CA2473187C - Mismatch endonucleases and methods of use - Google Patents

Mismatch endonucleases and methods of use Download PDF

Info

Publication number
CA2473187C
CA2473187C CA2473187A CA2473187A CA2473187C CA 2473187 C CA2473187 C CA 2473187C CA 2473187 A CA2473187 A CA 2473187A CA 2473187 A CA2473187 A CA 2473187A CA 2473187 C CA2473187 C CA 2473187C
Authority
CA
Canada
Prior art keywords
sequence
dna
polynucleotide
cel
mismatch
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA2473187A
Other languages
French (fr)
Other versions
CA2473187A1 (en
Inventor
Hal S. Padgett
Andrew A. Vaewhongs
Fakhrieh S. Vojdani
Mark L. Smith
John A. Lindbo
Wayne P. Fitzmaurice
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novici Biotech LLC
Original Assignee
Novici Biotech LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/098,155 external-priority patent/US20030157495A1/en
Application filed by Novici Biotech LLC filed Critical Novici Biotech LLC
Publication of CA2473187A1 publication Critical patent/CA2473187A1/en
Application granted granted Critical
Publication of CA2473187C publication Critical patent/CA2473187C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • C12N15/1027Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8203Virus mediated transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/00022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Disintegrating Or Milling (AREA)

Abstract

We describe here restriction endonucleases and their uses. Restriction endonucleases are useful in finding single nucleotide polymorphisms. They are also useful in an in vitro method of redistributing sequence variations between non-identical polynucleotide sequences.

Description

MISMATCH ENDONUCLEASES AND METHODS OF USE

FIELD OF THE INVENTION

The invention relates generally to molecular biology and more specifically to mismatch endonuclease enzymes and their uses in methods of generating populations of related nucleic acid molecules or in detection of single nucleotide polymorphisms.
BACKGROUND INFORMATION

DNA shuffling is a powerful tool for obtaining recombinants between two or more DNA sequences to evolve them in an accelerated manner. The parental, or input, DNAs for the process of DNA shuffling are typically mutants or variants of a given gene that have some improved character over the wild-type. The products of DNA shuffling represent a pool of essentially random reassortments of gene sequences from the parental nucleic acids that can then be analyzed for additive or synergistic effects resulting from new sequence combinations.
Recursive sequence reassortment is analogous to an evolutionary process where only variants with suitable properties are allowed to contribute their genetic material to the production of the next generation.
Optimized variants are generated through DNA shuffling-mediated sequence reassortment followed by testing for incremental improvements in performance. Additional cycles of reassortment and testing lead to the generation of genes that contain new combinations of the genetic improvements identified in previous rounds of the process. Reassorting and combining beneficial genetic changes allows an optimized sequence to arise without having to individually generate and screen all possible sequence combinations.

Shuffling differs sharply from random mutagenesis, where subsequent improvements to an already improved sequence result largely from serendipity. For example, in order to obtain a protein that has a desired set of enhanced properties, it may be necessary to identify a mutant that contains a combination of various beneficial mutations. If no process is available for combining these beneficial genetic changes, further random mutagenesis will be required. However, random mutagenesis requires repeated cycles of generating and screening large numbers of mutants, resulting in a process that is tedious and highly labor intensive.
Moreover, the rate at which sequences incur mutations with undesirable effects increases with the information content of a sequence. Hence, as the information content, library size, and mutagenesis rate increase, the ratio of deleterious mutations to beneficial mutations will increase, increasingly masking the selection of further improvements. Lastly, some computer simulations have suggested that point mutagenesis alone may often be too gradual to allow the large-scale block changes that are required for continued and dramatic sequence evolution.

Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a sequence. A limitation to this method, however, is that published error-prone PCR protocols suffer from a low processivity of the polymerase, making this approach inefficient at producing random mutagenesis in an average-sized gene.

In oligonucleotide-directed random mutagenesis, a short sequence is replaced with a synthetically mutagenized oligonucleotide. To generate combinations of distant mutations, different sites must be addressed simultaneously by different oligonucleotides. The limited library size that is obtained in this manner, relative to the library size required to saturate all sites, requires that many rounds of selection are required for optimization. Mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round followed by grouping them into families, arbitrarily choosing a single family, and reducing it to a consensus motif. Such a motif is resynthesized and reinserted into a single gene followed by additional selection. This step creates a statistical bottleneck, is labor intensive, and is not practical for many rounds of mutagenesis.

For these reasons, error-prone PCR and oligonucleotide-directed mutagenesis can be used for mutagenesis protocols that require relatively few cycles of sequence alteration, such as for sequence fine-tuning, but are limited in their usefulness for procedures requiring numerous mutagenesis and selection cycles, especially on large gene sequences.

As discussed above, prior methods for producing improved gene products from randomly mutated genes are of limited utility. One recognized method for producing a randomly reassorted gene sequences uses enzymes to cleave a long nucleotide chain into shorter pieces. The cleaving agents are then separated from the genetic material, and the material is amplified in such a manner that the genetic material is allowed to reassemble as chains of polynucleotides, where their reassembly is either random or according to a specific order. The method requires several rounds of amplification to assemble variants of genes that were broken into random fragments. ((Stemmer, 1994a; Stemmer, 1994b), US Patent No. 5,605,793, US Patent No. 5,811,238, US Patent No.
5,830,721, US Patent No. 5,928,905, US Patent No.
6,096,548, US Patent No. 6,117,679, US Patent No.
6,165,793, US Patent No. 6,153,410). A variation of this method uses primers and limited polymerase extensions to generate the fragments prior to reassembly (US Patent No.
5,965,408, US Patent No. 6,159,687).

However, both methods have limitations. These methods suffer from being technically complex. This limits the applicability of these methods to facilities that have sufficiently experienced staffs. In addition there are complications that arise from the reassembly of molecules from fragments, including unintended mutagenesis and the increasing difficulty of the reassembly of large target molecules of increasing size, which limits the utility of these methods for reassembling long polynucleotide strands.

Another limitation of these methods of fragmentation and reassembly-based gene shuffling is encountered when the parental template polynucleotides are increasingly heterogeneous. In the annealing step of those processes, the small polynucleotide fragments depend upon stabilizing forces that result from base-pairing interactions to anneal properly. As the small regions of annealing have limited stabilizing forces due to their short length, annealing of highly complementary sequences is favored over more divergent sequences. In such instances these methods have a strong tendency to regenerate the parental template polynucleotides due to annealing of complementary single-strands from a particular parental template. Therefore, the parental templates essentially reassemble themselves creating a background of unchanged polynucleotides in the library that increases the difficulty of detecting recombinant molecules. This problem becomes increasingly severe as the parental templates become more heterogeneous, that is, as the percentage of sequence identity between the parental templates decreases. This outcome was demonstrated by Kikuchi, et al., (Gene 243:133-137, 2000) who attempted to generate recombinants between xylE and nahH using the methods of family shuffling reported by Patten et al., 1997; Crameri et al., 1998; Harayama, 1998; Kumamaru et al., 1998; Chang et al., 1999; Hansson et al., 1999). Kikuchi, et al., found that essentially no recombinants (<1%) were generated. They also disclosed a method to improve the formation of chimeric genes by fragmentation and reassembly of single-stranded DNAs. Using this method, they obtained chimeric genes at a rate of 14 percent, with the other 86 percent being parental sequences.

The characteristic of low-efficiency recovery of recombinants limits the utility of these methods for generating novel polynucleotides from parental templates with a lower percentage of sequence identity, that is, parental templates that are more diverse.

Accordingly, there is a need for a method of generating gene sequences that addresses these needs. A
method has been developed for reassorting mutations among related polynucleotides, in vitro, by forming heteroduplex molecules and then addressing the mismatches such that sequence information at sites of mismatch is transferred from one strand to the other. The mismatches are addressed by incubating the heteroduplex molecules in a reaction containing a) an enzyme that recognizes and nicks a sequence strand at a mismatch site, b) a polymerase with a proofreading activity in the presence of dNTPs, and c) a ligase. These respective activities act in concert such that, at a given site of mismatch, the heteroduplex is nicked, unpaired bases are excised from one of the strands, then replaced using the opposite strand as a template, and nicks are sealed. Output polynucleotides may be amplified before cloning, or cloned directly and tested for improved properties.
Additional cycles of mismatch resolution reassortment and testing may lead to further improvement.

This method utilizes a mismatch endonuclease that is capable of recognizing and nicking at the site of a mismatch between a base or a sequence of bases along opposite strands of a nucleic acid sequence.

To address the need for enzymes that will recognize a mismatch, we have cloned the gene for the CEL I enzyme and a novel enzyme we refer to as RES I. Both of these enzymes are mismatch endonucleases and both are particularly suited to recognizing a base pair mismatch along a nucleic acid sequence, such as a chromosome, a plasmid, a gene, a portion of a gene or any artificial sequence of nucleic acids.

SUMMARY OF THE INVENTION

The present invention provides enzymes CEL I and RES
I that are capable of detecting a base mismatch in a nucleotide sequence, and nicking the sequence at the site of the base mismatch. These enzymes can be obtained from the native plants in which they occur. Methods are provided herein to make them as recombinant enzymes in a host organism by cloning into the host organism.

CEL I and RES I have utility in gene shuffling technology for developing new genes, and single nucleotide polymorphism (SNP) detection for e.g.
detecting evidence of cancer susceptibility.

Also provided is a method of cloning Cell and Resl genes into a plasmid or viral vector for transfer to a host organism that will amplify the number of copies of the gene or make the enzyme encoded in the plasmid or viral vector.
Also provided is a method making CEL I and RES I
enzymes a plant host.

The Cell and Resl nucleic acid sequences have been deposited at the ATCC under the Budapest Treaty.

Also provided is a complete description of a method by which CEL I and RES I are used for reassorting mutations among related polynucleotides, in vitro, by forming heteroduplex molecules and then addressing the mismatches such that sequence information at sites of mismatch is transferred from one strand to the other.
The mismatches are addressed by incubating the heteroduplex molecules in a reaction containing CEL I or RES I mismatch endonuclease enzyme that recognizes a mismatch and nicks one of the strands at the mismatch site, a polymerase with a proofreading activity in the presence of dNTPs, and a ligase. These respective activities act in concert such that, at a given site of mismatch, the heteroduplex is nicked, unpaired bases are excised from one of the strands, then replaced using the opposite strand as a template, and nicks are sealed.
Output polynucleotides may be amplified before cloning, or cloned directly and tested for improved properties.
Additional cycles of mismatch resolution reassortment and testing may lead to further improvement.

The method is also described as a method of increasing the number of complementary base pairs in a heteroduplex polynucleotide sequence where said heteroduplex polynucleotide sequence has at least two non-complementary nucleotide base pairs, the method includes mixing the heteroduplex polynucleotide sequence with an effective amount of mismatch-directed strand cleavage activity provided by CEL I or RES I enzyme, proofreading activity, and ligase activity; and allowing sufficient time for a number of non-complementary nucleotide base pairs to be converted to complementary base pairs, wherein the homogeneity between the strands is increased by at least one complementary base pair.

The method is also described as an in vitro method of making a population of sequence variants from a heteroduplex polynucleotide sequence wherein said heteroduplex polynucleotide sequence has at least two non-complementary nucleotide base pairs, said method includes mixing copies of the heteroduplex polynucleotide sequence with an effective amount of mismatch-directed strand cleavage activity provided by CEL I or RES I
enzyme, proofreading activity, and ligase activity; and allowing sufficient time for a number of non-complementary nucleotide base pairs to be converted to complementary base pairs, wherein a diverse population of polynucleotide sequences results.

The method is also described as an in vitro method of obtaining a polynucleotide sequence encoding a desired functional property, includes preparing at least one heteroduplex polynucleotide sequence; mixing copies of the heteroduplex polynucleotide sequence with an effective amount of mismatch-directed strand cleavage activity provided by CEL I or RES I enzyme, proofreading activity, and ligase activity; and allowing sufficient time for the percentage of complementarity between strands of the heteroduplex polynucleotide sequence to increase, wherein sequence diversity in the population is increased; and screening or selecting a population of variants for the desired functional property.
The method is also described as an in vitro method of obtaining a polynucleotide encoding a desired functional property, includes preparing at least one heteroduplex polynucleotide, mixing copies of the heteroduplex polynucleotide sequence with an effective amount of mismatch-directed strand cleavage activity provided by CEL I or RES I enzyme, proofreading activity, and ligase activity, allowing sufficient time for some or all of the mismatched nucleotide base pairs in the heteroduplex polynucleotide sequence to be converted to complementary bases, wherein a diverse population of polynucleotide sequences results, screening or selecting for a population of variants having a desired functional property, denaturing said population of variants to obtain a population of single stranded polynucleotide sequences, annealing said population of single stranded polynucleotide sequences to form a diverse population heteroduplex polynucleotide sequences, mixing the heteroduplex polynucleotide sequence with an effective amount of mismatch-directed strand cleavage activity, proofreading activity, and ligase activity, allowing sufficient time for some or all of the mismatched nucleotide base pairs in the heteroduplex polynucleotide sequence to be converted to matched base pairs, wherein a diverse population of polynucleotide sequences results, and screening or selecting for a population of variants having a desired functional property. DNA can be converted to RNA prior to screening by transcription of the DNA. A ligase activity can be added to seal the strands after proofreading.

One of the advantages of this method is that the sequence is either circular or linear. This allows for shuffling of nearly unlimited sequence length. The variant polynucleotide sequences have different amounts of complementarity. We report increasing the complementarity in a polynucleotide heteroduplex between two polynucleotides with sequence homology as low as 47%.
This process can occur simultaneously at many sites and on either strand of a given heteroduplex DNA
molecule. The result is a randomization of sequence differences among input strands to give a population of sequence variants that is more diverse than the population of starting sequences.

In another embodiment, a method of identifying a reassorted DNA molecule encoding a protein with a desired functional property, includes providing at least one single-stranded uracil-containing DNA molecule, which single-stranded uracil-containing DNA molecule, or a complementary strand thereto, encodes a protein;
providing one or a plurality of non-identical single-stranded DNA molecules capable of hybridizing to the single-stranded uracil-containing DNA molecule, wherein said DNA molecules encode at least one additional variant of the protein; contacting the single-stranded uracil-containing DNA molecule with at least one single-stranded DNA molecule of step (b), thereby producing an annealed DNA molecule; incubating the annealed DNA molecule with a mismatch endonuclease, proofreading polymerase and a ligase, thereby producing a sequence-reassorted DNA
strand annealed to the uracil-containing DNA molecule;
amplifying the reassorted DNA strand under conditions wherein the uracil-containing DNA molecule is not amplified, thereby producing a population of reassorted DNA molecules; and, screening or selecting the population of reassorted DNA molecules to identify those that encode a polypeptide having the desired functional property, thereby identifying one or more DNA molecules(s) that encode a polypeptide with the desired functional property. This process can also occur using an RNA
molecule as a template.

In one embodiment, Cell is a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:01, or SEQ ID NO:02, or SEQ ID NO:03, or SEQ ID NO:04.

In another embodiment, a recombinant virus comprising a nucleic acid sequence of Cell as represented by SEQ ID NO:01, or SEQ ID NO:02, or SEQ ID NO:03, or SEQ
ID NO:04 is presented.

In another embodiment, a recombinant plasmid comprising a nucleic acid sequence of Cell as represented by SEQ ID NO:01, or SEQ ID NO:02, or SEQ ID NO:03, or SEQ
ID NO:04 is presented.

In another embodiment, a plant or plant cell comprising a recombinant virus encoding a nucleic acid sequence of Cell as represented by SEQ ID NO:01, or SEQ

ID NO:02, or SEQ ID NO:03, or SEQ ID NO:04 is presented.
In another embodiment, a plant or plant cell comprising a recombinant plasmid encoding a nucleic acid sequence of Cell as represented by SEQ ID NO:01, or SEQ
ID NO:02, or SEQ ID NO:03, or SEQ ID NO:04 is presented.
In another embodiment, the recombinant virus can be a plant virus, an animal virus, a fungus virus, or a bacterial virus.
In another embodiment method of expressing CEL I
endonuclease using a recombinant virus is presented.

In another embodiment, a method of using CEL I in an in vitro method of making sequence variants from at least one heteroduplex polynucleotide where said heteroduplex has at least two non-complementary nucleotide base pairs, said method comprising:
a. preparing at least one heteroduplex polynucleotide;
b. combining said heteroduplex polynucleotide with an effective amount of CEL I, T4 DNA
polymerase, and T4 DNA ligase; and allowing sufficient time for the percentage of complementarity to increase, wherein one or .more variants are made.

In one embodiment, Resl is a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:16. The RES I amino acid sequence of SEQ ID NO:34is presented.

In another embodiment, a recombinant virus comprising a nucleic acid sequence of Resl as represented by SEQ ID NO:16.

In another embodiment, a recombinant plasmid comprising a nucleic acid sequence of Resl as represented by SEQ ID NO:16.

In another embodiment, a plant or plant cell comprising a recombinant virus encoding a nucleic acid sequence of Resl as represented by SEQ ID NO:16.
In another embodiment, a plant or plant cell comprising a recombinant plasmid encoding a nucleic acid sequence of Resi as represented by SEQ ID NO:16.

In another embodiment, the recombinant virus can be a plant virus, an animal virus, a fungus virus, or a bacterial virus.

In another embodiment method of expressing RES I
endonuclease using a recombinant virus is presented.

In another embodiment, a method of using RES I in an in vitro method of making sequence variants from at least one heteroduplex polynucleotide where said heteroduplex has at least two non-complementary nucleotide base pairs, said method comprising:
a. preparing at least one heteroduplex polynucleotide;
b. combining said heteroduplex polynucleotide with an effective amount of RES I, T4 DNA
polymerase, and T4 DNA ligase; and c. allowing sufficient time for the percentage of complementarity to increase, wherein one or more variants are made.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 depicts the process of Genetic Reassortment by Mismatch Resolution (GRAMMR). Reassortment is contemplated between two hypothetical polynucleotides differing at least two nucleotide positions. Annealing between the top strand of A and the bottom strand of B is shown which results in mismatches at the two positions.
After the process of reassortment mismatch resolution, four distinct product polynucleotides are seen, the parental types A and B, and the reassorted products X and Y.

Figure 2 depicts an exemplary partially complementary nucleic acid population of two molecules.
Figure 2A shows the sequence of two nucleic acid molecules "X" and "Y" having completely complementary top/bottom strands l+/2- and 3+/4-, respectively. The positions of differing nucleotides between the nucleic acids X and Y are indicated (*). Figure 2B shows possible combinations of single strands derived from nucleic acids X and Y after denaturing and annealing and indicates which of those combinations would comprise a partially complementary nucleic acid population of two.

Figure 3 shows nucleic acid sequence encoding RES I
endonuclease (SEQ ID NO: 16) as taught in EXAMPLE B.
Figure 4 shows the corresponding amino acid sequence for RES I (SEQ ID NO: 34).

Figure 5 shows the nucleic acid sequence for plasmid pBSC3BFP (SEQ ID NO: 32) as taught in EXAMPLE 9.

Figure 6 shows the nucleic acid sequence for the tobamovirus movement protein open reading frame of TMV-Cg (SEQ ID NO: 18) as taught in Example 15.

Figure 7 shows the nucleic acid sequence for the tobamovirus movement protein open reading frame of TMV-Ob (SEQ ID NO: 19) as taught in Example 15.
Figure 8 shows the nucleic acid sequence for the tobamovirus movement protein open reading frame of TMV-U2 (SEQ ID NO: 20) as taught in Example 15.

Figure 9 shows a resultant clone from TMV-Cg and ToMV GRAMMR reaction (SEQ ID NO: 21) as taught in Example 15.

Figure 10 shows a second resultant clone from a TMV-Cg and ToMV GRAMMR reaction (SEQ ID NO: 22) as taught in Example 15.

Figure 11 shows a resultant clone from a TMV-Ob and ToMV GRAMMR reaction (SEQ ID NO: 23) as taught in Example 15.

Figure 12 shows a second resultant clone from a TMV-Ob and ToMV GRAMMR reaction (SEQ ID NO: 24) as taught in Example 15.

Figure 13 shows a resultant clone from a TMV-U2 and ToMV GRAMMR reaction (SEQ ID NO: 25) as taught in Example 15.

Figure 14 shows a second resultant clone from a TMV-U2 and ToMV GRAMMR reaction (SEQ ID NO: 26) as taught in Example 15.

Figure 15 shows a resultant clone from a TMV-U1 and ToMV GRAMMR reaction (SEQ ID NO: 27) as taught in Example 15.
Figure 16 shows a second resultant clone from a TMV-U1 and ToMV GRAMMR reaction (SEQ ID NO: 28) as taught in Example 15.

Figure [17] shows the nucleic acid sequence for the tobamovirus movement protein open reading frame of TMV
(SEQ ID NO: 9) as taught in Example 15.

Figure [18] shows the nucleic acid sequence for the tobamovirus movement protein open reading frame of ToMV
(SEQ ID NO: 10) as taught in Example 15.

Definitions In order to provide a clear and consistent understanding of the specification and the claims, including the scope given herein to such terms, the following definitions are provided:

As used herein, the term "amplification" refers to a process where the number of copies of a polynucleotide is increased.

As used herein, the term "annealing" refers to the formation of at least partially double stranded nucleic acid by hybridization of at least partially complementary nucleotide sequences. A partially double stranded nucleic acid can be due to the hybridization of a smaller nucleic acid strand to a longer nucleic acid strand, where the smaller nucleic acid is 100% identical to a portion of the larger nucleic acid. A partially double stranded nucleic acid can also be due to the hybridization of two nucleic acid strands that do not share 100% identity but have sufficient homology to hybridize under a particular set of hybridization conditions.
As used herein, the term "clamp" refers to a unique nucleotide sequence added to one end of a polynucleotide, such as by incorporation of the clamp sequence into a PCR
primer. The clamp sequences are intended to allow amplification only of polynucleotides that arise from hybridization of strands from different parents (i.e., heteroduplex molecules) thereby ensuring the production of full-length hybrid products as described previously (Skarfstad, J. Bact, vol 182, No 11, P. 3008-3016).

As used herein, the term "cleaving" means digesting the polynucleotide with enzymes or otherwise breaking phosphodiester bonds within the polynucleotide. As used herein, the term "strand cleavage activity" or "cleavage"
refers to the breaking of a phosphodiester bond in the backbone of the polynucleotide strand, as in forming a nick. Strand cleavage activity can be provided by an enzymatic agent. Such agents include CEL I, RES I and their variants.

As used herein, the term "complementary base pair"
refers to the correspondence of DNA (or RNA) bases in the double helix such that adenine in one strand is opposite thymine (or uracil) in the other strand and cytosine in one strand is opposite guanine in the other.

As used herein, the term "complementary to" is used herein to mean that the complementary sequence is identical to the reverse-complement of all or a portion of a reference polynucleotide sequence or that each nucleotide in one strand is able to form a base-pair with a nucleotide, or analog thereof in the opposite strand.
For illustration, the nucleotide sequence "TATAC" is complementary to a reference sequence "GTATA".

As used herein, the term "denaturing" or "denatured," when used in reference to nucleic acids, refers to the conversion of a double stranded nucleic acid to a single stranded nucleic acid. Methods of denaturing double stranded nucleic acids are well known to those skilled in the art, and include, for example, addition of agents that destabilize base-pairing, increasing temperature, decreasing salt, or combinations thereof. These factors are applied according to the complementarity of the strands, that is, whether the strands are 100% complementary or have one or more non-complementary nucleotides.

As used herein, the term "desired functional property" means a phenotypic property, which include but are not limited to, encoding a polypeptide, promoting transcription of linked polynucleotides, binding a protein, improving the function of a viral vector, and the like, which can be selected or screened for.
Polynucleotides with such desired functional properties, can be used in a number of ways, which include but are not limited to expression from a suitable plant, animal, fungal, yeast, or bacterial expression vector, integration to form a transgenic plant, animal or microorganism, function of a ribozyme, and the like.

As used herein, the term "DNA shuffling" is used herein to indicate reassortment of sequence information between substantially homologous but non-identical sequences.
As used herein, the term "effective amount" refers to the amount of an agent necessary for the agent to provide its desired activity. For the present invention, this determination is well within the knowledge of those of ordinary skill in the art.

As used herein, the term "host" refers to a cell, tissue or organism capable of replicating a vector or plant viral nucleic acid and which is capable of being infected by a virus containing the viral vector or plant viral nucleic acid. This term is intended to include prokaryotic and eukaryotic cells, organs, tissues or organisms, where appropriate.

As used herein, the term "infection" refers to the ability of a virus to transfer its nucleic acid to a host or introduce viral nucleic acid into a host, wherein the viral nucleic acid is replicated, viral proteins are synthesized, and new viral particles assembled. In this context, the terms "transmissible" and "infective" are used interchangeably herein.

As used herein, the term "non-native" refers to any RNA sequence that promotes production of subgenomic mRNA
including, but not limited to, 1) plant viral promoters such as ORSV and brome mosaic virus, 2) viral promoters from other organisms such as human Sindbis viral promoter, and 3) synthetic promoters.

As used herein, the term "phenotypic trait" refers to an observable property resulting from the expression of a gene.
As used herein, the term "plant cell" refers to the structural and physiological unit of plants, consisting of a protoplast and the cell wall.
As used herein, the term "plant organ" refers to a distinct and visibly differentiated part of a plant, such as root, stem, leaf or embryo.

As used herein, the term "plant tissue" refers to any tissue of a plant in planta or in culture. This term is intended to include a whole plant, plant cell, plant organ, protoplast, cell culture, or any group of plant cells organized into a structural and functional unit.
As used herein, the term "production cell" refers to a cell, tissue or organism capable of replicating a vector or a viral vector, but which is not necessarily a host to the virus. This term is intended to include prokaryotic and eukaryotic cells, organs, tissues or organisms, such as bacteria, yeast, fungus and plant tissue.

As used herein, the term "promoter" refers to the 51-flanking, non-coding sequence adjacent a coding sequence which is involved in the initiation of transcription of the coding sequence.

As used herein, the term "protoplast" refers to an isolated plant cell without cell walls, having the potency for regeneration into cell culture or a whole plant.
As used herein, the term "recombinant plant viral nucleic acid" refers to plant viral nucleic acid, which has been modified to contain non-native nucleic acid sequences.

As used herein, the term "recombinant plant virus"
refers to a plant virus containing the recombinant plant viral nucleic acid.

As used herein, the term "subgenomic promoter"
refers to a promoter of a subgenomic mRNA of a viral nucleic acid.

As used herein, the term "substantial sequence homology" refers to nucleotide sequences that are substantially functionally equivalent to one another.
Nucleotide differences between such sequences having substantial sequence homology will be de minimus in affecting function of the gene products or an RNA coded for by such sequence.

As used herein, the term "transcription" refers to production of an RNA molecule by RNA polymerase as a complementary copy of a DNA sequence.

As used herein, the term "vector" refers to a self-replicating DNA molecule which transfers a DNA segment between cells.

As used herein, the term "virus" refers to an infectious agent composed of a nucleic acid encapsidated in a protein. A virus may be a mono-, di-, tri- or multi-partite virus, as described above.
As used herein, the term "Genetic Reassortment by Mismatch Resolution (GRAMMR)" refers to a method for reassorting sequence variations among related polynucleotides by an in vitro method of redistributing sequence variations between non-identical polynucleotide sequences, by making a heteroduplex polynucleotide from two non-identical polynucleotides; introducing a nick in one strand at or near a base pair mismatch site; removing mismatched base(s) from the mismatch site where the nick occurred; and using the opposite strand as template to replace the removed base(s) with bases that complement base(s) in the first strand. By this method, information is transferred from one strand to the other at sites of mismatch.

Multiple sites in a partially complementary molecule can be addressed independently and simultaneously in this process. The result is an increase in the percentage of complementary base pairs in the polynucleotide sequence.
One or more base pair mismatches between two strands of the heteroduplex polynucleotide sequence are resolved by an in vitro method of mixing the heteroduplex polynucleotide sequence with an effective amount of mismatch-directed strand cleavage activity provided by CEL I or RES I enzyme, proofreading activity, and ligase activity to resolve one or more of the mismatches. By this method, information is transferred from one strand to the other at sites of a mismatch.

A mismatch can be the result of two non-complementary bases occurring opposite each other. A
mismatch site can consist of a cluster of any number of unpaired nucleotides, including nucleotide base-pairs that are made unstable by neighboring mismatches. A
mismatch can also be the result of one or more bases occurring on one strand that do not have a numerical opposite on the opposite strand. For example, at the site of a mismatch there might be 1 unpaired base on one strand and no unpaired bases on the other strand. This would result in a site of sequence length heterogeneity in which a single unpaired nucleotide is contained in one strand at that site. Depending on the strand that is initially nicked at this site of mismatch, the process of this invention would result in either the insertion of a single base relative to the shorter strand, or in the deletion of a single base relative to the strand that originally had the extra unpaired nucleotide. This principle of transfer of sequence length information from one strand to the other can apply to any site of mismatch where the number of mismatched bases on the two strands do not equal one-another.

Usually many copies of the heteroduplex polynucleotide are present in the reaction. In this situation, sequence information at a mismatch site might be templated from the top strand on one copy of the polynucleotide and from the bottom strand in another copy. Assuming a sufficient number of copies are available, if a single mismatch is present, then two output variants are possible. If two mismatch sites are present then 2 times 2 variants can result. If n mismatch sites are present, then at least 2 to the n power or 2n genetic reassortments are possible by mismatch resolution. The possible result is at least 2" variant polynucleotides. We say at least, because the exact mechanism is not fully understood. It can be speculated that for a mismatch site that is 2 or more bases in length, an individual event might template 1, 2 or more of the mismatched bases. If that is the case, then the result would be an increase in the probable number of variants.

As used herein, the term "GENEWARE" or "GENEWARE "
refers to a viral vector derived at least in part from a Tobamovirus and modified to contain an additional (usually heterologous) subgenomic promoter. A
Tobamovirus found in nature, typically contains subgenomic promoters for the movement protein and the coat protein. GENEWARE is a registered trademark of Large Scale Biology corporation.

As used herein, the term "granularity" refers to the amount of a nucleic acid's sequence information from a given parental polynucleotide sequence that occurs as a contiguous sequence in a given progeny polynucleotide.
As used herein, the term "template sequence" refers to a first single stranded polynucleotide sequence that is partially complementary to a second polynucleotide sequence such that treatment by GRAMMR results in transfer of genetic information from the template strand to the second strand.

The larger the units of sequence information transferred from a template strand, the higher the granularity. The smaller the blocks of sequence information transferred from the template strand, the lower or finer the granularity. Lower granularity indicates that a DNA shuffling or reassortment method is able to transfer smaller discrete blocks of genetic information from the template strand to the second strand. The advantage of a DNA shuffling or reassortment method with lower granularity is that it is able to resolve smaller nucleic acid sequences from others, and to transfer the sequence information. DNA shuffling or reassortment methods that return primarily high granularity are not readily able to resolve smaller nucleic acid sequences from others.

