CA2559161A1 - Irna agents targeting vegf - Google Patents
Irna agents targeting vegf Download PDFInfo
- Publication number
- CA2559161A1 CA2559161A1 CA002559161A CA2559161A CA2559161A1 CA 2559161 A1 CA2559161 A1 CA 2559161A1 CA 002559161 A CA002559161 A CA 002559161A CA 2559161 A CA2559161 A CA 2559161A CA 2559161 A1 CA2559161 A1 CA 2559161A1
- Authority
- CA
- Canada
- Prior art keywords
- seq
- irna agent
- sequence
- irna
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
- A61K47/551—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds one of the codrug's components being a vitamin, e.g. niacinamide, vitamin B3, cobalamin, vitamin B12, folate, vitamin A or retinoic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
- A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
- A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/06—Antiglaucoma agents or miotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/02—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
- A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
- A61K47/12—Carboxylic acids; Salts or anhydrides thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3515—Lipophilic moiety, e.g. cholesterol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/533—Physical structure partially self-complementary or closed having a mismatch or nick in at least one of the strands
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
Abstract
The features of the present invention relate to compounds, compositions and methods useful for modulating the expression of vascular endothelial growth factor (VEGF), such as by the mechanism of RNA interference (RNAi). The compounds and compositions include iRNA agents that can be unmodified or chemically-modified.
Description
iRNAAGENTS TARGETING VEGF
RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No.
601552,620, filed March 12, 2004, U.S. Provisional Application No. 60/559,824, filed April 5, 2004, and U.S.
Provisional Application No. 60/647,191, filed January 25, 2005. All three provisional applications are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
The present invention is in the filed of iRNA agents that can inhibit expression of vascular endothelial growth factor (VEGF). The invention also relates to the use of siRNA targeting VEGF sequences to treat conditions or disorders related to unwanted expression of VEGF, e.g., age-related macular degeneration or diabetic retinopathy.
BACKGROUND
VEGF (also known as vascular permeability factor, VPF) is a multifunctional cytokine that stimulates angiogenesis, epithelial cell proliferation, and endothelial cell survival. VEGF
can be produced by a wide variety of tissues, and its overexpression or aberrant expression can result in a variety disorders, including retinal disorders such as age-related macular degeneration and diabetic retinopathy, cancer, asthma, and other angiogenic disorders.
Macular degeneration is a major cause of blindness in the United States and the frequency of this disorder increases with age. Macular degeneration refers to the group of diseases in which sight-sensing cells in the macular zone of the retina malfunction or loose function and which can result in debilitating loss of vital central or detail vision. Adult macular degeneration (AMD), which is the most common form of macular degeneration, occurs in two main forms. Ninety percent of people with AMD have the form described as "dry"
macular degeneration. An area of the retina is affected, which leads to slow breakdown of cells in the macula, and a gradual loss of central vision. The other form of AMD is "wet"
macular degeneration. Although only 10% of people with AMD have this type, it accounts for 90% of blindness from the disease. As dry AMD progresses, new blood vessels may begin to grow and cause "wet" AMD. These new blood vessels often leak blood and fluid under the macula. This causes rapid damage to the macula that can lead to loss of central vision in a short time. iRNA
agents targeting VEGF can be useful for the treatment of wet and dry macular degeneration.
RNA interference or "RNAi" is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression when it is introduced into worms (Fire et al., Nature 391:806-811, 1998). Short dsRNA
directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function. RNAi has been suggested as a method of developing a new class of therapeutic agents. However, to date, these have remained mostly as suggestions with no demonstrate proof that RNAi can be used therapeutically The present invention advances the art by providing a detailed gene walk across the VEGF gene and a detailed structural analysis of modifications that can be employed to stabilize the molecule against degradation and increase cellular uptake and targeting.
SUMMARY OF THE INVENTION
The invention provides compounds, compositions and methods useful for modulating the expression of VEGF. The invention provides compounds, compositions and methods useful for modulating the expression of VEGF activity by RNA interference (RNAi) using small nucleic acid molecules, such as short interfering RNA (siRNA), double-stranded RNA
(dsRNA), microRNA (miRNA) and short hairpin RNA (shRNA) molecules, which collectively fall under the general term of iRNA agents. The iRNA agents can be unmodified or chemically-modified nucleic acid molecules. The iRNA agents can be chemically synthesized or expressed from a vector or enzymatically synthesized. The invention provides various chemically-modified synthetic iRNA agents capable of modulating VEGF gene expression or activity in cells and in a mammal by RNAi. The use of a chemically-modified iRNA agent can improve one or more properties of an iRNA agent through increased resistance to degradation, increased specificity to target moieties, improved cellular uptake, and the like.
In one aspect, the invention provides an iRNA agent that down-regulates expression of a VEGF gene. The VEGF gene can include a VEGF encoding sequence and/or VEGF
regulatory sequences such as may exist 5' or 3' of a VEGF open reading frame (ORF).
In one embodiment, the invention provides an isolated iRNA agent including a sense and antisense sequence, where the sense and antisense sequences can form an RNA
duplex. The sense sequence can include a nucleotide sequence that is identical or substantially identical to a target sequence of about 19 to 23 nucleotides of a VEGF sequence. In one embodiment, the VEGF sequence that is targeted includes the sequence of any one of SEQ ID
NOs:2-401 (see Table 1).
In one embodiment, the sense sequence of the iRNA agent includes a sequence identical or substantially identical to any of the VEGF target sequences, e.g., substantially identical to any of sense sequences provided in Table 1, SEQ ID NOs:2-401. In another embodiment, the antisense sequence of the iRNA agent can include a sequence complementary to or substantially complementary to, any of the target sequences, e.g., complementary to any of SEQ ID NOs:2-401. By "substantially identical" is meant that the mismatch between the nucleotide sequences is less than 50%, 40%, 30%, 20%, 10%, 5%, or 1%. Preferably, no more than l, 2, 3, 4, or 5 nucleotides differ between the target sequence and sense sequence.
Furthermore, sequences that are "complementary" to each other (e.g., sense and antisense sequences) can be fully complementary, or can have no more than l, 2, 3, 4, or 5 nucleotides that lack full complementarity.
In one embodiment, the sense and antisense pairs of sequences of an iRNA agent includes any one of the agents provided in Table 2, or a sequence which differs in the sense strand from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides, or in the antisense strand by no more than 1, 2,.3, 4, or 5 nucleotides, or in both strands by no more than 1, 2, 3, 4, or 5 nucleotides.
In one preferred embodiment, the sense sequence of an iRNA agent includes a sequence that is selected from the group consisting of SEQ ID N0:456, SEQ ID NO:550, SEQ ID
N0:608, and SEQ ID N0:634, or a sequence that differs from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides.
In another embodiment, the antisense sequence of the iRNA agent includes a sequence fully complementary or substantially complementary to any of the VEGF target sequences, e.g., complementary or substantially complementary to any of SEQ ID NOs:2-401.
In another embodiment, the antisense sequence of an iRNA agent includes a sequence selected from the group consisting any of the antisense sequences provided in Table 2, or a sequence which differs from the recited sequence by no more than l, 2, 3, 4, or 5 nucleotides. In a preferred embodiment, this antisense sequence is fully complementary to a sense sequence or has no more than l, 2, 3, 4, or 5 nucleotide mismatches with the sense sequence.
In a preferred embodiment, the antisense sequence of an iRNA agent includes a sequence selected from the group consisting of SEQ ID N0:457, SEQ ID N0:551, SEQ ID
N0:609, and SEQ ID N0:635, or a sequence that differs from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides.
In another embodiment, the iRNA agent is chemically modified. For example, the iRNA
agent can include a non-nucleotide moiety. A chemical modification or other non-nucleotide moiety can stabilize the sense and antisense sequences against nucleolytic degradation.
Additionally, conjugates can be used to increase uptake and target uptake of the iRNA agent to particular cell types. Preferred modifications include those specifically provided in the Examples, Tables 6-19.
In another embodiment, the iRNA agent includes a 3'-overhang that ranges from 1 to about 6 nucleotides. As used herein, a "3 'overhang" refers to at least one unpaired nucleotide extending from the 3' end of an iRNA sequence. The 3' overhang can include ribonucleotides or deoxyribonucleotides or modified ribonucleotides or modified deoxyribonucleotides. The 3' overhang is preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length and most preferably from about 2 to about 4 nucleotides in length. The 3' overhang can occur on the sense or antisense sequence, or on both sequences of an iRNA agent.
In one preferred embodiment, the iRNA agent of the invention includes an antisense sequence having 23 nucleotides complementary to the target VEGF sequence and a sense sequence having at least 21 nucleotides. Each sequence can include at least 21 nucleotides that are complementary to each other, and at least the antisense sequence can have a 3' overhang of two nucleotides.
In one embodiment, both the sense and antisense sequences of the iRNA agent include a 3' overhang, the length of which can be the same or different for each sequence. In one embodiment, the 3' overhang on each sequence ranges from 1 to about 6 (e.g., from 1 to about 3) nucleotides in length. In a preferred embodiment, the 3' overhang is on both sequences of the iRNA agent and is two nucleotides in length. In another preferred embodiment, the 3' overhang is on both sequences of the iRNA agent and the 3' overhangs include two thymidylic acid residues ("TT").
In one embodiment, an iRNA agent includes an antisense sequence having about 19 to 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides with complementarity to an RNA sequence encoding a VEGF protein. The iRNA agent can further include a sense sequence having about 19 to 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides, and the antisense and sense sequences can have distinct nucleotide sequences with at least about 19, 20, or 21 complementary nucleotides.
In one embodiment, an iRNA agent of the invention includes an antisense region having about 19 to about 25 (e.g., about 19 to about 23) nucleotides with complementarity to an RNA
sequence encoding VEGF, and a sense region having about 19 to 25 (e.g., about 19 to about 23) nucleotides. The sense and antisense regions can be included in a linear molecule with at least about 19 complementary nucleotides. The sense sequence can include a nucleotide sequence that is substantially identical to a nucleotide sequence of VEGF.
In one embodiment, the iRNA agent includes an antisense sequence of about 21 nucleotides complementary to the VEGF target sequence and a sense sequence of about 21 nucleotides complementary to the antisense sequence. The iRNA agent can include a non-nucleotide moiety. In one embodiment, the sense or antisense sequence of the iRNA agent can include a 2'-O-methyl (2'-OMe) pyrimidine nucleotide, 2'-deoxy nucleotide (e.g., deoxy cytodine), 2'-deoxy-2'-fluoro (2'-F) pyrimidine nucleotide, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-N-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethlyoxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-0-dimethylaminopropyl (2'-O-AP), 2'-hydroxy nucleotide, or a 2'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), cyclohexene nucleic acid (CeNA), ribo-difluorotoluyl, 5-allyamino-pyrimidines, or 5-Me-2'-modified pyrimidines. A 2' modification is preferably a 2'-OMe modification, and more preferably, a 2'-fluoro modification. In a preferred embodiment, one or more 2' modified nucleotides are on the sense strand of the iRNA agent.
In one embodiment, an iRNA agent includes a nucleobase modification, such as a cationic modification, such as a 3'-abasic cationic modification. The cationic modification can be, e.g., an alkylamino-dT (e.g., a C6 amino-dT), an allylamino conjugate, a pyrrolidine conjugate, a pthalamido a hydroxyprolinol conjugate or an aminooxy conjugate, on one or more of the terminal nucleotides of the iRNA agent. An alkylamino-dT conjugate is preferably attached to the 3' end of the sense or antisense strand of an iRNA agent. A pyrrolidine linker is preferably attached to the 3' or 5' end of the sense strand, or the 3' end of the antisense strand. An allyl amine uridine is preferably on the 3' or 5' end of the sense strand, and not on the 5' end of the antisense strand. An aminooxy conjugate can be attached to a hydroxyl prolinol and at the 3' or 5' end of either the sense or antisense strands.
In another embodiment, an iRNA agent that targets VEGF includes a conjugate, e.g., to facilitate entry into a cell or to inhibit exo- or endonucleolytic cleavage.
The conjugate can be, for example, a lipophile, a terpene, a protein binding agent, a vitamin, a carbohydrate, a retinoid or a peptide. For example, the conjugate can be naproxen, nitroindole (or another conjugate that contributes to stacking interactions), folate, ibuprofen, retinol or a CS
pyrimidine linker. In other embodiments, the conjugates are glyceride lipid conjugates (e.g. a dialkyl glyceride derivatives), vitamin E conjugates, or thio-cholesterols. Preferably, conjugates are on the 3' end of the antisense strand, or on the 5' or 3' end of the sense strand, and preferably the conjugates are not on the 3' end of the antisense strand and on the 3' end of the sense strand.
In one embodiment, the conjugate is naproxen, and the conjugate is preferably on the 5' or 3' end of the sense or antisense strands. In one embodiment, the conjugate is cholesterol or thiocholesterol, and the conjugate is preferably on the 5' or 3' end of the sense strand and preferably not present on the antisense strand. In some embodiments, the cholesterol is conjugated to the iRNA agent by a pyrrolidine linker, or serinol linker, or hydroxyprolinol linker.
In another embodiment, the conjugate is cholanic acid, and the cholanic acid is attached to the 5' or 3' end of the sense strand, or the 3' end of the antisense strand. In one embodiment, the cholanic acid is attached to the 3' end of the sense strand and the 3' end of the antisense strand.
In another embodiment, the conjugate is retinol acid, and the retinol acid is attached to the 5' or 3' end of the sense strand, or the 3' end of the antisense strand. In one embodiment, the retinol acid is attached to the 3' end of the sense strand and the 3' end of the antisense strand.
RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No.
601552,620, filed March 12, 2004, U.S. Provisional Application No. 60/559,824, filed April 5, 2004, and U.S.
Provisional Application No. 60/647,191, filed January 25, 2005. All three provisional applications are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
The present invention is in the filed of iRNA agents that can inhibit expression of vascular endothelial growth factor (VEGF). The invention also relates to the use of siRNA targeting VEGF sequences to treat conditions or disorders related to unwanted expression of VEGF, e.g., age-related macular degeneration or diabetic retinopathy.
BACKGROUND
VEGF (also known as vascular permeability factor, VPF) is a multifunctional cytokine that stimulates angiogenesis, epithelial cell proliferation, and endothelial cell survival. VEGF
can be produced by a wide variety of tissues, and its overexpression or aberrant expression can result in a variety disorders, including retinal disorders such as age-related macular degeneration and diabetic retinopathy, cancer, asthma, and other angiogenic disorders.
Macular degeneration is a major cause of blindness in the United States and the frequency of this disorder increases with age. Macular degeneration refers to the group of diseases in which sight-sensing cells in the macular zone of the retina malfunction or loose function and which can result in debilitating loss of vital central or detail vision. Adult macular degeneration (AMD), which is the most common form of macular degeneration, occurs in two main forms. Ninety percent of people with AMD have the form described as "dry"
macular degeneration. An area of the retina is affected, which leads to slow breakdown of cells in the macula, and a gradual loss of central vision. The other form of AMD is "wet"
macular degeneration. Although only 10% of people with AMD have this type, it accounts for 90% of blindness from the disease. As dry AMD progresses, new blood vessels may begin to grow and cause "wet" AMD. These new blood vessels often leak blood and fluid under the macula. This causes rapid damage to the macula that can lead to loss of central vision in a short time. iRNA
agents targeting VEGF can be useful for the treatment of wet and dry macular degeneration.
RNA interference or "RNAi" is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression when it is introduced into worms (Fire et al., Nature 391:806-811, 1998). Short dsRNA
directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function. RNAi has been suggested as a method of developing a new class of therapeutic agents. However, to date, these have remained mostly as suggestions with no demonstrate proof that RNAi can be used therapeutically The present invention advances the art by providing a detailed gene walk across the VEGF gene and a detailed structural analysis of modifications that can be employed to stabilize the molecule against degradation and increase cellular uptake and targeting.
SUMMARY OF THE INVENTION
The invention provides compounds, compositions and methods useful for modulating the expression of VEGF. The invention provides compounds, compositions and methods useful for modulating the expression of VEGF activity by RNA interference (RNAi) using small nucleic acid molecules, such as short interfering RNA (siRNA), double-stranded RNA
(dsRNA), microRNA (miRNA) and short hairpin RNA (shRNA) molecules, which collectively fall under the general term of iRNA agents. The iRNA agents can be unmodified or chemically-modified nucleic acid molecules. The iRNA agents can be chemically synthesized or expressed from a vector or enzymatically synthesized. The invention provides various chemically-modified synthetic iRNA agents capable of modulating VEGF gene expression or activity in cells and in a mammal by RNAi. The use of a chemically-modified iRNA agent can improve one or more properties of an iRNA agent through increased resistance to degradation, increased specificity to target moieties, improved cellular uptake, and the like.
In one aspect, the invention provides an iRNA agent that down-regulates expression of a VEGF gene. The VEGF gene can include a VEGF encoding sequence and/or VEGF
regulatory sequences such as may exist 5' or 3' of a VEGF open reading frame (ORF).
In one embodiment, the invention provides an isolated iRNA agent including a sense and antisense sequence, where the sense and antisense sequences can form an RNA
duplex. The sense sequence can include a nucleotide sequence that is identical or substantially identical to a target sequence of about 19 to 23 nucleotides of a VEGF sequence. In one embodiment, the VEGF sequence that is targeted includes the sequence of any one of SEQ ID
NOs:2-401 (see Table 1).
In one embodiment, the sense sequence of the iRNA agent includes a sequence identical or substantially identical to any of the VEGF target sequences, e.g., substantially identical to any of sense sequences provided in Table 1, SEQ ID NOs:2-401. In another embodiment, the antisense sequence of the iRNA agent can include a sequence complementary to or substantially complementary to, any of the target sequences, e.g., complementary to any of SEQ ID NOs:2-401. By "substantially identical" is meant that the mismatch between the nucleotide sequences is less than 50%, 40%, 30%, 20%, 10%, 5%, or 1%. Preferably, no more than l, 2, 3, 4, or 5 nucleotides differ between the target sequence and sense sequence.
Furthermore, sequences that are "complementary" to each other (e.g., sense and antisense sequences) can be fully complementary, or can have no more than l, 2, 3, 4, or 5 nucleotides that lack full complementarity.
In one embodiment, the sense and antisense pairs of sequences of an iRNA agent includes any one of the agents provided in Table 2, or a sequence which differs in the sense strand from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides, or in the antisense strand by no more than 1, 2,.3, 4, or 5 nucleotides, or in both strands by no more than 1, 2, 3, 4, or 5 nucleotides.
In one preferred embodiment, the sense sequence of an iRNA agent includes a sequence that is selected from the group consisting of SEQ ID N0:456, SEQ ID NO:550, SEQ ID
N0:608, and SEQ ID N0:634, or a sequence that differs from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides.
In another embodiment, the antisense sequence of the iRNA agent includes a sequence fully complementary or substantially complementary to any of the VEGF target sequences, e.g., complementary or substantially complementary to any of SEQ ID NOs:2-401.
In another embodiment, the antisense sequence of an iRNA agent includes a sequence selected from the group consisting any of the antisense sequences provided in Table 2, or a sequence which differs from the recited sequence by no more than l, 2, 3, 4, or 5 nucleotides. In a preferred embodiment, this antisense sequence is fully complementary to a sense sequence or has no more than l, 2, 3, 4, or 5 nucleotide mismatches with the sense sequence.
In a preferred embodiment, the antisense sequence of an iRNA agent includes a sequence selected from the group consisting of SEQ ID N0:457, SEQ ID N0:551, SEQ ID
N0:609, and SEQ ID N0:635, or a sequence that differs from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides.
In another embodiment, the iRNA agent is chemically modified. For example, the iRNA
agent can include a non-nucleotide moiety. A chemical modification or other non-nucleotide moiety can stabilize the sense and antisense sequences against nucleolytic degradation.
Additionally, conjugates can be used to increase uptake and target uptake of the iRNA agent to particular cell types. Preferred modifications include those specifically provided in the Examples, Tables 6-19.
In another embodiment, the iRNA agent includes a 3'-overhang that ranges from 1 to about 6 nucleotides. As used herein, a "3 'overhang" refers to at least one unpaired nucleotide extending from the 3' end of an iRNA sequence. The 3' overhang can include ribonucleotides or deoxyribonucleotides or modified ribonucleotides or modified deoxyribonucleotides. The 3' overhang is preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length and most preferably from about 2 to about 4 nucleotides in length. The 3' overhang can occur on the sense or antisense sequence, or on both sequences of an iRNA agent.
In one preferred embodiment, the iRNA agent of the invention includes an antisense sequence having 23 nucleotides complementary to the target VEGF sequence and a sense sequence having at least 21 nucleotides. Each sequence can include at least 21 nucleotides that are complementary to each other, and at least the antisense sequence can have a 3' overhang of two nucleotides.
In one embodiment, both the sense and antisense sequences of the iRNA agent include a 3' overhang, the length of which can be the same or different for each sequence. In one embodiment, the 3' overhang on each sequence ranges from 1 to about 6 (e.g., from 1 to about 3) nucleotides in length. In a preferred embodiment, the 3' overhang is on both sequences of the iRNA agent and is two nucleotides in length. In another preferred embodiment, the 3' overhang is on both sequences of the iRNA agent and the 3' overhangs include two thymidylic acid residues ("TT").
In one embodiment, an iRNA agent includes an antisense sequence having about 19 to 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides with complementarity to an RNA sequence encoding a VEGF protein. The iRNA agent can further include a sense sequence having about 19 to 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides, and the antisense and sense sequences can have distinct nucleotide sequences with at least about 19, 20, or 21 complementary nucleotides.
In one embodiment, an iRNA agent of the invention includes an antisense region having about 19 to about 25 (e.g., about 19 to about 23) nucleotides with complementarity to an RNA
sequence encoding VEGF, and a sense region having about 19 to 25 (e.g., about 19 to about 23) nucleotides. The sense and antisense regions can be included in a linear molecule with at least about 19 complementary nucleotides. The sense sequence can include a nucleotide sequence that is substantially identical to a nucleotide sequence of VEGF.
In one embodiment, the iRNA agent includes an antisense sequence of about 21 nucleotides complementary to the VEGF target sequence and a sense sequence of about 21 nucleotides complementary to the antisense sequence. The iRNA agent can include a non-nucleotide moiety. In one embodiment, the sense or antisense sequence of the iRNA agent can include a 2'-O-methyl (2'-OMe) pyrimidine nucleotide, 2'-deoxy nucleotide (e.g., deoxy cytodine), 2'-deoxy-2'-fluoro (2'-F) pyrimidine nucleotide, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-N-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethlyoxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-0-dimethylaminopropyl (2'-O-AP), 2'-hydroxy nucleotide, or a 2'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), cyclohexene nucleic acid (CeNA), ribo-difluorotoluyl, 5-allyamino-pyrimidines, or 5-Me-2'-modified pyrimidines. A 2' modification is preferably a 2'-OMe modification, and more preferably, a 2'-fluoro modification. In a preferred embodiment, one or more 2' modified nucleotides are on the sense strand of the iRNA agent.
In one embodiment, an iRNA agent includes a nucleobase modification, such as a cationic modification, such as a 3'-abasic cationic modification. The cationic modification can be, e.g., an alkylamino-dT (e.g., a C6 amino-dT), an allylamino conjugate, a pyrrolidine conjugate, a pthalamido a hydroxyprolinol conjugate or an aminooxy conjugate, on one or more of the terminal nucleotides of the iRNA agent. An alkylamino-dT conjugate is preferably attached to the 3' end of the sense or antisense strand of an iRNA agent. A pyrrolidine linker is preferably attached to the 3' or 5' end of the sense strand, or the 3' end of the antisense strand. An allyl amine uridine is preferably on the 3' or 5' end of the sense strand, and not on the 5' end of the antisense strand. An aminooxy conjugate can be attached to a hydroxyl prolinol and at the 3' or 5' end of either the sense or antisense strands.
In another embodiment, an iRNA agent that targets VEGF includes a conjugate, e.g., to facilitate entry into a cell or to inhibit exo- or endonucleolytic cleavage.
The conjugate can be, for example, a lipophile, a terpene, a protein binding agent, a vitamin, a carbohydrate, a retinoid or a peptide. For example, the conjugate can be naproxen, nitroindole (or another conjugate that contributes to stacking interactions), folate, ibuprofen, retinol or a CS
pyrimidine linker. In other embodiments, the conjugates are glyceride lipid conjugates (e.g. a dialkyl glyceride derivatives), vitamin E conjugates, or thio-cholesterols. Preferably, conjugates are on the 3' end of the antisense strand, or on the 5' or 3' end of the sense strand, and preferably the conjugates are not on the 3' end of the antisense strand and on the 3' end of the sense strand.
In one embodiment, the conjugate is naproxen, and the conjugate is preferably on the 5' or 3' end of the sense or antisense strands. In one embodiment, the conjugate is cholesterol or thiocholesterol, and the conjugate is preferably on the 5' or 3' end of the sense strand and preferably not present on the antisense strand. In some embodiments, the cholesterol is conjugated to the iRNA agent by a pyrrolidine linker, or serinol linker, or hydroxyprolinol linker.
In another embodiment, the conjugate is cholanic acid, and the cholanic acid is attached to the 5' or 3' end of the sense strand, or the 3' end of the antisense strand. In one embodiment, the cholanic acid is attached to the 3' end of the sense strand and the 3' end of the antisense strand.
In another embodiment, the conjugate is retinol acid, and the retinol acid is attached to the 5' or 3' end of the sense strand, or the 3' end of the antisense strand. In one embodiment, the retinol acid is attached to the 3' end of the sense strand and the 3' end of the antisense strand.
In one aspect, an iRNA agent of the invention has RNAi activity that modulates expression of RNA encoded by a VEGF gene. VEGF genes can share some degree of sequence identity with each other, and thus, iRNA agents can target a class of VEGF
genes, or alternatively, specific VEGF genes, by targeting sequences that are either shared amongst different VEGF targets or that are unique for a specific VEGF target.
Therefore, in one embodiment, an iRNA agent can target a conserved region of a VEGF nucleotide sequence (e.g., RNA sequence). The conserved region can have sequence identity with several different VEGF-related sequences (e.g., different VEGF isoforms, splice variants, mutant genes, etc.). Thus, one iRNA agent can target several different VEGF-related sequences.
In one embodiment, an iRNA agent is chemically modified. In another embodiment the iRNA agent includes a duplex molecule wherein one or more sequences of the duplex molecule is chemically modified. Non-limiting examples of such chemical modifications include phosphorothioate internucleotide linkages, 2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base"
nucleotides, "acyclic"
nucleotides, 5'-C-methyl nucleotides, and terminal glyceryl andlor inverted deoxy abasic residue incorporation. These chemical modifications, when used in iRNA agents, can help to preserve RNAi activity of the agents in cells and can increase the serum stability of the iRNA agents.
In one embodiment, an iRNA agent includes one or more chemical modifications and the sense and antisense sequences of the double-stranded RNA is about 21 nucleotides long.
In a preferred embodiment, the first and preferably the first two internucleotide linkages at the 5' end of the antisense and/or sense sequences are modified, preferably by a phosphorothioate. In a preferred embodiment, the first, and preferably the first two, three, or four internucleotide linkages at the 3' end of a sense and/or antisense sequence are modified, preferably by a phosphorothioate. More preferably, the 5' end of both the sense and antisense sequences, and the 3' end of both the sense and antisense sequences are modified as described.
In another aspect, an iRNA agent that mediates the down-regulation of VEGF
expression includes one or more chemical modifications that modulate the binding affinity between the sense and the antisense sequences of the iRNA construct.
In one embodiment, the invention features an iRNA agent that includes one or more chemical modifications that can modulate the cellular uptake of the iRNA
agent.
genes, or alternatively, specific VEGF genes, by targeting sequences that are either shared amongst different VEGF targets or that are unique for a specific VEGF target.
Therefore, in one embodiment, an iRNA agent can target a conserved region of a VEGF nucleotide sequence (e.g., RNA sequence). The conserved region can have sequence identity with several different VEGF-related sequences (e.g., different VEGF isoforms, splice variants, mutant genes, etc.). Thus, one iRNA agent can target several different VEGF-related sequences.
In one embodiment, an iRNA agent is chemically modified. In another embodiment the iRNA agent includes a duplex molecule wherein one or more sequences of the duplex molecule is chemically modified. Non-limiting examples of such chemical modifications include phosphorothioate internucleotide linkages, 2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base"
nucleotides, "acyclic"
nucleotides, 5'-C-methyl nucleotides, and terminal glyceryl andlor inverted deoxy abasic residue incorporation. These chemical modifications, when used in iRNA agents, can help to preserve RNAi activity of the agents in cells and can increase the serum stability of the iRNA agents.
In one embodiment, an iRNA agent includes one or more chemical modifications and the sense and antisense sequences of the double-stranded RNA is about 21 nucleotides long.
In a preferred embodiment, the first and preferably the first two internucleotide linkages at the 5' end of the antisense and/or sense sequences are modified, preferably by a phosphorothioate. In a preferred embodiment, the first, and preferably the first two, three, or four internucleotide linkages at the 3' end of a sense and/or antisense sequence are modified, preferably by a phosphorothioate. More preferably, the 5' end of both the sense and antisense sequences, and the 3' end of both the sense and antisense sequences are modified as described.
In another aspect, an iRNA agent that mediates the down-regulation of VEGF
expression includes one or more chemical modifications that modulate the binding affinity between the sense and the antisense sequences of the iRNA construct.
In one embodiment, the invention features an iRNA agent that includes one or more chemical modifications that can modulate the cellular uptake of the iRNA
agent.
In another embodiment, the invention features an iRNA agent that includes one or more chemical modifications that improve the pharmacokinetics of the iRNA agent.
Such chemical modifications include but are not limited to conjugates, such as ligands for cellular receptors, e.g., peptides derived from naturally occurring protein ligands; protein localization sequences;
antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate, retinoids and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG, e.g. PEG 5 and PEG20);
phospholipids; polyamines, such as spermine or spermidine; and others.
In one embodiment, the iRNA agent includes a duplex molecule selected from the group consisting of AL-DP-4003, AL-DP-4116, AL-DP-4015, AL-DP-4120, AL-DP-4002, AL-DP-4115, AL-DP-4014, AL-DP-4119, AL-DP-4094, AL-DP-4118, AL-DP-4107, AL-DP-4122, AL-DP-4004, AL-DP-4117, AL-DP-4016, AL-DP-4121, AL-DP-4127, AL-DP-4128, AL-DP-4129 , and AL-DP-4055 (see Tables 2 and 3).
In one preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4094, which includes the antisense sequence 5'AAGCUCAUCUCUCCUAUGUGCUG 3' (SEQ
ID N0:609) and the sense sequence 5' GCACAUAGGAGAGAUGAGCUU 3' (SEQ ID
N0:608).
In another preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4004, which includes the antisense sequence 5'CUUUCUUUGGUCUGCAUUCACAU 3' (SEQ
ID N0:635) and the sense sequence 5' GUGAAUGCAGACCAAAGAAAG 3' (SEQ ID
N0:634).
In another preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4015, which includes the antisense sequence 5' GUACUCCUGGAAGAUGUCCTT 3' (SEQ
ID
N0:551) and the sense sequence 5' GGACAUCUUCCAGGAGUACTT 3' (SEQ ID NO:550).
In another preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4055, which includes the antisense sequence 5' UGCAGCCUGGGACCACUUGTT 3' (SEQ
ID
N0:457) and the sense sequence 5' CAAGUGGUCCCAGGCUGCATT 3' (SEQ ID N0:456).
In one embodiment, the antisense sequence of an iRNA agent described herein does not hybridize to an off target sequence. For example, the antisense sequence can have less than 5, 4, 3, 2, or 1 nucleotides complementary to an off target sequence. By "off target" is meant a sequence other than a VEGF nucleotide sequence.
In another embodiment, the sense strand is modified to inhibit off target silencing. The sense strand can include a cholesterol moeity, such as cholesterol attached to the sense strand by a pyrrolidine linker.
In another embodiment, the antisense sequence of an iRNA agent described herein can hybridize to a VEGF sequence in a human and a VEGF sequence in a non-human mammal, e.g., a mouse, rat, or monkey.
In another aspect, the invention provides a method of delivering an iRNA
agent, e.g., an iRNA agent described herein, to the eye of a subject, e.g., a mammalian subject, such as a mouse, a rat, a monkey or a human.
In another aspect, the invention provides a method of delivering an iRNA agent to the eye of a subject, e.g., a mammalian subject, such as a mouse, a rat, a monkey or a human.
In one embodiment, the iRNA agent can be delivered to a cell or cells in a choroid region of the eye. In one preferred embodiment, the iRNA agent down-regulates expression of the VEGF gene at a target site within the eye. An iRNA agent delivered to the eye, e.g., choroid cells of the eye, can be an unmodified iRNA agent.
In one embodiment, the iRNA agent can be stabilized with phosphorothioate linkages. In another embodiment, the 3' end of the sense or antisense sequences, or both, of the iRNA agent can be modified with a cationic group, such as a 3'-abasic cationic modification. The cationic modification can be, e.g., an alkylamino-dT (e.g., a G6 amino-dT), an allylamine, a pyrrolidine, a pthalamido, a hydroxyprolinol, a polyarnine, a cationic peptide, or a cationic amino acid on one or more of the terminal nucleotides of the iRNA agent. The modification can be an external or terminal cationic residue. In preferred embodiments, a pyrrolidine cap is attached to the 3' or S' end of the sense strand, or the 3' end of the antisense strand.
In one embodiment, the sense or antisense sequence, or both, of the iRNA agent can be modified with a sugar, e.g., a glycoconjugate or alkylglycoside component, e.g., glucose, mannose, 2-deoxy-glucose, or an analog thereof. In another embodiment, the iRNA agent can be conjugated to an enzyme substrate, e.g., a substrate for which the relative enzyme is present in a higher amount, as compared to the enzyme level in other tissues of the body, e.g., in tissues other than the eye.
In one embodiment, at least about 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the iRNA agent administered to the subject reaches the eye. In a preferred embodiment, between about 30-90%, 40-80% or 50-70% of the iRNA agent administered to the subject reaches the eye.
In another aspect, the invention features a composition, e.g., a pharmaceutical composition that includes an iRNA agent of the present invention in a pharmaceutically acceptable carrier or diluent. The iRNA agent can be any agent described herein. In one embodiment, the iRNA agent is chemically modified, such as with any chemical modification described herein. Preferred modified iRNA agents includes those provided in Tables 2-19.
In another aspect, the invention features a method for treating or preventing a disease or condition in a subject. The method can include administering to the subject a composition of the invention under conditions suitable for the treatment or prevention of the disease or condition in the subject, alone or in conjunction with one or more other therapeutic compounds.
In one embodiment, the iRNA agent is administered at or near the site of unwanted VEGF
expression, e.g., by a catheter or other placement device (e.g., a retinal pellet or an implant including a porous, non-porous, or gelatinous material). In one embodiment the iRNA agent is administered via an intraocular implant, which can be inserted, for example, into an anterior or posterior chamber of the eye; or into the sclera, transchoroidal space, or an avascularized region exterior to the vitreous. In another embodiment, the implant is positioned over an avascular region, such as on the sclera, so as to allow for transcleral diffusion of the drug to the desired site of treatment, e.g., to the intraocular space and macula of the eye.
Furthermore, the site of transcleral diffusion is preferably in proximity to the macula.
In another embodiment, an iRNA agent is administered to the eye by injection, e.g., by intraocular, retinal, or subretinal injection.
In another embodiment, an iRNA agent is administered topically to the eye, such as by a patch or liquid eye drops, or by iontophoresis. Ointments or droppable liquids can be delivered by ocular delivery systems known in the art such as applicators or eye droppers.
In one embodiment, an iRNA is delivered at or near a site of neovascularization.
In one embodiment, an iRNA agent is administered repeatedly. Administration of an iRNA agent can be carried out over a range of time periods. It can be administered hourly, daily, once every few days, weekly, or monthly. The timing of administration can vary from patient to patient, depending upon such factors as the severity of a patient's symptoms.
For example, an effective dose of an iRNA agent can be administered to a patient once a month for an indefinite period of time, or until the patient no longer requires therapy. In addition, sustained release compositions containing an iRNA agent can be used to maintain a relatively constant dosage in the area of the target VEGF nucleotide sequences.
In another embodiment, an iRNA agent is delivered to the eye at a dosage on the order of about 0.00001 mg to about 3 mg per eye, or preferrably about 0.0001-0.001 mg per eye, about 0.03- 3.0 mg per eye, about 0.1-3.0 mg per eye or about 0.3-3.0 mg per eye.
In another embodiment, an iRNA agent is administered prophylactically such as to prevent or slovc~ the onset of a disorder or condition that affects the eye.
For example, an iRNA
can be administered to a patient who is susceptible to or otherwise at risk for a neovascular disorder.
In one embodiment one eye of a human is treated with an iRNA agent described herein, and in another embodiment, both eyes of a human are treated.
In another aspect, a method of inhibiting VEGF expression is provided. One such method includes administering an effective amount of an iRNA agent of the present invention.
In another aspect, a method of treating adult onset macular degeneration is provided. The method includes administering a therapeutically effective amount of an iRNA
agent of the present invention.
In one embodiment, a human has been diagnosed with dry adult macular degeneration (AMD), and in another embodiment the human has been diagnosed with wet AMD.
In one embodiment, a human treated with an iRNA agent described herein is over the age of 50, e.g., between the ages of 75 and 80, and the human has been diagnosed with adult onset macular degeneration. In another embodiment, a human treated with an iRNA
agent described herein is between the ages of 30-50, and the human has been diagnosed with late onset macular degeneration. In another embodiment, a human treated with an iRNA agent described herein is between the ages of 5-20, and the human has been diagnosed with middle onset macular degeneration. In another embodiment, a human treated with an iRNA agent described herein is 7 years old or younger, and the human has been diagnosed with early onset macular degeneration.
In one aspect, methods of treating any disease or disorder characterized by unwanted VEGF expression are provided. Particularly preferred embodiments include the treatment of disorders of the eye or retina, which are characterized by unwanted VEGF
expression. The disease or disorder can be a diabetic retinopathy, neovascular glaucoma, a tumor or metastic cancer (e.g., colon or breast cancer), a pulmonary disease (e.g., asthma or bronchitis), rheumatoid arthritis, or psoriases. Other angiogenic disorders can be treated by the methods featured in the invention.
In another aspect, the invention features a kit containing an iRNA agent of the invention.
The iRNA agent of the kit can be chemically modified and can be useful for modulating the expression of a VEGF target gene in a cell, tissue or organism. In one embodiment, the kit contains more than one iRNA agent of the invention.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, useful methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the accompanying drawings and description, and from the claims. The contents of all references, pending patent applications and published patents, cited throughout this application are hereby expressly incorporated by reference. In case of conflict, the present specification, including definitions, will control.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 is the nucleotide sequence of the mRNA of the 121 amino acid form of vascular endothelial growth factor, VEGF121. The first nucleotide of the initiator codon is nucleotide 1. The signal peptide is from nucleotide 1 through 78.
FIGURE 2 is a graphical representation of a comparative analysis of the activities of single- and double-overhang siRNAs in ira vitro assays in HeLa cells. Solid lines with filled symbols represent the single-overhang siRNA, solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. The control siRNA
hVEGF is described in Reich et al. (Mol. vis. 9:210, 2003); the control siRNA
hrmVEGF is described in Filleur et al. (Cancer Res. 63:3919, 2003). "L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 3 is a graphical representation of a comparative analysis of the activities of single- and double-overhang siRNAs in ARPE-19 cells. Solid lines with filled symbols represent the single-overhang siRNA; solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. The control siRNA hVEGF is described in Reich et al. (Mol. ~s. 9:210, 2003); the control siRNA hrmVEGF is described in Filleur et al.
(supra). "L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 4 is a graphical representation of a comparative analysis of the siRNAs activities in HeLa cells of single-overhang siRNAs with their analogous blunt siRNAs in which the number of base-paired nucleotides is 21. The control siRNA hVEGF is described in Reich et al.
(Mol. mss. 9:210, 2003); the control siRNA hrmVEGF is described in Filleur et al. (supra).
"L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 5 is a graphical representation of a comparative analysis of the siRNAs activities in HeLa cells of double-overhang siRNAs with their analogous blunt siRNAs in which the number of base-paired nucleotides is 19. The control siRNA hVEGF is described in Reich et al.
(supra); the control siRNA hrmVEGF is described in Filleur et al. (supra).
"L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF
expression.
FIGURE 6A is a graphical representation of the activities of single-overhang and double overhang siRNAs targeting ORF 319 (SEQ ID N0:320) (AL-DP-4002 and AL-DP-4014, respectively) and ORF 343 (SEQ ID N0:344) (AL-DP-4094 and AL-DP-4107, respectively) in cells under normal oxygen (normoxia, 20% oxygen).
FIGURE 6B is a graphical representation of the activities of single-overhang and double overhang siRNAs targeting ORF 319 (SEQ ID N0:320) (AL-DP-4002 and AL-DP-4014, respectively) and ORF 343 (SEQ ID N0:344) (AL-DP-4094 and AL-DP-4107, respectively) in cells under hypoxic conditions (1% oxygen).
FIGURE 6C is a graphical representation of the activities of single-overhang and double overhang siRNAs targeting ORF 319 (SEQ ID N0:320) (AL-DP-4002 and AL-DP-4014, respectively) and ORF 343 (SEQ ID N0:344) (AL-DP-4094 and AL-DP-4107, respectively) in cells under hypoxic conditions (130 ~,M defoxamine).
FIGURE 7 is a graphical representation of the comparative activities of double-overhang (AL-DP-4014) unmodified siRNA and phosphorothioate-modified (AL-DP-4127, AL-DP-4128, AL-DP-4129) siRNAs targeting ORF 319 (SEQ ID N0:320) in HeLa cells. The control siRNA
hVEGF is described in Reich et al. (supra); the control siRNA hrmVEGF is described in Filleur et al. (supra). "L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 8A is a graphical representation of the activities of siRNAs targeting (SEQ ID N0:320) (AL-DP-4014 and AL-DP-4127) and a mutated version AL-DP-4140 (Table 5) in cells under normal oxygen conditions (normoxia, 20% oxygen). The control siRNA CandS
is identical to the hVEGF control of FIGURE. 7 and is described in Reich et al. (supf~a).
"L2000" refers to Lipofectamine 2000 reagent. VEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 8B is a graphical representation of the activities of siRNAs targeting (SEQ ID N0:320) (AL-DP-4014 and AL-DP-4127) and a mutated version AL-DP-4140 (Table 5) in cells under normal or hypoxic conditions (hypoxia, 1% Oxygen). The control siRNAs are as described for FIGURE. 8A.
FIGURES 9A-9E are graphical representations of the activities of siRNAs having the sequence ofAL-DP-4094 but differing in the inclusion of nucleotide modifications (see Table 4).
The control siRNA "Acuity" is identical to the CandS control of FIGURE. 8A and the hVEGF
control of FIGURE. 7. The "Filleur" control siRNA is the equivalent of the hrmVEGF control siRNA of FIGURE. 7.
FIGURE 10 is a graphical representation of siRNA silencing activity in vitro in HeLa cells.
FIGURE 11 is an RP-HPLC scan of AL-DP-4094 siRNA following incubation in human serum.
FIGURE 12 is a summary of AL-DP-4094 fragment mapping as determined by LC/MS.
The analysis was performed following incubation of the siRNA in human serum.
FIGURES 13-29 are graphs of silencing activity of 2'-O-methyl and/or 2'-flouro modified siRNAs ifZ vitro in HeLa cells (Table 6).
FIGURE 30 are graphs of silencing activity of alternating 2'-O-methyl and 2'-flouro modified siRNAs iya vitro in HeLa cells (Table 7).
FIGURES 31-33 are graphs of silencing activity of cholesterol and colonic conjugated siRNAs ih viti°o in HeLa cells (Table 8).
FIGURE 34 is a graph of silencing activity of naproxen conjugated siRNAs in vitro in HeLa cells (Table 9).
FIGURE 35 is a graph of silencing activity of biotin conjugated siRNAs ifz vitro in HeLa cells (Table 10).
FIGURE 36 is a graph of silencing activity of 5'-retinal conjugated 51RNAS ifa VatYO In HeLa cells (Table 11).
FIGURE 37 is a graph of silencing activity of ribo-diflourotoluyl modified siRNAs ire vitro in HeLa cells (Table 13).
FIGURE 38 is a graph of silencing activity of 2'-arafluoro-2'deoxy-nucleoside modified siRNAs in vitro in HeLa cells (Table 14).
FIGURE 39 5'-O-DMTr-2'-deoxy-2'-fluoro A, C, G and U CPG supports for oligonucleotide synthesis. These supports were used for syntheses of selected sequences listed Tables 6 and 7.
FIGURE 40 Cholesterol and 5~3-cholanic (or cholanic) acid conjugate building blocks for conjugation to oligonucleotides. These building blocks were used for syntheses of selected sequences listed in Table 8.
FIGURE 41 SMeC and SMeU RNA building blocks for oligonucleotide synthesis.
These building blocks were used for syntheses of selected sequences listed in Table 8.
FIGURE 42. Naproxen - tf°afas-4- hydroxy-L-prolinol and naproxen-serinol building blocks for conjugation to oligonucleotides. These building blocks were used for syntheses of selected sequences listed in Table 9.
FIGURE 43 Biotin - trayas-4- hydroxy-L-prolinol and biotin-serinol building blocks for conjugation to oligonucleotides. These building blocks were used for syntheses of selected sequences listed in Table 10.
FIGURE 44 Building blocks for post-synthetic conjugation - Oxime approach.
These building blocks were/are used for syntheses of selected sequences listed in Table 11.
FIGURE 45 Building blocks for post-synthetic conjugation -Active ester approach.
These building blocks were used for syntheses of selected sequences listed in Table 12.
FIGURE 46 DFT amidite and CPG for oligonucleotide synthesis. These building blocks were used for syntheses of selected sequences listed in Table 13.
FIGURE 47 2'-Deoxy-2'-araf amidite for oligonucleotide synthesis. These building blocks were used for syntheses of selected sequences listed in Table 14.
FIGURE 48 P-methylphosphonamidite of ribo SMeU and ribo C(NA°). These building blocks were used for syntheses of selected sequences listed in Table 15.
FIGURE 49 CS-aminoallyl U amidite. These building blocks were used for syntheses of selected sequences listed in Table 16.
FIGURE 50 Thiocholesterol conjugate building blocks.
BRIEF DESCRIPTION OF THE TABLES
Table 1 provides the sequences in the VEGF gene that are targeted by the agents of the present invention. These sequence can also be the sense strand of some of the iRNA agents of the present invention.
Table 2 provides 123 iRNA duplexes that target the VEGF gene, the target sequence in the VEGF gene and activity data that is described in the Examples.
Table 3 provides iRNA duplexes that are modified to contain phosphorothioate stabilizations and activity data that is described in the Examples.
Table 4 provides iRNA duplexes based on the AL-DP-4094 duplex that are modified for stabilization and activity data that is described in the Examples.
Table 5 provides iRNA duplexes activity data in HeLa cells for several iRNA
agents of the present invention.
Table 6 provides iRNA agents with activity data in HeLa cells for agents containing one or more phosporothioate, 2'-O-methyl and 2'-fluoro modifications.
Table 7 provides iRNA agents with activity data in HeLa cells for agents containing alternating 2'-O-methyl and 2'-fluoro modifications.
Table 8 A and B provides iRNA agents with activity data in HeLa cells for agents containing cholesterol or cholanic acid conjugates.
Table 9 provides iRNA agents with activity data in HeLa cells for agents containing naproxen conjugates.
Table 10 provides iRNA agents with activity data in HeLa cells for agents containing biotin conjugates.
Table 11 provides iRNA agents containing aldehydes, retinal and other retinoid conjugates.
Table 12 provides iRNA agents containing polyethylene glycol conjugates.
Table 13 provides iRNA agents with activity data in HeLa cells for agents containing ribo-difluorotoluyl modifications.
Table 14 provides iRNA agents with activity data in HeLa cells for agents containing 2'-arafluoro-2'-deoxy-nucleoside modifications.
Table 15 provides iRNA agents containing methylphosphonate modifications.
Table 16 provides iRNA agents containing C-5 allyamino modifications.
Table 17 provides iRNA agents containing a variety and combinations of the modifications as noted in the Table.
Table 18 provides physical characterization of iRNA agents containing a variety and combinations of the modifications as noted in the Table.
DETAILED DESCRIPTION
Double-stranded (dsRNA) directs the sequence-specific silencing of mRNA
through a process known as RNA interference (RNAi). The process occurs in a wide variety of organisms, including mammals and other vertebrates.
It has been demonstrated that 21-23 nt fragments of dsRNA are sequence-specific mediators of RNA silencing, e.g., by causing RNA degradation. While not wishing to be bound by theory, it may be that a molecular signal, which may be merely the specific length of the fragments, present in these 21-23 nt fragments recruits cellular factors that mediate RNAi.
Described herein are methods for preparing and administering these 21-23 nt fragments, and other iRNAs agents, and their use for specifically inactivating gene function.
The use of iRNA
agents (or recombinantly produced or chemically synthesized oligonucleotides of the same or similar nature) enables the targeting of specific mRNAs for silencing in mammalian cells. In addition, longer dsRNA agent fragments can also be used, e.g., as described below.
Although, in mammalian cells, long dsRNAs can induce the interferon response, which is frequently deleterious, siRNAs do not trigger the interferon response, at least not to an extent that is deleterious to the cell and host. In particular, the length of the sense and antisense sequences in an iRNA agent can be less than 31, 30, 28, 25, or 23 nt, e.g., sufficiently short to avoid inducing a deleterious interferon response. Thus, the administration of a composition of iRNA agents (e.g., formulated as described herein) to a mammalian cell can be used to silence expression of a target gene while circumventing the interferon response.
Further, use of a discrete species of iRNA agent can be used to selectively target one allele of a target gene, e.g., in a subject heterozygous for the allele.
The target-complementary sequence (the antisense sequence) of an iRNA agent, such as an iRNA duplex, can have a 5' phosphate and ATP may be utilized to maintain the 5'- phosphate moiety on the siRNA (Nykanen et al., Cell 107:309, 2001); however, iRNA agents lacking a 5'-phosphate have been shown to be active when introduced exogenously, suggesting that 5'-phosphorylation of siRNA constructs may occur irZ vivo.
Vascular endothelial growth factor (VEGF) VEGF, also known as vascular permeability factor, is an angiogenic growth factor. VEGF is a homodimeric 45 kDa glycoprotein that exists in at least three different isoforms. VEGF isoforms are expressed in endothelial cells_ The VEGF gene contains 8 exons that express a 1 ~9-amino acid protein isoform. A
165-amino acid isoform lacks the residues encoded by exon 6, whereas a 121-amino acid isoform lacks the residues encoded by exons 6 and 7. VEGF145 is an isoform predicted to contain 145 amino acids and to lack exon 7.
VEGF can act on endothelial cells by binding to an endothelial tyrosine kinase receptor, such as Flt-1 (VEGFR-1) or KDR/flk-1 (VEGFR-2). VEGFR-2 is expressed in endothelial cells and is involved in endothelial cell differentiation and vasculogenesis. A
third receptor, VEGFR-3 has been implicated in lymphogenesis.
The various isoforms have different biologic activities and clinical implications. For example, VEGF145 induces angiogenesis and like VEGF189 (but unlike VEGF165) binds efficiently to the extracellular matrix by a mechanism that is not dependent on extracellular matrix-associated heparin sulfates. The mRNA corresponding to the coding sequence of human VEGF121 (Genbank Accession Number AF214570, SEQ ID NO:1) is shown in FIG 1.
VEGF
displays activity as an endothelial cell mitogen and chemoattractant ifa vitf°o and induces vascular permeability and angiogenesis in vivo. VEGF is secreted by a wide variety of cancer cell types and promotes the growth of tumors by inducing the development of tumor-associated vasculature. Inhibition of VEGF function has been shown to limit both the growth of primary experimental tumors as well as the incidence of metastases in immunocompromised mice.
VEGF is also expressed at abnormally high levels in inflammatory diseases such as rheumatoid arthritis and psoriasis, and is involved in the inflammation, airway and vascular remodeling that occurs during asthmatic episodes. Elevated VEGF expression is also correlated with several forms of ocular neovascularization that often lead to severe vision loss, including diabetic retinopathy, retinopathy of prematurity, and macular degeneration.
iRNA Agents An "RNA agent," as used herein, is an unmodified RNA, modified RNA, or nucleoside surrogate. Preferred examples include those which have greater resistance to nuclease degradation than do unmodified RNAs. Preferred examples include those which have a 2' sugar modification, a modification in a single strand overhang, preferably a 3' single strand overhang, or, particularly if single stranded, a 5' modification which includes one or more phosphate groups or one or more analogs of a phosphate group.
An "iRNA agent," as used herein, is an RNA agent which can, or which can be cleaved into an RNA agent which can, down regulate the expression of a target gene, preferably an endogenous or pathogen target RNA. While not wishing to be bound by theory, an iRNA agent may act by one or more of a number of mechanisms, including post-transcriptional cleavage of a target mRNA sometimes referred to in the art as RNAi, or pre-transcriptional or pre-translational mechanisms. An iRNA agent can include a single strand or can include more than one strands, e.g., it can be a double stranded iRNA agent. If the iRNA agent is a single strand it is particularly preferred that it include a 5' modification which includes one or more phosphate groups or one or more analogs of a phosphate group.
The iRNA agent should include a region of sufficient homology to the target gene, and be of sufficient length in terms of nucleotides, such that the iRNA agent, or a fragment thereof, can mediate down regulation of the target gene. (For ease of exposition the term nucleotide or ribonucleotide is sometimes used herein in reference to one or more monomeric subunits of an RNA agent. It will be understood herein that the usage of the term "ribonucleotide" or "nucleotide," herein can, in the case of a modified RNA or nucleotide surrogate, also refer to a modified nucleotide, or surrogate replacement moiety at one or more positions.) Thus, the iRNA
agent is or includes a region which is at least partially, and in some embodiments fully, complementary to the target RNA. It is not necessary that there be perfect complementarity between the iRNA agent and the target, but the correspondence must be sufficient to enable the iRNA agent, or a cleavage product thereof, to direct sequence specific silencing, e.g., by RNAi cleavage of the target RNA, e.g., mRNA.
Complementarity, or degree of homology with the target strand, is most critical in the antisense strand. While perfect complementarity, particularly in the antisense strand, is often desired some embodiments can include, particularly in the antisense strand, one or more but preferably 6, 5, 4, 3, 2, or fewer mismatches (with respect to the target RNA). The mismatches, particularly in the antisense strand, are most tolerated in the terminal regions and if present are preferably in a terminal region or regions, e.g., within 6, 5, 4, or 3 nucleotides of the 5' and/or 3' terminus. The sense strand need only be sufficiently complementary with the antisense strand to maintain the overall double strand character of the molecule.
Single stranded regions of an iRNA agent will often be modified or include nucleoside surrogates, e.g., the unpaired region or regions of a hairpin structure, e.g., a region which links two complementary regions, can have modifications or nucleoside surrogates.
Modification to stabilize one or more 3'- or 5'-terminus of an iRNA agent, e.g., against exonucleases, or to favor the antisense sRNA agent to enter into RISC are also favored. Modifications can include C3 (or C6, C7, C12) amino linkers, thiol linkers, carboxyl linkers, non-nucleotidic spacers (C3, C6, C9, C12, abasic, triethylene glycol, hexaethylene glycol), special biotin or fluorescein reagents that come as phosphoramidites and that have another DMT protected hydroxyl group, allowing multiple couplings during RNA synthesis.
iRNA agents include: molecules that are long enough to trigger the interferon response (which can be cleaved by Dicer (Bernstein et al., Nature 409:363-366, 2001)) and enter a RISC
(RNAi-induced silencing complex); and molecules that are sufficiently short that they do not trigger the interferon response (which molecules can also be cleaved by Dicer and/or enter a RISC), e.g., molecules which are of a size which allows entry into a RISC, e.g., molecules which resemble Dicer-cleavage products. Molecules that are short enough that they do not trigger an interferon response are termed sRNA agents or shorter iRNA agents herein.
"sRNA agent or shorter iRNA agent" as used herein, refers to an iRNA agent, e.g., a double stranded RNA agent or single strand agent, that is sufficiently short that it does not induce a deleterious interferon response in a human cell, e.g., it has a duplexed region of less than 60 but preferably less than 50, 40, or 30 nucleotide pairs. The sRNA agent, or a cleavage product thereof, can down regulate a target gene, e.g., by inducing RNAi with respect to a target RNA, preferably an endogenous or pathogen target RNA.
Each strand of a sRNA agent can be equal to or less than 30, 25, 24, 23, 22, 21, or 20 nucleotides in length. The strand is preferably at least 19 nucleotides in length. For example, each strand can be between 21 and 25 nucleotides in length. Preferred sRNA
agents have a duplex region of 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs, and one or more overhangs, preferably one or two 3' overhangs, of 2- 3 nucleotides.
A "single strand iRNA agent" as used herein, is an iRNA agent which is made up of a single molecule. It may include a duplexed region, formed by intra-strand pairing, e.g., it may be, or include, a hairpin or pan-handle structure. Single strand iRNA agents are preferably antisense with regard to the target molecule. In preferred embodiments single strand iRNA
agents are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus. 5'-phosphate modifications include those which are compatible with RISC mediated gene silencing.
Suitable modifications include: 5'-monophosphate ((HO)2(O)P-O-5'); 5'-diphosphate ((HO)2(O)P-O-P(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5');
5'-guanosine cap (7-methylated or non-methylated) (7m-G-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P-O-5'); 5'-monodithiophosphate (phosphorodithioate;
(HO)(HS)(S)P-O-5'), 5'-phosphorothiolate ((HO)2(O)P-S-5'); any additional combination of oxygenlsulfur replaced rnonophosphate, diphosphate and triphosphates (e.g. 5'-alpha thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)P-O-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g.
RP(OH)(O)-O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates (R=alkylether-methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(O)-O-5'-). (These modifications can also be used with the antisense strand of a double stranded iRNA.) A single strand iRNA agent should be sufficiently long that it can enter the RISC and participate in RISC mediated cleavage of a target mRNA. A single strand iRNA
agent is at least 14, and more preferably at least 15, 20, 25, 29, 35, 40, or 50 nucleotides in length. It is preferably less than 200, 100, or 60 nucleotides in length.
Hairpin iRNA agents will have a duplex region equal to or at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide pairs. The duplex region will preferably be equal to or less than 200, 100, or 50, in length. Preferred ranges for the duplex region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length. The hairpin will preferably have a single strand overhang or terminal unpaired region, preferably the 3', and preferably of the antisense side of the hairpin.
Preferred overhangs are 2-3 nucleotides in length.
A "double stranded (ds) iRNA agent" as used herein, is an iRNA agent which includes more than one, and preferably two, strands in which interchain hybridization can form a region of duplex structure.
Other suitable modifications to a sugar, base, or backbone of an iRNA agent are described in co-owned PCT Application No. PCT/LTS2004/Ol 193, filed January 16, 2004. An iRNA agent can include a non-naturally occurnng base, such as the bases described in co-owned PCT Application No. PCT/US2004/Ol 1822, filed April 16, 2004. An iRNA agent can include a non-naturally occurring sugar, such as a non-carbohydrate cyclic carrier molecule. Exemplary features of non-naturally occurring sugars for use in iRNA agents are described in co-owned PCT Application No. PCT/US2004/11829 filed April 16, 2003.
An iRNA agent can include an internucleotide linkage (e.g., the chiral phosphorothioate linkage) useful for increasing nuclease resistance. In addition, or in the alternative, an iRNA
1 S agent can include a ribose mimic for increased nuclease resistance.
Exemplary internucleotide linkages and ribose mimics for increased nuclease resistance are described in co-owned PGT
Application No. PCT/US2004/07070 filed on March 8, 2004.
An iRNA agent can have a ZXY structure, such as is described in co-owned PCT
Application No. PCT/LTS2004/07070 filed on March 8, 2004.
An iRNA agent can be complexed with an amphipathic moiety. Exemplary amphipathic moieties for use with iRNA agents are described in co-owned PCT Application No. PCT/US2004/07070 filed on March 8, 2004.
In another embodiment, the iRNA agent can be complexed to a delivery agent that features a modular complex. The complex can include a carrier agent linked to one or more of (preferably two or more, more preferably all three of): (a) a condensing agent (e.g., an agent capable of attracting, e.g., binding, a nucleic acid, e.g., through ionic or electrostatic interactions); (b) a fusogenic agent (e.g., an agent capable of fusing and/or being transported through a cell membrane); and (c) a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type. iRNA
agents complexed to a delivery agent are described in co-owned PCT Application No.
PCT/US2004/07070 filed on March 8, 2004.
An iRNA agent can have non-canonical pairings, such as between the sense and antisense sequences of the iRNA duplex. Exemplary features of non-canonical iRNA agents are described in co-owned PCT Application No. PGT/LTS2004/07070 filed on March 8, 2004.
Many of these types of modifications are provided in the Examples and are described in Tables 3-18.
Design of iRNA
The present invention is based on a gene walk of the VEGF gene to identify active iRNA
agents that can be used to reduce the level of VEGF mRNA in a cell. Not all potential iRNA
agent sequences in the VEGF gene are active, many of which also having significant off target effects. The present invention advances the art by selecting those sequences which are active and do not have significant off target effects. Further, the sequence chosen for the iRNA agents of the present invention are conserved amongst multiple species allowing one to use a single agent for animal and toxicological studies as well as using it for therapeutic purposes in humans.
Based on these results, the invention specifically provides an iRNA agent that can be used in treating VEGF mediated disorders, particularly in the eye such as AMD, in isolated form and as a pharmaceutical composition described below. Such agents will include a sense strand having at least 15 or more contiguous nucleotides that are complementary to the VEGF gene and an antisense strand having at least 15 or more contiguous nucleotides that are complementary to the sense strand sequence. Particularly useful are iRNA agents that have a sense strand that comprises, consist essentially of or consists of a nucleotide sequence provided in Table 1, such as those agents proved in Table 2, or any of the modifications provided in Tables 3-18.
Candidate iRNA agents can be designed by performing, as done herein, a gene walk analysis of the VEGF gene that will serve as the iRNA target. Overlapping, adjacent, or closely spaced candidate agents corresponding to all or some of the transcribed region can be generated and tested. Each of the iRNA agents can be tested and evaluated for the ability to down regulate the target gene expression (see below, "Evaluation of Candidate iRNA agents").
Preferably, the iRNA agents of the present invention are based on and comprise at least 15 or more contiguous nucleotides from one of the iRNA agents shown to be active in Table 2, or the modified sequences provided in Tables 3-18. In such agents, the agent can comprise, consist of or consist essentially of the entire sequence provided in the Table or can comprise 15 or more contiguous residues along with additional nucleotides from contiguous regions of the target gene.
An iRNA agent can be rationally designed based on sequence information and desired characteristics and the information of the target sequence provided in Table 1. For example, an iRNA agent can be designed according to the relative melting temperature of the candidate duplex. Generally, the duplex should have a lower melting temperature at the 5' end of the antisense strand than at the 3' end of the antisense strand.
Accordingly, the present invention provides iRNA agents comprising a sense strand and antisense strand each comprising a sequence of at least 15, 16, 17, 18, 19, 20, 21 or 23 nucleotides which is essentially identical to one of the agents provided in Table 1 or 2.
The antisense strand of an iRNA agent should be equal to or at least, 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in length. It should be equal to or less than 50, 40, or 30, nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides in length. Exemplified iRNA agents include those that comprise 15 or more nucleotides from one of the agents in Table 2 (or are complementary to the target sequence provided in Table 1) but are not longer than 25 nucleotides in length.
The sense strand of an iRNA agent should be equal to or at least 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in length. It should be equal to or less than 50, 40, or 30 nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides in length.
Exemplified iRNA agents include those that comprise 15 or more nucleotides from one of the agents in Table 2 (or the target sequence in Table 2) but are not longer than 25 nucleotides in length.
The double stranded portion of an iRNA agent should be equal to or at least, 15, 16 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 50 nucleotide pairs in length. It should be equal to or less than 50, 40, or 30 nucleotides pairs in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides pairs in length.
The agents provided in Table 2 are 23 nucleotides in length for each strand.
The iRNA
agents contain a 21 nucleotide double stranded region with a 2 nucleotide overhang on each of the 3' ends of the agent. These agents can be modified as described herein to obtain equivalent agents comprising at least a portion of these sequences (15 or more contiguous nucleotides) and or modifications to the oligonucleotide bases and linkages. Particularly preferred are the modification and agents provided in Tables 3-18.
Generally, the iRNA agents of the instant invention include a region of sufficient complementarity to the VEGF gene and are of sufficient length in terms of nucleotides that the iRNA agent, or a fragment thereof, can mediate down regulation of the VEGF
gene. The antisense strands of the iRNA agents of the present invention are preferably fully complementary to the mRNA sequences of VEGF gene. However, it is not necessary that there be perfect complementarity between the iRNA agent and the target, but the correspondence must be sufficient to enable the iRNA agent, or a cleavage product thereof, to direct sequence specific silencing, e.g., by RNAi cleavage of a VEGF mRNA.
Therefore, the iRNA agents of the instant invention include agents comprising a sense strand and antisense strand each comprising a sequence of at least 16, 17 or 18 nucleotides which is essentially identical, as defined below, to one of the sequences of the VEGF gene, such as those agent provided in Table 2, except that not more than 1, 2 or 3 nucleotides per strand, respectively, have been substituted by other nucleotides (e.g. adenosine replaced by uracil), while essentially retaining the ability to inhibit VEGF expression. These agents will therefore possess at least 15 or more nucleotides identical to the VEGF gene but 1, 2 or 3 base mismatches with respect to either the VEGF mRNA sequence or between the sense and antisense strand are introduced. Mismatches to the target VEGF mRNA sequence, particularly in the antisense strand, are most tolerated in the terminal regions and if present are preferably in a terminal region or regions, e.g., within 6, 5, 4, or 3 nucleotides of a 5' and/or 3' terminus, most preferably within 6, 5, 4, or 3 nucleotides of the 5'-terminus of the sense strand or the 3'-terminus of the antisense strand. The sense strand need only be sufFciently complementary with the antisense strand to maintain the overall double stranded character of the molecule.
It is preferred that the sense and antisense strands be chosen such that the iRNA agent includes a single strand or unpaired region at one or both ends of the molecule, such as those exemplified in Table 2 (as well as Tables 3-18). Thus, an iRNA agent contains sense and antisense strands, preferably paired to contain an overhang, e.g., one or two 5' or 3' overhangs but preferably a 3' overhang of 2-3 nucleotides. Most embodiments will have a 3' overhang.
Preferred siRNA agents will have single-stranded overhangs, preferably 3' overhangs, of 1 to 4, or preferably 2 or 3 nucleotides, in length, on one or both ends of the iRNA
agent. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. 5'-ends are preferably phosphorylated.
Preferred lengths for the duplexed region is between 15 and 30, most preferably 18, 19, 20, 21, 22, and 23 nucleotides in length, e.g., in the siRNA agent range discussed above.
Embodiments in which the two strands of the siRNA agent are linked, e.g., covalently linked are also included. Hairpin, or other single strand structures which provide the required double stranded region, and preferably a 3' overhang are also within the invention.
Synthesis of iRNA Ageyats Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) can be synthesized using protocols known in the art, for example as described in Caruthers et al., Methods ifa Erzzymology 211:3, 1992;
Thompson et al., International PCT Publication No. WO 99/54459; Wincott et al., Nucleic Acids Res. 23:2677, 1995; Wincott et al., Methods Mol. Bio. 74:59, 1997; Brennan et al., Biotechfaol.
Bioe~ag. 61:33, 1998; and Brennan, U. S. Pat. No. 6,001,311. All of these references are incorporated herein by reference. The synthesis of oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
The method of synthesis used for RNA including certain iRNA agents of the invention follows the procedure as described in Usman et al., J. Claern. Soc. 109:7845, 1987; Scaringe et al., Nucleic Acids Res. 18:5433, 1990; Wincott et al., Nucleic Aciels Res.
23:2677, 1995; and Wincott et al., Methods Mol. Bio. 74:59, 1997; and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
Detailed descriptions of a variety of synthetic methods to produce modified iRNA agents are provided in the Examples.
Alternatively, the nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., Science 256:9923, 1992; Draper et al., International PCT publication No. WO 93/23569;
Shabarova et al., Nucleic Acids Res. 19:4247, 1991; Bellon et al., Nucleosides &
Nucleotides 16:951, 1997;
Bellon et al., Biocohjugate 8:204, 1997), or by hybridization following synthesis and/or deprotection.
An iRNA agent can also be assembled from two distinct nucleic acid sequences or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the iRNA agent.
iRNA agents can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, 2'- C-allyl, 2'-fluoro, diflurortoluyl, 5-allyamino-pyrimidines, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren, Trends in Bioclaem. Sci. 17:34, 1992). iRNA constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al., supra, the totality of which is hereby incorporated herein by reference) and re-suspended in water.
In another aspect of the invention, iRNA agents can be expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. iRNA agent-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the iRNA agents can be delivered as described herein, and persist in target cells.
Alternatively, viral vectors can be used that provide for transient expression of iRNA agents.
Evaluating iRNA agents Any of the iRNA agents described herein can be evaluated and modified as follows.
An iRNA agent may be susceptible to cleavage by an endonuclease or exonuclease, such as when the iRNA agent is introduced into the body of a subject. Methods can be used to determine sites of cleavage, e.g., endo- and exonucleolytic cleavage on an iRNA agent and to determine the mechanism of cleavage. An iRNA agent can be modified to inhibit such cleavage.
2~
A dsRNA, e.g., an iRNA agent, can be evaluated to identify sites that are susceptible to modification, particularly cleavage, e.g., cleavage by a component found in the body of a subject.
The component can be specific for a particular area of the body, such as a particular tissue, organ, or bodily fluid (e.g., blood, plasma, or serum). Sites in an iRNA agent that are susceptible to cleavage, either by endonucleolytic or exonucleolytic cleavage, in certain areas of the body, may be resistant to cleavage in other areas of the body.
A method for evaluating an iRNA agent can include: (1) determining the point or points at which a substance present in the body of a subject, and preferably a component present in a compartment of the body into which a therapeutic dsRNA is to be introduced (this includes compartments into which the therapeutic is directly introduced, e.g., the circulation, as well as in compartments to which the therapeutic is eventually targeted, e.g, the liver or kidney; in some cases, e.g, the eye, the two are the same), cleaves a dsRNA, e.g., an iRNA
agent; and (2) identifying one or more points of cleavage, e.g., endonucleolytic, exonucleolytic, or both, in the dsRNA. Optionally, the method further includes providing an RNA (e.g., an iRNA
agent) modified to inhibit cleavage at such sites.
