Ile Ser Leu Ile Met Thr Gln Lys Thr <210> 40 <211> 134 <212> PRT
<213> Artificial Sequence <220>
<223> ETEC Protein Homology Sequence <400> 40 Val Asp Pro Lys Leu Asp Leu Leu Gln Ala Asp Gly Thr Ser Leu Pro Asp Ser Ile Ala Leu Thr Tyr Ser Ser Ala Ser Asn Asn Phe Glu Val Tyr Ser Leu Asn Thr Ala Ile His Thr Asn Asp Lys Ser Lys Gly Val Val Val Lys Leu Ser Ala Ser Pro Val Leu Ser Asn Ile Met Pro Asn Ser Gln Ile Pro Met Lys Val Thr Leu Gly Gly Glu Thr Leu Asn Thr Thr Asp Thr Glu Phe Thr Val Asp Thr Leu Asn Phe Gly Thr Ser Gly Val Glu Asn Val Ser Ser Thr Gln Gln Leu Thr Ile His Ala Asp Thr Gln Gly Thr Ala Pro Glu Ala Gly Asn Tyr Gln Gly Ile Ile Ser Leu Ile Met Thr Gln Lys Thr

Claims (81)

WHAT IS CLAIMED IS:

1. An immunogenic composition comprising:
a recombinant product of a csa operon and a carrier.

2. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is CsaA (SEQ ID NO.:2).

3. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is at least 95% homologous to CsaA (SEQ ID NO:2).

4. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is CsaB (SEQ ID NO.:4).

5. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is at least 95% homologous to CsaB (SEQ ID NO.:4).

6. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is CsaC (SEQ ID NO.:6).

7. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is at least 95% homologous to CsaC (SEQ ID NO.:6).

8. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is CsaD (SEQ ID NO.:8).

9. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is at least 95% homologous to CsaD (SEQ ID NO.:8).

10. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is CsaE (SEQ ID NO.:10).

11. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is at least 95% homologous to CsaE (SEQ ID NO.:10).

12. The immunogenic composition of claim 1, wherein the carrier is a composition comprising components suitable for parenteral administration.

13. The immunogenic composition of claim 12, wherein the carrier is a composition comprising components suitable for intranasal administration.

14. The immunogenic composition of claim 12, wherein the carrier is a composition comprising components suitable for intramuscular administration.

15. The immunogenic composition of claim 1, wherein the carrier is a composition comprising components suitable for enteric administration.

16. The immunogenic composition of claim 1, wherein the recombinant product of the csa operon is an expression vector comprising the csa operon or a fragment thereof,

17. An isolated nucleotide sequence comprising a csa operon or a functional fragment thereof.

18. The isolated nucleotide sequence of claim 17, wherein the csa operon comprises a csaA coding region.

19. The isolated nucleotide sequence of claim 18, wherein the csa operon comprises the csaA coding region of SEQ ID NO: 1.

20. The isolated nucleotide sequence of claim 18, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaA coding region of SEQ ID NO: 1.

21. The isolated nucleotide sequence of claim 17, wherein the csa operon comprises csaB.

22. The isolated nucleotide sequence of claim 21, wherein the csa operon comprises the csa8 coding region of SEQ ID NO: 3.

23. The isolated nucleotide sequence of claim 21, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaB coding region of SEQ ID NO: 3.

24. The isolated nucleotide sequence of claim 17, wherein the csa operon comprises csaC.

25. The isolated nucleotide sequence of claim 24, wherein the csa operon comprises the csaC coding region of SEQ ID NO: 5.

26. The isolated nucleotide sequence of claim 24, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaC coding region of SEQ ID NO: 5.

27. The isolated nucleotide sequence of claim 17, wherein the csa operon comprises csaD.

28. The isolated nucleotide sequence of claim 24, wherein the csa operon comprises the csaD coding region of SEQ ID NO: 7.

29. The isolated nucleotide sequence of claim 24, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaD coding region of SEQ ID NO: 7.

30. The isolated nucleotide sequence of claim 17, wherein the csa operon comprises csaE.

31. The isolated nucleotide sequence of claim 30, wherein the csa operon comprises the csaE coding region of SEQ ID NO: 9.

32. The isolated nucleotide sequence of claim 30, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaE coding region of SEQ ID NO: 9.

33. An expression vector comprising a csa operon nucleotide sequence or an antigenic fragment thereof.

34. A host cell comprising the expression vector of claim 33.

35. A purified polypeptide sequence expressed from a recombinant esa operon or an antigenic fragment thereof.

36. The purified polypeptide sequence of claim 35, wherein the csa operon comprises a csaA coding region.

37. The purified polypeptide sequence of claim 35, wherein the csa operon comprises the csaA coding region of SEQ ID NO: 1.

38. The purified polypeptide sequence of claim 37, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaA coding region of SEQ ID NO: 1.

39. The purified polypeptide sequence of claim 35, wherein the csa operon comprises csaB.

40. The purified polypeptide sequence of claim 39, wherein the csa operon comprises the csaB coding region of SEQ ID NO: 3.