As used herein, the term "heteroduplex polynucleotide" refers to a double stranded polynucleotide formed by annealing single strands, typically separate strands, where the strands are non-identical. A heteroduplex polynucleotide may have unpaired regions existing as single strand loops or bubbles. A heteroduplex polynucleotide region can also be formed by one single-strand polynucleotide wherein partial self-complementarity allows the formation of a stem-loop structure where the annealing portion of the strand is non-identical.

As used herein, the term "heteroduplex DNA" refers to a double-stranded DNA formed by annealing single strands, typically separate strands), where the strands are non-identical. A heteroduplex DNA may have unpaired regions existing as single strand loops or bubbles. A
heteroduplex DNA region can also be formed by one single-strand polynucleotide wherein partial self-complementarity allows the formation of a stem-loop structure where the annealing portion of the strand is non-identical.
As used herein, the term "homologous" means that one single-stranded nucleic acid sequence may hybridize to an at least partially complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentrations as discussed later.

Nucleic acids are "homologous" when they are derived, naturally or artificially, from a common ancestor sequence. During natural evolution, this occurs when two or more descendent sequences diverge from a parent sequence over time, i.e., due to mutation and natural selection. Under artificial conditions, divergence occurs, e.g., in one of two basic ways.
First, a given sequence can be artificially recombined with another sequence, as occurs, e.g., during typical cloning, to produce a descendent nucleic acid, or a given sequence can be chemically modified, or otherwise manipulated to modify the resulting molecule.
Alternatively, a nucleic acid can be synthesized de novo, by synthesizing a nucleic acid that varies in sequence from a selected parental nucleic acid sequence. When there is no explicit knowledge about the ancestry of two nucleic acids, homology is typically inferred by sequence comparison between two sequences. Where two nucleic acid sequences show sequence similarity over a significant portion of each of the nucleic acids, it is inferred that the two nucleic acids share a common ancestor. The precise level of sequence similarity that establishes homology varies in the art depending on a variety of factors.
For purposes of this disclosure, two nucleic acids are considered homologous where they share sufficient sequence identity to allow GRAMMR-mediated information transfer to occur between the two nucleic acid molecules.
As used herein, the term "identical" or "identity"
means that two nucleic acid sequences have the same sequence or a complementary sequence. Thus, "areas of identity" means that regions or areas of a polynucleotide or the overall polynucleotide are identical or complementary to areas of another polynucleotide.
As used herein, the term "increase in percent complementarity" means that the percentage of complementary base-pairs in a heteroduplex molecule is made larger.

As used herein, the term "ligase" refers to an enzyme that establishes a phosphodiester bond between adjacent nucleotides in a nucleic acid.

As used herein, the term "mismatch" refers to a base-pair that is unable to form normal base-pairing interactions (i.e., other than "A" with "T" (or "U"), or "G" with "C").

As used herein, the term "mismatch resolution"
refers to the conversion of a mismatched base-pair into a complementary base-pair.

As used herein, the term "mutations" means changes in the sequence of a wild-type or reference nucleic acid sequence or changes in the sequence of a polypeptide.
Such mutations can be point mutations such as transitions or transversions. The mutations can be deletions, insertions or duplications.

As used herein, the term "nucleic acid" or "nucleic acid molecule" means a polynucleotide such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and encompasses single-stranded and double-stranded nucleic acid as well as an oligonucleotide. Nucleic acids useful in the invention include genomic DNA, cDNA, mRNA, plasmids, cosmids, PCR products, and synthetic oligonucleotides, and can represent the sense strand, the anti-sense strand, or both. A nucleic acid generally incorporates the four naturally occurring nucleotides adenine, guanine, cytosine, and thymidine/uridine. An invention nucleic acid can also incorporate other naturally occurring or non-naturally occurring nucleotides, including derivatives thereof, so long as the nucleotide derivatives can be incorporated into a polynucleotide by a polymerase at an efficiency sufficient to generate a desired polynucleotide product.
As used herein, the term a "parental nucleic acid"
refers to a double stranded nucleic acid having a sequence that is 100% identical to an original single stranded nucleic acid in a starting population of partially complementary nucleic acids. Parental nucleic acids would include, for example in the illustration of Figure 2, nucleic acids X and Y if partially complementary nucleic acid combinations 1+/4- or 2-/3+
were used as a starting population in an invention method.

As used herein, the term "partially complementary"
refers to a nucleic acid having a substantially complementary sequence to another nucleic acid but that differs from the other nucleic acid by at least two or more nucleotides.

As used herein, the term "partially complementary nucleic acid population" refers to a population of nucleic acids comprising individual groups of nucleic acids having substantially complementary sequences but no nucleic acids belonging to a particular group having an exact complementary sequence for any other group of sequences in the population.

As used herein, any member of a partially complementary nucleic acid population differs from another nucleic acid of the population, or the complement thereto, by two or more nucleotides. As such, a partially complementary nucleic acid specifically excludes a population containing sequences that are exactly complementary, that is, a complementary sequence that has 1000 complementarity. Therefore, each member of such a partially complementary nucleic acid population differs from other members of the population by two or more nucleotides, including both strands. One strand is designated the top strand, and its complement is designated the bottom strand.

As used herein, the term "top" strand refers to a polynucleotide read in the 5' to 3' direction and the "bottom" its complement. It is understood that, while a sequence is referred to as bottom or top strand, such a designation is intended to distinguish complementary strands since, in solution, there is no orientation that fixes a strand as a top or bottom strand.
For example, a population containing two nucleic acid members can be derived from two double stranded nucleic acids, with a potential of using any of the four strands to generate a single stranded partially complementary nucleic acid population. An example of potential combinations of strands of two nucleic acids that can be used to obtain a partially complementary nucleic acid population of the invention is shown in Figure 2. The two nucleic acid sequences that are potential members of a partially complementary nucleic acid population are designated "X" (AGATCAATTG) and "Y"
(AGACCGATTG)(Figure 2A). The nucleic acid sequences differ at two positions (positions 4 and 6indicated by "*"). The "top" strand of nucleic acids X and Y are designated "1+" and "3+," respectively, and the "bottom"
strand of nucleic acids X and Y are designated "2-" and "4-," respectively.

Figure 2B shows the possible combinations of the four nucleic acid strands. Of the six possible strand combinations, only the combination of 1+/2-, 1+/4-, 2-/3+, or 3+/4- comprise the required top and bottom strand of a partially complementary nucleic acid population. Of these top/bottom sequence combinations, only 1+/4- or 2-/3+ comprise an example of a partially complementary nucleic acid population of two different molecules because only these combinations have complementary sequences that differ by at least one nucleotide. The remaining combinations, 1+/2- and 2+/4-, contain exactly complementary sequences and therefore do not comprise a partially complementary nucleic acid population of the invention.
In the above described example of a population of two different molecules, a partially complementary population of nucleic acid molecules excluded combinations of strands that differ by one or more nucleotides but which are the same sense, for example, 1+/3+ or 2-/4-. However, it is understood that such a combination of same stranded nucleic acids can be included in a larger population, so long as the population contains at least one bottom strand and at least one top strand. For example, if a third nucleic acid "Z," with strands 5+ and 6- is included, the combinations 1+/3+/6- or 2-/4-/5+ would comprise a partially complementary nucleic acid population.
Similarly, any number of nucleic acids and their corresponding top and bottom strands can be combined to generate a partially complementary nucleic acid population of the invention so long as the population contains at least one top strand and at least one bottom strand and so long as the population contains no members that are the exact complement.

The populations of nucleic acids of the invention can be about 3 or more, about 4 or more, about 5 or more, about 6 or more, about 7 or more, about 8 or more, about 9 or more, about 10 or more, about 12 or more, about 15 or more, about 20 or more, about 25 or more about 30 or more, about 40 or more, about 50 or more, about 75 or more, about 100 or more, about 150 or more, about 200 or more, about 250 or more, about 300 or more, about 350 or more, about 400 or more, about 450 or more, about 500 or more, or even about 1000 or more different nucleic acid molecules. A population can also contain about 2000 or more, about 5000 or more, about 1x104 or more, about 1x105 or more, about 1x106 or more, about 1x107 or more, or even about 1x108 or more different nucleic acids. One skilled in the art can readily determine a desirable population to include in invention methods depending on the nature of the desired reassortment experiment outcome and the available screening methods, as disclosed herein.

As used herein, the term a "polymerase" refers to an enzyme that catalyzes the formation of polymers of nucleotides, that is, polynucleotides in a template-directed fashion. A polymerase useful in the invention can be derived from any organism or source, including animal, plant, bacterial and viral polymerases. A
polymerase can be a DNA polymerase, RNA polymerase, or a reverse transcriptase capable of transcribing RNA into DNA.

As used herein, the term "proofreading" describes the property of an enzyme where a nucleotide, such as, a mismatched nucleotide, can be removed in a 3'-to-5' fashion and replaced by, typically, a base-paired nucleotide. In the case of addressing a loop caused by insertion or deletion, proofreading may involve only removal of the mismatched nucleotide(s) or only addition of base-paired nucleotide(s).

As used herein, the term a "recombinant"
polynucleotide refers to a polynucleotide that comprises sequence information from at least two different polynucleotides.

As used herein, the term "related polynucleotides"
means that regions or areas of the polynucleotides are identical and regions or areas of the polynucleotides are non-identical.
As used herein, the term DNA "reassortment" is used herein to indicate a redistribution of sequence variations between non-identical sequences.
As used herein, the term "replicon" refers to a genetic unit of replication including a length of polynucleotide and its site for initiation of replication.
As used herein, the term "sequence diversity" refers to the abundance of non-identical polynucleotides. The term "increasing sequence diversity in a population"
means to increase the relative abundance of non-identical polynucleotides in a population.

As used herein, the term "sequence variant" refers to a molecule (DNA, RNA polypeptide, and the like) with one or more sequence differences compared to a reference molecule. For example, the sum of the separate independent mismatch resolution events that occur throughout the heteroduplex molecule during the GRAMMR
process results in reassortment of sequence information throughout that molecule. The sequence information will reassort in a variety of combinations to generate a complex library of "sequence variants".

As used herein, the term "Mismatch-directed strand cleavage" means strand cleavage activity by an agent that recognizes a site of a mismatched base pair, group of mismatched base pairs, or extrahelical base or bases on a heteroduplex polynucleotide sequence and cleaves one strand at the site of the mismatch.
As used herein, the term "sufficient time" refers to the period of time necessary for a reaction or process to render a desired product. For the present invention, the determination of sufficient time is well within the knowledge of those of ordinary skill in the art. It is noted that "sufficient time" can vary widely, depending on the desires of the practitioner, without impacting on the functionality of the reaction, or the quality of the desired product.
As used herein, the term "wild-type" means that a nucleic acid fragment does not contain any mutations. A
"wild-type" protein means that the protein will be active at a level of activity found in nature and typically will be the amino acid sequence found in nature. In an aspect, the term "wild type" or "parental sequence" can indicate a starting or reference sequence prior to a manipulation of the invention.

In the polypeptide notation used herein, the left-hand direction is the amino terminal direction and the right-hand direction is the carboxy-terminal direction, in accordance with standard usage and convention.
Similarly, unless specified otherwise, the left-hand end of single-stranded polynucleotide sequences is the 5' end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction.

DETAILED DESCRIPTION OF THE INVENTION
The present invention provides nucleic acid molecules comprising a nucleic acid sequence which include SEQ ID NO:01, SEQ ID NO:02, SEQ ID NO:03, or SEQ
ID NO:04, useful as vectors or plasmids for the expression of CEL I endonuclease. The nucleic acid molecules of SEQ ID NO:03, and SEQ ID NO:04 are CEL I
open reading frames contained within SEQ ID NO:01 and SEQ
ID NO:02, respectively. The preparation and use of the nucleic acid molecules of SEQ ID NO:01, SEQ ID NO:02, SEQ
ID NO:03 and SEQ ID NO:04, are further taught in EXAMPLE
2 herein. The present invention also provides nucleic acid molecules comprising the nucleic acid sequence of Figure 3 (SEQ ID NO:16), useful as vectors or plasmids for the expression of RES I endonuclease.
Mismatch endonucleases from plants have the ability to detect mismatches between hybridized nucleic acid strands, detect polynucleotide loops and insertions between such hybridized strands, detect polymorphisms between such hybridized strands, detect sequence differences in polynucleotide strands, and detect such mutations in a target polynucleotide sequence without substantial adverse effects of flanking DNA sequences (Yeung, Anthony, T. and Patrick J. Hagan International Patent Application No. WO 97/46701). These endonucleases are found in a wide variety of plants and are probably found throughout the plant kingdom. They have been found in Alfalfa sprouts, Asparagus, mung bean shoots, celery stalks, Cha ha, iceberg lettuce, parsley, celery-cabbage, broccoli tops, cabbage, cauliflower tops, and tomatoes (Oleykowski, C.A. et al. Nucleic Acids Research, 1998, Vol. 26, No. 20 4597-4702).

Endonucleases from plants can now be used in a process to evolve sets of nucleotide sequence variants from hybridized sequences. In the process, the mismatch endonuclease detects the mismatched bases, and nicks at least one of the hybridized strands. A polymerase enzyme then replaces one or more mismatched bases with one or more bases that complement the bases on the opposite strand. The nick is then sealed by a ligase enzyme. If two or more mismatch sites are present on the hybrid, then a population of variant sequences will result, depending on the number and position of the mismatches at which replacements are made, and the strand on which base replacement was made. In the evolution of sequence variants it is not necessarily desirable for all mismatches on all copies of the sequence to be resolved.
From a set of sequence variants, one or more variants that have preferred activity can be selected. RES I and CEL I exemplify mismatch endonucleases useful in this process. Other plant derived mismatch endonucleases are also useful in a GRAMMR reaction.

The present invention also provides a process for expressing CEL I or RES I endonuclease using a recombinant plant viral nucleic acid comprising of a nucleic acid sequence selected from the group consisting of SEQ ID NO:01, SEQ ID NO:02, SEQ ID NO:03, SEQ ID
NO:04, or Figure 3 (SEQ ID NO:16).

The present invention also provides a recombinant plant viral nucleic acid comprising of at least one sub-genomic promoter capable of transcribing or expressing CEL I or RES I endonuclease in a plant cell, wherein the plant cell is a host cell, or production cell.

In another embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a fusion protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.

In another embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.

In yet another embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.

In another embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) in the host to produce the desired product.

Another embodiment to the present invention is directed to recombinant plant viral nucleic acids and recombinant viruses which are stable for maintenance and transcription or expression of non-native (foreign) nucleic acid sequences and which are capable of systemically transcribing or expressing such foreign sequences in the host plant. More specifically, recombinant plant viral nucleic acids according to the present invention comprise a native plant viral subgenomic promoter, at least one non-native plant viral subgenomic promoter, a plant viral coat protein coding sequence, and optionally, at least one non-native, nucleic acid sequence.

The present invention provides for the infection of a plant host by a recombinant plant virus containing recombinant plant viral nucleic acid or by the recombinant plant viral nucleic acid which contains one or more non-native nucleic acid sequences which are transcribed or expressed in the infected tissues of the plant host. The product of the coding sequences may be recovered from the plant or cause a phenotypic trait in the plant.

The first step in achieving any of the features of the invention is to modify the nucleotide sequences of the plant viral nucleotide sequence by known conventional techniques such that one or more non-native subgenomic promoters are inserted into the plant viral nucleic acid without destroying the biological function of the plant viral nucleic acid. The subgenomic promoters are capable of transcribing or expressing adjacent nucleic acid sequences in a plant host infected by the recombinant plant viral nucleic acid or recombinant plant virus. The native coat protein coding sequence may be deleted in two embodiments, placed under the control of a non-native subgenomic promoter in a second embodiment, or retained in a further embodiment. If it is deleted or otherwise inactivated, a non-native coat protein gene is inserted under control of one of the non-native subgenomic promoters, or optionally under control of the native coat protein gene subgenomic promoter. The non-native coat protein is capable of encapsidating the recombinant plant viral nucleic acid to produce a recombinant plant virus.
Thus, the recombinant plant viral nucleic acid contains a coat protein coding sequence, which may be native or a nonnative coat protein coding sequence, under control of one of the native or non-native subgenomic promoters.
The coat protein is involved in the systemic infection of the plant host.

Some of the viruses which meet this requirement, and are therefore suitable, include viruses from the tobacco mosaic virus group such as Tobacco Mosaic virus (TMV), Cowpea Mosaic virus (CMV), Alfalfa Mosaic virus (AMV), Cucumber Green Mottle Mosaic virus watermelon strain (CGMMV-W) and Oat Mosaic virus (OMV) and viruses from the brome mosaic virus group such as Brome Mosaic virus (BMV), broad bean mottle virus and cowpea chlorotic mottle virus. Additional suitable viruses include Rice Necrosis virus (RNV), and geminiviruses such as tomato golden mosaic virus (TGMV), Cassava latent virus (CLV) and maize streak virus (MSV).

Another embodiment of the present invention is a recombinant plant viral nucleic acid, which further comprises one or more non-native nucleic acid sequences capable of being transcribed in the plant host. The non-native nucleic acid sequence is placed adjacent one or the non-native viral subgenomic promoters and/or the native coat protein gene promoter depending on the particular embodiment used. The non-native nucleic acid is inserted by conventional techniques, or the non-native nucleic acid sequence can be inserted into or adjacent the native coat protein coding sequence such that a fusion protein is produced. The non-native nucleic acid sequence, which is transcribed, may be transcribed as an RNA capable of regulating the expression of a phenotypic trait by an anti-sense mechanism. Alternatively, the non-native nucleic acid sequence in the recombinant plant viral nucleic acid may be transcribed and translated in the plant host, to produce a phenotypic trait. The non-native nucleic acid sequence(s) may also code for the expression of more than one phenotypic trait. The recombinant plant viral nucleic acid containing the non-native nucleic acid sequence is constructed using conventional techniques such that non-native nucleic acid sequence(s) are in proper orientation to whichever viral subgenomic promoter is utilized.

The present invention further provides a plant cell comprising a vector or plasmid comprising of a nucleic acid sequence selected from the group consisting of SEQ
ID NO:01, SEQ ID NO:02, SEQ ID NO:03, SEQ ID NO:04, or Figure 3 (SEQ ID NO:16) where the plant cell is a host cell, or production cell.

Methods of making CEL I and RES I enzyme are not limited to plant viral vectors. These genes or their variants can be introduced into any known host organism by any of several methods known in the art today.
Methods for transforming various host cells are disclosed in Klein et al. "Transformation of microbes, plants and animals by particle bombardment", Bio/Technol.
New York, N.Y., Nature Publishing Company, March 1992, v.
10 (3) pp. 286-291. Techniques for transforming a wide variety of higher plant species are well known and described in the technical, scientific, and patent literature. See, for example, Weising et al., Ann. Rev.
Genet. 22: 421-477 (1988).

For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation, PEG-mediated transfection, particle bombardment, silicon fiber delivery, or microinjection of plant cell protoplasts or embryogenic callus. See, e.g., Tomes, et al., Direct DNA
Transfer into Intact Plant Cells Via Microprojectile Bombardment. pp.197-213 in Plant Cell, Tissue and Organ Culture, Fundamental Methods. eds. O. L. Gamborg and G.
C. Phillips. Springer-Verlag Berlin Heidelberg New York, 1995. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al., Embo J. 3: 2717-2722 (1984).
Electroporation techniques are described in Fromm et al., Proc. Natl. Acad. Sci. 82: 5824 (1985). Ballistic transformation techniques are described in Klein et al., Nature 327: 70-73 (1987).

Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. Agrobacterium tumefaciens-meditated transformation techniques are well described in the scientific literature. See, for example Horsch et al., Science 233: 496-498 (1984), and Fraley et al., Proc.
Natl. Acad. Sci. 80: 4803 (1983). For instance, Agrobacterium transformation of maize is described in U.S. Pat. No. 5,981,840. Agrobacterium transformation of monocot is found in U.S. Pat. No. 5,591,616.
Agrobacterium transformation of soybeans is described in U.S. Pat. No. 5,563,055.

Other methods of transformation include (1) Agrobacterium rhizogenes-mediated transformation (see, e.g., Lichtenstein and Fuller In: Genetic Engineering, vol. 6, PWJ Rigby, Ed., London, Academic Press, 1987; and Lichtenstein, C. P., and Draper, J,. In: DNA Cloning, Vol. II, D. M. Glover, Ed., Oxford, IRI Press, 1985), Application PCT/US87/02512 (WO 88/02405 published Apr. 7, 1988) describes the use of A. rhizogenes strain A4 and its Ri plasmid along with A. tumefaciens vectors pARC8 or pARC16 (2) liposome-mediated DNA uptake (see, e.g., Freeman et al., Plant Cell Physiol. 25: 1353, 1984), (3) the vortexing method (see, e.g., Kindle, Proc. Natl.
Acad. Sci., USA 87: 1228, (1990).

DNA can also be introduced into plants by direct DNA
transfer into pollen as described by Zhou et al., Methods in Enzymology, 101:433 (1983); D. Hess, Intern Rev.
Cytol., 107:367 (1987); Luo et al., Plane Mol. Biol.
Reporter, 6:165 (1988). Expression of polypeptide coding nucleic acids can be obtained by injection of the DNA
into reproductive organs of a plant as described by Pena et al., Nature, 325.:274 (1987). DNA can also be injected directly into the cells of immature embryos and the rehydration of desiccated embryos as described by Neuhaus et al., Theor. Appl. Genet., 75:30 (1987); and Benbrook et al., in Proceedings Bio Expo 1986, Butterworth, Stoneham, Mass., pp.27-54 (1986).

Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype. Such regeneration techniques often rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with a polynucleotide of the present invention. For transformation and regeneration of maize see, Gordon-Kamm et al., The Plant Cell, 2:603-618 (1990).

CEL I and RES I and their variants can also be made by other host or host/vector systems. A polynucleotide sequences may be inserted into a recombinant plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the genetic sequences. Such expression vectors contain a promoter a sequence that facilitates the efficient transcription of the inserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter. Vectors suitable for use in the present invention include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg, et al., Gene 56:125, 1987), the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J
Biol. Chem., 263:3521, 1988) and baculovirus-derived vectors for expression in insect cells. The DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter (e.g., T7, metallothionein I, or polyhedrin promoters).

Polynucleotide sequences can be expressed in either prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and mammalian organisms. Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art.
Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art. Such vectors are used to incorporate DNA
sequences of the invention.
Methods which are well known to those skilled in the art can be used to construct expression vectors containing a CEL I or RES I coding sequence and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA
techniques, synthetic techniques, and in vivo recombination/genetic techniques. (See, for example, the techniques described in Maniatis et al., 1989 Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.) A variety of host-expression vector systems may be utilized to express a CEL I or RES I coding sequence.
These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing a CEL I or RES I coding sequence; yeast transformed with recombinant yeast expression vectors containing a CEL I or RES I coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing a CEL I or RES I
coding sequence; or animal cell systems infected with recombinant virus expression vectors (e.g., retroviruses, adenovirus, vaccinia virus) containing a CEL I or RES I
coding sequence, or transformed animal cell systems engineered for stable expression.

Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector (see e.g., Bitter et al., 1987, Methods in Enzymology 153:516-544). For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage lambda, plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used. When cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K
promoter) may be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted RES I OR CEL I coding sequence.

In bacterial systems a number of expression vectors may be advantageously selected depending upon the use intended for the expressed protein. For example, when large quantities of RES I OR CEL I are to be produced, vectors that direct the expression of high levels of fusion protein products that are readily purified may be desirable. Those that are engineered to contain a cleavage site to aid in recovering are preferred. Such vectors include but are not limited to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791, 1983), in which a CEL I or RES I coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid -lac Z protein is produced; pIN
vectors (Inouye & Inouye, 1985, Nucleic acids Res.
13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
264:5503-5509); and the like.
In yeast, a number of vectors containing constitutive or inducible promoters may be used. For a review see, Current Protocols in Molecular Biology, Vol.
2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. &
Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 31987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol.
II, IRL Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad. Press, N.Y., Vol.
152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathem et al., Cold Spring Harbor Press, Vols. I and II. A constitutive yeast promoter such as ADH or LEU2 or an inducible promoter such as GAL may be used (Cloning in Yeast, Ch. 3, R.
Rothstein In: DNA Cloning Vol. 11, A Practical Approach, Ed. D M Glover, 1986, IRL Press, Wash., D.C.).
Alternatively, vectors may be used which promote integration of foreign DNA sequences into the yeast chromosome.

Eukaryotic systems, and preferably mammalian expression systems, allow for proper post-translational modifications of expressed mammalian proteins to occur.
Eukaryotic cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, phosphorylation, and advantageously, secretion of the gene product may be used as host cells for the expression of RES I OR CEL I. Mammalian cell lines may be preferable. Such host cell lines may include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, -293, and W138.
Mammalian cell systems that utilize recombinant viruses or viral elements to direct expression may be engineered. For example, when using adenovirus expression vectors, a CEL I or RES I coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination.
Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the protein in infected hosts (e.g.. see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81: 3655-3659). Alternatively, the vaccinia virus 7.5K promoter can be used. (e.g., see, Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79:
7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864;
Panicali et al., 1982, Proc. Natl. Acad. Sci. USA 79:
4927-4931). Vectors based on bovine papilloma virus which have the ability to replicate as extrachromosomal elements (Sarver, et al., 1981, Mol. Cell. Biol. 1: 486).
Shortly after entry of this DNA into mouse cells, the plasmid replicates to about 100 to 200 copies per cell.
Transcription of the inserted cDNA does not require integration of the plasmid into the host's chromosome, thereby yielding a high level of expression. These vectors can be used for stable expression by including a selectable marker in the plasmid, such as, for example, the neo gene. Alternatively, the retroviral genome can be modified for use as a vector capable of introducing and directing the expression of a CEL I or RES I gene in host cells (Cone & Mulligan, 1984, Proc. Natl. Acad. Sci.
USA 81:6349-6353). High level expression may also be achieved using inducible promoters, including, but not limited to, the metallothionine IIA promoter and heat shock promoters.

Host cells can be transformed with a CEL I or RES I
cDNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, poly-adenylation sites, etc.), and a selectable marker. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines. For example, following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. A
number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:
817) genes can be employed in tk hgprt- or aprt- cells respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl.
Acad. Sci. USA 77: 3567; O'Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072; neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150: 1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30: 147) genes. Recently, additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, 1988, Proc. Natl. Acad.
Sci. USA 85: 8047); and ODC (ornithine decarboxylase) which confers resistance to the ormithine decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine, DFMO
(McConlogue L., 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.).

Transformation of a host cell with recombinant DNA
may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E. coli, competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl2 method using procedures well known in the art. Alternatively, MgCl2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired.

Animal and lower eukaryotic (e.g., yeast) host cells are competent or rendered competent for transformation by various means. There are several well-known methods of introducing DNA into animal cells. These include: calcium phosphate co-precipitates, conventional mechanical procedures such as microinjection, electroporation, biolistics, insertion of a plasmid encased in liposomes, or virus vectors may be used. Eukaryotic cells can also be cotransformed with DNA sequences encoding a CEL I or RES I of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40), Sindbis virus or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein. (see for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzmnan ed., 1982). The transfected cells are cultured by means well known in the art. Kuchler, R. J., Biochemical Methods in Cell Culture and Virology, Dowden, Hutchinson and Ross, Inc. (1977).
The present invention provides an in vitro method of making sequence variants from at least one heteroduplex polynucleotide wherein the heteroduplex has at least two non-complementary nucleotide base pairs, the method comprising: preparing at least one heteroduplex polynucleotide; combining said heteroduplex polynucleotide with an effective amount of an agent or agents with strand cleavage activity provided by CEL I or RES I enzyme, proofreading activity, and ligase activity;
and allowing sufficient time for the percentage of complementarity to increase, wherein at least one or more variants are made.

Another aspect of the present invention is where the heteroduplex polynucleotides are circular, linear or a replicon.

Another aspect of the present invention is where the desired variants have different amounts of complementarity.

Another aspect of the present invention is where the strand cleavage activity , proofreading activity, and ligase activity is added sequentially, or concurrently.
Another aspect of the present invention provides the addition of ligase activity, provided by agents such as, T4 DNA ligase, E. coli DNA ligase, or Taq DNA ligase.
In another aspect of the present invention, the strand cleavage activity is provided by an enzyme, such as, CEL I, RES I, T4 endonuclease VII, or T7 endonuclease I.

In another aspect of the present invention, polymerase activity is provided by Pol beta.

In another aspect of the present invention, proofreading activity is provided T4 DNA polymerase or T7 DNA polymerase.

In another aspect of the present invention, the effective amount of strand cleavage activity, and proofreading activity and ligase activity are provided by CEL I or RES I enzyme, T4 DNA polymerase, and E. coli DNA
ligase.

In another aspect of the present invention, the effective amount of strand cleavage activity, and proofreading activity and ligase activity are provided by CEL I or RES I enzyme, T7 DNA polymerase, and T4 DNA
ligase.

Another embodiment of the present invention provides an in vitro method of increasing diversity in a population of sequences, comprising, preparing at least one heteroduplex polynucleotide; combining the heteroduplex polynucleotide with an effective amount of an agent or agents with proofreading activity, ligase activity, and strand cleavage activity provided by CEL I
or RES I enzyme; and allowing sufficient time for the percentage of complementarity to increase, wherein diversity in the population is increased.
Another embodiment of the present invention provides a method of obtaining a polynucleotide encoding a desired functional property, comprising: preparing at least one heteroduplex polynucleotide; combining said heteroduplex polynucleotide with an effective amount of an agent or agents with proofreading activity, ligase activity, and strand cleavage activity provided by CEL I or RES I
enzyme; allowing sufficient time for the percentage of complementarity between strands of the heteroduplex polynucleotide to increase, wherein diversity in the population is increased; and screening or selecting a population of variants for the desired functional property.

Another embodiment of the present invention provides a method of obtaining a polynucleotide encoding a desired functional property, comprising: preparing at least one heteroduplex polynucleotide; combining said heteroduplex polynucleotide with an effective amount of an agent or agents with proofreading activity, ligase activity, and strand cleavage activity provided by CEL I or RES I
enzyme; allowing sufficient time for the percentage of complementarity between strands of the heteroduplex polynucleotide to increase, wherein diversity in the population is increased; converting DNA to RNA; and screening or selecting a population of ribonucleic acid variants for the desired functional property.
Yet another embodiment of the present invention provides a method of obtaining a polypeptide having a desired functional property, comprising: preparing at least one heteroduplex polynucleotide; combining said heteroduplex polynucleotide with an effective amount of an agent or agents with proofreading activity, ligase activity, and provided by CEL I or RES I enzyme;
allowing sufficient time for the percentage of complementarity between strands of said heteroduplex polynucleotide to increase, converting said heteroduplex polynucleotide to RNA, and said RNA to a polypeptide; and screening or selecting a population of polypeptide variants for said desired functional property.