The steps described above can be accomplished by using one or more of the following assays:
(i) (a) contacting a candidate dsRNA, e.g., an iRNA agent, with a test agent (e.g., a biological agent), (b) using a size-based assay, e.g., gel electrophoresis to determine if the iRNA
agent is cleaved. In a preferred embodiment a time course is taken and a number of samples incubated for different times are applied to the size-based assay. In preferred embodiments, the candidate dsRNA is not labeled. The method can be a "stains all" method.
(ii) (a) supplying a candidate dsRNA, e.g., an iRNA agent, which is radiolabeled;
(b) contacting the candidate dsRNA with a test agent, (c) using a size-based assay, e.g., gel electrophoresis to determine if the iRNA
agent is cleaved. In a preferred embodiment, a time course is taken where a number of samples are incubated for different times and applied to the size-based assay. In preferred embodiments the determination is made under conditions that allow determination of the number of nucleotides present in a fragment. For example, an incubated sample is run on a gel having markers that allow assignment of the length of cleavage products. The gel can include a standard that is a "ladder" digestion. Either the sense or antisense strand can be labeled. Preferably only one strand is labeled in a particular experiment. The label can be incorporated at the 5' end, 3' end, or at an internal position. Length of a fragment (and thus the point of cleavage) can be determined from the size of the fragment based on the ladder and mapping using a site-specific endonuclease such as RNAse T1.
(iii) Fragments produced by any method, e.g., one described herein, e.g., one of those above, can be analyzed by mass spectrometry. Following contacting the iRNA
with the test agent, the iRNA can be purified (e.g., partially purified), such as by phenol-chloroform extraction followed by precipitation. Liquid chromatography can then be used to separate the fragments and mass spectrometry can be used to determine the mass of each fragment. This allows determination of the mechanism of cleavage, e.g., if by direct phosphate cleavage, such as by 5' or 3' exonuclease cleavage, or mediated by the 2'OH via formation of a cyclic phosphate.
In another embodiment, the information relating to a site of cleavage is used to select a backbone atom, a sugar or a base, for modification, e.g., a modification to decrease cleavage.
Exemplary modifications include modifications that inhibit endonucleolytic degradation, including the modifications described herein. Particularly favored modifications include:
2' modification, e.g., a 2'-O-methylated nucleotide or 2'-deoxy nucleotide (e.g., 2'deoxy-cytodine), or a 2°-fluoro, difluorotoluyl, 5-Me-2'-pyrimidines, 5-allyamino-pyrimidines, 2'-O-methoxyethyl, 2'-hydroxy, or 2'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), or cyclohexene nucleic acid (CeNA). In one embodiment, the 2' modification is on the uridine of at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide, at least one 5'-uridine-guanine-3' (5'-UG-3') dinucleotide, at least one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, or at least one 5'-uridine-cytidine-3' (5'-UC-3') dinucleotide, or on the cytidine of at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide, at least one 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, or at least one 5'-cytidine-uridine-3' (5'-CU-3') dinucleotide. The 2' modification can also be applied to all the pyrimidines in an iRNA agent. In one preferred embodiment, the 2' modification is a 2'OMe modification on the sense strand of an iRNA agent. In a more preferred embodiment the 2' modification is a 2' fluoro modification, and the 2' fluoro is on the sense or antisense strand or on both strands.
Modification of the backbone, e.g., with the replacement of an O with an S, in the phosphate backbone, e.g., the provision of a phosphorothioate modification can be used to inhibit endonuclease activity. In some embodiments, an iRNA agent has been modified by replacing one or more ribonucleotides with deoxyribonucleotides. Preferably, adjacent deoxyribonucleotides are joined by phosphorothioate linkages, and the iRNA
agent does not include more than four consecutive deoxyribonucleotides on the sense or the antisense strands.
Replacement of the U with a CS amino linker; replacement of an A with a G
(sequence changes are preferred to be located on the sense strand and not the antisense strand);
or modification of the sugar at the 2', 6', 7', or 8' position can also inhibit endonuclease cleavage of the iRNA
agent. Preferred embodiments are those in which one or more of these modifications are present on the sense but not the antisense strand, or embodiments where the antisense strand has fewer of such modifications.
Exemplary modifications also include those that inhibit degradation by exonucleases.
Examples of modifications that inhibit exonucleolytic degradation can be found herein. In one embodiment, an iRNA agent includes a phosphorothioate linkage or P-alkyl modification in the linkages between one or more of the terminal nucleotides of an iRNA agent. In another embodiment, one or more terminal nucleotides of an iRNA agent include a sugar modification, e.g., a 2' or 3' sugar modification. Exemplary sugar modifications include, for example, a 2'-O-methylated nucleotide, 2'-deoxy nucleotide (e.g., deoxy-cytodine), 2'-deoxy-2'-fluoro (2'-F) nucleotide, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-N-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethlyoxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-AP), 2'-hydroxy nucleotide, or a ~'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), or cyclohexene nucleic acid (CeNA). A 2' modification is preferably 2'OMe, more preferably, 2'fluoro.
The modifications described to inhibit exonucleolytic cleavage can be combined onto a single iRNA agent. For example, in one embodiment, at least one terminal nucleotide of an iRNA agent has a phosphorothioate linkage and a 2' sugar modification, e.g., a 2'F or 2'OMe modification. In another embodiment, at least one terminal nucleotide of an iRNA agent has a 5' Me-pyrimidine and a 2' sugar modification, e.g., a 2'F or 2'OMe modification.
To inhibit exonuclease cleavage, an iRNA agent can include a nucleobase modification, such as a cationic modification, such as a 3'-abasic cationic modification.
The cationic modification can be, e.g., an alkylamino-dT (e.g., a C6 amino-dT), an allylamino conjugate, a pyrrolidine conjugate, a pthalamido or a hydroxyprolinol conjugate, on one or more of the terminal nucleotides of the iRNA agent. An alkylamino-dT conjugate is preferably attached to the 3' end of the sense or antisense strand of an iRNA agent. A pyrrolidine linker is preferably attached to the 3' or 5' end of the sense strand, or the 3' end of the antisense strand. An allyl amine uridine is preferably on the 3' or 5' end of the sense strand, and not on the 5' end of the antisense strand.
In another embodiment, the iRNA agent includes a conjugate on one or more of the terminal nucleotides of the iRNA agent. The conjugate can be, for example, a lipophile, a terpene, a protein binding agent, a vitamin, a carbohydrate, a retiniod, or a peptide. For example, the conjugate can be naproxen, nitroindole (or another conjugate that contributes to stacking interactions), folate, ibuprofen, cholesterol, retinoids, PEG, or a CS
pyrimidine linker. In other embodiments, the conjugates are glyceride lipid conjugates (e.g. a dialkyl glyceride derivatives), vitamin E conjugates, or thio-cholesterols. Preferably, conjugates are on the 3' end of the antisense strand, or on the 5' or 3' end of the sense strand, and preferably the conjugates are not on the 3' end of the antisense strand and on the 3' end of the sense strand.
In one embodiment, the conjugate is naproxen, and the conjugate is preferably on the 5' or 3' end of the sense or antisense strands. In one embodiment, the conjugate is cholesterol, and the conjugate is preferably on the 5' or 3' end of the sense strand and preferably not present on the antisense strand. In some embodiments, the cholesterol is conjugated to the iRNA agent by a pyrrolidine linker, or serinol linker, aminooxy, or hydroxyprolinol linker. In other embodiments, the conjugate is a dU-cholesterol, or cholesterol is conjugated to the iRNA
agent by a disulfide linkage. In another embodiment, the conjugate is cholanic acid, and the cholanic acid is attached to the 5' or 3' end of the sense strand, or the 3' end of the antisense strand. In one embodiment, the cholanic acid is attached to the 3' end of the sense strand and the 3' end of the antisense strand_ In another embodiment, the conjugate is PEGS, PEG20, naproxen or retinal.
In another embodiment, one or more terminal nucleotides have a 2'-5' linkage.
Preferably, a 2'-5' linkage occurs on the sense strand, e.g., the 5' end of the sense strand.
In one embodiment, the iRNA agent includes an L-sugar, preferably at the 5' or 3' end of the sense strand.
In one embodiment, the iRNA agent includes a methylphosphonate at one or more terminal nucleotides to enhance exonuclease resistance, e.g., at the 3' end of the sense or antisense strands of the iRNA agent.
In one embodiment, an iRNA agent has been modified by replacing one or more ribonucleotides with deoxyribonucleotides. Preferably, adjacent deoxyribonucleotides are joined by phosphorothioate linkages, and the iRNA agent does not include more than four consecutive deoxyribonucleotides on the sense or the antisense strands.
In some embodiments, an iRNA agent having increased stability in cells and biological samples includes a difluorotoluyl (DFT) modification, e.g., 2,4-difluorotoluyl uracil, or a guanidine to inosine substitution.
The methods described can be used to select and/or optimize a therapeutic dsRNA, e.g., iRNA agent. dsRNAs, e.g., iRNA agents, made by a method described herein are within the invention.
The methods can be used to evaluate a candidate dsRNA, e.g., a candidate iRNA
agent, which is unmodified or which includes a modification, e.g., a modification that inhibits degradation, targets the dsRNA molecule, or modulates hybridization. Such modifications are described herein. A cleavage assay can be combined with an assay to determine the ability of a modified or non-modified candidate to silence the target. For example, one might (optionally) test a candidate to evaluate its ability to silence a target (or off target sequence), evaluate its susceptibility to cleavage, modify it (e.g., as described herein, e.g., to inhibit degradation) to produce a modified candidate, and test the modified candidate for one or both of the ability to silence and the ability to resist degradation. The procedure can be repeated.
Modifications can be introduced one at a time or in groups. It will often be convenient to use a cell-based method to monitor the ability to silence a target RNA. This can be followed by a different method, e.g, a whole animal method, to confirm activity.
The invention includes using information on cleavage sites obtained by a method described herein to modify a dsRNA, e.g., an iRNA agent.
Optirnizifzg the activity of tlae nucleic acid molecules of the invention Chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., Nature 344:565, 1990; Phieken et al., Science 253:314, 1991; Usman and Cedergren, Treads in Biochern. Sci.
17:334, 1992; Usman et al., International Publication No. WO 93/15187; and Rossi et al., International Publication No. WO 91/03162; Sproat, U.S. Pat. No. 5,334,711;
Gold et al., U.S.
Pat. No. 6,300,074; and Burgin et al., supra ; all of which are incorporated by reference herein).
All of the above references describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules described herein. Modifications that enhance their efFcacy in cells, and removal of bases from nucleic acid molecules to shorten oligonucleotide synthesis times and reduce chemical requirements are desired.
Other suitable modifications to a sugar, base, or backbone of an iRNA agent are described elsewhere herein.
There are several examples in the art describing sugar, base and phosphate modifications that can be introduced into nucleic acid molecules with significant enhancement in their nuclease stability and efficacy. For example, oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2'-amino, 2'-G-allyl, 2'-fluoro, 2'-O-methyl, 2'-O- allyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, Trends in Bioclzenz. Sci. 17:34, 1992; Usman et al., Nucleic Acids Symp. Sef°. 31:163, 1994; Burgin et al., Biochemistry 35:14090, 1996). Sugar modification of nucleic acid molecules have been extensively described in the art (see Eckstein et al., International Publication PCT No. WO 92/07065; Perrault et al., Natuf a 344:565, 1990; Pieken et al. Science 253:314, 1991; Usman and Cedergren, Trends in Bioclaem.Sci.
17:334, 1992;
Usman et al., International Publication PCT No. W093/15187; Sproat, U.S. Pat.
No. 5,334,711, and Beigelman et al., J. Biol. Chenz. 270:25702, 1995; Beigelman et al., International PCT
publication No. WO 97/26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat.
No. 5,627,053; Woolf et al., International PCT Publication No. WO 98/13526;
I~arpeisky et al., Tetralzedton Lett. 39:1131, 1998; Earnshaw and Gait, BiopolymeTS (Nucleic Acid Sciences) 48:39, 1998; Verma and Eckstein, Anrzu. Rev Bioclaem. 67:99, 1998; and Burlina et al., Bioorg.
Med. Clzern. 5:1999, 1997; all of the references are hereby incorporated in their totality by reference herein). Such publications describe general methods and strategies to determine the location of incorporation of sugar, base and/or phosphate modifications and the like into nucleic acid molecules without modulating catalysis, and are incorporated by reference herein. In view S of such teachings, similar modifications can be used as described herein to modify the iRNA
nucleic acid molecules of the instant invention so long as the ability of iRNA
agents to promote RNAi in cells is not significantly inhibited.
While chemical modification of oligonucleotide internucleotide linkages with phosphorothioate, phosphorodithioate, and/or 5'-methylphosphonate linkages improves stability, excessive modifications can cause some toxicity or decreased activity.
Therefore, when designing nucleic acid molecules, the amount of these internucleotide linkages should be minimized. The reduction in the concentration of these linkages should lower toxicity, resulting in increased efficacy and higher specificity of these molecules.
The 3' and 5' ends of an iRNA agent can be modified. Such modifications can be at the 3' end, 5' end or both ends of the molecule. They can include modification or replacement of an entire terminal phosphate or of one or more of the atoms of the phosphate group. For example, the 3' and 5' ends of an oligonucleotide can be conjugated to other functional molecular entities such as labeling moieties, e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protecting groups (based e.g., on sulfur, silicon, boron or ester).
The functional molecular entities can be attached to the sugar through a phosphate group and/or a spacer. The terminal atom of the spacer can connect to or replace the linking atom of the phosphate group or the C-3' or C-5' O, N, S or C group of the sugar. Alternatively, the spacer can connect to or replace the terminal atom of a nucleotide surrogate (e.g., PNAs). These spacers or linkers can include e.g., -(CH2)n-, -(CH2)nN-, -(CH2)n0-, -(CH2)nS-, O(CH2CH20)nCH2CH20H
(e.g., n = 3 or 6), abasic sugars, amide, carboxy, amine, oxyamine, oxyimine, thioether, disulfide, thiourea, sulfonamide, or morpholino, or biotin and fluorescein reagents. When a spacer/phosphate-functional molecular entity-spacer/phosphate array is interposed between two sequences of an iRNA agent, the array can substitute for a hairpin RNA loop in a hairpin-type RNA agent. The 3' end can be an -OH group. While not wishing to be bound by theory, it is believed that conjugation of certain moieties can improve transport, hybridization, and specificity properties. Again, while not wishing to be bound by theory, it may be desirable to introduce terminal alterations that improve nuclease resistance. Other examples of terminal modifications include dyes, intercalating agents (e.g., acridines), cross-linkers (e.g., psoralene, mitomycin C), porphyrins (TPPG4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic carriers (e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), and synthetic ribonucleases (e.g., irnidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazQle conjugates, Eu3+ complexes of tetraazamacrocycles). In some embodiments, conjugates such as retinol or retinoic acid can be attached to the 5' or 3' end, or both ends, of an iRNA agent. Use of such conjugates may improve specific uptake and delivery of iRNA agents to cells that express retinol receptors, such as retinal pigment epithelial cells.
Terminal modifications can be added for a number of reasons, such as to modulate activity or to modulate resistance to degradation. Terminal modifications useful for modulating activity include modification of the 5' end with phosphate or phosphate analogs. For example, in preferred embodiments iRNA agents, especially antisense sequences, are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus. 5'-phosphate modifications include those which are compatible with RISC mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO)2(O)P-O-5'); 5'-diphosphate ((HO)2(O)P-O-P(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-guanosine cap (7-methylated or non-methylated) (7m-G-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P-O-5'); 5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P-O-5'), 5'-phosphorothiolate ((HO)2(O)P-S-5'); any additional combination of oxygen/sulfur replaced monophosphate, diphosphate and triphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)P-O-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates (R=alkylethet=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g., RP(OH)(O)-O-5'-).
In another embodiment, the invention features conjugates andlor complexes of iRNA
agents of the invention. Such conjugates andlor complexes can be used to facilitate delivery of iRNA agents into a biological system, such as a cell. The conjugates and complexes provided by the instant invention can impart therapeutic activity by transfernng therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention. The present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example, proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes. In general, the transporters described are designed to be used either individually or as part of a mufti-component system, with or without degradable linkers. These compounds are expected to improve delivery and/or localization of nucleic acid molecules of the invention into a number of cell types originating from different tissues, in the presence or absence of serum (see Sullenger and Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
Adrninistration of tlxe iRNA Agents A patient who has been diagnosed with a disorder characterized by unwanted VEGF expression can be treated by administration of an iRNA agent described herein to block the negative effects of VEGF, thereby alleviating the symptoms associated with unwanted VEGF gene expression. For example, the iRNA agent can alleviate symptoms associated with a disease of the eye, such as a neovascular disorder.
In other examples, the iRNA agent can be administered to treat a patient who has a tumor or metastatic cancer, such as colon or breast cancer; a pulmonary disease, such as asthma or bronchitis; or an autoimmune disease such as rheumatoid arthritis or psoriasis. The anti-VEGF
iRNA agents can be administered systemically, e.g., orally or by intramuscular injection or by intravenous injection, in admixture with a pharmaceutically acceptable carrier adapted for the route of administration. An iRNA agent can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. Methods for the delivery of nucleic acid molecules are described in Akhtar et al., Trends in Cell Bio. 2:139, 1992; Delivery Strategies for Antisense Oli~onucleotide Thera ep utics, ed. Akhtar, 1995; Maurer et al., Mol.
lllenabr: Biol., 16:129, 1999;
Hofland and Huang, Handb. Exp. Pharmacol. 137:165, 1999; and Lee et al., ACS
Symp. Ser.
752:184, 2000, all of which are incorporated herein by reference. Beigelman et al., U.S. Pat. No.
6,395,713 and Sullivan et al., PGT WO 94/02595 further describe the general methods for delivery of nucleic acid molecules. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by ionophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins (see for example Gonzalez et al., Bioconjugate Chem.
10:1068, 1999), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722).
In the present methods, the iRNA agent can be administered to the subject either as naked iRNA agent, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the iRNA agent. Preferably, the iRNA agent is administered as naked iRNA.
The iRNA agent of the invention can be administered to the subject by any means suitable for delivering the iRNA agent to the cells of the tissue at or near the area of unwanted VEGF expression, such as at or near an area of neovascularization. For example, the iRNA
agent can be administered by gene gun, electroporation, or by other suitable parenteral administration routes.
Suitable enteral administration routes include oral delivery.
Suitable parenteral administration routes include intravascular administration (e.g., intravenous bolus injection, intravenous infusion, infra-arterial bolus injection, infra-arterial infusion and catheter instillation into the vasculature); peri- and infra-tissue injection (e.g., intraocular injection, infra-retinal injection, or sub-retinal injection);
subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the area at or near the site of neovascularization, for example by a catheter or other placement device (e.g., a retinal pellet or an implant comprising a porous, non-porous, or gelatinous material). It is preferred that injections or infusions of the iRNA agent be given at or near the site of neovascularization.
The iRNA agent of the invention can be delivered using an intraocular implant.
Such implants can be biodegradable and/or biocompatible implants, or may be non-biodegradable implants. The implants may be permeable or impermeable to the active agent, and may be inserted into a chamber of the eye, such as the anterior or posterior chambers, or may be implanted in the sclera, transchoroidal space, or an avascularized region exterior to the vitreous.
In a preferred embodiment, the implant may be positioned over an avascular region, such as on the sclera, so as to allow for transcleral diffusion of the drug to the desired site of treatment, e.g., the intraocular space and macula of the eye. Furthermore, the site of transcleral diffusion is preferably in proximity to the macula.
The iRNA agent of the invention can also be administered topically, for example, by patch or by direct application to the eye, or by iontophoresis. Ointments, sprays, or droppable liquids can be delivered by ocular delivery systems known in the art such as applicators or eyedroppers. The compositions can be administered directly to the surface of the eye or to the interior of the eyelid. Such compositions can include mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or polyvinyl alcohol), preservatives such as sorbic acid, EDTA or benzylchronium chloride, and the usual quantities of diluents and/or carriers.
The iRNA agent of the invention may be provided in sustained release compositions, such as those described in, for example, U.S. Patent Nos. 5,672,659 and 5,595,760. The use of immediate or sustained release compositions depends on the nature of the condition being treated. If the condition consists of an acute or over-acute disorder, treatment with an immediate release form will be preferred over a prolonged release composition.
Alternatively, for certain preventative or long-term treatments, a sustained release composition may be appropriate.
An iRNA agent can be injected into the interior of the eye, such as with a needle or other delivery device.
The iRNA agent of the invention can be administered in a single dose or in multiple doses. Where the administration of the iRNA agent of the invention is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions.
Injection of the agent directly into the tissue is at or near the site of neovascularization is preferred. Multiple injections of the agent into the tissue at or near the site of neovascularization are also preferred.
Dosage levels on the order of about 1 ~,g/kg to 100 mg/kg of body weight per administration are useful in the treatment of the neovascular diseases. When administered directly to the eye, the preferred dosage range is about 0.00001 mg to about 3 mg per eye, or preferrably about 0.0001-0.001 mg per eye, about 0.03- 3.0 mg per eye, about 0.1-3.0 mg per eye or about 0.3-3.0 mg per eye. One skilled in the art can also readily determine an appropriate dosage regimen for administering the iRNA agent of the invention to a given subj ect. For example, the iRNA agent can be administered to the subject once, e.g., as a single injection or deposition at or near the neovascularization site. Alternatively, the iRNA
agent can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days. In a preferred dosage regimen, the iRNA agent is injected at or near a site of unwanted VEGF expression (such as near a site of neovascularization) once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of iRNA agent administered to the subject can comprise the total amount of iRNA agent administered over the entire dosage regimen. One skilled in the art will appreciate that the exact individual dosages may be adjusted somewhat depending on a variety of factors, including the specific iRNA agent being administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disorder being treated, the severity of the disorder, the pharmacodynamics of the iRNA agent, and the age, sex, weight, and general health of the patient. Wide variations in the necessary dosage level are to be expected in view of the differing efficiencies of the various routes of administration. For instance, oral administration generally would be expected to require higher dosage levels than administration by intravenous or intravitreal injection. Variations in these dosage levels can be adjusted using standard empirical routines of optimization, which are well-known in the art. The precise therapeutically effective dosage levels and patterns are preferably determined by the attending physician in consideration of the above-identified factors.
In addition to treating pre-existing neovascular diseases, iRNA agents of the invention can be administered prophylactically in order to prevent or slow the onset of these and related disorders. In prophylactic applications, an iRNA of the invention is administered to a patient susceptible to or otherwise at risk of a particular neovascular disorder.
The iRNA agents featured by the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the W vention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 18th ed., Mack Publishing Company, Easton, Pa. (1990), and The Science and Practice of Pharmacy, 2003, Gennaro et al., the entire disclosures of which are herein incorporated by reference.
The present pharmaceutical formulations comprise an iRNA agent of the invention (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a physiologically acceptable carrier medium. Preferred physiologically acceptable Garner media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
For solid compositions, conventional non-toxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of one or more iRNA agents of the invention.
By "pharmaceutically acceptable formulation" is meant a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity. Non-limiting examples of agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as PluronicP85), which can enhance entry of drugs into the CNS
(Jolliet-Riant and Tillement, Fundam. Clin. Pharmacol. 13:16, 1999);
biodegradable polymers, such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery. Other non-limiting examples of delivery strategies for the nucleic acid molecules of the instant invention include material described in Boado et al., J. Pha~m. Sei. 87:1308, 1998;
Tyler et al., FEBSLett.
421:280, 1999; Pardridge et al., PNAS USA. 92:5592, 1995; Boado, Adu Drug Delivery Rev 15:73, 1995; Aldrian-Herrada et al., Nucleic Acids Res. 26:4910, 1998; and Tyler et al., PNAS
USA 96:7053, 1999.
The invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al., Claern.
Rev. 95:2601, 1995;
Ishiwata et al., Chena.Phare. Bull. 43:1005, 1995).
Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 267:1275, 1995; Oku et al., Biochim. BioplZys. Acta 1238:86, 1995). The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Clzern. 42:24864, 1995; Choi et al., International PCT
Publication No. WO 96/10391;
Ansell et al., International PCT Publication No. WO 96/10390 ; Holland et al., International PCT
Publication No. WO 96/10392). Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remin~ton's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided.
These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.
The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
Alternatively, certain iRNA agents of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, Seience 229:345, 1985;
McGarry and Lindquist, Proc. Natl. Acad. Sci. USA 83:399, 1986; Scanlon et al., Pr~oe.Natl. Acad. Sci. USA
88:10591, 1991; Kashani-Sabet et al., Antiserrse Res. I~ev 2:3, 1992; Dropulic et al., J. Yirol.
66:1432, 1992; Weerasinghe et al., J. Tirol. 65:5531, 1991; Ojwanget al., Proc. Natl. Acad. Sci.
USA 89:10802, 1992; Chen et al., Nucleic Acids Res. 20:4581, 1992; Sarver et al., Science 247:1222, 1990; Thompson et al., Nucleic Acids Res. 23:2259, 1995; Good et al., Gene Therapy 4:45, 1997). Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., Nucleic Acids Syrrap. Ser. 27:156, 1992; Taira et al., Nucleic Acids Res. 19:5125, 1991;
Ventura et al., Nucleic Acids Res. 21:3249, 1993; Chowrira et al., J. Biol. Chern. 269:25856, 1994).
In another aspect of the invention, RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al., Treads in Genetics 12:510, 1996) inserted into DNA or RNA vectors. The recombinant vectors can be DNA
plasmids or viral vectors. iRNA agent-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. I~ another embodiment, pol III
based constructs are used to express nucleic acid molecules of the invention (see for example Thompson, U. S. Pats. Nos. 5,902,880 and 6,146,886). The recombinant vectors capable of expressing the iRNA agents can be delivered as described above, awd persist in target cells.
Alternatively, viral vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the iRNA agent interacts with the target mRNA and generates an RNA_i response.
Delivery of iRNA
agent-expressing vectors can be systemic, such as by intravenous or infra-muscular administration, by administration to target cells ex-planted from a subj ect followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., Trends ira Genetics 12:510, 1996).
Additional ophthalmic indications for the iRNA agents of the invention include proliferative diabetic retinopathy (the most severe stage of diabetic retinopathy), uveitis (an inflammatory condition of the eye that often leads to macular edema), cystoid macular edema following cataract surgery, myopic degeneration (a condition in which a patient with a high degree of nearsightedness develops choroidal neovascularization), inflammatory macular degeneration (a condition in which a patient with inflammation in the macular area due to infections or other causes, develops choroidal neovascularization), and iris neovascularization (a serious complication of diabetic retinopathy or retinal vein occlusion involving new blood vessel growth on the surface of the iris).
Additional non-ophthalmic indications for the iRNA agents of the invention include cancer, including but not limited to renal and colon cancer, and psoriasis.
Solid tumors and their metastases rely on new blood vessel growth for their survival.
Psoriasis is a chronic inflammatory skin disease that causes skin cells to grow too quickly, resulting in thick white or red patches of skin. Preclinical and clinical data suggest that VEGF-induced blood vessel growth and blood vessel leakage play a role in the development of this condition.
The invention is further illustrated by the following examples, which should not be construed as further limiting.
EXAMPLES
Example 1: siRNA Design Four hundred target sequences were identified within exons 1-5 of the VEGF-mRNA sequence (See Table 1, SEQ ID NOs 2-401) and corresponding siRNAs targeting these subjected to a bioinformatics screen.
To ensure that the sequences were specific to VEGF sequence and not to sequences from any other genes, the target sequences were checked against the sequences in Genbank using the BLAST search engine provided by NCBI. The use of the BLAST algorithm is described in Altschul et al., J. Mol. Biol. 215:403, 1990; and Altschul and Gish, Meth.
Erazymol. 266:460, 1996.
siRNAs were also prioritized for their ability to cross react with monkey, rat and human VEGF sequences.
Of these 400 potential target sequences 80 were selected for analysis by experimental screening in order to identify a small number of lead candidates. A total of 114 siRNA molecules were designed for these ~0 target sequences 114 (Table 2).
Example 2: Synthesis of the siRNA oli~onucleotides RNA was synthesized on Expedite X909, ABI 392 and ABI394 Synthesizers (Applied Biosystems, Applera Deutschland GmbH, Frankfurter Str. 129b, 64293 Darnistadt, Germany) at 1 ,mole scale employing CPG solid support and Expedite RNA phosphoramidites (both from Proligo Biochemie GmbH, Georg-Hyken-Str.l4, Hamburg, Germany). Ancillary reagents were obtained from Mallinckrodt Baker (Im Leuschnerpark 4:64347 Griesheim, Germany).
Phosphorothioate linkages were introduced by replacement of the iodine oxidizer solution with a solution of the Beaucage reagent in acetonitrile (5% weight per volume).
Cleavage of the oligoribonucleotides from the solid support and base deprotection was accomplished with a 3:1 (v/v) mixture of methylamine (41%) in water and methylamine (33%) in ethanol. 2'-Desilylation was carried out according to established procedures (Wincott et al., Nucleic Acids Res. 23:2677-2684, 1995). Crude oligoribonucleotides were purified by anion exchange HPLC using a 22x250 mm DNAPac PA 100 column with buffer A containing 10 mM
NaC104, 20 mM Tris, pH 6.8, 6 M urea and buffer B containing 400 mM NaC104, 20 mM Tris, pH 6.8, 6 M Urea. Flow rate was 4.5 mL/min starting with 15% Buffer B which was increased to 55% over 45 minutes.
The purified compounds were characterized by LC/ESI-MS (LC: Ettan Micro, Amersham Biosciences Europe GmbH, Munzinger Strasse 9, 79111 Freiburg, Germany, ESI-MS:
LCQ, Deca XP, Thermo Finnigan, Im Steingrund 4-6, 63303 Dreieich, Germany) and capillary electrophoresis (P/ACE MDQ Capillary Electrophoresis System, Beckman Coulter GmbH, 85702 Unterschleil3heim, Germany). Purity of the isolated oligoribonucleotides was at least 85%.
Yields and concentrations were determined by UV absorption of a solution of the respective RNA at a wavelength of 260 nm using a spectral photometer. Double stranded RNA
was generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heating in a water bath at 85 - 90 °C for 3 minutes and cooling to room temperature over a period of 3 - 4 hours. The RNA was kept at -20 °C until use.
Example 3: Efficacy Screen of siRNAs Using two efficacy screens, the VEGF siRNA were screened for their ability to become a lead candidate. Table 2 shows the relative efficiencies of some of the siRNAs in their ability to inhibit expression of an endogenous VEGF gene. In this process the number of candidate siRNAs was winnowed. Human HeLa or ARPE-19 (human retinal pigment epithelial cell line with differentiated properties (Dunn et al., Exp. Eye Res. 62:155, 1996) were plated in 96-well plates (17,000 cells/well) in 100 ~.1 10% fetal bovine serum in Dulbecco's Modified Eagle Medium (DMEM). When the cells reached approximately 90% confluence (approximately 24 hours later) they were transfected with serial three-fold dilutions of siRNA
starting at 20 nM 0.4 ~,1 of transfection reagent LipofectamineTM 2000 (Invitrogen Corporation, Carlsbad, CA) was used per well and transfections were performed according to the manufacturer's protocol.
Namely, the siRNA: LipofectamineTM 2000 complexes were prepared as follows.
The appropriate amount of siRNA was diluted in Opti-MEM I Reduced Serum Medium without serum and mixed gently. The LipofectamineTM 2000 was mixed gently before use, then for each well of a 96 well plate, 0.4 ~.l was diluted in 25 ~,l of Opti-MEM I Reduced Serum Medium without serum and mixed gently and incubated for 5 minutes at room temperature. After the 5 minute incubation, 1 ~1 of the diluted siRNA was combined with the diluted LipofectamineTM
2000 (total volume is 26.4 ~.1). The complex was mixed gently and incubated for 20 minutes at room temperature to allow the siRNA: LipofectamineTM 2000 complexes to form.
Then 100 ~,l of 10% fetal bovine serum in DMEM was added to each of the siRNA:LipofectamineTM 2000 complexes and mixed gently by rocking the plate back and forth. 100 ~,1 of the above mixture was added to each well containing the cells and the plates were incubated at 37°C in a COZ
incubator for 24 hours, then the culture medium was removed and 100 ~1 10%
fetal bovine serum in DMEM was added. Following the medium change, conditioned medium was collected at 24 hours (HeLa cells) or 72 hours CARPE-19 cells) and a human VEGF ELISA
was performed using the DuoSet human VEGF ELISA Development kit (R&D Systems, Inc.
Minneapolis, MN
55413). This kit contains the basic component required for the development of sandwich ELISAs to measure natural and recombinant human VEGF in cell culture supernatants and serum.
The materials used included:
Capture Antibody - 576 ~,g/ml of goat anti-human VEGF when reconstituted with 0.25 ml PBS (137 mM NaCI, 2.7 mM KCI, 8.1 mM Na2HP04, 1.5 mM KHZP04, pH 7.2-7.4, 0.2 ~,m filtered). After reconstitution, stored at 2-8°C for up to 60 days or aliquoted and stored at -20°C
to -70°C in a manual defrost freezer for up to 6 months. Diluted to a working concentration of 0.8 ~g/ml in PBS without carrier protein.
Detection antibody - 4.5 ~g/ml of biotinylated goat anti-human VEGF when reconstituted with 1.0 ml of Reagent Diluent (1% bovine serum albumin in PBS, pH 7.2-7.4, 0.2 ~,m filtered. After reconstitution, stored at 2-8°C for up to 60 days or aliquoted and stored at -20°C to -70°C in a manual defrost freezer for up to 6 months.
Diluted to a working concentration of 25 ng/ml in Reagent Diluent.
Standard: 110 ng/ml of recombinant when reconstituted with 0.5 ml of Reagent Diluent.
Allowed the standard to sit for a minimum of 15 minutes with gentle agitation prior to making dilutions. The reconstituted Standard can be stored at 2-8°C for up to 60 days or aliquoted and stored at -20°C to -70°C in a manual defrost freezer for up to 6 months. A seven point standard curve using 2-fold serial dilutions in Reagent Diluent, and a high standard of 4000 pg/ml is recommended.
Streptavidin-HRP: 1.0 ml of streptavidin conjugated to horseradish-peroxidase.
Stored at 2-8°C for up to 6 months. Diluted to the working concentration specified on the vial label.
General ELISA protocol was followed (R&D Systems, Inc., Minneapolis, MN).
Controls included no siRNA, human VEGF siRNA (CandS, (a.k.a., hVEGFS) Reich et al., Mol ~s. 9:210, 2003) and an siRNA matching a 21-nt sequence conserved between the human, rat and mouse VEGF (hrmVEGF, Filleur et al., Caracer-Res. 63:3919-3922, 2003).
The activities of the siRNAs were compared to the activity of the control human VEGF
siRNA of Reich et al. (supra) with "+" representing a lower activity, "++"
representing similar activity and "+-I-I-" representing a higher activity than the control human VEGF siRNA (Table 2).
FIG. 2 shows the activities of single- and double-overhang siRNAs in HeLa cells. Solid lines with filled symbols represent the single-overhang siRNA, solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. All of the siRNAs are more active than the control siRNAs and may inhibit expression of VEGF by approximately 80%. In contrast, the siRNA from Reich et al. (supra) reduced the level of endogenous hVEGF by approximately 20% under the same experimental conditions.
Similarly, under the same experimental conditions, the siRNA based on consensus sequence hrmVEGF
(Filleur et al., supra) reduced the expression level by approximately 45%.
FIG. 3 shows the activities of single- and double-overhang siRNAs in ARPE-19 cells.
Solid lines with filled symbols represent the single-overhang siRNA, solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. All of the siRNAs are more active than the control siRNAs and may inhibit expression of VEGF by approximately 90%. In contrast, the siRNA from Reich et al. (Mol. his. 9:210, 2003) reduced the level of hVEGF by approximately 35% under the same experimental conditions.
Similarly, under the same experimental conditions, the siRNA based on consensus sequence hrmVEGF (Filleur et al., supra) reduced the expression level by approximately 70%.
FIGS. 4 and 5 show the results of a comparison of single- and double-overhang siRNAs with their analogous blunt-ended siRNAs, respectively in HeLa cells. The results are in agreement with the data of Elbashir et al. (Genes & Developrrzent 15:188, 2001) in that the presence of an overhang in an siRNA confers greater efficiency in inhibition of gene silencing.
However, it is important to note that the activity of the blunt ended siRNAs are comparable to the results achieved using the control siRNAs.
Example 4: Iyz vitro assay for the silencing of VEGF synthesis under hypoxic conditions Human HeLa cells were plated in 96 well plates at 10,000 cells/well in 100 p,l of growth medium (10% FBS in DMEM). 24 hours post cell seeding when the cells had reached approximately 50% confluence they were transfected with serial three fold dilutions of siRNA
starting at 30 nM. 0.2 p,l of LipofectamineTM 2000 transfection reagent (Invitrogen Corporation, Carlsbad CA) was used per well and transfections were carried out as described in the Invitrogen product insert. Controls included no siRNA, human VEGF siRNA (Reich et al., Mol. vis. 9:210, 2003) and an siRNA matching a 21-nt sequence conserved between the human, rat and mouse VEGF (hrmVEGF, Filleur et al., Cancer Res. 63:3919-3922, 2003). Transfections were done in duplicate on each plate. Additionally, duplicate plates were transfected so that 24 hours post transfection the growth media could be changed and one plate could be kept in normal oxygen growth conditions (37°C, 5% CO2, 20% oxygen) and the duplicate plate could be kept in hypoxic conditions (37°C, 1% oxygen, balance nitrogen). Hypoxic conditions were maintained by using a Pro-ox Oxygen Controller (BioSpherix, Ltd., Redfield, NY) attached to a Pro-ox in vitro culture chamber. Cells were maintained in either normoxic or hypoxic conditions for 24 hours post media change. Conditioned culture media was then collected from both plates and tested for secreted VEGF levels in a DuoSet VEGF ELISA (R&D Systems, Minneapolis, MN).
The assays were performed according to the manufacturer's protocol and as described in Example 2.
For deferoxamine chemically induced hypoxia, 130 p,M deferoxamine (Sigma D9533), was used. Deferoxamine was added to the fresh growth media 24 hours post-transfection. Cells treated with deferoxamine were then grown under normal growth conditions (37°C, 5% CO2, 20% oxygen).
FIG. 6 shows the results obtained with siRNAs (both single overhang siRNAs and double overhangs siRNAs) directed against ORF regions having the first nucleotides corresponding to 319 and 343 respectively, together with the control siRNAs. Under hypoxic conditions, either 1% oxygen (FIG 6B) or 130 ~,M deferoxamine (FIG. 6C), three of the experimental siRNAs achieved almost 95% inhibition of expression of VEGF, namely AL-DP-4094 (single-overhang) directed at ORF 343, and both of the siRNAs (single and double-overhangs) directed at ORF
319. The control siRNAs of Reich et al (supra) and Filleur et al. (supra) demonstrate an ability to inhibit VEGF expression by 45% and 85% respectively.
FIGs. 8A and 8B show the results obtained with the siRNAs AL-DP-4014, a phosphorothioate modified version of AL-DP-4014 (AL-DP-4127, see Table 3) and a mutated version of AL-DP-4014 (AL-DP-4140, see Table 5). Under both normal and hypoxic conditions, the unmodified (AL-DP-4014) and the phosphorothioate-modified siRNA (AL-DP-4127) reduced endogenous VEGF expression to less than 20% of its original expression level. Under hypoxic conditions, the phosphorothioate-modified siRNA essentially abolished VEGF
expression.
Example 5: Modified VEGF siRNA molecules retain full activity and show enhanced stabili Phosphorothioate derivatives were made for the AL-DP-4014, targeting ORF 319 of VEGF, and are presented in Table 3. These siRNAs were tested in the HeLa cell assay described in Example 3, and FIG. 7 shows that these derivatives are as active in the HeLa assay as the unmodified siRNA.
A panel of siRNAs were synthesized that retained the sequence of the AL-DP-siRNA (Table 1) but included different modifications including phosphorothioate linkages, O-methyl-modified nucleotides, and 2 °-fluoro-modified nucleotides (Table 4). The panel of siRNAs was tested in HeLa cells, and FIGs. 9A-9E demonstrate that all modified versions of the AL-DP-4094 siRNA effectively reduced VEGF expression by greater than 90%, exhibiting greater efficacy than either of the two previously identified VEGF siRNAs ("Acuity" in Reich et al. (supra), and "Filleur" in Filleur et al. (supra)). FIG. 10 also shows data from iTZ vita°o assays in HeLa cells. The graph in FIG. 10 shows that the unmodified AL-DP-4094 siRNA
and a phosphorothioate-modified AL-DP-4004 siRNA (AL-DP-4219) reduced VEGF
expression by more than 70% (FIG 10). Scrambled versions of the compound AL-DP-4094 (e.g., and AL-DP-4218 (sequences shown below; underlined nucleotides represent mismatched nucleotides as compared to AL-DP-4094)) did not inhibit VEGF expression. An siRNA targeting the firefly luciferase gene (AL-DP-3015; see below) also did not inhibit VEGF
expression.
AL-DP-4216 AL4094 MI s 5°- GCAGAUUGGACAGUUGUGGUU-3' as °3-GUCGUGUAACCUGUCAACACCAA-'S
AL-DP-4218 s 5'- GCACAUAGA_AGU_GA_CG_CGCUU-3' as '3-GUCGUGUAUCUUCACUGCGCGAA-°5 AL-DP-3015 5'- GAACUGUGUGUGAGAGGUCCU-3' '3-CGCUUGACACACAGUCUCCAGGA-'S
The Stains-All technique (Sigma, St. Louis, MO) was performed to examine the stability of the modified siRNAs. To perform the assay, an siRNA duplex was incubated in 90% human serum at 37°C. Samples of the reaction mix were quenched at various time points (at 0, 0.25, 1, 2, 4, and 24 hours) and subjected to polyacrylamide gel electrophoresis.
Cleavage of the RNA
over the time course provided information regarding the susceptibility of the siRNA duplex to serum nuclease degradation.
O-methyl and 2'fluoro modifications used in combination with phosphorothioate modifications were found to enhance stability to a greater extent than when phosphorothioate modifications were used alone. For example, modified versions of the AL-DP-4094 siRNA
included a phosphorothioate-modified siRNA (AL-DP-4198), a phosphorothioate plus O-methyl modified siRNAs (e.g., AL-DP-4180, AL-DP-4175, and AL-DP-4220), and phosphorothioate plus O-methyl plus 2'-fluoro modified siRNAs (e.g., AL-DP-4197 and AL-DP-4221) (Table 4).
The AL-DP-4180, AL-DP-4175, and AL-DP-4197 siRNAs were found to be more stable in human serum than the AL-DP-4198 siRNA. It was determined that the phosphorothioate modification stabilized the siRNAs against exonucleolytic degradation, and the O-methyl and 2'-fluoro modifications stabilized the siRNAs against endonucleolytic degradation.
Examule 6: In vitro Stability Assay of VEGF siRNAs in Different Rat Serum and Ocular tissues 1. Preparation of Tissue Homo eg hates Tissues from pooled whole eyes, retinas, vitreous humors from at least three rats were excised and frozen immediately in liquid nitrogen. The frozen tissue was pulverized over dry ice, using instruments that were pre-chilled on dry ice. 1 ml of RIPA buffer (50 mM Tris-HCI, pH 8.0, 150 mM NaCL, 1mM Na2EDTA, 0.5% Na-deoxycholate deoxycholic acid, 1% IGEPAL CA-630, 0.05% SDS) was added to the frozen tissue powder and the mixture was mixed thoroughly and vigorously. The homogenate was centrifuged at 10,000 x g for 5 min at 4°C and the pellet was discarded. 100 ~,1 aliquots of the supernatant were transferred to pre-chilled microcentrifuge tubes and stored at -70°C or used immediately in the stability assay.
2. 5'-end labelin o~~le stranded sense or antisense siRNA using T4 polynucleotide kinase and y 32P-ATP
The following reagents were used:
T4 Polynucleotide Kinase (PNK) 10 units/~l (New England Biolabs, Beverly, MA) l OX T4 PNK buffer (700 mM Tris-HCI, 1.00 mM MgCl2, 50 mM Dithiothreitol (DTT), pH7.6) Gamma-32P-ATP (PerkinElmer, Shelton, CT) 250 ~Ci, 3000 Ci/mmol (3.3 wM) 10 wM stocks of synthetic RNA oligo diluted in H20 Microspin SephadexTM G-25 columns (Amersham Biosciences RNAse-free Water and 0.65 ml microcentrifuge (1.5 ml) tubes A 25 ~1 kinase reaction contained:
2.5,1 from 10 ~M stock sense or antisense (l~.M final cone) 2.5,1 lOX PNK Buffer (1X) 1.5,1 ~y32-ATP'~approximately 0.2 nM) 1.0,1 10 unit/~,l T4 PNK (10 units) 17.5,1 dHzO
The reaction rnix was incubated at 37°C for 1 hour (water bath) prior to fractionating the labeled slRNA through SephadexTM G-25 spin columns (Amersham). 0.5 ~.L was used to determine the number of counts per minute (cpm)/ml of the radiolabeled sample.
3. Partial alkaline hydrolysis ladder of radiolabeled single-stranded siRNA
To generate a sample of size markers a portion of the 5' 'y 32 P-end- labeled siRNA was subjected to alkaline hydrolysis as follows:
3 0 ~,l hydrolysis reaction containing 2.5 ~.l 5' end -labeled siRNA (sense or antisense), 6.0 ~,l 0.5M Na2C03/NaHCO3 (pH 9.5), 1.51 lOmg/ml tRNA, and 20.0,1 dH20 was incubated at 90°C
for 7.5 min, then chilled on ice or at 4°G. 301 of 90% formamide, 50mM
Na2EDTA, lOmM
DTT, and XC&BB (xylene cyanol and bromophenol blue), of which 1 ~.l+4~.1 formamide dye was used for the gel electrophoretic analysis.
4. Annealing of radiolabeled 1 ~M stock siRNA duplexes 30.1 l~,M stock of different siRNA duplexes were prepared in which either the sense strand or the antisense strand was radiolabeled.
The samples were heated at 90°C for 2 min and then incubated at 37°C for 1 hour and then stored at -20°C until used.
5. (2uality control of siRNA duplex:
Samples of the siRNA duplex were analyzed by electrophoresis through 15%
polyacrylamide in Tris-Borate, EDTA (TBE) Gel. Electrophoresis was performed at 150V for 1 hour prior to running the samples through. Samples were prepared by mixing 0.5-1 ~,1 siRNA
duplex or single stranded, 3-3.5 ~.l 0.5X TBE, 1 ~,l 5X native loading dye (total volume = 5 ~.l).
6. Stability reactions 2 ~,1 siRNA duplex was added to 18 ~,l serum or tissue lysate or buffer control in PCR tube (0.2m1). A zero time point sample was removed immediately following the addition of the siRNA duplex by removing 2 ~,l and adding it to 18 x,190% formamide, 50 mM
EDTA, 10 mM DTT and xylene cyanol and bromophenol blue (XC ~ BB). Other samples were removed after 15 min, 30 min, 1 hour, 2 hours, and 4 hours and treated similarly. These samples were stored in a 96-well plate. In some experiments the time points were extended to 8, 24 and 48 hours. Time point samples for the buffer (phosphate buffered saline, PBS, 1X working PBS
contains 0.14 M Sodium Chloride, 0.003 M Potassium Chloride, 0.002 M Potassium phosphate, 0.01 M Sodium phosphate) were taken at zero and the last time point of the experiment.
Samples were analyzed by electrophoresis through 20% polyacrylamide gels (pre-run at 75 W
for 1 hour) in 1 X TBE (10 X = 890 mM Tris, 890 mM Boric acid, 20 mM EDTA, pH
8.0). The gel was transferred to a phosphorimager cassette, covered with an enhancer screen and scanned after overnight exposure.
Polyacrylamide gel analysis indicated that the ocular environment contains fewer nucleases than human serum. Testing the unmodified form of the VEGF siRNAAL-DP-for stability in rat eye extract revealed only the presence of exonuclease activity. In human serum, experiments with AL-DP-4127 and -4140 (Tables 4 and 5) indicated that terminally modified phosphorothioate modifications protected against exonucleolytic degradation but not against endonucleolytic activity. These results were consistent with experiments performed in rat whole eye extracts. The terminally modified phosphorothioate derivatives AL-DP-4127 and -4140 were stabilized against exonuclease activity as compared to the unmodified AL-DP-4014 siRNA and the unmodified CandS siRNA (Reich et al. (supra)). However, the -4127 and -4140 siRNAs were still subject to endonucleolytic degradation.
Modifications to the lead compound AL-DP-4094 stabilized the siRNA against exonucleolytic and endonucleolytic degradation. The phosphorothioate-modified siRNAAL-DP-4198 was degraded to a similar extent as the unmodified 4094 compound, but the addition of O-methyl modifications, as in AL-DP-4180 and AL-DP-4220, stabilized the siRNAs in rat whole eye extracts.
Notably, the siRNAs were generally more stable in rat retina lysates than in the rat whole eye extracts described above. Neither the unmodified AL-DP-4094, nor the modified AL-DP-4198, -4180, or -4220 siRNAs were degraded in the retina lysates.
Examine 7. Endonuclease-sensitive sites were mapued on AL-DP-4094 siRNA.
The stability of the AL-DP-4094 siItNA was examined by the Stains-All and radiolabeled techniques following incubation in human serum (see above). These assays revealed susceptibility to exo- and endonucleases. RP-HPLC was used to examine the fragment profile of the siltNA following incubation in serum FIG 11.
Following incubation of the -4094 siRNA in human serum, the fragments were phenol-chloroform extracted and precipitated, and then subjected to LC/MS analysis.
FIG. 12 describes the identified fragments and associated characteristics.
Example 8: Detailed study of modifications to siRNAs tar~etin~ VEGF (Table ~
Eight major different patterns of chemical modification of siRNA duplexes that target the VEGF mRIVA were synthesized and evaluated (Table 6). The ribose sugar modifications used were either 2'-O-methyl (2'OMe) or 2'-fluoro (2'F). Both pyrimidines (Py) and purines (Pu) could be modified as provided in Table 6.
The first four patterns(A-D) incorporated 2'OMe on both strands at every other position.
Four configurations were synthesized: 1) at each even position on the sense strand and at each odd position of the antisense strand, 2) at each odd position on the sense strand and at each even position of the antisense strand, 3) at even positions on both strands, and 4) at odd positions on both strands.;
The fifth pattern (E) incorporated the 2'OMe modification at all pyrimidine nucleotides on both the sense and antisense strands of the duplex.
Pattern F included duplexes with 2'OMe modifications only on pyrimidines in 5'-PyPu-3' dinucleotides, especially at only at UA, CA, UG sites (both strands).
Pattern G duplexes had the 2'F modification on pyrimidines of the antisense strand and 2'OMe modifications on pyrimidines in the sense strand.
Pattern (H) had antisense strands with 2'F-modified pyrimidines in 5'-PyPu-3' dinucleotides, only at UA, CA, UG sites (both strands) and sense strands with 2'OMe modifications only on pyrimidines in 5'-PyPu-3' dinucleotides, only at UA, CA, UG sites (both strands).
A-D: Full Alternating 2'-OMe (both strands) Four configurations: Even/Odd; Odd/Even; Even/Even; Odd/Odd E: 2'-OMe Py (both strands) F: 2'-OMe Py only at UA, CA, UG sites (both strands) G: 2'-OMe All Py (sense) 2'-F All Py (anti-sense) H: 2'-OMe Py only at UA, CA, UG sites (sense) 2'-F Py only at UA, CA, UG sites (anti-sense) 17 different parent VEGF duplexes from Table 2 tested 1. Evaluation of serum stability of siRNA duplexes 2 p,M siRNA duplexes (final concentration) were incubated in 90% pooled human serum at 37°C. Samples were quenched on dry ice after 30 minutes, 4 hours, and 24 hours. For each siRNA sequence, a sample at the same concentration was incubated in the absence of serum (in PBS) at 37°C for 24 hours. After all samples were quenched, RNA was extracted using phenol:chloroform and concentrated by ethanol precipitation. Samples were air dried and resuspended in a denaturing loading buffer. One third of each time point was analyzed on a 20%
acrylamide (19:1), 7 M urea, 1XTBE gel run at 60°C. RNA was visualized by staining with stains-all solution. A qualitative assessment of the stability of each modified siRNA was made by comparison to the parent unmodified siRNA for each duplex set. PBS controls served as markers for the quality of the input siRNA.
2. Stability of VEGF modular chemistries Four modular chemistries were screened 1) all pyrimidines substituted with 2'-O-methyl (2'OMe) in both sense and antisense strands, 2) pyrimidines in UA, UG, CA
pairs substituted with 2'OMe in both sense and antisense strands, 3) all pyrimidines substituted with 2'OMe in the sense strand and 2'-fluoro (2'F) in the antisense strand, 4) pyrimidines in UA, UG, CA pairs substituted with 2'OMe in the sense strand and 2'F in the antisense strand. In total, 85 siRNAs were screened including the unmodified parent duplexes plus the four modular chemistries.
Of the 85 siRNAs screened, 35 were stable for at least 24hours as assessed by visual comparison with the parent unmodified duplexes. These 35 duplexes had 2'OMe pyrimidines in both strands or 2'OMe pyrimidines in the sense strand and 2'F in the antisense strand (chemistries 1 and 3 above). Of the duplexes with fewer modified residues, only five had at least ~50% full length material remaining at the 4 hour time point as compared to their unmodified parent.
Substitution of all pyrimidines with either 2'OMe or 2'F protects siRNAs from serum nuclease degradation for ~24hr in 90% human serum at 37°C. The protected duplexes had roughly 85%-100% full length material remaining at 24 hours as compared to duplex incubated in the absence of serum. Minimal modification of pyrimidines in UA, UG, and GA
dinucleotide pairs only stabilized several siRNAs relative to their unmodified parent but did not stabilize sufficiently for long-term nuclease resistance. Some potential RNase A sites were not protected by methylation (YpN, e.g. UC, UU) and this is likely the reason for the lower resistance to serum endonucleases.
3. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 6 and Figures 13-29 provides summary and graphs of duplex activities in HeLa cells for each of the modifications described above.
Synthesis of the iRNA a-ents RNA Synthesis using "fast" deprotection monomers 1. RNA s~mthesis Oligoribonucleotides were synthesized using phosphoramidite technology on solid phase employing an AKTA 10 synthesizer (Amersham Biosciences) at scales ranging from 35 to 60 ~.mol. Synthesis was performed on solid supports made of controlled pore glass (CPG, 520, with a loading of 70 ~,mol/g) or polystyrene (with a loading of 71 ~.mol/g).
All amidites were dissolved in anhydrous acetonitrile (70 mM) and molecular sieves (3t~) were added. 5-Ethyl thiotetrazole (ETT, 600 mM in acetonitrile) was used as the activator solution. Coupling times were 8 minutes. Oxidation was carried out either with a mixture of iodine/water/pyridine (50 mM/10%/90% (vlv)) or by employing a 100 mM solution of 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) in anhydrous acetonitrile in order to introduce phosphorothioate linkages. Standard capping reagents were used. Cholesterol was conjugated to RNA via the either the 5' or the 3'-end of the sense strand by starting from a GPG modified with cholesterol (described below) using a hydroxyprolinol linker. The DMT protecting group was removed from cholesterol-conjugated RNA, but the DMT was left on unconjugated RNA to facilitate purification.
2. Cleavage and deprotection of support bound oli~onucleotide.
After solid-phase synthesis, the RNA was cleaved from the support by passing 14 mL of a 3:1 (v/v) mixture of 40% methylamW a in water and methylamine in ethanol through the synthesis column over a 30 min time period. For the cholesterol-conjugated RNA, the ratio of methylamine in water to methylamine in ethanol was 1:13. The eluent was divided into four 15 mL screw cap vials and heated to 65°C for additional 30 min. This solution was subsequently dried down under reduced pressure in a speedvac. The residue in each vial was dissolved in 250 ~L N methylpyrolidin-2-one (NMP), and 120 ~,L triethylamine (TEA) and 160 ~.L
TEA~3HF
were added. This mixture was brought to 65°C for 2h. After cooling to ambient temperature, 1.5 mL NMP and 1 mL of ethoxytrimethylsilane were added. After 10 min, the oligoribonucleotide was precipitated by adding 3 mL of ether. The pellets were collected by centrifugation, the supernatants were discarded, and the solids were reconstituted in 1 mL buffer 10 mM sodium phosphate.
3. Purification of oli~oribonucleotides Crude oligonucleotides were purified by reversed phase HPLC on an AKTA
Explorer system (Amersham Biosciences) using a 16/10 HR column (Amersham Biosciences) packed to a bed height of 10 cm with Source RPC 15. Buffer A was 10 mM sodium phosphate and buffer B
contained 65% acetonitrile in buffer A. A flow rate of 6.5 mLlmin was employed. UV traces at 260, 280, and 290 nm were recorded. For DMT-on oligoribonucleotides a gradient of 7% B to 45% B within 10 column volumes (CV) was used and for cholesterol-conjugated RNA a gradient of 5% B to 100% B within 14 CV was employed. Appropriate fractions were pooled and concentrated under reduced pressure to roughly 10 mL. DMT-on oligonucleotides were treated with one-third volume 1M NaOAc, pH 4.25 for several hours at ambient temp.
Finally, the purified oligonucleotides were desalted by size exclusion chromatography on a column containing Sephadex G-25. The oligonucleotide solutions were concentrated to a volume <15 mL. The concentrations of the solutions were determined by measurement of the absorbance at 260 nm in a UV spectrophotometer. Until annealing the individual strands were stored as frozen solutions at -20°C.
4. Analysis of oli~oribonucleotides Cholesterol conjugated RNA was analyzed by CGE and LC/MS. Unconjugated RNA was also analyzed by IEX-HPLC. CGE analysis was performed on a BeckmanCoulter PACE
MDQ
CE instrument, equipped with a fixed wavelength detector at 254 nm. An eCap DNA capillary (BeckmanCoulter) with an effective length of 20 cm was used. All single stranded RNA samples were analyzed under denaturing conditions containing 6 M urea (eCap ssDNA100 Gel Buffer I~it, BeckmanCoulter) at 40°C. Samples were injected electrokinetically with 10 kV for 5-8 sec.
The run voltage was 15 lcV.
IEX HPLG analysis was performed on a Dionex BioLC system equipped with a fixed wavelength detector (260 and 280 nm), column oven, autosampler, and internal degasser. A
Dionex DNAPac P100 column (4*250mm) was used as at a flow rate of 1.0 mL/min and 30°C.
Unconjugated RNA (20 ~,L, 1 OD/mL concentration) was injected. Eluent A
contained 20 mM
Na2HP04, 10 mM NaBr, 10% acetonitrile, pH 11 and Eluent B was 1 M NaBr in Eluent A. The elution started with 20% B for 1 min and then a linear gradient with a target concentration of 80% B over 20 min was employed.
LC-MS analysis was performed on an Ettan ~,LC-system (Amersham Bioscience) equipped with a Jetstream column heater and a fixed wavelength detector (254nm). A
ThermoFinnigan LCQ DecaXP ESI-MS system with micro-spray source and ion trap detector was coupled online to the HPLC. Oligonucleotide samples (25 ,uL sample, 1 ODImL
concentration in water for unconjugated RNA and 40 ~L for cholesterol-conjugated RNA) were injected onto a Waters Xterra C8 MS column (2.1 x 50 mm; 2.5 ~m particle size) with a flow rate of 200 ~.L/min at 60°C. Composition of eluent A was 400 mM
hexafluoroisopropanol (HFIP), 16.3 mM TEA in HzO, pH 7.9 and eluent B was methanol. For unconjugated RNA
elution started with 7% B for 3 min and then a gradient from 7% B to 25% B in 13 min was used. For cholesterol-conjugated material the starting conditions were 35% B
for 3 min and then the concentration of eluent B was increased to 75% B in 30 min. Analysis figures are provided in Table 6.
5. Annealing of oli~oribonucleotides Complementary strands were annealed by combining equimolar RNA solutions. The mixture was lyophilized and reconstituted with an appropriate volume of annealing buffer (100 mM NaCI, 20 mM sodium phosphate, pH 6.8) to achieve the desired concentration.
This solution was placed into a water bath at 95°C and then cooled to ambient temp.
within 3h. Extent of duplex formation was monitored by native 10% polyacrylamide gel electrophoresis (PAGE) and bands were visualized by staining with the "stains all" reagent (Sigma).
RNA Synthesis using "standard" de~rotection monomers including ribo and 2'-O-methyl phos~horamidites.
A. RNAl2'OMe (Thioate ends) The chimeric RNA molecules with 2'-OMe nucleotides were synthesized on a 394 ABI
machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was CPG (SOOA). The monomers were either RNA
phosphoramidites or 2' OMe RNA phosphoramidites with standard protecting groups and used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated. Specifically the RNA
phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl) phosphoramidite , 5'-O-Dimethoxytrityl-N2-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-0-Dimethoxytrityl-N4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'-O-(,Q-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite; the 2'OMe RNA
phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-methyl-adenosine-3'-O-(,Q-cyanoethyl-N,N'-diisopropyl) phosphoramidite, 5'-O-Dimethoxytrityl-NZ-isobutyryl-2'-O-methyl-guanosine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-methyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-O-methyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min for all monomers. Details of the other reagents are as follows:
Activator: 5-(ethylthio)-1H-tetrazole (0.25M); Cap A: 5% acetic anhydride/THF/pyridine; Cap B: 10% N-methylimidazole/THF. Phosphate oxidation involved THBP (10% in ACN) for 10 min while phosphorothioate oxidation utilized 0.05 M EDITH reagent /acetonitrile.
Detritylation was achieved with 3% TCA/dichloromethane. The DMT protecting group was removed after the last step of the cycle.
After completion of synthesis the controlled pore glass (CPG) was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and simultaneously the base and phosphate groups deprotected with 1.0 mL of a mixture of ethanolic methylamine:ammonia (8 M
methylamine in ethanol/ 30% aq ammonia) (1:1) for 5 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL centrifuge tube; this was followed by washing three times with 0.25 mL of 50% acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 uL of NMP/Bt3N/Et3N-HF and heated at 65°C for l.Sh to remove the TBDMS groups at the 2'-position.
The oligonucleotides were then precipitated in dry diethyl ether (400 uL) containing Et3N (1%). The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual ether was removed in the speed vacuum to give the "crude" RNA as a white fluffy material. Samples were dissolved in 1mL RNase free water and quantitated by measuring absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by HPLC. The crude oligonucleotides were analyzed and purified by Reverse Phase IonPair (RP IP) HPLC. The RP
HPLC analysis was performed on a Gilson LC system, equipped with a fixed wavelength detector (260 and 280 nm), column oven, autosampler and internal degasser. An XTerra C18 column (4.6*250mm) was used at a flow rate of 1.0 mL/min at 65°C. RNA
(20 ~,L for analytical run, 1 mL for a preparative run at 1 OD/mL concentration) was injected. Eluent A contained 0.1 M TEAAc, HPLC water, pH 7.0 and Eluent B was 0.1 M TEAAc in HPLC water, 70%
acetonitrile, pH 7Ø The elution started with 10% B for 2 min, followed by 25% B in 4 min and then a linear gradient with a target concentration of 50% B over another 30 min was employed.
The purified dry oligonucleotides were then desalted using Sephadex G25M .
B. Synthesis of oli~onucleotides with 2'-Fluoro modifications The RNA molecules were synthesized on a 394 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was CPG
(SOOA, TsT AG 001 from AM Chemicals LLC and the rC and rU were from Prime Synthesis).
The monomers were either RNA phosphoramidites or 2' F phosphoramidites with standard protecting groups and used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated. Specifically the RNA phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl) phosphoramidite , 5'-O-Dimethoxytrityl-NZ-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-0-tbutyldimethylsilyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite; the 2'F RNA
phosphoramidites were 5'-O-Dimethoxytrityl-N4-acetyl-2' fluoro-2'-deoxy-cytidine-3'-O-(,~-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2' fluoy~o -2'-deoxy-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min for all monomers. Details of the other reagents are as follows: Activator: 5-ethyl thiotetrazole (0.25 M); Cap A: 5% acetic anhydride/THF/pyridine; Cap B: 10% N-methylimidazole/THF;
phosphate oxidation involved THBP (10% in ACN) for 10 min while phosphorothioate oxidation utilized 0.05 M EDITH reagent/acetonitrile. Detritylation was achieved with 3%
TCA/dichloromethane. The DMT protecting group was removed after the last step of the cycle.
After completion of synthesis, CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic ammonia (1:3) for 7 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube; this was followed by washing three times with 0.25 mL of 50% acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 uL of NMP/Et3N/Et3N-HF and heated at 50°C for 16 h to remove the TBDMS groups at the 2'position.
The oligonucleotides were then precipitated in dry diethyl ether (400 uL) containing Et3N (1 %).
The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual ether was removed in the speed vacuum to give the "crude" RNA as a white fluffy material. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm.
This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by HPLC. The purified dry oligonucleotides were then desalted using Sephadex G25M.
C. Synthesis of phosphorothioate RNA oli~oribonucleotides The oligonucleotides were synthesized on a 394 ABI machine (ALN 0208) using the standard 93 step cycle written by the manufacturer with modiftcations to a few steps as described below. The solid support was controlled pore glass (CPG, 2 .mole rA GPG, 520A, or rU CPG, SOOA). The monomers were RNA phosphoramidites with standard protecting groups used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated.
Specifically the RNA
phosphoramidites were 5'-O-Dimethoxytrityl- N6-benzoyl-2'-O-tbutyldimethylsilyl- adenosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl) phosphoramidite , 5'-O-Dimethoxytrityl-Nz-isobutyryl-2'-O-tbutyldimethylsilyl- guanosine-3'-O-( (~-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl- N4-acetyl-2'-O-tbutyldimethylsilyl- cytidine-3'-O-( ~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min. Details of the other reagents are as follows: activator: 5-ethyl thiotetrazole (0.25M);
Cap A: 5°~o acetic anhydride/THF/pyridine; Cap B:10% N-methylimidazole/THF; PS-oxidation, O.OSM
EDITH
reagent /acetonitrile. Detritylation was achieved with 3% TCA/dichloromethane.
After completion of synthesis the CPG was transferred to a screw cap sterile microfuge tube. The oligonucleotide was cleaved and simultaneously the base and phosphate groups deprotected with 1.0 mL of a mixture of ethanolic methylamine:ammonia (1:1) for 5 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a S mL
centrifuge tube; this was followed by washing with 3 x 0.25 mL of 50%
acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 ~,L of TEA'3HF and heated at 65°C
for 1.5 h to remove the TBDMS groups at the 2'-position. The oligonucleotides were then precipitated by addition of 400 ~,L dry MeOH. The liquid was removed after spinning in a microcentrifuge for 5 minutes on the highest speed available. Residual methanol was removed in speed vacuum. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm. The crude material was stored at -20°C. The oligonucleotides were analyzed and purified by HPLC and then desalted using Sephadex G25M.
Example 9. Synthesis of oli~onucleotides with alternating 2'-F RNA and 2'O-Me RNA
Table 7 A. Synthesis of CPGs for 2'F.
CPGs of 5'-O-DMTr-2'-deoxy-2'-fluororibonucleosides with appropriate base protection were synthesized as shown in Scheme A. 5'-O-DMTr-2'-Deoxy-2'-fluoro-NBZ-A and 5'-O-DMTr-2'-Deoxy-2'-fluoro-N'B°-G were synthesized as reported (Kawasaki et al., J. Med. Chena., 1993, 36, 831). Reaction of compounds 1001 with succinic anhydride in the presence of DMAP
in ethylenedichloride yielded compound 1005. Compound 1005 was treated with 2,2'-dithiobis(5-nitropyridine) (DTNP) and firiphenylphosphine in the presence of DMAP in acetonitrile-ethylenedichloride and subsequently with lcaa CPG as reported by Kumar et al.
(Nucleosides & Nucleotides, 1996, I5, 879) yielded the desired CPG 1009.
Loading of the CPG
was determined as reported in the literature (Prakash et al., J. O>~g. Che~n., 2002, 67, 357). CPGs of suitably protected 2'-deoxy-2'-fluoro A, C and G were obtained as described above (Scheme A).
Scheme Aa: lcaa CPG of 2'-deoxy-2'-F A(NBZ), C(NA~), G(N'B°) and U
DMTrO-i " B DMTrO~B DMTrO~B
OH F HO O F CPG N~O F
O H O
1001 B = U 1005 B = U 1009 B = U; Loading: 97.09 gM/g 1002 B = C(NA~) 1006 B = C(NA°) 1010 B = C(N~°); Loading: 95.30 gM/g 1003 B = A(NBZ) 1007 B = A(Ne~) 1011 B = A(NaZ); Loading: 79.10 ~M/g 2~ 1004 B = G(N'$") 1008 B = G(N'$°) 1012 B = G(N'~"); Loading: 91.13 ~M/g a (i) Succinic anhydride, DMAP/EDC (ii) DTNP, Ph3P, DMAP and lcaa CPG.
The chimeric RNA molecules with alternating 2'-F RNA and 2'O-Me RNA were synthesized on a 394 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support were GPG (SOOA). The monomers were either 2'-F RNA phosphoramidites or 2' OMe RNA phosphoramidites with standard protecting groups and used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated.
Specifically the 2'OMe RNA phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-methyl-adenosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl) phosphorarnidite, 5'-O-Dimethoxytrityl-N2-isobutyryl-2'-O-methyl-guanosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-methyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O~-Dimethoxytrityl-2'-O-methyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The 2'F RNA
phosphoramidites 5'-O-Dimethoxytrityl-N4-acetyl-2'-fluoro-2'-deoxy-cytidine-3'-O-((d-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-2'-fluoro-2'-deoxy-uridine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. 5'-O-Di~nethoxytrityl-2'-fluoro-NZ-isobutyryl-2'-deoxy-guanosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-fluoro- Nz-isobutyryl-2'-deoxy-guanosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min for all monomers.
Details of the other reagents are as follows: Activator: 5-ethyl thiotetrazole (0.25M); Cap A: 5% acetic anhydride/THF/pyridine; Cap B: 10% N-methylimidazole/THF; phosphate oxidation involved 0.02M I2/THF/H20, while PS-oxidation was carried out using EDITH reagent as described above. Detritylation was achieved with 3% TCA/dichloromethane. The final DMT
protecting group was removed in the synthesizer.