41. The purified polypeptide sequence of claim 39, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaB coding region of SEQ ID NO: 3.

42. The purified polypeptide sequence of claim 35, wherein the csa operon comprises csaC.

43. The purified polypeptide sequence of claim 42, wherein the csa operon comprises the csaC coding region of SEQ ID NO: 5.

44. The purified polypeptide sequence of claim 42, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaC coding region of SEQ ID NO: 5.

45. The purified polypeptide sequence of claim 35, wherein the csa operon comprises csaD.

46. The purified polypeptide sequence of claim 45, wherein the csa operon comprises the csaD coding region of SEQ ID NO: 7.

47. The purified polypeptide sequence of claim 45, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaD coding region of SEQ ID NO: 7.

48. The purified polypeptide sequence of claim 35, wherein the csa operon comprises csaE.

49. The purified polypeptide sequence of claim 48, wherein the csa operon comprises the csaE coding region of SEQ ID NO: 9.

50. The purified polypeptide sequence of claim 48, wherein the csa operon comprises a nucleotide sequence having at least 95% sequence homology to the csaE coding region of SEQ ID NO: 9,

51. A use of an immungenic composition comprising a recombinant product of a csa operon for the manufacture of a medicament to generate an immune response against said recombinant product, whereby said composition is contacted with a subject, producing an immune response in said subject.

52. The use of claim 51, wherein the recombinant product of the csa operon is the CS4 antigen.

53. The use of claim 52, wherein the CS4 antigen is provided in an acellular composition.

54. The use of claim 52, wherein the CS4 antigen is provided in a cellular composition.

55. The use of claim 51, wherein the recombinant product of the csa operon is CsaA (SEQ ID NO.:2).

56. The use of claim 51, wherein the recombinant product of the csa operon is at least 95%
homologous to CsaA (SEQ ID NO.:2).

57. The use of claim 51, wherein the recombinant product of the csa operon is CsaB (SEQ ID NO.:4).

58. The use of claim 51, wherein the recombinant product of the csa operon is at least 95%
homologous to CsaB (SEQ ID NO.:4).

59. The use of claim 51, wherein the recombinant product of the csa operon is CsaC (SEQ ID NO.:6).

60. The use of claim 51, wherein the recombinant product of the csa operon is at least 95%
homologous to CsaC (SEQ ID NO.:6).

61. The use of claim 51, wherein the recombinant product of the csa operon is CsaD (SEQ ID NO.:8).

62. The use of claim 51, wherein the recombinant product of the csa operon is at least 95%
homologous to CsaD (SEQ ID NO.:8).

63. The use of claim 51, wherein the recombinant product of the csa operon is CsaE (SEQ ID NO.:10).

64. The use of claim 51, wherein the recombinant product of the csa operon is at least 95%
homologous to CsaE (SEQ ID NO.:10).

65. The use of claim 51, wherein the composition further comprises a carrier, and wherein said carrier is a composition comprising components suitable for parenteral administration.

66. The use of claim 65, wherein the carrier is a composition comprising components suitable for intranasal administration.

67. The use of claim 65, wherein the carrier is a composition comprising components suitable for intramuscular administration.

68. The use of claim 51, wherein the composition further comprises a carrier, and wherein said carrier is a composition comprising components suitable for enteric administration.

69. The use of claim 51, wherein said recombinant product comprises a polypeptide product from a csa operon or a functional fragment thereof.

70. The use of claim 69, wherein the polypeptide product of the csa operon is the CS4 antigen.

71. The use of claim 69, wherein the polypeptide product of the csa operon is CsaA (SEQ ID NO.:2).

72. The use of claim 69, wherein the polypeptide product of the csa operon is at least 95%
homologous to CsaA (SEQ ID NO.:2).

73. The use of claim 69, wherein the polypeptide product of the csa operon is CsaB (SEQ ID NO.:4).

74. The use of claim 69, wherein the polypeptide product of the csa operon is at least 95%
homologous to CsaB (SEQ ID NO.:4).

75. The use of claim 69, wherein the polypeptide product of the csa operon is CsaC (SEQ ID NO.:6).

76. The use of claim 69, wherein the polypeptide product of the csa operon is at least 95%
homologous to CsaC (SEQ ID NO.:6).

77. The use of claim 69, wherein the polypeptide product of the csa operon is CsaD (SEQ ID NO.:8).

78. The use of claim 69, wherein the polypeptide product of the csa operon is at least 95%
homologous to CsaD (SEQ ID NO.:8).

79. The use of claim 69, wherein the polypeptide product of the csa operon is CsaE (SEQ ID NO.:10).

80. The use of claim 69, wherein the polypeptide product of the csa operon is at least 95%
homologous to CsaE (SEQ ID NO.:10).

81. The use of Claim 51, wherein said immunogenic composition comprises a polynucleotide operatively encoding at least an immunogenic portion of the csa operon and having at least about 15 nucleotides.