Still another embodiment of the present invention provides a method of obtaining a polynucleotide encoding a desired functional property, comprising: preparing at least one heteroduplex polynucleotide, where the heteroduplex is optionally, about 95%, 90%, 85%, 80%, 75%, 62%, 58% or 47% identical, and about 100 base pairs, 1000 base-pairs, 10,000 base-pairs, or 100,000 base-pairs or more in size; combining said heteroduplex polynucleotide with an effective amount of an agent or agents with proofreading activity, ligase activity, and strand cleavage activity provided by CEL I or RES I
enzyme; allowing sufficient time for the percentage of complementarity between strands of the heteroduplex polynucleotide to increase, screening or selecting for a population of variants having a desired functional property; denaturing said population of variants to obtain single strand polynucleotides; annealing said single strand polynucleotides to form at least one second heteroduplex polynucleotide; combining said second heteroduplex polynucleotide with an effective amount of an agent or agents with proofreading activity, ligase activity, and strand cleavage activity provided by CEL I
or RES I enzyme; and allowing sufficient time for the percentage of complementarity between strands of the heteroduplex polynucleotide to increase.

The present invention is directed to a method for generating an improved polynucleotide sequence or a population of improved polynucleotide sequences, typically in the form of amplified and/or cloned polynucleotides, whereby the improved polynucleotide sequence(s) possess at least one desired phenotypic characteristic (e.g., encodes a polypeptide, promotes transcription of linked polynucleotides, binds a protein, improves the function of a viral vector, and the like) which can be selected or screened for. Such desired polynucleotides can be used in a number of ways such as expression from a suitable plant, animal, fungal, yeast, or bacterial expression vector, integration to form a transgenic plant, animal or microorganism, expression of a ribozyme, and the like.

GRAMMR provides for resolution of mismatched base pairs on heteroduplex DNA strands in an in vitro reaction. This reaction begins with cleavage of one strand or the other at or near a mismatch followed by excision of mismatched bases from the cleaved strand and polymerization to fill in the resulting gap with nucleotides that are templated to the sequence of the other strand. The resulting nick can be sealed by ligation to rejoin the backbone. The sum of the separate independent mismatch resolution events that occur throughout the heteroduplex molecule will result in reassortment of sequence information throughout that molecule. The sequence information will reassort in a variety of combinations to generate a complex library of sequence variants.

In one embodiment of GRAMMR, a library of mutants is generated by any method known in the art such as mutagenic PCR, chemical mutagenesis, etc. followed by screening or selection for mutants with a desired property. The mutant DNAs are mixed, denatured to single strands, and allowed to anneal. Partially complementary strands that hybridize will have non-base-paired nucleotides at the sites of the mismatches.
Treatment with CEL I (Oleykowski et al., 1998; Yang et al., 2000), or a similar mismatch-directed activity, such as RES I, will cause nicking of one or the other polynucleotide strands at or near mismatches. In addition, CEL I or RES I can nick at or near an insertion/deletion. The presence of a polymerase containing a proofreading activity (e.g., T4 DNA Pol) will allow excision of the mismatch, and subsequent polymerase activity will fill in the gap using the other strand as a template. A polymerase that lacks 5' to 3' exonuclease activity and strand-displacement activity will fill in the gap and will cease to polymerize when it reaches the 5' end of DNA located at the original CEL I
cleavage site, thus re-synthesizing only short patches of sequence. DNA ligase (e.g., T4 DNA ligase or E. coli DNA
ligase) can then seal the nick by restoring the phosphate backbone. This process can occur simultaneously at many sites and on either strand of a given heteroduplex DNA
molecule. The result is a randomization of sequence differences among input strands to give a population of sequence variants that is more diverse than the population of starting sequences. These output polynucleotides can be cloned directly into a suitable vector, or they can be amplified by PCR before cloning.
Alternatively, the reaction can be carried out on heteroduplex regions within the context of a double-stranded circular plasmid molecule or other suitable replicon that can be directly introduced into the appropriate host following the GRAMMR reaction. In another alternative, the output polynucleotides can be transcribed into RNA polynucleotides and used directly, for example, by inoculation of a plant viral vector onto a plant, such as in the instance of a viral vector transcription plasmid. The resulting clones are subjected to a selection or a screen for improvements in a desired property. The overall process can then be repeated one or more times with the selected clones in an attempt to obtain additional improvements.

If the output polynucleotides are cloned directly, there is the possibility of incompletely resolved molecules persisting that, upon replication in the cloning host, could lead to two different plasmids in the same cell. These plasmids could potentially give rise to mixed-plasmid colonies. If it is desired to avoid such a possibility, the output polynucleotide molecules can be grown in the host to allow replication/resolution, the polynucleotides isolated and retransformed into new host cells.

In another embodiment, when sequence input from more than two parents per molecule is desired, the above procedure is performed in a cyclic manner before any cloning of output polynucleotides. After the GRAMMR
reaction, the double stranded polynucleotides are denatured, allowed to anneal, and the mismatch resolution process is repeated. After a desired number of such cycles, the output polynucleotides can be cloned directly, introduced into a suitable vector, or they can be amplified by PCR before cloning. The resulting clones are subjected to a selection or a screen for improvements in a desired property.

In another embodiment, a "molecular backcross" is performed to help eliminate the background of deleterious mutations from the desired mutations. A pool of desired mutant DNAs can be hybridized to wild-type DNA to perform the method. Clones can be selected for improvement, pooled, and crossed back to wild-type again until there is no further significant change.
The efficiency of the process is improved by various methods of enriching the starting population for heteroduplex molecules, thus reducing the number of unaltered parental-type output molecules. The mismatched hybrids can be affinity purified using aptamers, dyes, or other agents that bind to mismatched DNA. A preferred embodiment is the use of MutS protein affinity matrix (Wagner et al., Nucleic Acids Res. 23(19):3944-3948 (1995); Su et al., Proc. Natl. Acad. Sci. (U.S.A.), 83:5057-5061(1986)) or mismatch-binding but non-cleaving mutants of phage T4 endonuclease VII (Golz and Kemper, Nucleic Acids Research, 1999; 27: e7).

In one embodiment, the procedure is modified so that the input polynucleotides consist of a single strand of each sequence variant. For example, single-stranded DNAs of opposite strandedness are produced from the different parent sequences by asymmetric PCR to generate partially complementary single-stranded molecules. Annealing of the strands with one-another to make heteroduplex is performed as described in EXAMPLE 2. Alternatively, single-stranded DNAs can be generated by preferentially digesting one strand of each parental double-stranded DNA
with Lambda exonuclease followed by annealing the remaining strands to one-another. In this embodiment, the annealing strands have no 100% complementary strand present with which to re-anneal. Hence, there is a lower background of unmodified polynucleotides, that is, "parental polynucleotides" among the output polynucleotides leading to a higher efficiency of reassorting sequence variations. This increased efficiency will be particularly valuable in situations where a screen rather than a selection is employed to test for the desired polynucleotides.

Another method for heteroduplex formation is to mix the double-stranded parent DNAs, denature to dissociate the strands, and allow the single-stranded DNAs to anneal to one-another to generate a population of heteroduplexes and parental homoduplexes. The heteroduplexes can then be selectively enriched by a heteroduplex capture method such as those described above using MutS or a non-cleaving T4 endonuclease VII mutant. Alternatively, the parental homoduplex molecules in the population may be cleaved by restriction enzymes that overlap with sites of mismatch such that they are not cleaved in the heteroduplex but are cleaved in the parental homoduplex molecules. Uncleaved heteroduplex DNA can then be isolated by size fractionation in an agarose gel as was performed to generate full-length plasmid on full-length plasmid heteroduplex DNA molecules as describe in EXAMPLE
9. Nick-sealing in those full-length heteroduplexed plasmid molecules was then brought about by incubation with DNA ligase.

In another embodiment, the parental, or input, double-stranded polynucleotides are modified by the addition of "clamp" sequences. One input polynucleotide or pool of polynucleotides is amplified by PCR with the addition of a unique sequence in the 5' primer. The other input polynucleotide or pool is amplified by PCR
with the addition of a unique sequence in the 3' primer.
The clamp sequences can be designed to contain a unique restriction enzyme site for the 5' end of the gene of interest and another for the 3' end such that, at the step of cloning the products of the GRAMMR reaction, only products with the 5' clamp from the first polynucleotide (or pool) and the 3' end from the second polynucleotide (or pool) will have appropriate ends for cloning.
Alternatively, the products of the GRAMMR reaction can be PCR amplified using the unique sequences of the 5' and 3' clamps to achieve a similar result. Hence, there is a lower background of unmodified polynucleotides, that is, "parental polynucleotides" among the output polynucleotide clones leading to a higher efficiency of reassorting sequence variations. This increased efficiency will be particularly valuable in situations where a screen rather than a selection is employed to test for the desired polynucleotides. Optionally, oligonucleotide primers can be added to the GRAMMR
reaction that are complementary to the clamp primer sequences such that either parent can serve as the top strand, thus permitting both reciprocal heteroduplexes to participate in the mismatch-resolution reaction.
Another method for generating cyclic heteroduplexed polynucleotides is performed where parental double-stranded DNAs have terminal clamp sequences as described above where the single-stranded clamp sequences extending from one end of the heteroduplex are complementary to single-stranded clamp sequences extending from the other end of the heteroduplex. These complementary, single-stranded clamps are allowed to anneal, thereby circularizing the heteroduplexed DNA molecule. Parental homoduplexes that result from re-annealing of identical sequences have only one clamp sequence and therefore, no complementary single-stranded sequences at their termini with which circularization can occur. Additionally, a DNA polymerase and a DNA ligase can be used to fill-in any gaps in the circular molecules and to seal the nicks in the backbone, respectively, to result in the formation of a population of covalently closed circular heteroduplex molecules. As the covalently-closed circular heteroduplex molecules will not dissociate into their component strands if subjected to further denaturating conditions, the process of denaturation, circularization, and ligation can be repeated to convert more of the linear double-stranded parental duplexes into closed into closed circular heteroduplexes.

In another embodiment, a region of a single-stranded circular phagemid DNA can be hybridized to a related, but non-identical linear DNA, which can then be extended with a polymerase such as T7 DNA polymerase or T4 DNA
polymerase plus T4 gene 32 protein, then ligated at the resulting nick to obtain a circular, double-stranded molecule with heteroduplexed regions at the sites of differences between the DNAs. GRAMMR can then be carried out on this molecule to obtain a library of sequence-reassorted molecules.

Alternately, two single-stranded circular phagemid DNAs of opposite strand polarity relative to the plasmid backbone, and parent gene sequences that are the target of the reassortment are annealed to one and other. A
region of extensive mismatch will occur where the phage fl origin sequences reside. Upon GRAMMR treatment, however, this region of extensive mismatch can revert to either parental type sequence restoring a functional fl origin. These double-stranded molecules will also contain mismatch regions at the sites of differences between the strands encoding the parent genes of interest. GRAMMR can then be carried out on this molecule to obtain a library of sequence re-assorted molecule.

As discussed in the preceding paragraphs, the starting DNA or input DNA can be of any number of forms.
For example, input DNA can be full-length, single stranded and of opposite sense, as is taught in EXAMPLE
2. Alternatively, the input DNA can also be a fragment of the full-length strand. The input DNAs can be double-stranded, either one or both, or modified, such as by, methylation, phosphorothiolate linkages, peptide-nucleic acid, incorporation of uracil into the DNA, substitution of RNA in one or both strands, or the like. Either strand of a duplex can be continuous along both strands, discontinuous but contiguous, discontinuous-with overlaps, or discontinuous with gaps.

GRAMMR can also be applied to DNA fragmentation and reassembly-based DNA shuffling schemes. For instance, in methods where gene fragments are taken through cycles of denaturation, annealing, and extension in the course of gene reassembly, GRAMMR can be employed as an intermediate step.
In one such embodiment, the DNA from a gene, or pool of mutant genes is fragmented by enzymatic, mechanical or chemical means, and optionally a size range of said fragments is isolated by a means such as separation on an agarose gel. The starting polynucleotide, such as a wild-type, or a desired variant, or a pool thereof, is added to the fragments and the mixture is denatured and then allowed to anneal. The annealed polynucleotides are treated with a polymerase to fill in the single stranded gaps using the intact strand as a template. The resulting partially complementary double strands will have non-base-paired nucleotides at the sites of the mismatches. Treatment with CEL I (Oleykowski et al., 1998; Yang et al., 2000), or an agent with similar activity, such as RES I, will cause nicking of one or the other polynucleotide strands at or near mismatches.
Addition of a polymerase containing a proofreading activity, such as T4 DNA Polymerase, will allow excision of the mismatch, and subsequent polymerase activity will fill in the gap using the other strand as a template. A
DNA ligase, such as, T4 DNA Ligase, can then seal the nick by restoring the phosphate backbone. The result is a randomization of sequence variation among input strands to give output strands with potentially improved properties. These output polynucleotides can be cloned directly into a suitable vector, or they can be amplified by PCR before cloning. The resulting clones are subjected to a selection or a screen for improvements in a desired property.
In one such embodiment, the DNA from a pool of mutant genes is fragmented by enzymatic, mechanical or chemical means, or fragments are generated by limited extension of random oligonucleotides annealed to parental templates (United States Patent 5,965,408), and optionally a size range of said fragments is isolated by a means such as separation on an agarose gel. The mixture is denatured and then allowed to anneal. The annealed polynucleotides are optionally treated with a polymerase to fill in the single stranded gaps. The resulting partially complementary double-strand fragments will have non-base paired nucleotides at the sites of the mismatches. Treatment with CEL I (Oleykowski et al., 1998; Yang et al., 2000), or an agent with similar activity, such as RES I, will cause nicking of one or the other polynucleotide strand 3' of each mismatch. The activity of a polymerase containing a proofreading activity, such as T4 DNA Polymerase, will allow excision of the mismatch, and subsequent polymerase activity will fill in the gap using the other strand as a template.
Optionally, DNA ligase, such as, T4 DNA Ligase, can then seal the nick by restoring the phosphate backbone. The result is a randomization of sequence variation among input strands to give output strands with potentially improved properties. Subsequent rounds of denaturing, annealing, and GRAMMR allows gene reassembly. PCR can be used to amplify the desired portion of the reassembled gene. These PCR output polynucleotides can be cloned into a suitable vector. The resulting clones are subjected to a selection or a screen for the desired functional property.
Another embodiment of the present invention provides starting with a continuous scaffold strand to which fragments of another gene or genes anneal. The flaps and gaps are trimmed and filled as is described in Coco, et al., Nature Biotech 19 (01)354; United States Patent 6,319,713, and GRAMMR is performed. In this process, GRAMMR would bring about further sequence reassortment by permitting transfer of sequence information between the template strand and the strand resulting from flap and gap trimming and ligation. This method provides the benefits of incorporating specific sequence patches into one continuous strand followed by GRAMMR of residues that mismatch with the scaffold. By annealing many fragments simultaneously to the same sequence or gene, many individual sites can be addressed simultaneously, thereby allowing reassortment of multiple sequences or genes at once. In the present embodiment, the scaffold is not necessarily degraded, rather the duplex can be directly cloned, or amplified by PCR prior to cloning. Exhaustive mismatch resolution will result in a perfectly duplexed DNA. Partial mismatch resolution will result in essentially two different reassorted products per duplex.

As can be appreciated from the present disclosure, GRAMMR can also be applied to a variety of methods that include the annealing of related DNAs as a step in their process. For example, many site-directed mutagenesis protocols call for the annealing of mutant-encoding DNA
molecules to a circular DNA in single-stranded form, either phagemid or denatured plasmid. These DNAs are then extended with a polymerase, followed by treatment with ligase to seal the nick, with further manipulation to remove the parental sequence, leaving the desired mutation or mutations incorporated into the parental genetic background. Though these protocols are generally used to incorporate specific mutations into a particular DNA sequence, it is feasible that the GRAMMR reaction can be applied to the heteroduplexed molecules generated in such a process to reassort sequence variations between the two strands, thereby resulting in a diverse set of progeny with reassorted genetic variation.

Another embodiment provides for sequential rounds of reassortment on only a particular region of the DNA of interest. For example, DNA fragments are annealed to a circular single-strand phagemid DNA, and GRAMMR is performed. The fragments can be treated in order to prevent them from being physically incorporated into the output material. For example, they can be terminated at the 3' end with di-deoxy residues making them non-extendible. Multiple rounds of reassortment can be performed, but only modified molecules from the original input single stranded DNA clone will be recovered. The consequence will be that the DNA fragments used in this reassortment will contribute only sequence information to the final product and will not be physically integrated into the final recoverable product.

GRAMMR can be used for protein, peptide, or aptamer display methods to obtain recombination between library members that have been selected. As fragmentation of the input DNAs is not required for GRAMMR, it may be possible to reassort sequence information between very small stretches of sequence. For instance, DNAs encoding small peptides or RNA aptamers that have been selected for a particular property such as target binding can be reassorted. For annealing to occur between the selected DNA molecules, some level of sequence homology should be shared between the molecules, such as at the 5' and 3' regions of the coding sequence, in regions of the randomized sequence segment that bear similarity because of similar binding activities, or through the biasing of codon wobble-base identity to a particular set of defaults.

Manipulation of the reaction temperature at which GRAMMR is conducted can be useful. For example, lower temperatures will help to stabilize heteroduplexes allowing GRAMMR to be performed on more highly mismatched substrates. Likewise, additives that affect base-pairing between strands, such as salts, PEG, formamide, etc, can be used to alter the stability of the heteroduplex in the GRAMMR reaction, thereby affecting the outcome of the reaction.
Another embodiment provides for zonal mutagenesis by GRAMMR, that is, random or semi-random mutations at, and in the immediate vicinity of, mismatched residues using nucleotide analogues that have multiple base-pairing potential. This provides for concentration of essentially random mutagenesis at a particular point of interest, and adds another benefit to the present invention. Groups of genes that are similar, but have slightly different functions from one-another, for example, many enzymes, will exhibit moderate sequence differences from one-another in regions that will be operative for their own particular activities. These activities, can include substrate preference, binding partners, regulatory sites, or the like. Gene sequences that govern these functions should be heterogeneous within the population of related genes. Since it is known that the specificity of such function is associated with these amino acids and their neighbors, GRAMMR
mutagenesis, in addition to reassorting sequence information between genes, may also be used to direct random mutagenesis to these regions to evolve their function, while not disturbing other sequences, such as structural framework, invariant residues, and other such important sites, that are potentially less tolerant to randomization.

Different enzymes with distinct functions will not differ just in the operative regions, such as active sites and regulatory sites. They are likely to have other differences from one another that arise through genetic drift. Further randomization in the locales of such changes might therefore be considered neutral, minimally important, or deleterious to the outcome of a mutagenesis experiment. In order to direct the random mutagenesis away from such inconsequential sites, and toward sites that might present a better result for random mutagenesis, such as the active site of an enzyme, the codon usage bias of the genes could be manipulated to decrease or increase the overall level of nucleotide complementarity in those regions. If regions of greater complementarity are less susceptible to GRAMMR than regions of lesser complementarity, then the degree of GRAMMER-directed zonal random mutagenesis at a given site can be modulated.

In any DNA shuffling experiment, it is desirable to minimize the proportion of non-shuffled, or parental, DNAs that are obtained within the population of shuffled progeny. Numerous approaches may be used to accomplish this. In a plasmid-on-plasmid DNA shuffling format, where the genes to be shuffled are present on separate, but otherwise identical plasmids, each plasmid is linearized at one or another different unique restriction sites that are present. After removal of the restriction endonucleases, the linearized DNAs are mixed, melted apart, and allowed to anneal so that populations of heteroduplex DNA form that are either nicked, closed circular heteroduplex molecules, or are double stranded and linear homoduplexes. It is the population of circular double-stranded heteroduplex DNA molecules that represents the desired substrate for the GRAMMR reaction.
One can either enrich this desired population by gel fractionation or use one or a number of methods that do not require physical separation of this population, but rather, discourages the recovery of non-shuffled parental molecules. Several such methods are listed below.

First, after GRAMMR reaction of the mixed population of linear parental homoduplex and circular double-stranded heteroduplex, transformation of E. coli is generally performed. Since circular DNA is vastly more efficient at transforming E. coli than its linearized counterpart, the parental homoduplexes can be strongly discriminated against at this step by preventing their circularization into transformation-competent molecules.
The use of E. coli DNA lipase as the ligase component of the GRAMMR reaction will serve to prevent recircularization of parental homoduplex, as it more efficiently seals nicks than joins short cohesive termini that result from restriction endonuclease cleavage.
Additionally, this enzyme very inefficiently ligates blunt ends. As a result of using this strategy, the progeny resulting from transformation of E. coli with the GRAMMR reaction are depleted of non-shuffled parental genes and enriched for molecules that entered the GRAMMR
reaction as heteroduplex substrates.
Another method for excluding parental gene contamination from the population of GRAMMR output molecules is to position the plasmid linearization sites within a selectable marker. The sites should be of sufficient distance from one another to allow annealing to take place between staggered ends of a heteroduplex, and should either have overhangs that can be filled-in or trimmed off, or cause a deletion of sequence upon cleavage. As above, the plasmids containing the genes to be shuffled are linearized at one or other of the sites.
After removal of the restriction endonucleases, the linearized DNAs are mixed, melted, and allowed to anneal.
The resulting sample is made up of a mixture of circular heteroduplexes and of linear homoduplexes. This sample can then be treated with a proofreading polymerase such as T4 DNA polymerase in the presence of dNTPs. The circular homoduplexes should be unaffected, whereas the linear parental homoduplexes will have been blunted at their termini, effectively adding or deleting bases to the sequence of the selectable marker if that molecule becomes recircularized at any point in the GRAMMR
reaction or after transformation into E. coli. If the addition or deletion of these sequences results in disruption of the function of the selectable marker, then the resulting molecules will not be recovered under appropriate selection.

Another method one can use to prevent unshuffled parental contamination of the shuffled library is to dephosphorylate the linearized DNAs prior to melting and annealing. Linear homoduplex molecules will be rendered unable to ligate into circular molecules whereas circular heteroduplexes will simply contain a single nick in each strand, but will still remain circular, and thus competent for efficient transformation into E. coli.
Another method one can use to prevent unshuffled parental contamination of the shuffled library is to digest with enzymes whose recognition sites are overlapped by mismatches in the heteroduplexed molecules.
Digestion of the parental homoduplexes at those sites will render the resulting molecules linear so that they may be subject to any of the treatments described above to reduce parental contamination. The resulting molecules may also be made smaller, facilitating separation from the intact circular heteroduplex molecules.

If, in addition to excluding unshuffled parental molecules from a shuffling experiment, one desires to prevent shuffling between any two or more genes of a population of two or more parent genes, the same principles described above can be applied.

In the current invention the random reassortment occurs in an in vitro DNA mismatch-resolution reaction.
This method does not require any steps of "gene reassembly" that serve as the foundation for the earlier mutation reassortment ("shuffling") methods. Instead, it is based upon the ability of a reconstituted or artificial DNA mismatch resolving system to transmit sequence variations from one or more strands of DNA into another DNA strand by hybridization and mismatch resolution in vitro.
In general, standard techniques of recombinant DNA
technology are described in various publications, e.g., (Ausubel, 1987; Ausubel, 1999; Sambrook et al., 1989).
Polynucleotide modifying enzymes were used according to the manufacturer's recommendations. If desired, PCR
amplimers for amplifying a predetermined DNA sequence may be chosen at the discretion of the practitioner.
It is noted that each of the activities taught in the present invention that are involved in the GRAMMR
reaction can be interchanged with a functional equivalent agent with similar activity, and that such changes are within the scope of the present invention. For instance, as was indicated in EXAMPLE 6, Taq DNA ligase could substitute for T4 DNA ligase. Other ligases can be substituted as well, such as E. coif DNA ligase.
Likewise, as shown in EXAMPLE 12, T7 DNA polymerase can be substituted for T4 DNA polymerase. Other enzymes with appropriate proofreading activity can function in place of any of these enzymes for the proofreading activity needed for the GRAMMR reaction. In a similar way, any polymerase with functionally equivalent activity to those demonstrated to work for GRAMMR can be used for substitution.

Strand cleavage may be brought about in a number of ways. In addition to CEL I, a number of functionally equivalent, and potentially similar activities found in extracts from a variety of plant species (Oleykowski, Nucleic Acids Res 1998;26:4597-602) may be used. Other mismatch-directed endonucleases such as T4 endonuclease VII, T7 endonuclease I, and SP nuclease (Oleykowski, Biochemistry 1999; 38: 2200-5) may be used. Another particularly useful mismatch-directed endonuclease is RES

I.
CEL I and RES I can be modified to obtain enzyme variants with desired properties. Homologous nucleic acid sequences from other sources can be found by surveying plants. Alternatively, CEL I or RES I can be mutated, and opposite strands with less than 100% identity can be brought together to form a heteroduplex molecule. The present method disclosed herein or another method can be used to evolve new CEL I and RES I enzyme variants.

CEL I IS A MISMATCH ENDONUCLEASE
CEL I is a mismatch endonuclease isolated from celery. The use of CEL I in a diagnostic method for the detection of mutations in targeted polynucleotide sequences, in particular, those associated with cancer, is disclosed in U.S. Patent No. 5,869,245. Methods of isolating and preparing CEL I are also disclosed in this patent. However, there is no disclosure in this patent relating to the use of CEL I in DNA sequence reassortment.

Nucleic acid molecules that encode CEL I are disclosed in PCT Application Publication No. WO 01/62974 Al. As with U.S. Patent No. 5,869,245, the use of CEL I
in a diagnostic method for the detection of mutations in targeted polynucleotide sequences associated with cancer is disclosed. Also similarly, there is no disclosure relating to the use of CEL I in DNA sequence reassortment.
RES I IS A MISMATCH ENDONUCLEASE

The use of RES I endonuclease is contemplated in diagnostic methods for the detection of mutations in targeted polynucleotide sequences, in particular, those associated with cancer. Examples of some of these types of diagnostic methods are disclosed in U.S. Patent No.
5,869,245, and Del Tito, et al.. The use of RES I is also contemplated in methods for detecting mutations in large genomic regions Sokurenko, et al., and for mutation screening methods such as TILLING as disclosed in McCallum, et al.

The reactivity of Endonuclease VII of phage T4 with DNA-loops of eight, four, or one nucleotide, or any of 8 possible base mismatches in vitro is disclosed in "Endonuclease VII of Phage T4 Triggers Mismatch Correction in Vitro" Solaro, et al., J Mol Biol 230(93)868. The publication reports a mechanism where Endonuclease VII introduces double stranded breaks by creating nicks and counternicks within six nucleotides 3' of the mispairing. The publication discloses that a time delay between the occurrence of the first nick and the counternick was sufficient to allow the 31-5' exonuclease activity of gp43 to remove the mispairing and its polymerase activity to fill in the gap before the occurrence of the counternick. Nucleotides are erased from the first nick, which is located 3' of the mismatch on either strand and stops 5' of the mismatch at the first stable base-pair. The polymerase activity proceeds in the 5' to 3' direction towards the initial nick, which is sealed by DNA ligase. As a result, very short repair tracks of 3 to 4 nucleotides extend across the site of the former mismatch. The publication concludes with a discussion regarding the various activities Endonuclease VII may have within phage T4. However, the publication does not disclose any practical utility for Endonuclease VII outside of phage T4, and there is no disclosure regarding its applicability in DNA reassortment.
Methods of creating libraries of chimeric DNA
sequences in vivo in Escherichia coli are disclosed in Nucleic Acids Research, 1999, Vol 27, No. 18, e18, Volkov, A. A., Shao, Z., and Arnold, F.H. Abostado, J.P., et. Al., (1984). Proc Natl Acad Sci USA 81(18): 5792-5796. Cami, B.P., et al., (1984). Proc Natl Acad Sci USA
81(2): 503-507. Chang, S.D., et al., (1984). Gene 29(3):
255-261. The methods use heteroduplexes formed in vitro to transform E. coli where repair of regions of non-identity in the heteroduplex creates a library of new, recombined sequences composed of elements of each parent.
Although the publications disclose the use of this method as a convenient addition to existing DNA recombination methods, the disclosed methods are limited to the in vivo environment of E. coli. Volkov, A.A., et al., Methods in Enzymology 328: 456-463(2000) Academic Press, Inc., San Diego state that there is more than one mechanism available for mismatch repair in E. coli, and speculates that the `long patch' repair mechanism, which utilizes the MutS/L/H enzyme system, was probably responsible for the heteroduplex repair.

The following non-limiting examples are provided to illustrate the present invention.
CLONING, EXPRESSION AND PURIFICATION
OF CEL I ENDONUCLEASE

This example teaches the preparation of nucleic acid molecules that were used for expressing CEL I
endonuclease from plants, identified herein as, p1177MP4-CEL I Avr (SEQ ID NO: 1), and p1177MP4-CEL I 6HIS (SEQ ID
NO: 2). In particular, this example refers to disclosures taught in U.S. Patents No. 5,316,931, 5,589,367, 5,866,785, and 5,889,190.

Celery RNA extraction:
Celery was purchased from a local market. Small amounts of celery tissue (0.5 to 0.75 grams) were chopped, frozen in liquid nitrogen, and ground in a mortar and pestle in the presence of crushed glass.
After addition of 400 microliters of Trizol and further grinding, 700 microliters of the extract were removed and kept on ice for five minutes. Two hundred microliters of chloroform were then added and the samples were centrifuged, left at room temperature for three minutes, and re-centrifuged at 15,000g for 10 minutes. The aqueous layer was removed to a new tube and an equal volume of isopropanol was added. Tubes were inverted to mix and left at room temperature for 10 minutes followed by centrifugation at 15,000g for ten minutes at 4 C. The pellet was washed twice in 400 microliters of 70%
ethanol, once in 100% ethanol, air dried, and resuspended in 40 microliters of distilled water. One microliter of RNasin was added and 3.5 microliters was run on a 1%
agarose gel to check the quality of the RNA prep (Gel picture). The remainder was stored at -70 C until further use.

Cell gene cloning and expression by a viral vector:
The total RNA from celery was subjected to reverse transcription followed by PCR to amplify the cDNA
encoding the Cell gene sequence. In separate reactions, eleven microliters of the total celery RNA prep was mixed with one microliter (50 picomoles) of either CelI-Avr-R, CelI-6H-R, or with two microliters of oligo dT primer.
CelI-Avr-R was used to prime cDNA and amplify the native Cell sequence at the 3' end of the gene, while CelI-6H-R
was used to add a sequence encoding linker peptide and a 6-His tag to the 3' terminus of the Cell gene. The samples were heated to 70 C for one minute and quick-chilled on ice prior to the addition of 4 microliters of 5X Superscript II buffer, two microliters of 0.1M DTT, 1 microliter of 10mM each dNTP, and 1 microliter of Superscript II (Gibco/BRL) to each reaction. The reactions were incubated at 42 C for one hour.