After completion of synthesis the CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic:ammonia (1:3) for 7 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube; this was followed by washing three times with 0.25 mL of 5 O% acetonitrile. The tubes were cooled at -80°C for 15 min before drying in a lyophilizer to give the "crude" RNA
as a white fluffy material. Samples were dissolved in 1mL RNase free water and quantitated by measuring the absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by 20% polyacrylimide denaturing gels. The purified dry oligonucleotides were then desalted using Sephadex G25M
(Amersham Biosciences).
B. Anal ~sis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 7 and Figure 30 provides graphs of the activities in HeLa cells for each of the modifications described above.
Example 10 Coniu~ated VEGF molecules (Tables 8, 9, 10 and 18) 1. Synthesis:
The RNA molecules were synthesized on an ABI-394 machine (Applied Biosystems) using the standard 93 step cycle written by the manufacturer with modifications to a few wait steps as described below. The solid support was controlled pore glass (CPG, lumole, 500 A) and the monomers were RNA phosphoramidites with standard protecting groups (5'-O-dimethoxytrityl-N6-benzoyl-2'-O-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-O-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-O-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-O-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite. All amidites were used at a concentration of 0.15M
in acetonitrile (CH3CN) and a coupling time of 6 min for unmodified and 2'-O-Me modified monomers and 12 min for modified and conjugated monomers. 5-ethyl thiotetrazole (0.25M) was used as an activator. For the PO-oxidation Iodine/WaterlPyridine and for PS-oxidation Beaucage reagent (2 %) in anhy. acetonitrile was used. The sulfurization time was about 6 min. All syntheses was performed on a 1 umole scale.
Reagents Concentration Wait or Cou ling ste Activator: 0.25M 5-Ethylthio-1H-tetrazole720 sec PO-oxidation 0.02M Iodine in THF/Water/Pyridine20 sec PO-oxidation 0.02M t-Butyl-hydrogen peroxide600 sec PS-oxidation 2 % Beaucage reagent /anhy.360 Sec (200 Acetonitrile sec, wait +30 sec pulse+130 sec wait Gap A 5% 5%Phenoxyacetic 20 sec anhydride/THF/pyridine Ca B 10% 10% N-methylimidazole/THF20 sec Detritylation 3% TCA Trichloro Acetic Acid 70 sec /dichloromethane The following types of modifications were used to perforrri the synthesis using these protocols:
1. Unmodified phosphodiester backbone (PO) only 2. Phosphorothioate (PS) only 3. 2'-O-Me, PS
4. 3'-Naproxen, 2'F- SMe-U, PS
5. 5'-Cholesterol, PS
6. 3'-Choletserol,PS
7. 2'F- SMe-U, PS
8. 3'-Biotin, 2'F- SMe-U, PS
Such chemical modifications include but are not limited to conjugates, such as ligands for cellular receptors, e.g., peptides derived from naturally occurring protein ligands; protein localization sequences;
antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate, retinoids and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG, e.g. PEG 5 and PEG20);
phospholipids; polyamines, such as spermine or spermidine; and others.
In one embodiment, the iRNA agent includes a duplex molecule selected from the group consisting of AL-DP-4003, AL-DP-4116, AL-DP-4015, AL-DP-4120, AL-DP-4002, AL-DP-4115, AL-DP-4014, AL-DP-4119, AL-DP-4094, AL-DP-4118, AL-DP-4107, AL-DP-4122, AL-DP-4004, AL-DP-4117, AL-DP-4016, AL-DP-4121, AL-DP-4127, AL-DP-4128, AL-DP-4129 , and AL-DP-4055 (see Tables 2 and 3).
In one preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4094, which includes the antisense sequence 5'AAGCUCAUCUCUCCUAUGUGCUG 3' (SEQ
ID N0:609) and the sense sequence 5' GCACAUAGGAGAGAUGAGCUU 3' (SEQ ID
N0:608).
In another preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4004, which includes the antisense sequence 5'CUUUCUUUGGUCUGCAUUCACAU 3' (SEQ
ID N0:635) and the sense sequence 5' GUGAAUGCAGACCAAAGAAAG 3' (SEQ ID
N0:634).
In another preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4015, which includes the antisense sequence 5' GUACUCCUGGAAGAUGUCCTT 3' (SEQ
ID
N0:551) and the sense sequence 5' GGACAUCUUCCAGGAGUACTT 3' (SEQ ID NO:550).
In another preferred embodiment, the iRNA agent includes a duplex described as AL-DP-4055, which includes the antisense sequence 5' UGCAGCCUGGGACCACUUGTT 3' (SEQ
ID
N0:457) and the sense sequence 5' CAAGUGGUCCCAGGCUGCATT 3' (SEQ ID N0:456).
In one embodiment, the antisense sequence of an iRNA agent described herein does not hybridize to an off target sequence. For example, the antisense sequence can have less than 5, 4, 3, 2, or 1 nucleotides complementary to an off target sequence. By "off target" is meant a sequence other than a VEGF nucleotide sequence.
In another embodiment, the sense strand is modified to inhibit off target silencing. The sense strand can include a cholesterol moeity, such as cholesterol attached to the sense strand by a pyrrolidine linker.
In another embodiment, the antisense sequence of an iRNA agent described herein can hybridize to a VEGF sequence in a human and a VEGF sequence in a non-human mammal, e.g., a mouse, rat, or monkey.
In another aspect, the invention provides a method of delivering an iRNA
agent, e.g., an iRNA agent described herein, to the eye of a subject, e.g., a mammalian subject, such as a mouse, a rat, a monkey or a human.
In another aspect, the invention provides a method of delivering an iRNA agent to the eye of a subject, e.g., a mammalian subject, such as a mouse, a rat, a monkey or a human.
In one embodiment, the iRNA agent can be delivered to a cell or cells in a choroid region of the eye. In one preferred embodiment, the iRNA agent down-regulates expression of the VEGF gene at a target site within the eye. An iRNA agent delivered to the eye, e.g., choroid cells of the eye, can be an unmodified iRNA agent.
In one embodiment, the iRNA agent can be stabilized with phosphorothioate linkages. In another embodiment, the 3' end of the sense or antisense sequences, or both, of the iRNA agent can be modified with a cationic group, such as a 3'-abasic cationic modification. The cationic modification can be, e.g., an alkylamino-dT (e.g., a G6 amino-dT), an allylamine, a pyrrolidine, a pthalamido, a hydroxyprolinol, a polyarnine, a cationic peptide, or a cationic amino acid on one or more of the terminal nucleotides of the iRNA agent. The modification can be an external or terminal cationic residue. In preferred embodiments, a pyrrolidine cap is attached to the 3' or S' end of the sense strand, or the 3' end of the antisense strand.
In one embodiment, the sense or antisense sequence, or both, of the iRNA agent can be modified with a sugar, e.g., a glycoconjugate or alkylglycoside component, e.g., glucose, mannose, 2-deoxy-glucose, or an analog thereof. In another embodiment, the iRNA agent can be conjugated to an enzyme substrate, e.g., a substrate for which the relative enzyme is present in a higher amount, as compared to the enzyme level in other tissues of the body, e.g., in tissues other than the eye.
In one embodiment, at least about 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the iRNA agent administered to the subject reaches the eye. In a preferred embodiment, between about 30-90%, 40-80% or 50-70% of the iRNA agent administered to the subject reaches the eye.
In another aspect, the invention features a composition, e.g., a pharmaceutical composition that includes an iRNA agent of the present invention in a pharmaceutically acceptable carrier or diluent. The iRNA agent can be any agent described herein. In one embodiment, the iRNA agent is chemically modified, such as with any chemical modification described herein. Preferred modified iRNA agents includes those provided in Tables 2-19.
In another aspect, the invention features a method for treating or preventing a disease or condition in a subject. The method can include administering to the subject a composition of the invention under conditions suitable for the treatment or prevention of the disease or condition in the subject, alone or in conjunction with one or more other therapeutic compounds.
In one embodiment, the iRNA agent is administered at or near the site of unwanted VEGF
expression, e.g., by a catheter or other placement device (e.g., a retinal pellet or an implant including a porous, non-porous, or gelatinous material). In one embodiment the iRNA agent is administered via an intraocular implant, which can be inserted, for example, into an anterior or posterior chamber of the eye; or into the sclera, transchoroidal space, or an avascularized region exterior to the vitreous. In another embodiment, the implant is positioned over an avascular region, such as on the sclera, so as to allow for transcleral diffusion of the drug to the desired site of treatment, e.g., to the intraocular space and macula of the eye.
Furthermore, the site of transcleral diffusion is preferably in proximity to the macula.
In another embodiment, an iRNA agent is administered to the eye by injection, e.g., by intraocular, retinal, or subretinal injection.
In another embodiment, an iRNA agent is administered topically to the eye, such as by a patch or liquid eye drops, or by iontophoresis. Ointments or droppable liquids can be delivered by ocular delivery systems known in the art such as applicators or eye droppers.
In one embodiment, an iRNA is delivered at or near a site of neovascularization.
In one embodiment, an iRNA agent is administered repeatedly. Administration of an iRNA agent can be carried out over a range of time periods. It can be administered hourly, daily, once every few days, weekly, or monthly. The timing of administration can vary from patient to patient, depending upon such factors as the severity of a patient's symptoms.
For example, an effective dose of an iRNA agent can be administered to a patient once a month for an indefinite period of time, or until the patient no longer requires therapy. In addition, sustained release compositions containing an iRNA agent can be used to maintain a relatively constant dosage in the area of the target VEGF nucleotide sequences.
In another embodiment, an iRNA agent is delivered to the eye at a dosage on the order of about 0.00001 mg to about 3 mg per eye, or preferrably about 0.0001-0.001 mg per eye, about 0.03- 3.0 mg per eye, about 0.1-3.0 mg per eye or about 0.3-3.0 mg per eye.
In another embodiment, an iRNA agent is administered prophylactically such as to prevent or slovc~ the onset of a disorder or condition that affects the eye.
For example, an iRNA
can be administered to a patient who is susceptible to or otherwise at risk for a neovascular disorder.
In one embodiment one eye of a human is treated with an iRNA agent described herein, and in another embodiment, both eyes of a human are treated.
In another aspect, a method of inhibiting VEGF expression is provided. One such method includes administering an effective amount of an iRNA agent of the present invention.
In another aspect, a method of treating adult onset macular degeneration is provided. The method includes administering a therapeutically effective amount of an iRNA
agent of the present invention.
In one embodiment, a human has been diagnosed with dry adult macular degeneration (AMD), and in another embodiment the human has been diagnosed with wet AMD.
In one embodiment, a human treated with an iRNA agent described herein is over the age of 50, e.g., between the ages of 75 and 80, and the human has been diagnosed with adult onset macular degeneration. In another embodiment, a human treated with an iRNA
agent described herein is between the ages of 30-50, and the human has been diagnosed with late onset macular degeneration. In another embodiment, a human treated with an iRNA agent described herein is between the ages of 5-20, and the human has been diagnosed with middle onset macular degeneration. In another embodiment, a human treated with an iRNA agent described herein is 7 years old or younger, and the human has been diagnosed with early onset macular degeneration.
In one aspect, methods of treating any disease or disorder characterized by unwanted VEGF expression are provided. Particularly preferred embodiments include the treatment of disorders of the eye or retina, which are characterized by unwanted VEGF
expression. The disease or disorder can be a diabetic retinopathy, neovascular glaucoma, a tumor or metastic cancer (e.g., colon or breast cancer), a pulmonary disease (e.g., asthma or bronchitis), rheumatoid arthritis, or psoriases. Other angiogenic disorders can be treated by the methods featured in the invention.
In another aspect, the invention features a kit containing an iRNA agent of the invention.
The iRNA agent of the kit can be chemically modified and can be useful for modulating the expression of a VEGF target gene in a cell, tissue or organism. In one embodiment, the kit contains more than one iRNA agent of the invention.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, useful methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the accompanying drawings and description, and from the claims. The contents of all references, pending patent applications and published patents, cited throughout this application are hereby expressly incorporated by reference. In case of conflict, the present specification, including definitions, will control.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 is the nucleotide sequence of the mRNA of the 121 amino acid form of vascular endothelial growth factor, VEGF121. The first nucleotide of the initiator codon is nucleotide 1. The signal peptide is from nucleotide 1 through 78.
FIGURE 2 is a graphical representation of a comparative analysis of the activities of single- and double-overhang siRNAs in ira vitro assays in HeLa cells. Solid lines with filled symbols represent the single-overhang siRNA, solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. The control siRNA
hVEGF is described in Reich et al. (Mol. vis. 9:210, 2003); the control siRNA
hrmVEGF is described in Filleur et al. (Cancer Res. 63:3919, 2003). "L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 3 is a graphical representation of a comparative analysis of the activities of single- and double-overhang siRNAs in ARPE-19 cells. Solid lines with filled symbols represent the single-overhang siRNA; solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. The control siRNA hVEGF is described in Reich et al. (Mol. ~s. 9:210, 2003); the control siRNA hrmVEGF is described in Filleur et al.
(supra). "L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 4 is a graphical representation of a comparative analysis of the siRNAs activities in HeLa cells of single-overhang siRNAs with their analogous blunt siRNAs in which the number of base-paired nucleotides is 21. The control siRNA hVEGF is described in Reich et al.
(Mol. mss. 9:210, 2003); the control siRNA hrmVEGF is described in Filleur et al. (supra).
"L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 5 is a graphical representation of a comparative analysis of the siRNAs activities in HeLa cells of double-overhang siRNAs with their analogous blunt siRNAs in which the number of base-paired nucleotides is 19. The control siRNA hVEGF is described in Reich et al.
(supra); the control siRNA hrmVEGF is described in Filleur et al. (supra).
"L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF
expression.
FIGURE 6A is a graphical representation of the activities of single-overhang and double overhang siRNAs targeting ORF 319 (SEQ ID N0:320) (AL-DP-4002 and AL-DP-4014, respectively) and ORF 343 (SEQ ID N0:344) (AL-DP-4094 and AL-DP-4107, respectively) in cells under normal oxygen (normoxia, 20% oxygen).
FIGURE 6B is a graphical representation of the activities of single-overhang and double overhang siRNAs targeting ORF 319 (SEQ ID N0:320) (AL-DP-4002 and AL-DP-4014, respectively) and ORF 343 (SEQ ID N0:344) (AL-DP-4094 and AL-DP-4107, respectively) in cells under hypoxic conditions (1% oxygen).
FIGURE 6C is a graphical representation of the activities of single-overhang and double overhang siRNAs targeting ORF 319 (SEQ ID N0:320) (AL-DP-4002 and AL-DP-4014, respectively) and ORF 343 (SEQ ID N0:344) (AL-DP-4094 and AL-DP-4107, respectively) in cells under hypoxic conditions (130 ~,M defoxamine).
FIGURE 7 is a graphical representation of the comparative activities of double-overhang (AL-DP-4014) unmodified siRNA and phosphorothioate-modified (AL-DP-4127, AL-DP-4128, AL-DP-4129) siRNAs targeting ORF 319 (SEQ ID N0:320) in HeLa cells. The control siRNA
hVEGF is described in Reich et al. (supra); the control siRNA hrmVEGF is described in Filleur et al. (supra). "L2000" refers to Lipofectamine 2000 reagent. hVEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 8A is a graphical representation of the activities of siRNAs targeting (SEQ ID N0:320) (AL-DP-4014 and AL-DP-4127) and a mutated version AL-DP-4140 (Table 5) in cells under normal oxygen conditions (normoxia, 20% oxygen). The control siRNA CandS
is identical to the hVEGF control of FIGURE. 7 and is described in Reich et al. (supf~a).
"L2000" refers to Lipofectamine 2000 reagent. VEGF expression (y-axis) refers to endogenous VEGF expression.
FIGURE 8B is a graphical representation of the activities of siRNAs targeting (SEQ ID N0:320) (AL-DP-4014 and AL-DP-4127) and a mutated version AL-DP-4140 (Table 5) in cells under normal or hypoxic conditions (hypoxia, 1% Oxygen). The control siRNAs are as described for FIGURE. 8A.
FIGURES 9A-9E are graphical representations of the activities of siRNAs having the sequence ofAL-DP-4094 but differing in the inclusion of nucleotide modifications (see Table 4).
The control siRNA "Acuity" is identical to the CandS control of FIGURE. 8A and the hVEGF
control of FIGURE. 7. The "Filleur" control siRNA is the equivalent of the hrmVEGF control siRNA of FIGURE. 7.
FIGURE 10 is a graphical representation of siRNA silencing activity in vitro in HeLa cells.
FIGURE 11 is an RP-HPLC scan of AL-DP-4094 siRNA following incubation in human serum.
FIGURE 12 is a summary of AL-DP-4094 fragment mapping as determined by LC/MS.
The analysis was performed following incubation of the siRNA in human serum.
FIGURES 13-29 are graphs of silencing activity of 2'-O-methyl and/or 2'-flouro modified siRNAs ifZ vitro in HeLa cells (Table 6).
FIGURE 30 are graphs of silencing activity of alternating 2'-O-methyl and 2'-flouro modified siRNAs iya vitro in HeLa cells (Table 7).
FIGURES 31-33 are graphs of silencing activity of cholesterol and colonic conjugated siRNAs ih viti°o in HeLa cells (Table 8).
FIGURE 34 is a graph of silencing activity of naproxen conjugated siRNAs in vitro in HeLa cells (Table 9).
FIGURE 35 is a graph of silencing activity of biotin conjugated siRNAs ifz vitro in HeLa cells (Table 10).
FIGURE 36 is a graph of silencing activity of 5'-retinal conjugated 51RNAS ifa VatYO In HeLa cells (Table 11).
FIGURE 37 is a graph of silencing activity of ribo-diflourotoluyl modified siRNAs ire vitro in HeLa cells (Table 13).
FIGURE 38 is a graph of silencing activity of 2'-arafluoro-2'deoxy-nucleoside modified siRNAs in vitro in HeLa cells (Table 14).
FIGURE 39 5'-O-DMTr-2'-deoxy-2'-fluoro A, C, G and U CPG supports for oligonucleotide synthesis. These supports were used for syntheses of selected sequences listed Tables 6 and 7.
FIGURE 40 Cholesterol and 5~3-cholanic (or cholanic) acid conjugate building blocks for conjugation to oligonucleotides. These building blocks were used for syntheses of selected sequences listed in Table 8.
FIGURE 41 SMeC and SMeU RNA building blocks for oligonucleotide synthesis.
These building blocks were used for syntheses of selected sequences listed in Table 8.
FIGURE 42. Naproxen - tf°afas-4- hydroxy-L-prolinol and naproxen-serinol building blocks for conjugation to oligonucleotides. These building blocks were used for syntheses of selected sequences listed in Table 9.
FIGURE 43 Biotin - trayas-4- hydroxy-L-prolinol and biotin-serinol building blocks for conjugation to oligonucleotides. These building blocks were used for syntheses of selected sequences listed in Table 10.
FIGURE 44 Building blocks for post-synthetic conjugation - Oxime approach.
These building blocks were/are used for syntheses of selected sequences listed in Table 11.
FIGURE 45 Building blocks for post-synthetic conjugation -Active ester approach.
These building blocks were used for syntheses of selected sequences listed in Table 12.
FIGURE 46 DFT amidite and CPG for oligonucleotide synthesis. These building blocks were used for syntheses of selected sequences listed in Table 13.
FIGURE 47 2'-Deoxy-2'-araf amidite for oligonucleotide synthesis. These building blocks were used for syntheses of selected sequences listed in Table 14.
FIGURE 48 P-methylphosphonamidite of ribo SMeU and ribo C(NA°). These building blocks were used for syntheses of selected sequences listed in Table 15.
FIGURE 49 CS-aminoallyl U amidite. These building blocks were used for syntheses of selected sequences listed in Table 16.
FIGURE 50 Thiocholesterol conjugate building blocks.
BRIEF DESCRIPTION OF THE TABLES
Table 1 provides the sequences in the VEGF gene that are targeted by the agents of the present invention. These sequence can also be the sense strand of some of the iRNA agents of the present invention.
Table 2 provides 123 iRNA duplexes that target the VEGF gene, the target sequence in the VEGF gene and activity data that is described in the Examples.
Table 3 provides iRNA duplexes that are modified to contain phosphorothioate stabilizations and activity data that is described in the Examples.
Table 4 provides iRNA duplexes based on the AL-DP-4094 duplex that are modified for stabilization and activity data that is described in the Examples.
Table 5 provides iRNA duplexes activity data in HeLa cells for several iRNA
agents of the present invention.
Table 6 provides iRNA agents with activity data in HeLa cells for agents containing one or more phosporothioate, 2'-O-methyl and 2'-fluoro modifications.
Table 7 provides iRNA agents with activity data in HeLa cells for agents containing alternating 2'-O-methyl and 2'-fluoro modifications.
Table 8 A and B provides iRNA agents with activity data in HeLa cells for agents containing cholesterol or cholanic acid conjugates.
Table 9 provides iRNA agents with activity data in HeLa cells for agents containing naproxen conjugates.
Table 10 provides iRNA agents with activity data in HeLa cells for agents containing biotin conjugates.
Table 11 provides iRNA agents containing aldehydes, retinal and other retinoid conjugates.
Table 12 provides iRNA agents containing polyethylene glycol conjugates.
Table 13 provides iRNA agents with activity data in HeLa cells for agents containing ribo-difluorotoluyl modifications.
Table 14 provides iRNA agents with activity data in HeLa cells for agents containing 2'-arafluoro-2'-deoxy-nucleoside modifications.
Table 15 provides iRNA agents containing methylphosphonate modifications.
Table 16 provides iRNA agents containing C-5 allyamino modifications.
Table 17 provides iRNA agents containing a variety and combinations of the modifications as noted in the Table.
Table 18 provides physical characterization of iRNA agents containing a variety and combinations of the modifications as noted in the Table.
DETAILED DESCRIPTION
Double-stranded (dsRNA) directs the sequence-specific silencing of mRNA
through a process known as RNA interference (RNAi). The process occurs in a wide variety of organisms, including mammals and other vertebrates.
It has been demonstrated that 21-23 nt fragments of dsRNA are sequence-specific mediators of RNA silencing, e.g., by causing RNA degradation. While not wishing to be bound by theory, it may be that a molecular signal, which may be merely the specific length of the fragments, present in these 21-23 nt fragments recruits cellular factors that mediate RNAi.
Described herein are methods for preparing and administering these 21-23 nt fragments, and other iRNAs agents, and their use for specifically inactivating gene function.
The use of iRNA
agents (or recombinantly produced or chemically synthesized oligonucleotides of the same or similar nature) enables the targeting of specific mRNAs for silencing in mammalian cells. In addition, longer dsRNA agent fragments can also be used, e.g., as described below.
Although, in mammalian cells, long dsRNAs can induce the interferon response, which is frequently deleterious, siRNAs do not trigger the interferon response, at least not to an extent that is deleterious to the cell and host. In particular, the length of the sense and antisense sequences in an iRNA agent can be less than 31, 30, 28, 25, or 23 nt, e.g., sufficiently short to avoid inducing a deleterious interferon response. Thus, the administration of a composition of iRNA agents (e.g., formulated as described herein) to a mammalian cell can be used to silence expression of a target gene while circumventing the interferon response.
Further, use of a discrete species of iRNA agent can be used to selectively target one allele of a target gene, e.g., in a subject heterozygous for the allele.
The target-complementary sequence (the antisense sequence) of an iRNA agent, such as an iRNA duplex, can have a 5' phosphate and ATP may be utilized to maintain the 5'- phosphate moiety on the siRNA (Nykanen et al., Cell 107:309, 2001); however, iRNA agents lacking a 5'-phosphate have been shown to be active when introduced exogenously, suggesting that 5'-phosphorylation of siRNA constructs may occur irZ vivo.
Vascular endothelial growth factor (VEGF) VEGF, also known as vascular permeability factor, is an angiogenic growth factor. VEGF is a homodimeric 45 kDa glycoprotein that exists in at least three different isoforms. VEGF isoforms are expressed in endothelial cells_ The VEGF gene contains 8 exons that express a 1 ~9-amino acid protein isoform. A
165-amino acid isoform lacks the residues encoded by exon 6, whereas a 121-amino acid isoform lacks the residues encoded by exons 6 and 7. VEGF145 is an isoform predicted to contain 145 amino acids and to lack exon 7.
VEGF can act on endothelial cells by binding to an endothelial tyrosine kinase receptor, such as Flt-1 (VEGFR-1) or KDR/flk-1 (VEGFR-2). VEGFR-2 is expressed in endothelial cells and is involved in endothelial cell differentiation and vasculogenesis. A
third receptor, VEGFR-3 has been implicated in lymphogenesis.
The various isoforms have different biologic activities and clinical implications. For example, VEGF145 induces angiogenesis and like VEGF189 (but unlike VEGF165) binds efficiently to the extracellular matrix by a mechanism that is not dependent on extracellular matrix-associated heparin sulfates. The mRNA corresponding to the coding sequence of human VEGF121 (Genbank Accession Number AF214570, SEQ ID NO:1) is shown in FIG 1.
VEGF
displays activity as an endothelial cell mitogen and chemoattractant ifa vitf°o and induces vascular permeability and angiogenesis in vivo. VEGF is secreted by a wide variety of cancer cell types and promotes the growth of tumors by inducing the development of tumor-associated vasculature. Inhibition of VEGF function has been shown to limit both the growth of primary experimental tumors as well as the incidence of metastases in immunocompromised mice.
VEGF is also expressed at abnormally high levels in inflammatory diseases such as rheumatoid arthritis and psoriasis, and is involved in the inflammation, airway and vascular remodeling that occurs during asthmatic episodes. Elevated VEGF expression is also correlated with several forms of ocular neovascularization that often lead to severe vision loss, including diabetic retinopathy, retinopathy of prematurity, and macular degeneration.
iRNA Agents An "RNA agent," as used herein, is an unmodified RNA, modified RNA, or nucleoside surrogate. Preferred examples include those which have greater resistance to nuclease degradation than do unmodified RNAs. Preferred examples include those which have a 2' sugar modification, a modification in a single strand overhang, preferably a 3' single strand overhang, or, particularly if single stranded, a 5' modification which includes one or more phosphate groups or one or more analogs of a phosphate group.
An "iRNA agent," as used herein, is an RNA agent which can, or which can be cleaved into an RNA agent which can, down regulate the expression of a target gene, preferably an endogenous or pathogen target RNA. While not wishing to be bound by theory, an iRNA agent may act by one or more of a number of mechanisms, including post-transcriptional cleavage of a target mRNA sometimes referred to in the art as RNAi, or pre-transcriptional or pre-translational mechanisms. An iRNA agent can include a single strand or can include more than one strands, e.g., it can be a double stranded iRNA agent. If the iRNA agent is a single strand it is particularly preferred that it include a 5' modification which includes one or more phosphate groups or one or more analogs of a phosphate group.
The iRNA agent should include a region of sufficient homology to the target gene, and be of sufficient length in terms of nucleotides, such that the iRNA agent, or a fragment thereof, can mediate down regulation of the target gene. (For ease of exposition the term nucleotide or ribonucleotide is sometimes used herein in reference to one or more monomeric subunits of an RNA agent. It will be understood herein that the usage of the term "ribonucleotide" or "nucleotide," herein can, in the case of a modified RNA or nucleotide surrogate, also refer to a modified nucleotide, or surrogate replacement moiety at one or more positions.) Thus, the iRNA
agent is or includes a region which is at least partially, and in some embodiments fully, complementary to the target RNA. It is not necessary that there be perfect complementarity between the iRNA agent and the target, but the correspondence must be sufficient to enable the iRNA agent, or a cleavage product thereof, to direct sequence specific silencing, e.g., by RNAi cleavage of the target RNA, e.g., mRNA.
Complementarity, or degree of homology with the target strand, is most critical in the antisense strand. While perfect complementarity, particularly in the antisense strand, is often desired some embodiments can include, particularly in the antisense strand, one or more but preferably 6, 5, 4, 3, 2, or fewer mismatches (with respect to the target RNA). The mismatches, particularly in the antisense strand, are most tolerated in the terminal regions and if present are preferably in a terminal region or regions, e.g., within 6, 5, 4, or 3 nucleotides of the 5' and/or 3' terminus. The sense strand need only be sufficiently complementary with the antisense strand to maintain the overall double strand character of the molecule.
Single stranded regions of an iRNA agent will often be modified or include nucleoside surrogates, e.g., the unpaired region or regions of a hairpin structure, e.g., a region which links two complementary regions, can have modifications or nucleoside surrogates.
Modification to stabilize one or more 3'- or 5'-terminus of an iRNA agent, e.g., against exonucleases, or to favor the antisense sRNA agent to enter into RISC are also favored. Modifications can include C3 (or C6, C7, C12) amino linkers, thiol linkers, carboxyl linkers, non-nucleotidic spacers (C3, C6, C9, C12, abasic, triethylene glycol, hexaethylene glycol), special biotin or fluorescein reagents that come as phosphoramidites and that have another DMT protected hydroxyl group, allowing multiple couplings during RNA synthesis.
iRNA agents include: molecules that are long enough to trigger the interferon response (which can be cleaved by Dicer (Bernstein et al., Nature 409:363-366, 2001)) and enter a RISC
(RNAi-induced silencing complex); and molecules that are sufficiently short that they do not trigger the interferon response (which molecules can also be cleaved by Dicer and/or enter a RISC), e.g., molecules which are of a size which allows entry into a RISC, e.g., molecules which resemble Dicer-cleavage products. Molecules that are short enough that they do not trigger an interferon response are termed sRNA agents or shorter iRNA agents herein.
"sRNA agent or shorter iRNA agent" as used herein, refers to an iRNA agent, e.g., a double stranded RNA agent or single strand agent, that is sufficiently short that it does not induce a deleterious interferon response in a human cell, e.g., it has a duplexed region of less than 60 but preferably less than 50, 40, or 30 nucleotide pairs. The sRNA agent, or a cleavage product thereof, can down regulate a target gene, e.g., by inducing RNAi with respect to a target RNA, preferably an endogenous or pathogen target RNA.
Each strand of a sRNA agent can be equal to or less than 30, 25, 24, 23, 22, 21, or 20 nucleotides in length. The strand is preferably at least 19 nucleotides in length. For example, each strand can be between 21 and 25 nucleotides in length. Preferred sRNA
agents have a duplex region of 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs, and one or more overhangs, preferably one or two 3' overhangs, of 2- 3 nucleotides.
A "single strand iRNA agent" as used herein, is an iRNA agent which is made up of a single molecule. It may include a duplexed region, formed by intra-strand pairing, e.g., it may be, or include, a hairpin or pan-handle structure. Single strand iRNA agents are preferably antisense with regard to the target molecule. In preferred embodiments single strand iRNA
agents are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus. 5'-phosphate modifications include those which are compatible with RISC mediated gene silencing.
Suitable modifications include: 5'-monophosphate ((HO)2(O)P-O-5'); 5'-diphosphate ((HO)2(O)P-O-P(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5');
5'-guanosine cap (7-methylated or non-methylated) (7m-G-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P-O-5'); 5'-monodithiophosphate (phosphorodithioate;
(HO)(HS)(S)P-O-5'), 5'-phosphorothiolate ((HO)2(O)P-S-5'); any additional combination of oxygenlsulfur replaced rnonophosphate, diphosphate and triphosphates (e.g. 5'-alpha thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)P-O-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g.
RP(OH)(O)-O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates (R=alkylether-methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(O)-O-5'-). (These modifications can also be used with the antisense strand of a double stranded iRNA.) A single strand iRNA agent should be sufficiently long that it can enter the RISC and participate in RISC mediated cleavage of a target mRNA. A single strand iRNA
agent is at least 14, and more preferably at least 15, 20, 25, 29, 35, 40, or 50 nucleotides in length. It is preferably less than 200, 100, or 60 nucleotides in length.
Hairpin iRNA agents will have a duplex region equal to or at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide pairs. The duplex region will preferably be equal to or less than 200, 100, or 50, in length. Preferred ranges for the duplex region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length. The hairpin will preferably have a single strand overhang or terminal unpaired region, preferably the 3', and preferably of the antisense side of the hairpin.
Preferred overhangs are 2-3 nucleotides in length.
A "double stranded (ds) iRNA agent" as used herein, is an iRNA agent which includes more than one, and preferably two, strands in which interchain hybridization can form a region of duplex structure.
Other suitable modifications to a sugar, base, or backbone of an iRNA agent are described in co-owned PCT Application No. PCT/LTS2004/Ol 193, filed January 16, 2004. An iRNA agent can include a non-naturally occurnng base, such as the bases described in co-owned PCT Application No. PCT/US2004/Ol 1822, filed April 16, 2004. An iRNA agent can include a non-naturally occurring sugar, such as a non-carbohydrate cyclic carrier molecule. Exemplary features of non-naturally occurring sugars for use in iRNA agents are described in co-owned PCT Application No. PCT/US2004/11829 filed April 16, 2003.
An iRNA agent can include an internucleotide linkage (e.g., the chiral phosphorothioate linkage) useful for increasing nuclease resistance. In addition, or in the alternative, an iRNA
1 S agent can include a ribose mimic for increased nuclease resistance.
Exemplary internucleotide linkages and ribose mimics for increased nuclease resistance are described in co-owned PGT
Application No. PCT/US2004/07070 filed on March 8, 2004.
An iRNA agent can have a ZXY structure, such as is described in co-owned PCT
Application No. PCT/LTS2004/07070 filed on March 8, 2004.
An iRNA agent can be complexed with an amphipathic moiety. Exemplary amphipathic moieties for use with iRNA agents are described in co-owned PCT Application No. PCT/US2004/07070 filed on March 8, 2004.
In another embodiment, the iRNA agent can be complexed to a delivery agent that features a modular complex. The complex can include a carrier agent linked to one or more of (preferably two or more, more preferably all three of): (a) a condensing agent (e.g., an agent capable of attracting, e.g., binding, a nucleic acid, e.g., through ionic or electrostatic interactions); (b) a fusogenic agent (e.g., an agent capable of fusing and/or being transported through a cell membrane); and (c) a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type. iRNA
agents complexed to a delivery agent are described in co-owned PCT Application No.
PCT/US2004/07070 filed on March 8, 2004.
An iRNA agent can have non-canonical pairings, such as between the sense and antisense sequences of the iRNA duplex. Exemplary features of non-canonical iRNA agents are described in co-owned PCT Application No. PGT/LTS2004/07070 filed on March 8, 2004.
Many of these types of modifications are provided in the Examples and are described in Tables 3-18.
Design of iRNA
The present invention is based on a gene walk of the VEGF gene to identify active iRNA
agents that can be used to reduce the level of VEGF mRNA in a cell. Not all potential iRNA
agent sequences in the VEGF gene are active, many of which also having significant off target effects. The present invention advances the art by selecting those sequences which are active and do not have significant off target effects. Further, the sequence chosen for the iRNA agents of the present invention are conserved amongst multiple species allowing one to use a single agent for animal and toxicological studies as well as using it for therapeutic purposes in humans.
Based on these results, the invention specifically provides an iRNA agent that can be used in treating VEGF mediated disorders, particularly in the eye such as AMD, in isolated form and as a pharmaceutical composition described below. Such agents will include a sense strand having at least 15 or more contiguous nucleotides that are complementary to the VEGF gene and an antisense strand having at least 15 or more contiguous nucleotides that are complementary to the sense strand sequence. Particularly useful are iRNA agents that have a sense strand that comprises, consist essentially of or consists of a nucleotide sequence provided in Table 1, such as those agents proved in Table 2, or any of the modifications provided in Tables 3-18.
Candidate iRNA agents can be designed by performing, as done herein, a gene walk analysis of the VEGF gene that will serve as the iRNA target. Overlapping, adjacent, or closely spaced candidate agents corresponding to all or some of the transcribed region can be generated and tested. Each of the iRNA agents can be tested and evaluated for the ability to down regulate the target gene expression (see below, "Evaluation of Candidate iRNA agents").
Preferably, the iRNA agents of the present invention are based on and comprise at least 15 or more contiguous nucleotides from one of the iRNA agents shown to be active in Table 2, or the modified sequences provided in Tables 3-18. In such agents, the agent can comprise, consist of or consist essentially of the entire sequence provided in the Table or can comprise 15 or more contiguous residues along with additional nucleotides from contiguous regions of the target gene.
An iRNA agent can be rationally designed based on sequence information and desired characteristics and the information of the target sequence provided in Table 1. For example, an iRNA agent can be designed according to the relative melting temperature of the candidate duplex. Generally, the duplex should have a lower melting temperature at the 5' end of the antisense strand than at the 3' end of the antisense strand.
Accordingly, the present invention provides iRNA agents comprising a sense strand and antisense strand each comprising a sequence of at least 15, 16, 17, 18, 19, 20, 21 or 23 nucleotides which is essentially identical to one of the agents provided in Table 1 or 2.
The antisense strand of an iRNA agent should be equal to or at least, 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in length. It should be equal to or less than 50, 40, or 30, nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides in length. Exemplified iRNA agents include those that comprise 15 or more nucleotides from one of the agents in Table 2 (or are complementary to the target sequence provided in Table 1) but are not longer than 25 nucleotides in length.
The sense strand of an iRNA agent should be equal to or at least 15, 16 17, 18, 19, 25, 29, 40, or 50 nucleotides in length. It should be equal to or less than 50, 40, or 30 nucleotides in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides in length.
Exemplified iRNA agents include those that comprise 15 or more nucleotides from one of the agents in Table 2 (or the target sequence in Table 2) but are not longer than 25 nucleotides in length.
The double stranded portion of an iRNA agent should be equal to or at least, 15, 16 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 50 nucleotide pairs in length. It should be equal to or less than 50, 40, or 30 nucleotides pairs in length. Preferred ranges are 15-30, 17 to 25, 19 to 23, and 19 to 21 nucleotides pairs in length.
The agents provided in Table 2 are 23 nucleotides in length for each strand.
The iRNA
agents contain a 21 nucleotide double stranded region with a 2 nucleotide overhang on each of the 3' ends of the agent. These agents can be modified as described herein to obtain equivalent agents comprising at least a portion of these sequences (15 or more contiguous nucleotides) and or modifications to the oligonucleotide bases and linkages. Particularly preferred are the modification and agents provided in Tables 3-18.
Generally, the iRNA agents of the instant invention include a region of sufficient complementarity to the VEGF gene and are of sufficient length in terms of nucleotides that the iRNA agent, or a fragment thereof, can mediate down regulation of the VEGF
gene. The antisense strands of the iRNA agents of the present invention are preferably fully complementary to the mRNA sequences of VEGF gene. However, it is not necessary that there be perfect complementarity between the iRNA agent and the target, but the correspondence must be sufficient to enable the iRNA agent, or a cleavage product thereof, to direct sequence specific silencing, e.g., by RNAi cleavage of a VEGF mRNA.
Therefore, the iRNA agents of the instant invention include agents comprising a sense strand and antisense strand each comprising a sequence of at least 16, 17 or 18 nucleotides which is essentially identical, as defined below, to one of the sequences of the VEGF gene, such as those agent provided in Table 2, except that not more than 1, 2 or 3 nucleotides per strand, respectively, have been substituted by other nucleotides (e.g. adenosine replaced by uracil), while essentially retaining the ability to inhibit VEGF expression. These agents will therefore possess at least 15 or more nucleotides identical to the VEGF gene but 1, 2 or 3 base mismatches with respect to either the VEGF mRNA sequence or between the sense and antisense strand are introduced. Mismatches to the target VEGF mRNA sequence, particularly in the antisense strand, are most tolerated in the terminal regions and if present are preferably in a terminal region or regions, e.g., within 6, 5, 4, or 3 nucleotides of a 5' and/or 3' terminus, most preferably within 6, 5, 4, or 3 nucleotides of the 5'-terminus of the sense strand or the 3'-terminus of the antisense strand. The sense strand need only be sufFciently complementary with the antisense strand to maintain the overall double stranded character of the molecule.
It is preferred that the sense and antisense strands be chosen such that the iRNA agent includes a single strand or unpaired region at one or both ends of the molecule, such as those exemplified in Table 2 (as well as Tables 3-18). Thus, an iRNA agent contains sense and antisense strands, preferably paired to contain an overhang, e.g., one or two 5' or 3' overhangs but preferably a 3' overhang of 2-3 nucleotides. Most embodiments will have a 3' overhang.
Preferred siRNA agents will have single-stranded overhangs, preferably 3' overhangs, of 1 to 4, or preferably 2 or 3 nucleotides, in length, on one or both ends of the iRNA
agent. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. 5'-ends are preferably phosphorylated.
Preferred lengths for the duplexed region is between 15 and 30, most preferably 18, 19, 20, 21, 22, and 23 nucleotides in length, e.g., in the siRNA agent range discussed above.
Embodiments in which the two strands of the siRNA agent are linked, e.g., covalently linked are also included. Hairpin, or other single strand structures which provide the required double stranded region, and preferably a 3' overhang are also within the invention.
Synthesis of iRNA Ageyats Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) can be synthesized using protocols known in the art, for example as described in Caruthers et al., Methods ifa Erzzymology 211:3, 1992;
Thompson et al., International PCT Publication No. WO 99/54459; Wincott et al., Nucleic Acids Res. 23:2677, 1995; Wincott et al., Methods Mol. Bio. 74:59, 1997; Brennan et al., Biotechfaol.
Bioe~ag. 61:33, 1998; and Brennan, U. S. Pat. No. 6,001,311. All of these references are incorporated herein by reference. The synthesis of oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
The method of synthesis used for RNA including certain iRNA agents of the invention follows the procedure as described in Usman et al., J. Claern. Soc. 109:7845, 1987; Scaringe et al., Nucleic Acids Res. 18:5433, 1990; Wincott et al., Nucleic Aciels Res.
23:2677, 1995; and Wincott et al., Methods Mol. Bio. 74:59, 1997; and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
Detailed descriptions of a variety of synthetic methods to produce modified iRNA agents are provided in the Examples.
Alternatively, the nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., Science 256:9923, 1992; Draper et al., International PCT publication No. WO 93/23569;
Shabarova et al., Nucleic Acids Res. 19:4247, 1991; Bellon et al., Nucleosides &
Nucleotides 16:951, 1997;
Bellon et al., Biocohjugate 8:204, 1997), or by hybridization following synthesis and/or deprotection.
An iRNA agent can also be assembled from two distinct nucleic acid sequences or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the iRNA agent.
iRNA agents can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, 2'- C-allyl, 2'-fluoro, diflurortoluyl, 5-allyamino-pyrimidines, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren, Trends in Bioclaem. Sci. 17:34, 1992). iRNA constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al., supra, the totality of which is hereby incorporated herein by reference) and re-suspended in water.
In another aspect of the invention, iRNA agents can be expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. iRNA agent-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the iRNA agents can be delivered as described herein, and persist in target cells.
Alternatively, viral vectors can be used that provide for transient expression of iRNA agents.
Evaluating iRNA agents Any of the iRNA agents described herein can be evaluated and modified as follows.
An iRNA agent may be susceptible to cleavage by an endonuclease or exonuclease, such as when the iRNA agent is introduced into the body of a subject. Methods can be used to determine sites of cleavage, e.g., endo- and exonucleolytic cleavage on an iRNA agent and to determine the mechanism of cleavage. An iRNA agent can be modified to inhibit such cleavage.
2~
A dsRNA, e.g., an iRNA agent, can be evaluated to identify sites that are susceptible to modification, particularly cleavage, e.g., cleavage by a component found in the body of a subject.
The component can be specific for a particular area of the body, such as a particular tissue, organ, or bodily fluid (e.g., blood, plasma, or serum). Sites in an iRNA agent that are susceptible to cleavage, either by endonucleolytic or exonucleolytic cleavage, in certain areas of the body, may be resistant to cleavage in other areas of the body.
A method for evaluating an iRNA agent can include: (1) determining the point or points at which a substance present in the body of a subject, and preferably a component present in a compartment of the body into which a therapeutic dsRNA is to be introduced (this includes compartments into which the therapeutic is directly introduced, e.g., the circulation, as well as in compartments to which the therapeutic is eventually targeted, e.g, the liver or kidney; in some cases, e.g, the eye, the two are the same), cleaves a dsRNA, e.g., an iRNA
agent; and (2) identifying one or more points of cleavage, e.g., endonucleolytic, exonucleolytic, or both, in the dsRNA. Optionally, the method further includes providing an RNA (e.g., an iRNA
agent) modified to inhibit cleavage at such sites.
The steps described above can be accomplished by using one or more of the following assays:
(i) (a) contacting a candidate dsRNA, e.g., an iRNA agent, with a test agent (e.g., a biological agent), (b) using a size-based assay, e.g., gel electrophoresis to determine if the iRNA
agent is cleaved. In a preferred embodiment a time course is taken and a number of samples incubated for different times are applied to the size-based assay. In preferred embodiments, the candidate dsRNA is not labeled. The method can be a "stains all" method.
(ii) (a) supplying a candidate dsRNA, e.g., an iRNA agent, which is radiolabeled;
(b) contacting the candidate dsRNA with a test agent, (c) using a size-based assay, e.g., gel electrophoresis to determine if the iRNA
agent is cleaved. In a preferred embodiment, a time course is taken where a number of samples are incubated for different times and applied to the size-based assay. In preferred embodiments the determination is made under conditions that allow determination of the number of nucleotides present in a fragment. For example, an incubated sample is run on a gel having markers that allow assignment of the length of cleavage products. The gel can include a standard that is a "ladder" digestion. Either the sense or antisense strand can be labeled. Preferably only one strand is labeled in a particular experiment. The label can be incorporated at the 5' end, 3' end, or at an internal position. Length of a fragment (and thus the point of cleavage) can be determined from the size of the fragment based on the ladder and mapping using a site-specific endonuclease such as RNAse T1.
(iii) Fragments produced by any method, e.g., one described herein, e.g., one of those above, can be analyzed by mass spectrometry. Following contacting the iRNA
with the test agent, the iRNA can be purified (e.g., partially purified), such as by phenol-chloroform extraction followed by precipitation. Liquid chromatography can then be used to separate the fragments and mass spectrometry can be used to determine the mass of each fragment. This allows determination of the mechanism of cleavage, e.g., if by direct phosphate cleavage, such as by 5' or 3' exonuclease cleavage, or mediated by the 2'OH via formation of a cyclic phosphate.
In another embodiment, the information relating to a site of cleavage is used to select a backbone atom, a sugar or a base, for modification, e.g., a modification to decrease cleavage.
Exemplary modifications include modifications that inhibit endonucleolytic degradation, including the modifications described herein. Particularly favored modifications include:
2' modification, e.g., a 2'-O-methylated nucleotide or 2'-deoxy nucleotide (e.g., 2'deoxy-cytodine), or a 2°-fluoro, difluorotoluyl, 5-Me-2'-pyrimidines, 5-allyamino-pyrimidines, 2'-O-methoxyethyl, 2'-hydroxy, or 2'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), or cyclohexene nucleic acid (CeNA). In one embodiment, the 2' modification is on the uridine of at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide, at least one 5'-uridine-guanine-3' (5'-UG-3') dinucleotide, at least one 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, or at least one 5'-uridine-cytidine-3' (5'-UC-3') dinucleotide, or on the cytidine of at least one 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide, at least one 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, or at least one 5'-cytidine-uridine-3' (5'-CU-3') dinucleotide. The 2' modification can also be applied to all the pyrimidines in an iRNA agent. In one preferred embodiment, the 2' modification is a 2'OMe modification on the sense strand of an iRNA agent. In a more preferred embodiment the 2' modification is a 2' fluoro modification, and the 2' fluoro is on the sense or antisense strand or on both strands.
Modification of the backbone, e.g., with the replacement of an O with an S, in the phosphate backbone, e.g., the provision of a phosphorothioate modification can be used to inhibit endonuclease activity. In some embodiments, an iRNA agent has been modified by replacing one or more ribonucleotides with deoxyribonucleotides. Preferably, adjacent deoxyribonucleotides are joined by phosphorothioate linkages, and the iRNA
agent does not include more than four consecutive deoxyribonucleotides on the sense or the antisense strands.
Replacement of the U with a CS amino linker; replacement of an A with a G
(sequence changes are preferred to be located on the sense strand and not the antisense strand);
or modification of the sugar at the 2', 6', 7', or 8' position can also inhibit endonuclease cleavage of the iRNA
agent. Preferred embodiments are those in which one or more of these modifications are present on the sense but not the antisense strand, or embodiments where the antisense strand has fewer of such modifications.
Exemplary modifications also include those that inhibit degradation by exonucleases.
Examples of modifications that inhibit exonucleolytic degradation can be found herein. In one embodiment, an iRNA agent includes a phosphorothioate linkage or P-alkyl modification in the linkages between one or more of the terminal nucleotides of an iRNA agent. In another embodiment, one or more terminal nucleotides of an iRNA agent include a sugar modification, e.g., a 2' or 3' sugar modification. Exemplary sugar modifications include, for example, a 2'-O-methylated nucleotide, 2'-deoxy nucleotide (e.g., deoxy-cytodine), 2'-deoxy-2'-fluoro (2'-F) nucleotide, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-N-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethlyoxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-AP), 2'-hydroxy nucleotide, or a ~'-ara-fluoro nucleotide, or a locked nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), or cyclohexene nucleic acid (CeNA). A 2' modification is preferably 2'OMe, more preferably, 2'fluoro.
The modifications described to inhibit exonucleolytic cleavage can be combined onto a single iRNA agent. For example, in one embodiment, at least one terminal nucleotide of an iRNA agent has a phosphorothioate linkage and a 2' sugar modification, e.g., a 2'F or 2'OMe modification. In another embodiment, at least one terminal nucleotide of an iRNA agent has a 5' Me-pyrimidine and a 2' sugar modification, e.g., a 2'F or 2'OMe modification.
To inhibit exonuclease cleavage, an iRNA agent can include a nucleobase modification, such as a cationic modification, such as a 3'-abasic cationic modification.
The cationic modification can be, e.g., an alkylamino-dT (e.g., a C6 amino-dT), an allylamino conjugate, a pyrrolidine conjugate, a pthalamido or a hydroxyprolinol conjugate, on one or more of the terminal nucleotides of the iRNA agent. An alkylamino-dT conjugate is preferably attached to the 3' end of the sense or antisense strand of an iRNA agent. A pyrrolidine linker is preferably attached to the 3' or 5' end of the sense strand, or the 3' end of the antisense strand. An allyl amine uridine is preferably on the 3' or 5' end of the sense strand, and not on the 5' end of the antisense strand.
In another embodiment, the iRNA agent includes a conjugate on one or more of the terminal nucleotides of the iRNA agent. The conjugate can be, for example, a lipophile, a terpene, a protein binding agent, a vitamin, a carbohydrate, a retiniod, or a peptide. For example, the conjugate can be naproxen, nitroindole (or another conjugate that contributes to stacking interactions), folate, ibuprofen, cholesterol, retinoids, PEG, or a CS
pyrimidine linker. In other embodiments, the conjugates are glyceride lipid conjugates (e.g. a dialkyl glyceride derivatives), vitamin E conjugates, or thio-cholesterols. Preferably, conjugates are on the 3' end of the antisense strand, or on the 5' or 3' end of the sense strand, and preferably the conjugates are not on the 3' end of the antisense strand and on the 3' end of the sense strand.
In one embodiment, the conjugate is naproxen, and the conjugate is preferably on the 5' or 3' end of the sense or antisense strands. In one embodiment, the conjugate is cholesterol, and the conjugate is preferably on the 5' or 3' end of the sense strand and preferably not present on the antisense strand. In some embodiments, the cholesterol is conjugated to the iRNA agent by a pyrrolidine linker, or serinol linker, aminooxy, or hydroxyprolinol linker. In other embodiments, the conjugate is a dU-cholesterol, or cholesterol is conjugated to the iRNA
agent by a disulfide linkage. In another embodiment, the conjugate is cholanic acid, and the cholanic acid is attached to the 5' or 3' end of the sense strand, or the 3' end of the antisense strand. In one embodiment, the cholanic acid is attached to the 3' end of the sense strand and the 3' end of the antisense strand_ In another embodiment, the conjugate is PEGS, PEG20, naproxen or retinal.
In another embodiment, one or more terminal nucleotides have a 2'-5' linkage.
Preferably, a 2'-5' linkage occurs on the sense strand, e.g., the 5' end of the sense strand.
In one embodiment, the iRNA agent includes an L-sugar, preferably at the 5' or 3' end of the sense strand.
In one embodiment, the iRNA agent includes a methylphosphonate at one or more terminal nucleotides to enhance exonuclease resistance, e.g., at the 3' end of the sense or antisense strands of the iRNA agent.
In one embodiment, an iRNA agent has been modified by replacing one or more ribonucleotides with deoxyribonucleotides. Preferably, adjacent deoxyribonucleotides are joined by phosphorothioate linkages, and the iRNA agent does not include more than four consecutive deoxyribonucleotides on the sense or the antisense strands.
In some embodiments, an iRNA agent having increased stability in cells and biological samples includes a difluorotoluyl (DFT) modification, e.g., 2,4-difluorotoluyl uracil, or a guanidine to inosine substitution.
The methods described can be used to select and/or optimize a therapeutic dsRNA, e.g., iRNA agent. dsRNAs, e.g., iRNA agents, made by a method described herein are within the invention.
The methods can be used to evaluate a candidate dsRNA, e.g., a candidate iRNA
agent, which is unmodified or which includes a modification, e.g., a modification that inhibits degradation, targets the dsRNA molecule, or modulates hybridization. Such modifications are described herein. A cleavage assay can be combined with an assay to determine the ability of a modified or non-modified candidate to silence the target. For example, one might (optionally) test a candidate to evaluate its ability to silence a target (or off target sequence), evaluate its susceptibility to cleavage, modify it (e.g., as described herein, e.g., to inhibit degradation) to produce a modified candidate, and test the modified candidate for one or both of the ability to silence and the ability to resist degradation. The procedure can be repeated.
Modifications can be introduced one at a time or in groups. It will often be convenient to use a cell-based method to monitor the ability to silence a target RNA. This can be followed by a different method, e.g, a whole animal method, to confirm activity.
The invention includes using information on cleavage sites obtained by a method described herein to modify a dsRNA, e.g., an iRNA agent.
Optirnizifzg the activity of tlae nucleic acid molecules of the invention Chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., Nature 344:565, 1990; Phieken et al., Science 253:314, 1991; Usman and Cedergren, Treads in Biochern. Sci.
17:334, 1992; Usman et al., International Publication No. WO 93/15187; and Rossi et al., International Publication No. WO 91/03162; Sproat, U.S. Pat. No. 5,334,711;
Gold et al., U.S.
Pat. No. 6,300,074; and Burgin et al., supra ; all of which are incorporated by reference herein).
All of the above references describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules described herein. Modifications that enhance their efFcacy in cells, and removal of bases from nucleic acid molecules to shorten oligonucleotide synthesis times and reduce chemical requirements are desired.
Other suitable modifications to a sugar, base, or backbone of an iRNA agent are described elsewhere herein.
There are several examples in the art describing sugar, base and phosphate modifications that can be introduced into nucleic acid molecules with significant enhancement in their nuclease stability and efficacy. For example, oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2'-amino, 2'-G-allyl, 2'-fluoro, 2'-O-methyl, 2'-O- allyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, Trends in Bioclzenz. Sci. 17:34, 1992; Usman et al., Nucleic Acids Symp. Sef°. 31:163, 1994; Burgin et al., Biochemistry 35:14090, 1996). Sugar modification of nucleic acid molecules have been extensively described in the art (see Eckstein et al., International Publication PCT No. WO 92/07065; Perrault et al., Natuf a 344:565, 1990; Pieken et al. Science 253:314, 1991; Usman and Cedergren, Trends in Bioclaem.Sci.
17:334, 1992;
Usman et al., International Publication PCT No. W093/15187; Sproat, U.S. Pat.
No. 5,334,711, and Beigelman et al., J. Biol. Chenz. 270:25702, 1995; Beigelman et al., International PCT
publication No. WO 97/26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat.
No. 5,627,053; Woolf et al., International PCT Publication No. WO 98/13526;
I~arpeisky et al., Tetralzedton Lett. 39:1131, 1998; Earnshaw and Gait, BiopolymeTS (Nucleic Acid Sciences) 48:39, 1998; Verma and Eckstein, Anrzu. Rev Bioclaem. 67:99, 1998; and Burlina et al., Bioorg.
Med. Clzern. 5:1999, 1997; all of the references are hereby incorporated in their totality by reference herein). Such publications describe general methods and strategies to determine the location of incorporation of sugar, base and/or phosphate modifications and the like into nucleic acid molecules without modulating catalysis, and are incorporated by reference herein. In view S of such teachings, similar modifications can be used as described herein to modify the iRNA
nucleic acid molecules of the instant invention so long as the ability of iRNA
agents to promote RNAi in cells is not significantly inhibited.
While chemical modification of oligonucleotide internucleotide linkages with phosphorothioate, phosphorodithioate, and/or 5'-methylphosphonate linkages improves stability, excessive modifications can cause some toxicity or decreased activity.
Therefore, when designing nucleic acid molecules, the amount of these internucleotide linkages should be minimized. The reduction in the concentration of these linkages should lower toxicity, resulting in increased efficacy and higher specificity of these molecules.
The 3' and 5' ends of an iRNA agent can be modified. Such modifications can be at the 3' end, 5' end or both ends of the molecule. They can include modification or replacement of an entire terminal phosphate or of one or more of the atoms of the phosphate group. For example, the 3' and 5' ends of an oligonucleotide can be conjugated to other functional molecular entities such as labeling moieties, e.g., fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or protecting groups (based e.g., on sulfur, silicon, boron or ester).
The functional molecular entities can be attached to the sugar through a phosphate group and/or a spacer. The terminal atom of the spacer can connect to or replace the linking atom of the phosphate group or the C-3' or C-5' O, N, S or C group of the sugar. Alternatively, the spacer can connect to or replace the terminal atom of a nucleotide surrogate (e.g., PNAs). These spacers or linkers can include e.g., -(CH2)n-, -(CH2)nN-, -(CH2)n0-, -(CH2)nS-, O(CH2CH20)nCH2CH20H
(e.g., n = 3 or 6), abasic sugars, amide, carboxy, amine, oxyamine, oxyimine, thioether, disulfide, thiourea, sulfonamide, or morpholino, or biotin and fluorescein reagents. When a spacer/phosphate-functional molecular entity-spacer/phosphate array is interposed between two sequences of an iRNA agent, the array can substitute for a hairpin RNA loop in a hairpin-type RNA agent. The 3' end can be an -OH group. While not wishing to be bound by theory, it is believed that conjugation of certain moieties can improve transport, hybridization, and specificity properties. Again, while not wishing to be bound by theory, it may be desirable to introduce terminal alterations that improve nuclease resistance. Other examples of terminal modifications include dyes, intercalating agents (e.g., acridines), cross-linkers (e.g., psoralene, mitomycin C), porphyrins (TPPG4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic carriers (e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), and synthetic ribonucleases (e.g., irnidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazQle conjugates, Eu3+ complexes of tetraazamacrocycles). In some embodiments, conjugates such as retinol or retinoic acid can be attached to the 5' or 3' end, or both ends, of an iRNA agent. Use of such conjugates may improve specific uptake and delivery of iRNA agents to cells that express retinol receptors, such as retinal pigment epithelial cells.
Terminal modifications can be added for a number of reasons, such as to modulate activity or to modulate resistance to degradation. Terminal modifications useful for modulating activity include modification of the 5' end with phosphate or phosphate analogs. For example, in preferred embodiments iRNA agents, especially antisense sequences, are 5' phosphorylated or include a phosphoryl analog at the 5' prime terminus. 5'-phosphate modifications include those which are compatible with RISC mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO)2(O)P-O-5'); 5'-diphosphate ((HO)2(O)P-O-P(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-guanosine cap (7-methylated or non-methylated) (7m-G-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P-O-5'); 5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P-O-5'), 5'-phosphorothiolate ((HO)2(O)P-S-5'); any additional combination of oxygen/sulfur replaced monophosphate, diphosphate and triphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)P-O-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates (R=alkylethet=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g., RP(OH)(O)-O-5'-).
In another embodiment, the invention features conjugates andlor complexes of iRNA
agents of the invention. Such conjugates andlor complexes can be used to facilitate delivery of iRNA agents into a biological system, such as a cell. The conjugates and complexes provided by the instant invention can impart therapeutic activity by transfernng therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention. The present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example, proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes. In general, the transporters described are designed to be used either individually or as part of a mufti-component system, with or without degradable linkers. These compounds are expected to improve delivery and/or localization of nucleic acid molecules of the invention into a number of cell types originating from different tissues, in the presence or absence of serum (see Sullenger and Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
Adrninistration of tlxe iRNA Agents A patient who has been diagnosed with a disorder characterized by unwanted VEGF expression can be treated by administration of an iRNA agent described herein to block the negative effects of VEGF, thereby alleviating the symptoms associated with unwanted VEGF gene expression. For example, the iRNA agent can alleviate symptoms associated with a disease of the eye, such as a neovascular disorder.
In other examples, the iRNA agent can be administered to treat a patient who has a tumor or metastatic cancer, such as colon or breast cancer; a pulmonary disease, such as asthma or bronchitis; or an autoimmune disease such as rheumatoid arthritis or psoriasis. The anti-VEGF
iRNA agents can be administered systemically, e.g., orally or by intramuscular injection or by intravenous injection, in admixture with a pharmaceutically acceptable carrier adapted for the route of administration. An iRNA agent can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. Methods for the delivery of nucleic acid molecules are described in Akhtar et al., Trends in Cell Bio. 2:139, 1992; Delivery Strategies for Antisense Oli~onucleotide Thera ep utics, ed. Akhtar, 1995; Maurer et al., Mol.
lllenabr: Biol., 16:129, 1999;
Hofland and Huang, Handb. Exp. Pharmacol. 137:165, 1999; and Lee et al., ACS
Symp. Ser.
752:184, 2000, all of which are incorporated herein by reference. Beigelman et al., U.S. Pat. No.
6,395,713 and Sullivan et al., PGT WO 94/02595 further describe the general methods for delivery of nucleic acid molecules. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by ionophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins (see for example Gonzalez et al., Bioconjugate Chem.
10:1068, 1999), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722).
In the present methods, the iRNA agent can be administered to the subject either as naked iRNA agent, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the iRNA agent. Preferably, the iRNA agent is administered as naked iRNA.
The iRNA agent of the invention can be administered to the subject by any means suitable for delivering the iRNA agent to the cells of the tissue at or near the area of unwanted VEGF expression, such as at or near an area of neovascularization. For example, the iRNA
agent can be administered by gene gun, electroporation, or by other suitable parenteral administration routes.
Suitable enteral administration routes include oral delivery.
Suitable parenteral administration routes include intravascular administration (e.g., intravenous bolus injection, intravenous infusion, infra-arterial bolus injection, infra-arterial infusion and catheter instillation into the vasculature); peri- and infra-tissue injection (e.g., intraocular injection, infra-retinal injection, or sub-retinal injection);
subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the area at or near the site of neovascularization, for example by a catheter or other placement device (e.g., a retinal pellet or an implant comprising a porous, non-porous, or gelatinous material). It is preferred that injections or infusions of the iRNA agent be given at or near the site of neovascularization.
The iRNA agent of the invention can be delivered using an intraocular implant.
Such implants can be biodegradable and/or biocompatible implants, or may be non-biodegradable implants. The implants may be permeable or impermeable to the active agent, and may be inserted into a chamber of the eye, such as the anterior or posterior chambers, or may be implanted in the sclera, transchoroidal space, or an avascularized region exterior to the vitreous.
In a preferred embodiment, the implant may be positioned over an avascular region, such as on the sclera, so as to allow for transcleral diffusion of the drug to the desired site of treatment, e.g., the intraocular space and macula of the eye. Furthermore, the site of transcleral diffusion is preferably in proximity to the macula.
The iRNA agent of the invention can also be administered topically, for example, by patch or by direct application to the eye, or by iontophoresis. Ointments, sprays, or droppable liquids can be delivered by ocular delivery systems known in the art such as applicators or eyedroppers. The compositions can be administered directly to the surface of the eye or to the interior of the eyelid. Such compositions can include mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or polyvinyl alcohol), preservatives such as sorbic acid, EDTA or benzylchronium chloride, and the usual quantities of diluents and/or carriers.
The iRNA agent of the invention may be provided in sustained release compositions, such as those described in, for example, U.S. Patent Nos. 5,672,659 and 5,595,760. The use of immediate or sustained release compositions depends on the nature of the condition being treated. If the condition consists of an acute or over-acute disorder, treatment with an immediate release form will be preferred over a prolonged release composition.
Alternatively, for certain preventative or long-term treatments, a sustained release composition may be appropriate.
An iRNA agent can be injected into the interior of the eye, such as with a needle or other delivery device.
The iRNA agent of the invention can be administered in a single dose or in multiple doses. Where the administration of the iRNA agent of the invention is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions.
Injection of the agent directly into the tissue is at or near the site of neovascularization is preferred. Multiple injections of the agent into the tissue at or near the site of neovascularization are also preferred.
Dosage levels on the order of about 1 ~,g/kg to 100 mg/kg of body weight per administration are useful in the treatment of the neovascular diseases. When administered directly to the eye, the preferred dosage range is about 0.00001 mg to about 3 mg per eye, or preferrably about 0.0001-0.001 mg per eye, about 0.03- 3.0 mg per eye, about 0.1-3.0 mg per eye or about 0.3-3.0 mg per eye. One skilled in the art can also readily determine an appropriate dosage regimen for administering the iRNA agent of the invention to a given subj ect. For example, the iRNA agent can be administered to the subject once, e.g., as a single injection or deposition at or near the neovascularization site. Alternatively, the iRNA
agent can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days. In a preferred dosage regimen, the iRNA agent is injected at or near a site of unwanted VEGF expression (such as near a site of neovascularization) once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of iRNA agent administered to the subject can comprise the total amount of iRNA agent administered over the entire dosage regimen. One skilled in the art will appreciate that the exact individual dosages may be adjusted somewhat depending on a variety of factors, including the specific iRNA agent being administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disorder being treated, the severity of the disorder, the pharmacodynamics of the iRNA agent, and the age, sex, weight, and general health of the patient. Wide variations in the necessary dosage level are to be expected in view of the differing efficiencies of the various routes of administration. For instance, oral administration generally would be expected to require higher dosage levels than administration by intravenous or intravitreal injection. Variations in these dosage levels can be adjusted using standard empirical routines of optimization, which are well-known in the art. The precise therapeutically effective dosage levels and patterns are preferably determined by the attending physician in consideration of the above-identified factors.
In addition to treating pre-existing neovascular diseases, iRNA agents of the invention can be administered prophylactically in order to prevent or slow the onset of these and related disorders. In prophylactic applications, an iRNA of the invention is administered to a patient susceptible to or otherwise at risk of a particular neovascular disorder.
The iRNA agents featured by the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the W vention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 18th ed., Mack Publishing Company, Easton, Pa. (1990), and The Science and Practice of Pharmacy, 2003, Gennaro et al., the entire disclosures of which are herein incorporated by reference.
The present pharmaceutical formulations comprise an iRNA agent of the invention (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a physiologically acceptable carrier medium. Preferred physiologically acceptable Garner media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
For solid compositions, conventional non-toxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of one or more iRNA agents of the invention.
By "pharmaceutically acceptable formulation" is meant a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity. Non-limiting examples of agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as PluronicP85), which can enhance entry of drugs into the CNS
(Jolliet-Riant and Tillement, Fundam. Clin. Pharmacol. 13:16, 1999);
biodegradable polymers, such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery. Other non-limiting examples of delivery strategies for the nucleic acid molecules of the instant invention include material described in Boado et al., J. Pha~m. Sei. 87:1308, 1998;
Tyler et al., FEBSLett.
421:280, 1999; Pardridge et al., PNAS USA. 92:5592, 1995; Boado, Adu Drug Delivery Rev 15:73, 1995; Aldrian-Herrada et al., Nucleic Acids Res. 26:4910, 1998; and Tyler et al., PNAS
USA 96:7053, 1999.
The invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al., Claern.
Rev. 95:2601, 1995;
Ishiwata et al., Chena.Phare. Bull. 43:1005, 1995).
Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 267:1275, 1995; Oku et al., Biochim. BioplZys. Acta 1238:86, 1995). The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Clzern. 42:24864, 1995; Choi et al., International PCT
Publication No. WO 96/10391;
Ansell et al., International PCT Publication No. WO 96/10390 ; Holland et al., International PCT
Publication No. WO 96/10392). Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remin~ton's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided.
These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.
The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
Alternatively, certain iRNA agents of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, Seience 229:345, 1985;
McGarry and Lindquist, Proc. Natl. Acad. Sci. USA 83:399, 1986; Scanlon et al., Pr~oe.Natl. Acad. Sci. USA
88:10591, 1991; Kashani-Sabet et al., Antiserrse Res. I~ev 2:3, 1992; Dropulic et al., J. Yirol.
66:1432, 1992; Weerasinghe et al., J. Tirol. 65:5531, 1991; Ojwanget al., Proc. Natl. Acad. Sci.
USA 89:10802, 1992; Chen et al., Nucleic Acids Res. 20:4581, 1992; Sarver et al., Science 247:1222, 1990; Thompson et al., Nucleic Acids Res. 23:2259, 1995; Good et al., Gene Therapy 4:45, 1997). Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., Nucleic Acids Syrrap. Ser. 27:156, 1992; Taira et al., Nucleic Acids Res. 19:5125, 1991;
Ventura et al., Nucleic Acids Res. 21:3249, 1993; Chowrira et al., J. Biol. Chern. 269:25856, 1994).
In another aspect of the invention, RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al., Treads in Genetics 12:510, 1996) inserted into DNA or RNA vectors. The recombinant vectors can be DNA
plasmids or viral vectors. iRNA agent-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. I~ another embodiment, pol III
based constructs are used to express nucleic acid molecules of the invention (see for example Thompson, U. S. Pats. Nos. 5,902,880 and 6,146,886). The recombinant vectors capable of expressing the iRNA agents can be delivered as described above, awd persist in target cells.
Alternatively, viral vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the iRNA agent interacts with the target mRNA and generates an RNA_i response.
Delivery of iRNA
agent-expressing vectors can be systemic, such as by intravenous or infra-muscular administration, by administration to target cells ex-planted from a subj ect followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., Trends ira Genetics 12:510, 1996).
Additional ophthalmic indications for the iRNA agents of the invention include proliferative diabetic retinopathy (the most severe stage of diabetic retinopathy), uveitis (an inflammatory condition of the eye that often leads to macular edema), cystoid macular edema following cataract surgery, myopic degeneration (a condition in which a patient with a high degree of nearsightedness develops choroidal neovascularization), inflammatory macular degeneration (a condition in which a patient with inflammation in the macular area due to infections or other causes, develops choroidal neovascularization), and iris neovascularization (a serious complication of diabetic retinopathy or retinal vein occlusion involving new blood vessel growth on the surface of the iris).
Additional non-ophthalmic indications for the iRNA agents of the invention include cancer, including but not limited to renal and colon cancer, and psoriasis.
Solid tumors and their metastases rely on new blood vessel growth for their survival.
Psoriasis is a chronic inflammatory skin disease that causes skin cells to grow too quickly, resulting in thick white or red patches of skin. Preclinical and clinical data suggest that VEGF-induced blood vessel growth and blood vessel leakage play a role in the development of this condition.
The invention is further illustrated by the following examples, which should not be construed as further limiting.
EXAMPLES
Example 1: siRNA Design Four hundred target sequences were identified within exons 1-5 of the VEGF-mRNA sequence (See Table 1, SEQ ID NOs 2-401) and corresponding siRNAs targeting these subjected to a bioinformatics screen.
To ensure that the sequences were specific to VEGF sequence and not to sequences from any other genes, the target sequences were checked against the sequences in Genbank using the BLAST search engine provided by NCBI. The use of the BLAST algorithm is described in Altschul et al., J. Mol. Biol. 215:403, 1990; and Altschul and Gish, Meth.
Erazymol. 266:460, 1996.
siRNAs were also prioritized for their ability to cross react with monkey, rat and human VEGF sequences.
Of these 400 potential target sequences 80 were selected for analysis by experimental screening in order to identify a small number of lead candidates. A total of 114 siRNA molecules were designed for these ~0 target sequences 114 (Table 2).
Example 2: Synthesis of the siRNA oli~onucleotides RNA was synthesized on Expedite X909, ABI 392 and ABI394 Synthesizers (Applied Biosystems, Applera Deutschland GmbH, Frankfurter Str. 129b, 64293 Darnistadt, Germany) at 1 ,mole scale employing CPG solid support and Expedite RNA phosphoramidites (both from Proligo Biochemie GmbH, Georg-Hyken-Str.l4, Hamburg, Germany). Ancillary reagents were obtained from Mallinckrodt Baker (Im Leuschnerpark 4:64347 Griesheim, Germany).
Phosphorothioate linkages were introduced by replacement of the iodine oxidizer solution with a solution of the Beaucage reagent in acetonitrile (5% weight per volume).
Cleavage of the oligoribonucleotides from the solid support and base deprotection was accomplished with a 3:1 (v/v) mixture of methylamine (41%) in water and methylamine (33%) in ethanol. 2'-Desilylation was carried out according to established procedures (Wincott et al., Nucleic Acids Res. 23:2677-2684, 1995). Crude oligoribonucleotides were purified by anion exchange HPLC using a 22x250 mm DNAPac PA 100 column with buffer A containing 10 mM
NaC104, 20 mM Tris, pH 6.8, 6 M urea and buffer B containing 400 mM NaC104, 20 mM Tris, pH 6.8, 6 M Urea. Flow rate was 4.5 mL/min starting with 15% Buffer B which was increased to 55% over 45 minutes.
The purified compounds were characterized by LC/ESI-MS (LC: Ettan Micro, Amersham Biosciences Europe GmbH, Munzinger Strasse 9, 79111 Freiburg, Germany, ESI-MS:
LCQ, Deca XP, Thermo Finnigan, Im Steingrund 4-6, 63303 Dreieich, Germany) and capillary electrophoresis (P/ACE MDQ Capillary Electrophoresis System, Beckman Coulter GmbH, 85702 Unterschleil3heim, Germany). Purity of the isolated oligoribonucleotides was at least 85%.
Yields and concentrations were determined by UV absorption of a solution of the respective RNA at a wavelength of 260 nm using a spectral photometer. Double stranded RNA
was generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heating in a water bath at 85 - 90 °C for 3 minutes and cooling to room temperature over a period of 3 - 4 hours. The RNA was kept at -20 °C until use.
Example 3: Efficacy Screen of siRNAs Using two efficacy screens, the VEGF siRNA were screened for their ability to become a lead candidate. Table 2 shows the relative efficiencies of some of the siRNAs in their ability to inhibit expression of an endogenous VEGF gene. In this process the number of candidate siRNAs was winnowed. Human HeLa or ARPE-19 (human retinal pigment epithelial cell line with differentiated properties (Dunn et al., Exp. Eye Res. 62:155, 1996) were plated in 96-well plates (17,000 cells/well) in 100 ~.1 10% fetal bovine serum in Dulbecco's Modified Eagle Medium (DMEM). When the cells reached approximately 90% confluence (approximately 24 hours later) they were transfected with serial three-fold dilutions of siRNA
starting at 20 nM 0.4 ~,1 of transfection reagent LipofectamineTM 2000 (Invitrogen Corporation, Carlsbad, CA) was used per well and transfections were performed according to the manufacturer's protocol.
Namely, the siRNA: LipofectamineTM 2000 complexes were prepared as follows.
The appropriate amount of siRNA was diluted in Opti-MEM I Reduced Serum Medium without serum and mixed gently. The LipofectamineTM 2000 was mixed gently before use, then for each well of a 96 well plate, 0.4 ~.l was diluted in 25 ~,l of Opti-MEM I Reduced Serum Medium without serum and mixed gently and incubated for 5 minutes at room temperature. After the 5 minute incubation, 1 ~1 of the diluted siRNA was combined with the diluted LipofectamineTM
2000 (total volume is 26.4 ~.1). The complex was mixed gently and incubated for 20 minutes at room temperature to allow the siRNA: LipofectamineTM 2000 complexes to form.
Then 100 ~,l of 10% fetal bovine serum in DMEM was added to each of the siRNA:LipofectamineTM 2000 complexes and mixed gently by rocking the plate back and forth. 100 ~,1 of the above mixture was added to each well containing the cells and the plates were incubated at 37°C in a COZ
incubator for 24 hours, then the culture medium was removed and 100 ~1 10%
fetal bovine serum in DMEM was added. Following the medium change, conditioned medium was collected at 24 hours (HeLa cells) or 72 hours CARPE-19 cells) and a human VEGF ELISA
was performed using the DuoSet human VEGF ELISA Development kit (R&D Systems, Inc.
Minneapolis, MN
55413). This kit contains the basic component required for the development of sandwich ELISAs to measure natural and recombinant human VEGF in cell culture supernatants and serum.
The materials used included:
Capture Antibody - 576 ~,g/ml of goat anti-human VEGF when reconstituted with 0.25 ml PBS (137 mM NaCI, 2.7 mM KCI, 8.1 mM Na2HP04, 1.5 mM KHZP04, pH 7.2-7.4, 0.2 ~,m filtered). After reconstitution, stored at 2-8°C for up to 60 days or aliquoted and stored at -20°C
to -70°C in a manual defrost freezer for up to 6 months. Diluted to a working concentration of 0.8 ~g/ml in PBS without carrier protein.
Detection antibody - 4.5 ~g/ml of biotinylated goat anti-human VEGF when reconstituted with 1.0 ml of Reagent Diluent (1% bovine serum albumin in PBS, pH 7.2-7.4, 0.2 ~,m filtered. After reconstitution, stored at 2-8°C for up to 60 days or aliquoted and stored at -20°C to -70°C in a manual defrost freezer for up to 6 months.
Diluted to a working concentration of 25 ng/ml in Reagent Diluent.
Standard: 110 ng/ml of recombinant when reconstituted with 0.5 ml of Reagent Diluent.
Allowed the standard to sit for a minimum of 15 minutes with gentle agitation prior to making dilutions. The reconstituted Standard can be stored at 2-8°C for up to 60 days or aliquoted and stored at -20°C to -70°C in a manual defrost freezer for up to 6 months. A seven point standard curve using 2-fold serial dilutions in Reagent Diluent, and a high standard of 4000 pg/ml is recommended.
Streptavidin-HRP: 1.0 ml of streptavidin conjugated to horseradish-peroxidase.
Stored at 2-8°C for up to 6 months. Diluted to the working concentration specified on the vial label.
General ELISA protocol was followed (R&D Systems, Inc., Minneapolis, MN).
Controls included no siRNA, human VEGF siRNA (CandS, (a.k.a., hVEGFS) Reich et al., Mol ~s. 9:210, 2003) and an siRNA matching a 21-nt sequence conserved between the human, rat and mouse VEGF (hrmVEGF, Filleur et al., Caracer-Res. 63:3919-3922, 2003).
The activities of the siRNAs were compared to the activity of the control human VEGF
siRNA of Reich et al. (supra) with "+" representing a lower activity, "++"
representing similar activity and "+-I-I-" representing a higher activity than the control human VEGF siRNA (Table 2).
FIG. 2 shows the activities of single- and double-overhang siRNAs in HeLa cells. Solid lines with filled symbols represent the single-overhang siRNA, solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. All of the siRNAs are more active than the control siRNAs and may inhibit expression of VEGF by approximately 80%. In contrast, the siRNA from Reich et al. (supra) reduced the level of endogenous hVEGF by approximately 20% under the same experimental conditions.
Similarly, under the same experimental conditions, the siRNA based on consensus sequence hrmVEGF
(Filleur et al., supra) reduced the expression level by approximately 45%.
FIG. 3 shows the activities of single- and double-overhang siRNAs in ARPE-19 cells.
Solid lines with filled symbols represent the single-overhang siRNA, solid lines with open symbols represent the double-overhang siRNAs; dashed lines represent the control siRNAs. All of the siRNAs are more active than the control siRNAs and may inhibit expression of VEGF by approximately 90%. In contrast, the siRNA from Reich et al. (Mol. his. 9:210, 2003) reduced the level of hVEGF by approximately 35% under the same experimental conditions.
Similarly, under the same experimental conditions, the siRNA based on consensus sequence hrmVEGF (Filleur et al., supra) reduced the expression level by approximately 70%.
FIGS. 4 and 5 show the results of a comparison of single- and double-overhang siRNAs with their analogous blunt-ended siRNAs, respectively in HeLa cells. The results are in agreement with the data of Elbashir et al. (Genes & Developrrzent 15:188, 2001) in that the presence of an overhang in an siRNA confers greater efficiency in inhibition of gene silencing.
However, it is important to note that the activity of the blunt ended siRNAs are comparable to the results achieved using the control siRNAs.
Example 4: Iyz vitro assay for the silencing of VEGF synthesis under hypoxic conditions Human HeLa cells were plated in 96 well plates at 10,000 cells/well in 100 p,l of growth medium (10% FBS in DMEM). 24 hours post cell seeding when the cells had reached approximately 50% confluence they were transfected with serial three fold dilutions of siRNA
starting at 30 nM. 0.2 p,l of LipofectamineTM 2000 transfection reagent (Invitrogen Corporation, Carlsbad CA) was used per well and transfections were carried out as described in the Invitrogen product insert. Controls included no siRNA, human VEGF siRNA (Reich et al., Mol. vis. 9:210, 2003) and an siRNA matching a 21-nt sequence conserved between the human, rat and mouse VEGF (hrmVEGF, Filleur et al., Cancer Res. 63:3919-3922, 2003). Transfections were done in duplicate on each plate. Additionally, duplicate plates were transfected so that 24 hours post transfection the growth media could be changed and one plate could be kept in normal oxygen growth conditions (37°C, 5% CO2, 20% oxygen) and the duplicate plate could be kept in hypoxic conditions (37°C, 1% oxygen, balance nitrogen). Hypoxic conditions were maintained by using a Pro-ox Oxygen Controller (BioSpherix, Ltd., Redfield, NY) attached to a Pro-ox in vitro culture chamber. Cells were maintained in either normoxic or hypoxic conditions for 24 hours post media change. Conditioned culture media was then collected from both plates and tested for secreted VEGF levels in a DuoSet VEGF ELISA (R&D Systems, Minneapolis, MN).
The assays were performed according to the manufacturer's protocol and as described in Example 2.
For deferoxamine chemically induced hypoxia, 130 p,M deferoxamine (Sigma D9533), was used. Deferoxamine was added to the fresh growth media 24 hours post-transfection. Cells treated with deferoxamine were then grown under normal growth conditions (37°C, 5% CO2, 20% oxygen).
FIG. 6 shows the results obtained with siRNAs (both single overhang siRNAs and double overhangs siRNAs) directed against ORF regions having the first nucleotides corresponding to 319 and 343 respectively, together with the control siRNAs. Under hypoxic conditions, either 1% oxygen (FIG 6B) or 130 ~,M deferoxamine (FIG. 6C), three of the experimental siRNAs achieved almost 95% inhibition of expression of VEGF, namely AL-DP-4094 (single-overhang) directed at ORF 343, and both of the siRNAs (single and double-overhangs) directed at ORF
319. The control siRNAs of Reich et al (supra) and Filleur et al. (supra) demonstrate an ability to inhibit VEGF expression by 45% and 85% respectively.
FIGs. 8A and 8B show the results obtained with the siRNAs AL-DP-4014, a phosphorothioate modified version of AL-DP-4014 (AL-DP-4127, see Table 3) and a mutated version of AL-DP-4014 (AL-DP-4140, see Table 5). Under both normal and hypoxic conditions, the unmodified (AL-DP-4014) and the phosphorothioate-modified siRNA (AL-DP-4127) reduced endogenous VEGF expression to less than 20% of its original expression level. Under hypoxic conditions, the phosphorothioate-modified siRNA essentially abolished VEGF
expression.
Example 5: Modified VEGF siRNA molecules retain full activity and show enhanced stabili Phosphorothioate derivatives were made for the AL-DP-4014, targeting ORF 319 of VEGF, and are presented in Table 3. These siRNAs were tested in the HeLa cell assay described in Example 3, and FIG. 7 shows that these derivatives are as active in the HeLa assay as the unmodified siRNA.
A panel of siRNAs were synthesized that retained the sequence of the AL-DP-siRNA (Table 1) but included different modifications including phosphorothioate linkages, O-methyl-modified nucleotides, and 2 °-fluoro-modified nucleotides (Table 4). The panel of siRNAs was tested in HeLa cells, and FIGs. 9A-9E demonstrate that all modified versions of the AL-DP-4094 siRNA effectively reduced VEGF expression by greater than 90%, exhibiting greater efficacy than either of the two previously identified VEGF siRNAs ("Acuity" in Reich et al. (supra), and "Filleur" in Filleur et al. (supra)). FIG. 10 also shows data from iTZ vita°o assays in HeLa cells. The graph in FIG. 10 shows that the unmodified AL-DP-4094 siRNA
and a phosphorothioate-modified AL-DP-4004 siRNA (AL-DP-4219) reduced VEGF
expression by more than 70% (FIG 10). Scrambled versions of the compound AL-DP-4094 (e.g., and AL-DP-4218 (sequences shown below; underlined nucleotides represent mismatched nucleotides as compared to AL-DP-4094)) did not inhibit VEGF expression. An siRNA targeting the firefly luciferase gene (AL-DP-3015; see below) also did not inhibit VEGF
expression.
AL-DP-4216 AL4094 MI s 5°- GCAGAUUGGACAGUUGUGGUU-3' as °3-GUCGUGUAACCUGUCAACACCAA-'S
AL-DP-4218 s 5'- GCACAUAGA_AGU_GA_CG_CGCUU-3' as '3-GUCGUGUAUCUUCACUGCGCGAA-°5 AL-DP-3015 5'- GAACUGUGUGUGAGAGGUCCU-3' '3-CGCUUGACACACAGUCUCCAGGA-'S
The Stains-All technique (Sigma, St. Louis, MO) was performed to examine the stability of the modified siRNAs. To perform the assay, an siRNA duplex was incubated in 90% human serum at 37°C. Samples of the reaction mix were quenched at various time points (at 0, 0.25, 1, 2, 4, and 24 hours) and subjected to polyacrylamide gel electrophoresis.
Cleavage of the RNA
over the time course provided information regarding the susceptibility of the siRNA duplex to serum nuclease degradation.
O-methyl and 2'fluoro modifications used in combination with phosphorothioate modifications were found to enhance stability to a greater extent than when phosphorothioate modifications were used alone. For example, modified versions of the AL-DP-4094 siRNA
included a phosphorothioate-modified siRNA (AL-DP-4198), a phosphorothioate plus O-methyl modified siRNAs (e.g., AL-DP-4180, AL-DP-4175, and AL-DP-4220), and phosphorothioate plus O-methyl plus 2'-fluoro modified siRNAs (e.g., AL-DP-4197 and AL-DP-4221) (Table 4).
The AL-DP-4180, AL-DP-4175, and AL-DP-4197 siRNAs were found to be more stable in human serum than the AL-DP-4198 siRNA. It was determined that the phosphorothioate modification stabilized the siRNAs against exonucleolytic degradation, and the O-methyl and 2'-fluoro modifications stabilized the siRNAs against endonucleolytic degradation.
Examule 6: In vitro Stability Assay of VEGF siRNAs in Different Rat Serum and Ocular tissues 1. Preparation of Tissue Homo eg hates Tissues from pooled whole eyes, retinas, vitreous humors from at least three rats were excised and frozen immediately in liquid nitrogen. The frozen tissue was pulverized over dry ice, using instruments that were pre-chilled on dry ice. 1 ml of RIPA buffer (50 mM Tris-HCI, pH 8.0, 150 mM NaCL, 1mM Na2EDTA, 0.5% Na-deoxycholate deoxycholic acid, 1% IGEPAL CA-630, 0.05% SDS) was added to the frozen tissue powder and the mixture was mixed thoroughly and vigorously. The homogenate was centrifuged at 10,000 x g for 5 min at 4°C and the pellet was discarded. 100 ~,1 aliquots of the supernatant were transferred to pre-chilled microcentrifuge tubes and stored at -70°C or used immediately in the stability assay.
2. 5'-end labelin o~~le stranded sense or antisense siRNA using T4 polynucleotide kinase and y 32P-ATP
The following reagents were used:
T4 Polynucleotide Kinase (PNK) 10 units/~l (New England Biolabs, Beverly, MA) l OX T4 PNK buffer (700 mM Tris-HCI, 1.00 mM MgCl2, 50 mM Dithiothreitol (DTT), pH7.6) Gamma-32P-ATP (PerkinElmer, Shelton, CT) 250 ~Ci, 3000 Ci/mmol (3.3 wM) 10 wM stocks of synthetic RNA oligo diluted in H20 Microspin SephadexTM G-25 columns (Amersham Biosciences RNAse-free Water and 0.65 ml microcentrifuge (1.5 ml) tubes A 25 ~1 kinase reaction contained:
2.5,1 from 10 ~M stock sense or antisense (l~.M final cone) 2.5,1 lOX PNK Buffer (1X) 1.5,1 ~y32-ATP'~approximately 0.2 nM) 1.0,1 10 unit/~,l T4 PNK (10 units) 17.5,1 dHzO
The reaction rnix was incubated at 37°C for 1 hour (water bath) prior to fractionating the labeled slRNA through SephadexTM G-25 spin columns (Amersham). 0.5 ~.L was used to determine the number of counts per minute (cpm)/ml of the radiolabeled sample.
3. Partial alkaline hydrolysis ladder of radiolabeled single-stranded siRNA
To generate a sample of size markers a portion of the 5' 'y 32 P-end- labeled siRNA was subjected to alkaline hydrolysis as follows:
3 0 ~,l hydrolysis reaction containing 2.5 ~.l 5' end -labeled siRNA (sense or antisense), 6.0 ~,l 0.5M Na2C03/NaHCO3 (pH 9.5), 1.51 lOmg/ml tRNA, and 20.0,1 dH20 was incubated at 90°C
for 7.5 min, then chilled on ice or at 4°G. 301 of 90% formamide, 50mM
Na2EDTA, lOmM
DTT, and XC&BB (xylene cyanol and bromophenol blue), of which 1 ~.l+4~.1 formamide dye was used for the gel electrophoretic analysis.
4. Annealing of radiolabeled 1 ~M stock siRNA duplexes 30.1 l~,M stock of different siRNA duplexes were prepared in which either the sense strand or the antisense strand was radiolabeled.
The samples were heated at 90°C for 2 min and then incubated at 37°C for 1 hour and then stored at -20°C until used.
5. (2uality control of siRNA duplex:
Samples of the siRNA duplex were analyzed by electrophoresis through 15%
polyacrylamide in Tris-Borate, EDTA (TBE) Gel. Electrophoresis was performed at 150V for 1 hour prior to running the samples through. Samples were prepared by mixing 0.5-1 ~,1 siRNA
duplex or single stranded, 3-3.5 ~.l 0.5X TBE, 1 ~,l 5X native loading dye (total volume = 5 ~.l).
6. Stability reactions 2 ~,1 siRNA duplex was added to 18 ~,l serum or tissue lysate or buffer control in PCR tube (0.2m1). A zero time point sample was removed immediately following the addition of the siRNA duplex by removing 2 ~,l and adding it to 18 x,190% formamide, 50 mM
EDTA, 10 mM DTT and xylene cyanol and bromophenol blue (XC ~ BB). Other samples were removed after 15 min, 30 min, 1 hour, 2 hours, and 4 hours and treated similarly. These samples were stored in a 96-well plate. In some experiments the time points were extended to 8, 24 and 48 hours. Time point samples for the buffer (phosphate buffered saline, PBS, 1X working PBS
contains 0.14 M Sodium Chloride, 0.003 M Potassium Chloride, 0.002 M Potassium phosphate, 0.01 M Sodium phosphate) were taken at zero and the last time point of the experiment.
Samples were analyzed by electrophoresis through 20% polyacrylamide gels (pre-run at 75 W
for 1 hour) in 1 X TBE (10 X = 890 mM Tris, 890 mM Boric acid, 20 mM EDTA, pH
8.0). The gel was transferred to a phosphorimager cassette, covered with an enhancer screen and scanned after overnight exposure.
Polyacrylamide gel analysis indicated that the ocular environment contains fewer nucleases than human serum. Testing the unmodified form of the VEGF siRNAAL-DP-for stability in rat eye extract revealed only the presence of exonuclease activity. In human serum, experiments with AL-DP-4127 and -4140 (Tables 4 and 5) indicated that terminally modified phosphorothioate modifications protected against exonucleolytic degradation but not against endonucleolytic activity. These results were consistent with experiments performed in rat whole eye extracts. The terminally modified phosphorothioate derivatives AL-DP-4127 and -4140 were stabilized against exonuclease activity as compared to the unmodified AL-DP-4014 siRNA and the unmodified CandS siRNA (Reich et al. (supra)). However, the -4127 and -4140 siRNAs were still subject to endonucleolytic degradation.
Modifications to the lead compound AL-DP-4094 stabilized the siRNA against exonucleolytic and endonucleolytic degradation. The phosphorothioate-modified siRNAAL-DP-4198 was degraded to a similar extent as the unmodified 4094 compound, but the addition of O-methyl modifications, as in AL-DP-4180 and AL-DP-4220, stabilized the siRNAs in rat whole eye extracts.
Notably, the siRNAs were generally more stable in rat retina lysates than in the rat whole eye extracts described above. Neither the unmodified AL-DP-4094, nor the modified AL-DP-4198, -4180, or -4220 siRNAs were degraded in the retina lysates.
Examine 7. Endonuclease-sensitive sites were mapued on AL-DP-4094 siRNA.
The stability of the AL-DP-4094 siItNA was examined by the Stains-All and radiolabeled techniques following incubation in human serum (see above). These assays revealed susceptibility to exo- and endonucleases. RP-HPLC was used to examine the fragment profile of the siltNA following incubation in serum FIG 11.
Following incubation of the -4094 siRNA in human serum, the fragments were phenol-chloroform extracted and precipitated, and then subjected to LC/MS analysis.
FIG. 12 describes the identified fragments and associated characteristics.
Example 8: Detailed study of modifications to siRNAs tar~etin~ VEGF (Table ~
Eight major different patterns of chemical modification of siRNA duplexes that target the VEGF mRIVA were synthesized and evaluated (Table 6). The ribose sugar modifications used were either 2'-O-methyl (2'OMe) or 2'-fluoro (2'F). Both pyrimidines (Py) and purines (Pu) could be modified as provided in Table 6.
The first four patterns(A-D) incorporated 2'OMe on both strands at every other position.
Four configurations were synthesized: 1) at each even position on the sense strand and at each odd position of the antisense strand, 2) at each odd position on the sense strand and at each even position of the antisense strand, 3) at even positions on both strands, and 4) at odd positions on both strands.;
The fifth pattern (E) incorporated the 2'OMe modification at all pyrimidine nucleotides on both the sense and antisense strands of the duplex.
Pattern F included duplexes with 2'OMe modifications only on pyrimidines in 5'-PyPu-3' dinucleotides, especially at only at UA, CA, UG sites (both strands).
Pattern G duplexes had the 2'F modification on pyrimidines of the antisense strand and 2'OMe modifications on pyrimidines in the sense strand.
Pattern (H) had antisense strands with 2'F-modified pyrimidines in 5'-PyPu-3' dinucleotides, only at UA, CA, UG sites (both strands) and sense strands with 2'OMe modifications only on pyrimidines in 5'-PyPu-3' dinucleotides, only at UA, CA, UG sites (both strands).
A-D: Full Alternating 2'-OMe (both strands) Four configurations: Even/Odd; Odd/Even; Even/Even; Odd/Odd E: 2'-OMe Py (both strands) F: 2'-OMe Py only at UA, CA, UG sites (both strands) G: 2'-OMe All Py (sense) 2'-F All Py (anti-sense) H: 2'-OMe Py only at UA, CA, UG sites (sense) 2'-F Py only at UA, CA, UG sites (anti-sense) 17 different parent VEGF duplexes from Table 2 tested 1. Evaluation of serum stability of siRNA duplexes 2 p,M siRNA duplexes (final concentration) were incubated in 90% pooled human serum at 37°C. Samples were quenched on dry ice after 30 minutes, 4 hours, and 24 hours. For each siRNA sequence, a sample at the same concentration was incubated in the absence of serum (in PBS) at 37°C for 24 hours. After all samples were quenched, RNA was extracted using phenol:chloroform and concentrated by ethanol precipitation. Samples were air dried and resuspended in a denaturing loading buffer. One third of each time point was analyzed on a 20%
acrylamide (19:1), 7 M urea, 1XTBE gel run at 60°C. RNA was visualized by staining with stains-all solution. A qualitative assessment of the stability of each modified siRNA was made by comparison to the parent unmodified siRNA for each duplex set. PBS controls served as markers for the quality of the input siRNA.
2. Stability of VEGF modular chemistries Four modular chemistries were screened 1) all pyrimidines substituted with 2'-O-methyl (2'OMe) in both sense and antisense strands, 2) pyrimidines in UA, UG, CA
pairs substituted with 2'OMe in both sense and antisense strands, 3) all pyrimidines substituted with 2'OMe in the sense strand and 2'-fluoro (2'F) in the antisense strand, 4) pyrimidines in UA, UG, CA pairs substituted with 2'OMe in the sense strand and 2'F in the antisense strand. In total, 85 siRNAs were screened including the unmodified parent duplexes plus the four modular chemistries.
Of the 85 siRNAs screened, 35 were stable for at least 24hours as assessed by visual comparison with the parent unmodified duplexes. These 35 duplexes had 2'OMe pyrimidines in both strands or 2'OMe pyrimidines in the sense strand and 2'F in the antisense strand (chemistries 1 and 3 above). Of the duplexes with fewer modified residues, only five had at least ~50% full length material remaining at the 4 hour time point as compared to their unmodified parent.
Substitution of all pyrimidines with either 2'OMe or 2'F protects siRNAs from serum nuclease degradation for ~24hr in 90% human serum at 37°C. The protected duplexes had roughly 85%-100% full length material remaining at 24 hours as compared to duplex incubated in the absence of serum. Minimal modification of pyrimidines in UA, UG, and GA
dinucleotide pairs only stabilized several siRNAs relative to their unmodified parent but did not stabilize sufficiently for long-term nuclease resistance. Some potential RNase A sites were not protected by methylation (YpN, e.g. UC, UU) and this is likely the reason for the lower resistance to serum endonucleases.
3. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 6 and Figures 13-29 provides summary and graphs of duplex activities in HeLa cells for each of the modifications described above.
Synthesis of the iRNA a-ents RNA Synthesis using "fast" deprotection monomers 1. RNA s~mthesis Oligoribonucleotides were synthesized using phosphoramidite technology on solid phase employing an AKTA 10 synthesizer (Amersham Biosciences) at scales ranging from 35 to 60 ~.mol. Synthesis was performed on solid supports made of controlled pore glass (CPG, 520, with a loading of 70 ~,mol/g) or polystyrene (with a loading of 71 ~.mol/g).
All amidites were dissolved in anhydrous acetonitrile (70 mM) and molecular sieves (3t~) were added. 5-Ethyl thiotetrazole (ETT, 600 mM in acetonitrile) was used as the activator solution. Coupling times were 8 minutes. Oxidation was carried out either with a mixture of iodine/water/pyridine (50 mM/10%/90% (vlv)) or by employing a 100 mM solution of 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) in anhydrous acetonitrile in order to introduce phosphorothioate linkages. Standard capping reagents were used. Cholesterol was conjugated to RNA via the either the 5' or the 3'-end of the sense strand by starting from a GPG modified with cholesterol (described below) using a hydroxyprolinol linker. The DMT protecting group was removed from cholesterol-conjugated RNA, but the DMT was left on unconjugated RNA to facilitate purification.
2. Cleavage and deprotection of support bound oli~onucleotide.
After solid-phase synthesis, the RNA was cleaved from the support by passing 14 mL of a 3:1 (v/v) mixture of 40% methylamW a in water and methylamine in ethanol through the synthesis column over a 30 min time period. For the cholesterol-conjugated RNA, the ratio of methylamine in water to methylamine in ethanol was 1:13. The eluent was divided into four 15 mL screw cap vials and heated to 65°C for additional 30 min. This solution was subsequently dried down under reduced pressure in a speedvac. The residue in each vial was dissolved in 250 ~L N methylpyrolidin-2-one (NMP), and 120 ~,L triethylamine (TEA) and 160 ~.L
TEA~3HF
were added. This mixture was brought to 65°C for 2h. After cooling to ambient temperature, 1.5 mL NMP and 1 mL of ethoxytrimethylsilane were added. After 10 min, the oligoribonucleotide was precipitated by adding 3 mL of ether. The pellets were collected by centrifugation, the supernatants were discarded, and the solids were reconstituted in 1 mL buffer 10 mM sodium phosphate.
3. Purification of oli~oribonucleotides Crude oligonucleotides were purified by reversed phase HPLC on an AKTA
Explorer system (Amersham Biosciences) using a 16/10 HR column (Amersham Biosciences) packed to a bed height of 10 cm with Source RPC 15. Buffer A was 10 mM sodium phosphate and buffer B
contained 65% acetonitrile in buffer A. A flow rate of 6.5 mLlmin was employed. UV traces at 260, 280, and 290 nm were recorded. For DMT-on oligoribonucleotides a gradient of 7% B to 45% B within 10 column volumes (CV) was used and for cholesterol-conjugated RNA a gradient of 5% B to 100% B within 14 CV was employed. Appropriate fractions were pooled and concentrated under reduced pressure to roughly 10 mL. DMT-on oligonucleotides were treated with one-third volume 1M NaOAc, pH 4.25 for several hours at ambient temp.
Finally, the purified oligonucleotides were desalted by size exclusion chromatography on a column containing Sephadex G-25. The oligonucleotide solutions were concentrated to a volume <15 mL. The concentrations of the solutions were determined by measurement of the absorbance at 260 nm in a UV spectrophotometer. Until annealing the individual strands were stored as frozen solutions at -20°C.
4. Analysis of oli~oribonucleotides Cholesterol conjugated RNA was analyzed by CGE and LC/MS. Unconjugated RNA was also analyzed by IEX-HPLC. CGE analysis was performed on a BeckmanCoulter PACE
MDQ
CE instrument, equipped with a fixed wavelength detector at 254 nm. An eCap DNA capillary (BeckmanCoulter) with an effective length of 20 cm was used. All single stranded RNA samples were analyzed under denaturing conditions containing 6 M urea (eCap ssDNA100 Gel Buffer I~it, BeckmanCoulter) at 40°C. Samples were injected electrokinetically with 10 kV for 5-8 sec.
The run voltage was 15 lcV.
IEX HPLG analysis was performed on a Dionex BioLC system equipped with a fixed wavelength detector (260 and 280 nm), column oven, autosampler, and internal degasser. A
Dionex DNAPac P100 column (4*250mm) was used as at a flow rate of 1.0 mL/min and 30°C.
Unconjugated RNA (20 ~,L, 1 OD/mL concentration) was injected. Eluent A
contained 20 mM
Na2HP04, 10 mM NaBr, 10% acetonitrile, pH 11 and Eluent B was 1 M NaBr in Eluent A. The elution started with 20% B for 1 min and then a linear gradient with a target concentration of 80% B over 20 min was employed.
LC-MS analysis was performed on an Ettan ~,LC-system (Amersham Bioscience) equipped with a Jetstream column heater and a fixed wavelength detector (254nm). A
ThermoFinnigan LCQ DecaXP ESI-MS system with micro-spray source and ion trap detector was coupled online to the HPLC. Oligonucleotide samples (25 ,uL sample, 1 ODImL
concentration in water for unconjugated RNA and 40 ~L for cholesterol-conjugated RNA) were injected onto a Waters Xterra C8 MS column (2.1 x 50 mm; 2.5 ~m particle size) with a flow rate of 200 ~.L/min at 60°C. Composition of eluent A was 400 mM
hexafluoroisopropanol (HFIP), 16.3 mM TEA in HzO, pH 7.9 and eluent B was methanol. For unconjugated RNA
elution started with 7% B for 3 min and then a gradient from 7% B to 25% B in 13 min was used. For cholesterol-conjugated material the starting conditions were 35% B
for 3 min and then the concentration of eluent B was increased to 75% B in 30 min. Analysis figures are provided in Table 6.
5. Annealing of oli~oribonucleotides Complementary strands were annealed by combining equimolar RNA solutions. The mixture was lyophilized and reconstituted with an appropriate volume of annealing buffer (100 mM NaCI, 20 mM sodium phosphate, pH 6.8) to achieve the desired concentration.
This solution was placed into a water bath at 95°C and then cooled to ambient temp.
within 3h. Extent of duplex formation was monitored by native 10% polyacrylamide gel electrophoresis (PAGE) and bands were visualized by staining with the "stains all" reagent (Sigma).
RNA Synthesis using "standard" de~rotection monomers including ribo and 2'-O-methyl phos~horamidites.
A. RNAl2'OMe (Thioate ends) The chimeric RNA molecules with 2'-OMe nucleotides were synthesized on a 394 ABI
machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was CPG (SOOA). The monomers were either RNA
phosphoramidites or 2' OMe RNA phosphoramidites with standard protecting groups and used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated. Specifically the RNA
phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl) phosphoramidite , 5'-O-Dimethoxytrityl-N2-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-0-Dimethoxytrityl-N4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'-O-(,Q-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite; the 2'OMe RNA
phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-methyl-adenosine-3'-O-(,Q-cyanoethyl-N,N'-diisopropyl) phosphoramidite, 5'-O-Dimethoxytrityl-NZ-isobutyryl-2'-O-methyl-guanosine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-methyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-O-methyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min for all monomers. Details of the other reagents are as follows:
Activator: 5-(ethylthio)-1H-tetrazole (0.25M); Cap A: 5% acetic anhydride/THF/pyridine; Cap B: 10% N-methylimidazole/THF. Phosphate oxidation involved THBP (10% in ACN) for 10 min while phosphorothioate oxidation utilized 0.05 M EDITH reagent /acetonitrile.
Detritylation was achieved with 3% TCA/dichloromethane. The DMT protecting group was removed after the last step of the cycle.
After completion of synthesis the controlled pore glass (CPG) was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and simultaneously the base and phosphate groups deprotected with 1.0 mL of a mixture of ethanolic methylamine:ammonia (8 M
methylamine in ethanol/ 30% aq ammonia) (1:1) for 5 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL centrifuge tube; this was followed by washing three times with 0.25 mL of 50% acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 uL of NMP/Bt3N/Et3N-HF and heated at 65°C for l.Sh to remove the TBDMS groups at the 2'-position.
The oligonucleotides were then precipitated in dry diethyl ether (400 uL) containing Et3N (1%). The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual ether was removed in the speed vacuum to give the "crude" RNA as a white fluffy material. Samples were dissolved in 1mL RNase free water and quantitated by measuring absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by HPLC. The crude oligonucleotides were analyzed and purified by Reverse Phase IonPair (RP IP) HPLC. The RP
HPLC analysis was performed on a Gilson LC system, equipped with a fixed wavelength detector (260 and 280 nm), column oven, autosampler and internal degasser. An XTerra C18 column (4.6*250mm) was used at a flow rate of 1.0 mL/min at 65°C. RNA
(20 ~,L for analytical run, 1 mL for a preparative run at 1 OD/mL concentration) was injected. Eluent A contained 0.1 M TEAAc, HPLC water, pH 7.0 and Eluent B was 0.1 M TEAAc in HPLC water, 70%
acetonitrile, pH 7Ø The elution started with 10% B for 2 min, followed by 25% B in 4 min and then a linear gradient with a target concentration of 50% B over another 30 min was employed.
The purified dry oligonucleotides were then desalted using Sephadex G25M .
B. Synthesis of oli~onucleotides with 2'-Fluoro modifications The RNA molecules were synthesized on a 394 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was CPG
(SOOA, TsT AG 001 from AM Chemicals LLC and the rC and rU were from Prime Synthesis).
The monomers were either RNA phosphoramidites or 2' F phosphoramidites with standard protecting groups and used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated. Specifically the RNA phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl) phosphoramidite , 5'-O-Dimethoxytrityl-NZ-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-0-tbutyldimethylsilyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite; the 2'F RNA
phosphoramidites were 5'-O-Dimethoxytrityl-N4-acetyl-2' fluoro-2'-deoxy-cytidine-3'-O-(,~-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2' fluoy~o -2'-deoxy-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min for all monomers. Details of the other reagents are as follows: Activator: 5-ethyl thiotetrazole (0.25 M); Cap A: 5% acetic anhydride/THF/pyridine; Cap B: 10% N-methylimidazole/THF;
phosphate oxidation involved THBP (10% in ACN) for 10 min while phosphorothioate oxidation utilized 0.05 M EDITH reagent/acetonitrile. Detritylation was achieved with 3%
TCA/dichloromethane. The DMT protecting group was removed after the last step of the cycle.
After completion of synthesis, CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic ammonia (1:3) for 7 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube; this was followed by washing three times with 0.25 mL of 50% acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 uL of NMP/Et3N/Et3N-HF and heated at 50°C for 16 h to remove the TBDMS groups at the 2'position.
The oligonucleotides were then precipitated in dry diethyl ether (400 uL) containing Et3N (1 %).
The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual ether was removed in the speed vacuum to give the "crude" RNA as a white fluffy material. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm.
This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by HPLC. The purified dry oligonucleotides were then desalted using Sephadex G25M.
C. Synthesis of phosphorothioate RNA oli~oribonucleotides The oligonucleotides were synthesized on a 394 ABI machine (ALN 0208) using the standard 93 step cycle written by the manufacturer with modiftcations to a few steps as described below. The solid support was controlled pore glass (CPG, 2 .mole rA GPG, 520A, or rU CPG, SOOA). The monomers were RNA phosphoramidites with standard protecting groups used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated.
Specifically the RNA
phosphoramidites were 5'-O-Dimethoxytrityl- N6-benzoyl-2'-O-tbutyldimethylsilyl- adenosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl) phosphoramidite , 5'-O-Dimethoxytrityl-Nz-isobutyryl-2'-O-tbutyldimethylsilyl- guanosine-3'-O-( (~-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl- N4-acetyl-2'-O-tbutyldimethylsilyl- cytidine-3'-O-( ~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min. Details of the other reagents are as follows: activator: 5-ethyl thiotetrazole (0.25M);
Cap A: 5°~o acetic anhydride/THF/pyridine; Cap B:10% N-methylimidazole/THF; PS-oxidation, O.OSM
EDITH
reagent /acetonitrile. Detritylation was achieved with 3% TCA/dichloromethane.
After completion of synthesis the CPG was transferred to a screw cap sterile microfuge tube. The oligonucleotide was cleaved and simultaneously the base and phosphate groups deprotected with 1.0 mL of a mixture of ethanolic methylamine:ammonia (1:1) for 5 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a S mL
centrifuge tube; this was followed by washing with 3 x 0.25 mL of 50%
acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 ~,L of TEA'3HF and heated at 65°C
for 1.5 h to remove the TBDMS groups at the 2'-position. The oligonucleotides were then precipitated by addition of 400 ~,L dry MeOH. The liquid was removed after spinning in a microcentrifuge for 5 minutes on the highest speed available. Residual methanol was removed in speed vacuum. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm. The crude material was stored at -20°C. The oligonucleotides were analyzed and purified by HPLC and then desalted using Sephadex G25M.
Example 9. Synthesis of oli~onucleotides with alternating 2'-F RNA and 2'O-Me RNA
Table 7 A. Synthesis of CPGs for 2'F.
CPGs of 5'-O-DMTr-2'-deoxy-2'-fluororibonucleosides with appropriate base protection were synthesized as shown in Scheme A. 5'-O-DMTr-2'-Deoxy-2'-fluoro-NBZ-A and 5'-O-DMTr-2'-Deoxy-2'-fluoro-N'B°-G were synthesized as reported (Kawasaki et al., J. Med. Chena., 1993, 36, 831). Reaction of compounds 1001 with succinic anhydride in the presence of DMAP
in ethylenedichloride yielded compound 1005. Compound 1005 was treated with 2,2'-dithiobis(5-nitropyridine) (DTNP) and firiphenylphosphine in the presence of DMAP in acetonitrile-ethylenedichloride and subsequently with lcaa CPG as reported by Kumar et al.
(Nucleosides & Nucleotides, 1996, I5, 879) yielded the desired CPG 1009.
Loading of the CPG
was determined as reported in the literature (Prakash et al., J. O>~g. Che~n., 2002, 67, 357). CPGs of suitably protected 2'-deoxy-2'-fluoro A, C and G were obtained as described above (Scheme A).
Scheme Aa: lcaa CPG of 2'-deoxy-2'-F A(NBZ), C(NA~), G(N'B°) and U
DMTrO-i " B DMTrO~B DMTrO~B
OH F HO O F CPG N~O F
O H O
1001 B = U 1005 B = U 1009 B = U; Loading: 97.09 gM/g 1002 B = C(NA~) 1006 B = C(NA°) 1010 B = C(N~°); Loading: 95.30 gM/g 1003 B = A(NBZ) 1007 B = A(Ne~) 1011 B = A(NaZ); Loading: 79.10 ~M/g 2~ 1004 B = G(N'$") 1008 B = G(N'$°) 1012 B = G(N'~"); Loading: 91.13 ~M/g a (i) Succinic anhydride, DMAP/EDC (ii) DTNP, Ph3P, DMAP and lcaa CPG.
The chimeric RNA molecules with alternating 2'-F RNA and 2'O-Me RNA were synthesized on a 394 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support were GPG (SOOA). The monomers were either 2'-F RNA phosphoramidites or 2' OMe RNA phosphoramidites with standard protecting groups and used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated.
Specifically the 2'OMe RNA phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-methyl-adenosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl) phosphorarnidite, 5'-O-Dimethoxytrityl-N2-isobutyryl-2'-O-methyl-guanosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-methyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O~-Dimethoxytrityl-2'-O-methyl-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The 2'F RNA
phosphoramidites 5'-O-Dimethoxytrityl-N4-acetyl-2'-fluoro-2'-deoxy-cytidine-3'-O-((d-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-2'-fluoro-2'-deoxy-uridine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. 5'-O-Di~nethoxytrityl-2'-fluoro-NZ-isobutyryl-2'-deoxy-guanosine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite and 5'-O-Dimethoxytrityl-2'-fluoro- Nz-isobutyryl-2'-deoxy-guanosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite. The coupling times were 10 min for all monomers.
Details of the other reagents are as follows: Activator: 5-ethyl thiotetrazole (0.25M); Cap A: 5% acetic anhydride/THF/pyridine; Cap B: 10% N-methylimidazole/THF; phosphate oxidation involved 0.02M I2/THF/H20, while PS-oxidation was carried out using EDITH reagent as described above. Detritylation was achieved with 3% TCA/dichloromethane. The final DMT
protecting group was removed in the synthesizer.
After completion of synthesis the CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic:ammonia (1:3) for 7 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube; this was followed by washing three times with 0.25 mL of 5 O% acetonitrile. The tubes were cooled at -80°C for 15 min before drying in a lyophilizer to give the "crude" RNA
as a white fluffy material. Samples were dissolved in 1mL RNase free water and quantitated by measuring the absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by 20% polyacrylimide denaturing gels. The purified dry oligonucleotides were then desalted using Sephadex G25M
(Amersham Biosciences).
B. Anal ~sis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 7 and Figure 30 provides graphs of the activities in HeLa cells for each of the modifications described above.
Example 10 Coniu~ated VEGF molecules (Tables 8, 9, 10 and 18) 1. Synthesis:
The RNA molecules were synthesized on an ABI-394 machine (Applied Biosystems) using the standard 93 step cycle written by the manufacturer with modifications to a few wait steps as described below. The solid support was controlled pore glass (CPG, lumole, 500 A) and the monomers were RNA phosphoramidites with standard protecting groups (5'-O-dimethoxytrityl-N6-benzoyl-2'-O-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-O-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-O-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-O-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite. All amidites were used at a concentration of 0.15M
in acetonitrile (CH3CN) and a coupling time of 6 min for unmodified and 2'-O-Me modified monomers and 12 min for modified and conjugated monomers. 5-ethyl thiotetrazole (0.25M) was used as an activator. For the PO-oxidation Iodine/WaterlPyridine and for PS-oxidation Beaucage reagent (2 %) in anhy. acetonitrile was used. The sulfurization time was about 6 min. All syntheses was performed on a 1 umole scale.
Reagents Concentration Wait or Cou ling ste Activator: 0.25M 5-Ethylthio-1H-tetrazole720 sec PO-oxidation 0.02M Iodine in THF/Water/Pyridine20 sec PO-oxidation 0.02M t-Butyl-hydrogen peroxide600 sec PS-oxidation 2 % Beaucage reagent /anhy.360 Sec (200 Acetonitrile sec, wait +30 sec pulse+130 sec wait Gap A 5% 5%Phenoxyacetic 20 sec anhydride/THF/pyridine Ca B 10% 10% N-methylimidazole/THF20 sec Detritylation 3% TCA Trichloro Acetic Acid 70 sec /dichloromethane The following types of modifications were used to perforrri the synthesis using these protocols:
1. Unmodified phosphodiester backbone (PO) only 2. Phosphorothioate (PS) only 3. 2'-O-Me, PS
4. 3'-Naproxen, 2'F- SMe-U, PS
5. 5'-Cholesterol, PS
6. 3'-Choletserol,PS
7. 2'F- SMe-U, PS
8. 3'-Biotin, 2'F- SMe-U, PS
9. 3'-cholanic acid, 2'F-SMe-U, PS
10. Methylphosphonate 11. C-5 allyamino rU
2. De~rotection- I (Nucleobase Deprotection) After completion of the synthesis, the controlled pore glass (CPG) was transferred to a screw cap vial or screw cap RNase free microfuge tube. The oligonucleotide was cleaved from the support and the base and phosphate protecting groups were simultaneously removed by using of a mixture of ethanolic ammonia (ammonia (28-30 % : ethanol (3:1))- (1.0 mL) for 15h at 55°C. The vial was cooled briefly on ice and then the ethanolic arrLrnonia mixture was transferred to a new microfuge tube. The CPG was washed with portions of deionized water (2 x 0.1 mL).
The supernatant was combined, cooled in dry ice for 10 min and then dried in a speed vac.
3. Deprotection-II (Removal of 2'-O- TBDMS group) The white residue obtained was resuspended in a mixture ~f triethylamine, triethylamine trihydrofluoride (TEA.3HF ca. 24% HF)) and 1-Methyl-2-Pyrrolidinone (NMP) (4:3:7) (400 ul) and heated at 65°C for 90 min to remove the tent-butyldimethylsilyl (TBDMS) groups at the 2'-position. The reaction was then quenched with isopropoxytrimethylsilane (iPrOMe3Si, 400 ul) and further incubated on the heating block leaving the caps open for l Omin;
This causes the volatile isopropoxytrimethylsilylfluoride adduct to vaporize. The residual quenching reagent was removed by drying in a speed vac. 3% Triethylamine in diethyl ether ( 1.5 ml) was added.
The mixture was subjected to centrifugation. A pellet of RNA formed. The supernatant was pipetted out without disturbing the pellet. The pellet was dried in a speed vac. The crude RNA
was obtained as a white fluffy material in the microfuge tube.
4. Ouantitation of Crude Oli~omer or Raw Analysis Samples were dissolved in deionized water (l.OmL) and quantitated as follows:
Blanking was first performed with water alone (1mL). A sample of the RNA solution (20u1) was diluted with water (980 uL) and mixed well in a microfuge tube, then transferred to a cuvette and the absorbance reading was obtained at 260 nm. The crude material was dried down and stored at -°C
5. MS anal, The crude samples (0.1 OD) analyzed using LC-MS.
6. Purification of Oli~omers (a) Pol~ylamide Gel Electrophoresis (PAGE) Purification The oligonucleotides were purified by vertical slab polyacrylamide gel electrophoresis (PAGE) using an Owl's Separation Systems (Portsmouth, NH). Electrophoresis grade acrylamide (40%), N,N'-methylene-bis(acrylamide) (BIS), ammonium persulfate (APS, N,N,NN'-tetramethylenediamine (TEMED), bromophenol blue (BPB), xylene cyanol (XC) 10 x TBE (0.89 M tris-hydroxy-methylaminomethane, borate pH 8.3, 20mM disodium ethylenediaminetetraacetate) were from National Diagnostics (Atlanta, GA). The denaturing gel was prepared for purification of unmodified and modified oligoribonucleotides.
The thickness of the preparative gels was 1.5 mm. Loading buffer was 80%
formamide in l Ox TBE. After removal of the glass plates, the gels were covered with Saran Wrap° and placed over a fluorescent TLC plate illuminated by a hand-held UV lamp for visualization. The desired bands were excised and shaken overnight in 2mL of water or 0.03 M Sodium Acetate. The eluent was removed by drying in a speed vac.
f b) High Performance Liduid chromato -g-raph~(HPLC) Purification:
Condition A: Purification of unmodified, 2'-O-Me/PS Oligoribonucleotides:
Amount of injected sample is about 100 OD.
Column: Dionex PA-100 Semiprep.
Buffer A: Water Buffer B: 0.25 M Tris.Cl pH 8.0 Buffer C: 0.375 M Sod.Perchlorate Heating: 65 °C
Time Flow Buffer Buffer Buffer TotalYieldPurity A B C
0 5.00 88 % 10 % 2.0 % 40-60% 85-98 3.0 5.00 88% 10% 2.0%
30.0 5.00 57.0 10 % 33.0 35.0 5.00 88% 10% 2.0%
40.0 5.00 88% 10% 2.0%
Condition B: Protocols for Purification of 2'-O-Me/PS Oligoribonucleotides:
Column: Dionex PA-100 Semiprep.
Buffer A: Water Buffer B 0.25 M Tris.Cl pH 8.0 Buffer C 0.8 M Sod.Perchlorate Heating: 65 °C
Time Flow Buffer Buffer Buffer Total Purity A B C
Yield 0 5.00 88 % 10 % 2.0 % ~40-60% 85-98 3.0 5.00 88% 10% 2.0%
30.0 5.00 57.0 10 % 33.0 35.0 5.00 88 % 10 % 2.0 40.0 5.00 88% 10% 2.0%
7. Desalting~of Purified Oli.gomer The purified dry oligomer was then desalted using Sephadex G-25 M. The cartridge was conditioned with 10 mL of deionised water thrice. Finally the purified oligomer dissolved thoroughly in 2.SmL RNAse free water was applied to the cartridge with a very slow drop-wise elution. The salt free oligomer was eluted with 3.5 ml deionized water directly into a screw cap vial. The purified RNA material was dried down in speed vac and stored at -20°C.
Biotin conlu~ated siRNAs (Table 10) 1. Synthesis:
The RNA molecules were synthesized on an ABI-394 machine (Applied Biosystems) using the standard 93 step cycle written by the manufacturer with modifications to a few wait steps as described below. The solid support was controlled pore glass (CPG, lumole, 500 A) a.nd the monomers were RNA phosphoramidites with standard protecting groups (5'-O-dimethoxytrityl N6-Benzoyl-2'O-t-butyldimethylsilyl- adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, S'-O-dimethoxytrityl-N4-acetyl-2'-O-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-O-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-O-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite. The modified CPG and amidites were synthesized using known methods and as described herein. . All amidites were used at a concentration of O.15M in acetonitrile (CH3CN) and a coupling time of 6 min for unmodified and 2'-O-Me monomers arid 12 min for modified and conjugated monomers. 5-Ethylthio-1H-tetrazole (0.25M) was used as an activator. For the PO-oxidation Iodine/Water/Pyridine and for PS-oxidation Beaucage reagent (2 %) in anhy. acetonitrile was used. The sulfurization time is about 6 min. For synthesis of 3'-biotin conjugated siRNAs, t-butyl-hydrogen peroxide was used as oxidizing agent (oxidation time 10 min).
Reagent Concentration Wait or Cou ling ste Activator: 0.25M 5-Ethylthio-tetrazole 300 sec for unmodified and 720 sec for modified oligos.
PO-oxidation 0.02M Iodine in THF/waterl 20sec yridine PO-oxidation 0.02M t-Butyl-hydrogen peroxide600 sec PS-oxidation 2 % Beaucage reagent /anhy.360 Sec (200 Acetonitrile sec, wait +30 sec pulse+130 sec wait Cap A 5% 5% Phenoxyacetic 20sec anhydride/THF/ yridine Cap B 10% 10% N- 20sec Methylimidazole/THF
Detritylation 3% TCA Trichloro Acetic 70sec Acidldichloromethane 2. De~rotection- I (Nucleobase Deprotectionl After completion of synthesis the controlled pore glass (CPC) was transferred to a screw cap vial or a screw cap RNase free microfuge tube. The oligonucleotide was cleaved from the support with the simultaneous removal of base and phosphate protecting groups with a mixture of ethanalic ammonia [ammonia (2$-30%): ethanol (3:1) 1.0 mL] for 15h at 55°C. The vial was cooled briefly on ice and then the ethanolic ammonia mixture was transferred to a new microfuge tube. The CPC was washed with portions of deionized water (2 x 0.1 mL). The combined filtrate was then put in dry ice for 10 min dried in a speed vac.
3 DeRrotection-II (Removal of 2'-O- TBDMS Q;roupl The white residue obtained was resuspended in a mixture of triethylamine, triethylamine trihydrofluoride (TEA.3HF ca, 24% HF) and 1-Methyl-2-Pyrrolidinone (NMP) (4:3:7) (400 ul) and heated at 65°C for 90 min to remove the tent-butyldimethylsilyl (TBDMS) groups at the 2'-position. The reaction was then quenched with isopropoxytrimethylsilane (iPrOMe3Si, 400 ul) and further incubated on the heating block leaving the caps open for l Omin;
(This causes the volatile isopropxytrimethylsilylfluoride adduct to vaporize). The residual quenching reagent was removed by drying in a speed vac. 3% Triethylamine in diethyl ether (1.5 ml) was added and the mixture was subjected to centrifugation to afford a pellet of RNA. The supernatant was pipetted out without disturbing the pellet. The pellet was dried in a speed vac. The crude RNA was obtained as a white fluffy material in the microfuge tube.
4. Ouantitation of Crude Oli~omer or Raw Analysis Samples were dissolved in deionized water (l.OmL) and quantitated as follows:
Blanking was first performed with water alone (1mL). A sample of the RNA solution (20u1) was diluted with water (980 uL) and mixed well in a microfuge tube, then transferred to a cuvette and the absorbance reading was obtained at 260 nm. The crude material was dried down and stored at -20°C.
5. MS analysis:
Samples of the RNA ( 0.1 OD) were analyzed using MS.
6. Purification of Olipomers Pol~ac~lamide Gel Electrophoresis (PAGE) Purification The oligonucleotides were purified by vertical slab polyacrylamide gel electrophoresis (PAGE) using an Owl's Separation Systems (Portsmouth, NH). Electrophoresis grade acrylamide (40%), N,N'-methylene-bis(acrylamide) (BIS), ammonium persulfate (APS, N,N,NN'-tetramethylenediamine (TEMED), bromophenol blue (BPB), xylene cyanol (~C) 10 x TBE (0.89 M). Trishydroxy-methylaminomethane, borate (pH 8.3), 20mM disodium ethylenediaminetetraacetate) were from National Diagnostics (Atlanta, GA). The Denaturing gel was prepared for purification of oligoribonucleotides. The thickness of the preparative gel was 1.5 mm. Loading buffer was 80% formamide in l Ox TBE.
After removal of the PAGE glass plates, the gels were covered with Saran Wrap and placed over a fluorescent TLC plate illuminated by a hand-held UV lamp (Upland, CA) for visualization.
The desired bands were excised and shaken overnight in water (2mL) or 0.03 M sodium acetate. The eluent was removed and dried in a speed vac. All biotin conjugated sequences were purified by PAGE.
7. Desalting of Purified Oligomer The purified dry oligomer was then desalted using Sephadex G-25 M (Amersham Biosciences). The cartridge was conditioned with of deionized water thrice (10 mL each).
Finally the purified oligomer dissolved thoroughly in 2.SmL RNAse free water was applied to the cartridge with very slow drop- wise elution. The salt free oligomer was eluted with deionized water (3.5 ml) directly into a screw cap vial. The purified RNA material was dried down on speed vac and stored at -20°C
8~ualit~Control (a) Capillary Gel Electrophoresis (CGE) (b) Electrospray LC/Ms A sample of the oligomer (approx. 0.10 OD) was dissolved in water (50 ul & 100 ml in separate tubes) and then pipetted into special vials for GGE and LC/MS
analysis.
9. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Tables 8, 9, 10 and 18 and Figures 31-35 provides data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 11 Coniu~ation of retinoids to RNA (Table 14) Conjugation of all-ts°aras-retinal to Oli~onucleotides (RNA
Phoshoramidite 104 was synthesized as shown in Scheme B for retinal conjugation to oligonucleotides.
Scheme B: Synthesis of Post-synthetic conjugation building blocks for retinal conjugation - oxime approach 1 for 5'-conjugation.
BnO~OH ~ Bn0~0-N ~ o ~~ HO~O-N
iii N O
i NC~O.P~O~O-N
a (i) Ph3P, DIAD, N hydroxyphthalimide / MeCN; (ii) H2, Pd-C (10 %), 1 atm/ETOAc;
(iii) Phosphitylation Step l: Compound 102:Monobenzylpentan-1,5-diol (15.70 g, 80.82 mmol), Ph3P
(25.43 g, 96.84 mmol) and and N hydroxyphthalimide (1 l6.Og, 98.08 mmol) were taken in anhydrous CH3CN (100 ml) under argon atm. Neat DIAD(20.0 mL, 103.25 mmol) was added dropwise into the stirring solution over a period of 20 minutes and the stirnng was continued for 24h. The reaction was monitored by TLC. Solvents were removed ih vacuo; and the residue was triturated with diethyl ether and filtered. Residue was washed with ether, filtered and combined the filtrate.
Hexane was added dropwise into the filtrate until it gave turbidity and subsequently the solution was made homogeneous by adding ether into it. The homogeneous solution was stored at 5 °C
for 24 h. Precipitated Ph3PO was filtered off, washed with ether-hexane mixture (1:1). Combined filtrate was evaporated to dryness and the residue was purified by flash silica gel column chromatography (10-15 % EtOAc in Hexane) to obtain 24.5 g (89.3 %) of compound 102 as a viscous pale yellow oil. 1H NMR (400 MHz, CDC13, 25 °C): 7.84-7.82 (m, 2H); 7.75-7.73 (m, 2H); 7.34-7.33 (m, 4H); 7.29-7.26 (m, 1H); 4.51 (s, 2H); 4.22-4.18 (t, J(H,H) = 6.71 Hz, 2H);
3.52-3.48 (t, J(H,H) = 6.4 Hz, 2H); 2.04-1.78 (m, 2H); 1.73-1.56 (m, 4H). 13C
NMR (100 MHz, CDC13, 25 °C): 163.9, 138.8, 134.6,129.2, 128.6, 127.8, 127.7, 123.7, 78.6, 73.1, 70.3, 29.6, 28.2, 22.5.
Std Compound 103: Compound 102 (23.5 g, 69.29 mmol) was taken in 100 ml of EtOAc/methanol (1:1). The mixture was degassed and purged with argon, to this 2.4 g of Pd-C
(10%- wet Degusa type) was added. The mixture was then hydrogenated overnight, filtered through a celite bed over a sintered funnel. The residue was subsequently passed through a column of silica gel and eluted out using 40 % EtOAc in hexane to obtain compound 103 (15.70 g, 90.9 %) as a white solid. 1H NMR (400 MHz, CDCl3, 25 °C) 7.83-7.81 (bm. 2H); 7.75-7.73 (bm, 2H); 4.23-4.19 (t, J(H,H) = 6.4 Hz, 2H); 3.70-3.66 (t, J(H,H) = 5.80 Hz, 2H); 1.83-1.79 (m, 2H); 1.67-1.60 (m, 4H). 13C NMR (100 MHz, CDCl3, 25 °C) D 163.9, 134.7, 129.1, 123.7, 78.6, 62.7, 32.4, 28.0, 22Ø
St_ ep 3: Compound 104: Compound 103 (5.4 g, 21.67 mmol) and triethylamine (4 ml, 28.69 mmol) were taken in anhydrous EtOAc(30 ml) under argon. 2-Cyanoethyl diisopropylchlorophosphoramidite (S.OOmI, 21.97 mmol) was added to the reaction mixture dropwise. A white precipitate of Et3N.HCl was formed immediately after the addition of the reagent and the reaction was complete in 10 min (monitored by TLC). The precipitate was filtered through a sintered funnel and solvent was removed under reduced pressure. The residue was directly loaded on a silica gel column for purification. Eluted with hexane/EtOAc 9:1 to afford compound 104 as a yellow oil, 8.68g (89.13%). 1H NMR (400 MHz, CDC13, 25 °C) D
7.85-7.81 (m, 2H); & 7.77-7.72 (m, 2H); 4.22-4.19 (t. J(H,H) = 6.80 Hz, 2H);
3.91-3.76 (m, 2H);
3.72-3.53 (m, 4H)2.67-2.63 (t, J(H,H) = 6.71 Hz, 2H); 1.86-1.78 (m, 2H); 1.73-1.66 (m, 2H);
1.62-1.56 (m, 2H); 1.19-1.16 (m, 12H). 31P NMR (162 MHz, CDCl3, 25 °C) 8 145.09. 13C NMR
(100 MHz, CDCl3, 25 °C) 8 163.9, 134.7, 129.2, 123.7, 117.9, 78.6, 64.0, 63.4, 58.7, 58.5, 43.2, 43.1, 31.1, 31.0, 28.1, 24.9, 24.8, 24.7, 22.3, 20.6, 20.5.
Step 4: Conjugation of all-trayas-retinal to Olig~onucleotide: All-traps-retinal was conjugated to oligonucleotide as shown in the Scheme C. Compound 104 was coupled to solid bound oligonucleotide 105 under standard solid phase oligonucleotide synthesis conditions to obtain compound 106. Phthalimido protecting group on compound 106 was selectively removed by treating with hydrazinium hydrate as reported by Salo et al. (Bioconjugate C'hena. 1999, 10, 815) to obtain compound 107. Treatment of compound 107 with all-tr~aras-retinal under dark condition gave compound 108 as reported in the literature (Biocoyajugate Claem. 1999, 10, 815).
Standard RNA oligonucleotide deprotection and purification under dark yielded the desired oligonucleotide-retinal conjugate 109. Compound 109 was also obtained from compound 110 as shown in Scheme C. Complete deprotection and purification of compound 106 yielded an unbound free oligonucleotide 110 which was subsequently reacted with all-traps-retinal to afford the desired compound 109.
Scheme C: Conjugation of all-tans-retinal to oligonucleotides O g~ 5, O ~ P. e~ W
CPG H~O OH ~ CPG H~O O O~ O N
O O
v ii O
O
CPG N~O O ~\O~O-NH2 HO O~~O~O-NHp H O 107 ~CN
iii iv O
i i 5, 3.
W -N-O~O'~ O OH
a (i) Phosphoramidite 104, (standard oligonucleotide synthesis cycle); (ii) Hydrazinium hydrate/Py/AcOH (0.124/4/7); (iii) all-traps-retinal in DMF or MeCN; (iv) Oligonucleotide (RNA) deprotection (MeNHz, TEA.3HF) and purification; (v) Oligonucleotide (RNA) deprotection (MeNH2, TEA.3HF) and purification; (vi) all-traps-retinal in DMSO-Step 4.1. Oli~onucleotide Synthesis:
All oligonucleotides except AL-3166 were synthesized on an ABI 490 DNA
synthesizer.
Commercially available controlled pore glass solid supports (dT-CPG and U-CPG, 500th) and RNA phosphoramidites with standard protecting groups, 5'-O-dimethoxytrityl-N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite were used for the oligonucleotide synthesis. All phosphoramidites were used at a concentration of O.15M in acetonitrile (CH3CN). Coupling time of 10 minutes was used. The activator was 5-ethyl thiotetrazole (0.25M), for the PO-oxidation Iodine/Water/Pyridine was used.
Sequence AL-3166 was synthesized on the AKTAoligopilot synthesizer. All phosphoramidites were used at a concentration of 0.2M in acetonitrile (CH3CN) except for guanosine which was used at 0.2M concentration in 10% THF/acetonitrile (v/v).
Coupling/recycling time of 16 minutes was used. The activator was 5-ethyl thiotetrazole (0.75M), for the PO-oxidation Iodine/Water/Pyridine was used and for the PS-oxidation PADS
(2 %) in 2,6-lutidine/ACN (l:l v/v) was used.
The aminooxy-linker phosphoramidite was synthesized as described above and used at a concentration of O.15M in acetonitrile. Coupling time for the aminooxy-linker phosphoramidite was 15 minutes. For all sequences, coupling of the aminooxy-linker phosphoramidite was carried out on the ABI 390 DNA synthesizer.
Step 4.2. Cleavag-a of the phthalimido-protectin~L~roup from the aminoxy-linker oli~onucleotides After coupling of the aminooxy-linker, the CPG was treated with 2.5 ml of O.SM
hydrazinium acetate in pyridine (0.16/4/2 hydrazine anhydrous, pyridine, acetic acid) using the dual syringe method. Every 5 minutes the syringes were pushed back and forth to get new solution on the CPG. After the hydarzinium acetate treatment, the CPG was washed with 2x5 ml of pyridine followed by 3x5m1 of acetonitrile. Flushing with dry argon for 30 seconds then dried CPG.
Step 4.3. On support conjugation with the aldehydes The 1-pyrene-carboxaldehyde and the all-traps-retinal were from Aldrich and used at concentrations of O.SM in DMF. The 4-keto-retinol was used at a concentration of 0.13M in DMF. The CPG from above was added to the aldehyde solutions. Conjugation was carried out overnight (-V 16 hrs) at room temperature. After the reaction was complete, the CPG was rinsed with DMF followed by acetonitrile and air dried for 10-15 minutes. For sequence AL-3213, the conjugation with both all-tr-ans-retinal and 1-pyrene-carboxaldehyde was also carried out in acetonitrile. In the case of 1-pyrene-carboxaldehyde, the aldehyde did not fully dissolved at O.SM and the solution was used as is without filtration to get rid of the undissolved aldehyde.
Step 4.4. Deprotection- I (Nucleobase Deprotection) of on support conju ag ted oli~onucleotides For on support retinal conjugated oligonucleotides, the support was transferred to a 5 ml tube (VWR). The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 1 mL of 40% aq. methylamine 15 mins at 65°C. The tube was cooled briefly on ice and then the methylamine was filtered into a new 15 ml tube. The CPG was washed with 3 x 1 mL portions of DMSO.
Step 4.5. Deprotection-II (Removal of 2' TBDMS ~,roup) of on support conjuJ a~
ted oli~onucleotides To the above mixture was added 1.5 ml of triethylamine trihydrofluoride (TREAT-HF) and heated at 60°C for 15 minutes to remove the test-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction was then quenched with 5.5 ml of SOmM sodium acetate (pH 5.5) and stored in freezer until purification.
Step 4.6. After deprotection conjugation with aldehydes Conjugation with the aldehydes (1-pyrene-carboxaldehyde and all-traas-retinal) after deprotection of the aminooxy-linker oligonucleotides was also carned out as an alternative conjugation strategy.
Step 4.7. Deprotection- I (Nucleobase Deprotection) for after deprotection coniu-~-a~n The support was transferred to a 2 ml screw cap tube. The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 0.5 mL of 40% aq. methylamine 15 mins at 65°C. The tube was cooled briefly on ice and then the methylamine was filtered into a new 15 ml tube. The CPG was washed with 2 x 0.5 mL portions of 50% acetonitrile/water. The mixture was then frozen on dry ice and dried under vacuum on a speed vac.
Step 4.8. Deprotection-II (Removal of 2' TBDMS r~oup) for after deprotection conjugation The dried residue was resuspended in 0.5 ml of triethylamine trihydrofluoride (TEA.3HF) and heated at 60°C for 15 minutes to remove the tart-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction mixture was then cooled to room temperature and RNA
precipitated with 2 ml of dry methanol and dried under vacuum on a speed vac.
The sample was then dissolved in 2 ml of water and kept frozen in freezer till further analysis.
Step 4.9. Quantitation of Crude Oli~omer or Raw Analysis For all samples, a l~,l, a 10,1 or 30w1 aliqoute was diluted with 999.1, 990,1 or 970w1 of deionised nuclease free water ( 1.0 mL) and absorbance reading obtained at 260 nm.
Step 4.10. Purification of conjugated Oli omers ~) Cude LCIMS anal, The crude oligomers were first analyzed by LC/MS, to look at the presence and abundance of the expected final product.