PCR amplification of the Cell cDNA sequence was performed using the method of W.M. Barnes (Prot Natl Acad Sci. USA, 1994 Mar 15;91(6) :2216-20) with a Taq-Pfu mixture or with Pfu alone. The RT reaction primed with CelI-Avr-R was used as template for a PCR using primers CelI-Pac-F (as the forward primer) paired with CelI-Avr-R
(as the reverse primer). In other PCRs, the RT reaction that was primed with oligo dT was used as template for both of the above primer pairs. All PCR reactions were performed in 100 microliters with 30 cycles of annealing at 50 C and two minutes of extension at 72 C. Aliquots of the resulting reactions were analyzed by agarose gel electrophoresis. Reactions in which Pfu was used as the sole polymerase showed no product. All reactions performed with the Taq/Pfu mixtures yielded product of the expected size. However, those amplified from cDNA
primed with Cell specific primer pairs gave more product than reactions amplified from cDNA primed with oligo-dT.
DNAs from the PCR reactions that gave the most product were purified using a Zymoclean DNA spin column kit and digested with Pacl and AvrII, gel-isolated, and ligated into Pacl and AvrII-digested plasmid pRT130, a tobamovirus-based GENEWARE vector. 2 microliters of each ligation were transformed into DH5a competent E.
coli and cultured overnight on LB-amp agar plates.
Colonies were picked and grown overnight in liquid culture, and plasmid DNA was isolated using a Qiagen plasmid prep kit. 12 clones from each construct were screened by digestion with Pacl and AvrII and 11 of 12 of each set were positive for insert of the correct size.
Ten of the clones for each construct were transcribed in-vitro and RNA was inoculated to N. benthamiana plants.
In addition, the CELI gene inserts in both sets of ten clones were subjected to sequence analysis. Several clones containing inserts encoding the native form of CEL
I had sequence identical to the published Cell sequence in WO 01/62974 Al. One clone containing an insert encoding CEL I fused to a 6-Histidine sequence was identical to the published Cell sequence. One clone of each (pRT130-CEL I Avr-B3 and pRT130-CEL I 6His-A9, respectively) was selected for further work. The CEL I-encoding sequences in these clones were subsequently transferred to another GENEWARE vector. The sequences of these clones, pll77MP4- CEL I Avr-B3, and pll77MP4-CEL
I 6His-A9 are provided as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.
Assay of cloned CEL I activities:

To determine whether the GENEWARE constructs containing Cell sequences could produce active CEL I
enzyme, samples of pRT130-CEL I Avr and pRT130-CEL I
6His, and GFP-GENEWARE control-infected plants were harvested and homogenized in a small mortar and pestle in Tris-HC1 at pH 8Ø Extracts were clarified and assayed for supercoiled DNA nicking activity. Each supercoiled DNA nicking assay was performed in a reaction containing 0.5 micrograms of a supercoiled plasmid prep of a pUC19-derivative in 1X NEB ligase buffer in a total volume of 10 microliters. The amounts of plant extract added to the reactions were 0.1 microliter, 0.01 microliter, or 0.001 microliter, incubated at 42 C for 30 minutes, and run on a 1% TBE-agarose gel in the presence of ethidium bromide. Little or no nicking activity was detected in the GFP-GENEWARE control-infected plant extract whereas extracts from plants infected with the CEL I-GENEWARE
constructs showed appreciable amounts of activity against the plasmid DNA substrate.

Additional activity assays were performed on extracts of plants inoculated with pRT130-CEL I Avr-B3 and pRT130-CEL I 6His-A9. In these assays, intracellular fluid was washed from infected leaves and assayed separately from material obtained from the remaining washed leaf tissues. Assays were performed as described above with the exception that the incubation was at 37 C
for one hour. Samples were run on a 1% TBE-agarose gel in the presence of ethidium bromide and photographed.
Purification of 6His-tagged CEL I from infected N.
benthamiana plants:
N. benthamiana plants were inoculated with RNA
transcripts from pRT130-CEL I 6His-A9 at 20-21 days post-sowing. Tissues were harvested from 96 infected plants at 10 days post-inoculation and subjected to intracellular fluid washes. Briefly, infected leaf and stem material was vacuum infiltrated for 30 seconds twice with chilled infiltration buffer (50 mM phosphate pH 4 in the presence of 7 mM j3-ME). Infiltrated tissues were blotted to adsorb excess buffer and secreted proteins were recovered by centrifugation at 2500x g for 20 min using basket rotor (Beckman). PMSF was added to the extracted intracellular fluid (IF) containing recombinant CEL I to a final concentration of 1 mM, and incubated at 25 C for 15 min with stirring. After addition of Imidazole (pH 6.0) and NaCl to the extract to the final concentration of 5 mM and 0.5 M respectively, IF was adjusted to pH 5.2 and filtered through 1.2 Sartorius GF membrane (Whatman) to remove most of the Rubisco and green pigments. Immediately after clarification, pH was adjusted to 7.0 using concentrated NaOH solution and incubated on ice for 20 min to allow non-proteinaceous material to precipitate. IF was further clarified using 0.8 g or 0.65/0.45 j. Sartorius GF (Whatman). Recombinant CEL I was purified from the clarified IF by metal chelating affinity chromatography using Nit' Fast Flow Sepharose (Amersham Pharmacia Biotech, NJ) equilibrated with binding buffer (50 mM phosphate, 0.5 M NaCl; pH 7.0) containing 5 mM imidazole, with a linear velocity of 300 cm/hr. Unbound protein was washed with 20 mM
imidazole/binding buffer, and CEL I was eluted from NiZ+
TM
Sepharose with a linear gradient of 20 to 400 M imidazole in the binding buffer. Fractions still containing imidazole were assayed for supercoiled DNA nicking activity as described above but were found to have negligible activity. The same fractions were then dialyzed against 0.1 M Tris-HC1, pH 8.0 in the presence of ZnC12 using 10 kD molecular weight cutoff dialysis tubing (Pierce) and assayed again. The supercoiled DNA
nicking activity was restored after this dialysis.

IF and purified CEL I protein were analyzed using Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) precast Tris-glycine gels (Invitrogen, TM
Carlbad, CA) in the buffer system of Laemmli with a Xcell II Mini-Cell apparatus (Invitrogen, Carlsbad, CA). The protein bands were visualized by Coomassie brilliant blue and by silver staining. SDS-PAGE Gels were scanned and analyzed using Bic-Rad gel imager.

Mass spectrometry of purified CEL I:
The average molecular mass of the purified CEL I was determined by matrix-assisted laser/desorption ionization time-of-flight mass spectrometry (MALDI-TOF). An aliquot of CEL I was diluted 1:10 with 50% acetonitrile/water and mixed with sinapinic acid matrix (1:1 v/v) using a PE
Biosystem DE-Pro mass spectrometer. The mass spectrometry was performed using an accelerating voltage of 25 kV and in the positive-linear ion mode.
Mass spectrometry of peptides isolated from purified CEL I:
CEL I was separated on SDS-PAGE on a 14% gel and stained with Coomassie brilliant blue. A single homogenous band was visible. This band was excised and de-stained completely. Protein was reduced in the presence of 10 mM DDT in 50% acetonitrile for 30 min at 37 C and reduced sulfhydro groups were blocked in the presence of 2B mM iodoacetamide in 50% acetonitrile for 30 min at 24 C in absence of light. Gel pieces were washed with 50% acetonitrile and after partial dehydration, the excised CEL I band was macerated in a solution of high purity trypsin (Promega). The proteolytic digestion was allowed to continue at 37 C for 16 h. The resulting peptides were eluted from gel pieces with a 50% acetonitrile and 0.1 % tri-fluoro-acetic acid TM
(TFA) concentrated in a SpeedVac. The peptides were analyzed by MALDI-TOF. Mixed tryptic digests were crystallized in a matrix of a-cyano-4-hydroxycinnamic acid and analyzed by using a PerSeptive Biosystem DE-STR
MALDI-TOF mass spectrometer equipped with delayed extraction operated in the reflector-positive ion mode and accelerating voltage of 20 kV. Expected theoretical masses were calculated by MS-digest (Protein Prospector) or GPMAW program (Lighthouse Data, Odense, Denmark). For tandem mass spectrometry (nano electrospray ionization (ESI), peptide samples were diluted with 5%
acetonitrile/0.1% formic acid and subjected to LC MS/MS, analyzed on a quadropole orthogonal time-of-flight mass spectrometry instrument (micromass, inc., Manchester, UK). The data were processed by Mslynx and database was TM
searched by Sonar.

Virally expressed, recombinant CEL I was secreted to the IF. Clarified IF-extracted material was used to purify the His-tag CEL I activity. CEL I was purified using one step Ni2'affinity chromatography separation. A
highly purified homogeneous single protein band was purified as determined by Coomassie stained SDS-PAGE and mass spectrometry. The size of mature proteins and percent glycosylation concur with what has been reported for the CEL I protein isolated from celery (Yang et al., 2000). The purified CEL I has an average molecular mass of 40 kD as determined by MALDI-TOF mass spectrometry, indicates 23.5% glycosylation by mass. CEL I has four potential glycosylation cites at amino acid positions 58, 116, 134, and 208. A mono-isotopic mass of 2152.6086 (2152.0068 Theoretical) Da corresponding to the mass of the peptide 107-125 (K)DMCVAGAIQNFTSQLGHFR(H) (SEQ ID NO:
35) that was recovered by MALDI-TOF, indicates that asparagine 116 is not glycosylated. Together, these gel analyses and mass spectrometry data indicate that a significant fraction of the CEL I protein was recoverable, and that the protein was correctly processed in the N. benthamiana plant.

For subsequent experiments, the 6-His tagged CEL I
enzyme was produced using p1177MP4-CEL I 6His-A9. This clone was transcribed and inoculated onto N. benthamiana plants, which were harvested 8 days post infection. The plant material was combined with 2 volumes of extraction buffer (500 mM NaCl, 100 mM NaPi, 25 mM Tris pH 8.0, 7mM
Beta-mercaptoethanol, 2mM PMSF) and vacuum infiltrated.
Following buffer infiltration the tissue was macerated in a juice extractor, the resulting green juice adjusted to 4% w/v polyethyleneglycol, and let stand at 4 C for one hour. The green juice was clarified by either centrifugation at low speed (3500 x g) for 20 minutes or combined with perlite (2% w/v) and filtered through a 1.2 m filter. The tagged CEL I can be selectively purified from the clarified green juice by metal affinity chromatography. The green juice was either combined with nickel-NTA resin, and batch binding of the CEL I
performed, or purification was performed in column format, where the green juice was permitted to flow through a bed of nickel-NTA resin. For binding, the clarified green juice was adjusted to 10% w/v glycerol and 10 mM imidazole. Following binding the resin was washed extensively with wash buffer (330 mM NaCl, 100 mM
NaPi, pH 8.0, 10 mM imidazole) and the bound CEL I enzyme eluted from the nickel-NTA resin in 2 resin-bed volumes of 1X phosphate-buffered saline (PBS) containing 400 mM
imidazole. The CEL I preparation was subsequently dialyzed against 1X PBS to remove the imidazole, assayed for activity, and stored at 4 C or at -20 C with or without glycerol until use.

Example 2 Cleavage of Mismatched DNA Substrate by CEL I

This example teaches the preparation of CEL I enzyme and its use in the cleavage of mismatched DNA substrate.
CEL I enzyme was prepared from celery stalks using the homogenization, ammonium sulfate, and Concanavalin A-Sepharose protocol described by Yang et al.
(Biochemistry, 39:3533-3541 (2000).
A 1.5 kg sample of chilled celery stalks was homogenized with a juice extractor. One liter of juice was collected, adjusted to 100 mM Tris-HCL, pH 7.7 with 100 micromolar phenylmethylsulfonyl fluoride (PMSF), TM
and filtered through two layers of miracloth. Solid (NH4)2SO4 was slowly added to 25% saturation while stirring on ice. After 30 minutes, the suspension was centrifuged at 27,000g for 1.5 hours at 4 C. The supernatants were collected and adjusted with solid (NH4)2SO4 to 80o saturation while stirring on ice followed by centrifugation at 27,000g for 2 hours. The pellets were re-suspended in buffer B (0.1 M Tris-HCL, pH 7.7, 0.5 M KC1, 100 micromolar PMSF) and dialyzed against the same buffer.

Conconavalin A (ConA) Sepharose affinity chromatography was performed by first incubating the dialyzed sample with 2 ml of ConA resin overnight with gentle agitation. The ConA resin was then packed into a 0.5 cm diameter column and washed with several column volumes of buffer B. Elution was performed using 0.3 M
alpha-methyl-mannoside in buffer B. Fractions were collected in 1 ml aliquots. Fractions were assayed for mismatch cleavage activity on a radiolabeled mismatch substrate by incubating 0.1 microliter of each fraction with the mismatched probe in buffer D (20 mM Tris-HCL, pH
7.4, 25 -,14 KCL, 10 ~~M MgC12) for 30 minutes at 45 C as described by Oleykowski et al. (Nucleic Acids Research 26: 4597-4602 (1998).
Reaction products were visualized by separation on 10%
TBE-PAGE gels containing 7% urea (Invitrogen) , followed by autoradiography. Aliquots of the CEL I fractions having mismatch cleavage activity were stored frozen at -20 C. A series of five-fold dilutions of CEL I fraction #5 were then analyzed for mismatch cleavage of radiolabeled mismatch substrate. Reactions were performed either in buffer D, New England BioLabs (NEB) T4 DNA ligase buffer (50 mM Tris-HCL, pH 7.5, 10 mM MgC12, 10 mm dithiothreitol (DTT), 1 mM ATP, 25 microgram/ml BSA), or Gibco/BRL T4 DNA ligase buffer (50 mM Tris-HCL, pH 7.6, 10mM MgCl2, 1 mM DTT, 1 mM ATP, 5%(w/v) polyethylene glycol-8000). Reaction products were visualized as above. Cleavage activity in buffer D and in NEB T4 DNA ligase buffer were found to be roughly equivalent, whereas cleavage in the PEG-containing Gibco/BRL ligase buffer was enhanced by five to ten-fold compared to the other buffers.
Additional analysis of CEL I activity was carried out using defined heteroduplex DNAs from two different Green Fluorescent Protein (GFP) genes as substrate. This GFP heteroduplex substrate was prepared by annealing single stranded DNAs corresponding to cycle 3 GFP (SEQ ID
NO: 30) on the sense strand and wild-type GFP (SEQ ID NO:
29) on the antisense strand. The single-stranded DNAs had been synthesized by asymmetric PCR and isolated by agarose gel electrophoresis. After annealing by heating to 90 C and cooling to room-temperature in the presence of 1X NEB restriction enzyme buffer 2 (10 mM Tris-HCL, pH
7.9, 10 MM MgC12, 50 mM NaCl, 1 mM dithiothreitol) , the heteroduplex DNA was isolated by agarose gel electrophoresis followed by excision of the heterduplex band and extraction using Qiaquick DNA spin columns. A
total of twenty eight mismatches, one or two nucleotides in length, occur throughout the length of the heteroduplex molecule. The distribution of the mismatches ranges from small clusters of several mismatches separated by one or two nucleotides to mismatches separated by more than thirty base pairs on either side.

A series of three-fold dilutions of CEL I in 1X NEB
T4 DNA ligase buffer were prepared and one microliter aliquots of each were incubated in two separate series of 10 microliter reactions, each containing as substrate either 0.5 microgram of a supercoiled plasmid preparation or one hundred nanograms of the cycle3/wild-type GFP
heteroduplex. All reactions took place in 1X NEB T4 DNA
ligase buffer. Reactions were incubated at 45 C for 30 minutes and run on 1.5% TBE-agarose gel in the presence of ethidium bromide.
Treatment of the supercoiled plasmid preparation with increasing amounts of CEL I resulted in the conversion of supercoiled DNA to nicked circular, then linear molecules, and then to smaller fragments of DNA of random size. Treatment of the mismatched GFP substrate with the CEL I preparation resulted in the digestion of the full-length heteroduplex into laddered DNA bands which are likely to represent cleavage on opposite DNA
strands in the vicinity of clusters of mismatches.
Further digestion resulted in the conversion of the mismatched GFP substrate to smaller DNAs that may represent a limit digest of the heteroduplex DNA by the CEL I preparation.

Use of Cloned CEL I in the GRAMMR Reaction This example teaches that CEL I from a cloned source can be used in place of native CEL I enzyme purified from celery in Genetic Reassortment By DNA Mismatch Resolution without any noticeable change in results.

The cDNA of Cell was cloned from celery RNA. The gene was inserted into a TMV viral vector and expressed.
Transcripts of the construct were used to infect Nicotiana benthamiana plants. Infected tissue was harvested, and the CEL I enzyme was purified. The results of the GRAMMR reaction obtained using the purified enzyme were compared to those using CEL I
purified from celery, and were found to be similar.
Reactions were set up using twenty-one nanograms of the circular double-stranded heteroduplexed GFP plasmid substrate, as described in EXAMPLE 3, in ten microliters containing 1X NEB ligase buffer, 0.5 mM each dNTP, 0.2 units T4 DNA ligase (Gibco/BRL), 1 unit of T4 DNA
polymerase, and either 1.0 microliter of CEL I purified from celery (fraction 5, described in EXAMPLE 2), or 0.3 microliters of CEL I purified from a cloned source.
After 30 minutes, one microliter aliquots of each reaction were transformed into competent DH5-alpha E.
coli which were then plated on LB amp plates. Colonies were picked and cultured. Plasmid DNA was extracted and examined by RFLP analysis followed by sequence analysis of the GFP gene sequences. The RFLP results showed that reassortment of restriction sites, that is, GRAMMR had occurred in both celery-derived CEL I, as well as cloned CEL I-containing reactions. DNA sequence analysis confirmed these results. Therefore, the data shows CEL I
from a cloned source can be used in lieu of CEL I from celery for GRAMMR. In addition, the data demonstrates that it is CEL I activity that is part of the GRAMMR
reaction, rather than a coincidental effect resulting from the purifying steps used in extracting CEL I from celery.

Cloning, Expression And Use Of RES I Endonuclease .This example teaches the construction of a cDNA
library from Selaginella lepidophylla, the identification of a nucleic acid sequence from the library that encodes an endonuclease, and the expression of the new endonuclease, herein designated as "RES I."RNA was extracted from tissues of the resurrection plant, Selaginella lepidophylla, using the Trizol method, and oligo-dT primed cDNA that was prepared using standard methodology. Resulting cDNAs were ligated into a GENEWARE -based cloning vector and the ligation products were transformed into competent E. coli cells. Bacterial colonies containing GENEWARE cDNA clones were picked at random and grown as liquid cultures prior to DNA prepping and determination of the cloned cDNA sequences. The sequence files for the cloned Selaginella cDNAs were loaded into a database which was then searched by BLAST
analysis for sequences that had similarity to the DNA
sequence of the Cell gene. BLAST analysis was also performed on other DNA sequence databases containing sequences of cDNAs obtained from other species.

BLAST hits that showed some level of homology to the celery Cell sequence were identified in libraries from several species and the corresponding GENEWARE -cDNA
clones were re-arrayed into a single set of GENEWARE -cDNA clones. This set of cDNA clones was then transcribed in vitro to generate infectious GENEWARE
transcripts which were then inoculated onto leaves on Nicotiana benthamiana plants for expression analysis of the cDNA sequences encoded within the GENEWARE viral genome. At seven days post-inoculation, leaf samples were taken from the infected plants and homogenized in two volumes of water. The extracts were then assayed for supercoiled DNA nicking and cleavage activity.

Each supercoiled DNA nicking assay was performed in a reaction containing 0.5 micrograms of a supercoiled plasmid prep of a pUC19-derivative in 1X NEB T4 DNA
lipase buffer in a total volume of 10 microliters. The amounts of plant extract added to the reactions were 1 microliter, 0.33 microliter, or 0.011 microliter, incubated at 37 C for 30 minutes, and run on a 1% TAE-agarose gel in the presence of Gelstar fluorescent DNA
staining reagent. Little or no nicking activity was detected in uninfected plant extracts whereas only extracts from plants infected with GENEWARE constructs containing cDNAs for a single gene from Selaginella lepidophylla showed appreciable amounts of activity against the plasmid DNA substrate.

The complete gene sequences of these clones were determined and PCR primers were designed to amplify the open reading frame minus any non-coding 5' and 3' sequences and to add a six histidine tail to the C-terminus of the encoded protein. The primers were then used to amplify the ORF from one of the active full-length Selaginella clones. The resulting PCR product was then cloned into the GENEWARE vector pDN4 between the Pacl and AvrII sites for expression in planta. The resulting clone, pLSB2225, which contains the Resl ORF
(SEQ ID NO: 16), and which encodes the RES I protein (SEQ
ID NO: 34), was sequenced to confirm that the gene had been inserted correctly, and then transcribed in vitro followed by inoculation of the infectious transcripts onto N. benthamiana plants. Seven days post inoculation, infected plant extracts were made as above and assayed for supercoiled DNA nicking and digestion activity to confirm the activity of the cloned enzyme.

Each supercoiled DNA nicking assay was performed in a reaction containing 0.5 micrograms of a supercoiled plasmid prep of a pUC19-derivative in 1X NEB E. coli DNA
ligase buffer in the presence of 50 mM KC1 in a total volume of 10 microliters. The amounts of plant extract added to the reactions were 0.2 microliter, 0.04 microliter, 0.008 microliter, or 0.0016 microliter, incubated at 37 C for 30 minutes, and run on a 0.8% TAE-agarose gel in the presence of Gelstar fluorescent DNA
staining reagent. Little or no nicking activity was detected in uninfected plant extracts whereas extracts from plants infected with the GENEWARE -Selaginella construct pLSB2225 showed appreciable amounts of activity against the plasmid DNA substrate.

After positive results were obtained in that assay, extracts of pLSB2225 infected plants were used in a GRAMMR reaction to test the ability of this enzyme to operate as a component of the mismatch resolution reaction in place of the GENEWARE -produced CEL I enzyme.

Use of RES I in the GRAMMR Reaction This example teaches that RES I can be used in place of native CEL I enzyme purified from celery in Genetic Reassortment By DNA Mismatch Resolution without any noticeable change in results.

GRAMMR was performed between the wild-type Aequorea victoria GFP gene (Prasher, et al., Genelll(92)229) in a pBS derivative (Stratagene, La Jolla, CA) encoded by pBSWTGFP (SEQ ID NO:31) and a variant with mutations to increase fluorescence intensity in E. coli, and to alter the emission wavelength to blue light emission (Crameri, et al., Nat Biotechnol 14(96)315; Heim et al., PNAS91(94)12501; Yang, et al., J Biol Chem 273(98)8212).
This variant gene (SEQ ID NO: 33), encoded by the plasmid pBSC3BFP, as shown in Figure 5 (SEQ ID NO: 32), encodes a fluorescent protein that emits bright blue light when excited by longwave UV light.
The GRAMMR reactions were performed on GFP/c3BFP
heteroduplexes in a circular, double-stranded plasmid DNA
context. The circular, whole-plasmid heteroduplex DNA
substrates were prepared by first linearizing pBSWTGFP
(SEQ ID NO:31) and pBSC3BFP (Figure 5, SEQ ID NO: 32) by digestion with Kpn I and NgoM IV, respectively, then purifying the digested DNA using DNA spin columns. Next, 200 nanograms of each of the two linearized plasmids were mixed and brought to 1X SSPE (180 nM NaCl, 10 mM NaH2PO4, 1mM EDTA at pH 7.4) in a volume of 20 microliters. The mixture was then incubated at 95 degrees Celsius for 4 minutes, plunged into icewater where it remained for 10 minutes prior to incubation at 37 degrees Celsius. After 30 minutes, the annealed DNA sample was then transferred back to ice where it was held until use in GRAMMR
reactions.

Two independent series of shuffling reactions were performed to compare CEL I with RES I in their abilities to facilitate sequence shuffling by GRAMMR. Each GRAMMR
reaction contained 1 unit of T4 DNA polymerase, 2 units of E. coli DNA ligase, and 5 nanomoles of each dNTP in 1X
NEB E. coli ligase buffer supplemented with KC1 to 50 mM.
Two separate enzyme dilution series were then performed.
To each of two series of tubes containing aliquots of the above cocktail, one microliter aliquots of GENEWARE -expressed CEL I or RES I extracts at dilutions of 1/3, 1/9, 1/27, 1/81, or 1/243 were added. An endonuclease-free control reaction was also prepared. To each of the reactions, one microliter aliquots containing 20 nanograms of the annealed DNA heteroduplex substrate were added and the reactions incubated at room temperature for one hour and on ice for 30 minutes prior to transformation into competent E. coli.

Green fluorescent protein (GFP) and blue fluorescent protein (BFP) could be visualized in the resulting colonies by long wave UV illumination. The parental wild-type GFP has dim green fluorescence, and the parental c3BFP gave bright blue fluorescence. In the genes encoding these fluorescent proteins, the sequences that determine the emission color and those that govern fluorescence intensity are at different positions from one another. It is expected that DNA shuffling would result in the "de-linking" of the sequences that determine the emission color from those that govern fluorescence intensity. As a consequence, the resultant progeny would be expected to exhibit reassortment of the functional properties of emission color and intensity.
Therefore a measure of the extent of the DNA shuffling that had taken place in each reaction could be scored by examining the color and intensity of fluorescence from the bacterial colonies on the corresponding plates. In the zero-nuclease control, only dim green and bright blue colonies were observed. However, on plates with cells transformed with DNAs from the reactions containing either CEL I or RES I, some bright green as well as some dim blue colonies were observed, indicating that shuffling of DNA sequences had taken place. DNA sequence analysis confirmed that this was indeed the case and that on average, the recovery of shuffled clones was greater than 85% for both CEL I and RES I and that the number and distribution of information transfer events was similar for both enzymes. However, it appeared that the activity of RES I in this experiment was several-fold higher than that of CEL I, as indicated by the low transformation efficiency of reactions treated with the higher concentrations of the RES I preparation.

Conservation of Full Length GFP Gene with Mismatch Resolution Cocktails This example teaches various mismatch resolution cocktails that conserve the full length GFP Gene.
Mismatched GFP substrate was treated with various concentrations of CEL I in the presence of cocktails of enzymes that together constitute a synthetic mismatch resolution system. The enzymes used were CEL I, T4 DNA
polymerase, Taq DNA polymerase and T4 DNA ligase. CEL I
activity should nick the heteroduplex 3' of mismatched bases. T4 DNA polymerase contains 31-5' proofreading activity for excision of the mismatched base from the nicked heteroduplex. T4 DNA polymerase and Taq DNA
polymerase contain DNA polymerase capable of filling the gap. T4 DNA ligase seals the nick in the repaired molecule. Taq DNA polymerase also. has 5' flap-ase activity.

Matrix experiments were performed to identify the reaction conditions that would serve to resolve mismatches in the GFP heteroduplex substrate. In one experiment, cycle 3/wild-type GFP heteroduplex was incubated in a matrix format with serial dilutions of CEL
I fraction number five (described above) at eight different concentrations. Each reaction contained 100 nanograms of heteroduplex substrate and 0.2 microliters of T4 DNA ligase (Gibco BRL) in 1X NEBT4 DNA ligase buffer and dNTPs at 250 micromolar each, in a reaction volume of 10 microliters. In all, the matrix contained 96 individual reactions. One full set of reactions was incubated at room temperature for 30 minutes while another full set was incubated at 37 C for 30 minutes.
After incubation, PCR was used to amplify the GFP
gene from each reaction. Aliquots from each PCR were then digested with Hindlll and HpaI and electrophoresed on 3% agarose gels with ethidium bromide. Only cycle 3 GFP has a Hindlll site and only wild-type encodes an HpaI
site.

If DNA mismatch resolution occurred at either the HindlIl or HpaI mismatched sites, then a proportion of the PCR product would be expected to contain both sites, yielding a novel band. The band was observed in all samples, including the negative control samples that had neither CEL I, nor T4 DNA polymerase, nor Taq DNA
polymerase. The results suggested that a basal level of background recombination might have occurred at some point in the experiment other than in the GRAMMR
reaction; possibly in the PCR step. PCR-mediated recombination is known to occur at some frequency between related sequences during amplification Paabo, et al., J
Biol Chem 265(90)4718-4721.

In another experiment, 200 nanograms of cycle 3/wild-type GFP heteroduplex was treated with CEL I and T4 DNA polymerase in various concentrations along with 2.5 units of Taq DNA polymerase in the presence or absence of T4 DNA ligase (0.2 units; Gibco BRL). Each reaction contained 1X NEB T4 DNA ligase buffer with 0.05 mM each dNTP in a final volume of 20 microliters.
Reactions were incubated for 30 minutes at 37 C and 10 microliters were run on a 2% TBE-agarose gel in the presence of ethidium bromide. Results showed that in the presence of DNA ligase, but in the absence of T4 DNA
polymerase, increasing amounts of CEL I caused greater degradation of the heteroduplexed DNA, but that this effect could be counteracted by increasing the amount of T4 DNA polymerase in the reaction. These results indicated that the various components of the complete reaction could act together to conserve the integrity of the full-length gene through DNA mismatch resolution.
Another matrix experiment was conducted to expand on these results and to identify additional conditions for DNA mismatch resolution for this synthetic system. 60 nanograms of cycle3/wild-type GFP heteroduplex were treated with CEL I and T4 DNA polymerase at various concentrations in the presence of 2.5 units of Taq DNA
polymerase and 0.2 units of T4 DNA ligase in 1 X NEB T4 DNA ligase buffer containing 0.5 mM of each dNTP in a reaction volume of 10 microliters. Each set of reactions was incubated for 1 hour at 20 C, 30 C, 37 C, or 45 C. All reactions were then run on a 1.5% TBE-agarose gels in the presence of ethidium bromide. The results showed that the GFP heteroduplex was cleaved into discrete fragments by the CEL I preparation alone. The success of DNA
mismatch resolution was initially gauged by the degree to which the apparent full-length integrity of the GFP
sequence was maintained by the other components of the mismatch resolution system in the presence of CEL I.
Conditions of enzyme concentration and temperature were identified that conserved a high proportion of the DNA as full-length molecules in this assay. Namely, one microliter of the CEL I fraction five preparation (described in EXAMPLE 2) with one microliter (1 unit) of the T4 DNA polymerase in the presence of the other reaction components which were held constant in the experiment. It was found that as the reaction temperature increased, the degradative activity of CEL I
increased accordingly. Furthermore, it was shown that the other components of the repair reaction acted to conserve the integrity of the full-length DNA at 20 C, 30 C, and 37 C, but was remarkably less efficient at conserving the full-length DNA at 45 C. From these results, we concluded that under these experimental conditions, incubation at 45 C was not optimal for the process of GRAMMR, and that incubation at 20 C, 30 C, and 37 C were permissible.

Restoration of Restriction Sites to GFP Heteroduplex DNA after DNA Mismatch Resolution (GRAMMR) This experiment teaches the operability of genetic reassortment by DNA mismatch resolution (GRAMMR) by demonstrating the restoration of restriction sites.