(b) Reverse-phase purification The conjugated samples were purified by reverse-phase HPLC on an RPG-Sourcel5 column (21.5 x 1 cm). The buffer system was: A = 20 mM sodium acetate in 10%
ACN, pH 8.5 and B = 20 mM sodium acetate in 70% ACN, pH 8.5, with a flow rate of 5.0 mL/min, and wavelengths 260 and 375. The fractions containing the full-length oligonucleotides were then individually desalted.
Step 4.11. Desalting of purified oli~onucleotides The purified oligonucleotide fractions were desalted using the PD-10 Sephadex columns. First the columns were equilibrated with 25-30 ml of water. The samples were then applied in a volume of 2.5 ml. The samples were then eluted in salt-free fraction of 3.5 ml. The desalted fractions were combined together and kept frozen till needed.
Step 4.12. Capillary Gel Electrophoresis (CGE), Ion-Exchan.~e HPLC (IEX) and Electrospray LC/Ms Approximately 0.3 OD of desalted oligonucleotides were diluted in water to 300 ~l and then pipetted in special vials for CGE, IEX and LC/MS analysis.
Step 5 Conjugation of all-traps-retinal to 3'-end of Oli~onucleotides (RNA):
Phoshoramidite 116 for 5'-conjugation and CPG support 115 for 3'-conjugation of retinoids were synthesized as shown in the Scheme D. The CPG support 115 is used for 3' conjugation of retinoids to oligoriucleotides Scheme Da. Synthesis of Post-synthetic conjugation building blocks for retinal conjugation - oxime approach 2 for 3' and 5' conjugation.
HO TBDMSO>, TBDMSO, '~ODMTr ~ '~ODMTr i! ~ '~ODMTr ii~
O~NHCbz O~NHCbz O~N~OH
HO, ~ODMTr ~ N. P.O, N H 4 p ~ODMTr O
O N~O N ~ / NC°
N
114 O O O ~O-N
iv 116 O
O
CPG H~O, O ~ODMTr N O
H
O N~O N I /
O
a (i) TBDMS-C1, Imidazole/Py, rt; (ii) (a) HZ, Pd-C (10 %)/EtOAC-MeOH, 4 h and (b) ~-Caprolactone, TEA, 55 °C, 24 h; (iii) TEA.3HF/THF; (iv) (a) Succinic anhydride, DMAP/EDC, 24 h and (b) DTNP, Ph3P, DMAP followed by addition of lcaa CPG; (v) Phosphitylation Step 5.1: Compound 112: Compound 111 (120_0 g, 30.01 mmol) was stirred with TBDMS-Cl (5.43 g, 36.02 mmol) in the presence of imidazole (7.5 g, 110.16 mmol) in anhydrous pyridine ( 100 mL) overnight. After removing pyridine, the product was extracted into S ethyl acetate (300 mL), washed with aqueous sodium bicarbonate, followed by standard workup.
Residue obtained was subjected to flash silica gel column chromatography using 1 % methanol in dichloromethane as eluent to afford compound 112as a pale white solid (24.4 g, qunat. 1H
NMR (500 MHz, [D6]DMSO, 25 °C): ~ 7.33-7.13 (bm, 15H, accounted for 14H
after D20 exchange); 6.87-6.82 (bm, 4H); 5.01 (s, 0.2H, rotamer minor); 4.99 (s, 1.8H, rotamer major), 4.68-4.64 (m, 0.72 H, major rotamer); 4.14-4.07 (bm, 1H), 3.72 (s, 7H), 3.38-3.36 (m, 0.6H, rotamer minor); 3.26-3.21 (m, 1.4H, rotamer major); 3.08-3.07 (m, 0.3H, rotamer, minor); 2.99-2.89 (m, 2.7H, rotamer, major); 2.22-2.12 (m, 2H), 2.04-1.78 (m, 2H); 1.48-1.23 (m, 6H), 0.84, 0.82 (s, 9H, rotamers major and minor); 0.05 (d, J(H,H) = 1.5 Hz, 4.3H, rotamer major); 0.03-0.02 (d, J(H,H) = 5.5 Hz, 1.7H).
Step 5.2: Compound 113: Compound 112 (9.4 g, 14.54 mmol) was suspended in 15 mL
of ~i-caprolactone and 10 mL of TEA was added into the suspension. The reaction mixture was stirred under argon at 55 °C bath temperature for 24 h. Completion of the reaction was monitored by TLC analysis. TEA was removed form the reaction mixture ih vacuo and 150 mL
of dichloromethane-hexane (2:1 mixture) was added into the residue. The homogeneous solution thus obtained was directly loaded on a column of silica gel and eluted with dichloromethane-hexane (2:1) followed by neat dichloromethane. Elution of the silica column with 4 % methanol in dichloromethane afforded the desired compound 113 as a white solid (8.73 g, 78.9 %). 1H
NMR (400 MHz, [D6]DMSO, 25 °C) 8 7.72-7.68 (brn, 1H, exchangeable with DSO); 7.33-7.16 (m, 9H); 6.88-6.84 (m, 4H); 4.68-4.62 (m, 0.8H); 4.57-4.52 (m, 0.2H); 4.34-4.31 (t, J(H,H) _ 5.18 Hz, 1H, exchangeable with D20); 4.14-4.08 (bm, 1H); 3.74-3.67 (m, 7H);
3.39-3.32 (m, 3.3H); 3.25-3.21 (m, 1.7H); 3.09-2.88 (m, 4H) 6. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 14 and Figure 38 provides data and a graph of the activities in HeLa cells for each of the modifications described above.
Example 12 Conjugation of Polyethylene glycol to siRNA (Table 12) Amino linker oligonucleotides for PEG Conju ag tion General. Ion exchange preparative chromatography was performed on TSKgeI-SuperQ-SPW (Tosoh). Ion exchange analytical chromatography was performed on a DNAPac Pa100 (Dionex). Electron spray ionization mass spectra were recorded with an Agilent 1100 MSD-SL.
HPLC Techniques. The RNA was analyzed by ion-exchange chromatography (column, DNAPac Pa100, 4x250mm, analytical), heated to 30°C, flow rate 1.5 mL
miri 1, buffer A =
0.020M Na2HP04 in 10% CH3CN, pH 11; buffer B = buffer A + 1 M NaBr in 10%
CH3CN, pH
11, linear gradient from 0 to 75% in 53 min. The LC/ESI-MS conditions were as follows:
column XTerra C8 (2.1x30 mm, 2.S~m), linear gradient from 5 to 35% in 2 min and from 35 to 70% in 30.5 min, flow rate 0.200 mL miri 1, buffer A = 400mM HFIP/16.3mM TEA
in H20, buffer B = 100% methanol. The RNA was purified by ion-exchange chromatography (Scm in-house packed column, TSKgeI-SuperQ-SPW, 20~,m), heated to 75°C, flow rate 50 mL miri 1, buffer A = 0 '020M Na2HP04 in 10% CH3CN, pH 8.5; buffer B = buffer A + 1 M
NaBr in 10%
CH3CN, pH 8.5, linear gradient from 20 to 55% in 120 min.
RNA synthesis. The protected RNA was assembled on an AKTA Oligo Pilot 100 on a 100-150 ~,mol scale using custom in-house support and phosphoramidite chemistry.
Phosphoramidites were used as 0.2 mol L-1 solutions in dry CH3CN, with a 900s coupling time and the manufacturer's recommended synthesis protocols were used. After synthesis, the support-bound RNA was treated with aqueous CH3NHz (40%)for 90 minutes at 45°C, cooled, filtered and washed with DMSO (3x40mL). The filtrate was then treated with TEA.3HF
(60mL) for 60 minutes at 40°C, and quenched with aq. NaOAc (O.OSM, pH
5.5, 200mL). The synthesis was followed by analytical ion-exchange HPLC, preparative HPLC, then desalting on Sephadex G-25.
Step 1. Oli~onucleotide Synthesis:
A general conjugation approach is shown in the Scheme E.
All oligonucleotides were synthesized on an AKTAoligopilot synthesizer.
Commercially available controlled pore glass solid support (dT-CPG, 5001) or the phthalimido-hydroxy-prolinol solid support and RNA phosphoramidites with standard protecting groups, 5'-O-dimethoxytrityl-N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite were used for the oligonucleotide synthesis. All phosphoramidites were used at a concentration of 0.2M in acetonitrile (CH3CN) except for guanosine which was used at 0.2M concentration in 10% THF/acetonitrile (v/v). Coupling/recycling time of 16 minutes was used. The activator was 5-ethyl thiotetrazole (0.75M), for the PO-oxidation Iodine/Water/Pyridine was used and for the PS-oxidation PADS (2 %) in 2,6-lutidine/ACN (1:1 v/v) was used. The amino-linker phosphoramidite was synthesized and used at a concentration of 0.2M in acetonitrile. Coupling/recycling time for the amino-linker phosphoramidite was 16 minutes.
Scheme E°: Pegylation of RNA Oligonucleotides CPG H~~% I CPG
O ~,ODMTr O
N
O'~N
p x=~or~
p 3~ 5' iii O 3' 5' HO,, O.P O OH E HO, O.P O OH
/~ /~ i X
NO ~O
N H N
0~~~~PEG O.~NH2 IO n Oigonucleotide with amino linker Oigonucleotide - PEG Conjugate a (i) Solid phase Oligonucleotide synthesis; (ii) Deprotection and purification; (iii) PEG-NHS ester, NaHC03, pH 8.1, 1 h.
Step 2. Deprotection- I (Nucleobase Deprotection) After completion of synthesis, the support was transferred to a 100 ml glass bottle. The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 40 mL of a 40% aq. methyl amine 90 mins at 45°G.
The bottle was cooled briefly on ice and then the methylamine was filtered into a new 500 ml bottle.
The CPG was washed with 3 x 40 mL portions of DMSO. The mixture was then cooled on dry ice.
Step 3. Deprotection-II (Removal of 2' TBDMS gTOUp) To the above mixture was added 60 ml triethylamine trihydrofluoride (TREAT-HF) and heated at 40°C for 60 minutes to remove the tent-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction was then quenched with 220 ml of SOmM sodium acetate (pH 5.5) and stored in freezer until purification.
Step 4. ~uantitation of Crude Olisomer or Raw Anal For all samples, a lOp,l aliqoute was diluted with 990 pl of deionised nuclease free water (1.0 mL) and absorbance reading obtained at 260 nm.
Step 5. Purification of Oli og mers (al HPLC Purification The crude oligomers were first analyzed by HPLC (Dionex PA 100). The buffer system was: A = 20 mM phosphate pH 1 l, B = 20 mM phosphate, 1.8 M NaBr, pH 11, flow rate 1.0 mL/min, and wavelength 260-280 nm. Injections of 5-15 pl were done for each sample. The samples were purified by HPLC on an TSI~-Gel SuperQ-SPW (20) column (17.3 x 5 cm). The buffer system was: A = 20 mM phosphate in 10% ACN, pH 8.5 and B = 20 mM
phosphate, 1.0 M NaBr in 10% ACN, pH 8.5, with a flow rate of 50.0 mL/min, and wavelength 260 and 294.
The fractions containing the fulllength oligonucleotides were then pooled together, evaporated and reconstituted to 100 ml with deionised water.
Step 6. Desalting_of Purified Oligomer The purified oligonucleotides were desalted on an AKTA Explorer (Amersham Biosciences) using Sephadex G-25 column. First column was washed with water at a flow rate of 25 ml/min for 20-30 min. The sample was then applied in 25 ml fractions. The eluted salt-free fractions were combined together, dried down and reconstituted in 50 ml of RNase free water.
Step 7. Capillary Gel Electrophoresis (CGE) and Electrospray LC/Ms Approximately 0.15 OD of desalted oligonucleotides were diluted in water to 150 ~.l and then pipetted in special vials for CGE and LC/MS analysis.
Step 8. PEG conjugation.
A) Initial reaction conditions. The purified and desalted RNA was lyophilized.
RNA
(lmg) was dissolved in aq.NaHCO3 (O.1M, 200gL, pH 8.1) and DMF (200~,L each).
5 K (13 equivalents, lOmg) or 20KPEG (3.4 equivalents, l Omg) was added directly to reaction vial and vortexed thoroughly. The reaction continued overnight at 4°C, and was followed by analytical ion-exchange HPLC. When the reaction reached >85% completion, it was quenched with aq.
NaOAc (0.05M, pH 5.5) until the pH was ~7.
B) Borate buffer coniu~ation. The purified and desalted RNA was lyophilized. A
sample of RNA (lmg) was dissolved in sodium borate buffer (200wL, 0.05M,pH10). SKPEG
(3mg, 4.5 equivalents Sunbright ME-50H8, NOF Corp.) was dissolved in CH3CN (200~.L). The RNA
solution was added to the PEG solution and vortexed thoroughly. The reaction continued for one hour at room temperature, and was followed by analytical ion-exchange HPLC. When reaction reached >85% completion, it was quenched with aq. NaOAc (0.05M, pH
5.5) until the pH was ~7.
C7 PEG linker (AS and HS) comparison. A sample of RNA (lmg) was dissolved in aq, NaHC03 (O.1M, 200~L, pH 8.1) and DMF (200~L). SKPEG (13.5 eq, lOmg, Sunbright ME-50HS or Sunbright ME-50AS, NOF Corp.) was added directly to the reaction vial and vortexed thoroughly. The reaction continued overnight at 4°C, and was followed by analytical ion-exchange HPLC. When the reaction reached >85% completion, it was quenched with aq.
NaOAc (O.OSM, pH 5.5) until the pH was ~7.
D) Final optimized PEG conju_~ation. The purified and desalted RNA was lyophilized. A
sample of RNA (SOmg) was dissolved in aq. NaHC03 ( O.1M, 2mL pH 8.1) and DMF
(1mL).
20KPEG (approximately 2.7 eq, 400-520mg Sunbright ME-200HS, different amounts for different sequences within this range) was dissolved in CH3CN (2mL). The RNA
solution was added to the PEG solution and vortexed thoroughly. HZO (250mL) was added to the reaction to decrease turbidity. The reaction continued for one hour at room temperature, and was followed by analytical ion-exchange HPLC. When the reaction reached >85% completion, it was quenched with aq. NaOAc (O.OSM, pH 5.5) until the pH was ~7.
Step 9. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 12 and Figure 45 provide data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 13 Synthesis of oli~onucleotides containing the ribo-difluorotoluyl (DFT) nucleoside (Table 13) The RNA molecules were synthesized on a 3 94 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was 500 ~
dT CPG (2 umole). The monomers were either RNA_ phosphoramidites or the ribo-difluorotoluyl amidite. All had standard protecting groups and were used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated. Specifically the phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl) phosphoramidite, 5'-O-Dimethoxytrityl -Na-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-difluorotoluyl O-tbutyldimethylsilyl-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite (0 _ 12 M). The coupling times were 7 min for all RNA monomers and 10 min for the DFT monomer. Details of the other reagents are as follows: Activator: 5-ethylthio-1H-tetrazole (0.25M), Cap A: 5% acetic anhydride/THF/pyridine, Cap B: 10% N-methylimidazole/THF; phosphate oxidation involved 0.02M
IZ/THF/H20.
Detritylation was achieved with 3% TCA/dichloromethane. The DMT protecting group was removed after the last step of the cycle.
After completion of synthesis the CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic ammonia (1:3) for 16 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube; this was followed by washing three times with 0.25 mL of 50% acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizes.
The white residue obtained was resuspended in 200 uL of triethylamine trihydrofluoride and heated at 65°C for 1.5 h to remove the TBDMS groups at the 2'-position. The oligonucleotides were then precipitated in dry methanol (400 uL). The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual methanol was removed in the speed vacuum to give a white fluffy material. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by 20% polyacrylamide denaturing gels. The purified dry oligonucleotides were then desalted using Sephadex G25M.
Duplexes were tested for activity in the HeLa cell assay described above.
Table 13 and Figure 46 provide data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 14 Synthesis of RNA modified with 2'-ara-fluoro-2'-deoxv-nucleosides (Table 14) The chimeric RNA molecules were synthesized on a 394 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was 500 ~ dT CPG (2 ,mole). The monomers were either RNA phosphoramidites, or 2'-arafluro-2'-deoxy (2' ara F) phosphoramidites. All monomers had standard protecting groups and were used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated.
Specifically the RNA phosphoramidites were 5'-O-Dimethoxytrityl-N~-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-(a-cyanoethyl-N,N'-diisopropyl) phosphoramidite, 5'-O-Dimethoxytrityl-NZ-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite; the 2'ara F
phosphoramidites were 5'-O-Dimethoxytrityl-N4-benzoyl-2'-arafluro-2'-deoxy-cytidine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-arafluoro-2'-deoxy-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-arafluoro-thymidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite.
The coupling times were 10 min for all monomers. Details of the other reagents are as follows:
Activator: 5-ethylthio-1H-tetrazole (0.25M), Cap A: 5% acetic anhydride/THF/pyridine, Cap B:
10% N-methylimidazole/THF; phosphate oxidation involved 0.02 M IZ/THF/HZO.
Detritylation was achieved with 3% TCA/dichloromethane. The final DMT protecting group was removed after the last cycle.
After completion of synthesis the CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic ammonia conc (1:3) for 5 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube;
this was followed by washing three times with 0.25 mL of 50% acetonitrile .
The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 ~,L of triethylamine trihydrofluoride and heated at 65°C for 1.Sh to remove the TBDMS groups at the 2'-OH
position. The oligonucleotides were then precipitated in dry methanol (400 ~L). The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual methanol was removed in the speed vacuum to give a white fluffy material. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by 20% polyacrylamide denaturing gels. The purified dry oligonucleotides were then desalted using Sephadex G25M
(Amersham Biosciences).
Duplexes were tested for activity in the HeLa cell assay described above.
Table 14 and Figure 47 provide data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 15 Deprotection of Methylphosnhonate Modified siRNAs (Table 15) Deprotection step 1:
After completion of the synthesis, the controlled pore glass (CPG) was transferred to a screw cap vial. A solution (0.5 ml) consisting of Acetonitrile/Ethanol/NH~OH
(45:45:10) was added to the support. The vial was sealed and left at room temperature for 30 min.
Ethylenediamine (0,5 mL) was added to the vial and left at room temperature for an additional 6 hours. The supernatant was decanted and the support was washed twice with 1:1 acetonitrile/water (0.5 mL). The combined supernatant was diluted with water (15 mL). The pH
was adjusted to 7.0 with 6 M HCI in AcCN/H20 (1:9). The sample was desalted using a Sep-pak Cl$ cartridge and then dried in a speed vac.
Deprotection step 2 (Removal of 2'-O- TBDMS grout) The white residue obtained was resuspended in a mixture of triethylamine, triethylamine trihydrofluoride (TEA.3HF ca, 24% HF) and 1-Methyl-2-Pyrrolidinone (Nl~IP) (4:3:7) (400 ul) and heated at 65°C for 90 min to remove the tert-butyldimethylsilyl (TBDMS) groups at the 2'-position. The reaction was then quenched with isopropoxytrimethylsilane (i1'rOMe3Si, 400 ul) and further incubated on the heating block leaving the caps open for l Omin~
(This causes the volatile isopropxytrimethylsilylfluoride adduct to vaporize). The residual qwenching reagent was removed by drying in a speed vac. 3% Triethylamine in diethyl ether (1.5 ml) was added and the mixture was subjected to centrifugation to afford a pellet of RNA. The supernatant was pipetted out without disturbing the pellet. The pellet was dried in a speed vac. The crude RNA was obtained as a white fluffy material in the microfuge tube.
Purification:
All methylphosphonate modified sequences were purified by PAGE
Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 15 and Figure 48 provide dat and graphs of the activities in HeLa cells for each of the modifications described above.
TABLE 1. Target sequences in VEGF 121 ARGET SEQUENCE IN VEGF121 mRNA
SE ID NO: ORF 5' to 3' ~ 14 UGUCWGGGUGCAUUGGAGCCUU
20l 200 UGAGAUCGAGUACAUCUUCAAG
352 357. GGAGAGAUGAGCUUCCUACAGC
a>
z z z z + + z z + + + + +
w + +
+ + + + + + + + $ + + +
r, a + + + .~. +
W M~
W W
m m m tn m m m m m m m m m tn m m w m m W
a ~ ".~ r.C H m H tn U C7 N(-~ m U c7 H N ~ C~'J F ~ U 'U'J E ~ CU.7 U
CU9U C.U7U"HJr.CCH7U'UJ~ ~~UCU7UC7UC7UC9~C7UU' ~'J
C7 ~ C7 U t7 U C7 ~ U' ~ 'J 5 U C7 U C7 U C7 U C7 ~ ~ 'J "J C7 U C7 U C7 ~ C7 ~ ".W C 'a U C7 C7 U C7 U U' ~ ~ C7 ~ C7 ~ ~ ~ ~ r.C C7 U c7 U c7 U C7 ~ "J
D ~ Cp7 U U C7 c7 ~ ~ U' C7 Upp 5 ~a Ca7 ~ "UJ U 'UJ U ~ U
c~7~ ~~IUWC CU7 CU7~~~~~~~~U~U~CU7 C7 U U C7 U C7 ~ C~'J "UJ a' ~ FC (7 U C7 U U ~ U CU7 ~ "~~ ~ "tJ7 UC~7~~j~~~C9~r~CU7UCU7~C~7~c~'JU"~J~rU~~~~,~A,'Dr.CCU'JU
r~ ~UC~7UFC~CU7~CU7U'UJ~"U,~~CU'J~~~C~7~(U7 U~~FC~~C~7~C~'J~~'UJ0.'~CU7~C7~CU7U5U
ar ~ H H C7 H C7 ~ H C7 ~ N ~ C~9 yn "J tn ~ tn H W H m p ui H W c7 m ~ N U' tn H tn FC tn H of C7 V] r.o m m m m m m m m m m m m A
~ ~ N m ~ 1f1 ~D n m Ot O v-1 N m cH ll1 ~D n t9 01 O ri N m ~' U1 CD n OJ O O O O O O O O v-1 ri rl rl wi W ri rl ri e-I N N N N N N N N
V~ ~ V~ W ~' C' V' V~ C~ V~ ~ t' V' d' ~ d' <T V' V' V~ ~ W ~ C~ G~ V~
~ N ~ ~ ~ N ~ N N ~ N ~ ~ N N ~ ~ N N N N ~ ~ O
L, i~
m n .-~ m m m n n m cmn ao vo q w n N o 0 0~ cn rt v~ o m .-i m 0 0 o rl 0 0 0 0 o rl 0 0 0 w .n ~ w w ~ w ~r ~ ~n w w w n n n n n i n n i n n n n A w w w w w w w w w w w w w A A A A A A A A A A A A A
n i n n n n n i i n n n n a a a a a a a a a a a a a a a a ~ a a .s .e ~ a a a CU7 C~7 U U ~ r.C CU7 G7 ~ UC~7D~ ~ U U
U U
CU7 "C7a C7 ~ C5'J
M ~ ~ ~ ~ ~ c~
'J U C7 ~n ~ a ~
bA CU7 U ~ U ~ 'J C7 C~7 '.~ ~ a' ~ U
a N
m of 41 v-I N m ~1' u1 N W V~ u1 N If1 !ti u7 N G
N n ~ O rl N m ' N V' V~ If1 1f1 V7 !t1 !f1 + + + + + +F + .*~ + + + + + + +
+ + + + + + + + + + $ + + + + +
+ + + + + + + + + + +
m M V7 M M V7 M M Il1 M M I(7 M M tf1 M M Lf1 M M 111 M M !f1 H In U~ t7 H In "J IS H In C7 U H ~ U U ~', N ~ (~7 H ~ ~ ~ U c7 U ~ H 5 U CU7 ES~U~U C7U ~U'UU~ U C7U C7U UFC 5rC C7U C7U
UCU'JU~~~~ "JC7~U'~CU7UCU7UU'U~U~C~7~C~'J~FC
C7 U U' ~ C7 ~ ~ ~ U C7 U ~ ~ CU9 U C7 ~ U C7 U C7 U ~ C7 C7 U C7 U (7 ~ C7 ~ 5 'J U C7 ~ C7 ~ CU'd ~ ~ ~ C~'J U C7 U C7 U C7 U
"a ,~ "a r.C C7 U C7 U L7 ~ C7 ~ 'a "a U C7 U ~ U C7 ~ CU7 ~ CU'J ~ C7 U
"aC7U C7U',W C'J~ ~U~ U ~~ ~~ C~7~ C~7~ "J~ "JU UCU7 ~CU7UCU7 U 'J C7 ~ C7 ~ 5 ~ 5 ~ C7 U C7 U C7 ~ C7 ~ 'J ~ ".~ ~ ~ C7 U C7 C7 ~ C7 C7 ~ ~ C7 U C7 U C7 C7 'J 'J c7 U c7 U
'J FC C7 U C7 U U ~ U CU7 ~ C7 C7 C~J ~ ~ U U C7 ~ C7 ~ 'J IS ".~ ,~
C~7~"~J~~'JFC U~ C7UC7 U UCU7 CU7 ~~ ~~ ~ ~ UU C7 C7 ~ ~ ~ 5cc~9 ~ C~7 ~ "~J ~ "~.~ ".~ r~ ~ r.C C7 U C7 U ~ C7 ~ LU7 ~ ~ ~ C~7 FC
In E W C~7 In H In U In N In CU7 W E u7 c~'J In H In ~ In H In ~ In H In U In H In 'C-~U~7 M M M M M M m M M M M M M M M m W T O rl N M C It1 lO l~ m 01 O v-1 N M C If1 lD h N 01 O r1 N M V' V1 tD h m N N M M M M M M M M M M c>t V' ct~ V' Ch VI VI ~N C VI Lf1 If1 Ill If1 If1 N N
V7 V1 It1 ~ V' V' V' C~ C W G' d' <T V' C V' C d' d' VI C V' W CI ~H ~ ~ ~ CI CI CI W CI
V' V' V7 N V1 In !!) V1 U7 VI Ul V~ U1 U1 V7 U1 V1 N V1 U7 V7 U1 0.' U7 V7 In N N V7 N !!) Ul U1 V1 VI M Ill l~ VI O b 01 I~ I-I N h O O N 'i CD 01 W M If1 M O W O O !t1 O W I~ 111 I~
O O O O O O O O O O O O O O O O
'W W W W W W W W ~N ~N ~N ~N ~N ~N W W
w w w w w w w w w w w a w w a w A A A A A A A A A A A A A A A A
a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a .x a CU7 U ~ CU'J ~ U U U
U CU'J C7 ~ ~ C9 ~
C
~ ~
~
C~7 ~ ~ ~ C7 ~ U ~ ~
C ' C 'J U
'l J ~ .7 U ~
U
U' "J C C D
~
~
D C~7 U
r~ ".W 9 Ip h LO 01 O r-1 N M
!!1 If1 N 1f1 ID 10 10 t0 !!) N N If1 Vi 10 ~0 N
+ + a a ~ ~ ~x a a ~ ~c a a a a z + z z z z z z z z z z z z z + + + + + +
+ + w + + + + + + + + + + + + +
+ + + + + + + + + + + +
m m N m M M m m Hf N m m M M m N m N m m N
H N ~ Ca7 H N E N E N E N H N C~7 U H N H N H N H N ~ "~J ~ Ca'J E
U,~ U' U C7 U (7 U C!~7 a U' U,~ C7 U 5 ~ U,~ C7 U rC a U' U a FC C7 U U U' UCa'JU"UJ U"JU~U~ Ca'JU "UJUC~7 ~ CU7U Ca7~ "U.~' U aFC "~JFC ~aU' Ua p C7 ~ U' ~ ~ ~ ~ ~ C7 ~ ~ U Ca'J ~ ~ U CU7 ~ Ca'J ~ ~ Ca'J a U U C7 C7 U
C~7~C~7UC~'JUFCU~Ur~(7~~~ ~~~U~Ca'JU~U~~DFCUaC7U
FCaCU7UCU7UC7U~~C~Ca7a."JU C7UU' ~~ ~~ ~~~~~~~C"~a~FC
U C7 ~ ~ a Cr~7 U a' a a FC U C7 ~C a ~ ~ U "Ua U CU.7 C7 U C7 U a ~C FC ~ a UCUr~7 UC7 ~CU7~Ca'J'JFC ~Ca9 ar~'~J'a FC'.-~' FC ccr~~i!! ,U~
a ~ ~ U U CU7 a sC ~ C7 FC a ~ ~ a ~ ~ FC ~ Ca9 CU7 ~ ~ U "C7~
~a~a~~~~~ ~aa~~c~
a a a ~a~a~2~~~~a~ac~a~ a~c~c~ c~
H H H H~H..~~~ ~~~~~~ ~N~U~~~0.H'CU7U~
N H N U' N H N H N H N H N H W N H N N H N H N a N N H N a m m m M m m M m m m m m m m m O I-1 N m ~ N b n m Ov O I-i N m V' N 10 n m Ot O rl N M CI N ~0 r m ~ O rl b b io b ~o b b b b b r r n r r~ n r r r n m m m m m m m m m m o~ a~
w ~ ~r ~r al m <r a a a w w wr ~r w w ~ ~ ~ w ~r w ~r ~r rn a~ m ~ <r V1 !l~ U7 (~ V7 N N N V7 N m m G7 (p V7 Cn V1 W V7 UI [n Cf7 N VI V7 N VI V1 b U1 U7 Ul b N r b N M W ~ a1 1f1 O m a~ O ei rl N r N b N N N !~ rl N rl b r N r-I W
O O O O O O O O O O r1 O O O ei O
cH W sH W ch W W W W W ~ ~H VI W W VI
w w w w w w w w w al w w a w w w A A A A A A A A A A A A A A A A
I I I I n n I n n I I n I
a a a a a a a a a a a a a a a a a .c a a ~c Is .c Ix a Is a a a a a a '~u ~ ~ '~ ~ ~ ~ ~ a c'~ I~ ~a ~ a a ~ ~a a ~ ~a a a CU7 ~ a ~ ~' U U U ~ CU7 U a Ca7 C7 r.C
~a ~ c~ ~ ~ c~ ~ ~ ~ ~ a b b ~ O ~ O ~ O ~ O ~ O ~ O ~ O ~ I-i ~ N ~ O ~ m 'i H r1 ~ ri H 'i 'i H ~-i ri b b T ri W fi rl ri ri ri rl 'i ri a a a a a a a ~ ~ a ~ a a +
z z z z z z z z z z z z z + z + + + + + + +
+ + + + + + + + + + + + + + + +
+ + + + + + + + + + + +
m m m m m In m m m In m u1 m m m m m !!1 m m V1 H m H ~n H tn H tn U c7 H tn H m C7 U C7 U H m H W H u7 N tn r.C ~ H m C7 H H H C7 U H H U C7 r.C b H~ U U, ~ U U U' UU C7 U C7 ~ C7 ~a~~~~ ~aap~~p~~~~~a~U~ a5~~ a" acC7~ acs UU' C7UUJ C7U~C~7~C~'J5~ CU7 ~ UC7C~7~ FC~ C~7 C7 ~~~~U">U' UU5 (U7 ~~ "J a' UC7 C~'J J 0."J 'JFC
c~ a ~ ~ ~ ~ ~ ~ ~ ~ ~a ~59 ° ~ ~ a ~ ~ ~ ~ a CJ7 ~~CU.7UUCU7C7UU' U
J~~cU'JUD(U'JUC7UUC7U~UCU7 'J~ U(7 C~7 ~ ~ ~ ~ ~ r-C ~ CJ7 J C7 U ~ C7 C7 U ",~ 'J FC U C7 ~ C7 C7 ~ C7 cr~~ a ~c ap a ~ a ~ ~ c~ ~ ~ ~ ~ ~ ~ ~ c~ ~ "~ ~ ~ ~ "pU ~ "pU ~ ~p a GU"J~ J~,.UJU~C~7'~J~~~~~U' U~ ~ Sr.C U' U ~CU7 ~CU7 UCU'J ~U~C~'J
"Jr~ CJ7~ JU'JU~(~7~CU7U' U FCa ~C~7'UJrC U' U FC~ C~7~FC
CU7 U U' U FC 'J 'J FC U' ~ U' ~ 'J r.C U' U rQ J ~ r~ r.C 5 U C7 "J FC U' tn E W E ~n H tn H ~n '~',mn N tn N W U m U m E W H W N W H tn W n H ~n "J
m m m m m m m m m m m m m m m m N m ~r m b r m o~ o ,a N m m b r m m o .-i N m r m b r m o~ o H N m 01 01 Ov 01 O1 01 01 01 O O O O O O O O O O rl ri r1 rl rl n-i ri v-i rl ri N
N N N
T V' V' t' V~ ~ ~ W !f1 1f1 V1 In In N In tf7 tf1 u1 V1 tf1 In tf1 In 1f1 !f1 It1 It1 1f1 If1 !f1 In !f1 UI ff7 N V! b G7 VI U1 N (A W Ul U1 U7 N Cn fn fA fJ7 Cn !n U1 V7 N N Cn N U1 CO U7 (17 f4 N 01 N b IIi O r rl m m Ot O r-I m m at b rl N 41 N N m 01 N N m m O If1 O
0 o rl 0 0 0 o a o 0 0 0 0 0 0 0 w cN w w w w w w ~ ~r w ~ w w ~n i i i i i i ~ i ~ i i i ~ i w w w a w w w w w w w w w w w w A A A A A A A A A A A A A A A A
n n n t i n n i i i n n n a a a a a a a a a a a a a a a a a a a t a a a a a a a .c a a a R
(U7 U U ~ U U
C7 'J U' rC U U U U U
U ~ U U
~ U D,~ 2 U' r.C C~9 ~
~ U ~ FC
C~7 ~ ~ UJ ~ ~ ~
C7 'J C r.C
a ~ ~ 'J
a u a 5 c~
c~ ~ a c~ 5 c~
~ ~ U
U CU7 U C ~ ~ U ~ U c~'J
7 ~ ~ a' ~
~ ~
"J C7 C7 C7 p r.~ C7 r.C
N ~ m C U7 b u1 r ~ O ~ rl ~ N ~ m r ~ m m m m m m ~r ~r wW un b b 'i rl rl rl ri ri ,1 ri rl ri rl rl ri ~-i ~ N ~ m C~ ~ N ~ ~ ~p 01 ~ O ~ ri ~ N ~ ~O r m m m m m ~r w W wn b b rl H ri W fW -i 'i ~ H ri ri ra 'i + + + + z z + + + + + z + z z + + + + + + + + + + + + + + + +
+ + + + + + + + +
t~ m In r1 m N t~1 t~t N t'1 n'1 N r'W '~1 N t'1 t"7 N r~l N m t~1 N
H N C7 U H N r.C '~ H N C7 U H N ".~ ~ H N ~ ",~ H N U C7 U C7 H N rl N ",J r~
H C,~7 U H C7 H x~C ppU H C7 H p ".~ H U (7 U C7 H FC "J
UCU'JJ~C~7~~U~U"J~~CU7UC~7UC~'J~~~~UFC SFC~FC~FC".1' U~2 pp~"~r~ r~ C7 D~~Ur~,.U~UDCU'J~~~CU7 ~C~7~C~7~p C~7~~CU7 ~CU7UC7~c7~C7 ~CU7 ~U C~7 ~C~7~C~'J~ C~'J
t~.7 U~ ~ U ~ "UJ U2 ~ ~ ~ ~ ~ ~ U ~ U ~ U t7 U ~ ~ ~ t7 ~ c7 ~ U 5 CU7 U' FC 'J rC "..1 ;".~'~ r~ 'J FC C7 ~ U' ~ ~ ~ ~ U C7 ~ U' ~ C7 ~ (7 r.C 7 SU,~C~'J~C~7U C~7U~(9U~CU7~C~7~~~"~J'J~'JFC U C7 UC7UC~ UC7 U' U
U r~ C7pUpp ~ C~7 C~7~C~7~CU7U "UaU~UCU7~CU7UC~7~C~7~ rC"UJ FC~'a FC "a0.'"J0."aFC UC7 U C~7 Up FC U FC CU7 ~ CUp'J ~ CU7 ~ C~7 ~ "JU~ U '~'J ~ CU7 U,~ CU7 U,~ U
C~7, ~ C~'~~'J, ~ C~7 ~ CU9 C7~U' ~FC'~C~9U~UFC~~CU.7UCU7~C~7~~ ~~~~U CU7U
C7 ~ C7 'J a' U FC C7 U C7 vU
H N ~ N H N ~ N N N CU7 N H N ~ N H N C~'J N H In rn N n1 N H N In N "U,..t' m r.l m rl fn M rl nl tn m r.l m rn C N 10 r W 01 O v-I N t~1 H' N l~ r of 01 O rl N t't W N t0 r O 01 O ri N t~W
P N
N N N N N N t~l tel r'1 r'1 t'1 M f~1 H1 r~l n1 ~ d' C V' W V' cH CI OI ~ N N
N N N N
N N N N N N N N N N N N N N N N N N N N N N If1 N N N N N N N N N
V7 (n (n N V1 Vl V1 N U7 Vl U1 N (n V7 N f0 (17 N U] (p N V1 U1 In U7 U7 N Ul 00 o O M VI rl m W o ow-I tn In N o o1 N ri b r O ri W r 01 n'1 01 O rl r/ N o1 O O O O rl O O O O O O O rl O r-I O
W VI W W W W VI W CI ~N W W W W W W
I 1 I 1 1 1 I I 1 I t I 1 1 1 a w w a w w a a w w w w w w w w A A A A A A A A A A A A A A A A
I I 1 1 I 1 1 1 I t I 1 1 1 a a a a a a a a a a a a a a a a a a a a a a .x a .~ a a ~ ~ a a a L~7~C~'J"~JU
U' C7 ~ C7 U C7 U ~ ~ C7 U ~ rC U
a ~ ~ a a U t~
a ~ ~ ~ ~ a of O rl N m ID o In r r r r r m 'i ~ ,~ ~1 a (p 01 O r1 N
In ~ r r r r~ r H ~ H H H N H
a a a a a a a a a a a a a a a a z z z z z z z z z z z z z z z z + + + + + + + + + + + +
+ + + + + + + + + + + + + + + +
+ + + + + + + +
M M N m C7 m N t~t N m N t~1 N m N N m N m rat N W7 N r1 tn H N ~ H N H N "a ~ ~ U ~ ~ U C7 'J ~ H N ~ U H N U CU_7 'Ua' ~ H N E N
,~ a 'J ~ 5 ~ a ~ r~ C7 ~ U C7 ~ ~ C7 ~ C7 U C7 a "J U C7 '.~ U t7 'J~' SaUG C7~'Ja~~~~ ~ Up "JaCUnU ~~ UC7 ~~ ~C~7 a ~ a ~ a ".~ "J ~ Ca'J U U C7 U
5 a 5 'J ~ C7 ~ U' a ~ U C7 (7 ~ry' ~ C7 p a UC7C7UU''U~C~'JSaa'~7~UaU,~C~'J~~C~7~ ~"aJ C~7Ej~~UC7~
(a7~~~~aaC7UUCU9CU7UG~C7Ua C7U UU a"a a ".~ C7 U C7 ~ ar~ 5 C7 U ~ a~ "J a a ".~ U' ~ ~ ~ a a ~ ~ U C7 (7 U ~ C7 ""UJaCa'JJ~Ca7U~C~7CU7UU~Ua'JUpaa5UCU7C7UCa'J~ ~aUC7~a",»p aSUaapspp ~a'JC~7UU~C9~ ~aC7Cp7U"J~~~UCa7 t-~J. ~aaUGC~7 Upa Ca7~Ca'J~ UC7 UC7 ~UU~~C~~7 UaC7 a'JUU' U'U
UU' ~aU' '~~~~ CanU Ca'!U'UJ'r.CUU' ~C~7 CU7UUa5~~ U,a ~ a~ 5a U CUn U U' U U U' ~ a U C7 C7 U U' U U C7 a "a U C7 ~ a ~ ~a a 5 ~ a ~ 5 ~ ~ ~ ~a ~ ~a ~ ~a ~ a ~ ~ ~ ~ ~ v a ~ ~' ~ ~ a N E N U N F N H N U N ,.7 N CJ N U N CJ N E N a N H uI ~ N U N E N F
m m n, m m m M m m rwn m rn rmn rn b r N O1 O ri N m ~ N b r t0 01 O r1 N m V' N b r m 01 O r-I N r1 ~!' N b r N N N N w ~o ~o b ~o b b b b b r r r r r r r r r r m m m m m m m o~
N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N
V1 VI U1 V) U7 b N U7 N V7 N N VI Cl1 N V7 V1 In VI Q7 Vl (n In V7 C4 U7 Vl U1 U1 N U7 Ul a a a a a a a a a a a a a a a a N N t'1 W V~ N b b O N O wl ri N W t~1 M W b b W W ~W O1 W 10 O N1 O O n1 ~-1 O O O O O O O O O O rl O v-I n-I O r-I
V~ V~ W ~ W V~ W W W W ~ <N V~ W W
w w w w w w w w w w w w rL w w w A A A A A A A A A A A A A A A A
i ~ ~ ~ i i i i i i i a a a a a a a a a a a a a a a a a a a a .c a a a a a a a .c a a a a ~ C7 C7 'U'a ~ U,r~y 'a ~,U~ CUn 'a U "J U
C7'J ~C~75",~~~~C7Ca'J ~ UU
a a ~ 5 a ~ ~ c~ a a ~' a c~ ~ a c~ ~ ~ ~ ~a a ~ ~ U
cn a ~ ~ ~ ~ ~ ~ a a ~ ~ ~, ~ can '~ c~ c~
a a ~ ~ ~ ~ c~ ~ ~ ~ ~ ~ a a ~a~a~5a~~cJu c~~a c~ ~ c~
a c~ a cn a cn cn cn a a 5 a cn cn a N r1 O ri G~ O N cf~ O m b .1 rat b r o\ ov ri b b ~ m m 01 O o .-I rl ri .-i r-1 wl N N N N N N N M M M rat r1 t~1 r-1 N 01 O tn 41 rl t"1 O1 N N O N N vD
01 01 O t0 b r c0 CD o0 O O rW -I ~-I rl r1 -I N N N N N N N r'1 r1 r~1 r~1 n1 t'1 + ,~ + ~ ~ + + + + + ~ + ,~ + +
+ + + + + z + z + +
z + z + z z + + + + + + + +
+ + + + + + + + + + + + + +
+ + + + + + + + + + + * + + + +
+ + + + + + + + + +
m m m m m W m tn m W n m m tn m tn m m m m H ~ C7 U m m H ~n m m U C7 U U' H ~n ~ ~ H W .~ ~ ~ E ui m W U C7 H tn ~CU7U t~'J~C~7~FCaFCa~U~UC7UC7U~~ ~C~7 Ca.7UCU7UCU7UUCU7UCU_7 a~a~UUU' Ur.C r.CaFCaFC'JC~U U' U
~a a a a a a ~c a a c~ ~ c~ a c~ a c~ a a ~c ~ ~ c~ ~ ~ ~ a a a " ~ ~ ~ ~ a ~ a ~ a ~ a 5 a a ~ a U U' a r.C a FC ".~ EC a r~27 rU~ a C7 U C7 ~ C7 U C7 ~p C7 U r.C 5 FC a UCU7UCU'JUCU7UC7aFC C~7UC~7~~aFC5C~7~C~7UC~'J~C~7Ur.Ca ~a U C7 C7 U (7 U C7 U C7 U rC "~ ~ '~-~ ~ '~-~ ~ ~ ~ U ~ U
U C7 U C7 FC a FC a C7 U C7 U C7 a r.C a r.C r-C a ~C a C7 U U' U C7 U C7 U U' ~ C7 r.C U C7 C7 C7 C7 a a a ~C a FC a' a FC a FC a FC a U' U C7 U
a~ a~ a~aa ~ c~c~c~c~~canc~~a5a U U' ~ ~ C~7 ~ ~U' U C~'J U a r.C U Ca7 ~ Ca'J ~ Ca'J ~ Ca7 ~ ~ ~ "UJ ~ a a U C7 U C7 U C7 U r.C '~-~ U ~ U ~ C7 U C7 U
a r.C U U' U C7 U C7 U C7 C7 ~ ~ U r.C a FC a C7 U ~ U ~ U C7 U ~ Ca'J ~ Ca7 FC C7 U~ C7 U U' E C7 U C7 ~n H tn a N m in H W m ~n U m U tn H W CU7 m H W cal ~n rW n H N m tn W n H
m m m m m m m m m m m m N 01 O ri N m ~ N tD I~ W 41 O ri N m ~ Lf1 ~O L~ W 01 O vi N m <N ~f1 l0 l~
CD T
N of O~ O~ O1 O1 O1 01 01 O~ 01 01 O O O O O O O O O O r-1 r-I ri ri wl v-I wl rl rl r1 !f1 N u1 N tf1 !n !f1 U1 1f7 u1 V1 !f1 t0 t0 \D vO CD l0 ~O l0 \O vD ~D ~O CD
t0 CO \D v0 t0 vD v0 V7 U1 V7 fl7 N (n (1J U7 V1 U7 N N U7 fA U7 V1 N V7 U7 U1 fp V1 U7 G7 U7 tl1 U7 U7 f17 N N V7 W N It1 W 01 m ~1 1f1 O ~D Vn N L~ N N W
v-I O 'i rl wl rl h O It1 O OW -I O N rl O
v-1 O ri O 'i O O ri O ri O ri ri e-1 O ri W W V~ V~ W W V~ W W W V~ W N W d V~
w w w w w w w a. w w w w w w w w A A A A A A A A A A A A A A A A
i ~ i i i i i i i i i i a a a a a a a a a a a a a a a a a a a a ~ a a ~ a a a .x a a a a U U
U U p C~.7 FC C7 U FC a c7 cC
c~J a ~ ~ ~ a a ~ a a ~ 5 a a a a a m o N N m V' u1 ri N N ~ ch V' d' m m m m m m m l~ 01 ~ N N m C
r-I ri N V' C V' d' m m m m m m m + + z z z z z + z + z + +
+ + + + + + + + +
+ + + + + + + + + +
+ + $ + + + + + + + + + +
m !n m m W m !n m u1 m m m N m In m m In m C~'J H N U CU7 ~ c~7 ~2 ~ H N ~H-, N C7 U L7 U H m m ul ~ r.C H In a ~, a ~ a ~
r.C ".~ r.C ".~ r.C p ~ ~ ~ ~ C~7 ~ 'J Cr~7 U C7 U C7 U U~' U U C7 U tp7 C~7 ~p C~'J U ~ ~ C7 ~ ~ U r.C C7 U ~ C~'J U C~7 ~ CU7 ~ C~7 C~7 U C~7 C~7~ CU7~ C~7~p~~ ~~ ~~ ~~ "UJFC ~FC'.» '.a~~C~7 ~CU'J
"~J ~ C~7 ~ ~ C~'J ~ ~ C~7 ~U' ~C~7 r.~"Jr$W S"Uar~~Dr.~CU7~C~7~C9~C9~U' U' In C~9 In N In ~ In ~ In U m H In H W ~ In m In N In m In ~ In H
m m m m m m m m m m m O rl N m ~ If1 ~O r o~ 01 O r1 N m C N ~D r m Ov O r-I N m W If1 N N N N N N N N N N m m P1 m m m m m m m ~N c!, W
l0 ~O t0 l~ l0 N ~0 t0 10 ~O t0 ID lO b 10 1O ~O LD ~O ID ~O t0 ID 10 lD ~O
U7 U7 V1 G7 V7 U7 N (n CO VI V7 fn U7 N U7 N U7 (n U1 N W W U7 V7 VI fn v-1 rl N a1 r r N W r OD 'i 1t7 t'1 1f1 ID N r Ot 10 C1 O ri 'i N O 1f1 O O O O O O O O ri O 'i O O
V~ W W W W W W W W cN W ~N W
w of a w w a a w w w w w a A A A A A A A A A A A A A
1 ~ I ~ 1 1 1 1 1 1 1 I 1 a a a a a a a a a a a a a .s a a a .c a R a a .s a R a U U' "J
p C7 ~ A.' U
C~7 'r3 c~ d cJ ~ ~ ~ ~a r O O m O rl N ~N
~r u, r r m m m m m m m m m m m m ~p O1 Ot N 01 O ~-/ m yo r r co m m m m m m m m m m w W
O
Z
~ t~ oo a, o .-a ~r ~r d- ~r V, ~n cn N Ei ro ro H
ro H H
* ro ro H * *
-ro * * *
- i U U U
~ ~
p O
U U ~
+
C-~ U U
L7 C "a "J
"a U~ U~ U O
~
C.
O
U' U U rl ~
C7 r~
y l, U
U
~ ~1 ~i ~ ~i ~i Pd U' x ~
C ~ o J
~,* ~,ro~ro a, b Aro M ('1 ~i N N
N
d d' d~ 0 O.P.~ P.~ P~
b N
o .aJ
U
00 o o ~ ~ ~
_ _ _ M M M
-r-I
O
Table 4. ha vitro efficacy of Modified AL-DP-4094 series 5'-sense strand-3' SiRNA EffICaCy3' -antisense strand-5' AL-DP-4198AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGASA-'5 AL-DP-4165AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3-AL4558 ' 3 -GSUotneCoMeGUGUAUCCUCUCUACUGASA-' S
AL-DP-4166AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4559 ' 3 -GSUoMeCoMeGUGUAUpMeCCUCUCUACUCGASA-' S
AL-DP-4167AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4560 ' 3 -GSUoMeCGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-'5 AL-DP-4168AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4561 ' 3 -GsUonseCoMeGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-' S
AL-DP-4169AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4562 ' 3 -GSUoMedCGUoMeGUoMeAUoMeCCUCUCUAdCUCGAA-' S
AL-DP-4170AL4555 +++ 5'- GsCACAUzoMeAGGAGAGAUGAGCUsU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'S
AL-DP-4171AL4555 +++ 5'- GSCACAUzoMeAGGAGAGAUGAGCUsU-3' AL4558 ' 3 -GSUoMeCoMeGUGUAUCCUCUCUACUGASA-' S
AL-DP-4172AL4555 +++ 5'- GsCACAU2oMeAGGAGAGAUGAGCUsU-3' AL4559 ' 3-GSUoMeComeGUGUAUoMeCCUCUCUACUGAsA-' S
AL-DP-4173AL4555 +++ 5'- GsCACAU~oMeAGGAGAGAUGAGCZJSU-3' AL4560 ' 3 -GSUoMeCGUonteGUoMeAUpMeCCUCUCUACoMeUCGAA-' S
AL-DP-4174AL4555 +++ 5'- GsCACAUzoMeAGGAGAGAUGAGCUsU-3' AL4561 ' 3 -GSUoMeCoMeGUoMeGUoMeAUoMeCCUCUCUACoMaUCGAA-' S
AL-DP-4175AL4555 +++ 5'- GsCACAU2oMeAGGAGAGAUGAGCUsU-3' AL4562 ' 3 -GSUoMedCGUomeGUoMeAUotneCCUCUCUAdCUCGAA-' AL-DP-4176AL4556 +++ 5'-GCo~eACoMeAUpMeAGGAGAGAUoMeGAGCUoMesU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAs~ -'S
AL-DP-4177AL4556 +++ 5'-GCoMeACoMeAUoctel:GGAGAGAUoMeGAGCUoMesU-3' AL4558 ' 3 -GSUoMe~.'oMeGUGUAUCCUCUCUACUGAeA- ' 5 AL-DP-4178AL4556 +++ 5'-GCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMesU-3' AL4559 ' 3 -GSUo~qeCoMeGUGUAUoMeCCUCUCUACUGA SA-' 5 AL-DP-4179AL4556 +++ 5'-GCoMeACor.~eAUoMeAGGAGAGAUoMeGAGCU~MesU-3' AL4560 ' 3 -GSUo~~eCGUo,~eGUoMeAUoMeCCUCUCUACoMeU~'GAA-' S
AL-DP-4180AL4556 +++ 5'-GCoMeACoMeAUoMeAGGAGAGAUoMeGAGG'UpMesU-3' AL4561 ' 3 -GSUo~eCoMeGUomeGUorneAUoMeCCUCUCUACoM~UCGAA-' AL-DP-4181 AL4556 +++ s'-GCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMesU-3' AL4562 ' 3 -GSUoMedCGUoMeGUoMeAUome CCUCUCUAdCUCGAA-' S
IAL-DP-4220 AL2780 +++ 5'-GsCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMesU-3' I
AL2781 ' 3 -GSUoMeConteGUoMeGUon~E~AUoMeCCUCUCUACoMeUCGASA- ' S
AL-DP-4182AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUaMeGAGCUoMesU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4183AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUoMeSU-3' AL4558 ' 3 -GSUoMeCo~teGUGUAUCCUCUCUACUGASA-' S
AL-DP-4184AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUo~,~eSU-3' AL4559 ' 3 -GSUoMeCpMeGUGUAUoMeCCUCUCUACUGASA-' S
AL-DP-4185AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUp~.~eSU-3' AL456t) ' 3 -GSUoMeCGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-' S
AL-DP-4186AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUpmeSU-3' AL4561 ' 3 -GSUomeCor.~eGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-' S
AL-DP-4187AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUoMesU-3' AL4562 ' 3 -GsUoMedCGUoMeGUpMeAUoMeCCUCUCUAdCUCGAA-' S
AL-DP-4188AL4564 +++ 5'-GsCACAUFAGGAGAGAUGAGCUsU-3' AL4557 '3-GSUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4189AL4565 +++ 5'-GCFACFAUFAGGAGAGAUFGAGCUFSU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4190AL4566 +++ 5'-GCpACpAUoMeAGGAGAGAUoMeGAGCUoMeSU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4191AL4567 +++ 5'-GCoMeACoMeAUpAGGAGAGAUpGAGCUFSU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4192AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUSU-3' AL4568 '3-GsUFCGUFGUFAUFCCUCUCUACFUCGAA-'S
AL-DP-4193AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4569 '3-GSUFCGUFGUFAUFCCUCUCUACoMeUCGAA-'5 AL-DP-4194AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUSU-3' AL4570 ' 3 -GSUoMeCGUpMeGUoMeAUoMeCCUCUCUACFUCGAA-' S
AL-DP-4197AL4556 ND 5'- GCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMeSU-3' AL4568 '3-GsUFCGUFGUFAUFCCUCUCUACFUCGAA-'5 AL-DP-4221AL2780 +++ 5'- GSCoMeACoMeAUpMeAGGAGAGAUoMeGAGCUoMeSU-3' AL2782 '3-GsUFCGUFGUFAUFCCUCUCUACFUCGAsA-'S
"Atugen Design"
based on single overhang AL-DP-4195AL4571 + 5'-GcAcAuAgGaGaGaUgAgCusU-3' AL4572 '3-gsUcGuGuAuCcUcUcUaCuCgAa-'S
OMe 2'O-Methyl F 2'Flouro s phosphorothioate linkage N Mismatches in scrambled controls Table 5. In vitro efficacy of siRNAs in HeLa cells siRNA UnmodifiedStrandEfficacy5'-sense strand- 3' #
parent 3'- antisense strand-5' AL-DP-4374AL-DP-4055AL2732+++ 5' CsAAGUGGUCCCAGGCUGCATsT 3' AL2740 3' TsTGUUCACCAGGGUCCGACGsU 5' AL-DP-4375AL-DP-4015AL2728+++ s' GsGACAUCUUCCAGGAGUACTsT 3' AL2730 3' TsTCCUGUAGAAGGUCCUCAUsG 5' AL-DP-4379AL-DP-4088AL2963+++ s' CpMeCoM~AAGUoMeGGUpMeCoMeCoMeCotteAGGCpMeLToMeG~-'orvteTST3' AL2964 3' TsTGGUFUFCFACFCFAGGGUFCFCFGACeG
5' AL-DP-4380AL-DP-4014AL2966+++ s' GCoMeGGAUoMeCoMeAAACoMeCoMeUonaeCoMeACocneCoMeAATST
3' AL2967 3 "TsTCFGCFCFUFAGUFUeUFGGAGUFGGUFUF~5' AL-DP-4219AL-DP-4004AL2712+++ s' GsUGAAUGCAGACCAAAGAAAsG 3' AL2720 3' UsACACWACGUCUGGUUUCUUUsC 5' AL-DP-4140AL-DP-4014AL2281- 5' GsCsGGAACAAUCCUGACCAsAsTsT 3' AL2282 3' TsTCGCCWGUUAGGACUGGsUsU 3' OMe 2'O-Methyl F 2'Flouro s phosphorothioate linkage N Mismatches in scrambled controls c c ~ N N N N N N N N N N N N N N N
d N
_ I~ t0t~ (Oh c0h c0I~ c0t~. I~ (Ot~CO
(O
da ~ ~ d)d) ~ d)~ ~ ~ m d) Q)d)O?
00 0700 O M O o007M O ~ N Qac0 M
W
W
r r r r r r r r r r r r U
M 'd'M ~ M d:C'~'V'd'd'NM ~i'r N r N O d' r N d'h O II)CO O W (OCh r d'N COO CON V O OOM O) 00O Op O
d' 00 O CO O OD O)ODW !~ M I' !~ N h n O
O
O
r ~
y E ~ ~ + i ~ ~ i .H -i-G -I-o l ll ~ O O a ' O
'~O '~O
m -p U U'-pa~
~
F- p d c h t m n n ~ ~ O O
U U ~ U V o V
o ~ ~ ~ o ~ o U Q
U
U ~ U ~ U j U o (~ o U
a ' o C7 ~'' ~ d o 9 a o ~ 7 o a U U ~ C~ H
Q
C C a d 'o U U
tJ7 ~ U ~ ~ ~ U ~ ~ U ~ U
V
o ~ o U U U ~ C7 ~
U
U U ~ U Q ~ ~ V Q
~ ~ ej~ o ~ o ~ C7o j ~ o V o a ~~ ~
y. I- C9Q C9 C7Q C U o ~ U U ~ U f~
. o ~ ~ U U ~
o ~ U ~ o ~ V o o ~ ~ o ~j Q ~
U a U V Q V j V ~ V Q ~ ~ ~ U' > > ~
Q U
U ~ ~ o o ~ ~ > >
~ = U
c C ~ ~ ~ o ~ o ~ ~oo U UU o C0U C7U
C .7~ U
C7 o C~ o ~ a ~
C U Q ~ ~ ~ ~ U ~ U a C~ ~ o o ~ o o o ~ o o ~ U
~ _ U
~
3 Q ~ ~ ~ ~ U V ~ Q
U ~,U U U , o C~~, o U ~ U U
U ~ ~ V U ~ U U ~ ~ ~ ~ =
~ ~ a U j 9 ~ ~ ~
?C ( C 0 (j o C Q = U= ~ j U j a a C7 d U ~' ~ N ~ ~ ~ '~~ C~C~ C9Q ~ C7 U ~ ~ ~ U ~ N ~ C9 _ U ~-- ~-- I- I-c --E- t-, ~
C ~ W ~
. a U ~ ~ ~ U ~ ~ N ~ vaU ~ N U ~ a - N
o U ~ ~ ~ U
D ~ U ' U ~ U ~ U - U a U- U ~ U ~ a o o o d' O r O r O O r O r O O O N
N d' d' d wt h. 1 r h M O CDO
M O d' M O V' O tf)Lntn InIn tf7~ tfaLn tn(p tn CO(OCOO
c0 V
Wit'N N N N N N N N N N N N N N N ~t d' N ' J
D
N N N N N N N N
J ~ W d ~Nd' dN' ~ dN' dN' a a c c0 N O
M M
~ CO
O_ c0 o '~' 'r U
z' O O
fa J
a a l1~ Ln Ln r tn r tn II~ lf~r LL)r M M M M M M M M M M M M M M M
M
O 'd'O d'O V'O d'O O d'O ~tO d' W W O O O O O O ~t O d)O O O O
r r r ~ O r r r r W
r M d'd' d'M d''d'd''V' N N d' r N r 'ch CO COO O c0 O O c0CV a0 c0N O Op O
a0 CO O CO N M N 00 O M d' N M tf7d" d' t!7 co ~ co 0 00 0 ~ ~ ao n n o n n n ao O O O O O O M M O O M M M O O
O
t ~ ~ ~ m f w f- -~- -f' ~ ~ i a d O a O ~ ~ a '~o ~ v~ ~ ~ _ a 0 U U ~ U ~n ~ ~ N w o U o ~ ~ ~ o U U d n o ' rnU o U o U rn~ F- !- ~ C=.7 C~ a ~, a ~ a ~ a ~ C9~ N Q v (~
o c?c? o ~ Q
C90 o C9 0 o U o ~ ~ ~ a ti 0 U ~ U U ~ - ~ ~ ~ ~ Ca'?ti 0 ~ ~ o ~ ~ ~ ~,~ ~ C~~ ' ' ~
~ C~ = UU'~ C~ ~ Q ~ ~ o o V Q
Q ~ ~UrJ ~ U a ~U'o C7Q C~Q C~Q C7~ -o U a U U C7U'' ~~j ~ ~ ~. = U
0 o U ~ o C'C' ~ o ~ d (~ ~ U o Q ' U ~-o U '~ C~ C~' d U Q U ~ U ~ U ~ U ~ = C9 ~ ~ ~ ~
U ~ V U a o o o o 0 o U V o U U o U U ~ ~ a ~ o U
U _ ~ ,~U U U U U U U
U ~ U ~ U ~ U ej ~ ~ ~ U ~ ~ U
U o (~V ~ o ~ a U C~
0 ~ U'~Q ~ Q C7~~ U U o U U ~ a U U o o U (~ U (9 U (~ U (~ j a U U U U o U o C~
V V C7 " ~ V U ~ ~ C~ C7 C7 ~ ~ o ~ ~ ~ ~ U C~ ~
o o Q ~ V U ~ ~ Q C7 ~ C9 C7C~ C~C9 > ~ o a ~ V o U V C~ U C9 o U ~ a 0 o U > > U U ~ o U C~N C~~ U'~ U O C'JUU' U o U'V ~ U C9 C~ ~ U
~ U ~ ~ ~ U ~ ~ ' U U ~ ~ U U
a a ~ ~ a o U U
~n~ u~U v~~ u~U U N ~ u~U ~nC7 ena ~ U ~' U U ~
~ U U o U c~
~ o a ~ > o > c~ ' > a U
> U C~
C~ IU- U o U
O ~ o U a o a U
U
U ~ ~
U a ~
~n a ~
cn ~
~n U - U a U a U ~ U~ U - U ~ U ~ Ua ~ U~ Ua o o N M N M N M N M N N M N M N M M ( ~tn CO
M r tn In r r ~t d'r ~htt r n O O n M O (OV' M ctM M
n 'cY d' d' m n u m m m wn co co~ eoco coo n n n n ~ r n n N N N N N N N N N N N N N N N 'd' N N N N
N ~t N N
O N M d' ~ CO n 00 W O
M M M M M M M M ~f7 ~ CO
N N N N N N N N M M M
<Y d' d w t d' ~t ~h ~t d' dw t r M
O
~' ~t m N °~ N O N °~ N O N O N O
d; N d; M V M d: N wt M N r-M d' I~ N M o0 N ~t t~. OD ~ CV
N I~ M 00 N 00 M Iv d' (O O 'd' i i ~ ~' -f~ + i i i ~ i i Q
a~ m Q 1~ Q ~ h Q U
o ~' ~° U U
I- ~ f- ~ o ~ ~, -~o d ~ o U
a ~ ~ C7 ~ H ~ ° o !N o ° ~ I-U N U U ~ U
U V a Q a N o ~ ~ ~ ~ ~ o ~ U
°' o o C~ o ~ Q o o ~ ° o Q
o Q U ~ U o U (9 U o U U U
C~ U U~ o ~ ~ ~ ~ ~ o ? ~ CU7 ~ ? o o U ~ o ~ U ~ ~ o ~ U'° = o ~ C~ ~ ~ ~ h Q
U U ~ U a ~ ~ ~- ~, ~ ~ Q ~ ~ V Q ~ ° o -o ~n C~~o~~oo~ ~ C~°~~C~ ~~°~U~U
o U o ° U U U o ~ U o d o U C~ U 1-C7 ~ C~ C='~ C7 C7 U Q C7 ~ ~ (~9 > > ~ ~ ~ o ~ U
~ U ~ U ~ ~ _ ~ ~ ~ o ~ _ ~ ~ ~ Q
U (U9 U ~ U o U U U y..°- U C~ ~ U ~ C9 o U C9 C9 0 ~ U' U ~ V ~ ~ ~ ° ~ ° ~ ~ ~ ~ U C7 o Q U °' Q C7 U C9 ~ '~ C~ ~ ~ U ~ o ~ U ~ ° C~
> > ~ ~ U' Q U' ~ ~ V o o U o Q o ~ o C7 j ~ U o ~ ~ U ~ ~ o ~ ~ C9 C~ Q o o U o o a U UU' U U Q a ~ a a a Q
o ~ U C=7 Q C~7 U =U' U U Q U ~ o o U o o ~
Q U U > > > > > > > > > U d o ~ o ~ o ~ o j ~ Q o o ~' ~ ~ N ~ o o ~ o ~ o ~ ~ ~ u. Q j ~ o o ~ ~ U
C7 ~ C~ ~ C~ ~ C~ ~ U ~ ~ >
C~ C7 U C9 U ~ U d ~n U ~n d ~n U N U >
. I- I- F- I-- I- ~ ~ E- N E- ~ ~ ~ ~ ~ ~- E--p ~ -o ~ -p m -p ~ -0 1- o -a ~ w ° a m ~ ~ w -o s ~n ~ N ~ ~n ~ v~ ~ e~ -o C~ u~ ~ u~ C~ ~n ~ v~ ~ v~ C~ ~n U~U~U~U'~oU~Q'~aQ~Q~Q-~o~aQ~Q~
I' d' tn M d' N LO t~ eY cD M O d' tn 'V' In d' ~ d' ltd d' In d' In M 'd' M d' M d' M st M d' O I~ ~- ~h d' 'd' ~t ~ N I~ O O
N N N N N N N N N N ~ ~ N N N N N N N N N N N N
r- N M 'd' ~ CO 07 O ~ N M
(O CO (° CO CO M M ~1' 'd' 'd' d' M M M M M N N N N N N
d' dwt d"d' ~t vt ~Y 'd' V' d~
N
O O
r O LL
V' O
r M M M M M M M M M M M M M M M M
O ~° ~ O ~ O 00 O 00 O Ci7 O N O d0 O 00 O Op N °~ N °~ ~ °~ ~ °~ O ~ O ~ O ~ O ~ O ~ O d) r N r N r N r N N r N r N r N r d: O N O M M d' 'd; M 'd' d: M M ~Y N N M r N
I~~ d' ~ CO N tf~ CO O N ~ CO ~ d' r 00 r d' c- OO
d' N O O 07 M O d' O d' O M ~t O 00 M ~Y 00 00 h M O N O M M Qa M M M W M M M N N M O ~ O
O M O O O O O O M O O O O O O O O O O O
t i i i ~ i y- .f.
t O O N
N
NfUn~'aNNm~u~ o I- ~ d ~ I- ~ ~ ~ a U
O ~ N ~ O
tn f/~ M fO O fly E- ~ ~ U ~ U ~, ° O ~ O
o U~UrJUUr°UUr°U(U~~'ti U
~ o C7 ~ o C~ ~j o o C~ o o ~j U ~ v o U a v I- V ~ U ~ V ~ U ~ ~ U FN- ~ yUn C~ ~ U ~ ~ o °' 'o C9 o u.
C~7 Q H U'o ~ o ~ U'o 0 0 ~ U o Q ~ U U Q
a a a a ~' Q a a a U ~ ~, U ~ ~, U
~U' U ~U' ~ o ~U~ o~ U ~~Q o ~~CU.7 0~
U U
~ U ~' U ~ _ ~ a° ~ a° ~ = U o C9 ~ U U U V E.-o ~ a ~ o ~ C9 Q ~ ~ ~ Q ,~ U
U C9 ~ C~ U ~ ~ ~ o ° o ~ ~ ~ a UU' ~ ° C=7 ~ U
o C~ ~ = a C9 ~ ~ V a ~ a U ~ ~ ~ o ~o ~ ~ o ~ C7 Q
CU.7 ~ V o o g V ~ o o ~ U ~ C~7 > > > Q
U C~ U o U ~ a a a ~ a a ~ U
c~ a ~ a ~ ~ ~ ? ~ Q o ~ ~ ~ o ~ ~ a d ~, ~ ~ U o 0 o U ~ o C~ Q
oQU~~Ca.7U= ° oU o °=(=9 ~UQ=U' aUUUC9 Q ~ U ~ ~ ~ U ~ U ~ ~ ~ o > > ~ _ ~ a = C7 > > _ ? ~ V o ~ ~ ~ ~ ~ ~ ~ a Q
V jUUUUa NQUQ ~aCa.7U~UC~.7U~UUC~
U ~ ~, ~ ~, ~ ~, ~ ~, ~ a a a c~ a a a c~
a -~o a v ~ -o ~ a ~ -a ~ 'o ~ a ~ ~ ~ -o ~ 'o ~ -o ~ -o dW n dWCW~ dWfl t~ c0 I~ c0 f~ cfl [~. c0 1~ t0 t~ CO h CO I~ ~h t~ M o co o ~ r ~r d' ~ ~r r n ~ o o t~ M o co r ao N N N N ~ VO' N N N N N N N N N N N N N N N N
d~wd 'd d~wd ~ t~ ~ t~ j ~ t Wd ~~~~dN'dN'dN' m O
'_ '- N d' r O W W O O O O O d) O O d)m O O 07 M O M m M
(O CO(O GO(O(O(O (DCO CO(~ O CO COCO(O r M r-N m ~-CO
t-~ ~ ~ T LO N lf7N LIB
N
o O o O o 0 0 o O O O O o O O o M o M o M
N N N N N N N N N N N N N N N N ~- N ~-N o t-N
M M dw t M ~h'd'M ~t M N N d' N ~ M wtM ~ M
LO
Oi P'7ch h.O)I~c'MM In tf7u- ~ tf~~ .rh o0 d'(VN a0 O)M O ~ O M O o0 ti'O f~N N O N a0 tf7O (Ot0 o0 0oeo oao00~~ oon con r'i. r r~n r~ o~o o~OD
~ 0 0 0 0 ~ 0 0 0 ~ ~ 0 0 0 0 0 0 ~ (O
n a~
m ~o ~u ~a a a ~ ~ '~' + + +
0 0 0 0 '~' +
z Z z Z
d ~ ~ d ~" r=nIN ~ f' t~ ~ f' H- a ~ a ~ ~ h ? '~o ~ U uaU N ~ can N ~ ~ ~ U'~
~ H d C~
o O N O N a a N N O
~ v ~ ~ N ? a ~ ~ _ a ~ ~, N
U ~ C7~U ~ V O
Q ~ ~ d ~ d > U ~ U a 0 ~ Q ~ ~ 0 0 o 0 ~ ~ U U a ~ ~ ~ C~~ C7~U
= ~ o ~ ~ ~ v~ ~ N o ~ a U CJ U U > > C? ~
C9 0 U ~ ~ U ~ o o o Q C7 0 ~ _ ~, ~ -~o ~ ~j Cd ~ Q U~~ U'o o Q o a > C9~ U' 0 0 ~ U a U ~ a U ~ ~ ~ ~ a ~
o o ~ ~ ~ ~ ~ ~ ~ ~ C~ o 0 U
a c~ ~ a o c~ o a o ~ a ~ a ~ o o o U a U ~ U ~ U a U ~ ~ ~ V eJ~ U ~ C~U U U U
U ~ ~ ~ U ~ ~ a U C~ ~ ~ a U =C9 0 0 0 o ~ o o ~ o u.~ a a o 0 U o o > > ~ ~ > > > ~ a U a c~~ c~~ c~~ c~a ~ ~ Q a ~-~ a U c~ a c~a 0 Q c?~ c~a ~ o 0 0 0 0 ~ o ~ U ~ ~ ~ ~?~
0 ~ ~ o ~ ~ o V ~ U ~ U ~ U C~= ~ C7 U o o U
U U U U U U U U ~ ~ V ~ ~ Q V Q U ~ ~ U ~ U U
V Q ~ Q V ~ U ~ Q ~ U ~ Q = = V o o ~ a ~
U ~ o o U o o d ~ ~ ~ C~7~ (~Q Q ~U'~ C7U'oU
U o U ~ ,~o ~.
0 0 ~ ~2,~ ~3, ~ o a V a o U V U C7 U ~ ~ ~ C~a o ~ o ~ ~ V ~ ~ a U a ~ U o o ~ ~3,o ~ a O O = O O N O O CR O O C~U C~= a ~ InO O ~
~ a ~ a ~ a U ~ o ~ U ~ 0 ~ ~ (~9~ C~cUnC~a Q ~ a N ' ~ a v~a a ~ a a a ~ a ~' ~ tnU cn~
~ ~ Q ~ ~ ~ ~ ~ Q ~ ~ ~ Q ~ V -~oU ~ ~ ~ v v~ f...o H ~nH o E._.o ~-y - o ~ ~n~.U H ~n ~ o H C9 ~ 'o= ~ ~ 'o~ 'o~ -a~ ~o~ -o~ a U ~oU -aU a 0 o U' C~
~
o ~3, =
O
~U' ~
cn U
c'an ~n H
U
'o 00 0~oo a~aoa>ao o~eo o~ao o>ao o~eoo~~ a~0 0 0 <- .-~r ~ .-rr~t t~ n.o o r M o coco ~ N cv~nio.-m ~n ~ m m N Wn ~ co com cococoo mn u mnu N
N N N N N N N N N N N N N N N d' d'N N N N w m ~n N
N
N N N N N N N N N N N
~t d' d~ d' ~Y V' d' d' d w d' d' M
O ~
O IL
d' 0.' M m M M O M OM 07 N N N N N CON 00N
r OpO ~- 00~ 00<- 00 00 a0 M M M M c~7Mo0 M M M
Lt7a0tO ~ OD~ a0LO o0 N CV CV COCV COCV (OCV
a0 O eD o0 O M Oo0 O (O c0 O O)O O O 07(O
N o0 ~- N ~ Nr- N O O N N r-N r-O
O > O7 O) ~- N N N
N
ch 'd~M M M N~ N 'd' rt ~ M d' M d' MN
d' M M v-CV d'CV O COCV c0O CV ~ ~ ~ c0d) CVt~ a~M
DO CV c0 O
O ~ 00 n M 00 nn n n 00 n (Oe~ tnN ~V
00 0~n co aon nco n LIa CD e~ 000o aoao 0oN
n o0 0o n oo 00 ao n M O O O O M MM ~ O O O O O O O OO
O O O M
m H + -i' F- E-H
,~ ~ a a ~ N ~ N ~ O ~ O
O o p N
U V ~ ~ o ~
U ~ N ~d U o U m ~ o U -a U ~ ~ ~ ~; V o U ~ ~ ? ' ~ U U ~ d ~ ~
> ~ cn o ~ -~a ~ ~ ~ N ~ U CJ ' Uo ~ Q ~ ~ ~ ~ ~ ~ V ~ ~ ~ a ~'U U ~, ~ ~ U o o U U
o ~ a o ~nQ ~ ~, Q U a U o o U ~ ~ > > o ~ ~ ~ Q
~ C9~ ~ > > CU.7U'oC~ ~ ~ Uo v ~ ~ 1- ~ UU
Cj V ~ ~ v C~.7 U d ~ ~ c~a ~ ~
~ ~ a o ~~ 0 ~ U ~ U Q o > ~ U U~ ~ V 0 o ~ U ~ ~ C7 U U o a U > C7 o o C~
a _ = U a~ U Q U a U o C~~ U_ ~ ~ Q = C7 ~Q Q Q U ~ C9~
U o > U U ~ ~ ~ ~, o o U ~ ~o > o ~ ~ a ~ ~C7 o o U Q o C7 Ua U Ca7U o C~U'oU ~ U ~ o ~
> ~ V ~ Q~ U Q CU9C~9 o ~ a a a ~ d o u.~ a U a a ~ o (~o oU
o ~ ~ U o U~ U ~ ~ c~ ~ o (jU C9 a U aU a ~ = ~ U U ~ U C~
U o ~ C9~ C9~ U U = U ~ a ~ o a ~n C9U o U o Uo U ~ U Q U ~, U ~n U ~
U N U ~ C7U C7~ C9a ~, d ~ u~(9 cn(9 U~, cn t- U ~--~n i-U i-U U ~ o o I-~n I-~n 1-~ U ~ ~ c'onU ~ a -~o~ o (~ N ~ N ~ ~
o ~ o ~n H o H~n H U ~.~ 7 ~n ~ o ~.o ~o U -aC~ U ~oU -oU -oC~ ~oU C~ C~ ~oC~ -oC~ ~oU
Q Q
~ > ~ U
(j C~ a U
o o U a d ~ ~ I-~ ~ U' U U ~ N
a ~ o ~n ~ o ~ C~
C7 o U ~a o ~ o U C~ ~
U ~ a U ~ o ~n U ~n ~- U U
a (9 o o cn H ~ ~n U U I-~o ~ ~
~n N
o o F- ~
(~ C9 N a cn ~.
C~
-a O ~ O O ~ O ~O (O d'N N N M N M N MN
c- M M M
~ N OD ~- ~ c0 d n (O (ON ~ N u7tn N a0 00 o0 N tn ~c'7tn~ CO CO~ c0CO COO t-tn 47 tn tOIn tntn O(O
tn ~ tn c0 CV N NN N N N NN N ~J'~tNN NN N N N N N NNN
Lf7 CO n CO O) O r- N M d' In co co co co co n n n n n n CV N N N N N N N N N N
~1' ~t ~t d' 'V' dw t d w d' d' d' cn-~t O
N o0 N N n n n r n n n r n r n r M M M M M n (° n O n O Is M n M n M n O n CV CO CV t0 ch Oi M o) ch of ch of O? O) ch o) P') of M 07 O o7 O o7 O O O d) O o7 O W O O O °) O o) O 07 N r N r N r N N N ~- N r N r N N
'd'ONO MMd'MMMd'MMMNrMONO
Is a0 M d' (O CO O O c0 O O c0 a0 CV ~F 'd' a0 CV d' N
N o) d' 00 n M O ~ n LC~ W M N O ct O N 00 ~t i0 ~ co n co o0 0o co 0o m ao ao ao co eo n n oo co n co O O M O M O O M M O M O M O O M O O O O
y- -1- -I- -1- + ~ y- -j -t- i--I- -i- + -F -I- i- i-m m F-a H- ~ m ~ ~ ~ ~, ~ I-- F-~Uu7 ~ o ~ o ~tUnh H
o ~~ c~n~ c~n~ ~~'a -o U Cd ~ 0 0 0 0 ~ ~ o ~ ~ o =
a ~ a c~ a c~ a ~ Q a a c~
U
a ~. U ~ U ~ U ~ U ~ o ~ a o U C9 ~ ~ ~ ~ U ~ U ~ ~ ~ o ~ V a ~ U o o ~ o o U o ~ ~ j o U -~o V V ~ ~ ~ ~ ~ ~ ~ U Ca7~ ~ ~ C~ ~ C9 ~ ~ v ~
a o o ~ ~ o ~ ~ ° a ~ a U ~ U
a ~ a a Q ~ a a a a a ~ o ° U a ~ -~o ~ o o ~ ~ o ~ ~ o o V ~ ? o ~ U U
U ~ U C7 ~ o o C7 0 0 > > = U o ~ U Q a U U (~ U ~ U ~ U ~ U ~ U a U ~ U a V > > U U
d Q ~ ~ j ~ o ~ ~ o ~ ~ o ~ Q
0 0 ~ U ~ a o ° a ° o a o ~ a ~ o U a U U > > U'~ C7 C9 C~ C7 C~ C~ U'~ ~ = U o ~ Q C~ Q
C~ ~ a U ~ ~ ~ U ' C9 ~ ~ ~ U ~ U ~ ~ ~ >
CO a o ° ~ ~ o ~ ~ ° ° a ° a ° ~ o ~.
j U
a > > U' o o ~ o o U' V U ~ Ur U U ~ U
> > > Q Ur U U C9 U U' U C9 U C9 ~ ~J a ~rJ ~ a a a Q e~
Q C~ U = = a ~ ~ U ~ ~ ~ U ~ ° U ~ ~ o C9 C7 C7 U U
U a U o o ~ '3, o '2~ ~ ° V d ~ d V U ~ U a ° V ~ = U C9 U ~ o p U ~ o N ~ a U U U ~ ~ ~ Q ~ ~ ~ Q N Q Q U Q Q Q U Q ~ CU'J
U-~o~~ ~~Q c'~n ~c~°n ~~Q ~ f~Q ~
o ~ v~ ~. a ~-. ~n f- o H ~n H o H o ~. ~n ~ o ~ ~n H U E-C9 ~o C~ -o ~ ~o ~ -o ~ -a ~ -o ~ -0 7 ~o ~ -o ~ -o ~ -o a ~o N M N M lf> N d' tn 'cf' tn rt ~ d' Lf~ ~t to d' ~ 'd' M 'd' ~ CO M
N d' r n N O N N ~ tt~ N tf) tn N 00 N r OD d' r n N m In CD CO (o O O ~ tn ~I7 tp ~ ~ tn ~ tf) t° c0 c0 ~c7 CO t0 c0 O O
N N N N d' d' N N N N N N N N N N N N N N N N ~t ~t (O n 00 m O N M 'd' In n n n n ao ao 00 0o ao 00 ~ ~ ~ ~ ~ v r M M
d' Q.' V' ~- I' f~r- t~ f~<- I~ t~ a0 N a0N OO
CO ~c0 N CO 1~(O I~CO h c0 !~c0 f~(OI~ N d'N V'N
N
d' Qi c~?Oi C~~ c'~~ M O) M ~ M Q) chd)ch CO CV(O(V(~
O mO ~ O O O O)O O O O)O m O O) O O O O CV
N c-N r N r'N N ~ N N a-N s- N N <-O
d) N
d: Md' c'~d~ M ~t M ~t M M N d' ~ M O ~Y M rtM ~t O MM h O7 !~M M I~ M ~ O)Iw .~.Lf7O T CO1pO M
m N O) N r M 07O O M ~pO d' <Y N ~ O O
co mo~ ooao eoo~ ooco r~n r~eo ~ph c m m aoo~~
O
co o>
+ + +
+ + ~ ~ ~ ~ + + + +
+ + +
d d d tan ~ ~ 0 0 a N~"'N v ~ ~ >
tin~"' cantin can ~,E.-.u~~
UflyN ~ U t/~O ~ ~ ~ N N m tQn o ~ c-n~ ~ U U I- ~ I- a ~ ~ ~ ~
U~ U canU ~ U ~ ~ ~ a ~ U'N~~ C7tl~
c~ ~ c~c~ ~ ~ ~ o Q C~a~
c~o o c~ o o c~a ~ a cnQ a ~ Q ~ a ~ ~
C~ UU U CJ U U U ~ o ~ V ~ V (~C~
U h U ~ H ~ _ ~
U ~_~ ~ U ~ ~ ~'~ ~ o a U U o ~ c~
o o Q U a C~ 0(_9Q C7 Q C9 ~ U C~,CU.7 COU o o ' ~ V
0 ~ o ~ o ~ ~ C7 ~ ~ U C7 o ~ o ~ U ~jo C7 U CHo o 0 Q ~ ~ ~ U Q ~ U ~ U H U ~ ~ V > U
0 ~ ~ o ~ Q o C~ ' ~, C~~
> ~ ~ ~ ~ o ~ ~-~ o o ~ ~ o > o = o ~ _o d o = o U _o(j U ~ o o ~
Q a C~~ ? Q =
0 o Q o o o a V Q V o j Q a ~ ~ (_) U > > o o ~ o ~ ~ . ~ o o o Q ~ a > > d a ~d~ ~ ~ c~j o o a o o o c~ ~ c~~' o U Q U ~ o ~ ~ ~' U c~~ a o o U Q U Q U ~, U ~ ~ '~Q ~ V C7U ~ U ~ ~
C~ ~ ~ = C7 ~ U ~ a U ~ o > > > ~ ~ ~ V U
~ ~ C~'~ U U C~ " U C~ U > > U ~ o o O~ (9= (~j (~o > C~ Q o Q C7U U U Q U ~ U
> > _~- Q Q ~ ~ c~c~~
U' ~ d U NU o U o U ~ o o CU7~ > ~ > ~ '3,~
~ ~ ~ ~ ~ U C9 N U o o m ~cn ~ cn ~ tn ~ U ~ U ~ ~ Q U'~, U tnU c~
U N ' ~ U ~ U ~ o ~ U o ~
U can~ canU can~ can~ canU can~ tanU canU -~oU can~ cana a ~a ~ a ~ ~ ~ a ~ a ~ a ~ a o U
~
~
U
~
o Q
U
~
c~
'2~
U
v~
U
U
can Cp htD h (O f~.CO h (D I~(O I~t0 t~COI~ N O a0 Q)a007N
N N~ tf7N ~ ~n N a0 00~ r-00 it I~ r _o0N N u7u7O) N NN N N N N N N N N N N N N N d"d'N N N N N
~
N
N
m ~ ~ ~ m N wN N N N N N N N N N
d t d' V' 'd' ~t ~t d' d' ~t ~t O
~'M
V
O
N Nt0 N o0 N N N N N cr d' d w t d' d' N d~N d'N ~YN ~tN d' c0 ~ c0 ~ c0 ~ co CO ~co N
c0 NCO cVc0 N CO cVc0 cV t~ '-' '-' N O)N O N O)N O N O) O) d' Md' M N r 'd'O N O ~i'M d' d'd' d'd' d' MN
M N
t~ a00OM7~ ~O t0~ ~ O M ~ ~ O tnc0 tOO CV Mc0 ao aon e0n N I~ r.t~ n oo ~ ~ ~ oo ~ r ~ ~M
oM0 c00 ~ aN0 d d ~ oh o I-- H' ~ ~ h IN o ~ ~ ~ ~
~ ~ N N ~ a ~ ~ ~ O ~
Qo C~a ~ a a ~ ~ ~ a ~ a c~
~ ~ ~ U U'NU C~U C7o U j Q o~ C=.7cn ~ ~ ~ o Q U ~ V ~
U ~ U ~ U ~ o o ~ U o U ~0 0 o U ~ U ~ U ~ U Q UIw ~ i- ~ o ~ o C7 ~ oN
o v~ ~ ~ Q Q O =
U oU v I- o v ~ U o V U~
U C9 ~- o U d ~ ~ C~a o U~ o ~, I- U o ~ o ~ U o C=.7~ Cu U o U U U UI-' o~ ~ ' ~ ~ H UU ~ U ~ U ~ ~ U
C9~ ~ ' ~ o ~, ~ o,o U ~a j jo o ~ o C9 C~ ~ ~ o o ~ ~ U
U ~ o U Q o U ~C9 = C7 ~ C~ = ~ ~U
o = U ~ o ~ U ~ ~ o ~ ~ o ~ Q U ~
U U ~ Q U ~ Q C=9Q C~ U o 0 0 ~ ~ ~0 o C9 ~ o Q ~ ~ Q j ~ ~ U 0 Uo o = > o j j UU'U U ~ ~ o ~ o Q ~U
~ U ~ C~U ~ a U ~
o U ~ U ~ U U ~ U ~V ~ U Q V Q U d oU
U~ o ~ o ~ ~ ~ U =~ ~ ~ ~ ~ d U C7 U ~ _ _ ~ CU7C~~ Q o o ~ o U o =U'~
Q o ~ Q Q ,~o Q C~U C7U COU C~U U
~ C~U U o ~ U U ~ V ~~ ~ _ ~ ~ N o ~ (~oU
~ ~ = V U U ? V Q~ C~o ~ ~ ~ ~
U Uo o Q C9~ ~ U U'U ~ U U ~ ~ ~C9 ~U U CO U ej U ~ U Ud ~ U N d ~ C~ CJ ~0 a~ -~oU ~ ~ a U a = 1=-o -~ov ~ ~ ~ ~ v a C~ m~ ~nU cn~ v~U m U aU ~n~ m U u~~ ~ ~n~
~U'o-~oU'~~ U'o~ C7 a Q aQ ~ Q -~oQ -~ao ~ ~C9 oC9 a o0 ~
~ C~
o o ~, j ~
U
o~ ~n U Q-~o ~
~
o U
~
U
~
~
~
~
m ~-~o 00 O)00 W Op O 00 O OD O N MO O O O O rO
r r ~ NOO OD~--r 00 ti' I~(O COM M CO (OM (O(O O) ON
IIIt0tf7InCO (OIn CO(O (OM MIn Intn Lf7LO InM LO t0N
N NN N N N N N N N ~t ~YN N N N N N In N NCO
In CO
N N
N N
1~ a~ a~ O N M d' ~ c0 I~
O 07 ~ O o O O o 0 o O
N N N M M M M M M M M
d' d' d. '~' d' ~' '~' ' O
M M
N M
r IL
~t O
d' ~ ~t~ T ~ N ~ N r N
CO CO O ~ m ~ ~ O r- O ~ ~ ~ ~ ~ ~ r h ~ 1~~ CVCOCV (OCV CV (OCV CDN COCV (OCVCO (V
O r.O N O N O CO N O N O N O N O N O N
~- N N N N N N N N N N N N N N N N
O
N
N
d' s-N t0CO~ I~~ ~ ( d' 0pM Lf7ct M M M LO
!~
CV LO00tn ~ 1'M u-~ ch f~O7 LO~..1n~ cYjn:
00 00W [ w - 00M O O M OpN W 00LIaN ~ 00O O
t~ I~CO1~ O ~tO ~ O O 'd'07 ~ OOM O N o0N O
O M O O ~ N ~ ~ tn ~ ~ O ~ O r O n O N
~
~
+ f + +
y . -~- i ~ ~ ~ -!. -I- f -1- -h -1--f-a a C'J
d O
U
a ~ ~ ~ ~ 0 0 N fOM !O ~ fO fO ~ p H
~ c?~ a N ~ ~? U
U ~ Q a U ~ U U'oa U ~ ~ a ~ U
d a 0 o ~ o ~ o U o U ~j= = d CO C? C~ ~ ~ Q ~ ~
CU7 > ~ Q ~ ~ V Q ~ ~ 0 UQ
~ o C~ ~ d U o ~ j ~ 'o U cUn~a o ~ ~ V ~ _ ~ ~ ~ U ~ ~ ~ 0 N C9U o a ~ o U j o j a C~
Q o ~ ~ 0 o ~ ~ o ~ C~~ o U CU.7 o C7 ~ U a V U Q V UU'~ U ~ ~ a ~ C9 U'~~ U ~ V C~ ~ a ~ a a a U a U =
Q CU9U Q U ~ U ~ o U o U ~ = o ~ ~ UQ' Q
a > ~ U ~ ~ ~ ~ ~ Q U Q ~ Q V Q a U ~ o o ~ U m >
U U UU'a ~ U'~~~ C9 ~ o U'o~ ~ _ ~ ~ ~ U ~ U = UU'o ~ C7U_ o Q ~ ~ C9 ~ Q a Q a a ~ a ~ U a = ~ Q a ~ ? U U a U U U U Ca? a C~~ ~ o ~ ~ 0 ~ ~ ~ ~ o ~ V Q U
~ Q ~ o C~~ 0 0 ~ C9~ d ~ _ ~ ~ ~ ~ Q o U C~v U U ~ ~ ~ aU o ~ o ~ o o a o ~ U U~
U a U ~ ~ ~ ~ C7~ a ~ Q ~ Q ~ a ~ a a a ~a ~ C~ ~ o V ~,~ U o ~ Urd d ~ ~ C7 o o CU.7 U U ~ ~ o a ~ ~ ~ g o ~ o ~ o C~,(~ ~o ~ a U ~ ~ U ~ U U o U C9U ~ U ~ a ~Q
U ~ ~ ~ N N ~ cn u~Q U Q U ~ ~ ~,U'~ C9 'o E.-.Q U U ~ ~ ~ ~ ~ ~ U = U ~ U ~ U ~ a ~U
N U ~ N fnO O o O tnfO fpN tntO fnUJN U ~fO
a 'oC~ C9C9GOC9 U C.~7C9 U'C9 C9C~C9C9 C~C9C~C9 'oC~
V
o o Q
Q
~
~
>
>
Q
~
~
~, U
o a ~
~, m U
~
tn O
U
O ~ O r-CO t~N M N M N N M N M N M N M N M !~ Lf5st M
Q) InN 00N N M M CD (flM CO M O D)N N 07 InN 00s- 00M
CO
N N N N ~ 'dN N N N N N N N N N N N N N N d' V'N
N
CO O O ~ N M d' Ln CO t~ M
O O r ~ T r' M M M M M M M M M M M
d' d' d' d' Wit'~i' Wit' d' V' V d' M
O U- O Il O ~
~r O d. U
M N N _Nc0N o0N_ 00N_ o0_N o0 M N M ~ ~ O
~ ~
~ ~
COCV CV CV(ON COCV CON CDN CO CY7~ M ~ (~'!~ ch ~ (O CO N r N h N .rrN r N ~ M M M
N N N r-N N ~ N
r ~
N ~ In ~ N '~tM M O d: O M O~ d- N d' M d; M d~
N N
O
COLn O tO(Of~.N C~ OOh ~ cM ~ O) M c7 h O h ch N O O w-N O 'd'c0 O O h 00 LO M h ~ N M 0047 h r' d O h OD h CO COM LO00 LO O h O h O h O
O ~l' O h O O M O COO O M O CO M O M O f0O
O h h h h O
O
-E
i ~ -~- -/- .~- -~. + i O
U
d t- ~ t- o I- ~' ~'I-N ~ ~ ~ ~ ~ tl~~ o N 0 ~ 'O O p '~ON (O'O
U a ~ f ~ '~~,y~ u~
N 'O o U ~ a n o ~ ~ o N m ~ ~ ~ a ~ a U o u~ C9~ _ ~ ~ ~ C~~ C~
~ ~ d ~ ~ d 0 o U ~j ~ C70 0 ~ 0 C9 ~ a ~ ~ U ~ U ~ U ~
U U
d ~
~ C~
o o d ~ C o F- ~ ~ ~ ~ V ~ ~ ~ U
~ o o 7 ~ -o o ~ ~ -o U ~ U ~ o o U o 0 o ~ d U ~ ~ ~ U ~ ~ ~ C7 C~ U C7 U C~ U C7 U C7 0 ~ U a a = U ~ -a C~ 0 U'U (~ U Q U C~ U Q U ~ ~ ~ ~ C~ ~ aU'~~ C~
U ~ > ~ _ ~ a ~ o o j V o U ~
U ~ o ~ ~ o ~ V > ~ ~ ~ U ~ o = o 0 U C7U ~ U > = > V ~ U ~-~ Q ~ ~ ~ Q C9 o ~ a ~ a ~ Ca.7~ a a ~ ~ U U ~ U
a CJ~ Q a ~ a ~ Q ~ ~ ~ Q ~ a ~ Q ~ a ' C7U o ~ U ~ a o a ~ja U U U o o ~ V o U C7 C9U ~ ~ ~ Q U Q U' U U U Q ~ Q U Q U Q U Q
C7 ~ ' o o a ~ ~ ~ a U
U'o> > o U U ~ ~ U ~ ~ ~ C~
~ o o U a ~ ~ a Q o Q = U C~ ~ o ~ C~ ~ o ~ ao ~ a ~ ~ ~ ~ ~ ~ > > ~-a ~ c~ a c~ ~ c~ a c~
~ Q ~ a c~ ~ a ~ c~~
C9U ~ ~ ~ ~ ~ U a ' ~ ~ ~ ~ ~,o ~ a C~~, ~ o ? Q ~ o ~ > U'oa U 0 C~ N U o a ~ ~ o ~ ~ U cn U ,n (~,n 0 ~ a c~o ~ ~ ~ o ~ a cna ~ ~ ~n~ ~nU cn~ N U ~ v a ~ ~ ~ a a ~ o C9~ C7 ~ C9 ~ C~ ~ U'Na U a U a U a U a U
a d ~
0 v ~
~ U
U ~
~
~ U
~n ~ N
a t d' d' ~Ytf)~t ~ d' Lnd' Ind' lf~O)h CO h (O h (O h CO
M In ~ (OM O O)N GVd) Li7N 00~-00M M CO (OM COCO
t0CO M ~ t0~ ~ CD ffl~ COCO O l0 U7~ ~ ~ ~ tC~
N (O (O N N N N N CVN N N N d'd'N N N N N N N
O t0 M ~
NN NN
N N N N N N N N N N
M M M M M M M M M M M
d' d. ~' ~' ~' .d. ~' ~' d. d' d' O
M
r h h r h r h d' N d' N 'd'N 'd'N '~hN 'ui'N 'd' opt0 00t 00Ino0W OD t0 N OD N o0 N OD N CO N o0 N o0 pjch ~ cYj~ ch~ M ~ (V ~ CV ~ CV LOCV tnCV ~ N tf~CV
pp Op o0 Opr 00 N OON ODN CON 00N o0N 00N
r N r N r N N N N N r N N N N
N <1'M N r d'O N O In N l N l N L N d' M M r d' ~
M M I~t~ r M M h lf7 (O O tc)CD InO - f0 O)N f~CO
h f c0O rt( N O O d' ~ C ( d' COc LnI t st ~tLf7 h 00 h e0 ( ODO CO O 07 h O h 07 h O h.OD h N ( 00 M O O M O O O O O M O O O O O O O O o M O o .E. + .E. ~ y .
+ -H -f O ~ d 'HO~ 'HOv)'HON a N O
O
U ~ ~ '~~ '~~ o v~ V o ~ v~ ~ o U
c~~- o ~- a ~ N j 'a3,~ ~ j o c~ ~ Q
N ~ ~ ~ ~ ~ Iu ~ a ~ a ~ ~ a ~
c~
a ~ e~~ c~~ c~o c~~ ~ U
= o ~ ~ a ~ o o ~ C7~ ~ U ~ ~ ~ U ~
U ~ ~ U 0 0 ~ ' ~ ~ o o U o 0 ~ o ~ ,- UU U U U U U U U
U ~ I- ~ ~ a ~ ~ ~ a ~ o a CJ o U ~-~ C7 o ~ o Q o 0 o C7 ~ >a ~ c~ c~ c~ ~
U U (~U ~ U a ~ ~ Q U U ~,U U ~ a a ~ U a a U ~~ ~ d U s U ~ ~ a C~
U U a _ ~ U ~ U ~ U ~ a o a U U
Q U ~ Q ? ~ U ~ ~ ~ ~ ~ ~ U ~ a U' a > > C9~_> > U U> > > > > > ~ = U o o a U
o a U a a ~ ~,a ~ a ~,~ ~ U
o V U ~ U U U ~ Q C70 0 ~ ~ o ~ ~ o = o U ~ =
Q Q U a U U U V j ~ ~ a a ~ ~ ~ o ~ ' ' (9 U ~ U ~ ~ ~ U C7 N ~ U 0 Q U' ~ U >o o ~ u~o ~ ~ U'~o ~ Q
o o C7 ~ Q U Q > UC~ U o ~ C9 ~ U ~ U 0 U ~ o ~ ~n~ o ~ o ~ ~no a C9 0 > > ~ _ ~ ~ ~ ~ V~ Q u~ a ~, a ~n a ~ U ~ U ~
"~ON 'O7 '0N 'O~ 'O ~-- ~ ~ "~O '~pN a N '~p~ '~pN
a ~ ~ ~ a ~ U~ -c~ ~ ~ ~,c~
.-.O E-fn f.-O f--.N E-- f-U) ~ O ~.-fp E-O ~ O ~--M ~-O
v U -oU 'oU -oU ~ ~ 'o~ -a~ 'a~ -o~ ~a~ -o~ -o~
h co h c h c h co h M co o~ao ~ ao o~m ~ eo o~~ a~o0 M ) a)N N ) ~ N d0N mM M ( C M (OCO M ) W N N ) N N N N N N N N N N N N N
N N N N N N d' d'N N N
O r N M ~h L CO h d0 Q) o M M M M M M M M M M V
M M M M M M M M M M M
'd' d' V' V' rt d' d' d' ~i' d' ~i' O
N M
M
O ~-d' ~' N d' N
N a0 N
~ CV tf~
N
O
U
~-v.. ...r O
~ M ~ ~ N
t0 cV CO in t~°O CMO CEO O
M
-H + ~S''.. ~ '~~
-1~ -I- W- -f' ~ -F -f--F -I- -F 'LJ C//~ ~--~
N
~N
O
+~' ~ ~
U o 0 a~
d Q.
a~ m U U U U ~ .~ ~ 4~
m ~ ~ m d ~ b 0 o U ~ ~ o C9 j C~ ~° C9 ~ C~ j fn m tO N v O
O ~ ~ ° ~ U
U ° U ~ U ° U
o°~~o~ °'° o .~~.Ua~
Ca,7 ~ U'o ~ C~7 ~ C9 ~ C~7 U a~ ..~
o~o~o~=rOn ~ ~ ~~ ~~lc~
~. I'~ U'~ C9 U' U j N ? ~ N °~ p tn U .n ~ ~ C7 ~ Cd m ~ ~ U ~ ~ ..fl b Ca.7 ~ Q U'° ~ o Q o o C~ O U ~ ~ U ~ U ø, V U ~ U ~ U ~ U ~ ~ ~ C7 ~ = C9 f ~ V U ~ U V ~ m ° ~ ~, u. = O c~ .-~
C9 ~ > j U U a U o ~ U ° O ~ C~ U
U ~ U ~ a ? ~ = a = ~ ? V ~ o O ~' C9 0 ~ ~=.
U O ~ o o ~ ~ o ~ ~ o o ~j U ~ o C~ U ~ , v o Ca.7 ~ ~ ~ Q V Q ~j ~ ej Q V Q Q Q V Q ~ Q ~ o ~~ ~
C9 ~' ~ O ~ o ~ U a o a V ~ Q ° Q ~ Q U Q C~ ~ ~ .r;
o ~ °' v ~ o ~ in '~ N
Q V ~ U j ~ ~ C~ ~° UU'~ ~ C~ ~ o 0 0 ~ o ~ o V -r", ~ cd U ~ > > ~ > > U ~ U o U U ~ a~ Wn ~ Q ~ ° ° ~ ~ ° ~ ~ o ~ ~ ~ U ~ Q C~, C~ ~ c o > > o ~ o ~ ~ o ~ Q ~ ~ ~ at O Q U ~ U Q U ~ U ° U o ~ o ~ o U U Q ~ ~ d ~ ~ Q ~, ~ ~Q Q > > >Q > >Q j ..d ..~ b Q o o ~ o o Q a o ~ o ~ U
U ~ U > > U U C~ U U'~ U O U ~ U ~ U ~ Q ~ U .fit U
Q ° Q U ~ ~ ~ Q ~ Q ~ ~ ~ Q ~ a ~ U s Q N
cOnH~Q~cQn oo~ ooN~ o~~ ~'~.c~n 'o ~ 'o C~ ~ C9 ~ C9 ~ C~ 7 O ~ C~ ~ O ~ C~ ~ C9 a) 00 °) a0 07 c0 ~t n ~ CO u) n d' !° M d' N ~ n d' (O c tn N eD M M <- N ~- N ~ N .~,., ~ b c° co c° M M n n n n n n n ~ i n i ~ ~ ~ r~ rN. .
N N N ~t d' N N N N N N N N N N N N N N N N
,~ 't~ c~
O.
.s', ~ (n CO n d0 p~ O N M ~., m MO~°7c'~MMM MM
d' ~h ~f' <1' d' '~i' 'cY d' ~ N U
i ,~ N O
~ p N
° ~ ~1 ~l ~t M
v o°
O
c a V M CO N V O (O 00 1~ M
'U
CD N CO W d) O 07 O
<- ~- N N N .~, N
W .o U
~
~ a0 t~ eh M o0 c0 ~ O O
N -~-N M c~ N ch M M M O N
~
O
~
M ~, U
.L"
~ O
~ N
.~
cd U
d~ d0' d~ ~ (~O L~ ~ cMO CO
' ' ~ ~ .
'a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
O
M
vi cn ~
~"
, a, n t t t t t t ~, t U ''-' t~ t t t U
c ~"'..y..,~
.
,.., t t t t t _ W U
CC
,3 .fl N
m ou. ~a ~u. ~u ~ ~~ ~a ~~ ~~ ~ c~
~~ a a~ ~~ e~N a~ Q~ ~~
~
w U ~, C7 CPU ~~ C7 ~ C~
V
~ ~c~ ~~ ~a ~~ ~ ~ ,_~
~. U Q? ~a = ~ ~
V ~U ~ ~
o Q ( ~
~ ~
U C~ U U U U Q Q a~
U ~ ~ g~ E
~ ~= -~
v~
~
oQ Q V U ~ Q U ~ ~ ~
~ C7 ' y ~
U U ~ = U Q Q U o cd o o o o o U o a ~a V ~ ~ ~ U UC UC a~
o C7 Q Q? o CP C7U H H j ~o a ~ ~ .
o ~
Q (j ~o UU o ~o o Uo .
+
o ~ o~ oa o~ o~ o~ ~ ~ ' ~ ~ " " ~
c c .
Q? U~ (9V ~'? ~,~ Q? ('jU
~ ~ ~ U ~
~
Q V ~ V _ o ' V ~
V ~ C ~ ( ~ ~
( o ~ ~ ' 9 .7 ~ ~ .~.~
~ ~ '~ ~ ~ U .n ~ o o r:, U ~ Q Q U U (~ o a~ p., ce o ~~ ~~ ~~ ~ o o o ' ~., ~U ~- dU dU d U
' a ~ ~ ~ ~ ~U ~ ~ ~~ ~ ~, ~. ~ ~ ~ U ~ ~ Q ~U ~ o Q U oU U ~ ? ~ . ~
.b ~ ~ ~ V " ~ ~ ~ ~ ,.fl ~ ~ ~ ~ ~ ~ 0 U > > U ~Q ~~ C~V ~, ~ M ~
o o ~
~ ~Q o ~
oU ~ oC7 oQ ~ ~ oU > ~ aj v~
U ~ a o o = C~ o ~ C~ ~ cd b U o U U o ~ ~ ~
Q o o > ~ ~ o ~
oQ V
~ +~ v a ~C7 ~U ~ ~C7 ~ ~C~ ~~ ~ ~ -d p ~ ~ j ' ~u ~ c ~ ~ ~ ( a ~
~ n~ ~ ~ a ~ ~ ~
~ ~ U
N
~ u. u. _ 0 U U a u. ,.
. ' a U C7U
~ U U
>C U U ~ Q U U = -~ o ,?; ~ o p., fa ~ o o p, .~
N M d~ m c ~ 0o a~ 0 ~ ~
~ N M ~ m co r~ eo oa o> o> o~ oo aoo 00 00 00 00 ~ ~y.
d 00 00 00 00 00 00 00 00 00 ,~
M M M M M M M M M
M M M M M M M c''7M
, U ~
O
b #
O .~
M ~ ~ ~ ~ ~ ue ~
V 'd' d V
' ' ' ' ' ~t d V rY d 'd' rt ~1' ~h y.U
. "
, O
~
i N cci '.~
N
U -N
PH y O ~ cd d. - N ~
~
o o O~ o o o O D
~ 3 t t v W ar ar d W o , ~ rya ~ ~
12~
O ~ ~ ~ Wi n '~' N O O O p O O O O N O N M
~'" 0000 r 00O O O O O pppj 00r W ~- r r r r ~ p~ 00N
N
~, m c~ m I~ d: d;o0 ~ M O ~ Ln Lf~~ ch U
~ ~
a w ~ ~ ~ ~ ~ ~ ~ , tnM M 1~. Is 00M cd U
cMOM ~ C~O O ~ ~ N
O
M M M ~ ~ ~
V
U ~ ~ o .'"
Vd ~
H
a~
Q Q o m ~ ,-~ U
o ~ a~
o I-~
~ F a -d m ~ ~ U'~ g = C .~
O U' ~ ~ O ~ C1 ~ N O ~
' o U ~ c o ~ s-.
U ~ ~ ~ R s p o ~
~ - o ti~ ~ o ~ ~ m s v "
o ~ ~
' V ~ ~ V ~ ~ o j ~ o ~ +~
, - p ~j V ~ ~ N v, p Q o U > > > Q ~ ~ U h U ,~ ~
c = ...
h o V N a ~ o a cn-a U ~" ~
C7 ~ U
F ~ ~ o I .
- p U ~ ? U ~ o ~ ~ V
~
a Q ~ U ~ ~ .
~, m Q Q a ~ o U a ~ o a a a ~ ~,~ ca0 U U ~ Q a ~ ~ Q U o Q o j ~ ~ Q Q Q ~ V
V V V ~ Q u.
a U U U Q a U
o U U ~ U U Q 'n U U o ~ ~ a ~ U U U'~
U ~ ~ U U C9%
U o o ~ ~ ~ U ~ t o U > > U ~ ~ C~
- U Q Q o ~
a a o U
~C .7 C ~ ~ o C '?
o ~ U C9U j ~ V U Q Q ~ U U
c ~ , ~ o ~ o a a a o ~ U ~ ~ ~ U ~ C~ ~ ~ ~ M
v U o o U o 0 0 0 0 0 o U U ~ ~
s s ~ns s s s s s s v~u~ v~O
v~ C9U V COV t~U t~V U f~ C~C7 N
'b O N N N N N O ~ N d N N N ~ U
O
~ ~
C C C C C C C C C C C C C N
N N N N N N N ~ N O d N N
N ~ N ~ N N ~ ~ N N N N N ~
(0'.' ~
V
~ "
M t~ M O O r Ln r (p N In ~-N CO~
' ' ' ' ' (O~ ~ ~ rl d M d M d CO O O
C/~ M CO O COW O O O O O O N t~ CON
N N N N ~t N d' d'd wtN N N N t ~
.N N
ctd' d'd'O O M M r r . d'd d'~
'd' ' ~
r r r e-CO COM M (O (O~ r _ r ' ~ U
~
y O O O O O O O O O O O O O O v~ ,~
, d'1' V ~l'd' ' . ' ' ' ' ' d' t' ' .
7.. c ~ ~ d d d d ~I ~ N ~
~ O
N O O O O N c~
m Pr ce N M M h M O d' tn LIj p7 ~ d d V N N N N
O f~ h h h h h. h O
G~
tn M P? h Is e0 M
(MO M due' (~O O
h ~ M h M
C~
U
a ''~' + ~ ~ + + + + +
W
c~ c~a c> R s s ~ ~ ~ .~ .~c v~ ~ o V O C) ~ ~ U
-E--o Q o V C7 V h U ~
H o d '~ aU' '~ ~° V U
U o N -~o U Q U o can Q U Q ~~~ ~ ~(~ NU
a ~ a ~ a ~ ~ ~ ~ ~ v Q
p ~ ~j o CJ Q U U I- o I- ~ Q
U v U = a Q U Q IN Q F- N,L Q c9 0 o a U a U U U o U U' Q o U o U H °~ Q Q U
U U ~ U ~ U ~ U Q ~ ~ U ~ U H ~ C7 ~ CQ'~
U m U U U o ~ U j U ~ ~ C7 j ~ U > > U Q U Q U CU °' Q
> > ~ > > o ~ ~ > > ~ U
~oU~Ca'J?Ua' ? o=U ~ o~ oC~.7v c~s~aUUUUUU~~UU'UC~
a ~ N a ~ a Q a a v c~a'~~~~~~~~~c~a~~ c?~v j s° ~ s ~ ~ ~ t U cUn N cUn N v v~ .°c U r°
r/~ U' U ~ U ~ C7 ~ C) ~ U' ~ C~ = C7 ~ U ~ C?
a>
a~ a~ as N a~ a~ N a>
m M r h O O' O ~ O l(7 tn r r N r N CO O~ Vl O
d CO o0 O N O o0 O CO CO 'd' O 00 O N r m d' ~f' V1 V~ M M CO r CO r (p r ~ ~ h M h M r (p ~
N N N' d' N ~Y N d' N N N N N N ~Y N N N N
N ~'~~~~ VM' .N~.dNwd ~M
d' d' i d- ~t d~
~~O,O~,O~,OO00O
~Y d- d' d' d-d' d' ai b -a o U
N
U ;=
b O
N
N
N
O U
.r, N N t=n N
Z
O ~ ~ r~
U m ~ U (J
U ~ ~ ~ U
N
a O
U' U U m U' ~
O
O
U
U ~ a U' O N
N
Q
a ~ ~ ~ ~ ~ a ~ ~ ~
~ a ~ c ~ ~ ~ c v a a o ~
w ~ ~
U ~ U U U ~ U ~ U
U ~ U o U ;:n s ~ O ~ U ~ ~ t ~ U
U C7 C~ ~ c~ ...
U U
~ U U s., pp U
N
H U U ~ p N O
~
cncn ~ m cnen v,rn v~rn ~ .,~
t i t d ~ U
ttm v~ a cn a v~ c ~n N O
V1 .
~N
~ 00 V101 l~O l~~ I~
~
d'V1 d'd' d'd' N ~n N ~n N ~ 2t U
0101 O~01 0101 M O\ M Q1 M v ~
N N N N N N 'd'N d'N ~tN
b ~
.
O .~
~N O
~Ou ~ o v 1 ~
-b '~ U
I~ O
U
w U
O
a o U ~ Cd ~
U~
a~
U
O :.~
."
t .f ,' .
~' t ~
+, .
~
O ..
w SS
,~ ~4 C
X
'C
O
Q
Z yn ~~, h a~ N
U
-p ~ V7 N
O U
a~
a Mb a ~~y ~ U
a Q. ~
~ .
b ~
m v> j ~ 4, ~~"
O .
"' ~ O
cd ~G
N
N d' ~', 'd O
111 ~ .
~ U
M ~
"
d ~ ~
. -!
, U O
''d O
d.
C
A
~I' V7 .N N N
O
p O cV
~ O
v W ''>.~
y0y~' c~C
U
d; e' C/~
v ~ N N
~
U
~ ~ ~ o b w + 'n d ~ N
w + j i.Jl1 ~
vi ..
b ~
a ~
c '+
, U
b O ~"
7-a ..~
O m o a~
p o ~
U ._ C9 ~ a>
b U ~
,-.
o O
O
c~3 m ~ Q
a~ F, '~ ~ O
7 U ~
cd a>
v~
U
c~C
U ' '' ' ~ ~ b S.~
Q
m U (~ O
w ~
~ ~ U ~
!~"
C
~ a a .o M
ea ~ a~ c o s...
N tn c-O ~ U
~ CO O
~
~l-N M , b c~i O
'' , CO U
U
A
bA
O
N
~
C
dN.
LLJ U v o a a a a a m a a ~ ~ a c~ e~ c~
N O M ~ ~ ~ ~
V
' IJ E M ~ ' ~
~
- C M 'V't~DLn ct~ m ~ LL (.b O M ~
M
N
N M ~ ~ ~ M
N O N C CO CO
O
t~ O d' ~ tOLf7t1~ h. tI~lI~
CO N M OD V O CO I~ CO (O M N
~
h O O h N O~ N N h O N
U M m rr cfl ~ co co r~.~ co co ~ r~
=
c > > c ~ j U U U
n ~ >
F H H > C9 C~a=nU' U CH ~
-a a a a v ~ U C9 U'U U' U' Q
Q a a a a a a a c~ c~ c~c~ e~ c~ ~ c~ a a a Q ~ ~ a ~ ~ a a a ~
~o o v a U >
~ -~oC'J> > C~ ~ > > > C9 C~ C~
Q U U Q U U Q ~ U U U
U U = U V U C~
a a a U U U U ~
C9 C7 C~ C~ C7 C7 a ~ ~.a N N N U N N U N N N N N N
a a a c~ a a c~ a a a e~ a a a V d' ~ CO CO I~ N CO d' lI~M N M d' N
M ~ ~ N N N
' N
M M M ~ M M M M M M M M M M
a a a Q a a a Q Q Q Q a a a o s O N
'.d O
N
a ~, x o .~ W
~ E1 .
o ~
~
v ~
w v7 ~ a~ r-' o ~r - ~ ~ 'd ~c N
E
C
w ~ ~ ~ b d' c W ' V O % j a .~ ~ ~ U ~
d.
a~ ~
~ '~
+,.~.. N
N
~ .~
~
.
'd 4a cOn O
~ ~ ~ J
> ~ > ~ ~ ~ N C
U U
v c>> ~, a u, a~ ~
~ c~~ ~ o ~ ~ ~
c~~
c~ a c~
-d H M
-O ,~ ~ N
i V V V U , , o O O
c fn N 'C
~ ~
n"~
a N ~'L!
Ox.~,ON
~X ~"~
y ~"' a O .-~~ ~ ~r ~ .~"~, 00 h ~fih O '~
C ' -~r ~ ~ ~ ~
r M ~ r p .
. ,-, . ~
60 ~ ~ ~ ~
~
O
~j J J J ~ o ~ ~ ~ O ~
J W ~ N
~
~' a a a a c a G
~-~
~.'y N
d~cNNNU
-U
7. ~ ~- ~ W ..
o 7.-n _~
O N
X
' ' ~
C
' "
, (~
,-tr E-.Ti ~, .fir C j, ~ ~~, E"~ H h (~
O E"~ ~
E -= -Y r.
r, r.
o m n mvy~U ~1 ~'' ~ C7 a a a NNNN
aaaa c) 07 N Is ~ N N c0 O O
o N M M M M M M
C ~ ' U
f" U
~
by ~. p7 ct W m O O ~ 07 .
r O ~ ~ ~ ~ ~ ~
l 'd't t t t u7 fi '~
~
N
M
, x U
'b ~
o I~ M M N 'd' COO W t~N I~ O
O - N
N
.-~ o e0 M N CD O N N M I~ N
' '~ N I OD r t N lttt~O
L ; r ~ CO fD n W ~ 7 I~ N ~
~ [' O O O O -~
O O
'.f, y M M r r r N r N r r L r U
W
~
M
e~ i - N
~
'd m ~ ~ cfl~ ~ ~
~ O ~ O 'd ' M~ O O _ ~ O N ~ M O v ~
C' V p O N O tn ~ N N~ O O M
M M N ~
O M N
z aMONc00r - c00c - Nc00~ NN b NN r N r N
N s.
O b N
O
.O
~
O O ~ M ~ V M V V ~
W
In CO t0 lOr Lnr 4r .S''.~
,~,~' O N M ~ I~~. O)O O O)O O b0 '- O O
iS I~ r CO CflN ~ CON I~ p N ~ r N N N
~' N
N
~
~' ~
N
W
~
-a [-~
'~
Pi e .
x w ~, ~ ~ ~
~, ~'' ~
"
c9 ~ w a Ts m ~ ~ t- ~
o o a~
o - !L ~ ~ Q a o Q
a Y ~
~
y ~
., o Y o a .
,-.
cV ~ N I-CO(~ N N N ~ ~ y.., ~ V Z Z Z tea-'S~
N N N N N ~ U~ bp .
Z Z > Z Z Z ~ ~ a-iyM'r z Z Z z z - V U o.ti.a a a a ~ ~ a ~ = x x ~ o.b a o _ ~
"' j > > ~ U Q
> > ~ a > > ~ c~= a a a ~
~
~nC7 C7 V U U U U , ~
o ~
O
b ~
~
~
~
, Q '~
a U > > > o 'Ua U U U ~
~
~ ~
a a ~ ,, ~
M
b U' U' U ~ V >
o a a ~ ~ ~ COU ' COC7 CO ''~
~C
~' .~
,~
'~tw a ~ ~ a~
' ~ Q Q Q Q = = .7 ~
C M
.~v.-~~
~' Q Q Q ~ N = U U U ~~
O
~
M
~
a a U U U U = Z C9C9 U' .
~ in cd v ' a > ' Z U U U ~
w oo ~
~"
~' O
~ a a a = c~ a a a a a a U U ~ r ~ Z Y o c r n n n ~
C/sC7 U' U' C~ C~ Z u~N U U U
O
~
ty ~
,-~~, ~
o r ~
~
Oc~
N
~
~
U' ~ o ~ o 0 0 ~, :~
~
N
' ~
~
C C C C C C C O
U U
.C~
-' ~~ U U U U U U U U U
Cc f ~
z ~t ~ d' O r c0f~a0 ~ N M
O O (O H t~ M Opa0 M t~ h r r' r T r ~ r r' ~ r t-' M M M M M N M M N M M ~
~
~
U
U
O
U
b (~
o o H
~
~
~
Z
~ ~r ~r r~ t~ r~ 0 0 0 0 0 0 p o~ o~ cflco cfl o 0 0 0 0 0 o~ o~ ~ ~ ~ 0 0 0 0 0 0 p, U
_ n O
U ~ o o N M M ~ M M M U
a ~ c o n U
~
E'~ , 7-n O
O
a~
U
Mb N ., .C L _C 7 7 7 7 .C ,.C ..CN
d N d ~ UfpUW Ufn~ O O _ U U UO ~ bU
O O O
~ ~~ ~~ ~N L O ~ ~ ON
N N
O N U U O O O O U ~ N
V ~ O O 7 N O O
~ ~ ~ 4=~ ~ ;--.~ ~ ~ ~ a~
m c ~
o D D D D
O
V
'i,' O c d 'd c~ ..~
at O
~.
p H H H H H H H H H H
H ''d'rJ''d~3b 'd b ~d b 'ri~. +~
.
ea b '.d~ ~i ~ ~ 'Hdb ~ ''d ''ci ~.r O
"
b ~
, N
4 C7 U' C7 U'C7 U' C7 C7 C7 O
U U
(7 i7 C7 U U U U U U U U -~ ~ ~C C7 L7C7 L7 C7 C7 C7 C7 H ~
~ ~ ~ ~ r~~c ~c ~ x ~ ~ sc ' ~ ~ ~ ~ ~ ~ ~ ~
' ' b FC U C7 C7 U U C7 ~ C7 t7 C7 a~ p ~ ~ ~ ".~~ ~ FC ~ ~ ~
~C FC FC ~CFC FC ~ ~C FC
.
C7 C7 C7 C7 L7C7 L7 C7 U' U' C7 ~ b U U U U U U U C7 L7 U' ~ ~ U ~ ~ ~ ~ ~ U ~ O
N O
U FC FC ~ FCC FC ~C C C C
D ~ ~ C " ~ ~ " ~ D ~
~ ~ ~
G ~U ~U ~ . F~ U . F ~ F ~a U
U ~U U ~U U 0 U U ~U
U U U U U
~ U U U C U C C C C
7 7 7 7 7 7 7 .7 7 7 U U U U
7 ' 7 y U' 7 ' 7 7 7 7 7 ' C7 C7 U U U U U U U U
H H H H H H H H U U U 'd H H H
U' zf 'd rt3rd~d 'b ''~2i d ~d 'd H H H H H H H H H H H
A ~ ~d b 2S ~J2S ~d ~d b zi ~
c d N O
~k, .
a Qi N N N N N N N N M d~ LO
o I~ eo o~ N M ~t u~ o o o cn v~
r- ~- ~ - - - ~ c- ~ ~ ~ 'b of l0 tW W fmI~ !~ t~.N e0 N
r' t- t- T t-'T T v- O) O) O) N ~
d' ~ ~ O) CY~' '~'V~ T r' T I-I
d' d' ~h d' d'~i'~Y ~Y N N N
N N N N N N N V' rt d' U
+~ N
,-~~
O
A
v v~~ ~ v ,.~
v o ' ~' cc~
V O
U
U
i, V' Wit'd_'d' ~hWit'd' d' d' d' d' L;
Pa T t~ i~ t-'i~ ~ -' ~C
i t r r T
x~
N N ~
r ~" e~C t~ M ~ f~ a0 'a ~ C~O C~O CEO C~O
?~S
b O
U
~i-1 m O O O) O) T
N d I~ t~ co c0 co N
co co co co co O
O
v + + t -F + f -I-N
b O
~J, U
U
~.~'' ~ O
H ~ ~ ~ ~
b U N
U U U' ~ ~
U U w o V N ?N UH ~H H b 0' U
u-U ~
, 4, C9U~ ~~ ~~ m~C Q ~ U
o ~ U ~U ~U ~U
L~ L
= U U U U ~ O
+' p = ~ ? U c ~ U~' U (0 C9 d c~
~ C7 'LC7 mL7 ~'-C7 ~ (7 +' w ~ ~ y 'cU7~~ ~~ U ~ ~
A
- U
~
d U
O
a a~ a~ a~ a~ ~ o M
C/~ C ~ C~ CN CN ~ ~ CS
(9 N N f0 c0 N
N
N
aoN O~N ON ~-N d-O
I~r' I~s- a0~- ODt-'T Op ~ ' ' ' ' ' ' 1 ~r dT ~r ~ T V]
Vj N ~t NV N~t N~Y N ~t U
"C
A dN' dM' V~' ~' '~' .c;
d ch d ' 'd' d' sN.~
d N
U
W dw h d' d' N
N
' .~ ~
'd V
a~
w a~
a ~ ~ a' +~
. U
W O ~
O !~d' u7Ood: i-.
r ~ Ln U
V ~ ~ ~
a r C ( n O O
C~
U~
bn x .., a~
I- o I-~n-0 0 canU
U U
U ~ a cd a a ~b U = _ -U.
N
.
U .
a C9C~
a a o E COU
U
.~ E U
a 'o ~ _ ~ M
y c o b ~a N N N
Q.
~
O
O
p p Q.
C A w-~- ~
'~' y , O O O O
,.L", ~t~Y~t Or ~r o U
O
W
."
cd N O
M d: ''-' U
O
C~
U ~ i ~
a~
bn x H o a ~ o v , C~ U o U U p.
U
Q
CO
U
m N
b 'b ~
U
Q ~
~
w ~ U
DC
~tt m ~ O
cct M
U
e~C O
;
v ~' N
N N
N
p C C O
'~
N
cOEN ~
~".
O
.d cd U
a .~.
' N N
O
F~
t~" d0''~ N
~ ,~', O o I't~ O t~ O) lO o N I~ c0o O I~m O m c0a0 d'O 00OJ N CO tn CD COr In v COCVN OOO CO(~d' O O O M O O O M M O O O O O M N O M M M
Cpr N O O) ~ N lI~M COM M M o CON M d'COr ' N d'd'd M O M of ~ ~ N t~.N O cod N O d' t -d'N t~h ~ _ h. M _ tno0 N r ~ 'V'_ Wit'I~f~t~
a0u7O o N N CO CO 1~!~o I~O ~ f~.COr 1~t~N
p c0c0c0c0 cflGO c0 O c0O O O tf~O c0o c0 c0c0c0 O
w M ChO ~ d' O O ~ d;M N r d;M t(7M d: LnInr LnIn In O In O L(7O M N M O t~COM ~-In ' ' V CC ~.00h 1' Ln N i~ M r (ON N r COd ~t I~I~.
o O N ~ O ~ ~ ~ O r O ~ ~ o N ~
o O O O O O o o O O O O ~ O O O O O O
U ~ts H
~.a a a a ~ a 1-- ~ ~ ~ ~ ~ I- ~ ~ ~-E-~ (ja U
f"'-a~ - ~n u~ I- ~ u~a U ~ 0 0 0 U ~ U N cUn!- ~ N ~ ~ j U Q U U Q U Q
C c n U ~ Q Q U U U ~
p U ~ C9 V a U U COa o ~ o o ~ (~C~C9 U ? U U U = V U = U a ~
Q Q ~ U
Q Q ~ Q ~ ~ V Q U Q U ~ U o U U
U'U' ~ U > > (9a (9> > > > >
~o Q U a a U ~ > V j U U
= ? ~ j U U U U
U C? U a U U U U
U = a ~ U U
Q U j ~ U ~ Q ~ a U ~ >
C U'C ~ ~ _ ~
y > > a = ~ U a ~ a a a a a a a _ a a a U a C9 C9 = U (9 = ~ U U C9 C7COC~
a ~ ~ a =y. U U U U U ~ U U U = U ~ U ~ U U U U U U
v~m m ~n cn v~ U ~ m ~n~n ~n~ m u~vo~n ~nu~m v~ COC9(~C~ CO ~ C9 ~ C9~ U > > > C9C9C9 C9C9CO
N N _C N .C N N
.~ L
N C ~ C N C N ~ N ~ N C N N ~ N N N N d V .~ U ~
fn fn M (0 fn (D fn fn tnInfnfnIn N (nfl!
(9 (0 ~ ~ ~ N
N ~ N 4D .+~d N N N N N N N N N
i ~ ~ ~
C tnC InC In C fn ~ fnC fn ~ fnInInfnfn N fnfn ~ N N . . . .
E CO E E
E
m (0 m N M 'd'CO r N O O O r N M f0(~O N M CtInO
O 07O O 00 00 O O O O O O O O r r N N N O) C/~ N N ' N N r r N N N M N N N N N N N N M M M d N N N N N N N N N N N N N N N N
i I~I~I~I~ ~Y ~t'~Y d' ~Yd'~Y V r o~V~V~V d'V ~Y
O O O O r r ~- r r r r r I(]LL~r r r _ r r r r r T O O O O O O O O M M O O O O O O
(O O N M O
N
aNO~ aoo~m ~ ~
cd ~n N
U
CO M V. O ~ b ~ O
C~OM aN0 V
N
~
"
a 'cYd:M M M M n N dj . . . .
r-O M by ~
N ~
vi O ~
N
'~o E- O
u WO ,r;
N
h N 'o tin ~ O v~
a .~
H ~ ~ U o j ~ ~
P
-oc C7 N Q ~ .
n m v~ ca ~
U p ~ .
U U U U CO
U w C9 U U U m m Y ,~
b ~ U U Q ~ Q
a ~
a aU' ~
U 7 ~. > > > U ~ P.
C :, ~ a U d ~ ~~ "'u.U ~ CO cn a U ~
U ~ d ~ ~ ~ ~s rj Q ,O
U .-n U U ~
U C9 U'U
U a Q Q Q U Q p c~ j a ~ a .~
N ~ N
ca ~ ~ a ~ a ~
~
, o H
0 0 ~ N ~
U ~ ~ ~ ~ U U
7 ~ > > > ~ Q
C U' N ~ N d d N N N N ~ ~ d "
fnf f f f f ~., ~ n n n U n VJ .
~r N N (B ca t0 t0 ~
C
.d ~
0 0 0 O 0 000O O ~
N N N N N N N N U
U U
b U
~ ~
d' d'd' ~t d' O p O bD
;-, , O U
N
rt d'd' d' d' d ' U H
'b ..
E o0 000000000000000 oooooao oo~o O O O N 'd' O d' M d' CO c- O M O ~ d' 1~ I~ N M M C~ O d- fs op f~ N M ~ d' a0 N O) N O M N N CO ~ V ~t -~ 'ct' O) lid O o_O r 'a .~ (0 (w (0 O CMO~ CMO~~M CMOM CMOM~M~fN~.CMOMCMO~CMDMC00~C0~ I-~ ~C~O
r M M d' M ch M '~1' (~ d~ N ~t M d' M d' M d~ M 'd~ M d~ 00 Ln O N r M O
~ O O O N d' O d' d' ~ Cfl N O 'd' O O C4 a0 00 M 'd' d' d' lf~ O r [v LIB I' O
1~ N M LO d- Op 00 O N O M N N CO CO 'd' d' LI~ cf O Ltd O 00 r 00 ~ Cp [w tv ~ CO N 00 N 00 N 00 N 00 M 00 M 00 N 00 N 00 N 00 N ~ d' r 07 V ~ W M W W W O N O W N O W N O ~ O O M W
O
U U !~- ~ u. u. ti ~ ~ j N N N t~ d M ~ O O ~- 7;
N ~ N ~ ~ N N N ~ N ~ ~ N N ~ ~0..
c ~ ~ ~ ~ ~ LL ~ LL ~ ~ L~ ~ ~ ~ ~ c c o OpOOOO XO XOO XOOOO ~ ~ o V r X ~ C~ M if r CO In d- M Lf7 N r N 'd' (Lf (0 ~ N N
N
v'= Cn (n Cn f~ (n tn (n fn f!J fn fn fn fn fn f~ Cn fO -~-~ +W'= Cn Cn o aaa~~a~aXaa~a~aXaoXaXaanX ~ ~ oaa x N N N N r N r r N r r r r r r r r r r r "p ~ ~ r r r M jn N
t *~ UI
M M *u.U' ~ M NM U' 1 ~ M I M N ~ U I = 1 M
U ~~; ~i;~UU~C~-?U*=U' MCP * U? v<''> >U*~~~U-° >>~~? ~ ~"~ i~in Qt->U~Uj ~C9 ~U ~~ ~UC~U~U~M ' i~in ~~ NE-U~U~* QUU ~ I~ U NUUC7 ~ ' *~ I . I-(~ ~Q
U ~~C9UQC9 NU ~ ~. »UU Q
C9U UUQUUC9 ~ ~U ~~ ~~QQ NQC~ ~ ~~U UC9 ~C~~
~ Q U Q U ~ Q C9 > C~ Q ~ ~ N ~ Q ~ Q U ~ a ~
>> QUQ U~QQU~QUC9U~ N~
~U C9UUUQUQU~UQ~~?UQ' UQU' ?> jQU' ? j~ ~V V
QU QU' U(9UUVU~Q~U~QU~~~UC~~QU Q~ ~QCQ.7 ~U Q~Q~Q~~UUU~UU~QUQ~ ca=C?U UU
C9UUUUU ~~CJ~Q~UU(~~(9UC~ c~Q~ QU v N
C9~C9~~~QUQUjQ ~Q(JUUQ~ ~UU' ? CPU ~UC~
~n co Q QQ ~QUQU~ N~QUQ u~Q~Q ~ CjC9 U ~ U U U Q = Q I>_ -a u. N ~- Q ~ N oW Q U ~ U C9 Q~Q~ ~~-° ~Q ~ cV NUj U~U ~V=~ U' Q ~U~ U
a~ QC9 UUUUQUQ~U~U~U> > > as c~c~ c~
cn UU QUQV, tiVr UUQUQUQU tiU tiU ti~jUU ~(~ U' U' a> ~ V~ UQUQ tiQ-vUUU~jU~jU ~U ~U ~QUU UU ~I-U-.°~
c-.~-~ C9~ (~Q~QC~QC7~C7~U~C9~C9~C9~C9coC9(~
C ~ ~ I I I I I I I I I I I I I I I I I I I I I i I I I I I
Q Ln M Lf7 In L(7 In Ln Ln Lf7 Ln Ln lW.f> Lf7 LC> L(~ In L(] Ln L(7 In L(7 L(7 ~ Ln M Ln M L(7 CO I' ''' d' 1' ~ 00 CO O M O cf' r Ln N CO 00 I' W h O r N N M r O 4= O r ~
N N ~ LO tn LSD Ln Lf7 Lf~ CO (O t0 C~ C~ Cfl CO CO (fl CO t0 1~ 1~ IW f7 Ln CO lO ~ 00 d' M
M M ~ L(7 Ln LC7 Ln Ln LO LC) Ln Ltd LO Lf7 Ln In lf7 Lt7 Ln Ln L(7 L(7 L(7 M
M O r ~ Ln (O
Q ~r et ~ d' d' d' d' d' ~r ~r d- ~r ~r d- ~r d' ~r d- ~r ~r d- ~r d' ~r ~r ~r ~r ~ N N 'd' "'' X p~_, p~_, C
N Q ~ ~ D O
d ~ Q d' Q d' O O 07 O O O O O O O O O O O O O 00 L(7 O O In M
I~ ~ fW O 'd' d' O 'd' LO lf7 Ln LO tn O cj- d' r M O O V' O
[~. 00 1' 'L5 r ~ 'D ~ M d' -O d' O 'D O Cfl O 00 N ~ r N O M M M
I~ d' f' .O ~ op CO .O (p lO CO -Q ~ 00 CO .Q CO Lf~ CO I~ (O ~ r- 07 ~ W N CD
(O
co r. c~ !-- ° co c~ f- co N co F- ° co co I-- co ~ co cfl co ° co m cfl e0 ~ co co M O M r O N O r O r O N O M r N r N r M r M M ~(7 M O d' M r r I~ CO I~ N CO O d' LIB d' ~- d' N CO CO d' r d' 1~ 'ct' O d' 00 M N ~ M O r ~
O
I' 00 1' W O N d' N ~t' d' d' M CO d' O 1.n O CO O O N N ~ r N N O M M I~
f~ d' !~ Cfl CO 00 ffl LO CO L(~ ~O I~ LC) 00 CO Lf) CO tf~ Cfl i~ CO 00 r- O
00 Ln O N C~ CO
O ~ ~ ~ O O O ~ O N O O O O O ~ O ~ O O O O O ~ O O O N O O
O O O O
L L ~, L
U U o_.
in in a~ ai ai ~ o' ~: ~ a~ a~ a~
a~~ ~pa.papa ~~~~ ~@~o.''. pp ~ 00 O N N N ~ O ~ ~ ~ ~ N N O N N
LL ~ ~ :~. X LL X LL X LL :p O LL O LL ~ LL X X :~. X X
N N N V ao N oo N ap CV ~ N cV CV _ N N cV M M ~ d' d' ~ (!j Uj 4= fn (~ fn (O ~ (n v'= (n f~ fO ~ (n fn fn tn "_ -~ .~-. .~-. .,.., fn fn n.~,~ oaaaaaa oo_a.a. jdaa. a. o. 0 3 ~ ~ ~a~
X x x X X X X X X X X X X X X X X X X
r N r ~ r r r r N r ~ r r r Ln r N r r r ~ .fl ..Q .Q ..O r r N N N
i~ in U U U
N N N N N
> > U U U
C~ C~ C~ C~ C~
N N N
a a~a Lf7 N ~ N I-, N I-, U M ~ M U ~ tn ~. i ~ f =Q Q =Q ~- ~ U O c~'~ lO , = M M = , Q~ f-U ~aU'' QUQ ~U i-. ~ v ~U U~ o?~'?UQC')~ ~~
V Q t-' ~ ~C9 u. U~ * ~~in Ur inU~ ~? ~U~U* V aU' UU Q U ~ ~U ~UQU ~U~C9 U~ UUU~~= UQ~
UQ UVQV ~V ~~ ~~ ~~ Q~U~ C~ ~ UU= QQ
U UU jQ ~ N~ N3 N QU U~Q ~ U ~UQ ~U ~Q~U ~ UC9 NQ N~., QQ U~ ~~Q~ UQ Q ~C~ ~ Q =Q= U= UU
UUU » ~~~~C~~ >> >UQU C9UCJU UU UC9UU UU U~
~ NQ NQ N QU Q ~Q ~ Q ~Q~ Q= Q=Q~U ~ U~
ti(jU Q~ ~Q ~QC9Q UU U ~C9 ~ U ~(9U UU UUUC~a(~ ~~
N ~ N ~ ~ ~ N ~ N = N
U ~U UQ Q~Q= ~= QU Q U j U O UUU C7~ C9C9C7~ ~
Q U Q (,r = U C~ U U~ U U~ ()r V Vr U Q U Q U Q 7 c~e~~c~~c~~Q ~Q~Q ~Q~~ ~Q ~~~~~Q ~U
U' o '~U QU a~ o= o~ a~ Q ~ o ~ o ~Qt9 C9U C9UC9~ U UU
1-.~I- UH Cj~..cF-.cH QC9 QU~-.~~ L~ ~H =Q »» ~Q UU~--I ~I- QI- cvl-~I-Uf- U~ UI-UI- UI- ~I- C9~ C9=(~UC9~ U
i ~ ~ i ~ i ~ ~ ~ i i i , i i ~ i Y i i ~ i i i ~ ~ i ~ , <'~ i.n t~'~ icy M ~ iY7 lI~ M lC> M ~ M ~ M in M in ch it7 M ~ (~'7 in ic7 in in icy M ~ M
O N N
r O ~- CO M '~ CO f~ LO I~ r I~ O I~ '= CO f~ CO I~ I~ f~ Cfl I~ 00 O '~= O r OD d' d' N N O
d' d' d' N 07 ~ 00 'd' M d' d' d' r 00 o O ~ M ~ M ~ N N M M p ~ r.(~ M d' r N
r 00 (0 O CO O O Ln Cp O CO 07 CO r r L(7 (p p> (p p) (p ~p (fl M M M M M M f~ t~ r r N d' N ~t d' ~ N N d' N ~t N 'd' d' ~ N N ~Y N 'ct N N N d' '~t' ~ d' d' d' d' N N d' d' i i ~ i a a a n. n. a pcc~ ~cro ~c~ Do ~i ~~
Q° Q° a~ Q° Q~ a°
bn M ~ M ao 0 o mn ~ o ~.c> ao ~ o ch CO r d' d' O o0 N O N ~ Cfl f~
-O M N i' ~ -O O r- .O C~ d' -a CO CO LO M .D N
~ CO O O f' ~ f~ ~ _p Ln 00 ~p (fl M O O ~ 1~
.,... CO Cfl CO CO .~. (O CO r.~ (p (fl .,r Cfl f~ Cfl CO .n-. CO O N
U
N O I~ c0 d~ M N ~ N O d~ ~ ~- ~ f~ Is ~ t- r~, f~ ~- Lf> O d' ~ d' 00 ~ ~ N d' O r O CO r- I' O
~ 00 N I' r ~ O) t- O CO d' 1' I' CO Ln M I~ N '~"' ~ .-~~
I~ CO O O f~ t~ 1~ ~ I~ ~ 00 00 CO M O O f0 f' O O O O O O O O O O O O O ~ O O O O
O
b H
N
b0 x C C C
O O O O
U _d 0.. V d d_ _U ~~.' O
'O C C C C M c? 'O C N M 'O C C C C .b ..r:
O 3 O ~ ~ -I- -H O O -IwF O _~ O O 7 O
~.Q.fl~~~N ~ ~'-N ~m.n~~ ~~ O
a0~ ' V, ,~
U
b ~' i~ i~
i~ ~ ? i~? I= U
UUU' in~aU M~ =U~U UU i~i~UU °~
UaU ~ UQ? U? UjUC9 U~ UUU~
~U~~U~ (9U U(~Qa aC~ aUaU
U~UUUa as Q> C9 » »»
UQUUQ(~ (9~ (9aU~ C~a C9 C7C9a aUa~UU ~(~ »>a aU a~aU
UjU~ V~ a~ aU~C~ C9~ C9aUQ
~ C9 (~ C9 U a a C9 U C9 CQ9 C9 U
UUU~~~ aU' V U~' U~Q UU UaUC9 Q aU a~~C~ U~ UC~U~ N m C~ ~ C~ U C~ ~ U ~ C9 ~ U a~
~~~UUU (9a C9~Ua ~U ~»U ~~'~d U~UQ~U Q~ aaa~ U~ UUU~
~C'J~C'~a ~~ ~U=a ~U ~U~U
QUa~UU Q= a>VU as a~aa U~UU~U UU UU a U~ UUU~
C9~UC'7U~ aU aC9UU ~C9 Ua' ~aU''C9 ~ ~ o U a UU'~ U ~ ~ ~ I~ U t~- C9 Q (9 (9 C9 C9 C9 C~ C9 C9 -o ~
in iW .c~ icW .n ih in i~ ip in in in in ip in in ip in ~ .fl s.., ,b a~
3 ~o a-. O o u~
00 N (D t' 00 e- N LW'= CO L(7 d' Cfl (O IW'= 00 O CO M ~ cn ~ ~-~, ~ ~- d' 'ch d' ~ O v- 00 ~ N d' tn Ln 00 00 ~ d' ~ 00 d' vW-a t-a O
N ~ i ~~~~~ ~~~~~~~d a~
d d O_ ~ h Q f~ ~ M N ~ ~
J T J o J p .9 ~ Q.W, a~r a~ a~ ~a~~'~~
OTHER EMBODIMENTS
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.