The full-length products of a twenty-fold scale-up of the GRAMMR reaction, performed at 37 C for one hour, using the optimal conditions found above (the ix reaction contained sixty nanograms of heteroduplex DNA, one microliter of CEL I fraction five (described in EXAMPLE
2), one unit T4 DNA polymerase in the presence of 2.5 units of Taq DNA polymerase and 0.2 units of T4 DNA
ligase in 1 X NEB T4 DNA ligase buffer containing 0.5 mM
of each dNTP in a reaction volume of 10 microliters) were gel-isolated and subjected to restriction analysis by endonucleases whose recognition sites overlap with mismatches in the GFP heteroduplex, thereby rendering those sites in the DNA resistant to restriction enzyme cleavage. The enzymes used were BamHI, Hindill, HpaI, and XhoI. Negative controls consisted of untreated GFP
heteroduplex. Positive controls consisted of Cycle 3 or wild type GFP sequences, individually. All controls were digested with the same enzymes as the product of the DNA
mismatch resolution reaction. All samples were run on a 2% TBE-agarose gel in the presence of ethidium bromide.
After treatment with the mismatch resolution cocktail, a proportion of the DNA gained sensitivity to BamHI and XhoI restriction endonucleases, indicating that DNA mismatch resolution had occurred. The HpaI-cut samples could not be interpreted since a low level of cleavage occurred in the negative control. The Hindlll, BamHI and XhoI sites displayed different degrees of cleavage in the GRAMMR-treated samples. Restoration of the XhoI site was more extensive than that of the BamHI

site, which was in turn, more extensive than restoration at Hindlll site.

The extent to which cleavage occurs is indicative of the extent to which mismatches in the DNA have been resolved at that site. Differences in mismatch resolution efficiency may relate to the nature or density of mismatches present at those sites. For example, the XhoI site spans a three-mismatch cluster, whereas the BamHI site spans two mismatches and the Hindlll site spans a single mismatch.
GRAMMR-treated GFP Genes This example demonstrates that GRAMMR can reassort sequence variation between two gene sequences in a heteroduplex and that there are no significant differences in GRAMMR products that were directly cloned, or PCR amplified prior to cloning.

The GRAMMR-treated DNA molecules of EXAMPLE 7 were subsequently either directly cloned by ligation into pCR-Blunt II-TOPO (Invitrogen), or amplified by PCR and ligated into pCR-Blunt II-TOPO according to the manufacturer's instructions, followed by transformation into E. coli. After picking individual colonies and growing in liquid culture, DNA was prepared and the sequences of the GFP inserts were determined. As negative controls, the untreated GFP heteroduplex substrate was either directly cloned or PCR amplified prior to cloning into the plasmid.

In GRAMMR, reassortment of sequence information results from a process of information transfer from one strand to the other. These sites of information transfer are analogous to crossover events that occur in recombination-based DNA shuffling methods. For the purposes of relating the results of these reassortment experiments, however, the GRAMMR output sequences are described in terms of crossovers. Sequences of twenty full-length GFP clones that were derived from the GRAMMR-treated GFP genes were analyzed. Four of these clones were derived from DNA that had been directly cloned into pZeroBlunt (Invitrogen) following GRAMMR reaction (no PCR
amplification). The other sixteen sequences were cloned after PCR amplification. Analysis of these full-length GFP sequences revealed that all twenty sequences had undergone sequence reassortment having between one and ten crossovers per gene. A total of 99 crossovers were found in this set of genes, giving an average of about 5 crossovers per gene. With the distance between the first and last mismatches of about 590 nucleotides, an overall frequency of roughly one crossover per 120 base-pairs was calculated. Within this set of twenty clones, a total of seven point mutations had occurred within the sequences situated between the PCR primer sequences, yielding a mutation frequency of roughly 0.05%.

Thirty-five clones that had not been subjected to the GRAMMR reaction were sequenced. Of these controls, fourteen were derived from direct cloning and twenty-one were obtained after PCR amplification using the GFP
heteroduplex as template. Of these thirty-five non-GRAMMR treated control clones, eight were recombinants, ranging from one to three crossovers, with most being single crossover events. A total of twenty-five point mutations had occurred within the sequences situated between the PCR primers, yielding a mutation frequency of roughly 0.1%.

No significant differences were observed between the GRAMMR-treated products that were either directly cloned or PCR amplified. Notably, though, in the non-GRAMMR-treated controls, the frequency of recombinants was higher in the PCR amplified DNAs than in the directly cloned DNAs. This higher frequency is consistent with results obtained by others in which a certain level of recombination was found to be caused by "jumping PCR."
(Paabo, et al., DNA damage promotes jumping between templates during enzymatic amplification. J Biol Chem 265(90)4718-4721).

Heteroduplex Substrate Preparation for Plasmid-on-Plasmid Genetic Reassortment By DNA Mismatch Resolution (POP GRAMMR) of GFP
Plasmids This example teaches that heteroduplex substrate for Genetic Reassortment by DNA Mismatch Resolution can be in the form of intact circular plasmids. Cycle 3-GFP and wild-type GFP heteroduplex molecules were prepared plasmid-on-plasmid (POP) format. In this format, the GFP
sequences were reassorted within the context of a circular double-stranded plasmid vector backbone. This made possible the recovery of the reassorted product by direct transformation of E. coli using an aliquot of the GRAMMR reaction. Consequently, neither PCR amplification nor other additional manipulation of the GRAMMR-treated DNA was necessary to obtain reassorted clones.
Mismatched DNA substrate for POP-GRAMMR reactions was generated containing wild-type GFP (SEQ ID NO: 29) and Cycle 3 GFP (SEQ ID NO: 30), resulting in the two pBluescript-based plasmids, pBSWTGFP (SEQ ID NO: 31) and pBSC3GFP (SEQ ID NO: 17), respectively. The GFPs were inserted between the KpnI and EcoRI sites of the pBluescript polylinker so that the only sequence differences between the two plasmids occurred at sites where the wild-type and Cycle 3 GFPs differ from one-another. Both plasmids were linearized by digestion of the plasmid backbone with SapI, cleaned up using a DNA
spin-column, mixed, amended to 1X PCR buffer (Barnes, 1994; PNAS, 91, 2216-2220), heated in a boiling water bath for three minutes, and slow-cooled to room temperature to anneal the denatured DNA strands.
Denaturing and annealing these DNAs led to a mixture of duplexes; the re-formation of parental duplexes, and the formation of heteroduplexes from the annealing of strands from each of the two input plasmids. Parental duplexes were deemed undesirable for GRAMMR and were removed by digestion with restriction enzymes that cut in one or the other parental duplex but not in the heteroduplexed molecules. Pm11 and XhoI were chosen for this operation since Pm1I cuts only in the wild-type GFP sequence and XhoI cuts only Cycle 3 GFP. After treatment with these enzymes, the products were resolved on an agarose gel.
The full-length, uncut heteroduplex molecules were resolved from the PmlI- and XhoI-cut parental homoduplexes in an agarose gel and purified by excision of the band and purification with a DNA spin column.

The resulting population of heteroduplexed molecules was treated with DNA ligase to convert the linear DNA
into circular, double-stranded DNA heteroduplexes. After confirmation by agarose gel-shift analysis, the circular double-stranded GFP heteroduplexed plasmid was used as substrate for GRAMMR reactions. Examples of the resulting clones are included as SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7, and SEQ ID NO: B.

Exemplary Reaction Parameters for Genetic Reassortment by DNA Mismatch Resoluton CEL I and T4 DNA Polymerase Concentrations Compared The GRAMMR reaction involves the interaction of numerous enzymatic activities. Several parameters associated with the GRAMMR reaction were examined, such as CEL I concentration, T4 DNA polymerase concentration, reaction temperature, substitution of T4 DNA polymerase with T7 DNA polymerase, the presence of Taq DNA
polymerase, and the source of the CEL I enzyme. A matrix of three different CEL I concentrations versus two concentrations of T4 DNA polymerase was set up to examine the limits of the in vitro DNA mismatch resolution reaction.

Twenty-one nanograms (21ng) of the circular double-stranded heteroduplexed plasmid, prepared as described in EXAMPLE 9, was used as substrate in a series of ten microliter reactions containing 1X NEB ligase buffer, 0.5 mM each dNTP, 1.0 unit Taq DNA polymerase, 0.2 units T4 DNA ligase (Gibco/BRL), either 1.0 or 0.2 units T4 DNA
polymerase, and either 0.3, 0.1, or 0.03 microliters of a CEL I preparation (fraction 5, described in EXAMPLE 2).
Six reactions representing all six combinations of the two T4 DNA polymerase concentrations with the three CEL I
concentrations were prepared, split into equivalent sets of five microliters, and incubated at either 20 degrees C
or 37 degrees C. A control reaction containing no CEL I
and 0.2 unit of T4 DNA polymerase with the other reaction components was prepared and incubated at 37 degrees C.
After 30 minutes, one microliter aliquots of each reaction were transformed into competent DH5-alpha E.
coli which were then plated on LB amp plates. Colonies were picked and cultured. Plasmid DNA was extracted and examined by restriction fragment length polymorphism analysis (RFLP) followed by sequence analysis of the GFP
gene sequences. RFLP analysis was based on differences in several restriction enzyme recognition sites between the wild-type and Cycle 3 GFP genes. The RFLP results showed that throughout the CEL I /T4 DNA
polymerase/temperature matrix, reassortment of restriction sites, that is GRAMMR, had occurred, and that no such reassortment had occurred in the zero CEL I
control clones. DNA sequence analysis confirmed that reassortment had occurred in all of the CEL I -containing samples. Sequencing also confirmed that the zero- CEL I
controls were not reassorted, with the exception of a single clone of the 16 control clones, which had a single-base change from one gene sequence to the other, presumably resulting either from repair in E. coli or from random mutation. The sequences of several exemplary GRAMMR-output GFP clones are shown; all of which came from the reaction containing 0.3 microliters of the CEL I
preparation and 1.0 unit of T4 DNA polymerase incubated at 37 degrees C. The parental wild-type and Cycle 3 GFP
genes are shown first for reference.

Taq DNA Polymerase is Not Required for Genetic Reassortment by DNA Mismatch Resolution This experiment teaches that Taq DNA Polymerase does not dramatically, if at all, contribute or interfere with the functioning of GRAMMR. Taq DNA polymerase is reported to have a 5' flap-ase activity, and had been included in the teachings of the previous examples as a safeguard against the possible formation and persistence of undesirable 5' flaps in the heteroduplexed DNA
undergoing the GRAMMR reaction.

GRAMMR reactions were set up, as in EXAMPLE 10, with twenty-one nanograms of the circular double-stranded heteroduplexed GFP plasmid substrate in ten microliter reactions containing 1X NEB ligase buffer, 0.5 mM each dNTP, 0.2 units T4 DNA ligase, 1.0 unit T4 DNA
polymerase, 1.0 microliter of a CEL I preparation (fraction 5, described in EXAMPLE 2), and either 2.5 units, 0.5 units of Taq DNA polymerase, or no Taq DNA
polymerase. After 30 minutes, one microliter aliquots of each reaction were transformed into competent DH5-alpha E. coli which were then plated on LB amp plates.
Colonies were picked and cultured. Plasmid DNA was extracted and examined by RFLP analysis followed by sequence analysis of the GFP gene sequences. The RFLP
results showed that reassortment of restriction sites, that is, GRAMMR, had occurred both in the presence and the absence of Taq DNA polymerase in the GRAMMR reaction.
DNA sequence analysis confirmed these results.
Therefore, the data shows that Taq DNA polymerase was unnecessary for GRAMMR.

Alternate Proofreading DNA Polymerases for Genetic Reassortment by DNA Mismatch Resolution This experiment teaches that Genetic Reassortment by DNA Mismatch Resolution is not limited to the use of T4 DNA polymerase, and that alternate DNA polymerases can be substituted for it.

Reactions were set up, as in EXAMPLE 10, with twenty-one nanograms of the circular double-stranded heteroduplexed GFP plasmid substrate in ten microliter reactions containing 1X NEB ligase buffer, 0.5 mM each dNTP, 0.2 units T4 DNA ligase (Gibco/BRL), 10 units or 2 units of T7 DNA polymerase, 1.0 microliter of a CEL I
preparation (fraction 5, described in EXAMPLE 2), and 2.5 units of Taq DNA polymerase. After 30 minutes, one microliter aliquots of each reaction were transformed into competent DH5-alpha E. coli which were then plated on LB amp plates. Colonies were picked and cultured.
Plasmid DNA was extracted and examined by RFLP analysis followed by sequence analysis of the GFP gene sequences.
The RFLP results showed that reassortment of restriction sites, that is GRAMMR, had occurred in both T7 DNA
polymerase-containing reactions. DNA sequence analysis confirmed these results. Therefore, the data shows that T7 DNA polymerase can substitute for T4 DNA polymerase for GRAMMR. In addition, it shows that individual components and functionalities can be broadly substituted in GRAMMR, while still obtaining similar results.

Molecular Breeding of Tobamovirus 30K Genes in a Viral Vector.

In the preceding examples, Genetic Reassortment by DNA Mismatch Resolution has been taught to be useful for reassorting sequences that are highly homologous, for example, wtGFP and Cycle 3 GFP are 96% identical. The present example teaches that GRAMMR can be used to reassort more divergent nucleic acid sequences, such as genes encoding tobamovirus movement protein genes.

Heteroduplexes of two tobamovirus movement protein (MP) genes that are approximately 75% identical were generated. The heteroduplex substrate was prepared by annealing partially-complementary single-stranded DNAs of opposite strandedness synthesized by asymmetric PCR; one strand encoding the movement protein gene from the tobacco mosaic virus U1 type strain (TMV-U1) (SEQ ID NO:
9), and the other strand encoding the movement protein gene from tomato mosaic virus (ToMV) (SEQ ID NO: 10).
The sequences of the two partially complementary movement protein genes were flanked by 33 nucleotides of absolute complementarity to promote annealing of the DNAs at their termini and to facilitate PCR amplification and cloning.
The annealing reaction took place by mixing 2.5 micrograms of each single-stranded DNA in a 150 microliter reaction containing 333 mM NaCl, 33 mM MgC12, 3.3 mM dithiothreitol, 166mM Tris-HC1, pH 7, and incubating at 95 C for one minute followed by slow cooling to room-temperature. GRAMMR was performed by incubating 5 microliters of the heteroduplex substrate in a 20 microliter reaction containing 1X NEB ligase buffer, 0.5 mM each dNTP, 0.4 units T4 DNA ligase (Gibco/BRL), 2.0 units of T4 DNA polymerase, and CEL I. The CEL I was from a cloned preparation and the amount that was used varied from 2 microliters of the prep, followed by five serial 3-fold dilutions. A seventh preparation with no CEL I was prepared, which served as a control.

After one hour at room-temperature, DNA was purified from the reactions using Strataprep spin DNA purification columns (Stratagene, LaJolla, CA) and used as templates for PCR reactions using primers designed to anneal to the flanking primer-binding sites of the two sequences. PCR
products from each reaction were purified using Strataprep columns, digested with AvrII and Pacl, and ligated into the movement protein slot of similarly-cut pGENEWARE -MP-Avr-Pac. This plasmid contained a full-length infectious tobamovirus-GFP clone modified with AvrII and Pacl sites flanking the movement protein gene to permit its replacement by other movement protein genes. After transformation of DH5-alpha E. coli and plating, colonies were picked, cultures grown, and DNA
was extracted. The movement protein inserts were subjected to DNA sequence analysis from both directions and the sequence data confirmed that in the majority of inserts derived from the GRAMMR-treated material were reassorted sequences made up of both TMV-U1 and ToMV
movement protein gene sequences. The DNA sequences of several exemplary GRAMMR output MP clones are shown as SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:
14, and SEQ ID NO: 15.

Example 14 Molecular Breeding of Highly Divergent Tobamovirus 30K Genes in Viral Vectors using Plasmid-on-Plasmid Genetic Reassortment By DNA Mismatch Resolution (POP GRAMMR) EXAMPLE 4 taught the reassortment of movement protein (MP) genes from several divergent strains of tobamovirus (approximately 75% identical; cloned into the pGENEWARE-MP-Avr-Pac vector) using GRAMMR. This example teaches the use of Plasmid-on-plasmid GRAMMR (POP GRAMMR) for reassorting even more highly divergent species.
Starting parental MP genes from the tobamoviruses TMV-Cg (Figure 6, SEQ ID NO: 18), TMV-Ob (Figure 7, SEQ
ID NO: 19), TMV-U2 (Figure 8, SEQ ID NO: 20), TMV-U1 (SEQ

ID NO: 9), and tomato mosaic virus (ToMV) (SEQ ID NO: 10) were used. The plasmid of pGENEWARE-ToMV MP was linearized by digestion with Sma I. The plasmids of pGENEWARE containing the MP genes from either TMV-Cg, TMV-Ob, TMV-U2, or TMV-U1 were digested with Stu I. The digested pGENEWARE-MP constructs were purified using DNA

spin columns. The following heterduplex pairs were generated: pGENEWARE-Cg MP and pGENEWARE-ToMV MP, pGENEWARE-TMV-Ob MP and pGENEWARE-ToMV MP, pGENEWARE-TMV-U2 MP and pGENEWARE-ToMV MP, pGENEWARE-TMV-Ul MP and pGENEWARE- ToMV MP. The heteroduplexes of these MP gene sequences are approximately 470, 58%, 62%, and 75%
identical, respectively. Heteroduplex DNA was generated by mixing 200 nanograms of each of the two linearized plasmids in 1X SSPE (180 mM NaCl, 10 mM NaH2PO4, 1 mM
EDTA, at pH 7.4) in a volume of 20 microliters. The mixture was incubated at 95 degrees Celsius for 4 minutes, plunged into ice water where it remained for 10 minutes prior to incubation at 37 degrees Celsius. After 30 minutes, the annealed DNA sample was then transferred back to ice where it was held until use in GRAMMR
reactions.

Each 10 microliter GRAMMR reaction contained 1 unit of T4 DNA polymerase, 2 units of E. coli DNA ligase, and 0.5 mM of each dNTP in 1X NEB E. coli DNA ligase buffer supplemented with KC1 to 50 mM. A one microliter aliquot of CEL I (diluted 1/3, 1/9, 1/27, 1/81, 1/243, or 1/729) was next added. An endonuclease-free control reaction was also prepared. To each of the reactions, a one microliter aliquot containing 20 nanograms of the annealed DNA heteroduplex substrate was added and the reactions were incubated at room temperature for one hour and on ice for 30 minutes prior to transformation into competent E. coli.

DNA sequence analysis was performed from both directions, and the sequence data showed that a significant number of clones derived from the GRAMMR--III -treated material were reassorted sequences containing information from both parental movement protein gene sequences. The DNA sequences of several exemplary out output pGENEWARE-MP clones from the GRAMMR reaction are shown as follows, TMV-Cg/ToMV clones, Figure 9, SEQ ID
NO: 21, and Figure 10, SEQ ID NO: 22; TMV-Ob/ToMV clones, Figure 11, SEQ ID NO: 23, and Figure 12, SEQ ID NO: 24;
TMV-U2/ToMV clones, Figure 13, SEQ ID NO: 25, and Figure 14, SEQ ID NO: 26; and TMV-U1/ToMV clones, Figure 15, SEQ

ID NO: 27, and Figure 16, SEQ ID NO: 28.
Example 15 GRAMMR On Linearized DNA Substrate Using Endonucleases That Cleave Within A Selectable Marker This example teaches a GRAMMR reaction where DNA
substrate molecules are linearized with restriction endonucleases that cleave within a selectable marker gene.

GRAMMR is performed between the wild-type Aequorea victoria GFP gene (Prasher, et al., Genelll(92)229) in a pBS derivative (Stratagene, La Jolla, CA) encoded by pBSWTGFP (SEQ ID NO:31) and a variant with mutations to increase fluorescence intensity in E. coli, and to alter the emission wavelength to blue light emission (Crameri, et al., Nat Biotechnol 14 (96) 315; Heim et al., PNAS91(94)12501; Yang, et al., J Biol Chem 273(98)8212).
This variant gene, encoded by the plasmid pBSC3BFP (SEQ
ID NO: 32), encodes a fluorescent protein that emits bright blue light when excited by longwave UV light.

The GRAMMR reactions are performed on GFP/c3BFP
heteroduplexes in a circular, double-stranded plasmid DNA
context. The circular, whole-plasmid heteroduplex DNA
substrates are prepared by first linearizing pBSWTGFP
(SEQ ID NO:31) and pBSC3BFP (SEQ ID NO: 32) by digestion with Ahd I and Bcg I, respectively, then purifying the digested DNA using DNA spin columns. Next, 200 nanograms of each of the two linearized plasmids are mixed and brought to 1X SSPE (180 nM NaCl, 10 mM NaH2PO4, 1mM EDTA
at pH 7.4) in a volume of 20 microliters. The mixture is then incubated at 95 degrees Celsius for 4 minutes, plunged into icewater where it remains for 10 minutes prior to incubation at 37 degrees Celsius. After 30 minutes, the annealed DNA sample is then transferred back to ice where it is held until use in GRAMMR reactions.
Two independent series of reassortment reactions are performed to compare CEL I with RES I in their abilities to facilitate sequence reassortment by GRAMMR. Each reaction is first treated for 10 minutes at room-temperature with 1 unit of T4 DNA polymerase in the presence of 5 nanomoles of each dNTP in 1X NEB E. coli ligase buffer supplemented with KC1 to 50 mM.
Subsequently, 2 units of E. coli DNA ligase are added.
Two separate enzyme dilution series are then performed.
To each of two series of tubes containing aliquots of the above cocktail, one microliter aliquots of GENEWARE -expressed CEL I or RES I extracts at dilutions of 1/3, 1/9, 1/27, 1/81, or 1/243 are added. An endonuclease-free control reaction is also prepared. To each of the reactions, one microliter aliquots containing 20 nanograms of the annealed DNA heteroduplex substrate are added and the reactions incubated at room temperature for one hour and on ice for 30 minutes prior to transformation into competent E. coli.

Green fluorescent protein (GFP) and blue fluorescent protein (BFP) is visualized in the resulting colonies by long wave UV illumination. The parental wild-type GFP
gives dim green fluorescence, and the parental c3BFP
gives bright blue fluorescence. In the genes encoding these fluorescent proteins, the sequences that determine the emission color and those that govern fluorescence intensity are at different positions from one another.

It is expected that DNA reassortment would result in the "de-linking" of the sequences that determine the emission color from those that govern fluorescence intensity. As a consequence, the resultant progeny would be expected to exhibit reassortment of the functional properties of emission color and intensity. Therefore a measure of the extent of the DNA reassortment that had taken place in each reaction can be scored by examining the color and intensity of fluorescence from the bacterial colonies on the corresponding plates.

Detection of DNA mutations Using RES I and Multiplex Analysis The sensitivity of RES I for mismatch detection is illustrated by its ability to detect mutations in pooled DNA samples. DNA is obtained from peripheral blood lymphocytes from individuals undergoing genetic screening. Samples are obtained from breast cancer-only, ovarian cancer-only, breast/ovarian cancer syndrome families or from non-breast/ovarian cancer control samples. Unlabeled primers specific for exon 2 of BRCA1 are utilized to PCR amplify this region of the gene. The wild-type PCR products of exon 2 are labeled with Y.32P-ATP. Briefly, 10 picomoles of PCR product are purified by the Wizard procedure (Promega). Exon 2 wild-type products are then phosphorylated using T4 kinase and 15 picomoles of y-32P-ATP at 6,000 Ci/mmol in 30 pl 1X kinase buffer (70 mM Tris-HC1 (pH 7.6), 10 mM MgC12, 5 mM
dithiothreitol) at 37 C. for 1 hour. The reactions are stopped with 1 pl 0.5M EDTA. The reaction volume is brought up to 50 pl with lX STE buffer (100 mM NaCl, 20 mM Tris-HC1, pH 7.5, 10 mM EDTA) and processed through a Pharmacia Probe Quant column. Labeled DNA (1 pmol/pl in 100 pl) is then used for hybridization with individual unlabeled PCR amplified experimental samples. For each individual sample, 100 fmol of the unlabeled PCR
amplified product is incubated with 200 fmol of the 32P-labeled wild-type PCR product in RES I reaction buffer (25 mM KC1, 10 mM MgCl2, 20 mM Tris-HC1, pH 7.5).
Following denaturation and renaturation, heteroduplexed, radiolabeled PCR products are exposed to RES I for 30 minutes at 37 C in 1X RES reaction buffer and stopped via the addition of 10 pl stop mix (75% formamide, 47 mM
EDTA, 1.5% SDS, xylene cyanol and bromophenol blue). The heteroduplexes are treated with the enzyme individually or pooled in one sample tube and treated. The products of the reaction are loaded onto a 15% polyacrylamide gel containing 7M urea.

To further illustrate the ability of RES I to detect mutations in pooled DNA samples, 1, 2, 3, 5, 10 or 30 heteroduplexed, radiolabeled PCR products, (again amplified from exon 2 of the BRCA1 gene), are exposed to RES-I in a single reaction tube and the products run on a 6% polyacrylamide gel containing 7M urea. Samples are amplified and radiolabeled as described above. Each pool contains only one sample that has a mutation (AG
deletion). The other samples in each pool are wild-type.
Control samples are not exposed to RES I. In the pooled samples where a mutation is present, RES-I consistently cleaves the PCR products illustrating the sensitivity of the enzyme in the presence of excess wild-type, non-mutated DNA. As a control, heteroduplexed PCR products containing no mutations are analyzed and no cut band corresponding to a mutation appears.

Detection of Mutations and Polymorphisms by RES-I in Samples Obtained from High Risk Families PCR primer sets specific for the exons in the BRCA1 gene are synthesized. The gene sequence of BRCA1 is known. The exon boundaries and corresponding base numbers are shown in table II. Primers to amplify desired sequences can be readily designed by those skilled in the art following the methodology set forth in Current Protocols in Molecular Biology, Ausubel et al., eds, John Wiley and Sons, Inc. (1995). These primers are planned such than in each PCR reaction, one primer is labeled at the 5' termini with a fluorescent-label, 6-FAM, while the other primer is similarly labeled with a label of another color, TET. A PCR product will thus be labeled with two colors such that DNA nicking events in either strand can be observed independently and the measurements corroborated.

TABLE II

EXON BOUNDARIES AND CORRESPONDING

EXON BASE #I s Peripheral blood samples from individuals in high-risk families are collected and the DNA isolated. The PCR products are amplified using Elongase (BRL) and purified using Wizard PCR Preps (Promega). The DNA is heated to 94 C and slowly cooled in 1X RES I buffer (20 mM Tris-HC1 pH 7.4, 25 mM KC1, 10 mM MgC12) to form heteroduplexes. The heteroduplexes are incubated in 20 }il 1X RES I buffer with 0.2 pl of RES I and 0.5 units of AmpliTaq at 45 C. for 30 minutes. The reactions are stopped with 1 mM phenanthroline and incubated for an additional 10 minutes at 45 C. The sample is processed through a Centricep column (Princeton Separations) and dried down. One microliter of ABI loading buffer (25 mM
EDTA, pH 8.0, 50 mg/ml Blue dextran), 4 pl deionized formamide and 0.5 p1 TAMRA internal lane standard are added to the dried DNA pellet. The sample is heated at 90 C. for 2 minutes and then quenched on ice prior to loading. The sample is then loaded onto a 4.25%
denaturing 34 cm well-to-read acrylamide gel and analyzed on an ABI 373 Sequencer using GENESCAN 672 software. The 6-FAM labeled primer in this experimental sample is at nucleotide 3177 of the BRCA1 cDNA (region 11D), the TET
labeled primer is 73 nucleotides into the intron between exon 11 and exon 12. Each spike represents the presence of a DNA band produced by the cleavage of the heteroduplex by RES-I where a mutation or a polymorphism is present. One spike represents the size of the RES I
produced fragment from the 3' side of the mismatch site to the 5' 6-FAM label of the top strand. The other spike represents the corresponding fragment in the bottom strand from the 3' side of the mismatch to the 5' TET
label. The sum of the two fragments equals one base longer than the length of the PCR product. The 6-FAM
panel shows a spike at base #645 from the 6-FAM label and the TET panel shows a spike at base #483 from the TET
label, both corresponding to the site of the 5 base deletion at nucleotide 3819 of the BRCA1 cDNA.

Analysis of exon 11 in another individual is performed using a 6-FAM-labelled primer at nucleotide 1454 of the BRCA1 cDNA. The TET-labeled primer is at nucleotide 2459 (region 11C). The PCR amplified products are amplified and prepared as described above. In this individual, the 6-FAM panel shows a spike at base #700 and the TET panel shows a spike at #305, each spike corresponding to the site of RES I incision in the respective DNA strand at a nonsense mutation of A>T at nucleotide 2154 of the BRCA1 cDNA. The 6-FAM panel also shows a spike at base #747 and the TET panel shows a spike at #258 corresponding to the site of a polymorphism C>T at nucleotide 2201 of the BRCA1 cDNA. The nonsense mutation and polymorphism can be confirmed by sequencing the sample using the ABI 377 Sequencer.
Certain individuals have mutations in another region of exon 11, region 11A, on the schematic in FIG. n. A 6-FAM-labelled primer at nucleotide 2248 of the BRCA1 cDNA
and a TET labeled primer at nucleotide 3290 are used to amplify this region of exon 11. Following amplification, the samples are processed as described above.

Deposits with The American Type Culture Collection (ATCC) Three deposits have been made in the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, VA. A deposit has been made of a plasmid DNA
construct containing a derivative of tobacco mosaic virus and cDNA of the CEL I mismatch-endonuclease gene from celery, tagged with 6HIS. The construct is internally designated P1177MP4-CEL I 6HIS, and has been assigned ATCC Number PTA-3927. A deposit has been made of a plasmid DNA construct containing a derivative of tobacco mosaic virus and cDNA of the CEL I mismatch-endonuclease gene from celery. The construct is internally designated P1177MP4-CEL I Avr, and has been assigned ATCC Number PTA-3926. A deposit has been made of a plasmid DNA
construct containing a derivative of tobacco mosaic virus and a cDNA insert encoding a 34kDa protein from Selaginella lepidophylla. The cDNA insert is referred to as RES I-6HIS. RES I is a mismatch endonuclease gene.
The construct is internally designated pLSB-2225, and has been assigned ATCC Number PTA-4562.

These deposits were made in accordance with the terms and provisions of the Budapest Treaty relating to deposit of microorganisms and was made for a term of at least thirty (30) years and at least five (05) years after the most recent request for the furnishing of a sample of the deposit is received by the depository, or for the effective term of a patent to issue from this application or a subsequent application citing any of these deposits, whichever is longer. Each deposit will be replaced if it becomes non-viable during that period.
It should be noted that applicant's designations for each of the clones were shortened in the deposit to the aforementioned deposit with the American Type Culture Collection, that is, p1177MP4- CEL I Avr-B3 is referred to as p1177MP4- CEL I Avr; and p1177MP4- CEL I 6His-A9 is referred to as p1177MP4-CEL I 6His. The clone p1177MP4-CEL I Avr (SEQ ID NO:01) contained the CEL I open reading frame extending from nucleotide 5765 to 6655 (SEQ ID
NO:03); and the clone p1177MP4- CEL I 6His-A9 (SEQ ID
NO:02) contained the CEL I-6His open reading frame extending from nucleotide 5765-6679 (SEQ ID NO:04).

SEQUENCE LISTING
<110> Large Scale Biology Corporation <120> MISMATCH ENDONUCLEASES AND METHODS OF USE THEREOF
<130> O8900840CA

<140>
<141> 2003-01-31 <150> 60/353,722 <151> 2002-02-01 <150> 10/098,155 <151> 2002-03-14 <150> 10/211,079 <151> 2002-08-01 <160> 35 <170> Patentln version 3.1 <210> 1 <211> 10600 <212> DNA
<213> Artificial Sequence <220>
<223> TMV infectious clone containing CEL I gene <400> 1 gtatttttac aacaattacc aacaacaaca aacaacaaac aacattacaa ttactattta 60 caattacaat ggcatacaca cagacagcta ccacatcagc tttgctggac actgtccgag 120 gaaacaactc cttggtcaat gatctagcaa agcgtcgtct ttacgacaca gcggttgaag 180 agtttaacgc tcgtgaccgc aggcccaagg tgaacttttc aaaagtaata agcgaggagc 240 agacgcttat tgctacccgg gcgtatccag aattccaaat tacattttat aacacgcaaa 300 atgccgtgca ttcgcttgca ggtggattgc gatctttaga actggaatat ctgatgatgc 360 aaattcccta cggatcattg acttatgaca taggcgggaa ttttgcatcg catctgttca 420 agggacgagc atatgtacac tgctgcatgc ccaacctgga cgttcgagac atcatgcggc 480 acgaaggcca gaaagacagt attgaactat acctttctag gctagagaga ggggggaaaa 540 cagtccccaa cttccaaaag gaagcatttg acagatacgc agaaattcct gaagacgctg 600 tctgtcacaa tactttccag acaatgcgac atcagccgat gcagcaatca ggcagagtgt 660 atgccattgc gctacacagc atatatgacataccagccga tgagttcggg gcggcactct 720 tgaggaaaaa tgtccatacg tgctatgccg ctttccactt ctctgagaac ctgcttcttg 780 aagattcata cgtcaatttg gacgaaatca acgcgtgttt ttcgcgcgat ggagacaagt 840 tgaccttttc ttttgcatca gagagtactc ttaattattg tcatagttat tctaatattc 900 ttaagtatgt gtgcaaaact tacttcccgg cctctaatag agaggtttac atgaaggagt 960 ttttagtcac cagagttaat acctggtttt gtaagttttc tagaatagat acttttcttt 1020 tgtacaaagg tgtggcccat aaaagtgtag atagtgagca gttttatact gcaatggaag 1080 acgcatggca ttacaaaaag actcttacaa tgtgcaacag cgagagaatc ctccttgagg 1140 attcatcatc agtCaattac tggtttccca aaatgaggga tatggtcatc gtaccattat 1200 tcgacatttc tttggaaact agtaagagga cgcgcaagga agtcttagtg tccaaggatt 1260 tcgtgtttac agtgcttaac cacattcgaa cataccaggc gaaagctctt acataagcaa 1320 atgttttgtc ctttgtcgaa tcgattcgat cgagggtaat cattaacggt gtgacagcga 1380 ggtccgaatg ggatgtggac aaatctttgt tacaatcctt gtccatgacg ttttacctgc 1440 atactaagct tgccgttcta aaggatgact tactgattag caagtttagt ctcggttcga 1500 aaacggtgtg ccagcatgtg tgggatgaga tttcgctggc gtttgggaac gcatttccct 1560 ccgtgaaaga gaggctcttg aacaggaaac ttatcagagt ggcaggcgac gcattagaga 1620 tcagggtgcc tgatctatat gtgaccttcc acgacagatt agtgactgag tacaaggcct 1680 ctgtggacat gcctgcgctt gacattagga agaagatgga agaaacggaa gtgatgtaca 1740 atgcactttc agagttatcg gtgttaaggg agtctgacaa attcgatgtt gatgtttttt 1800 ccaagatgtg ccaatctttg gaagttgacc caatgacggc agcgaaggtt atagtcgcgg 1860 tcatgagcaa tgagagcggt ctgactctca catttgaacg acctactgag gcgaatgttg 1920 cgctagcttt acaggatcaa gagaaggctt cagaaggtgc tttggtagtt acctcaagag 1980 aagttgaaga accgtccatg aagggttcga tggccagagg agagttacaa ttagctggtc 2040 ttgctggaga tcatccggag tcgtcctatt ctaagaacga ggagatagag tctttagagc 2100 agtttcatat ggcaacggca gattcgttaa ttcgtaagca gatgagctcg attgtgtaca 2160 cgggtccgat taaagttcag caaatgaaaa actttatcga tagcctggta gcatcactat 2220 ctgctgcggt gtcgaatctc gtcaagatcc tcaaagatac agctgctatt gaccttgaaa 2280 cccgtcaaaa gtttggagtc ttggatgttg catctaggaa gtggttaatc aaaccaacgg 2340 ccaagagtca tgcatggggt gttgttgaaa cccacgcgag gaagtatcat gtggcgcttt 2400 tggaatatga tgagcagggt gtggtgacat gcgatgattg gagaagagta gctgtcagct 2460 ctgagtctgt tgtttattcc gacatggcga aactcagaac tctgcgcaga ctgcttcgaa 2520 acggagaacc gcatgtcagt agcgcaaagg ttgttcttgt ggacggagtt ccgggctgtg 2580 ggaaaaccaa agaaattctt tccagggtta attttgatga agatctaatt ttagtacctg 2640 ggaagcaagc cgcggaaatg atcagaagac gtgcgaattc ctcagggatt attgtggcca 2700 cgaaggacaa cgttaaaacc gttgattctt tcatgatgaa ttttgggaaa agcacacgct 2760 gtcagttcaa gaggttattc attgatgaag ggttgatgtt gcatactggt tgtgttaatt 2820 ttcttgtggc gatgtcattg tgcgaaattg catatgttta cggagacaca cagcagattc 2880 catacatcaa tagagtttca ggattcccgt accccgccca ttttgccaaa ttggaagttg 2940 acgaggtgga gacacgcaga actactctcc gttgtccagc cgatgtcaca cattatctga 3000 acaggagata tgagggcttt gtcatgagca cttcttcggt taaaaagtct gtttcgcagg 3060 agatggtcgg cggagccgcc gtgatcaatc cgatctcaaa acccttgcat ggcaagatcc 3120 tgacttttac ccaatcggat aaagaagctc tgctttcaag agggtattca gatgttcaca 3180 ctgtgcatga agtgcaaggc gagacatact ctgatgtttc actagttagg ttaaccccta 3240 caccagtctc catcattgca ggagacagcc cacatgtttt ggtcgcattg tcaaggcaca 3300 cctgttcgct caagtactac actgttgtta tggatccttt agttagtatc attagagatc 3360 tagagaaact tagctcgtac ttgttagata tgtataaggt cgatgcagga acacaatagc 3420 aattacagat tgactcggtg ttcaaaggtt ccaatctttt tgttgcagcg ccaaagactg 3480 gtgatatttc tgatatgcag ttttactatg ataagtgtct cccaggcaac agcaccatga 3540 tgaataattt tgatgctgtt accatgaggt tgactgacat ttcattgaat gtcaaagatt 3600 gcatattgga tatgtctaag tctgttgctg cgcctaagga tcaaatcaaa ccactaatac 3660 ctatggtacg aacggcggca gaaatgccac gccagactgg actattggaa aatttagtgg 3720 cgatgattaa aaggaacttt aacgcacccg agttgtctgg catcattgat attgaaaata 3780 ctgcatcttt agttgtagat aagttttttg atagttattt gcttaaagaa aaaagaaaac 3840 caaataaaaa tgtttctttg ttcagtagag agtctctcaa tagatggtta gaaaagcagg 3900 aacaggtaac aataggccag ctcgcagatt ttgattttgt agatttgcca gcagttgatc 3960 agtacagaca catgattaaa gcacaaccca agcaaaaatt ggacacttca atccaaacgg 4020 agtacccggc tttgcagacg attgtgtacc attcaaaaaa gatcaatgca atatttggcc 4080 cgttgtttag tgagcttact aggcaattac tggacagtgt tgattcgagc agatttttgt 4140 ttttcaaaag aaagacacca gcgcagattg aggatttctt cggagatatc gacagtcatg 4200 tgccgatgga tgtcttggag ctggatatat caaaatacga caaatctcag aatgaattcc 4260 actgtgcagt agaatacgag atctggcgaa gattgggttt tgaagacttc ttgggagaag 4320 tttggaaaca agggcataga aagaccaccc tcaaggatta taccgcaggt ataaaaactt 4380 gcatctggta tcaaagaaag agcggggacg tcacgacgtt cattggaaac actgtgatca 4440 ttgctgcatg tttggcctcg atgcttccga tggagaaaat aatcaaagga gccttttgcg 4500 gtgacgatag tctgctgtac tttccaaagg gttgtgagtt tccggatgtg caacactccg 4560 cgaatcttat gtggaatttt gaagcaaaac tgtttaaaaa acagtatgga tacttttgcg 4620 gaagatatgt aatacatcac gacagaggat gcattgtgta ttacgatccc ctaaagttga 4680 tctcgaaact tggtgctaaa cacatcaagg attgggaaca cttggaggag ttcagaaggt 4740 ctctttgtga tgttgctgtt tcgttgaaca attgtgcgta ttacacacag ttggacgacg 4800 ctgtatggga ggttcataag accgcccctc caggttcgtt tgtttataaa agtctggtga 4860 agtatttgtc tgataaagtt ctttttagaa gtttgtttat agatggctct agttgttaaa 4920 ggaaaagtga atatcaatga gtttatcgac ctgacaaaaa tggagaagat cttaccgtcg 4980 atgtttaccc ctgtaaagag tgttatgtgt tccaaagttg ataaaataat ggttcatgag 5040 aatgagtcat tgtcagaggt gaaccttctt aaaggagtta agcttattga tagtggaaac 5100 gtctgtttag ccggtttggt cgtcacgggc gagtggaact tgcctgacaa ttgcagagga 5160 ggtgtgagcg tgtgtctggt ggacaaaagg atggaaagag ccgacgaggc cactctcgga 5220 tcttactaca cagcagctgc aaagaaaaga tttcagttca aggtcgttcc caattatgct 5280 ataaccaccc aggacgcgat gaaaaacgtc tggcaagttt tagttaatat tagaaatgtg 5340 aagatgtcag cgggtttctg tccgctttct ctggagtttg tgtcggtgtg tattgtttat 5400 agaaataata taaaattagg tttgagagag aagattacaa acgtgagaga cggagggccc 5460 atggaactta cagaagaagt cgttgatgag ttcatggaag atgtccctat gtcgatcagg 5520 cttgcaaagt ttcgatctcg aaccggaaaa aagagtgatg tccgcaaagg gaaaaatagt 5580 agtaatgatc ggtcagtgcc gaacaagaac tatagaaatg ttaaggattt tggaggaatg 5640 agttttaaaa agaataattt aatcgatgat gattcggagg ctactgtcgc cgaatcggat 5700 tcgttttaaa tagatcttac agtatcacta ctccatctca gttcgtgttc ttgtcattaa 5760 ttaaatgacg cgattatatt ctgtgttctt tcttttgttg gctcttgtag ttgaaccggg 5820 tgttagagcc tggagcaaag aaggccatgt catgacatgt caaattgcgc aggatctgtt 5880 ggagccagaa gcagcacatg ctgtaaagat gctgttaccg gactatgcta atggcaactt 5940 atcgtcgctg tgtgtgtggc ctgatcaaat tcgacactgg tacaagtaca ggtggactag 6000 ctctctccat ttcatcgata cacctgatca agcctgttca tttgattacc agagagactg 6060 tcatgatcca catggaggga aggacatgtg tgttgctgta gccattcaaa atttcacatc 6120 tcagcttgga catttccgcc atggaacatc tgatcgtcga tataatatga cagaggcttt 6180 gttattttta tcccacttca tgggagatat tcatcagcct atgcatgttg gatttacaag 6240 tgatatggga ggaaacagta tagatttgcg ctggtttcgc cacaaatcca acctgcacca 6300 tgtttgggat agagagatta ttcttacagc tgcagaagat taccatggta aggatatgca 6360 ctctctccta caagacatac agaggaactt tacagagggt agttggttgc aagatgttga 6420 atcctggaag gaatgtgatg atatctctac ttgcgccaat aagtatgcta aggagagtat 6480 aaaactagcc tgtaactggg gttacaaaga tgttgaatct ggcgaaactc tgtcagataa 6540 atacttcaac acaagaatgc caattgtcat gaaacggata gctcagggtg gaatccgttt 6600 atccatgatt ttgaaccgag ttcttggaag ctccgcagat cattctttgg catgacctag 6660 gccagtagtt tggtttaaac ccaactgcga ggggtagtca agatgcataa taaataacgg 6720 attgtgtccg taatcacacg tggtgcgtac gataacgcat agtgtttttc cctccactta 6780 aatcgaaggg ttgtgtcttg gatcgcgcgg gtcaaatgta tatggttcat atacatccgc 6840 aggcacgtaa taaagcgagg ggttcgggtc gaggtcggct gtgaaactcg aaaaggttcc 6900 ggaaaacaaa aaagagatgg taggtaatag tgttaataat aagaaaataa ataatagtgg 6960 taagaaaggt ttgaaagttg aggaaattga ggataatgta agtgatgacg agtctatcgc 7020 gtcatcgagt acgttttaat caatatgCct tatacaatca actctccgag ccaatttgtt 7080 tacttaagtt ccgcttatgc agatcctgtg cagctgatca atctgtgtac aaatgcattg 7140 ggtaaccagt ttcaaacgca acaagctagg acaacagtcc aaaagcaatt tgcggatgcc 7200 ttgaaacttg tgcctagtat gacagtgaga tttcctgcat cggatttcta tgtgtataga 7260 tataattcga cgcttgatcc gttgatcacg gcgttattaa atagcttcga tactagaaat 7320 agaataatag aggttgataa tcaacccgca ccgaatacta ctgaaatcgt taacgcgact 7380 cagagggtag acgatgcgac tgtagctata agggcttcaa tcaataattt ggataatgaa 7440 ctggttcgtg gaactggcat gttcaatcaa gcaagctttg agactgctag tggacttgtc 7500 tggaccacaa ctccggctac ttaggtattg ttgtgagatt tcttaaaata aagtcactga 7560 agacttaaaa ttcagggtgg ctgataccaa aatcagcagt ggttgttcgt ccacttaaat 7620 ataacgattg tcatatctgg atccaacagt taaaccatgt gatggtgtat actgtggtat 7680 ggcgtaaaac aacggaaaag tcgctgaaga cttaaaattc agggtggctg ataccaaaat 7740 cagcagtggt tgttcgtcca cttaaaaata acgattgtca tatctggatc caacagttaa 7800 accatgtgat ggtgtatact gtggtatggc gtaaaacaac ggagaggttc gaatcctccc 7860 ctaaccgcgg gtagcggccc aggtacccgg atgtgttttc cgggctgatg agtccgtgag 7920 gacgaaaccc ggcatgcaag cttggcgtaa tcatggtcat agctgtttcc tgtgtgaaat 7980 tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcgtgg 8040 ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 8100 tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 8160 ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggttgttcgg 8220 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatcaac agaatcaggg 8280 gataaCgCag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 8340 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatgga 8400 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 8460 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 8520 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 8580 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccacgttca gcccgaccgc 8640 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 8700 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 8760 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 8820 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 8880 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 8940 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 9000 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 9060 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac 9120 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt 9180 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt 9240 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag 9300 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct 9360 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt 9420 gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc 9480 tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt 9540 agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg 9600 gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg 9660 actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc gagttgctct 9720 tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa agtgctcatc 9780 attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt gagatccagt 9840 tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt caCCagcgtt 9900 tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg 9960 aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta tcagggttat 10020 tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg 10080 cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta 10140 acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt 10200 gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc 10260 gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt 10320 aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg 10380 cacagatgcg taaggagaaa ataccgcatc aggcgccatt cgccattcag gctgcgcaac 10440 tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga 10500 tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa 10560 acgacggcca gtgaattcaa gcttaatacg actcactata 10600 <210> 2 <211> 10624 <212> DNA
<213> Artificial Sequence <220>
<223> TMV infectous clone containing CEL I gene fused to a 6HIS encodin g sequence <400> 2 gtatttttac aacaattacc aacaacaaca aacaacaaac aacattacaa ttactattta 60 caattacaat ggcatacaca cagacagcta ccacatcagc tttgctggac actgtccgag 120 gaaacaactc cttggtcaat gatctagcaa agcgtcgtct ttacgacaca gcggttgaag 180 agtttaacgc tcgtgaccgc aggcccaagg tgaacttttc aaaagtaata agcgaggagc 240 agacgcttat tgctacccgg gcgtatccag aattccaaat tacattttat aacacgcaaa 300 atgccgtgca ttcgcttgca ggtggattgc gatctttaga actggaatat ctgatgatgc 360 aaattcccta cggatcattg acttatgaca taggcgggaa ttttgcatcg catctgttca 420 agggacgagc atatgtacac tgctgcatgc ccaacctgga cgttcgagac atcatgcggc 480 acgaaggcca gaaagacagt attgaactat acctttctag gctagagaga ggggggaaaa 540 cagtccccaa cttccaaaag gaagcatttg acagatacgc agaaattcct gaagacgctg 600 tctgtcacaa tactttccag acaatgcgac atcagccgat gcagcaatca ggcagagtgt 660 atgccattgc gctacacagc atatatgaca taccagccga tgagttcggg gcggcactct 720 tgaggaaaaa tgtccatacg tgctatccgg ctttccactt ctctgagaac ctgcttcttg 780 aagattcata cgtcaatttg gacaaaatca acgcgtgttt ttcgcgcgat ggagacaagt 840 tgaccttttc ttttgcatca gagagtactc ttaattattg tcatagttat tctaatattc 900 ttaagtatgt gtgcaaaact tacttcccgg cctctaatag agaggtttac atgaaggagt 960 ttttagtcac cagagttaat acctggtttt gtaagttttc tagaatagat acttttcttt 1020 tgtacaaagg tgtggcccat aaaagtgtag atagtgagca gttttatact gcaatggaag 1080 acgcatggca ttacaaaaag actcttgaaa tgtgcaacag cgagagaatc ctccttgagg 1140 attcatcatc agtcaattac tggtttccca aaatgaggga tatggtcatc gtaccattat 1200 tcgacatttc tttggagact agtaagagga cgcgcaagga agtcttagtg tccaaggatt 1260 tcgtgtttac agtgcttaac cacattcgaa cataccaggc gaaagctctt acatacgcaa 1320 atgttttgtc ctttgtcgaa tcgattcgat cgagggtaat cattaacggt gtgacagcga 1380 ggtccgaatg ggatgtggac aaatctttgt tacaatcctt gtccatgacg ttttacctgc 1440 atactaagct tgccgttcta aaggatgact tactgattag caagtttagt ctcggttcga 1500 aaacggtgtg ccagcatgtg tgggatgaga tttcgctggc gtttgggaac gcatttccct 1560 ccgtgaaaga gaggctcttg aacaggaaac ttatcagagt ggcaggcgac gcattagaga 1620 tcagggtgcc tgatctatat gtgaccttcc acgacagatt agtgactgag tacaaggcct 1680 ctgtggacat gcctgcgctt gacattagga agaagatgga agaaacggaa gtgatgtaca 1740 atgcactttc agagttatcg gtgttaaggg agtctgacaa attcgatgtt gatgtttttt 1800 ccaggatgtg ccaatctttg gaagttgacc caatgacggc agcgaaggtt atagtcgcgg 1860 tcatgagcaa tgagagcggt ctgactctca catttgaacg acctactgag gcgaatgttg 1920 cgctagcttt acaggatcaa gagaagagtt cagaaggtgc tttggtagtt acctcaagag 1980 aagttgaaga accgtccatg aagggttcga tggccagagg agagttacaa ttagctggtc 2040 ttgctggaga tcatccggag tcgtcctatt ctaagaacga ggagatagag tctttagagc 2100 agtttcatat ggcaacggca gattcgttaa ttcgtaagca gatgagctcg attgtgtaca 2160 cgggtccgat taaagttcag caaatgaaaa actttatcga tagcctggta gcatcactat 2220 ctgctgcggt gtcgaatctc gtcaagatcc tcaaagatac agctgctatt gaccttgaaa 2280 cccgtcaaaa gtttggagtc ttggatgttg catctaggaa gtggttaatc aaaccaacgg 2340 ccaagagtca tgcatggggt gttgttgaaa cccacgcgag gaagtatcat gtggcgcttt 2400 tggaatatga tgagcagggt gtggtgacat gcgatgattg gagaagagta gctgtcagct 2460 ctgagtctgt tgtttattcc gacatggcga aactcagaac tctgcgcaga ctgtttcgaa 2520 acggagaacc gcatgtcagt agcgcaaagg ttgttcttgt ggacggagtt ccgggctgtg 2580 ggaaaaccaa agaaattctt tccagggtta attttgatga agatctaatt ttagtacctg 2640 ggaagcaagc cgcggaaatg atcagaagac gtgcgaattc ctcagggatt attgtggcca 2700 cgaaggacaa cgttaaaacc gttgattctt tcatgatgaa ttttgggaaa agcacacgct 2760 gtcagttcaa gaggttattc attgatgaag ggttgatgtt gcatactggt tgtgttaatt 2820 ttcttgtggc gatgtcattg tgcgaaattg catatgttta cggagacaca cagcagattc 2880 catacatcaa tagagtttca ggattcccgt accccgccca ttttcccaaa ttggaagttg 2940 acgaggtgga gacacgcaga actactctcc gttgtccagc cgatgtcaca cattatctga 3000 acaggagata tgagggcttt gtcatgagca cttcttcggt taaaaagtct gtttcgcagg 3060 agatggtcgg cggagccgcc gtgatcaatc cgatctcaaa acccttgcat ggcaagatcc 3120 tgacttttac ccaatcggat aaagaagctc tgctttcaag agggtattca gatgttcaca 3180 ctgtgcatga agtgcaaggc gagacatact ctgatgtttc actagttagg ttaaccccta 3240 caccagtctc catcattgca ggagacagcc cacatgtttt ggtcgcattg tcaaggcaca 3300 cctgttcgct caagtactac actgttgtta tggatccttt agttagtatc attagagatc 3360 tagagaaact tagctcgtac ttgttagata tgtataaggt cgatgcagga acacaatagc 3420 aattacagat tgactcggtg ttcaaaggtt CCaatctttt tgttgcagcg ccaaagactg 3480 gtgatatttc tgatatgcag ttttactatg ataagtgtct cccaggcaac agcaccatga 3540 tgaataattt tgatgctgtt accatgaggt tgactgacat ttcattgaat gtcaaagatt 3600 gcatattgga tatgtctaag tctgttgctg cgcctaagga tcaaatcaaa ccactaatac 3660 ctatggtacg aacggcggca gaaatgccac gccagactgg actattggaa aatttagtgg 3720 cgatgattaa aaggaacttt aacgcacccg agttgtctgg catcattgat attgaaaata 3780 ctgcatcttt agttgtagat aagttttttg atagttattt gcttaaagaa aaaagaaaac 3840 caaataaaaa tgtttctttg ttcagtagag agtctctcaa tagatggtta gaaaagcagg 3900 aacaggtaac aataggccag ctcgcagatt ttgattttgt agatttgcca gcagttgatc 3960 agtacagaca catgattaaa gcacaaccca agcaaaaatt ggacacttca atccaaacgg 4020 agtacccggc tttgcagacg attgtgtacc attcaaaaaa gatcaatgca atatttggcc 4080 cgttgtttag tgagcttact aggcaattac tggacagtgt tgattcgagc agatttttgt 4140 ttttcacaag aaagacacca gcgcagattg aggatttctt cggagatctc gacagtcatg 4200 tgccgatgga tgtcttggag ctggatatat caaaatacga caaatctcag aatgaattcc 4260 actgtgcagt agaatacgag atctggcgaa gattgggttt tgaagacttc ttgggagaag 4320 tttggaaaca agggcataga aagaccaccc tcaaggatta taccgcaggt ataaaaactt 4380 gcatctggta tcaaagaaag agcggggacg tcacgacgtt cattggaaac actgtgatca 4440 ttgctgcatg tttggcctcg atgcttccga tggagaaaat aatcaaagga gccttttgcg 4500 gtgacgatag tctgctgtac tttccaaagg gttgtgagtt tccggatgtg caacactccg 4560 cgaatcttat gtggaatttt gaagcaaaac tgtttaaaaa acagtatgga tacttttgcg 4620 gaagatatgt aatacatcac gacagaggat gcattgtgta ttacgatccc ctaaagttga 4680 tct,cgaaact tggtgctaaa cacatcaagg attgggaaca cttggaggag ttcagaaggt 4740 ctctttgtga tgttgctgtt tcgttgaaca attgtgcgta ttacacacag ttggacgacg 4800 ctgtatggga ggttcataag accgcccctc caggttcgtt tgtttataaa agtctggtga 4860 agtatttgtc tgataaagtt ctttttagaa gtttgtttat agatggctct agttgttaaa 4920 ggaaaagtga atatcaatga gtttatcgac ctgacaaaaa tggagaagat cttaccgtcg 4980 atgtttaccc ctgtaaagag tgttatgtgt tccaaagttg ataaaataat ggttcatgag 5040 aatgagtcat tgtcagaggt gaaccttctt aaaggagtta agcttattga tagtggatac 5100 gtctgtttag ccggtttggt cgtcacgggc gagtggaact tgcctgacaa ttgcagagga 5160 ggtgtgagcg tgtgtctggt ggacaaaagg atggaaagag ccgacgaggc cactctcgga 5220 tcttactaca cagcagctgc aaagaaaaga tttcagttca aggtcgttcc caattatgct 5280 ataaccaccc aggacgcgat gaaaaacgtc tggcaagttt tagttaatat tagaaatgtg 5340 aagatgtcag cgggtttctg tccgctttct ctggagtttg tgtcggtgtg tattgtttat 5400 agaaataata taaaattagg tttgagagag aagattacaa acgtgagaga cggagggccc 5460 atggaactta cagaagaagt cgttgatgag ttcatggaag atgtccctat gtcgatcagg 5520 cttgcaaagt ttcgatctcg aaccggaaaa aagagtgatg tccgcaaagg gaaaaatagt 5580 agtaatgatc ggtcagtgcc gaacaagaac tatagaaatg ttaaggattt tggaggaatg 5640 agttttaaaa agaataattt aatcgatgat gattcggagg ctactgtcgc cgaatcggat 5700 tcgttttaaa tagatcttac agtatcacta ctccatctca gttcgtgttc ttgtcattaa 5760 ttaaatgacg cgattatatt ctgtgttctt tcttttgttg gctcttgtag ttgaaccggg 5820 tgttagagcc tggagaaaag aaggccatgt catgacatgt caaattgcgc aggatctgtt 5880 ggagccagaa gcagcacatg ctgtaaagat gctgttaccg gactatgcta atggcaactt 5940 atcgtcgctg tgtgtgtggc ctgatcaaat tcgacactgg tacaagtaca ggtggactag 6000 ctctctccat ttcatcgata cacctgatca agcctgttca tttgattacc agagagactg 6060 tcatgatcca catggaggga aggaaatgtg tgttgctgga gccattcaaa atttcacatc 6120 tcagcttgga catttccgcc atggaacatc tgatcgtcga tataatatga cagaggcttt 6180 gttattttta tcccacttca tgggagatat tcatcagcct atgcatgttg gatttacaag 6240 tgatatggga ggaaacagta tagatttgcg ctggtttcgc cacaaatcca acctgcacca 6300 tgtttgggat agagagatta ttcttacagc tgcagcagat taccatggta aggatatgca 6360 ctctctccta caagacatac agaggaactt tacagagggt agttggttgc aagatgttga 6420 atcctggaag gaatgtgatg atatctctac ttgcgccaat aagtatgcta aggagagtat 6480 aaaactagcc tgtaactggg gttacaaaga tgttgaatct ggcgaaactc tttcagataa 6540 atacttcaac acaagaatgc caattgtcat gaaacggata gctcagggtg gaatccgttt 6600 atccatgatt ttgaaccgag ttcttggaag ctccgcagat cattctttgg caggaggtca 6660 ccatcaccat caccattgac ctaggccagt agtttggttt aaacccaact gcgaggggta 6720 gtcaagatgc ataataaata acggattgtg tccgtaatca cacgtggtgc gtacgataac 6780 gcatagtgtt tttccctcca cttaaatcga agggttgtgt cttggatcgc gcgggtcaaa 6840 tgtatatggt tcatatacat ccgcaggcac gtaataaagc gaggggttcg ggtcgaggtc 6900 ggctgtgaaa ctcgaaaagg ttccggaaaa caaaaaagag atggtaggta atagtgttaa 6960 taataagaaa ataaataata gtggtaagaa aggtttgaaa gttgaggaaa ttgaggataa 7020 tgtaagtgat gacgagtcta tcgcgtcatc gagtacgttt taatcaatat gccttataca 7080 atcaactctc cgagccaatt tgtttactta agttccgctt atgcagatcc tgtgcagctg 7140 atcaatctgt gtacaaatgc attgggtaac cagtttcaaa cgcaacaagc taggacaaca 7200 gtccaacagc aatttgcgga tgcctggaaa cctgtgccta gtatgacagt gagatttcct 7260 gcatcggatt tctatgtgta tagatataat tcgacgcttg atccgttgat cacggcgtta 7320 ttaaatagct tcgatactag aaatagaata atagaggttg ataatcaacc cgcaccgaat 7380 actactgaaa tcgttaacgc gactcagagg gtagacgatg cgactgtagc tataagggct 7440 tcaatcaata atttggctaa tgaactggtt cgtggaactg gcatgttcaa tcaagcaagc 7500 tttgagactg ctagtggact tgtctggacc acaactccgg ctacttagct attgttgtga 7560 gatttcctaa aataaagtca ctgaagactt aaaattcagg gtggctgata ccaaaatcag 7620 cagtggttgt tcgtccactt aaatataacg attgtcatat ctggatccaa cagttaaacc 7680 atgtgatggt gtatactgtg gtatggcgta aaacaacgga aaagtcgctg aagacttaaa 7740 attcagggtg gctgatacca aaatcagcag tggttgttcg tccacttaaa aataacgatt 7800 gtcatatctg gatccaacag ttaaaccatg tgatggtgta tactgtggta tggCgtaaaa 7860 caacggagag gttcgaatcc tcccctaacc gcgggtagcg gcccaggtac ccggatgtgt 7920 tttccgggct gatgagtccg tgaggacgaa acccggcatg caagcttggc gtaatcatgg 7980 tcatagcttt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc 8040 ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg 8100 ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc 8160 ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact 8220 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 8280 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag 8340 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 8400 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 8460 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 8520 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 8580 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 8640 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 8700 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 8760 aggtatgtag gaggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 8820 aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 8880 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 8940 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 9000 gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 9060 atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat 9120 gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc 9180 tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg 9240 gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct 9300 ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca 9360 actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg 9420 ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg 9480 tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc 9540 cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag 9600 ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg 9660 ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag 9720 tgtatccggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat 9780 agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg 9840 atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca 9900 gcatctttta ctttcaccag cgtttctggg tcagcaaaaa caggaaggca aaatgccgca 9960 aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat 10020 tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag 10080 aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa 10140 gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt 10200 ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc 10260 acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt 10320 gttggcgggt gtcggggctg gcttaactat gcggcatcag agcagattgt actgagagtg 10380 caccatatgc ggtgtgaaat accgcacaga tgggtaagga gaaaataccg catcaggcgc 10440 cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta 10500 ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg 10560 ttttcccagt cacgacgttg taaaacgacg gccagtgaat tcaagcttaa tacgactcac 10620 tata 10624 <210> 3 <211> 891 <212> DNA
<213> Apium graveolens <400> 3 atgacgcgat tatattctgt gttctttctt ttgttggctc ttgtagttga accgggtgtt 60 agagcctgga gcaaagaagg ccatgtcatg acatgtcaaa ttgcgcagga tctgttggag 120 ccagaagcag cacatgctgt aaagatgctg ttaccggact atgctaatgg caacttatcg 180 tcgctgtgtg tgtggcctga tcaaattcga cactggtaca agtacaggtg gactagctct 240 ctccatttca tcgatacacc tgatcaagcc tgttcatttg attaccagag agactgtcat 300 gatccacatg gagggaagga catgtgtgtt gctggagcca ttcaaaattt cacatctcag 360 cttggacatt tccgccatgg aacatctgat cgtcgatata atatgacaga ggctttgtta 420 tttttatccc acttcatggg agatattcat cagcctatgc atgttggatt tacaagtgat 480 atgggaggaa acagtataga tttgcgctgg tttcgccaca aatccaacct gcaccatgtt 540 tgggatagag agattattct tacagctgca gcagattacc atggtaagga tatgcactct 600 ctcttacaag acatacagag gaactttaca gagggtagtt ggttgcaaga tgttgaatcc 660 tggaaggaat gtgatgatat ctctacttgc gccaataagt atgctaagga gagtataaaa 720 ctagcctgta actggggtta caaagatgtt gaatctggcg aaactctgtc agataaatac 780 ttcaacacaa gaatgccaat tgtcatgaaa cggatagctc agggtggaat ccgtttatcc 840 atgattttga accgagtttt tggaagctcc gcagatcatt ctttggcatg a 891 <210> 4 <211> 915 <212> DNA

<213> Apium graveolens <400> 4 atgacgcgat tatattctgt gttctttctt ttgttggctc ttgtagttga accgggtgtt 60 agagcctgga gcaaagaagg ccatgtcatg acatgtcaaa ttgcgcagga tctgttggag 120 ccagaagcag cacatgctgt aaagatgctg ttaccggact atgctaatgg caacttatcg 180 tcgctgtgtg tgtggcctga tcaaattcga cactggtaca agtacaggtg gactagctct 240 ctccatttca tcgatacacc tgatcaagcc tgttcatttg attaccagag agactgtcat 300 gatccacatg gagggaagga catgtgtgtt gctggagcca ttcaaaattt cacatctcag 360 cttggacatt tccgccatgg aacatctgat cgtcgatata atatgacaga ggctttgtta 420 tttttatccc acttcatggg agatattcat cagcctatgc atgttggatt tacaagtgat 480 atgggaggaa acagtataga tttgcgctgg tttcgccaca aatccaacct gcaccatgtt 540 tgggatagag agattattct tacagctgca gcagattacc atggtaagga tatgcactct 600 ctcctacaag acatacagag gaactttaca gagggtagtt ggttgcaaga tgttgaatcc 660 tggaaggaat gtgatgatat ctctacttgc gccaataagt atgctaagga gagtataaaa 720 ctagcctgta actggggtta caaagatgtt gaatctggcg aaactctgtc agataaatac 780 ttcaacacaa gaatgccaat tgtcatgaaa cggatagctc agggtggaat ccgtttatcc 840 atgattttga accgagttct tggaagctcc gcagatcatt ctttggcagg aggtcaccat 900 caccatcacc attga 915 <210> 5 <211> 717 <212> DNA
<213> Artificial Sequence derived from Aequorea victoria GFP
<220>
<223> This construct was derived by shuffling in accordance with the me thodogy of the present invention.