2. De~rotection- I (Nucleobase Deprotection) After completion of the synthesis, the controlled pore glass (CPG) was transferred to a screw cap vial or screw cap RNase free microfuge tube. The oligonucleotide was cleaved from the support and the base and phosphate protecting groups were simultaneously removed by using of a mixture of ethanolic ammonia (ammonia (28-30 % : ethanol (3:1))- (1.0 mL) for 15h at 55°C. The vial was cooled briefly on ice and then the ethanolic arrLrnonia mixture was transferred to a new microfuge tube. The CPG was washed with portions of deionized water (2 x 0.1 mL).
The supernatant was combined, cooled in dry ice for 10 min and then dried in a speed vac.
3. Deprotection-II (Removal of 2'-O- TBDMS group) The white residue obtained was resuspended in a mixture ~f triethylamine, triethylamine trihydrofluoride (TEA.3HF ca. 24% HF)) and 1-Methyl-2-Pyrrolidinone (NMP) (4:3:7) (400 ul) and heated at 65°C for 90 min to remove the tent-butyldimethylsilyl (TBDMS) groups at the 2'-position. The reaction was then quenched with isopropoxytrimethylsilane (iPrOMe3Si, 400 ul) and further incubated on the heating block leaving the caps open for l Omin;
This causes the volatile isopropoxytrimethylsilylfluoride adduct to vaporize. The residual quenching reagent was removed by drying in a speed vac. 3% Triethylamine in diethyl ether ( 1.5 ml) was added.
The mixture was subjected to centrifugation. A pellet of RNA formed. The supernatant was pipetted out without disturbing the pellet. The pellet was dried in a speed vac. The crude RNA
was obtained as a white fluffy material in the microfuge tube.
4. Ouantitation of Crude Oli~omer or Raw Analysis Samples were dissolved in deionized water (l.OmL) and quantitated as follows:
Blanking was first performed with water alone (1mL). A sample of the RNA solution (20u1) was diluted with water (980 uL) and mixed well in a microfuge tube, then transferred to a cuvette and the absorbance reading was obtained at 260 nm. The crude material was dried down and stored at -°C
5. MS anal, The crude samples (0.1 OD) analyzed using LC-MS.
6. Purification of Oli~omers (a) Pol~ylamide Gel Electrophoresis (PAGE) Purification The oligonucleotides were purified by vertical slab polyacrylamide gel electrophoresis (PAGE) using an Owl's Separation Systems (Portsmouth, NH). Electrophoresis grade acrylamide (40%), N,N'-methylene-bis(acrylamide) (BIS), ammonium persulfate (APS, N,N,NN'-tetramethylenediamine (TEMED), bromophenol blue (BPB), xylene cyanol (XC) 10 x TBE (0.89 M tris-hydroxy-methylaminomethane, borate pH 8.3, 20mM disodium ethylenediaminetetraacetate) were from National Diagnostics (Atlanta, GA). The denaturing gel was prepared for purification of unmodified and modified oligoribonucleotides.
The thickness of the preparative gels was 1.5 mm. Loading buffer was 80%
formamide in l Ox TBE. After removal of the glass plates, the gels were covered with Saran Wrap° and placed over a fluorescent TLC plate illuminated by a hand-held UV lamp for visualization. The desired bands were excised and shaken overnight in 2mL of water or 0.03 M Sodium Acetate. The eluent was removed by drying in a speed vac.
f b) High Performance Liduid chromato -g-raph~(HPLC) Purification:
Condition A: Purification of unmodified, 2'-O-Me/PS Oligoribonucleotides:
Amount of injected sample is about 100 OD.
Column: Dionex PA-100 Semiprep.
Buffer A: Water Buffer B: 0.25 M Tris.Cl pH 8.0 Buffer C: 0.375 M Sod.Perchlorate Heating: 65 °C
Time Flow Buffer Buffer Buffer TotalYieldPurity A B C
0 5.00 88 % 10 % 2.0 % 40-60% 85-98 3.0 5.00 88% 10% 2.0%
30.0 5.00 57.0 10 % 33.0 35.0 5.00 88% 10% 2.0%
40.0 5.00 88% 10% 2.0%
Condition B: Protocols for Purification of 2'-O-Me/PS Oligoribonucleotides:
Column: Dionex PA-100 Semiprep.
Buffer A: Water Buffer B 0.25 M Tris.Cl pH 8.0 Buffer C 0.8 M Sod.Perchlorate Heating: 65 °C
Time Flow Buffer Buffer Buffer Total Purity A B C
Yield 0 5.00 88 % 10 % 2.0 % ~40-60% 85-98 3.0 5.00 88% 10% 2.0%
30.0 5.00 57.0 10 % 33.0 35.0 5.00 88 % 10 % 2.0 40.0 5.00 88% 10% 2.0%
7. Desalting~of Purified Oli.gomer The purified dry oligomer was then desalted using Sephadex G-25 M. The cartridge was conditioned with 10 mL of deionised water thrice. Finally the purified oligomer dissolved thoroughly in 2.SmL RNAse free water was applied to the cartridge with a very slow drop-wise elution. The salt free oligomer was eluted with 3.5 ml deionized water directly into a screw cap vial. The purified RNA material was dried down in speed vac and stored at -20°C.
Biotin conlu~ated siRNAs (Table 10) 1. Synthesis:
The RNA molecules were synthesized on an ABI-394 machine (Applied Biosystems) using the standard 93 step cycle written by the manufacturer with modifications to a few wait steps as described below. The solid support was controlled pore glass (CPG, lumole, 500 A) a.nd the monomers were RNA phosphoramidites with standard protecting groups (5'-O-dimethoxytrityl N6-Benzoyl-2'O-t-butyldimethylsilyl- adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, S'-O-dimethoxytrityl-N4-acetyl-2'-O-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-O-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-O-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite. The modified CPG and amidites were synthesized using known methods and as described herein. . All amidites were used at a concentration of O.15M in acetonitrile (CH3CN) and a coupling time of 6 min for unmodified and 2'-O-Me monomers arid 12 min for modified and conjugated monomers. 5-Ethylthio-1H-tetrazole (0.25M) was used as an activator. For the PO-oxidation Iodine/Water/Pyridine and for PS-oxidation Beaucage reagent (2 %) in anhy. acetonitrile was used. The sulfurization time is about 6 min. For synthesis of 3'-biotin conjugated siRNAs, t-butyl-hydrogen peroxide was used as oxidizing agent (oxidation time 10 min).
Reagent Concentration Wait or Cou ling ste Activator: 0.25M 5-Ethylthio-tetrazole 300 sec for unmodified and 720 sec for modified oligos.
PO-oxidation 0.02M Iodine in THF/waterl 20sec yridine PO-oxidation 0.02M t-Butyl-hydrogen peroxide600 sec PS-oxidation 2 % Beaucage reagent /anhy.360 Sec (200 Acetonitrile sec, wait +30 sec pulse+130 sec wait Cap A 5% 5% Phenoxyacetic 20sec anhydride/THF/ yridine Cap B 10% 10% N- 20sec Methylimidazole/THF
Detritylation 3% TCA Trichloro Acetic 70sec Acidldichloromethane 2. De~rotection- I (Nucleobase Deprotectionl After completion of synthesis the controlled pore glass (CPC) was transferred to a screw cap vial or a screw cap RNase free microfuge tube. The oligonucleotide was cleaved from the support with the simultaneous removal of base and phosphate protecting groups with a mixture of ethanalic ammonia [ammonia (2$-30%): ethanol (3:1) 1.0 mL] for 15h at 55°C. The vial was cooled briefly on ice and then the ethanolic ammonia mixture was transferred to a new microfuge tube. The CPC was washed with portions of deionized water (2 x 0.1 mL). The combined filtrate was then put in dry ice for 10 min dried in a speed vac.
3 DeRrotection-II (Removal of 2'-O- TBDMS Q;roupl The white residue obtained was resuspended in a mixture of triethylamine, triethylamine trihydrofluoride (TEA.3HF ca, 24% HF) and 1-Methyl-2-Pyrrolidinone (NMP) (4:3:7) (400 ul) and heated at 65°C for 90 min to remove the tent-butyldimethylsilyl (TBDMS) groups at the 2'-position. The reaction was then quenched with isopropoxytrimethylsilane (iPrOMe3Si, 400 ul) and further incubated on the heating block leaving the caps open for l Omin;
(This causes the volatile isopropxytrimethylsilylfluoride adduct to vaporize). The residual quenching reagent was removed by drying in a speed vac. 3% Triethylamine in diethyl ether (1.5 ml) was added and the mixture was subjected to centrifugation to afford a pellet of RNA. The supernatant was pipetted out without disturbing the pellet. The pellet was dried in a speed vac. The crude RNA was obtained as a white fluffy material in the microfuge tube.
4. Ouantitation of Crude Oli~omer or Raw Analysis Samples were dissolved in deionized water (l.OmL) and quantitated as follows:
Blanking was first performed with water alone (1mL). A sample of the RNA solution (20u1) was diluted with water (980 uL) and mixed well in a microfuge tube, then transferred to a cuvette and the absorbance reading was obtained at 260 nm. The crude material was dried down and stored at -20°C.
5. MS analysis:
Samples of the RNA ( 0.1 OD) were analyzed using MS.
6. Purification of Olipomers Pol~ac~lamide Gel Electrophoresis (PAGE) Purification The oligonucleotides were purified by vertical slab polyacrylamide gel electrophoresis (PAGE) using an Owl's Separation Systems (Portsmouth, NH). Electrophoresis grade acrylamide (40%), N,N'-methylene-bis(acrylamide) (BIS), ammonium persulfate (APS, N,N,NN'-tetramethylenediamine (TEMED), bromophenol blue (BPB), xylene cyanol (~C) 10 x TBE (0.89 M). Trishydroxy-methylaminomethane, borate (pH 8.3), 20mM disodium ethylenediaminetetraacetate) were from National Diagnostics (Atlanta, GA). The Denaturing gel was prepared for purification of oligoribonucleotides. The thickness of the preparative gel was 1.5 mm. Loading buffer was 80% formamide in l Ox TBE.
After removal of the PAGE glass plates, the gels were covered with Saran Wrap and placed over a fluorescent TLC plate illuminated by a hand-held UV lamp (Upland, CA) for visualization.
The desired bands were excised and shaken overnight in water (2mL) or 0.03 M sodium acetate. The eluent was removed and dried in a speed vac. All biotin conjugated sequences were purified by PAGE.
7. Desalting of Purified Oligomer The purified dry oligomer was then desalted using Sephadex G-25 M (Amersham Biosciences). The cartridge was conditioned with of deionized water thrice (10 mL each).
Finally the purified oligomer dissolved thoroughly in 2.SmL RNAse free water was applied to the cartridge with very slow drop- wise elution. The salt free oligomer was eluted with deionized water (3.5 ml) directly into a screw cap vial. The purified RNA material was dried down on speed vac and stored at -20°C
8~ualit~Control (a) Capillary Gel Electrophoresis (CGE) (b) Electrospray LC/Ms A sample of the oligomer (approx. 0.10 OD) was dissolved in water (50 ul & 100 ml in separate tubes) and then pipetted into special vials for GGE and LC/MS
analysis.
9. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Tables 8, 9, 10 and 18 and Figures 31-35 provides data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 11 Coniu~ation of retinoids to RNA (Table 14) Conjugation of all-ts°aras-retinal to Oli~onucleotides (RNA
Phoshoramidite 104 was synthesized as shown in Scheme B for retinal conjugation to oligonucleotides.
Scheme B: Synthesis of Post-synthetic conjugation building blocks for retinal conjugation - oxime approach 1 for 5'-conjugation.
BnO~OH ~ Bn0~0-N ~ o ~~ HO~O-N
iii N O
i NC~O.P~O~O-N
a (i) Ph3P, DIAD, N hydroxyphthalimide / MeCN; (ii) H2, Pd-C (10 %), 1 atm/ETOAc;
(iii) Phosphitylation Step l: Compound 102:Monobenzylpentan-1,5-diol (15.70 g, 80.82 mmol), Ph3P
(25.43 g, 96.84 mmol) and and N hydroxyphthalimide (1 l6.Og, 98.08 mmol) were taken in anhydrous CH3CN (100 ml) under argon atm. Neat DIAD(20.0 mL, 103.25 mmol) was added dropwise into the stirring solution over a period of 20 minutes and the stirnng was continued for 24h. The reaction was monitored by TLC. Solvents were removed ih vacuo; and the residue was triturated with diethyl ether and filtered. Residue was washed with ether, filtered and combined the filtrate.
Hexane was added dropwise into the filtrate until it gave turbidity and subsequently the solution was made homogeneous by adding ether into it. The homogeneous solution was stored at 5 °C
for 24 h. Precipitated Ph3PO was filtered off, washed with ether-hexane mixture (1:1). Combined filtrate was evaporated to dryness and the residue was purified by flash silica gel column chromatography (10-15 % EtOAc in Hexane) to obtain 24.5 g (89.3 %) of compound 102 as a viscous pale yellow oil. 1H NMR (400 MHz, CDC13, 25 °C): 7.84-7.82 (m, 2H); 7.75-7.73 (m, 2H); 7.34-7.33 (m, 4H); 7.29-7.26 (m, 1H); 4.51 (s, 2H); 4.22-4.18 (t, J(H,H) = 6.71 Hz, 2H);
3.52-3.48 (t, J(H,H) = 6.4 Hz, 2H); 2.04-1.78 (m, 2H); 1.73-1.56 (m, 4H). 13C
NMR (100 MHz, CDC13, 25 °C): 163.9, 138.8, 134.6,129.2, 128.6, 127.8, 127.7, 123.7, 78.6, 73.1, 70.3, 29.6, 28.2, 22.5.
Std Compound 103: Compound 102 (23.5 g, 69.29 mmol) was taken in 100 ml of EtOAc/methanol (1:1). The mixture was degassed and purged with argon, to this 2.4 g of Pd-C
(10%- wet Degusa type) was added. The mixture was then hydrogenated overnight, filtered through a celite bed over a sintered funnel. The residue was subsequently passed through a column of silica gel and eluted out using 40 % EtOAc in hexane to obtain compound 103 (15.70 g, 90.9 %) as a white solid. 1H NMR (400 MHz, CDCl3, 25 °C) 7.83-7.81 (bm. 2H); 7.75-7.73 (bm, 2H); 4.23-4.19 (t, J(H,H) = 6.4 Hz, 2H); 3.70-3.66 (t, J(H,H) = 5.80 Hz, 2H); 1.83-1.79 (m, 2H); 1.67-1.60 (m, 4H). 13C NMR (100 MHz, CDCl3, 25 °C) D 163.9, 134.7, 129.1, 123.7, 78.6, 62.7, 32.4, 28.0, 22Ø
St_ ep 3: Compound 104: Compound 103 (5.4 g, 21.67 mmol) and triethylamine (4 ml, 28.69 mmol) were taken in anhydrous EtOAc(30 ml) under argon. 2-Cyanoethyl diisopropylchlorophosphoramidite (S.OOmI, 21.97 mmol) was added to the reaction mixture dropwise. A white precipitate of Et3N.HCl was formed immediately after the addition of the reagent and the reaction was complete in 10 min (monitored by TLC). The precipitate was filtered through a sintered funnel and solvent was removed under reduced pressure. The residue was directly loaded on a silica gel column for purification. Eluted with hexane/EtOAc 9:1 to afford compound 104 as a yellow oil, 8.68g (89.13%). 1H NMR (400 MHz, CDC13, 25 °C) D
7.85-7.81 (m, 2H); & 7.77-7.72 (m, 2H); 4.22-4.19 (t. J(H,H) = 6.80 Hz, 2H);
3.91-3.76 (m, 2H);
3.72-3.53 (m, 4H)2.67-2.63 (t, J(H,H) = 6.71 Hz, 2H); 1.86-1.78 (m, 2H); 1.73-1.66 (m, 2H);
1.62-1.56 (m, 2H); 1.19-1.16 (m, 12H). 31P NMR (162 MHz, CDCl3, 25 °C) 8 145.09. 13C NMR
(100 MHz, CDCl3, 25 °C) 8 163.9, 134.7, 129.2, 123.7, 117.9, 78.6, 64.0, 63.4, 58.7, 58.5, 43.2, 43.1, 31.1, 31.0, 28.1, 24.9, 24.8, 24.7, 22.3, 20.6, 20.5.
Step 4: Conjugation of all-trayas-retinal to Olig~onucleotide: All-traps-retinal was conjugated to oligonucleotide as shown in the Scheme C. Compound 104 was coupled to solid bound oligonucleotide 105 under standard solid phase oligonucleotide synthesis conditions to obtain compound 106. Phthalimido protecting group on compound 106 was selectively removed by treating with hydrazinium hydrate as reported by Salo et al. (Bioconjugate C'hena. 1999, 10, 815) to obtain compound 107. Treatment of compound 107 with all-tr~aras-retinal under dark condition gave compound 108 as reported in the literature (Biocoyajugate Claem. 1999, 10, 815).
Standard RNA oligonucleotide deprotection and purification under dark yielded the desired oligonucleotide-retinal conjugate 109. Compound 109 was also obtained from compound 110 as shown in Scheme C. Complete deprotection and purification of compound 106 yielded an unbound free oligonucleotide 110 which was subsequently reacted with all-traps-retinal to afford the desired compound 109.
Scheme C: Conjugation of all-tans-retinal to oligonucleotides O g~ 5, O ~ P. e~ W
CPG H~O OH ~ CPG H~O O O~ O N
O O
v ii O
O
CPG N~O O ~\O~O-NH2 HO O~~O~O-NHp H O 107 ~CN
iii iv O
i i 5, 3.
W -N-O~O'~ O OH
a (i) Phosphoramidite 104, (standard oligonucleotide synthesis cycle); (ii) Hydrazinium hydrate/Py/AcOH (0.124/4/7); (iii) all-traps-retinal in DMF or MeCN; (iv) Oligonucleotide (RNA) deprotection (MeNHz, TEA.3HF) and purification; (v) Oligonucleotide (RNA) deprotection (MeNH2, TEA.3HF) and purification; (vi) all-traps-retinal in DMSO-Step 4.1. Oli~onucleotide Synthesis:
All oligonucleotides except AL-3166 were synthesized on an ABI 490 DNA
synthesizer.
Commercially available controlled pore glass solid supports (dT-CPG and U-CPG, 500th) and RNA phosphoramidites with standard protecting groups, 5'-O-dimethoxytrityl-N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite were used for the oligonucleotide synthesis. All phosphoramidites were used at a concentration of O.15M in acetonitrile (CH3CN). Coupling time of 10 minutes was used. The activator was 5-ethyl thiotetrazole (0.25M), for the PO-oxidation Iodine/Water/Pyridine was used.
Sequence AL-3166 was synthesized on the AKTAoligopilot synthesizer. All phosphoramidites were used at a concentration of 0.2M in acetonitrile (CH3CN) except for guanosine which was used at 0.2M concentration in 10% THF/acetonitrile (v/v).
Coupling/recycling time of 16 minutes was used. The activator was 5-ethyl thiotetrazole (0.75M), for the PO-oxidation Iodine/Water/Pyridine was used and for the PS-oxidation PADS
(2 %) in 2,6-lutidine/ACN (l:l v/v) was used.
The aminooxy-linker phosphoramidite was synthesized as described above and used at a concentration of O.15M in acetonitrile. Coupling time for the aminooxy-linker phosphoramidite was 15 minutes. For all sequences, coupling of the aminooxy-linker phosphoramidite was carried out on the ABI 390 DNA synthesizer.
Step 4.2. Cleavag-a of the phthalimido-protectin~L~roup from the aminoxy-linker oli~onucleotides After coupling of the aminooxy-linker, the CPG was treated with 2.5 ml of O.SM
hydrazinium acetate in pyridine (0.16/4/2 hydrazine anhydrous, pyridine, acetic acid) using the dual syringe method. Every 5 minutes the syringes were pushed back and forth to get new solution on the CPG. After the hydarzinium acetate treatment, the CPG was washed with 2x5 ml of pyridine followed by 3x5m1 of acetonitrile. Flushing with dry argon for 30 seconds then dried CPG.
Step 4.3. On support conjugation with the aldehydes The 1-pyrene-carboxaldehyde and the all-traps-retinal were from Aldrich and used at concentrations of O.SM in DMF. The 4-keto-retinol was used at a concentration of 0.13M in DMF. The CPG from above was added to the aldehyde solutions. Conjugation was carried out overnight (-V 16 hrs) at room temperature. After the reaction was complete, the CPG was rinsed with DMF followed by acetonitrile and air dried for 10-15 minutes. For sequence AL-3213, the conjugation with both all-tr-ans-retinal and 1-pyrene-carboxaldehyde was also carried out in acetonitrile. In the case of 1-pyrene-carboxaldehyde, the aldehyde did not fully dissolved at O.SM and the solution was used as is without filtration to get rid of the undissolved aldehyde.
Step 4.4. Deprotection- I (Nucleobase Deprotection) of on support conju ag ted oli~onucleotides For on support retinal conjugated oligonucleotides, the support was transferred to a 5 ml tube (VWR). The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 1 mL of 40% aq. methylamine 15 mins at 65°C. The tube was cooled briefly on ice and then the methylamine was filtered into a new 15 ml tube. The CPG was washed with 3 x 1 mL portions of DMSO.
Step 4.5. Deprotection-II (Removal of 2' TBDMS ~,roup) of on support conjuJ a~
ted oli~onucleotides To the above mixture was added 1.5 ml of triethylamine trihydrofluoride (TREAT-HF) and heated at 60°C for 15 minutes to remove the test-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction was then quenched with 5.5 ml of SOmM sodium acetate (pH 5.5) and stored in freezer until purification.
Step 4.6. After deprotection conjugation with aldehydes Conjugation with the aldehydes (1-pyrene-carboxaldehyde and all-traas-retinal) after deprotection of the aminooxy-linker oligonucleotides was also carned out as an alternative conjugation strategy.
Step 4.7. Deprotection- I (Nucleobase Deprotection) for after deprotection coniu-~-a~n The support was transferred to a 2 ml screw cap tube. The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 0.5 mL of 40% aq. methylamine 15 mins at 65°C. The tube was cooled briefly on ice and then the methylamine was filtered into a new 15 ml tube. The CPG was washed with 2 x 0.5 mL portions of 50% acetonitrile/water. The mixture was then frozen on dry ice and dried under vacuum on a speed vac.
Step 4.8. Deprotection-II (Removal of 2' TBDMS r~oup) for after deprotection conjugation The dried residue was resuspended in 0.5 ml of triethylamine trihydrofluoride (TEA.3HF) and heated at 60°C for 15 minutes to remove the tart-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction mixture was then cooled to room temperature and RNA
precipitated with 2 ml of dry methanol and dried under vacuum on a speed vac.
The sample was then dissolved in 2 ml of water and kept frozen in freezer till further analysis.
Step 4.9. Quantitation of Crude Oli~omer or Raw Analysis For all samples, a l~,l, a 10,1 or 30w1 aliqoute was diluted with 999.1, 990,1 or 970w1 of deionised nuclease free water ( 1.0 mL) and absorbance reading obtained at 260 nm.
Step 4.10. Purification of conjugated Oli omers ~) Cude LCIMS anal, The crude oligomers were first analyzed by LC/MS, to look at the presence and abundance of the expected final product.
(b) Reverse-phase purification The conjugated samples were purified by reverse-phase HPLC on an RPG-Sourcel5 column (21.5 x 1 cm). The buffer system was: A = 20 mM sodium acetate in 10%
ACN, pH 8.5 and B = 20 mM sodium acetate in 70% ACN, pH 8.5, with a flow rate of 5.0 mL/min, and wavelengths 260 and 375. The fractions containing the full-length oligonucleotides were then individually desalted.
Step 4.11. Desalting of purified oli~onucleotides The purified oligonucleotide fractions were desalted using the PD-10 Sephadex columns. First the columns were equilibrated with 25-30 ml of water. The samples were then applied in a volume of 2.5 ml. The samples were then eluted in salt-free fraction of 3.5 ml. The desalted fractions were combined together and kept frozen till needed.
Step 4.12. Capillary Gel Electrophoresis (CGE), Ion-Exchan.~e HPLC (IEX) and Electrospray LC/Ms Approximately 0.3 OD of desalted oligonucleotides were diluted in water to 300 ~l and then pipetted in special vials for CGE, IEX and LC/MS analysis.
Step 5 Conjugation of all-traps-retinal to 3'-end of Oli~onucleotides (RNA):
Phoshoramidite 116 for 5'-conjugation and CPG support 115 for 3'-conjugation of retinoids were synthesized as shown in the Scheme D. The CPG support 115 is used for 3' conjugation of retinoids to oligoriucleotides Scheme Da. Synthesis of Post-synthetic conjugation building blocks for retinal conjugation - oxime approach 2 for 3' and 5' conjugation.
HO TBDMSO>, TBDMSO, '~ODMTr ~ '~ODMTr i! ~ '~ODMTr ii~
O~NHCbz O~NHCbz O~N~OH
HO, ~ODMTr ~ N. P.O, N H 4 p ~ODMTr O
O N~O N ~ / NC°
N
114 O O O ~O-N
iv 116 O
O
CPG H~O, O ~ODMTr N O
H
O N~O N I /
O
a (i) TBDMS-C1, Imidazole/Py, rt; (ii) (a) HZ, Pd-C (10 %)/EtOAC-MeOH, 4 h and (b) ~-Caprolactone, TEA, 55 °C, 24 h; (iii) TEA.3HF/THF; (iv) (a) Succinic anhydride, DMAP/EDC, 24 h and (b) DTNP, Ph3P, DMAP followed by addition of lcaa CPG; (v) Phosphitylation Step 5.1: Compound 112: Compound 111 (120_0 g, 30.01 mmol) was stirred with TBDMS-Cl (5.43 g, 36.02 mmol) in the presence of imidazole (7.5 g, 110.16 mmol) in anhydrous pyridine ( 100 mL) overnight. After removing pyridine, the product was extracted into S ethyl acetate (300 mL), washed with aqueous sodium bicarbonate, followed by standard workup.
Residue obtained was subjected to flash silica gel column chromatography using 1 % methanol in dichloromethane as eluent to afford compound 112as a pale white solid (24.4 g, qunat. 1H
NMR (500 MHz, [D6]DMSO, 25 °C): ~ 7.33-7.13 (bm, 15H, accounted for 14H
after D20 exchange); 6.87-6.82 (bm, 4H); 5.01 (s, 0.2H, rotamer minor); 4.99 (s, 1.8H, rotamer major), 4.68-4.64 (m, 0.72 H, major rotamer); 4.14-4.07 (bm, 1H), 3.72 (s, 7H), 3.38-3.36 (m, 0.6H, rotamer minor); 3.26-3.21 (m, 1.4H, rotamer major); 3.08-3.07 (m, 0.3H, rotamer, minor); 2.99-2.89 (m, 2.7H, rotamer, major); 2.22-2.12 (m, 2H), 2.04-1.78 (m, 2H); 1.48-1.23 (m, 6H), 0.84, 0.82 (s, 9H, rotamers major and minor); 0.05 (d, J(H,H) = 1.5 Hz, 4.3H, rotamer major); 0.03-0.02 (d, J(H,H) = 5.5 Hz, 1.7H).
Step 5.2: Compound 113: Compound 112 (9.4 g, 14.54 mmol) was suspended in 15 mL
of ~i-caprolactone and 10 mL of TEA was added into the suspension. The reaction mixture was stirred under argon at 55 °C bath temperature for 24 h. Completion of the reaction was monitored by TLC analysis. TEA was removed form the reaction mixture ih vacuo and 150 mL
of dichloromethane-hexane (2:1 mixture) was added into the residue. The homogeneous solution thus obtained was directly loaded on a column of silica gel and eluted with dichloromethane-hexane (2:1) followed by neat dichloromethane. Elution of the silica column with 4 % methanol in dichloromethane afforded the desired compound 113 as a white solid (8.73 g, 78.9 %). 1H
NMR (400 MHz, [D6]DMSO, 25 °C) 8 7.72-7.68 (brn, 1H, exchangeable with DSO); 7.33-7.16 (m, 9H); 6.88-6.84 (m, 4H); 4.68-4.62 (m, 0.8H); 4.57-4.52 (m, 0.2H); 4.34-4.31 (t, J(H,H) _ 5.18 Hz, 1H, exchangeable with D20); 4.14-4.08 (bm, 1H); 3.74-3.67 (m, 7H);
3.39-3.32 (m, 3.3H); 3.25-3.21 (m, 1.7H); 3.09-2.88 (m, 4H) 6. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 14 and Figure 38 provides data and a graph of the activities in HeLa cells for each of the modifications described above.
Example 12 Conjugation of Polyethylene glycol to siRNA (Table 12) Amino linker oligonucleotides for PEG Conju ag tion General. Ion exchange preparative chromatography was performed on TSKgeI-SuperQ-SPW (Tosoh). Ion exchange analytical chromatography was performed on a DNAPac Pa100 (Dionex). Electron spray ionization mass spectra were recorded with an Agilent 1100 MSD-SL.
HPLC Techniques. The RNA was analyzed by ion-exchange chromatography (column, DNAPac Pa100, 4x250mm, analytical), heated to 30°C, flow rate 1.5 mL
miri 1, buffer A =
0.020M Na2HP04 in 10% CH3CN, pH 11; buffer B = buffer A + 1 M NaBr in 10%
CH3CN, pH
11, linear gradient from 0 to 75% in 53 min. The LC/ESI-MS conditions were as follows:
column XTerra C8 (2.1x30 mm, 2.S~m), linear gradient from 5 to 35% in 2 min and from 35 to 70% in 30.5 min, flow rate 0.200 mL miri 1, buffer A = 400mM HFIP/16.3mM TEA
in H20, buffer B = 100% methanol. The RNA was purified by ion-exchange chromatography (Scm in-house packed column, TSKgeI-SuperQ-SPW, 20~,m), heated to 75°C, flow rate 50 mL miri 1, buffer A = 0 '020M Na2HP04 in 10% CH3CN, pH 8.5; buffer B = buffer A + 1 M
NaBr in 10%
CH3CN, pH 8.5, linear gradient from 20 to 55% in 120 min.
RNA synthesis. The protected RNA was assembled on an AKTA Oligo Pilot 100 on a 100-150 ~,mol scale using custom in-house support and phosphoramidite chemistry.
Phosphoramidites were used as 0.2 mol L-1 solutions in dry CH3CN, with a 900s coupling time and the manufacturer's recommended synthesis protocols were used. After synthesis, the support-bound RNA was treated with aqueous CH3NHz (40%)for 90 minutes at 45°C, cooled, filtered and washed with DMSO (3x40mL). The filtrate was then treated with TEA.3HF
(60mL) for 60 minutes at 40°C, and quenched with aq. NaOAc (O.OSM, pH
5.5, 200mL). The synthesis was followed by analytical ion-exchange HPLC, preparative HPLC, then desalting on Sephadex G-25.
Step 1. Oli~onucleotide Synthesis:
A general conjugation approach is shown in the Scheme E.
All oligonucleotides were synthesized on an AKTAoligopilot synthesizer.
Commercially available controlled pore glass solid support (dT-CPG, 5001) or the phthalimido-hydroxy-prolinol solid support and RNA phosphoramidites with standard protecting groups, 5'-O-dimethoxytrityl-N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-t-butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-t-butyldimethylsilyl-guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite were used for the oligonucleotide synthesis. All phosphoramidites were used at a concentration of 0.2M in acetonitrile (CH3CN) except for guanosine which was used at 0.2M concentration in 10% THF/acetonitrile (v/v). Coupling/recycling time of 16 minutes was used. The activator was 5-ethyl thiotetrazole (0.75M), for the PO-oxidation Iodine/Water/Pyridine was used and for the PS-oxidation PADS (2 %) in 2,6-lutidine/ACN (1:1 v/v) was used. The amino-linker phosphoramidite was synthesized and used at a concentration of 0.2M in acetonitrile. Coupling/recycling time for the amino-linker phosphoramidite was 16 minutes.
Scheme E°: Pegylation of RNA Oligonucleotides CPG H~~% I CPG
O ~,ODMTr O
N
O'~N
p x=~or~
p 3~ 5' iii O 3' 5' HO,, O.P O OH E HO, O.P O OH
/~ /~ i X
NO ~O
N H N
0~~~~PEG O.~NH2 IO n Oigonucleotide with amino linker Oigonucleotide - PEG Conjugate a (i) Solid phase Oligonucleotide synthesis; (ii) Deprotection and purification; (iii) PEG-NHS ester, NaHC03, pH 8.1, 1 h.
Step 2. Deprotection- I (Nucleobase Deprotection) After completion of synthesis, the support was transferred to a 100 ml glass bottle. The oligonucleotide was cleaved from the support with simultaneous deprotection of base and phosphate groups with 40 mL of a 40% aq. methyl amine 90 mins at 45°G.
The bottle was cooled briefly on ice and then the methylamine was filtered into a new 500 ml bottle.
The CPG was washed with 3 x 40 mL portions of DMSO. The mixture was then cooled on dry ice.
Step 3. Deprotection-II (Removal of 2' TBDMS gTOUp) To the above mixture was added 60 ml triethylamine trihydrofluoride (TREAT-HF) and heated at 40°C for 60 minutes to remove the tent-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction was then quenched with 220 ml of SOmM sodium acetate (pH 5.5) and stored in freezer until purification.
Step 4. ~uantitation of Crude Olisomer or Raw Anal For all samples, a lOp,l aliqoute was diluted with 990 pl of deionised nuclease free water (1.0 mL) and absorbance reading obtained at 260 nm.
Step 5. Purification of Oli og mers (al HPLC Purification The crude oligomers were first analyzed by HPLC (Dionex PA 100). The buffer system was: A = 20 mM phosphate pH 1 l, B = 20 mM phosphate, 1.8 M NaBr, pH 11, flow rate 1.0 mL/min, and wavelength 260-280 nm. Injections of 5-15 pl were done for each sample. The samples were purified by HPLC on an TSI~-Gel SuperQ-SPW (20) column (17.3 x 5 cm). The buffer system was: A = 20 mM phosphate in 10% ACN, pH 8.5 and B = 20 mM
phosphate, 1.0 M NaBr in 10% ACN, pH 8.5, with a flow rate of 50.0 mL/min, and wavelength 260 and 294.
The fractions containing the fulllength oligonucleotides were then pooled together, evaporated and reconstituted to 100 ml with deionised water.
Step 6. Desalting_of Purified Oligomer The purified oligonucleotides were desalted on an AKTA Explorer (Amersham Biosciences) using Sephadex G-25 column. First column was washed with water at a flow rate of 25 ml/min for 20-30 min. The sample was then applied in 25 ml fractions. The eluted salt-free fractions were combined together, dried down and reconstituted in 50 ml of RNase free water.
Step 7. Capillary Gel Electrophoresis (CGE) and Electrospray LC/Ms Approximately 0.15 OD of desalted oligonucleotides were diluted in water to 150 ~.l and then pipetted in special vials for CGE and LC/MS analysis.
Step 8. PEG conjugation.
A) Initial reaction conditions. The purified and desalted RNA was lyophilized.
RNA
(lmg) was dissolved in aq.NaHCO3 (O.1M, 200gL, pH 8.1) and DMF (200~,L each).
5 K (13 equivalents, lOmg) or 20KPEG (3.4 equivalents, l Omg) was added directly to reaction vial and vortexed thoroughly. The reaction continued overnight at 4°C, and was followed by analytical ion-exchange HPLC. When the reaction reached >85% completion, it was quenched with aq.
NaOAc (0.05M, pH 5.5) until the pH was ~7.
B) Borate buffer coniu~ation. The purified and desalted RNA was lyophilized. A
sample of RNA (lmg) was dissolved in sodium borate buffer (200wL, 0.05M,pH10). SKPEG
(3mg, 4.5 equivalents Sunbright ME-50H8, NOF Corp.) was dissolved in CH3CN (200~.L). The RNA
solution was added to the PEG solution and vortexed thoroughly. The reaction continued for one hour at room temperature, and was followed by analytical ion-exchange HPLC. When reaction reached >85% completion, it was quenched with aq. NaOAc (0.05M, pH
5.5) until the pH was ~7.
C7 PEG linker (AS and HS) comparison. A sample of RNA (lmg) was dissolved in aq, NaHC03 (O.1M, 200~L, pH 8.1) and DMF (200~L). SKPEG (13.5 eq, lOmg, Sunbright ME-50HS or Sunbright ME-50AS, NOF Corp.) was added directly to the reaction vial and vortexed thoroughly. The reaction continued overnight at 4°C, and was followed by analytical ion-exchange HPLC. When the reaction reached >85% completion, it was quenched with aq.
NaOAc (O.OSM, pH 5.5) until the pH was ~7.
D) Final optimized PEG conju_~ation. The purified and desalted RNA was lyophilized. A
sample of RNA (SOmg) was dissolved in aq. NaHC03 ( O.1M, 2mL pH 8.1) and DMF
(1mL).
20KPEG (approximately 2.7 eq, 400-520mg Sunbright ME-200HS, different amounts for different sequences within this range) was dissolved in CH3CN (2mL). The RNA
solution was added to the PEG solution and vortexed thoroughly. HZO (250mL) was added to the reaction to decrease turbidity. The reaction continued for one hour at room temperature, and was followed by analytical ion-exchange HPLC. When the reaction reached >85% completion, it was quenched with aq. NaOAc (O.OSM, pH 5.5) until the pH was ~7.
Step 9. Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 12 and Figure 45 provide data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 13 Synthesis of oli~onucleotides containing the ribo-difluorotoluyl (DFT) nucleoside (Table 13) The RNA molecules were synthesized on a 3 94 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was 500 ~
dT CPG (2 umole). The monomers were either RNA_ phosphoramidites or the ribo-difluorotoluyl amidite. All had standard protecting groups and were used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated. Specifically the phosphoramidites were 5'-O-Dimethoxytrityl-N6-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl) phosphoramidite, 5'-O-Dimethoxytrityl -Na-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-difluorotoluyl O-tbutyldimethylsilyl-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite (0 _ 12 M). The coupling times were 7 min for all RNA monomers and 10 min for the DFT monomer. Details of the other reagents are as follows: Activator: 5-ethylthio-1H-tetrazole (0.25M), Cap A: 5% acetic anhydride/THF/pyridine, Cap B: 10% N-methylimidazole/THF; phosphate oxidation involved 0.02M
IZ/THF/H20.
Detritylation was achieved with 3% TCA/dichloromethane. The DMT protecting group was removed after the last step of the cycle.
After completion of synthesis the CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic ammonia (1:3) for 16 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube; this was followed by washing three times with 0.25 mL of 50% acetonitrile . The tubes were cooled at -80°C for 15 min, before drying in a lyophilizes.
The white residue obtained was resuspended in 200 uL of triethylamine trihydrofluoride and heated at 65°C for 1.5 h to remove the TBDMS groups at the 2'-position. The oligonucleotides were then precipitated in dry methanol (400 uL). The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual methanol was removed in the speed vacuum to give a white fluffy material. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by 20% polyacrylamide denaturing gels. The purified dry oligonucleotides were then desalted using Sephadex G25M.
Duplexes were tested for activity in the HeLa cell assay described above.
Table 13 and Figure 46 provide data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 14 Synthesis of RNA modified with 2'-ara-fluoro-2'-deoxv-nucleosides (Table 14) The chimeric RNA molecules were synthesized on a 394 ABI machine using the standard cycle written by the manufacturer with modifications to a few wait steps. The solid support was 500 ~ dT CPG (2 ,mole). The monomers were either RNA phosphoramidites, or 2'-arafluro-2'-deoxy (2' ara F) phosphoramidites. All monomers had standard protecting groups and were used at concentrations of 0.15 M in acetonitrile (CH3CN) unless otherwise stated.
Specifically the RNA phosphoramidites were 5'-O-Dimethoxytrityl-N~-benzoyl-2'-O-tbutyldimethylsilyl-adenosine-3'-O-(a-cyanoethyl-N,N'-diisopropyl) phosphoramidite, 5'-O-Dimethoxytrityl-NZ-isobutyryl-2'-O-tbutyldimethylsilyl-guanosine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite, 5'-O-Dimethoxytrityl-N4-acetyl-2'-O-tbutyldimethylsilyl-cytidine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-O-tbutyldimethylsilyl-uridine-3'-O-(~i-cyanoethyl-N,N'-diisopropyl)phosphoramidite; the 2'ara F
phosphoramidites were 5'-O-Dimethoxytrityl-N4-benzoyl-2'-arafluro-2'-deoxy-cytidine-3'-O-((3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-arafluoro-2'-deoxy-uridine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite, and 5'-O-Dimethoxytrityl-2'-arafluoro-thymidine-3'-O-(~3-cyanoethyl-N,N'-diisopropyl)phosphoramidite.
The coupling times were 10 min for all monomers. Details of the other reagents are as follows:
Activator: 5-ethylthio-1H-tetrazole (0.25M), Cap A: 5% acetic anhydride/THF/pyridine, Cap B:
10% N-methylimidazole/THF; phosphate oxidation involved 0.02 M IZ/THF/HZO.
Detritylation was achieved with 3% TCA/dichloromethane. The final DMT protecting group was removed after the last cycle.
After completion of synthesis the CPG was transferred to a screw cap, sterile microfuge tube. The oligonucleotide was cleaved and the base and phosphate groups were simultaneously deprotected with 1.0 mL of a mixture of ethanolic ammonia conc (1:3) for 5 hours at 55°C. The tube was cooled briefly on ice and then the solution was transferred to a 5 mL
centrifuge tube;
this was followed by washing three times with 0.25 mL of 50% acetonitrile .
The tubes were cooled at -80°C for 15 min, before drying in a lyophilizer.
The white residue obtained was resuspended in 200 ~,L of triethylamine trihydrofluoride and heated at 65°C for 1.Sh to remove the TBDMS groups at the 2'-OH
position. The oligonucleotides were then precipitated in dry methanol (400 ~L). The liquid was removed carefully to yield a pellet at the bottom of the tube. Residual methanol was removed in the speed vacuum to give a white fluffy material. Samples were dissolved in 1 mL RNase free water and quantitated by measuring the absorbance at 260 nm. This crude material was stored at -20°C.
The crude oligonucleotides were analyzed and purified by 20% polyacrylamide denaturing gels. The purified dry oligonucleotides were then desalted using Sephadex G25M
(Amersham Biosciences).
Duplexes were tested for activity in the HeLa cell assay described above.
Table 14 and Figure 47 provide data and graphs of the activities in HeLa cells for each of the modifications described above.
Example 15 Deprotection of Methylphosnhonate Modified siRNAs (Table 15) Deprotection step 1:
After completion of the synthesis, the controlled pore glass (CPG) was transferred to a screw cap vial. A solution (0.5 ml) consisting of Acetonitrile/Ethanol/NH~OH
(45:45:10) was added to the support. The vial was sealed and left at room temperature for 30 min.
Ethylenediamine (0,5 mL) was added to the vial and left at room temperature for an additional 6 hours. The supernatant was decanted and the support was washed twice with 1:1 acetonitrile/water (0.5 mL). The combined supernatant was diluted with water (15 mL). The pH
was adjusted to 7.0 with 6 M HCI in AcCN/H20 (1:9). The sample was desalted using a Sep-pak Cl$ cartridge and then dried in a speed vac.
Deprotection step 2 (Removal of 2'-O- TBDMS grout) The white residue obtained was resuspended in a mixture of triethylamine, triethylamine trihydrofluoride (TEA.3HF ca, 24% HF) and 1-Methyl-2-Pyrrolidinone (Nl~IP) (4:3:7) (400 ul) and heated at 65°C for 90 min to remove the tert-butyldimethylsilyl (TBDMS) groups at the 2'-position. The reaction was then quenched with isopropoxytrimethylsilane (i1'rOMe3Si, 400 ul) and further incubated on the heating block leaving the caps open for l Omin~
(This causes the volatile isopropxytrimethylsilylfluoride adduct to vaporize). The residual qwenching reagent was removed by drying in a speed vac. 3% Triethylamine in diethyl ether (1.5 ml) was added and the mixture was subjected to centrifugation to afford a pellet of RNA. The supernatant was pipetted out without disturbing the pellet. The pellet was dried in a speed vac. The crude RNA was obtained as a white fluffy material in the microfuge tube.
Purification:
All methylphosphonate modified sequences were purified by PAGE
Analysis of Duplex activity Duplexes were tested for activity in the HeLa cell assay described above.
Table 15 and Figure 48 provide dat and graphs of the activities in HeLa cells for each of the modifications described above.
TABLE 1. Target sequences in VEGF 121 ARGET SEQUENCE IN VEGF121 mRNA
SE ID NO: ORF 5' to 3' ~ 14 UGUCWGGGUGCAUUGGAGCCUU
20l 200 UGAGAUCGAGUACAUCUUCAAG
352 357. GGAGAGAUGAGCUUCCUACAGC
a>
z z z z + + z z + + + + +
w + +
+ + + + + + + + $ + + +
r, a + + + .~. +
W M~
W W
m m m tn m m m m m m m m m tn m m w m m W
a ~ ".~ r.C H m H tn U C7 N(-~ m U c7 H N ~ C~'J F ~ U 'U'J E ~ CU.7 U
CU9U C.U7U"HJr.CCH7U'UJ~ ~~UCU7UC7UC7UC9~C7UU' ~'J
C7 ~ C7 U t7 U C7 ~ U' ~ 'J 5 U C7 U C7 U C7 U C7 ~ ~ 'J "J C7 U C7 U C7 ~ C7 ~ ".W C 'a U C7 C7 U C7 U U' ~ ~ C7 ~ C7 ~ ~ ~ ~ r.C C7 U c7 U c7 U C7 ~ "J
D ~ Cp7 U U C7 c7 ~ ~ U' C7 Upp 5 ~a Ca7 ~ "UJ U 'UJ U ~ U
c~7~ ~~IUWC CU7 CU7~~~~~~~~U~U~CU7 C7 U U C7 U C7 ~ C~'J "UJ a' ~ FC (7 U C7 U U ~ U CU7 ~ "~~ ~ "tJ7 UC~7~~j~~~C9~r~CU7UCU7~C~7~c~'JU"~J~rU~~~~,~A,'Dr.CCU'JU
r~ ~UC~7UFC~CU7~CU7U'UJ~"U,~~CU'J~~~C~7~(U7 U~~FC~~C~7~C~'J~~'UJ0.'~CU7~C7~CU7U5U
ar ~ H H C7 H C7 ~ H C7 ~ N ~ C~9 yn "J tn ~ tn H W H m p ui H W c7 m ~ N U' tn H tn FC tn H of C7 V] r.o m m m m m m m m m m m m A
~ ~ N m ~ 1f1 ~D n m Ot O v-1 N m cH ll1 ~D n t9 01 O ri N m ~' U1 CD n OJ O O O O O O O O v-1 ri rl rl wi W ri rl ri e-I N N N N N N N N
V~ ~ V~ W ~' C' V' V~ C~ V~ ~ t' V' d' ~ d' <T V' V' V~ ~ W ~ C~ G~ V~
~ N ~ ~ ~ N ~ N N ~ N ~ ~ N N ~ ~ N N N N ~ ~ O
L, i~
m n .-~ m m m n n m cmn ao vo q w n N o 0 0~ cn rt v~ o m .-i m 0 0 o rl 0 0 0 0 o rl 0 0 0 w .n ~ w w ~ w ~r ~ ~n w w w n n n n n i n n i n n n n A w w w w w w w w w w w w w A A A A A A A A A A A A A
n i n n n n n i i n n n n a a a a a a a a a a a a a a a a ~ a a .s .e ~ a a a CU7 C~7 U U ~ r.C CU7 G7 ~ UC~7D~ ~ U U
U U
CU7 "C7a C7 ~ C5'J
M ~ ~ ~ ~ ~ c~
'J U C7 ~n ~ a ~
bA CU7 U ~ U ~ 'J C7 C~7 '.~ ~ a' ~ U
a N
m of 41 v-I N m ~1' u1 N W V~ u1 N If1 !ti u7 N G
N n ~ O rl N m ' N V' V~ If1 1f1 V7 !t1 !f1 + + + + + +F + .*~ + + + + + + +
+ + + + + + + + + + $ + + + + +
+ + + + + + + + + + +
m M V7 M M V7 M M Il1 M M I(7 M M tf1 M M Lf1 M M 111 M M !f1 H In U~ t7 H In "J IS H In C7 U H ~ U U ~', N ~ (~7 H ~ ~ ~ U c7 U ~ H 5 U CU7 ES~U~U C7U ~U'UU~ U C7U C7U UFC 5rC C7U C7U
UCU'JU~~~~ "JC7~U'~CU7UCU7UU'U~U~C~7~C~'J~FC
C7 U U' ~ C7 ~ ~ ~ U C7 U ~ ~ CU9 U C7 ~ U C7 U C7 U ~ C7 C7 U C7 U (7 ~ C7 ~ 5 'J U C7 ~ C7 ~ CU'd ~ ~ ~ C~'J U C7 U C7 U C7 U
"a ,~ "a r.C C7 U C7 U L7 ~ C7 ~ 'a "a U C7 U ~ U C7 ~ CU7 ~ CU'J ~ C7 U
"aC7U C7U',W C'J~ ~U~ U ~~ ~~ C~7~ C~7~ "J~ "JU UCU7 ~CU7UCU7 U 'J C7 ~ C7 ~ 5 ~ 5 ~ C7 U C7 U C7 ~ C7 ~ 'J ~ ".~ ~ ~ C7 U C7 C7 ~ C7 C7 ~ ~ C7 U C7 U C7 C7 'J 'J c7 U c7 U
'J FC C7 U C7 U U ~ U CU7 ~ C7 C7 C~J ~ ~ U U C7 ~ C7 ~ 'J IS ".~ ,~
C~7~"~J~~'JFC U~ C7UC7 U UCU7 CU7 ~~ ~~ ~ ~ UU C7 C7 ~ ~ ~ 5cc~9 ~ C~7 ~ "~J ~ "~.~ ".~ r~ ~ r.C C7 U C7 U ~ C7 ~ LU7 ~ ~ ~ C~7 FC
In E W C~7 In H In U In N In CU7 W E u7 c~'J In H In ~ In H In ~ In H In U In H In 'C-~U~7 M M M M M M m M M M M M M M M m W T O rl N M C It1 lO l~ m 01 O v-1 N M C If1 lD h N 01 O r1 N M V' V1 tD h m N N M M M M M M M M M M c>t V' ct~ V' Ch VI VI ~N C VI Lf1 If1 Ill If1 If1 N N
V7 V1 It1 ~ V' V' V' C~ C W G' d' <T V' C V' C d' d' VI C V' W CI ~H ~ ~ ~ CI CI CI W CI
V' V' V7 N V1 In !!) V1 U7 VI Ul V~ U1 U1 V7 U1 V1 N V1 U7 V7 U1 0.' U7 V7 In N N V7 N !!) Ul U1 V1 VI M Ill l~ VI O b 01 I~ I-I N h O O N 'i CD 01 W M If1 M O W O O !t1 O W I~ 111 I~
O O O O O O O O O O O O O O O O
'W W W W W W W W ~N ~N ~N ~N ~N ~N W W
w w w w w w w w w w w a w w a w A A A A A A A A A A A A A A A A
a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a .x a CU7 U ~ CU'J ~ U U U
U CU'J C7 ~ ~ C9 ~
C
~ ~
~
C~7 ~ ~ ~ C7 ~ U ~ ~
C ' C 'J U
'l J ~ .7 U ~
U
U' "J C C D
~
~
D C~7 U
r~ ".W 9 Ip h LO 01 O r-1 N M
!!1 If1 N 1f1 ID 10 10 t0 !!) N N If1 Vi 10 ~0 N
+ + a a ~ ~ ~x a a ~ ~c a a a a z + z z z z z z z z z z z z z + + + + + +
+ + w + + + + + + + + + + + + +
+ + + + + + + + + + + +
m m N m M M m m Hf N m m M M m N m N m m N
H N ~ Ca7 H N E N E N E N H N C~7 U H N H N H N H N ~ "~J ~ Ca'J E
U,~ U' U C7 U (7 U C!~7 a U' U,~ C7 U 5 ~ U,~ C7 U rC a U' U a FC C7 U U U' UCa'JU"UJ U"JU~U~ Ca'JU "UJUC~7 ~ CU7U Ca7~ "U.~' U aFC "~JFC ~aU' Ua p C7 ~ U' ~ ~ ~ ~ ~ C7 ~ ~ U Ca'J ~ ~ U CU7 ~ Ca'J ~ ~ Ca'J a U U C7 C7 U
C~7~C~7UC~'JUFCU~Ur~(7~~~ ~~~U~Ca'JU~U~~DFCUaC7U
FCaCU7UCU7UC7U~~C~Ca7a."JU C7UU' ~~ ~~ ~~~~~~~C"~a~FC
U C7 ~ ~ a Cr~7 U a' a a FC U C7 ~C a ~ ~ U "Ua U CU.7 C7 U C7 U a ~C FC ~ a UCUr~7 UC7 ~CU7~Ca'J'JFC ~Ca9 ar~'~J'a FC'.-~' FC ccr~~i!! ,U~
a ~ ~ U U CU7 a sC ~ C7 FC a ~ ~ a ~ ~ FC ~ Ca9 CU7 ~ ~ U "C7~
~a~a~~~~~ ~aa~~c~
a a a ~a~a~2~~~~a~ac~a~ a~c~c~ c~
H H H H~H..~~~ ~~~~~~ ~N~U~~~0.H'CU7U~
N H N U' N H N H N H N H N H W N H N N H N H N a N N H N a m m m M m m M m m m m m m m m O I-1 N m ~ N b n m Ov O I-i N m V' N 10 n m Ot O rl N M CI N ~0 r m ~ O rl b b io b ~o b b b b b r r n r r~ n r r r n m m m m m m m m m m o~ a~
w ~ ~r ~r al m <r a a a w w wr ~r w w ~ ~ ~ w ~r w ~r ~r rn a~ m ~ <r V1 !l~ U7 (~ V7 N N N V7 N m m G7 (p V7 Cn V1 W V7 UI [n Cf7 N VI V7 N VI V1 b U1 U7 Ul b N r b N M W ~ a1 1f1 O m a~ O ei rl N r N b N N N !~ rl N rl b r N r-I W
O O O O O O O O O O r1 O O O ei O
cH W sH W ch W W W W W ~ ~H VI W W VI
w w w w w w w w w al w w a w w w A A A A A A A A A A A A A A A A
I I I I n n I n n I I n I
a a a a a a a a a a a a a a a a a .c a a ~c Is .c Ix a Is a a a a a a '~u ~ ~ '~ ~ ~ ~ ~ a c'~ I~ ~a ~ a a ~ ~a a ~ ~a a a CU7 ~ a ~ ~' U U U ~ CU7 U a Ca7 C7 r.C
~a ~ c~ ~ ~ c~ ~ ~ ~ ~ a b b ~ O ~ O ~ O ~ O ~ O ~ O ~ O ~ I-i ~ N ~ O ~ m 'i H r1 ~ ri H 'i 'i H ~-i ri b b T ri W fi rl ri ri ri rl 'i ri a a a a a a a ~ ~ a ~ a a +
z z z z z z z z z z z z z + z + + + + + + +
+ + + + + + + + + + + + + + + +
+ + + + + + + + + + + +
m m m m m In m m m In m u1 m m m m m !!1 m m V1 H m H ~n H tn H tn U c7 H tn H m C7 U C7 U H m H W H u7 N tn r.C ~ H m C7 H H H C7 U H H U C7 r.C b H~ U U, ~ U U U' UU C7 U C7 ~ C7 ~a~~~~ ~aap~~p~~~~~a~U~ a5~~ a" acC7~ acs UU' C7UUJ C7U~C~7~C~'J5~ CU7 ~ UC7C~7~ FC~ C~7 C7 ~~~~U">U' UU5 (U7 ~~ "J a' UC7 C~'J J 0."J 'JFC
c~ a ~ ~ ~ ~ ~ ~ ~ ~ ~a ~59 ° ~ ~ a ~ ~ ~ ~ a CJ7 ~~CU.7UUCU7C7UU' U
J~~cU'JUD(U'JUC7UUC7U~UCU7 'J~ U(7 C~7 ~ ~ ~ ~ ~ r-C ~ CJ7 J C7 U ~ C7 C7 U ",~ 'J FC U C7 ~ C7 C7 ~ C7 cr~~ a ~c ap a ~ a ~ ~ c~ ~ ~ ~ ~ ~ ~ ~ c~ ~ "~ ~ ~ ~ "pU ~ "pU ~ ~p a GU"J~ J~,.UJU~C~7'~J~~~~~U' U~ ~ Sr.C U' U ~CU7 ~CU7 UCU'J ~U~C~'J
"Jr~ CJ7~ JU'JU~(~7~CU7U' U FCa ~C~7'UJrC U' U FC~ C~7~FC
CU7 U U' U FC 'J 'J FC U' ~ U' ~ 'J r.C U' U rQ J ~ r~ r.C 5 U C7 "J FC U' tn E W E ~n H tn H ~n '~',mn N tn N W U m U m E W H W N W H tn W n H ~n "J
m m m m m m m m m m m m m m m m N m ~r m b r m o~ o ,a N m m b r m m o .-i N m r m b r m o~ o H N m 01 01 Ov 01 O1 01 01 01 O O O O O O O O O O rl ri r1 rl rl n-i ri v-i rl ri N
N N N
T V' V' t' V~ ~ ~ W !f1 1f1 V1 In In N In tf7 tf1 u1 V1 tf1 In tf1 In 1f1 !f1 It1 It1 1f1 If1 !f1 In !f1 UI ff7 N V! b G7 VI U1 N (A W Ul U1 U7 N Cn fn fA fJ7 Cn !n U1 V7 N N Cn N U1 CO U7 (17 f4 N 01 N b IIi O r rl m m Ot O r-I m m at b rl N 41 N N m 01 N N m m O If1 O
0 o rl 0 0 0 o a o 0 0 0 0 0 0 0 w cN w w w w w w ~ ~r w ~ w w ~n i i i i i i ~ i ~ i i i ~ i w w w a w w w w w w w w w w w w A A A A A A A A A A A A A A A A
n n n t i n n i i i n n n a a a a a a a a a a a a a a a a a a a t a a a a a a a .c a a a R
(U7 U U ~ U U
C7 'J U' rC U U U U U
U ~ U U
~ U D,~ 2 U' r.C C~9 ~
~ U ~ FC
C~7 ~ ~ UJ ~ ~ ~
C7 'J C r.C
a ~ ~ 'J
a u a 5 c~
c~ ~ a c~ 5 c~
~ ~ U
U CU7 U C ~ ~ U ~ U c~'J
7 ~ ~ a' ~
~ ~
"J C7 C7 C7 p r.~ C7 r.C
N ~ m C U7 b u1 r ~ O ~ rl ~ N ~ m r ~ m m m m m m ~r ~r wW un b b 'i rl rl rl ri ri ,1 ri rl ri rl rl ri ~-i ~ N ~ m C~ ~ N ~ ~ ~p 01 ~ O ~ ri ~ N ~ ~O r m m m m m ~r w W wn b b rl H ri W fW -i 'i ~ H ri ri ra 'i + + + + z z + + + + + z + z z + + + + + + + + + + + + + + + +
+ + + + + + + + +
t~ m In r1 m N t~1 t~t N t'1 n'1 N r'W '~1 N t'1 t"7 N r~l N m t~1 N
H N C7 U H N r.C '~ H N C7 U H N ".~ ~ H N ~ ",~ H N U C7 U C7 H N rl N ",J r~
H C,~7 U H C7 H x~C ppU H C7 H p ".~ H U (7 U C7 H FC "J
UCU'JJ~C~7~~U~U"J~~CU7UC~7UC~'J~~~~UFC SFC~FC~FC".1' U~2 pp~"~r~ r~ C7 D~~Ur~,.U~UDCU'J~~~CU7 ~C~7~C~7~p C~7~~CU7 ~CU7UC7~c7~C7 ~CU7 ~U C~7 ~C~7~C~'J~ C~'J
t~.7 U~ ~ U ~ "UJ U2 ~ ~ ~ ~ ~ ~ U ~ U ~ U t7 U ~ ~ ~ t7 ~ c7 ~ U 5 CU7 U' FC 'J rC "..1 ;".~'~ r~ 'J FC C7 ~ U' ~ ~ ~ ~ U C7 ~ U' ~ C7 ~ (7 r.C 7 SU,~C~'J~C~7U C~7U~(9U~CU7~C~7~~~"~J'J~'JFC U C7 UC7UC~ UC7 U' U
U r~ C7pUpp ~ C~7 C~7~C~7~CU7U "UaU~UCU7~CU7UC~7~C~7~ rC"UJ FC~'a FC "a0.'"J0."aFC UC7 U C~7 Up FC U FC CU7 ~ CUp'J ~ CU7 ~ C~7 ~ "JU~ U '~'J ~ CU7 U,~ CU7 U,~ U
C~7, ~ C~'~~'J, ~ C~7 ~ CU9 C7~U' ~FC'~C~9U~UFC~~CU.7UCU7~C~7~~ ~~~~U CU7U
C7 ~ C7 'J a' U FC C7 U C7 vU
H N ~ N H N ~ N N N CU7 N H N ~ N H N C~'J N H In rn N n1 N H N In N "U,..t' m r.l m rl fn M rl nl tn m r.l m rn C N 10 r W 01 O v-I N t~1 H' N l~ r of 01 O rl N t't W N t0 r O 01 O ri N t~W
P N
N N N N N N t~l tel r'1 r'1 t'1 M f~1 H1 r~l n1 ~ d' C V' W V' cH CI OI ~ N N
N N N N
N N N N N N N N N N N N N N N N N N N N N N If1 N N N N N N N N N
V7 (n (n N V1 Vl V1 N U7 Vl U1 N (n V7 N f0 (17 N U] (p N V1 U1 In U7 U7 N Ul 00 o O M VI rl m W o ow-I tn In N o o1 N ri b r O ri W r 01 n'1 01 O rl r/ N o1 O O O O rl O O O O O O O rl O r-I O
W VI W W W W VI W CI ~N W W W W W W
I 1 I 1 1 1 I I 1 I t I 1 1 1 a w w a w w a a w w w w w w w w A A A A A A A A A A A A A A A A
I I 1 1 I 1 1 1 I t I 1 1 1 a a a a a a a a a a a a a a a a a a a a a a .x a .~ a a ~ ~ a a a L~7~C~'J"~JU
U' C7 ~ C7 U C7 U ~ ~ C7 U ~ rC U
a ~ ~ a a U t~
a ~ ~ ~ ~ a of O rl N m ID o In r r r r r m 'i ~ ,~ ~1 a (p 01 O r1 N
In ~ r r r r~ r H ~ H H H N H
a a a a a a a a a a a a a a a a z z z z z z z z z z z z z z z z + + + + + + + + + + + +
+ + + + + + + + + + + + + + + +
+ + + + + + + +
M M N m C7 m N t~t N m N t~1 N m N N m N m rat N W7 N r1 tn H N ~ H N H N "a ~ ~ U ~ ~ U C7 'J ~ H N ~ U H N U CU_7 'Ua' ~ H N E N
,~ a 'J ~ 5 ~ a ~ r~ C7 ~ U C7 ~ ~ C7 ~ C7 U C7 a "J U C7 '.~ U t7 'J~' SaUG C7~'Ja~~~~ ~ Up "JaCUnU ~~ UC7 ~~ ~C~7 a ~ a ~ a ".~ "J ~ Ca'J U U C7 U
5 a 5 'J ~ C7 ~ U' a ~ U C7 (7 ~ry' ~ C7 p a UC7C7UU''U~C~'JSaa'~7~UaU,~C~'J~~C~7~ ~"aJ C~7Ej~~UC7~
(a7~~~~aaC7UUCU9CU7UG~C7Ua C7U UU a"a a ".~ C7 U C7 ~ ar~ 5 C7 U ~ a~ "J a a ".~ U' ~ ~ ~ a a ~ ~ U C7 (7 U ~ C7 ""UJaCa'JJ~Ca7U~C~7CU7UU~Ua'JUpaa5UCU7C7UCa'J~ ~aUC7~a",»p aSUaapspp ~a'JC~7UU~C9~ ~aC7Cp7U"J~~~UCa7 t-~J. ~aaUGC~7 Upa Ca7~Ca'J~ UC7 UC7 ~UU~~C~~7 UaC7 a'JUU' U'U
UU' ~aU' '~~~~ CanU Ca'!U'UJ'r.CUU' ~C~7 CU7UUa5~~ U,a ~ a~ 5a U CUn U U' U U U' ~ a U C7 C7 U U' U U C7 a "a U C7 ~ a ~ ~a a 5 ~ a ~ 5 ~ ~ ~ ~a ~ ~a ~ ~a ~ a ~ ~ ~ ~ ~ v a ~ ~' ~ ~ a N E N U N F N H N U N ,.7 N CJ N U N CJ N E N a N H uI ~ N U N E N F
m m n, m m m M m m rwn m rn rmn rn b r N O1 O ri N m ~ N b r t0 01 O r1 N m V' N b r m 01 O r-I N r1 ~!' N b r N N N N w ~o ~o b ~o b b b b b r r r r r r r r r r m m m m m m m o~
N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N
V1 VI U1 V) U7 b N U7 N V7 N N VI Cl1 N V7 V1 In VI Q7 Vl (n In V7 C4 U7 Vl U1 U1 N U7 Ul a a a a a a a a a a a a a a a a N N t'1 W V~ N b b O N O wl ri N W t~1 M W b b W W ~W O1 W 10 O N1 O O n1 ~-1 O O O O O O O O O O rl O v-I n-I O r-I
V~ V~ W ~ W V~ W W W W ~ <N V~ W W
w w w w w w w w w w w w rL w w w A A A A A A A A A A A A A A A A
i ~ ~ ~ i i i i i i i a a a a a a a a a a a a a a a a a a a a .c a a a a a a a .c a a a a ~ C7 C7 'U'a ~ U,r~y 'a ~,U~ CUn 'a U "J U
C7'J ~C~75",~~~~C7Ca'J ~ UU
a a ~ 5 a ~ ~ c~ a a ~' a c~ ~ a c~ ~ ~ ~ ~a a ~ ~ U
cn a ~ ~ ~ ~ ~ ~ a a ~ ~ ~, ~ can '~ c~ c~
a a ~ ~ ~ ~ c~ ~ ~ ~ ~ ~ a a ~a~a~5a~~cJu c~~a c~ ~ c~
a c~ a cn a cn cn cn a a 5 a cn cn a N r1 O ri G~ O N cf~ O m b .1 rat b r o\ ov ri b b ~ m m 01 O o .-I rl ri .-i r-1 wl N N N N N N N M M M rat r1 t~1 r-1 N 01 O tn 41 rl t"1 O1 N N O N N vD
01 01 O t0 b r c0 CD o0 O O rW -I ~-I rl r1 -I N N N N N N N r'1 r1 r~1 r~1 n1 t'1 + ,~ + ~ ~ + + + + + ~ + ,~ + +
+ + + + + z + z + +
z + z + z z + + + + + + + +
+ + + + + + + + + + + + + +
+ + + + + + + + + + + * + + + +
+ + + + + + + + + +
m m m m m W m tn m W n m m tn m tn m m m m H ~ C7 U m m H ~n m m U C7 U U' H ~n ~ ~ H W .~ ~ ~ E ui m W U C7 H tn ~CU7U t~'J~C~7~FCaFCa~U~UC7UC7U~~ ~C~7 Ca.7UCU7UCU7UUCU7UCU_7 a~a~UUU' Ur.C r.CaFCaFC'JC~U U' U
~a a a a a a ~c a a c~ ~ c~ a c~ a c~ a a ~c ~ ~ c~ ~ ~ ~ a a a " ~ ~ ~ ~ a ~ a ~ a ~ a 5 a a ~ a U U' a r.C a FC ".~ EC a r~27 rU~ a C7 U C7 ~ C7 U C7 ~p C7 U r.C 5 FC a UCU7UCU'JUCU7UC7aFC C~7UC~7~~aFC5C~7~C~7UC~'J~C~7Ur.Ca ~a U C7 C7 U (7 U C7 U C7 U rC "~ ~ '~-~ ~ '~-~ ~ ~ ~ U ~ U
U C7 U C7 FC a FC a C7 U C7 U C7 a r.C a r.C r-C a ~C a C7 U U' U C7 U C7 U U' ~ C7 r.C U C7 C7 C7 C7 a a a ~C a FC a' a FC a FC a FC a U' U C7 U
a~ a~ a~aa ~ c~c~c~c~~canc~~a5a U U' ~ ~ C~7 ~ ~U' U C~'J U a r.C U Ca7 ~ Ca'J ~ Ca'J ~ Ca7 ~ ~ ~ "UJ ~ a a U C7 U C7 U C7 U r.C '~-~ U ~ U ~ C7 U C7 U
a r.C U U' U C7 U C7 U C7 C7 ~ ~ U r.C a FC a C7 U ~ U ~ U C7 U ~ Ca'J ~ Ca7 FC C7 U~ C7 U U' E C7 U C7 ~n H tn a N m in H W m ~n U m U tn H W CU7 m H W cal ~n rW n H N m tn W n H
m m m m m m m m m m m m N 01 O ri N m ~ N tD I~ W 41 O ri N m ~ Lf1 ~O L~ W 01 O vi N m <N ~f1 l0 l~
CD T
N of O~ O~ O1 O1 O1 01 01 O~ 01 01 O O O O O O O O O O r-1 r-I ri ri wl v-I wl rl rl r1 !f1 N u1 N tf1 !n !f1 U1 1f7 u1 V1 !f1 t0 t0 \D vO CD l0 ~O l0 \O vD ~D ~O CD
t0 CO \D v0 t0 vD v0 V7 U1 V7 fl7 N (n (1J U7 V1 U7 N N U7 fA U7 V1 N V7 U7 U1 fp V1 U7 G7 U7 tl1 U7 U7 f17 N N V7 W N It1 W 01 m ~1 1f1 O ~D Vn N L~ N N W
v-I O 'i rl wl rl h O It1 O OW -I O N rl O
v-1 O ri O 'i O O ri O ri O ri ri e-1 O ri W W V~ V~ W W V~ W W W V~ W N W d V~
w w w w w w w a. w w w w w w w w A A A A A A A A A A A A A A A A
i ~ i i i i i i i i i i a a a a a a a a a a a a a a a a a a a a ~ a a ~ a a a .x a a a a U U
U U p C~.7 FC C7 U FC a c7 cC
c~J a ~ ~ ~ a a ~ a a ~ 5 a a a a a m o N N m V' u1 ri N N ~ ch V' d' m m m m m m m l~ 01 ~ N N m C
r-I ri N V' C V' d' m m m m m m m + + z z z z z + z + z + +
+ + + + + + + + +
+ + + + + + + + + +
+ + $ + + + + + + + + + +
m !n m m W m !n m u1 m m m N m In m m In m C~'J H N U CU7 ~ c~7 ~2 ~ H N ~H-, N C7 U L7 U H m m ul ~ r.C H In a ~, a ~ a ~
r.C ".~ r.C ".~ r.C p ~ ~ ~ ~ C~7 ~ 'J Cr~7 U C7 U C7 U U~' U U C7 U tp7 C~7 ~p C~'J U ~ ~ C7 ~ ~ U r.C C7 U ~ C~'J U C~7 ~ CU7 ~ C~7 C~7 U C~7 C~7~ CU7~ C~7~p~~ ~~ ~~ ~~ "UJFC ~FC'.» '.a~~C~7 ~CU'J
"~J ~ C~7 ~ ~ C~'J ~ ~ C~7 ~U' ~C~7 r.~"Jr$W S"Uar~~Dr.~CU7~C~7~C9~C9~U' U' In C~9 In N In ~ In ~ In U m H In H W ~ In m In N In m In ~ In H
m m m m m m m m m m m O rl N m ~ If1 ~O r o~ 01 O r1 N m C N ~D r m Ov O r-I N m W If1 N N N N N N N N N N m m P1 m m m m m m m ~N c!, W
l0 ~O t0 l~ l0 N ~0 t0 10 ~O t0 ID lO b 10 1O ~O LD ~O ID ~O t0 ID 10 lD ~O
U7 U7 V1 G7 V7 U7 N (n CO VI V7 fn U7 N U7 N U7 (n U1 N W W U7 V7 VI fn v-1 rl N a1 r r N W r OD 'i 1t7 t'1 1f1 ID N r Ot 10 C1 O ri 'i N O 1f1 O O O O O O O O ri O 'i O O
V~ W W W W W W W W cN W ~N W
w of a w w a a w w w w w a A A A A A A A A A A A A A
1 ~ I ~ 1 1 1 1 1 1 1 I 1 a a a a a a a a a a a a a .s a a a .c a R a a .s a R a U U' "J
p C7 ~ A.' U
C~7 'r3 c~ d cJ ~ ~ ~ ~a r O O m O rl N ~N
~r u, r r m m m m m m m m m m m m ~p O1 Ot N 01 O ~-/ m yo r r co m m m m m m m m m m w W
O
Z
~ t~ oo a, o .-a ~r ~r d- ~r V, ~n cn N Ei ro ro H
ro H H
* ro ro H * *
-ro * * *
- i U U U
~ ~
p O
U U ~
+
C-~ U U
L7 C "a "J
"a U~ U~ U O
~
C.