<400> 5 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120 aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctcttatgg tgttcaatgc ttttcaagat acccagatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatttttc 300 aaggatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 420 ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480 atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660 cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 6 <211> 717 <212> DNA
<213> Artificial Sequence was derived from Aequorea Victoria GFP
<220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 6 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc tacatacgga 120 aagcttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctcttatgg tgttcaatgc ttttcaagat acccagatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatctttc 300 aaagatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 420 ctcgagtaca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480 atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660 cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 7 <211> 717 <212> DNA
<213> Artificial Sequence was derived from Aequorea Victoria GFP
<220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 7 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc tacatacgga 120 aagcttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctcttatgg tgttcaatgc ttttcccgtt atccggatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatctttc 300 aaagatgacg ggaactacaa gacgcgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct cggacacaaa 420 ttggaataca actataactc acacaatgta tacatcacgg cagacaaaca aaagaatgga 480 atcaaagcta acttcaaaat tcgccacaac attgaagatg gatccgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtcgacac aatctgccct ttcgaaagat cccaacgaaa agcgtgacca catggtcctt 660 cttgagtttg taactgctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 8 <211> 717 <212> DNA
<213> Artificial Sequence was derived from Aequorea Victoria GFP
<220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention <400> 8 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120 aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctcttatgg tgttcaatgc ttttcaagat acccagatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaaagaac tatatttttc 300 aaggatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct cggacacaaa 420 ctcgagtaca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480 atcaaagtta acttcaaaat tcgccacaac attgaagatg gatccgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660 cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 9 <211> 807 <212> DNA
<213> Tobacco mosaic virus <400> 9 atggctctag ttgttaaagg aaaagtgaat atcaatgagt ttatcgacct gacaaaaatg 60 gagaagatct taccgtcgat gtttacccct gtaaagagtg ttatgtgttc caaagttgat 120 aaaataatgg ttcatgagaa tgagtcattg tcaggggtga accttcttaa aggagttaag 180 cttattgata gtggatacgt ctgtttagcc ggtttggtcg tcacgggcga gtggaacttg 240 cctgacaatt gcagaggagg tgtgagcgtg tgtctggtgg acaaaaggat ggaaagagcc 300 gacgaggcca ctctcggatc ttactacaca gcagctgcaa agaaaagatt tcagttcaag 360 gtcgttccca attatgctat aaccacccag gacgcgatga aaaacgtctg gcaagtttta 420 gttaatatta gaaatgtgaa gatgtcagcg ggtttctgtc cgctttctct ggagtttgtg 480 tcggtgtgta ttgtttatag aaataatata aaattaggtt tgagagagaa gattacaaac 540 gtgagagacg gagggcccat ggaacttaca gaagaagtcg ttgatgagtt catggaagat 600 gtccctatgt cgatcaggct tgcaaagttt cgatctcgaa ccggaaaaaa gagtgatgtc 660 cgcaaaggga aaaatagtag tagtgatcgg tcagtgccga acaagaacta tagaaatgtt 720 aaggattttg gaggaatgag ttttaaaaag aataatttaa tcgatgatga ttcggaggct 780 actgtcgccg aatcggattc gttttaa 807 <210> 10 <211> 793 <212> DNA
<213> Tomato mosaic virus <400> 10 atggctctag ttgttaaagg taaggtaaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggtga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactggggtc atattacact gctgctgcta aaaagcggtt tcagtttaaa 360 gtggtcccaa attacggtat tactacaaag gatgcagaaa agaacatatg gcaggtctta 420 gtaaatatta aaaatgtaaa aatgagtgcg ggctactgcc ctttgtcatt agaatttgtg 480 tctgtgtgta ttgtttataa aaataatata aaattgggtt tgagggagaa agtaacgagt 540 gtgaacgatg gaggacccat ggaactttca gaagaagttg ttgatgagtt catggagaat 600 gttccaatgt cggttagact cgcaaagttt cgaaccaaat cctcaaaaag aggtccgaaa 660 aataataata atttaggtaa ggggcgttca ggcggaaggc ctaaaccaaa aagttttgat 720 gaagttgaaa aagagtttga taatttgatt gaagatgaag ccgagacgtc ggtcgcggat 780 tctgattcgt att 793 <210> 11 <211> 795 <212> DNA
<213> Artificial Sequence derived from tobacco mosaic virus & tomato mosaic virus <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention <400> 11 atggctctag ttgttaaagg taaggtaaat attaatgagt ctatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggtga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactggggtc atattacact gctgctgcta aaaagcggtt tcagttcaag 360 gtcgttccca attatgctat aaccacccag gatgcagaaa agaacatatg gcaggtctta 420 gtaaatatta aaaatgtaaa aatgagtgcg ggctactacc ctttgtcatt agaatttgtg 480 tctgtgtgta ttgtttataa aaataatata aaattgggtt tgagggagaa agtaacgagt 540 gtgaacgatg gaggacccat ggaactttca gaagaagttg ttgatgagtt catggagaat 600 gttccaatgt cgatcaggct tgcaaagttt cgaaccaaat cctcaaaaag aggtccgaaa 660 aataataata atttaggtaa ggggcgttca ggcggaaggc ctaaaccaag aagttttgat 720 gaagttgaaa aagagtttga taatttgatt gaagatgaag ccgagacgtc ggtcgcggat 780 tctgattcgt attaa 795 <210> 12 <211> 795 <212> DNA
<213> Artificial Sequence derived from tobacco mosaic virus & tomato mosaic virus <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 12 atggctctag ttgttaaagg taaggtaaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggtgt gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactcggatc ttactacact gctgctgcta aaaagcggtt tcagttcaag 360 gtcgttccca attatgctat aaccacccag gatgcagaaa agaacatatg gcaggtctta 420 gtaaatatta aaaatgtaaa aatgagtgcg ggctactgcc ctttgtcatt agaatttgtg 480 tctgtgtgta ttgtttataa aaataatata aaattgggtt tgagggagaa agtaacgagt 540 gtgaacgatg gaggacccat ggaactttca gaagaagttg ttgatgagtt catggagaat 600 gttccaatgt cggttagact cgcaaagttt cgaaccaaat cctcaaaaag aggtccgaaa 660 aataataata atttaggtaa ggggcgttca ggcggaaggc ctaaaccaaa aagttttgat 720 gaagttggaa aagagtttga taatttgatt gaagatgaag ccgagacgtc ggtcgcggat 780 tctgattcgt attaa 795 <210> 13 <211> 795 <212> DNA
<213> Artificial Sequence derived from tobacco mosaic virus & tomato mosaic virus <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 13 atggctctag ttgttaaagg taaggtaaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaggagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggtga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactggggtc atattacact gctgctgcta aaaagcggtt tcagtttaaa 360 gtggtcccaa attacggtat tactacccag gacgcgatga aaaacgtctg gcaggtctta 420 gtaaatatta aaaatgtaaa aatgagtgcg ggctactgcc ctttgtcatt agaatttgtg 480 tctgtgtgta ttgtttataa aaataatata aaattgggtt tgagggagaa agtaacgagt 540 gtgaacgatg gaggacccat ggaactttca gaagaagttg ttgatgagtt catggagaat 600 gttccaatgt cgatcagact cgcaaagttt cgaaccaaat cctcaaaaag aggtccgaaa 660 aataataata atttaggtaa ggggcgttca ggcggaaggc ctaaaccaaa aagttttgat 720 gaagttgaaa aagagtttga taatttgatt gaagatgaag ccgagacgtc ggtcgcggat 780 tctgattcgt attaa 795 <210> 14 <211> 796 <212> DNA
<213> Artificial Sequence derived from tobacco mosaic virus & tomato mosaic virus <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 14 atggctctag ttgttaaagg taaggtaaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgttaag 180 cttattgata gtggatacgt ctgtttagcc ggtttggtcg tcacgggcga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactggggtc atattacact gctgctgcta aaaagcggtt tcagttcaag 360 gtcgttccca aattacggta ttactaccca ggatgcagaa aagaacatat ggcaggtctt 420 agtaaatatt aaaaatgtaa aaatgagtgc gggctactgc ccgctttctc tggagtttgt 480 gtctgtgtgt attgtttata aaaataatat aaaattgggt ttgagggaga aagtaacgag 540 tgtgaacgat ggaggaccca tggaactttc agaagaagtt gttgatgagt tcatggagaa 600 tgttccaatg tcggttagac tcgcaaagtt tcgaaccaaa tcctcaaaaa gaggtccgaa 660 aaataataat aatttaggta aggggcgttc aggcggaagg cctaaaccaa aaagttttga 720 tgaagttgaa aaagagtttg ataatttgat tgaggatgat tcggaggcta ctgtcgccga 780 ttctgattcg tattaa 796 <210> 15 <211> 795 <212> DNA
<213> Artificial Sequence derived from tobacco mosaic virus & tomato mosaic virus <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 15 atggctctag ttgttaaagg aaaagtgaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggcga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactggggtc atattacact gctgctgcaa agaaaagatt tcagttcaag 360 gtcgttccca attatgctat aaccacccag gatgcagaaa agaacatatg gcgggtctta 420 gtaaatatta aaaatgtaaa aatgagtgcg ggctactgcc cgctttctct ggagtttgtg 480 tctgtgtgta ttgtttataa aaataatata aaattgggtt tgagggagaa agtaacgagt 540 gtgaacgatg aaggacccat ggaactttca gaagaagttg ttgatgagtt catggagaat 600 gttccaatgt cgatcaggct cgcaaagttt cgaaccaaat cctcaaaaag aggtccgaaa 660 aataataata atttaggtaa ggggcgttca ggcggaaggc ctaaaccaaa aagttttgat 720 gaagttgaaa aagagtttga taatttgatt gaagatgaag ccgagacgtc ggtcgcggat 780 tctgattcgt actaa 795 <210> 16 <211> 888 <212> DNA
<213> Selaginella lepidophylla <400> 16 atggcaacga ccaagacgag cgggatggcg ctggctttgc tcctcgtcgc cgccctggcc 60 gtgggagctg cggcctgggg gaaagagggc catcgcctca cttgtatggt cgccgagccc 120 tttctaagct ctgaatccaa gcaagctgtg gaggagcttc tctctggaag agatctcccg 180 gacttgtgtt catgggccga tcagattcga agatcgtata agtttagatg gactggtcct 240 ttgcactaca tcgatactcc agacaacctc tgcacctatg actatgatcg tgactgccac 300 gattcccatg ggaagaagga cgtgtgtgtc gctggtggga tcaacaatta ctcgtcgcag 360 ctggaaacgt ttctagattc agagagctcg ttgtataact tgaccgaggc gctgctcttc 420 ctggctcact ttgtcgggga tatacaccag cccttgcacg tagcatttac gagtgatgcc 480 ggaggcaatg gcgtgcacgt ccgctggttt ggacgaaagg ccaacttgca tcacgtctgg 540 gatacagaat ttatttctag agccaatcgt gtgtactacc acgacatttc caagatgctc 600 cggaacatta ccaggagcat aactaagaag aatttcaata gttggagcag atgtaagact 660 gatccggcgg cttgtattga tagttatgcg acagaaagta tagatgcttc ttgcaactgg 720 gcatacaaag acgcacccga cggaagctct ctagatgatg attacttctc ttcacgcctt 780 ccaattgttg agcagcgtct tgctcaaggg ggcgtcaggc tggcgtcaat actcaacagg 840 atttttggag gagcaaagtc gaacaggtcc agtcgctcaa gcatgtag 888 <210> 17 <211> 3637 <212> DNA
<213> Artificial Sequence <220>
<223> Encodes cycle 3 GFP
<400> 17 gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 60 caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 120 ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt 180 gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 240 tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 300 ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 360 tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga 420 atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 480 gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 540 caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 600 ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 660 ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 720 ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 780 ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 840 gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 900 ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 960 taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 1020 agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 1080 atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 1140 aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 1200 caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 1260 ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 1320 cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 1380 tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 1440 gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 1500 ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 1560 gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 1620 caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 1680 ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 1740 tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 1800 ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg 1860 agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg 1920 aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat 1980 gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg 2040 tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt 2100 tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg 2160 ccaagcgcgc aattaaccct cactaaaggg aacaaaagct gggtaccgat gagtaaagga 2220 gaagaacttt tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg 2280 cacaaatttt ctgtcagtgg agagggtgaa ggtgatgcta catacggaaa gcttaccctt 2340 aaatttattt gcactactgg aaaactacct gttccatggc caacacttgt cactactttc 2400 tcttatggtg ttcaatgctt ttcccgttat ccggatcata tgaaacggca tgactttttc 2460 aagagtgcca tgcccgaagg ttatgtacag gaacgcacta tatctttcaa agatgacggg 2520 aactacaaga cgcgtgctga agtcaagttt gaaggtgata cccttgttaa tcgtatcgag 2580 ttaaaaggta ttgattttaa agaagatgga aacattctcg gacacaaact cgagtacaac 2640 tataactcac acaatgtata catcacggca gacaaacaaa agaatggaat caaagctaac 2700 ttcaaaattc gccacaacat tgaagatgga tccgttcaac tagcagacca ttatcaacaa 2760 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct gtcgacacaa 2820 tctgcccttt cgaaagatcc caacgaaaag cgtgaccaca tggtccttct tgagtttgta 2880 actgctgctg ggattacaca tggcatggat gaactataca aataagaatt cctgcagccc 2940 gggggatcca ctagttctag agcggccgcc accgcggtgg agctccaatt cgccctatag 3000 tgagtcgtat tacgcgcgct cactggccgt cgttttacaa cgtcgtgact gggaaaaccc 3060 tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag 3120 cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatggga 3180 cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 3240 tacacttgcc agcgccctag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 3300 gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag 3360 tgctttacgg cacctcgacc ccaaaaaact tgattagggt gatggttcac gtagtgggcc 3420 atcgccctga tagacggttt ttcgcctttt gacgttggag tccacgttct ttaatagtgg 3480 actcttgttc caaactgaaa caacactcaa ccctatctcg gtctattctt ttgatttata 3540 agggattttg ccgatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa 3600 cgcgaatttt aacaaaatat taacgcttac aatttag 3637 <210> 18 <211> 796 <212> DNA
<213> Tobamovirus Cg <400> 18 atgtcttacg agcctaaagt gagcgacttc cttgctctta cgaaaaagga ggaaatttta 60 cccaaggctc ttacgaggtt aaagactgtc tctattagta ctaaggatgt tatatctgtt 120 aaggattctg agtccctgtg tgatatagat ttactagtta atgtgccatt agataagtat 180 agatatgtgg gtgttttagg tgttgttttt accggtgagt ggttagtgcc ggatttcgtt 240 aaaggtggag taacagtgag cgtgattgac aaacggcttg agaactccaa agagtgcata 300 attggtacgt acagagctgc tgcgaaagac aaaaggttcc agttcaagct ggttccaaat 360 tacttcgtgt ctgttgcaga tgccaagcga aaaccgtggc aagttcatgt gcgtattcaa 420 aatttaagga ttgaagctgg atggcaacct ctggccttag aggtggtttc tgttgctatg 480 gtcactaata acgtggttgt taagggtttg agagaaaagg tcatcgcagt gaatgatccg 540 aatgtcgaag gtttcgaagg cgtgattgac gatttcgtcg attcggtcgc agcattcaag 600 gcggttgaca ctttcagaaa gaaaaagaaa aggattggag gaaaggatgt aaataataat 660 aagtttagat atagaccgga gagatacgcc ggtcaggatt cgttaaatta taaagaagaa 720 aacgtcttac aacatcacga actcgaatca gtaccagtat ttcgcagcga cgtgggcaga 780 gcccacagcg atgctt 796 <210> 19 <211> 823 <212> DNA
<213> Tobamovirus Ob <400> 19 atgtcaaagg ctattgtcaa gatcgatgaa ttcattaaat tatccaagtc tgaagaggtt 60 ttaccttctg cattcacaag aatgaagtcg gtcagagtct caacagtgga taagataatg 120 gccaaagaga atgacaatat ttccgaagta gatttactta agggtgttaa gttagttaaa 180 aatggttatg tttgtttagt aggtcttgtg gtgtcaggag agtggaattt acccgacaac 240 tgcagaggtg gtgtaagtat ctgtctgata gacaaacgta tgcaacgtca taacgaagct 300 actttaggtt cgtacactac caaagccagc aagaaaaact tttcgttcaa gcttataccg 360 aattactcga taacctctca agatgctgaa aggcgtcctt gggaagttat ggtaaatatt 420 cgtggtgtgg ctatgtccga aggttggtgt ccattatcct tagagttcgt ttctgtttgt 480 attgttcata aaaacaatgt tagaaagggt ctaagagaga aggtgactgc cgtgtccgaa 540 gacgacgcta tagaactcac agaagaggtt gttgatgagt ttatagaagc cgtaccgatg 600 gcgcgacgtt tgcagaactt gagaaaaccc aagtacaaca aagaaaaaga aaataaaaat 660 ttgaataata aaaatagtat aggagtttcc aaacctgtcg gtttggaaag aaataaagta 720 aggagtgtag ttagaaaagg ggttaggagt gatagtagtt taggtgtgac tgatatgagt 780 caggacggta gctcaagcga gatatcatcc gattcgttta ttt 823 <210> 20 <211> 769 <212> DNA
<213> Tobacco mosaic virus-U2 <400> 20 atggctgtta gtctcagaga tactgtcaaa attagcgagt tcattgatct ttcgaaacag 60 gatgagatac ttccggcatt catgactaag gtcaagagcg tcagaatatc gactgtggac 120 aagattatgg ctgttaagaa tgatagtctt tctgatgtag atttacttaa aggtgttaag 180 ttagttaaga atgggtacgt gtgcttagct ggtttggtag tgtctgggga gtggaatctc 240 ccggacaact gccgtggtgg tgtcagtgtt tgtattgtag ataagagaat gaaaaggagt 300 aaggaggcaa cgctgggtgc gtatcacgcc cctgcttgca aaaagaattt ttcctttaag 360 ctaatcccta attattcaat aacatccgag gatgctgaga agcacccatg gcaagtatta 420 gtgaatatca aaggagtggc tatggaagaa ggatactgtc ctttatcttt ggagttcgtt 480 tcaatttgtg tagtacataa aaataatgta agaaaaggtt tgagggaacg tattttgaga 540 gtaacagacg gctcgccaat tgaactcact gaaaaagttg ttgaggagtt catagatgaa 600 gtaccaatgg ctgtgaaact cgaaaggttc cggaaaacaa aaaagagagt ggtaggtaat 660 agtgttaata ataagaaaat aaataatagt ggtaagaaag gtttgaaagt tgaggaaatt 720 gaggataatg taagtgatga cgagtctatc gcgtcatcga gtacgtttt 769 <210> 21 <211> 808 <212> DNA
<213> Artificial Sequence derived from tomato mosaic virus and TMV-Cg <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 21 atggctctag ttgttaaagg taaggtaaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tctgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggtga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca cactggggtc atattacact gctgctgcta aaaagcggtt tcagtttaaa 360 gtggtcccaa attacggtat tactacaaag gatgcagaaa agaacatatg gcaagttcat 420 gtgcgtattc aaaatttaag gattgaagct ggatggcaac ctctggcctt agaggtggtt 480 tctgttgcta tggtcactaa taacgtggtt gttaagggtt tgagagaaaa ggtcatcgca 540 gtgaatgatc cgaatgtcga aggtttcgaa ggcgtggttg acgatttcgt cgattcggtc 600 gcagcattca aggcggttga cactttcaga aagaaaaaga aaaggattgg aggaaaggat 660 gtaaataata ataagtttag atatagaccg gagagatacg ccggtcagga ttcgttaaat 720 tataaagaag aaaacgtctt acaacatcac gaactcgaat cagtaccagt atttcgcagc 780 gacgtgggca gagcccacag cgatgctt 808 <210> 22 <211> 799 <212> DNA
<213> Artificial Sequence derived from tomato mosaic virus and TMV-Cg <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 22 atgtcttacg agcctaaagt gagcgacttc cttgctctta cgaaaaagga ggaaatttta 60 cccaaggctc ttacgaggtt aaagactgtc tctattagta ctaaggatgt tatatctgtt 120 aaggattctg agtccctgtg tgatatagat ttactagtta atgtgccatt agataagtat 180 agatatgtgg gtgttttagg tgttgttttt accggtgagt ggaatttacc agataattgc 240 cgtggtggtg tgagtgtctg catggttgac aagagaatgg aaagagcgga cgaagccaca 300 ctggggtcat attacactgc tgctgcgaaa gacaaaaggt tccagttcaa gctggttcca 360 aattacttcg tgtctgttgc agatgccaag cgaaaaccgt ggcaagttca tgtgcgtatt 420 caaaatttaa ggattgaagc tggatggcaa cctctggcct tagaggtggt ttctgttgct 480 atggtcacta ataacgtggt tgttaagggt ttgagagaaa aggtcatcgc agtgaatgat 540 ccgaatgtcg aaggtttcga aggcgtggtt gacgatttcg tcgattcggt cgcagcattc 600 aaggcggttg acactttcag aaagaaaaag aaaaggattg gaggaaagga tgtaaataat 660 aataagttta gatatagacc ggagagatac gccggtcagg attcgttaaa ttataaagaa 720 gaaaacgtct tacaacatca cgaactcgaa tcagtaccag tatttcgcag cgacgtgggc 780 agagcccaca gcgatgctt 799 <210> 23 <211> 823 <212> DNA
<213> Artificial Sequence derived from ToMV & TMV-Ob <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 23 aaataaacga atcggatgat atctcgcttg agctaccgtc ctgactcata tcagtcacac 60 ctaaactact atcactccta accccttttc taactacact ccttacttta tttctttcca 120 aaccgacagg tttggaaact cctatactat ttttattatt caaattttta ttttcttttt 180 ctttgttgta cttgggtttt ctcaagttct gcaaacgtcg cgccatcggt acggcttcta 240 taaactcatc aacaacctct tctgtgagtt ctatagcgtc gtcttcggac acggcagtca 300 ccttctctct tagacccttt ctaacattgt ttttatgaac aatacaaaca gaaacgaact 360 ctaaggataa tggacaccaa ccttcggaca tagccacacc acgaatattt accataactt 420 cccaaggacg cctttcagca tcttgagagg ttatcgagta attcggtata agcttgaacg 480 aaaagttttt cttgctggct ttggtagtgt acgaacctaa agtagcttcg ttatgacgtt 540 gcatacgttt gtctatcaga cagatactta caccacctct gcagttgtcg ggtaaattcc 600 actctcctga caccacaaga cctactaaac aaacataacc accttctata agttttacac 660 cttttaagag atttacttca gacaatgatt cattctcttt ggccattatc ttatccactg 720 ttgagactct gaccgacttc attcttgtga atgcagaagg taaaacctct tcagacttgg 780 ataatttaat gaattcatcg atcttgacaa tagcctttga cat 823 <210> 24 <211> 792 <212> DNA
<213> Artificial Sequence derived from ToMV & TMV-Ob <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 24 aatacgaatc agaatccgcg accgacgtct cggcttcatc ttcaatcaaa ttatcaaact 60 ctttttcaac ttcatcaaaa ctttttggtt taggccttcc gcctgaacgc cccttaccta 120 aattattatt atttttcgga cctctttttg aggatttggt tcgaaacttt gcgagtctaa 180 ccgacattgg aacattctcc atgaactcat caacaacctc ttctgtgagt tctatagcgt 240 cgtcttcgga cacggcagtc accttctctc ttagaccctt tctaacattg tttttatgaa 300 caatacaaac agaaacgaac tctaatgaca aagggcagta gcccgcactc atttttacat 360 ttttaatatt tactaagacc tgccatatgt tcttttctgc atcctttgta gtaataccgt 420 aatttgggac cactttaaac tgaaaccgct ttttagcagc agcagtgtaa tatgacccca 480 gtgtggcttc gtccgctctt tccattctct tgtcaaccat gcagacactc acaccaccac 540 ggcaattatc tggtaaattc cactctcctg acaccacaag acctactaaa caaacataac 600 catttttaac taacttaaca cccttaagag atttacttcg gacaatgatt cattttcatg 660 gaccataatc ttatcaacct ttgaaaccat aacactcttt acaggcgtga atgcagaagg 720 taaaacctct tcagactttg acagatcgat aaactcatta atatttacct tacctttaac 780 aactagagcc at 792 <210> 25 <211> 769 <212> DNA
<213> Artificial Sequence derived from ToMV & TMV-U2 <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 25 aatacgaatc agaatccgcg atagactcgt catcacttac attatcctca atttcctcaa 60 ctttcaaacc tttcttacca ctattattta ttttcttatt attaacacta ttacctacca 120 ctctcttttt tgttttccgg aacctttcga gtttcacagc cattggtact tcatctatga 180 actcatcaac aacttcttct gaaagttcca tgggtcctcc atcgttcaca ctcgttactt 240 tctccctcaa acccaatttt atattatttt tataaacaat acacacagac acaaattcta 300 aagataaagg gcagtatcct tcttccatag ccactccttt gatattcact aatacttgcc 360 atgggtgctt ttctgcatcc tcggatgtta ttgaataatt agggaccact ttaaactgaa 420 accgcttttt agcagcaggg gcgtgatacg cacccagcgt tgcctcctta ctcctttcca 480 ttctcttgtc aaccatgcag acactcacac caccacggca gttgtccggg agattccact 540 caccggacac aacaagacca actaagCaaa catacccacc ttctataagt tttacacctt 600 ttaagagatt tacttcagac aatgattcat tttcatggac cataatctta tcaacctttg 660 aaaccataac actctttaca ggcgtgaaca tcgacgggag aagtttctca gactttgaca 720 gatcgataaa ctcattaata tttaccttac ctttaacaac tagagccat 769 <210> 26 <211> 772 <212> DNA
<213> Artificial Sequence derived from ToMV & TMV-U2 <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 26 aatacgaatc agaatccgcg accgacgtct cggcttcact tacattatcc tcaatttcct 60 caactttcaa aactttctta ccactattat ttattttctt attattaaca ctattaccta 120 ccactctctt ttttgttttc cggaaccttt cgagtttcac agccattggt acttcatcta 180 tgaactcatc aacaactttt tcagtgagtt caattggcga gccgtctgtt actctcaaaa 240 tacgttccct caaacccaat tttatattat ttttataaac aatacacaca gacacaaatt 300 ctaatgacaa agggcagtag cccgcactca tttttacatt tttaatattt actaagacct 360 gccatgggtg cttctcagca tcctcggatg ttattgaata attagggatt agcttaaagg 420 aaaaattctt tttgcaagca ggggcgtgat acgcacccag tgtggcttcg tccgctcttt 480 ccattctctt gtcaaccatg cagacactca caccaccacg gcagttgtcc gggagattcc 540 actcaccgga cacaacaaga ccaactaagc acacgtaccc attcttaact aacttaacac 600 ctttaagtaa atctacatca gacaatgatt cattttcatg gaccataatc ttatcaacct 660 ttgaaaccat aacactcttt acaggcgtga acatcgacgg gagaagtttc tcagactttg 720 acagatcgat aaactcgcta attttgacag tatctctgag actaacagcc at 772 <210> 27 <211> 805 <212> DNA
<213> Artificial Sequence derived from ToMV & TMV-U1 <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 27 atggctctag ttgttaaagg aaaagtgaat attaatgagt ttatcgatct gtcaaagtct 60 gagaaacttc tcccgtcgat gttcacgcct gtaaagagtg ttatggtttc aaaggttgat 120 aagattatgg tccatgaaaa tgaatcattg tttgaagtaa atctcttaaa aggtgtaaaa 180 cttatagaag gtgggtatgt ttgcttagtt ggtcttgttg tgtccggtga gtggaattta 240 ccagataatt gccgtggtgg tgtgagtgtc tgcatggttg acaagagaat ggaaagagcg 300 gacgaagcca ctctcggatc ttactacaca gcagctgcaa agaaaagatt tcagttcaag 360 gtcgttccca attatgctat aaccacccag gacgcgatga aaaacgtctg gcaagtttta 420 gttaatatta gaaatgtgaa gatgtcagcg ggtttctgtc cgctttctct ggagtttgtg 480 tctgtgtgta ttgtttataa aaataatata aaattgggtt tgagggagaa agtaacgagt 540 gtgaacgatg gaggacccat ggaactttca gaagaagttg ttgatgagtt catggaagat 600 gtcccaatgt cggttagact cgcaaagttt cgatctcgaa ccggaaaaaa gagtgatgtc 660 cgcaaaggga aaaatagtag tagtgatcgg tcagtgccga acaagaacta tagaaatgtt 720 aaggattttg gaggaatgag ttttaaaaag aataatttaa tcgatgatga ttcggagacg 780 tcggtcgcgg attctgattc gtatt 805 <210> 28 <211> 804 <212> DNA
<213> Artificial Sequence derived from ToMV & TMV-U1 <220>
<223> This sequence was derived by shuffling in accordance with the met hodogy of the present invention.

<400> 28 atggctctag ttgttaaagg aaaagtgaat atcaatgagt ttatcgacct gacaaagtct 60 gagaaacttc tcccgtcgat gtttacccct gtaaagagtg ttatggttcc aaagttgata 120 agattatggt tcatgagaat gagtcattgt caggggtgaa ccttcttaaa ggagttaagc 180 ttattgatag tggatacgtc tgtttagccg gtttggtcgt cacgggcgag tggaacttgc 240 ctgacaattg ccgtggtggt gtgagcgtgt gtctggtgga caagagaatg gaaagagcgg 300 acgaagccac actggggtca tattacactg ctgctgctaa aaagcggttt cagttcaagg 360 tcgttcccaa ttatgctata accacccagg atgcagaaaa gaacatatgg caggtcttag 420 taaatattaa aaatgtgaag atgagtgcgg gctactgccc tttgtcatta gaatttgtgt 480 cggtgtgtat tgtttataga aataatataa aattgggttt gagagagaaa gtaacgagtg 540 tgaacgatgg agggcccatg gaacttacag aagaagtcgt tgatgagttc atggaagatg 600 tccctatgtc gatcaggctt gcaaagtttc gatctcgaat cctcaaaaag agtgatgtcc 660 gcaaagggaa aaatagtagt agtgatcggt cagtgccgaa caagaactat agaaatgtta 720 aggattttgg aggaatgagt tttaaaaaga ataatttaat cgatgatgat tcggaggcta 780 ctgtcgcgga ttctgattcg tttt 804 <210> 29 <211> 717 <212> DNA
<213> Aequorea victoria GFP ORF
<400> 29 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120 aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctcttatgg tgttcaatgc ttttcaagat acccagatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaaagaac tatatttttc 300 aaggatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 420 ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480 atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660 cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 30 <211> 717 <212> DNA
<213> Aequorea victoria GFP Cycle 3 ORF
<400> 30 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc tacatacgga 120 aagcttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctcttatgg tgttcaatgc ttttcccgtt atccggatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatctttc 300 aaagatgacg ggaactacaa gacgcgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatcgtatcg agttaaaagg tattgatttt aaagaagatg gaaacattct cggacacaaa 420 ctcgagtaca actataactc acacaatgta tacatcacgg cagacaaaca aaagaatgga 480 atcaaagcta acttcaaaat tcgccacaac attgaagatg gatccgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtcgacac aatctgccct ttcgaaagat cccaacgaaa agcgtgacca catggtcctt 660 cttgagtttg taactgctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 31 <211> 3637 <212> DNA
<213> Artificial Sequence <220>
<223> Plasmid encoding wild type Aequorea victoria GFP Cycle 3 ORF
<400> 31 gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 60 caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 120 ggaagagtat gagtattcaa catttctgcg tcgcccttat tccctttttt gcggcatttt 180 gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 240 tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 300 ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 360 tattatcccg tattgacgcc gggcaagagc aactggctcg ccgcatacac tattctcaga 420 atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 480 gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 540 caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 600 ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 660 ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 720 ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 780 ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 840 gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 900 ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 960 taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 1020 agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 1080 atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 1140 aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 1200 caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 1260 ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 1320 cgtagttagg ccaccacttc aagaactctg taggaccgcc tacatacctc gctcttgtaa 1380 tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 1440 gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 1500 ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 1560 gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 1620 caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 1680 ggtttcgcca cctctgactt gagcgtcaat ttttgtgatg ctcgtcaggg gggcggagcc 1740 tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 1800 ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg 1860 agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg 1920 aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat 1980 gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg 2040 tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt 2100 tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg 2160 ccaagcgcgc aattaacCct cactaaaggg aacaaaagct gggtaccgat gagtaaagga 2220 gaagaacttt tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg 2280 cacaaatttt ctgtcagtgg agagggtgaa ggtgatgcaa catacggaaa acttaccctt 2340 aaatttattt gcactactgg aaaactacct gttccatggc caacacttgt cactactttc 2400 tcttatggtg ttcaatgctt ttcaagatac ccagatcata tgaaacggca tgactttttc 2460 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta tatttttcaa ggatgacggg 2520 aactacaaga cacgtgctga agtcaagttt gaaggtgata cccttgttaa tagaatcgag 2580 ttaaaaggta ttgattttaa agaagatgga aacattcttg gacacaaatt ggaatacaac 2640 tataactcac acaatgtata catcatggca gacaaacaaa agaatggaat caaagttaac 2700 ttcaaaatta gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa 2760 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct gtccacacaa 2820 tctgcccttt cgaaagatcc caacgaaaag agagaccaca tggtccttct tgagtttgta 2880 acagctgctg ggattacaca tggcatggat gaactataca aataagaatt cctgcagccc 2940 gggggatcca ctagttctag agcggccgcc accgcggtgg agctccaatt cgccctatag 3000 tgagtcgtat tacgcgcgct cactggccgt cgttttacaa cgtcgtgact gggaaaaccc 3060 tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag 3120 cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatggga 3180 cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 3240 tacacttgcc agcgccctag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 3300 gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag 3360 tgctttacgg cacctcgacc ccaaaaaact tgattagggt gatggttcac gtagtgggcc 3420 atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg 3480 actcttgttc caaactggaa caacactcaa ccctatctcg gtctattctt ttgatttata 3540 agggattttg ccgatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa 3600 cgcgaatttt aacaaaatat taacgcttac aatttag 3637 <210> 32 <211> 3637 <212> DNA
<213> Artificial Sequence <220>
<223> Encodes Cycle 3 BFP gene <400> 32 gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 60 caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 120 ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt 180 gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 240 tgggtgaacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 300 ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 360 tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga 420 atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 480 gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 540 caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 600 ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 660 ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 720 ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 780 ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 840 gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 900 ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 960 taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 1020 agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 1080 atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 1140 aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 1200 caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 1260 ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 1320 cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 1380 tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 1440 gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 1500 ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 1560 gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 1620 caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 1680 ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 1740 tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 1800 ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg 1860 agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg 1920 aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat 1980 gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg 2040 tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt 2100 tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg 2160 ccaagcgcgc aattaaccct cactaaaggg aacaaaagct gggtaccgat gagtaaagga 2220 gaagaacttt tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg 2280 cacaaatttt ctgtcagtgg agagggtgaa ggtgatgcta catacggaaa gcttacactt 2340 aaatttattt gcactactgg aaaactacct gttccatggc caacacttgt cactactttc 2400 tctcatggtg ttcaatgctt ttctcgttat ccggatcata tgaaacggca tgactttttc 2460 aagagtgcca tgcccgaagg ttatgtacag gaacgcacta tatctttcaa agatgacggg 2520 aactacaaga cgcgtgctga agtcaagttt gaaggtgata cccttgttaa tcgtatcgag 2580 ttaaaaggta ttgattttaa agaagatgga aacattctcg gacacaaact cgagtacaac 2640 tttaactcac acaatgtata catcacggca gacaaacaaa agaatggaat caaagctaac 2700 ttcaaaattc gccacaacat tgaagatgga tccgttcaac tagcagacca ttatcaacaa 2760 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct gtcgacacaa 2820 tctgcccttt cgaaagatcc caacgaaaag cgtgaccaca tggtccttct tgagtttgta 2880 actgctgctg ggattacaca tggcatggat gaactataca aataagaatt cctgcagccc 2940 gggggatcca ctagttctag agcggccgcc accgcggtgg agctccaatt cgccctatag 3000 tgagtcgtat tacgCgCgCt cactggccgt cgttttacaa cgtcgtgact gggaaaaccc 3060 tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag 3120 cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatggga 3180 cgcgccctat agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 3240 tacacttgcc agcgccctag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 3300 gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag 3360 tgctttacgg cacctcgacc ccaaaaaact tgattagggt gatggttcac gtagtgggcc 3420 atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg 3480 actcttgttc caaactggaa caacactcaa ccctatctcg gtctattctt ttgatttata 3540 agggattttg ccgatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa 3600 cgcgaatttt aacaaaatat taacgcttac aatttag 3637 <210> 33 <211> 717 <212> DNA
<213> Aequorea victoria BFP Cycle 3 ORF
<400> 33 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc tacatacgga 120 aagcttacac ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactt tctctcatgg tgttcaatgc ttttctcgtt atccggatca tatgaaacgg 240 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatctttc 300 aaagatgacg ggaactacaa gacgcgtgct gaagtcaagt ttgaaggtga tacccttgtt 360 aatcgtatcg agttaaaagg tattgatttt aaagaagatg gaaacattct cggacacaaa 420 ctcgagtaca actttaactc acacaatgta tacatcacgg cagacaaaca aaagaatgga 480 atcaaagcta acttcaaaat tcgccacaac attgaagatg gatccgttca actagcagac 540 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600 ctgtcgacac aatctgccct ttcgaaagat cccaacgaaa agcgtgacca catggtcctt 660 cttgagtttg taactgctgc tgggattaca catggcatgg atgaactata caaataa 717 <210> 34 <211> 295 <212> PRT
<213> Selaginella lepidophylla <400> 34 Met Ala Thr Thr Lys Thr Ser Gly Met Ala Leu Ala Leu Leu Leu Val Ala Ala Leu Ala Val Gly Ala Ala Ala Trp Gly Lys Glu Gly His Arg Leu Thr Cys Met Val Ala Glu Pro Phe Leu Ser Ser Glu Ser Lys Gln Ala Val Glu Glu Leu Leu Ser Gly Arg Asp Leu Pro Asp Leu Cys Ser Trp Ala Asp Gln Ile Arg Arg Ser Tyr Lys Phe Arg Trp Thr Gly Pro Leu His Tyr Ile Asp Thr Pro Asp Asn Leu Cys Thr Tyr Asp Tyr Asp Arg Asp Cys His Asp Ser His Gly Lys Lys Asp Val Cys Val Ala Gly Gly Ile Asn Asn Tyr Ser Ser Gln Leu Glu Thr Phe Leu Asp Ser Glu Ser Ser Ser Tyr Asn Leu Thr Glu Ala Leu Leu Phe Leu Ala His Phe Val Gly Asp Ile His Gln Pro Leu His Val Ala Phe Thr Ser Asp Ala Gly Gly Asn Gly Val His Val Arg Trp Phe Gly Arg Lys Ala Asn Leu His His Val Trp Asp Thr Glu Phe Ile Ser Arg Ala Asn Arg Val Tyr Tyr His Asp Ile Ser Lys Met Leu Arg Asn Ile Thr Arg Ser Ile Thr Lys Lys Asn Phe Asn Ser Trp Ser Arg Cys Lys Thr Asp Pro Ala Ala Cys Ile Asp Ser Tyr Ala Thr Glu Ser Ile Asp Ala Ser Cys Asn Trp Ala Tyr Lys Asp Ala Pro Asp Gly Ser Ser Leu Asp Asp Asp Tyr Phe Ser Ser Arg Leu Pro Ile Val Glu Gln Arg Leu Ala Gln Gly Gly Val Arg Leu Ala Ser Ile Leu Asn Arg Ile Phe Gly Gly Ala Lys Ser Asn Arg Ser Ser Arg Ser Ser Met <210> 35 <211> 19 <212> PRT
<213> Apium graveolens fragment of Cel I expressed by TMV
<400> 35 Asp Met Cys Val Ala Gly Ala Ile Gln Asn Phe Thr Ser Gln Leu Gly His Phe Arg

Claims (10)

Claims:
1. An in vitro method of obtaining a peptide sequence having a desired functional property, comprising:
a) preparing at least one heteroduplex polynucleotide sequence wherein said heteroduplex polynucleotide sequence has at least two non-complementary nucleotide base pairs;
b) mixing copies of the heteroduplex polynucleotide sequence with an effective amount of a mismatch endonuclease RES I having the sequence of SEQ ID NO: 34 or a combination of mismatch endonucleases including a mismatch endonuclease RES I having the sequence of SEQ ID NO: 34, a proofreading enzyme, dNTPs, and a ligase enzyme;
c) allowing sufficient time for non-complementary nucleotide base pairs to be converted to complementary base pairs, wherein a population of polynucleotide sequence variants result;
d) expressing polynucleotide sequence variants to generate peptide sequence variants; and e) screening or selecting the polypeptide sequence variants for the desired functional property.
2. A method according to claim 1 wherein the heteroduplex polynucleotide sequence encodes endonuclease activity.
3. A method according to claim 1 or 2 wherein expressing polynucleotide variants comprises transfecting a host organism with a recombinant plasmid or a recombinant viral vector that encodes one of the polynucleotide variants.
4. A method according to claim 1 or 2 wherein expressing polynucleotide variants comprises transforming a host organism with one of the polynucleotide variants.
5. A method of making a mismatch endonuclease RES I having the sequence of SEQ ID NO: 34 comprising:
a) transfecting a host plant, or host animal, or host yeast or host fungus or host bacterium with a recombinant viral vector that encodes a polynucleotide sequence for said RES I;
b) growing the host plant, or host animal, or host yeast or host fungus or host bacterium wherein the polynucleotide sequence for said RES I is expressed; and c) extracting said RES I from the host.
6. A method for determining a mutation in a target sequence of a single stranded polynucleotide with reference to a non-mutated sequence of a polynucleotide that is hybridizable with the polynucleotide including said target sequence, wherein said polynucleotides are amplified, labeled with a detectable marker, hybridized to one another, subjected to the activity of an endonuclease and analyzed for the presence of said mutation, the improvement comprising the use of a mismatch endonuclease RES I having the sequence of SEQ ID NO:
34 or a sequence variant thereof of Selaginella lepidophylla origin, the activity of said mismatch endonuclease enzyme of Selaginella lepidophylla origin comprising:

a. detection of mismatches whether known or unknown between said hybridized polynucleotides;

b. catalytic formation of a substantially single-stranded nick at a target sequence containing a mismatch; and c. recognition of a mutation in a target polynucleotide sequence, said recognition being substantially unaffected by flanking polynucleotide sequences.
7. A method according to claim 6, wherein the activity of said mismatch endonuclease enzyme further comprises d) recognition of polynucleotide loops and insertions between said hybridized polynucleotides.
8. An in vitro method of obtaining a polynucleotide sequence encoding a desired functional property, comprising:
a) preparing at least one heteroduplex polynucleotide sequence wherein said heteroduplex polynucleotide sequence has at least two non-complementary nucleotide base pairs;
b) mixing copies of the heteroduplex polynucleotide sequence with an effective amount of a mismatch endonuclease RES I having the sequence of SEQ ID NO: 34, or a combination of mismatch endonucleases including said RES I, a proofreading enzyme, dNTPs, and a ligase enzyme;
c) allowing sufficient time for non-complementary nucleotide base pairs to be converted to complementary base pairs, wherein a population of polynucleotide sequence variants result; and d) screening or selecting said polynucleotide sequence variants for the desired functional property.
9. A nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:
16.
10. A polypeptide comprising the amino acid sequence of SEQ ID NO: 34.
CA2473187A 2002-02-01 2003-01-31 Mismatch endonucleases and methods of use Expired - Fee Related CA2473187C (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US35372202P 2002-02-01 2002-02-01
US60/353,722 2002-02-01
US10/098,155 2002-03-14
US10/098,155 US20030157495A1 (en) 2002-02-01 2002-03-14 Nucleic acid molecules encoding CEL I endonuclease and methods of use thereof
US10/211,079 2002-08-01
US10/211,079 US7078211B2 (en) 2002-02-01 2002-08-01 Nucleic acid molecules encoding endonucleases and methods of use thereof
PCT/US2003/002958 WO2003066809A2 (en) 2002-02-01 2003-01-31 Mismatch endonucleases and methods of use

Publications (2)

Publication Number Publication Date
CA2473187A1 CA2473187A1 (en) 2003-08-14
CA2473187C true CA2473187C (en) 2012-07-31

Family

ID=27739010

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2473187A Expired - Fee Related CA2473187C (en) 2002-02-01 2003-01-31 Mismatch endonucleases and methods of use

Country Status (8)

Country Link
US (4) US7078211B2 (en)
EP (1) EP1565557B1 (en)
JP (1) JP4395632B2 (en)
AT (1) ATE366807T1 (en)
AU (1) AU2003207776B2 (en)
CA (1) CA2473187C (en)
DE (1) DE60314902T2 (en)
WO (1) WO2003066809A2 (en)

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7838219B2 (en) * 2001-02-02 2010-11-23 Novici Biotech Llc Method of increasing complementarity in a heteroduplex
US20020146732A1 (en) * 2001-02-02 2002-10-10 Padgett Hal S. Method of increasing complementarity in a heteroduplex
US20110111413A1 (en) * 2001-02-02 2011-05-12 Padgett Hal S Method of optimizing codon usage through dna shuffling
US7078211B2 (en) * 2002-02-01 2006-07-18 Large Scale Biology Corporation Nucleic acid molecules encoding endonucleases and methods of use thereof
EP1574570A1 (en) * 2004-03-12 2005-09-14 Universität Regensburg Process for reducing the number of mismatches in double stranded polynucleotides
ES2292270B1 (en) * 2004-04-14 2009-02-16 Oryzon Genomics, S.A. PROCEDURE FOR SELECTLY DETECTING NUCLEIC ACIDS WITH ATIPIC STRUCTURES CONVERTIBLE IN MUESCAS.
US20060029612A1 (en) * 2004-04-15 2006-02-09 Large Scale Biology Corporation Prevention and treatment of recurrent respiratory papillomatosis
US7729761B2 (en) * 2004-07-14 2010-06-01 Cardiac Pacemakers, Inc. Method and apparatus for controlled gene or protein delivery
DE602005025878D1 (en) * 2004-07-30 2011-02-24 Genoplante Valor METHOD FOR THE PRODUCTION OF HIGHLY SENSITIVE ENDONUCLEASES, NOVEL PREPARATIONS OF NUCLEASES AND THEIR USE
EP2441840B1 (en) * 2005-07-18 2017-09-06 Protalix Ltd. Mucosal or enteral administration of biologically active macromolecules
CA2621466A1 (en) * 2005-09-08 2007-04-05 Kentucky Bioprocessing, Llc Modified tobacco mosaic virus particles as scaffolds for display of protein antigens for vaccine applications
WO2007101028A2 (en) * 2006-02-24 2007-09-07 Transgenomic, Inc. Method to produce enzymatically active recombinant endonucleases
US7888475B2 (en) * 2008-09-15 2011-02-15 Padgett Hal S Interferon alpha and interferon kappa fusion protein
WO2011102802A1 (en) * 2010-02-18 2011-08-25 Agency For Science, Technology And Research Method for reducing mismatches in double-stranded dna molecules
US20130109596A1 (en) 2011-09-26 2013-05-02 Life Technologies Corporation High efficiency, small volume nucleic acid synthesis
DK2809795T3 (en) * 2012-02-01 2019-12-16 Sgi Dna Inc MATERIALS AND PROCEDURES FOR SYNTHESIS OF ERROR-MINIMIZED NUCLEIC ACID MOLECULES
US20130274129A1 (en) 2012-04-04 2013-10-17 Geneart Ag Tal-effector assembly platform, customized services, kits and assays
US10563240B2 (en) 2013-03-14 2020-02-18 Life Technologies Corporation High efficiency, small volume nucleic acid synthesis
US20150119260A1 (en) * 2013-10-18 2015-04-30 National Taiwan University Circulating cancer biomarker and its use
EP3169781B1 (en) 2014-07-15 2020-04-08 Life Technologies Corporation Compositions and methods for nucleic acid assembly
LT3557262T (en) 2014-12-09 2022-11-10 Life Technologies Corporation High efficiency, small volume nucleic acid synthesis
WO2017007925A1 (en) 2015-07-07 2017-01-12 Thermo Fisher Scientific Geneart Gmbh Enzymatic synthesis of nucleic acid sequences
US20180291413A1 (en) 2015-10-06 2018-10-11 Thermo Fisher Scientific Geneart Gmbh Devices and methods for producing nucleic acids and proteins
JP2019502399A (en) * 2016-01-22 2019-01-31 ビオーム バイオサイエンシズ プライベート リミティド Method and kit for detecting and treating acne bacteria
US20210147830A1 (en) 2018-06-29 2021-05-20 Thermo Fisher Scientific Geneart Gmbh High throughput assembly of nucleic acid molecules
GB201905303D0 (en) 2019-04-15 2019-05-29 Thermo Fisher Scient Geneart Gmbh Multiplex assembly of nucleic acid molecules
EP4114972A1 (en) 2020-03-06 2023-01-11 Life Technologies Corporation High sequence fidelity nucleic acid synthesis and assembly
EP4095254A3 (en) 2021-05-27 2022-12-14 New England Biolabs, Inc. Fragmentation of dna

Family Cites Families (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US17477A (en) * 1857-06-09 allerton
US48268A (en) * 1865-06-20 Improved process for preparing coffee
US45175A (en) * 1864-11-22 Improved grinding-plate
EP0229046B1 (en) 1985-03-30 1994-05-04 BALLIVET, Marc Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique
US4994368A (en) 1987-07-23 1991-02-19 Syntex (U.S.A.) Inc. Amplification method for polynucleotide assays
US5556750A (en) 1989-05-12 1996-09-17 Duke University Methods and kits for fractionating a population of DNA molecules based on the presence or absence of a base-pair mismatch utilizing mismatch repair systems
US5459039A (en) 1989-05-12 1995-10-17 Duke University Methods for mapping genetic mutations
US5556747A (en) 1990-07-09 1996-09-17 E. R. Squibb & Sons, Inc. Method for site-directed mutagenesis
DE4112440C1 (en) 1991-04-16 1992-10-22 Diagen Institut Fuer Molekularbiologische Diagnostik Gmbh, 4000 Duesseldorf, De
US5795747A (en) 1991-04-16 1998-08-18 Evotec Biosystems Gmbh Process for manufacturing new biopolymers
AU3919293A (en) 1992-03-27 1993-11-08 University Of Maryland At Baltimore Detection of gene mutations with mismatch repair enzymes
US6165793A (en) 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
EP0832210B1 (en) 1995-06-07 2004-10-27 Trevigen, Inc. Nucleic acid repair enzyme methods for point mutation detection and in vitro mutagenesis
US6057103A (en) 1995-07-18 2000-05-02 Diversa Corporation Screening for novel bioactivities
JP2000501615A (en) 1995-12-15 2000-02-15 アマーシャム・ライフ・サイエンス・インコーポレーテッド Method using a mismatch repair system for detection and removal of mutant sequences generated during enzyme amplification
US7115413B2 (en) 1996-04-01 2006-10-03 Mixis France S.A. Meiotic recombination in vivo of partially homologous DNA sequences
AU721493B2 (en) 1996-06-05 2000-07-06 Fox Chase Cancer Center Mismatch endonucleases and uses thereof in identifying mutations in targeted polynucleotide strands
US5869245A (en) 1996-06-05 1999-02-09 Fox Chase Cancer Center Mismatch endonuclease and its use in identifying mutations in targeted polynucleotide strands
FR2772048B1 (en) 1997-12-04 2001-12-21 Biomethodes MULTIPLE DIGESTION CLONING METHOD, VECTORS FOR IMPLEMENTING SAME AND APPLICATIONS THEREOF
DK1036198T3 (en) 1997-12-08 2013-01-02 California Inst Of Techn Method for Preparation of Polynucleotide and Polypeptide Sequences
US6846655B1 (en) 1998-06-29 2005-01-25 Phylos, Inc. Methods for generating highly diverse libraries
FR2789696A1 (en) 1999-02-12 2000-08-18 Biomethodes Directed mutagenesis of nucleic acid useful e.g. for codon optimization, comprises polymerization-ligation reaction of cloned fragment in presence of mutagenic oligonucleotide
FR2793807B1 (en) 1999-05-20 2003-05-16 Biomethodes METHOD OF INSERTING A FRAGMENT OF NUCLEIC ACID INTO A VECTOR, ITS APPLICATIONS AND THE KITS FOR IMPLEMENTING SAME
DE19953854C2 (en) 1999-11-09 2002-01-17 Max Planck Gesellschaft Process for the production of biopolymers with modified properties
US6391557B1 (en) 2000-02-22 2002-05-21 Fox Chase Cancer Center Nucleic acid molecule encoding a mismatch endonuclease and methods of use thereof
JP4986358B2 (en) 2000-02-22 2012-07-25 フォックス・チェイス・キャンサー・センター Nucleic acid molecules encoding mismatch endonucleases and methods of use thereof
EP1283877A2 (en) 2000-05-23 2003-02-19 California Institute Of Technology Gene recombination and hybrid protein development
FR2813314B1 (en) 2000-08-25 2004-05-07 Biomethodes MASSIVE DIRECTED MUTAGENESIS PROCESS
JP2004509628A (en) 2000-09-21 2004-04-02 メルク エンド カムパニー インコーポレーテッド Method for producing recombinant polynucleotide
US6783941B2 (en) 2000-12-06 2004-08-31 Novozymes A/S Method for producing a polynucleotide library in vitro by mismatch repair of heteroduplexes
US20020146732A1 (en) 2001-02-02 2002-10-10 Padgett Hal S. Method of increasing complementarity in a heteroduplex
US7078211B2 (en) * 2002-02-01 2006-07-18 Large Scale Biology Corporation Nucleic acid molecules encoding endonucleases and methods of use thereof
DE10248258A1 (en) 2002-10-16 2004-05-06 Biopsytec Analytik Gmbh Mutant nucleic acid of a Cel I endonuclease and method for the production of the recombinant complete Cel I protein

Also Published As

Publication number Publication date
ATE366807T1 (en) 2007-08-15
US20060194288A1 (en) 2006-08-31
US7056740B2 (en) 2006-06-06
AU2003207776B2 (en) 2008-12-11
AU2003207776A1 (en) 2003-09-02
US7078211B2 (en) 2006-07-18
WO2003066809A2 (en) 2003-08-14
JP2005529586A (en) 2005-10-06
EP1565557B1 (en) 2007-07-11
DE60314902D1 (en) 2007-08-23
CA2473187A1 (en) 2003-08-14
EP1565557A2 (en) 2005-08-24
WO2003066809A3 (en) 2005-06-30
JP4395632B2 (en) 2010-01-13
US20030157682A1 (en) 2003-08-21
US20030148315A1 (en) 2003-08-07
DE60314902T2 (en) 2008-04-10
US7273739B2 (en) 2007-09-25
US20080145913A1 (en) 2008-06-19
EP1565557A4 (en) 2005-11-30

Similar Documents

Publication Publication Date Title
CA2473187C (en) Mismatch endonucleases and methods of use
CA2436214C (en) A method of increasing complementarity in a heteroduplex polynucleotide
CN1997743B (en) Method for improving productivity of plant by chloroplast technology
CN108070611B (en) Method for editing plant base
CN108396027A (en) The sgRNA of CRISPR-Cas9 targeting knock out people colon-cancer cell DEAF1 genes and its specificity
AU2014273089B2 (en) A LAGLIDADG homing endonuclease cleaving the C-C Chemokine Receptor Type-5 (CCR5) gene and uses thereof
KR102606190B1 (en) Bivalent antibodies directed against NKG2D and tumor associated antigens
US20040142433A1 (en) Polynucleotide sequence variants
US6420524B1 (en) Gain of function mutations in ATP-dependent transposition proteins
KR20230136697A (en) Rna-guided gene editing and gene regulation
Martinez et al. Exploring the functional robustness of an enzyme by in vitro evolution.
WO1994014958A1 (en) Synthetic polynucleotides
CN101460611B (en) Plants having improved growth characteristics and method for making the same
CN110004163B (en) Method for improving drought resistance of rice by multi-gene editing
CN112626123A (en) Recombinant plasmid, recombinant gene VII type Newcastle disease virus and culture method thereof
AU2016289877A1 (en) Method for gene optimization
US20040180352A1 (en) Method of increasing complementarity in a heteroduplex
KR101566371B1 (en) Recombinant foot and mouth disease virus expressing protective antigen of Asia1 type standard vaccine strain and producing method thereof
US20040110130A1 (en) Population of polynucleotide sequence variants
AU2017213137A1 (en) Increased triacylglycerol production in microalgae
CN112852884B (en) Rapid construction kit for circular RNA knock-down vector and application thereof
KR102341583B1 (en) Preparation and purification method of recombinant human fibrost growth factor receptor by using solubility-enhancing bifunctional fusion tag combined with split intein and use thereof
CN111848766A (en) Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii
CN109207491A (en) A kind of M1 virus full length infection clones and preparation method and its preparing the application in M1 virus
CN115247187A (en) Method for constructing SARS-CoV-2 susceptible model pig expressing three human genes and application thereof

Legal Events

Date Code Title Description
EEER Examination request
MKLA Lapsed

Effective date: 20210831

MKLA Lapsed

Effective date: 20200131