O
U' U U rl ~
C7 r~
y l, U
U
~ ~1 ~i ~ ~i ~i Pd U' x ~
C ~ o J
~,* ~,ro~ro a, b Aro M ('1 ~i N N
N
d d' d~ 0 O.P.~ P.~ P~
b N
o .aJ
U
00 o o ~ ~ ~
_ _ _ M M M
-r-I
O
Table 4. ha vitro efficacy of Modified AL-DP-4094 series 5'-sense strand-3' SiRNA EffICaCy3' -antisense strand-5' AL-DP-4198AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGASA-'5 AL-DP-4165AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3-AL4558 ' 3 -GSUotneCoMeGUGUAUCCUCUCUACUGASA-' S
AL-DP-4166AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4559 ' 3 -GSUoMeCoMeGUGUAUpMeCCUCUCUACUCGASA-' S
AL-DP-4167AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4560 ' 3 -GSUoMeCGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-'5 AL-DP-4168AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4561 ' 3 -GsUonseCoMeGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-' S
AL-DP-4169AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4562 ' 3 -GSUoMedCGUoMeGUoMeAUoMeCCUCUCUAdCUCGAA-' S
AL-DP-4170AL4555 +++ 5'- GsCACAUzoMeAGGAGAGAUGAGCUsU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'S
AL-DP-4171AL4555 +++ 5'- GSCACAUzoMeAGGAGAGAUGAGCUsU-3' AL4558 ' 3 -GSUoMeCoMeGUGUAUCCUCUCUACUGASA-' S
AL-DP-4172AL4555 +++ 5'- GsCACAU2oMeAGGAGAGAUGAGCUsU-3' AL4559 ' 3-GSUoMeComeGUGUAUoMeCCUCUCUACUGAsA-' S
AL-DP-4173AL4555 +++ 5'- GsCACAU~oMeAGGAGAGAUGAGCZJSU-3' AL4560 ' 3 -GSUoMeCGUonteGUoMeAUpMeCCUCUCUACoMeUCGAA-' S
AL-DP-4174AL4555 +++ 5'- GsCACAUzoMeAGGAGAGAUGAGCUsU-3' AL4561 ' 3 -GSUoMeCoMeGUoMeGUoMeAUoMeCCUCUCUACoMaUCGAA-' S
AL-DP-4175AL4555 +++ 5'- GsCACAU2oMeAGGAGAGAUGAGCUsU-3' AL4562 ' 3 -GSUoMedCGUomeGUoMeAUotneCCUCUCUAdCUCGAA-' AL-DP-4176AL4556 +++ 5'-GCo~eACoMeAUpMeAGGAGAGAUoMeGAGCUoMesU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAs~ -'S
AL-DP-4177AL4556 +++ 5'-GCoMeACoMeAUoctel:GGAGAGAUoMeGAGCUoMesU-3' AL4558 ' 3 -GSUoMe~.'oMeGUGUAUCCUCUCUACUGAeA- ' 5 AL-DP-4178AL4556 +++ 5'-GCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMesU-3' AL4559 ' 3 -GSUo~qeCoMeGUGUAUoMeCCUCUCUACUGA SA-' 5 AL-DP-4179AL4556 +++ 5'-GCoMeACor.~eAUoMeAGGAGAGAUoMeGAGCU~MesU-3' AL4560 ' 3 -GSUo~~eCGUo,~eGUoMeAUoMeCCUCUCUACoMeU~'GAA-' S
AL-DP-4180AL4556 +++ 5'-GCoMeACoMeAUoMeAGGAGAGAUoMeGAGG'UpMesU-3' AL4561 ' 3 -GSUo~eCoMeGUomeGUorneAUoMeCCUCUCUACoM~UCGAA-' AL-DP-4181 AL4556 +++ s'-GCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMesU-3' AL4562 ' 3 -GSUoMedCGUoMeGUoMeAUome CCUCUCUAdCUCGAA-' S
IAL-DP-4220 AL2780 +++ 5'-GsCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMesU-3' I
AL2781 ' 3 -GSUoMeConteGUoMeGUon~E~AUoMeCCUCUCUACoMeUCGASA- ' S
AL-DP-4182AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUaMeGAGCUoMesU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4183AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUoMeSU-3' AL4558 ' 3 -GSUoMeCo~teGUGUAUCCUCUCUACUGASA-' S
AL-DP-4184AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUo~,~eSU-3' AL4559 ' 3 -GSUoMeCpMeGUGUAUoMeCCUCUCUACUGASA-' S
AL-DP-4185AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUp~.~eSU-3' AL456t) ' 3 -GSUoMeCGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-' S
AL-DP-4186AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUpmeSU-3' AL4561 ' 3 -GSUomeCor.~eGUoMeGUoMeAUoMeCCUCUCUACoMeUCGAA-' S
AL-DP-4187AL4563 +++ 5'-G dC A dC AUoMeAGGAGAGAUoMeGAGCUoMesU-3' AL4562 ' 3 -GsUoMedCGUoMeGUpMeAUoMeCCUCUCUAdCUCGAA-' S
AL-DP-4188AL4564 +++ 5'-GsCACAUFAGGAGAGAUGAGCUsU-3' AL4557 '3-GSUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4189AL4565 +++ 5'-GCFACFAUFAGGAGAGAUFGAGCUFSU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4190AL4566 +++ 5'-GCpACpAUoMeAGGAGAGAUoMeGAGCUoMeSU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4191AL4567 +++ 5'-GCoMeACoMeAUpAGGAGAGAUpGAGCUFSU-3' AL4557 '3-GsUCGUGUAUCCUCUCUACUCGAsA -'5 AL-DP-4192AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUSU-3' AL4568 '3-GsUFCGUFGUFAUFCCUCUCUACFUCGAA-'S
AL-DP-4193AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUsU-3' AL4569 '3-GSUFCGUFGUFAUFCCUCUCUACoMeUCGAA-'5 AL-DP-4194AL4554 +++ 5'- GsCACAUAGGAGAGAUGAGCUSU-3' AL4570 ' 3 -GSUoMeCGUpMeGUoMeAUoMeCCUCUCUACFUCGAA-' S
AL-DP-4197AL4556 ND 5'- GCoMeACoMeAUoMeAGGAGAGAUoMeGAGCUoMeSU-3' AL4568 '3-GsUFCGUFGUFAUFCCUCUCUACFUCGAA-'5 AL-DP-4221AL2780 +++ 5'- GSCoMeACoMeAUpMeAGGAGAGAUoMeGAGCUoMeSU-3' AL2782 '3-GsUFCGUFGUFAUFCCUCUCUACFUCGAsA-'S
"Atugen Design"
based on single overhang AL-DP-4195AL4571 + 5'-GcAcAuAgGaGaGaUgAgCusU-3' AL4572 '3-gsUcGuGuAuCcUcUcUaCuCgAa-'S
OMe 2'O-Methyl F 2'Flouro s phosphorothioate linkage N Mismatches in scrambled controls Table 5. In vitro efficacy of siRNAs in HeLa cells siRNA UnmodifiedStrandEfficacy5'-sense strand- 3' #
parent 3'- antisense strand-5' AL-DP-4374AL-DP-4055AL2732+++ 5' CsAAGUGGUCCCAGGCUGCATsT 3' AL2740 3' TsTGUUCACCAGGGUCCGACGsU 5' AL-DP-4375AL-DP-4015AL2728+++ s' GsGACAUCUUCCAGGAGUACTsT 3' AL2730 3' TsTCCUGUAGAAGGUCCUCAUsG 5' AL-DP-4379AL-DP-4088AL2963+++ s' CpMeCoM~AAGUoMeGGUpMeCoMeCoMeCotteAGGCpMeLToMeG~-'orvteTST3' AL2964 3' TsTGGUFUFCFACFCFAGGGUFCFCFGACeG
5' AL-DP-4380AL-DP-4014AL2966+++ s' GCoMeGGAUoMeCoMeAAACoMeCoMeUonaeCoMeACocneCoMeAATST
3' AL2967 3 "TsTCFGCFCFUFAGUFUeUFGGAGUFGGUFUF~5' AL-DP-4219AL-DP-4004AL2712+++ s' GsUGAAUGCAGACCAAAGAAAsG 3' AL2720 3' UsACACWACGUCUGGUUUCUUUsC 5' AL-DP-4140AL-DP-4014AL2281- 5' GsCsGGAACAAUCCUGACCAsAsTsT 3' AL2282 3' TsTCGCCWGUUAGGACUGGsUsU 3' OMe 2'O-Methyl F 2'Flouro s phosphorothioate linkage N Mismatches in scrambled controls c c ~ N N N N N N N N N N N N N N N
d N
_ I~ t0t~ (Oh c0h c0I~ c0t~. I~ (Ot~CO
(O
da ~ ~ d)d) ~ d)~ ~ ~ m d) Q)d)O?
00 0700 O M O o007M O ~ N Qac0 M
W
W
r r r r r r r r r r r r U
M 'd'M ~ M d:C'~'V'd'd'NM ~i'r N r N O d' r N d'h O II)CO O W (OCh r d'N COO CON V O OOM O) 00O Op O
d' 00 O CO O OD O)ODW !~ M I' !~ N h n O
O
O
r ~
y E ~ ~ + i ~ ~ i .H -i-G -I-o l ll ~ O O a ' O
'~O '~O
m -p U U'-pa~
~
F- p d c h t m n n ~ ~ O O
U U ~ U V o V
o ~ ~ ~ o ~ o U Q
U
U ~ U ~ U j U o (~ o U
a ' o C7 ~'' ~ d o 9 a o ~ 7 o a U U ~ C~ H
Q
C C a d 'o U U
tJ7 ~ U ~ ~ ~ U ~ ~ U ~ U
V
o ~ o U U U ~ C7 ~
U
U U ~ U Q ~ ~ V Q
~ ~ ej~ o ~ o ~ C7o j ~ o V o a ~~ ~
y. I- C9Q C9 C7Q C U o ~ U U ~ U f~
. o ~ ~ U U ~
o ~ U ~ o ~ V o o ~ ~ o ~j Q ~
U a U V Q V j V ~ V Q ~ ~ ~ U' > > ~
Q U
U ~ ~ o o ~ ~ > >
~ = U
c C ~ ~ ~ o ~ o ~ ~oo U UU o C0U C7U
C .7~ U
C7 o C~ o ~ a ~
C U Q ~ ~ ~ ~ U ~ U a C~ ~ o o ~ o o o ~ o o ~ U
~ _ U
~
3 Q ~ ~ ~ ~ U V ~ Q
U ~,U U U , o C~~, o U ~ U U
U ~ ~ V U ~ U U ~ ~ ~ ~ =
~ ~ a U j 9 ~ ~ ~
?C ( C 0 (j o C Q = U= ~ j U j a a C7 d U ~' ~ N ~ ~ ~ '~~ C~C~ C9Q ~ C7 U ~ ~ ~ U ~ N ~ C9 _ U ~-- ~-- I- I-c --E- t-, ~
C ~ W ~
. a U ~ ~ ~ U ~ ~ N ~ vaU ~ N U ~ a - N
o U ~ ~ ~ U
D ~ U ' U ~ U ~ U - U a U- U ~ U ~ a o o o d' O r O r O O r O r O O O N
N d' d' d wt h. 1 r h M O CDO
M O d' M O V' O tf)Lntn InIn tf7~ tfaLn tn(p tn CO(OCOO
c0 V
Wit'N N N N N N N N N N N N N N N ~t d' N ' J
D
N N N N N N N N
J ~ W d ~Nd' dN' ~ dN' dN' a a c c0 N O
M M
~ CO
O_ c0 o '~' 'r U
z' O O
fa J
a a l1~ Ln Ln r tn r tn II~ lf~r LL)r M M M M M M M M M M M M M M M
M
O 'd'O d'O V'O d'O O d'O ~tO d' W W O O O O O O ~t O d)O O O O
r r r ~ O r r r r W
r M d'd' d'M d''d'd''V' N N d' r N r 'ch CO COO O c0 O O c0CV a0 c0N O Op O
a0 CO O CO N M N 00 O M d' N M tf7d" d' t!7 co ~ co 0 00 0 ~ ~ ao n n o n n n ao O O O O O O M M O O M M M O O
O
t ~ ~ ~ m f w f- -~- -f' ~ ~ i a d O a O ~ ~ a '~o ~ v~ ~ ~ _ a 0 U U ~ U ~n ~ ~ N w o U o ~ ~ ~ o U U d n o ' rnU o U o U rn~ F- !- ~ C=.7 C~ a ~, a ~ a ~ a ~ C9~ N Q v (~
o c?c? o ~ Q
C90 o C9 0 o U o ~ ~ ~ a ti 0 U ~ U U ~ - ~ ~ ~ ~ Ca'?ti 0 ~ ~ o ~ ~ ~ ~,~ ~ C~~ ' ' ~
~ C~ = UU'~ C~ ~ Q ~ ~ o o V Q
Q ~ ~UrJ ~ U a ~U'o C7Q C~Q C~Q C7~ -o U a U U C7U'' ~~j ~ ~ ~. = U
0 o U ~ o C'C' ~ o ~ d (~ ~ U o Q ' U ~-o U '~ C~ C~' d U Q U ~ U ~ U ~ U ~ = C9 ~ ~ ~ ~
U ~ V U a o o o o 0 o U V o U U o U U ~ ~ a ~ o U
U _ ~ ,~U U U U U U U
U ~ U ~ U ~ U ej ~ ~ ~ U ~ ~ U
U o (~V ~ o ~ a U C~
0 ~ U'~Q ~ Q C7~~ U U o U U ~ a U U o o U (~ U (9 U (~ U (~ j a U U U U o U o C~
V V C7 " ~ V U ~ ~ C~ C7 C7 ~ ~ o ~ ~ ~ ~ U C~ ~
o o Q ~ V U ~ ~ Q C7 ~ C9 C7C~ C~C9 > ~ o a ~ V o U V C~ U C9 o U ~ a 0 o U > > U U ~ o U C~N C~~ U'~ U O C'JUU' U o U'V ~ U C9 C~ ~ U
~ U ~ ~ ~ U ~ ~ ' U U ~ ~ U U
a a ~ ~ a o U U
~n~ u~U v~~ u~U U N ~ u~U ~nC7 ena ~ U ~' U U ~
~ U U o U c~
~ o a ~ > o > c~ ' > a U
> U C~
C~ IU- U o U
O ~ o U a o a U
U
U ~ ~
U a ~
~n a ~
cn ~
~n U - U a U a U ~ U~ U - U ~ U ~ Ua ~ U~ Ua o o N M N M N M N M N N M N M N M M ( ~tn CO
M r tn In r r ~t d'r ~htt r n O O n M O (OV' M ctM M
n 'cY d' d' m n u m m m wn co co~ eoco coo n n n n ~ r n n N N N N N N N N N N N N N N N 'd' N N N N
N ~t N N
O N M d' ~ CO n 00 W O
M M M M M M M M ~f7 ~ CO
N N N N N N N N M M M
<Y d' d w t d' ~t ~h ~t d' dw t r M
O
~' ~t m N °~ N O N °~ N O N O N O
d; N d; M V M d: N wt M N r-M d' I~ N M o0 N ~t t~. OD ~ CV
N I~ M 00 N 00 M Iv d' (O O 'd' i i ~ ~' -f~ + i i i ~ i i Q
a~ m Q 1~ Q ~ h Q U
o ~' ~° U U
I- ~ f- ~ o ~ ~, -~o d ~ o U
a ~ ~ C7 ~ H ~ ° o !N o ° ~ I-U N U U ~ U
U V a Q a N o ~ ~ ~ ~ ~ o ~ U
°' o o C~ o ~ Q o o ~ ° o Q
o Q U ~ U o U (9 U o U U U
C~ U U~ o ~ ~ ~ ~ ~ o ? ~ CU7 ~ ? o o U ~ o ~ U ~ ~ o ~ U'° = o ~ C~ ~ ~ ~ h Q
U U ~ U a ~ ~ ~- ~, ~ ~ Q ~ ~ V Q ~ ° o -o ~n C~~o~~oo~ ~ C~°~~C~ ~~°~U~U
o U o ° U U U o ~ U o d o U C~ U 1-C7 ~ C~ C='~ C7 C7 U Q C7 ~ ~ (~9 > > ~ ~ ~ o ~ U
~ U ~ U ~ ~ _ ~ ~ ~ o ~ _ ~ ~ ~ Q
U (U9 U ~ U o U U U y..°- U C~ ~ U ~ C9 o U C9 C9 0 ~ U' U ~ V ~ ~ ~ ° ~ ° ~ ~ ~ ~ U C7 o Q U °' Q C7 U C9 ~ '~ C~ ~ ~ U ~ o ~ U ~ ° C~
> > ~ ~ U' Q U' ~ ~ V o o U o Q o ~ o C7 j ~ U o ~ ~ U ~ ~ o ~ ~ C9 C~ Q o o U o o a U UU' U U Q a ~ a a a Q
o ~ U C=7 Q C~7 U =U' U U Q U ~ o o U o o ~
Q U U > > > > > > > > > U d o ~ o ~ o ~ o j ~ Q o o ~' ~ ~ N ~ o o ~ o ~ o ~ ~ ~ u. Q j ~ o o ~ ~ U
C7 ~ C~ ~ C~ ~ C~ ~ U ~ ~ >
C~ C7 U C9 U ~ U d ~n U ~n d ~n U N U >
. I- I- F- I-- I- ~ ~ E- N E- ~ ~ ~ ~ ~ ~- E--p ~ -o ~ -p m -p ~ -0 1- o -a ~ w ° a m ~ ~ w -o s ~n ~ N ~ ~n ~ v~ ~ e~ -o C~ u~ ~ u~ C~ ~n ~ v~ ~ v~ C~ ~n U~U~U~U'~oU~Q'~aQ~Q~Q-~o~aQ~Q~
I' d' tn M d' N LO t~ eY cD M O d' tn 'V' In d' ~ d' ltd d' In d' In M 'd' M d' M d' M st M d' O I~ ~- ~h d' 'd' ~t ~ N I~ O O
N N N N N N N N N N ~ ~ N N N N N N N N N N N N
r- N M 'd' ~ CO 07 O ~ N M
(O CO (° CO CO M M ~1' 'd' 'd' d' M M M M M N N N N N N
d' dwt d"d' ~t vt ~Y 'd' V' d~
N
O O
r O LL
V' O
r M M M M M M M M M M M M M M M M
O ~° ~ O ~ O 00 O 00 O Ci7 O N O d0 O 00 O Op N °~ N °~ ~ °~ ~ °~ O ~ O ~ O ~ O ~ O ~ O d) r N r N r N r N N r N r N r N r d: O N O M M d' 'd; M 'd' d: M M ~Y N N M r N
I~~ d' ~ CO N tf~ CO O N ~ CO ~ d' r 00 r d' c- OO
d' N O O 07 M O d' O d' O M ~t O 00 M ~Y 00 00 h M O N O M M Qa M M M W M M M N N M O ~ O
O M O O O O O O M O O O O O O O O O O O
t i i i ~ i y- .f.
t O O N
N
NfUn~'aNNm~u~ o I- ~ d ~ I- ~ ~ ~ a U
O ~ N ~ O
tn f/~ M fO O fly E- ~ ~ U ~ U ~, ° O ~ O
o U~UrJUUr°UUr°U(U~~'ti U
~ o C7 ~ o C~ ~j o o C~ o o ~j U ~ v o U a v I- V ~ U ~ V ~ U ~ ~ U FN- ~ yUn C~ ~ U ~ ~ o °' 'o C9 o u.
C~7 Q H U'o ~ o ~ U'o 0 0 ~ U o Q ~ U U Q
a a a a ~' Q a a a U ~ ~, U ~ ~, U
~U' U ~U' ~ o ~U~ o~ U ~~Q o ~~CU.7 0~
U U
~ U ~' U ~ _ ~ a° ~ a° ~ = U o C9 ~ U U U V E.-o ~ a ~ o ~ C9 Q ~ ~ ~ Q ,~ U
U C9 ~ C~ U ~ ~ ~ o ° o ~ ~ ~ a UU' ~ ° C=7 ~ U
o C~ ~ = a C9 ~ ~ V a ~ a U ~ ~ ~ o ~o ~ ~ o ~ C7 Q
CU.7 ~ V o o g V ~ o o ~ U ~ C~7 > > > Q
U C~ U o U ~ a a a ~ a a ~ U
c~ a ~ a ~ ~ ~ ? ~ Q o ~ ~ ~ o ~ ~ a d ~, ~ ~ U o 0 o U ~ o C~ Q
oQU~~Ca.7U= ° oU o °=(=9 ~UQ=U' aUUUC9 Q ~ U ~ ~ ~ U ~ U ~ ~ ~ o > > ~ _ ~ a = C7 > > _ ? ~ V o ~ ~ ~ ~ ~ ~ ~ a Q
V jUUUUa NQUQ ~aCa.7U~UC~.7U~UUC~
U ~ ~, ~ ~, ~ ~, ~ ~, ~ a a a c~ a a a c~
a -~o a v ~ -o ~ a ~ -a ~ 'o ~ a ~ ~ ~ -o ~ 'o ~ -o ~ -o dW n dWCW~ dWfl t~ c0 I~ c0 f~ cfl [~. c0 1~ t0 t~ CO h CO I~ ~h t~ M o co o ~ r ~r d' ~ ~r r n ~ o o t~ M o co r ao N N N N ~ VO' N N N N N N N N N N N N N N N N
d~wd 'd d~wd ~ t~ ~ t~ j ~ t Wd ~~~~dN'dN'dN' m O
'_ '- N d' r O W W O O O O O d) O O d)m O O 07 M O M m M
(O CO(O GO(O(O(O (DCO CO(~ O CO COCO(O r M r-N m ~-CO
t-~ ~ ~ T LO N lf7N LIB
N
o O o O o 0 0 o O O O O o O O o M o M o M
N N N N N N N N N N N N N N N N ~- N ~-N o t-N
M M dw t M ~h'd'M ~t M N N d' N ~ M wtM ~ M
LO
Oi P'7ch h.O)I~c'MM In tf7u- ~ tf~~ .rh o0 d'(VN a0 O)M O ~ O M O o0 ti'O f~N N O N a0 tf7O (Ot0 o0 0oeo oao00~~ oon con r'i. r r~n r~ o~o o~OD
~ 0 0 0 0 ~ 0 0 0 ~ ~ 0 0 0 0 0 0 ~ (O
n a~
m ~o ~u ~a a a ~ ~ '~' + + +
0 0 0 0 '~' +
z Z z Z
d ~ ~ d ~" r=nIN ~ f' t~ ~ f' H- a ~ a ~ ~ h ? '~o ~ U uaU N ~ can N ~ ~ ~ U'~
~ H d C~
o O N O N a a N N O
~ v ~ ~ N ? a ~ ~ _ a ~ ~, N
U ~ C7~U ~ V O
Q ~ ~ d ~ d > U ~ U a 0 ~ Q ~ ~ 0 0 o 0 ~ ~ U U a ~ ~ ~ C~~ C7~U
= ~ o ~ ~ ~ v~ ~ N o ~ a U CJ U U > > C? ~
C9 0 U ~ ~ U ~ o o o Q C7 0 ~ _ ~, ~ -~o ~ ~j Cd ~ Q U~~ U'o o Q o a > C9~ U' 0 0 ~ U a U ~ a U ~ ~ ~ ~ a ~
o o ~ ~ ~ ~ ~ ~ ~ ~ C~ o 0 U
a c~ ~ a o c~ o a o ~ a ~ a ~ o o o U a U ~ U ~ U a U ~ ~ ~ V eJ~ U ~ C~U U U U
U ~ ~ ~ U ~ ~ a U C~ ~ ~ a U =C9 0 0 0 o ~ o o ~ o u.~ a a o 0 U o o > > ~ ~ > > > ~ a U a c~~ c~~ c~~ c~a ~ ~ Q a ~-~ a U c~ a c~a 0 Q c?~ c~a ~ o 0 0 0 0 ~ o ~ U ~ ~ ~ ~?~
0 ~ ~ o ~ ~ o V ~ U ~ U ~ U C~= ~ C7 U o o U
U U U U U U U U ~ ~ V ~ ~ Q V Q U ~ ~ U ~ U U
V Q ~ Q V ~ U ~ Q ~ U ~ Q = = V o o ~ a ~
U ~ o o U o o d ~ ~ ~ C~7~ (~Q Q ~U'~ C7U'oU
U o U ~ ,~o ~.
0 0 ~ ~2,~ ~3, ~ o a V a o U V U C7 U ~ ~ ~ C~a o ~ o ~ ~ V ~ ~ a U a ~ U o o ~ ~3,o ~ a O O = O O N O O CR O O C~U C~= a ~ InO O ~
~ a ~ a ~ a U ~ o ~ U ~ 0 ~ ~ (~9~ C~cUnC~a Q ~ a N ' ~ a v~a a ~ a a a ~ a ~' ~ tnU cn~
~ ~ Q ~ ~ ~ ~ ~ Q ~ ~ ~ Q ~ V -~oU ~ ~ ~ v v~ f...o H ~nH o E._.o ~-y - o ~ ~n~.U H ~n ~ o H C9 ~ 'o= ~ ~ 'o~ 'o~ -a~ ~o~ -o~ a U ~oU -aU a 0 o U' C~
~
o ~3, =
O
~U' ~
cn U
c'an ~n H
U
'o 00 0~oo a~aoa>ao o~eo o~ao o>ao o~eoo~~ a~0 0 0 <- .-~r ~ .-rr~t t~ n.o o r M o coco ~ N cv~nio.-m ~n ~ m m N Wn ~ co com cococoo mn u mnu N
N N N N N N N N N N N N N N N d' d'N N N N w m ~n N
N
N N N N N N N N N N N
~t d' d~ d' ~Y V' d' d' d w d' d' M
O ~
O IL
d' 0.' M m M M O M OM 07 N N N N N CON 00N
r OpO ~- 00~ 00<- 00 00 a0 M M M M c~7Mo0 M M M
Lt7a0tO ~ OD~ a0LO o0 N CV CV COCV COCV (OCV
a0 O eD o0 O M Oo0 O (O c0 O O)O O O 07(O
N o0 ~- N ~ Nr- N O O N N r-N r-O
O > O7 O) ~- N N N
N
ch 'd~M M M N~ N 'd' rt ~ M d' M d' MN
d' M M v-CV d'CV O COCV c0O CV ~ ~ ~ c0d) CVt~ a~M
DO CV c0 O
O ~ 00 n M 00 nn n n 00 n (Oe~ tnN ~V
00 0~n co aon nco n LIa CD e~ 000o aoao 0oN
n o0 0o n oo 00 ao n M O O O O M MM ~ O O O O O O O OO
O O O M
m H + -i' F- E-H
,~ ~ a a ~ N ~ N ~ O ~ O
O o p N
U V ~ ~ o ~
U ~ N ~d U o U m ~ o U -a U ~ ~ ~ ~; V o U ~ ~ ? ' ~ U U ~ d ~ ~
> ~ cn o ~ -~a ~ ~ ~ N ~ U CJ ' Uo ~ Q ~ ~ ~ ~ ~ ~ V ~ ~ ~ a ~'U U ~, ~ ~ U o o U U
o ~ a o ~nQ ~ ~, Q U a U o o U ~ ~ > > o ~ ~ ~ Q
~ C9~ ~ > > CU.7U'oC~ ~ ~ Uo v ~ ~ 1- ~ UU
Cj V ~ ~ v C~.7 U d ~ ~ c~a ~ ~
~ ~ a o ~~ 0 ~ U ~ U Q o > ~ U U~ ~ V 0 o ~ U ~ ~ C7 U U o a U > C7 o o C~
a _ = U a~ U Q U a U o C~~ U_ ~ ~ Q = C7 ~Q Q Q U ~ C9~
U o > U U ~ ~ ~ ~, o o U ~ ~o > o ~ ~ a ~ ~C7 o o U Q o C7 Ua U Ca7U o C~U'oU ~ U ~ o ~
> ~ V ~ Q~ U Q CU9C~9 o ~ a a a ~ d o u.~ a U a a ~ o (~o oU
o ~ ~ U o U~ U ~ ~ c~ ~ o (jU C9 a U aU a ~ = ~ U U ~ U C~
U o ~ C9~ C9~ U U = U ~ a ~ o a ~n C9U o U o Uo U ~ U Q U ~, U ~n U ~
U N U ~ C7U C7~ C9a ~, d ~ u~(9 cn(9 U~, cn t- U ~--~n i-U i-U U ~ o o I-~n I-~n 1-~ U ~ ~ c'onU ~ a -~o~ o (~ N ~ N ~ ~
o ~ o ~n H o H~n H U ~.~ 7 ~n ~ o ~.o ~o U -aC~ U ~oU -oU -oC~ ~oU C~ C~ ~oC~ -oC~ ~oU
Q Q
~ > ~ U
(j C~ a U
o o U a d ~ ~ I-~ ~ U' U U ~ N
a ~ o ~n ~ o ~ C~
C7 o U ~a o ~ o U C~ ~
U ~ a U ~ o ~n U ~n ~- U U
a (9 o o cn H ~ ~n U U I-~o ~ ~
~n N
o o F- ~
(~ C9 N a cn ~.
C~
-a O ~ O O ~ O ~O (O d'N N N M N M N MN
c- M M M
~ N OD ~- ~ c0 d n (O (ON ~ N u7tn N a0 00 o0 N tn ~c'7tn~ CO CO~ c0CO COO t-tn 47 tn tOIn tntn O(O
tn ~ tn c0 CV N NN N N N NN N ~J'~tNN NN N N N N N NNN
Lf7 CO n CO O) O r- N M d' In co co co co co n n n n n n CV N N N N N N N N N N
~1' ~t ~t d' 'V' dw t d w d' d' d' cn-~t O
N o0 N N n n n r n n n r n r n r M M M M M n (° n O n O Is M n M n M n O n CV CO CV t0 ch Oi M o) ch of ch of O? O) ch o) P') of M 07 O o7 O o7 O O O d) O o7 O W O O O °) O o) O 07 N r N r N r N N N ~- N r N r N N
'd'ONO MMd'MMMd'MMMNrMONO
Is a0 M d' (O CO O O c0 O O c0 a0 CV ~F 'd' a0 CV d' N
N o) d' 00 n M O ~ n LC~ W M N O ct O N 00 ~t i0 ~ co n co o0 0o co 0o m ao ao ao co eo n n oo co n co O O M O M O O M M O M O M O O M O O O O
y- -1- -I- -1- + ~ y- -j -t- i--I- -i- + -F -I- i- i-m m F-a H- ~ m ~ ~ ~ ~, ~ I-- F-~Uu7 ~ o ~ o ~tUnh H
o ~~ c~n~ c~n~ ~~'a -o U Cd ~ 0 0 0 0 ~ ~ o ~ ~ o =
a ~ a c~ a c~ a ~ Q a a c~
U
a ~. U ~ U ~ U ~ U ~ o ~ a o U C9 ~ ~ ~ ~ U ~ U ~ ~ ~ o ~ V a ~ U o o ~ o o U o ~ ~ j o U -~o V V ~ ~ ~ ~ ~ ~ ~ U Ca7~ ~ ~ C~ ~ C9 ~ ~ v ~
a o o ~ ~ o ~ ~ ° a ~ a U ~ U
a ~ a a Q ~ a a a a a ~ o ° U a ~ -~o ~ o o ~ ~ o ~ ~ o o V ~ ? o ~ U U
U ~ U C7 ~ o o C7 0 0 > > = U o ~ U Q a U U (~ U ~ U ~ U ~ U ~ U a U ~ U a V > > U U
d Q ~ ~ j ~ o ~ ~ o ~ ~ o ~ Q
0 0 ~ U ~ a o ° a ° o a o ~ a ~ o U a U U > > U'~ C7 C9 C~ C7 C~ C~ U'~ ~ = U o ~ Q C~ Q
C~ ~ a U ~ ~ ~ U ' C9 ~ ~ ~ U ~ U ~ ~ ~ >
CO a o ° ~ ~ o ~ ~ ° ° a ° a ° ~ o ~.
j U
a > > U' o o ~ o o U' V U ~ Ur U U ~ U
> > > Q Ur U U C9 U U' U C9 U C9 ~ ~J a ~rJ ~ a a a Q e~
Q C~ U = = a ~ ~ U ~ ~ ~ U ~ ° U ~ ~ o C9 C7 C7 U U
U a U o o ~ '3, o '2~ ~ ° V d ~ d V U ~ U a ° V ~ = U C9 U ~ o p U ~ o N ~ a U U U ~ ~ ~ Q ~ ~ ~ Q N Q Q U Q Q Q U Q ~ CU'J
U-~o~~ ~~Q c'~n ~c~°n ~~Q ~ f~Q ~
o ~ v~ ~. a ~-. ~n f- o H ~n H o H o ~. ~n ~ o ~ ~n H U E-C9 ~o C~ -o ~ ~o ~ -o ~ -a ~ -o ~ -0 7 ~o ~ -o ~ -o ~ -o a ~o N M N M lf> N d' tn 'cf' tn rt ~ d' Lf~ ~t to d' ~ 'd' M 'd' ~ CO M
N d' r n N O N N ~ tt~ N tf) tn N 00 N r OD d' r n N m In CD CO (o O O ~ tn ~I7 tp ~ ~ tn ~ tf) t° c0 c0 ~c7 CO t0 c0 O O
N N N N d' d' N N N N N N N N N N N N N N N N ~t ~t (O n 00 m O N M 'd' In n n n n ao ao 00 0o ao 00 ~ ~ ~ ~ ~ v r M M
d' Q.' V' ~- I' f~r- t~ f~<- I~ t~ a0 N a0N OO
CO ~c0 N CO 1~(O I~CO h c0 !~c0 f~(OI~ N d'N V'N
N
d' Qi c~?Oi C~~ c'~~ M O) M ~ M Q) chd)ch CO CV(O(V(~
O mO ~ O O O O)O O O O)O m O O) O O O O CV
N c-N r N r'N N ~ N N a-N s- N N <-O
d) N
d: Md' c'~d~ M ~t M ~t M M N d' ~ M O ~Y M rtM ~t O MM h O7 !~M M I~ M ~ O)Iw .~.Lf7O T CO1pO M
m N O) N r M 07O O M ~pO d' <Y N ~ O O
co mo~ ooao eoo~ ooco r~n r~eo ~ph c m m aoo~~
O
co o>
+ + +
+ + ~ ~ ~ ~ + + + +
+ + +
d d d tan ~ ~ 0 0 a N~"'N v ~ ~ >
tin~"' cantin can ~,E.-.u~~
UflyN ~ U t/~O ~ ~ ~ N N m tQn o ~ c-n~ ~ U U I- ~ I- a ~ ~ ~ ~
U~ U canU ~ U ~ ~ ~ a ~ U'N~~ C7tl~
c~ ~ c~c~ ~ ~ ~ o Q C~a~
c~o o c~ o o c~a ~ a cnQ a ~ Q ~ a ~ ~
C~ UU U CJ U U U ~ o ~ V ~ V (~C~
U h U ~ H ~ _ ~
U ~_~ ~ U ~ ~ ~'~ ~ o a U U o ~ c~
o o Q U a C~ 0(_9Q C7 Q C9 ~ U C~,CU.7 COU o o ' ~ V
0 ~ o ~ o ~ ~ C7 ~ ~ U C7 o ~ o ~ U ~jo C7 U CHo o 0 Q ~ ~ ~ U Q ~ U ~ U H U ~ ~ V > U
0 ~ ~ o ~ Q o C~ ' ~, C~~
> ~ ~ ~ ~ o ~ ~-~ o o ~ ~ o > o = o ~ _o d o = o U _o(j U ~ o o ~
Q a C~~ ? Q =
0 o Q o o o a V Q V o j Q a ~ ~ (_) U > > o o ~ o ~ ~ . ~ o o o Q ~ a > > d a ~d~ ~ ~ c~j o o a o o o c~ ~ c~~' o U Q U ~ o ~ ~ ~' U c~~ a o o U Q U Q U ~, U ~ ~ '~Q ~ V C7U ~ U ~ ~
C~ ~ ~ = C7 ~ U ~ a U ~ o > > > ~ ~ ~ V U
~ ~ C~'~ U U C~ " U C~ U > > U ~ o o O~ (9= (~j (~o > C~ Q o Q C7U U U Q U ~ U
> > _~- Q Q ~ ~ c~c~~
U' ~ d U NU o U o U ~ o o CU7~ > ~ > ~ '3,~
~ ~ ~ ~ ~ U C9 N U o o m ~cn ~ cn ~ tn ~ U ~ U ~ ~ Q U'~, U tnU c~
U N ' ~ U ~ U ~ o ~ U o ~
U can~ canU can~ can~ canU can~ tanU canU -~oU can~ cana a ~a ~ a ~ ~ ~ a ~ a ~ a ~ a o U
~
~
U
~
o Q
U
~
c~
'2~
U
v~
U
U
can Cp htD h (O f~.CO h (D I~(O I~t0 t~COI~ N O a0 Q)a007N
N N~ tf7N ~ ~n N a0 00~ r-00 it I~ r _o0N N u7u7O) N NN N N N N N N N N N N N N N d"d'N N N N N
~
N
N
m ~ ~ ~ m N wN N N N N N N N N N
d t d' V' 'd' ~t ~t d' d' ~t ~t O
~'M
V
O
N Nt0 N o0 N N N N N cr d' d w t d' d' N d~N d'N ~YN ~tN d' c0 ~ c0 ~ c0 ~ co CO ~co N
c0 NCO cVc0 N CO cVc0 cV t~ '-' '-' N O)N O N O)N O N O) O) d' Md' M N r 'd'O N O ~i'M d' d'd' d'd' d' MN
M N
t~ a00OM7~ ~O t0~ ~ O M ~ ~ O tnc0 tOO CV Mc0 ao aon e0n N I~ r.t~ n oo ~ ~ ~ oo ~ r ~ ~M
oM0 c00 ~ aN0 d d ~ oh o I-- H' ~ ~ h IN o ~ ~ ~ ~
~ ~ N N ~ a ~ ~ ~ O ~
Qo C~a ~ a a ~ ~ ~ a ~ a c~
~ ~ ~ U U'NU C~U C7o U j Q o~ C=.7cn ~ ~ ~ o Q U ~ V ~
U ~ U ~ U ~ o o ~ U o U ~0 0 o U ~ U ~ U ~ U Q UIw ~ i- ~ o ~ o C7 ~ oN
o v~ ~ ~ Q Q O =
U oU v I- o v ~ U o V U~
U C9 ~- o U d ~ ~ C~a o U~ o ~, I- U o ~ o ~ U o C=.7~ Cu U o U U U UI-' o~ ~ ' ~ ~ H UU ~ U ~ U ~ ~ U
C9~ ~ ' ~ o ~, ~ o,o U ~a j jo o ~ o C9 C~ ~ ~ o o ~ ~ U
U ~ o U Q o U ~C9 = C7 ~ C~ = ~ ~U
o = U ~ o ~ U ~ ~ o ~ ~ o ~ Q U ~
U U ~ Q U ~ Q C=9Q C~ U o 0 0 ~ ~ ~0 o C9 ~ o Q ~ ~ Q j ~ ~ U 0 Uo o = > o j j UU'U U ~ ~ o ~ o Q ~U
~ U ~ C~U ~ a U ~
o U ~ U ~ U U ~ U ~V ~ U Q V Q U d oU
U~ o ~ o ~ ~ ~ U =~ ~ ~ ~ ~ d U C7 U ~ _ _ ~ CU7C~~ Q o o ~ o U o =U'~
Q o ~ Q Q ,~o Q C~U C7U COU C~U U
~ C~U U o ~ U U ~ V ~~ ~ _ ~ ~ N o ~ (~oU
~ ~ = V U U ? V Q~ C~o ~ ~ ~ ~
U Uo o Q C9~ ~ U U'U ~ U U ~ ~ ~C9 ~U U CO U ej U ~ U Ud ~ U N d ~ C~ CJ ~0 a~ -~oU ~ ~ a U a = 1=-o -~ov ~ ~ ~ ~ v a C~ m~ ~nU cn~ v~U m U aU ~n~ m U u~~ ~ ~n~
~U'o-~oU'~~ U'o~ C7 a Q aQ ~ Q -~oQ -~ao ~ ~C9 oC9 a o0 ~
~ C~
o o ~, j ~
U
o~ ~n U Q-~o ~
~
o U
~
U
~
~
~
~
m ~-~o 00 O)00 W Op O 00 O OD O N MO O O O O rO
r r ~ NOO OD~--r 00 ti' I~(O COM M CO (OM (O(O O) ON
IIIt0tf7InCO (OIn CO(O (OM MIn Intn Lf7LO InM LO t0N
N NN N N N N N N N ~t ~YN N N N N N In N NCO
In CO
N N
N N
1~ a~ a~ O N M d' ~ c0 I~
O 07 ~ O o O O o 0 o O
N N N M M M M M M M M
d' d' d. '~' d' ~' '~' ' O
M M
N M
r IL
~t O
d' ~ ~t~ T ~ N ~ N r N
CO CO O ~ m ~ ~ O r- O ~ ~ ~ ~ ~ ~ r h ~ 1~~ CVCOCV (OCV CV (OCV CDN COCV (OCVCO (V
O r.O N O N O CO N O N O N O N O N O N
~- N N N N N N N N N N N N N N N N
O
N
N
d' s-N t0CO~ I~~ ~ ( d' 0pM Lf7ct M M M LO
!~
CV LO00tn ~ 1'M u-~ ch f~O7 LO~..1n~ cYjn:
00 00W [ w - 00M O O M OpN W 00LIaN ~ 00O O
t~ I~CO1~ O ~tO ~ O O 'd'07 ~ OOM O N o0N O
O M O O ~ N ~ ~ tn ~ ~ O ~ O r O n O N
~
~
+ f + +
y . -~- i ~ ~ ~ -!. -I- f -1- -h -1--f-a a C'J
d O
U
a ~ ~ ~ ~ 0 0 N fOM !O ~ fO fO ~ p H
~ c?~ a N ~ ~? U
U ~ Q a U ~ U U'oa U ~ ~ a ~ U
d a 0 o ~ o ~ o U o U ~j= = d CO C? C~ ~ ~ Q ~ ~
CU7 > ~ Q ~ ~ V Q ~ ~ 0 UQ
~ o C~ ~ d U o ~ j ~ 'o U cUn~a o ~ ~ V ~ _ ~ ~ ~ U ~ ~ ~ 0 N C9U o a ~ o U j o j a C~
Q o ~ ~ 0 o ~ ~ o ~ C~~ o U CU.7 o C7 ~ U a V U Q V UU'~ U ~ ~ a ~ C9 U'~~ U ~ V C~ ~ a ~ a a a U a U =
Q CU9U Q U ~ U ~ o U o U ~ = o ~ ~ UQ' Q
a > ~ U ~ ~ ~ ~ ~ Q U Q ~ Q V Q a U ~ o o ~ U m >
U U UU'a ~ U'~~~ C9 ~ o U'o~ ~ _ ~ ~ ~ U ~ U = UU'o ~ C7U_ o Q ~ ~ C9 ~ Q a Q a a ~ a ~ U a = ~ Q a ~ ? U U a U U U U Ca? a C~~ ~ o ~ ~ 0 ~ ~ ~ ~ o ~ V Q U
~ Q ~ o C~~ 0 0 ~ C9~ d ~ _ ~ ~ ~ ~ Q o U C~v U U ~ ~ ~ aU o ~ o ~ o o a o ~ U U~
U a U ~ ~ ~ ~ C7~ a ~ Q ~ Q ~ a ~ a a a ~a ~ C~ ~ o V ~,~ U o ~ Urd d ~ ~ C7 o o CU.7 U U ~ ~ o a ~ ~ ~ g o ~ o ~ o C~,(~ ~o ~ a U ~ ~ U ~ U U o U C9U ~ U ~ a ~Q
U ~ ~ ~ N N ~ cn u~Q U Q U ~ ~ ~,U'~ C9 'o E.-.Q U U ~ ~ ~ ~ ~ ~ U = U ~ U ~ U ~ a ~U
N U ~ N fnO O o O tnfO fpN tntO fnUJN U ~fO
a 'oC~ C9C9GOC9 U C.~7C9 U'C9 C9C~C9C9 C~C9C~C9 'oC~
V
o o Q
Q
~
~
>
>
Q
~
~
~, U
o a ~
~, m U
~
tn O
U
O ~ O r-CO t~N M N M N N M N M N M N M N M !~ Lf5st M
Q) InN 00N N M M CD (flM CO M O D)N N 07 InN 00s- 00M
CO
N N N N ~ 'dN N N N N N N N N N N N N N N d' V'N
N
CO O O ~ N M d' Ln CO t~ M
O O r ~ T r' M M M M M M M M M M M
d' d' d' d' Wit'~i' Wit' d' V' V d' M
O U- O Il O ~
~r O d. U
M N N _Nc0N o0N_ 00N_ o0_N o0 M N M ~ ~ O
~ ~
~ ~
COCV CV CV(ON COCV CON CDN CO CY7~ M ~ (~'!~ ch ~ (O CO N r N h N .rrN r N ~ M M M
N N N r-N N ~ N
r ~
N ~ In ~ N '~tM M O d: O M O~ d- N d' M d; M d~
N N
O
COLn O tO(Of~.N C~ OOh ~ cM ~ O) M c7 h O h ch N O O w-N O 'd'c0 O O h 00 LO M h ~ N M 0047 h r' d O h OD h CO COM LO00 LO O h O h O h O
O ~l' O h O O M O COO O M O CO M O M O f0O
O h h h h O
O
-E
i ~ -~- -/- .~- -~. + i O
U
d t- ~ t- o I- ~' ~'I-N ~ ~ ~ ~ ~ tl~~ o N 0 ~ 'O O p '~ON (O'O
U a ~ f ~ '~~,y~ u~
N 'O o U ~ a n o ~ ~ o N m ~ ~ ~ a ~ a U o u~ C9~ _ ~ ~ ~ C~~ C~
~ ~ d ~ ~ d 0 o U ~j ~ C70 0 ~ 0 C9 ~ a ~ ~ U ~ U ~ U ~
U U
d ~
~ C~
o o d ~ C o F- ~ ~ ~ ~ V ~ ~ ~ U
~ o o 7 ~ -o o ~ ~ -o U ~ U ~ o o U o 0 o ~ d U ~ ~ ~ U ~ ~ ~ C7 C~ U C7 U C~ U C7 U C7 0 ~ U a a = U ~ -a C~ 0 U'U (~ U Q U C~ U Q U ~ ~ ~ ~ C~ ~ aU'~~ C~
U ~ > ~ _ ~ a ~ o o j V o U ~
U ~ o ~ ~ o ~ V > ~ ~ ~ U ~ o = o 0 U C7U ~ U > = > V ~ U ~-~ Q ~ ~ ~ Q C9 o ~ a ~ a ~ Ca.7~ a a ~ ~ U U ~ U
a CJ~ Q a ~ a ~ Q ~ ~ ~ Q ~ a ~ Q ~ a ' C7U o ~ U ~ a o a ~ja U U U o o ~ V o U C7 C9U ~ ~ ~ Q U Q U' U U U Q ~ Q U Q U Q U Q
C7 ~ ' o o a ~ ~ ~ a U
U'o> > o U U ~ ~ U ~ ~ ~ C~
~ o o U a ~ ~ a Q o Q = U C~ ~ o ~ C~ ~ o ~ ao ~ a ~ ~ ~ ~ ~ ~ > > ~-a ~ c~ a c~ ~ c~ a c~
~ Q ~ a c~ ~ a ~ c~~
C9U ~ ~ ~ ~ ~ U a ' ~ ~ ~ ~ ~,o ~ a C~~, ~ o ? Q ~ o ~ > U'oa U 0 C~ N U o a ~ ~ o ~ ~ U cn U ,n (~,n 0 ~ a c~o ~ ~ ~ o ~ a cna ~ ~ ~n~ ~nU cn~ N U ~ v a ~ ~ ~ a a ~ o C9~ C7 ~ C9 ~ C~ ~ U'Na U a U a U a U a U
a d ~
0 v ~
~ U
U ~
~
~ U
~n ~ N
a t d' d' ~Ytf)~t ~ d' Lnd' Ind' lf~O)h CO h (O h (O h CO
M In ~ (OM O O)N GVd) Li7N 00~-00M M CO (OM COCO
t0CO M ~ t0~ ~ CD ffl~ COCO O l0 U7~ ~ ~ ~ tC~
N (O (O N N N N N CVN N N N d'd'N N N N N N N
O t0 M ~
NN NN
N N N N N N N N N N
M M M M M M M M M M M
d' d. ~' ~' ~' .d. ~' ~' d. d' d' O
M
r h h r h r h d' N d' N 'd'N 'd'N '~hN 'ui'N 'd' opt0 00t 00Ino0W OD t0 N OD N o0 N OD N CO N o0 N o0 pjch ~ cYj~ ch~ M ~ (V ~ CV ~ CV LOCV tnCV ~ N tf~CV
pp Op o0 Opr 00 N OON ODN CON 00N o0N 00N
r N r N r N N N N N r N N N N
N <1'M N r d'O N O In N l N l N L N d' M M r d' ~
M M I~t~ r M M h lf7 (O O tc)CD InO - f0 O)N f~CO
h f c0O rt( N O O d' ~ C ( d' COc LnI t st ~tLf7 h 00 h e0 ( ODO CO O 07 h O h 07 h O h.OD h N ( 00 M O O M O O O O O M O O O O O O O O o M O o .E. + .E. ~ y .
+ -H -f O ~ d 'HO~ 'HOv)'HON a N O
O
U ~ ~ '~~ '~~ o v~ V o ~ v~ ~ o U
c~~- o ~- a ~ N j 'a3,~ ~ j o c~ ~ Q
N ~ ~ ~ ~ ~ Iu ~ a ~ a ~ ~ a ~
c~
a ~ e~~ c~~ c~o c~~ ~ U
= o ~ ~ a ~ o o ~ C7~ ~ U ~ ~ ~ U ~
U ~ ~ U 0 0 ~ ' ~ ~ o o U o 0 ~ o ~ ,- UU U U U U U U U
U ~ I- ~ ~ a ~ ~ ~ a ~ o a CJ o U ~-~ C7 o ~ o Q o 0 o C7 ~ >a ~ c~ c~ c~ ~
U U (~U ~ U a ~ ~ Q U U ~,U U ~ a a ~ U a a U ~~ ~ d U s U ~ ~ a C~
U U a _ ~ U ~ U ~ U ~ a o a U U
Q U ~ Q ? ~ U ~ ~ ~ ~ ~ ~ U ~ a U' a > > C9~_> > U U> > > > > > ~ = U o o a U
o a U a a ~ ~,a ~ a ~,~ ~ U
o V U ~ U U U ~ Q C70 0 ~ ~ o ~ ~ o = o U ~ =
Q Q U a U U U V j ~ ~ a a ~ ~ ~ o ~ ' ' (9 U ~ U ~ ~ ~ U C7 N ~ U 0 Q U' ~ U >o o ~ u~o ~ ~ U'~o ~ Q
o o C7 ~ Q U Q > UC~ U o ~ C9 ~ U ~ U 0 U ~ o ~ ~n~ o ~ o ~ ~no a C9 0 > > ~ _ ~ ~ ~ ~ V~ Q u~ a ~, a ~n a ~ U ~ U ~
"~ON 'O7 '0N 'O~ 'O ~-- ~ ~ "~O '~pN a N '~p~ '~pN
a ~ ~ ~ a ~ U~ -c~ ~ ~ ~,c~
.-.O E-fn f.-O f--.N E-- f-U) ~ O ~.-fp E-O ~ O ~--M ~-O
v U -oU 'oU -oU ~ ~ 'o~ -a~ 'a~ -o~ ~a~ -o~ -o~
h co h c h c h co h M co o~ao ~ ao o~m ~ eo o~~ a~o0 M ) a)N N ) ~ N d0N mM M ( C M (OCO M ) W N N ) N N N N N N N N N N N N N
N N N N N N d' d'N N N
O r N M ~h L CO h d0 Q) o M M M M M M M M M M V
M M M M M M M M M M M
'd' d' V' V' rt d' d' d' ~i' d' ~i' O
N M
M
O ~-d' ~' N d' N
N a0 N
~ CV tf~
N
O
U
~-v.. ...r O
~ M ~ ~ N
t0 cV CO in t~°O CMO CEO O
M
-H + ~S''.. ~ '~~
-1~ -I- W- -f' ~ -F -f--F -I- -F 'LJ C//~ ~--~
N
~N
O
+~' ~ ~
U o 0 a~
d Q.
a~ m U U U U ~ .~ ~ 4~
m ~ ~ m d ~ b 0 o U ~ ~ o C9 j C~ ~° C9 ~ C~ j fn m tO N v O
O ~ ~ ° ~ U
U ° U ~ U ° U
o°~~o~ °'° o .~~.Ua~
Ca,7 ~ U'o ~ C~7 ~ C9 ~ C~7 U a~ ..~
o~o~o~=rOn ~ ~ ~~ ~~lc~
~. I'~ U'~ C9 U' U j N ? ~ N °~ p tn U .n ~ ~ C7 ~ Cd m ~ ~ U ~ ~ ..fl b Ca.7 ~ Q U'° ~ o Q o o C~ O U ~ ~ U ~ U ø, V U ~ U ~ U ~ U ~ ~ ~ C7 ~ = C9 f ~ V U ~ U V ~ m ° ~ ~, u. = O c~ .-~
C9 ~ > j U U a U o ~ U ° O ~ C~ U
U ~ U ~ a ? ~ = a = ~ ? V ~ o O ~' C9 0 ~ ~=.
U O ~ o o ~ ~ o ~ ~ o o ~j U ~ o C~ U ~ , v o Ca.7 ~ ~ ~ Q V Q ~j ~ ej Q V Q Q Q V Q ~ Q ~ o ~~ ~
C9 ~' ~ O ~ o ~ U a o a V ~ Q ° Q ~ Q U Q C~ ~ ~ .r;
o ~ °' v ~ o ~ in '~ N
Q V ~ U j ~ ~ C~ ~° UU'~ ~ C~ ~ o 0 0 ~ o ~ o V -r", ~ cd U ~ > > ~ > > U ~ U o U U ~ a~ Wn ~ Q ~ ° ° ~ ~ ° ~ ~ o ~ ~ ~ U ~ Q C~, C~ ~ c o > > o ~ o ~ ~ o ~ Q ~ ~ ~ at O Q U ~ U Q U ~ U ° U o ~ o ~ o U U Q ~ ~ d ~ ~ Q ~, ~ ~Q Q > > >Q > >Q j ..d ..~ b Q o o ~ o o Q a o ~ o ~ U
U ~ U > > U U C~ U U'~ U O U ~ U ~ U ~ Q ~ U .fit U
Q ° Q U ~ ~ ~ Q ~ Q ~ ~ ~ Q ~ a ~ U s Q N
cOnH~Q~cQn oo~ ooN~ o~~ ~'~.c~n 'o ~ 'o C~ ~ C9 ~ C9 ~ C~ 7 O ~ C~ ~ O ~ C~ ~ C9 a) 00 °) a0 07 c0 ~t n ~ CO u) n d' !° M d' N ~ n d' (O c tn N eD M M <- N ~- N ~ N .~,., ~ b c° co c° M M n n n n n n n ~ i n i ~ ~ ~ r~ rN. .
N N N ~t d' N N N N N N N N N N N N N N N N
,~ 't~ c~
O.
.s', ~ (n CO n d0 p~ O N M ~., m MO~°7c'~MMM MM
d' ~h ~f' <1' d' '~i' 'cY d' ~ N U
i ,~ N O
~ p N
° ~ ~1 ~l ~t M
v o°
O
c a V M CO N V O (O 00 1~ M
'U
CD N CO W d) O 07 O
<- ~- N N N .~, N
W .o U
~
~ a0 t~ eh M o0 c0 ~ O O
N -~-N M c~ N ch M M M O N
~
O
~
M ~, U
.L"
~ O
~ N
.~
cd U
d~ d0' d~ ~ (~O L~ ~ cMO CO
' ' ~ ~ .
'a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
O
M
vi cn ~
~"
, a, n t t t t t t ~, t U ''-' t~ t t t U
c ~"'..y..,~
.
,.., t t t t t _ W U
CC
,3 .fl N
m ou. ~a ~u. ~u ~ ~~ ~a ~~ ~~ ~ c~
~~ a a~ ~~ e~N a~ Q~ ~~
~
w U ~, C7 CPU ~~ C7 ~ C~
V
~ ~c~ ~~ ~a ~~ ~ ~ ,_~
~. U Q? ~a = ~ ~
V ~U ~ ~
o Q ( ~
~ ~
U C~ U U U U Q Q a~
U ~ ~ g~ E
~ ~= -~
v~
~
oQ Q V U ~ Q U ~ ~ ~
~ C7 ' y ~
U U ~ = U Q Q U o cd o o o o o U o a ~a V ~ ~ ~ U UC UC a~
o C7 Q Q? o CP C7U H H j ~o a ~ ~ .
o ~
Q (j ~o UU o ~o o Uo .
+
o ~ o~ oa o~ o~ o~ ~ ~ ' ~ ~ " " ~
c c .
Q? U~ (9V ~'? ~,~ Q? ('jU
~ ~ ~ U ~
~
Q V ~ V _ o ' V ~
V ~ C ~ ( ~ ~
( o ~ ~ ' 9 .7 ~ ~ .~.~
~ ~ '~ ~ ~ U .n ~ o o r:, U ~ Q Q U U (~ o a~ p., ce o ~~ ~~ ~~ ~ o o o ' ~., ~U ~- dU dU d U
' a ~ ~ ~ ~ ~U ~ ~ ~~ ~ ~, ~. ~ ~ ~ U ~ ~ Q ~U ~ o Q U oU U ~ ? ~ . ~
.b ~ ~ ~ V " ~ ~ ~ ~ ,.fl ~ ~ ~ ~ ~ ~ 0 U > > U ~Q ~~ C~V ~, ~ M ~
o o ~
~ ~Q o ~
oU ~ oC7 oQ ~ ~ oU > ~ aj v~
U ~ a o o = C~ o ~ C~ ~ cd b U o U U o ~ ~ ~
Q o o > ~ ~ o ~
oQ V
~ +~ v a ~C7 ~U ~ ~C7 ~ ~C~ ~~ ~ ~ -d p ~ ~ j ' ~u ~ c ~ ~ ~ ( a ~
~ n~ ~ ~ a ~ ~ ~
~ ~ U
N
~ u. u. _ 0 U U a u. ,.
. ' a U C7U
~ U U
>C U U ~ Q U U = -~ o ,?; ~ o p., fa ~ o o p, .~
N M d~ m c ~ 0o a~ 0 ~ ~
~ N M ~ m co r~ eo oa o> o> o~ oo aoo 00 00 00 00 ~ ~y.
d 00 00 00 00 00 00 00 00 00 ,~
M M M M M M M M M
M M M M M M M c''7M
, U ~
O
b #
O .~
M ~ ~ ~ ~ ~ ue ~
V 'd' d V
' ' ' ' ' ~t d V rY d 'd' rt ~1' ~h y.U
. "
, O
~
i N cci '.~
N
U -N
PH y O ~ cd d. - N ~
~
o o O~ o o o O D
~ 3 t t v W ar ar d W o , ~ rya ~ ~
12~
O ~ ~ ~ Wi n '~' N O O O p O O O O N O N M
~'" 0000 r 00O O O O O pppj 00r W ~- r r r r ~ p~ 00N
N
~, m c~ m I~ d: d;o0 ~ M O ~ Ln Lf~~ ch U
~ ~
a w ~ ~ ~ ~ ~ ~ ~ , tnM M 1~. Is 00M cd U
cMOM ~ C~O O ~ ~ N
O
M M M ~ ~ ~
V
U ~ ~ o .'"
Vd ~
H
a~
Q Q o m ~ ,-~ U
o ~ a~
o I-~
~ F a -d m ~ ~ U'~ g = C .~
O U' ~ ~ O ~ C1 ~ N O ~
' o U ~ c o ~ s-.
U ~ ~ ~ R s p o ~
~ - o ti~ ~ o ~ ~ m s v "
o ~ ~
' V ~ ~ V ~ ~ o j ~ o ~ +~
, - p ~j V ~ ~ N v, p Q o U > > > Q ~ ~ U h U ,~ ~
c = ...
h o V N a ~ o a cn-a U ~" ~
C7 ~ U
F ~ ~ o I .
- p U ~ ? U ~ o ~ ~ V
~
a Q ~ U ~ ~ .
~, m Q Q a ~ o U a ~ o a a a ~ ~,~ ca0 U U ~ Q a ~ ~ Q U o Q o j ~ ~ Q Q Q ~ V
V V V ~ Q u.
a U U U Q a U
o U U ~ U U Q 'n U U o ~ ~ a ~ U U U'~
U ~ ~ U U C9%
U o o ~ ~ ~ U ~ t o U > > U ~ ~ C~
- U Q Q o ~
a a o U
~C .7 C ~ ~ o C '?
o ~ U C9U j ~ V U Q Q ~ U U
c ~ , ~ o ~ o a a a o ~ U ~ ~ ~ U ~ C~ ~ ~ ~ M
v U o o U o 0 0 0 0 0 o U U ~ ~
s s ~ns s s s s s s v~u~ v~O
v~ C9U V COV t~U t~V U f~ C~C7 N
'b O N N N N N O ~ N d N N N ~ U
O
~ ~
C C C C C C C C C C C C C N
N N N N N N N ~ N O d N N
N ~ N ~ N N ~ ~ N N N N N ~
(0'.' ~
V
~ "
M t~ M O O r Ln r (p N In ~-N CO~
' ' ' ' ' (O~ ~ ~ rl d M d M d CO O O
C/~ M CO O COW O O O O O O N t~ CON
N N N N ~t N d' d'd wtN N N N t ~
.N N
ctd' d'd'O O M M r r . d'd d'~
'd' ' ~
r r r e-CO COM M (O (O~ r _ r ' ~ U
~
y O O O O O O O O O O O O O O v~ ,~
, d'1' V ~l'd' ' . ' ' ' ' ' d' t' ' .
7.. c ~ ~ d d d d ~I ~ N ~
~ O
N O O O O N c~
m Pr ce N M M h M O d' tn LIj p7 ~ d d V N N N N
O f~ h h h h h. h O
G~
tn M P? h Is e0 M
(MO M due' (~O O
h ~ M h M
C~
U
a ''~' + ~ ~ + + + + +
W
c~ c~a c> R s s ~ ~ ~ .~ .~c v~ ~ o V O C) ~ ~ U
-E--o Q o V C7 V h U ~
H o d '~ aU' '~ ~° V U
U o N -~o U Q U o can Q U Q ~~~ ~ ~(~ NU
a ~ a ~ a ~ ~ ~ ~ ~ v Q
p ~ ~j o CJ Q U U I- o I- ~ Q
U v U = a Q U Q IN Q F- N,L Q c9 0 o a U a U U U o U U' Q o U o U H °~ Q Q U
U U ~ U ~ U ~ U Q ~ ~ U ~ U H ~ C7 ~ CQ'~
U m U U U o ~ U j U ~ ~ C7 j ~ U > > U Q U Q U CU °' Q
> > ~ > > o ~ ~ > > ~ U
~oU~Ca'J?Ua' ? o=U ~ o~ oC~.7v c~s~aUUUUUU~~UU'UC~
a ~ N a ~ a Q a a v c~a'~~~~~~~~~c~a~~ c?~v j s° ~ s ~ ~ ~ t U cUn N cUn N v v~ .°c U r°
r/~ U' U ~ U ~ C7 ~ C) ~ U' ~ C~ = C7 ~ U ~ C?
a>
a~ a~ as N a~ a~ N a>
m M r h O O' O ~ O l(7 tn r r N r N CO O~ Vl O
d CO o0 O N O o0 O CO CO 'd' O 00 O N r m d' ~f' V1 V~ M M CO r CO r (p r ~ ~ h M h M r (p ~
N N N' d' N ~Y N d' N N N N N N ~Y N N N N
N ~'~~~~ VM' .N~.dNwd ~M
d' d' i d- ~t d~
~~O,O~,O~,OO00O
~Y d- d' d' d-d' d' ai b -a o U
N
U ;=
b O
N
N
N
O U
.r, N N t=n N
Z
O ~ ~ r~
U m ~ U (J
U ~ ~ ~ U
N
a O
U' U U m U' ~
O
O
U
U ~ a U' O N
N
Q
a ~ ~ ~ ~ ~ a ~ ~ ~
~ a ~ c ~ ~ ~ c v a a o ~
w ~ ~
U ~ U U U ~ U ~ U
U ~ U o U ;:n s ~ O ~ U ~ ~ t ~ U
U C7 C~ ~ c~ ...
U U
~ U U s., pp U
N
H U U ~ p N O
~
cncn ~ m cnen v,rn v~rn ~ .,~
t i t d ~ U
ttm v~ a cn a v~ c ~n N O
V1 .
~N
~ 00 V101 l~O l~~ I~
~
d'V1 d'd' d'd' N ~n N ~n N ~ 2t U
0101 O~01 0101 M O\ M Q1 M v ~
N N N N N N 'd'N d'N ~tN
b ~
.
O .~
~N O
~Ou ~ o v 1 ~
-b '~ U
I~ O
U
w U
O
a o U ~ Cd ~
U~
a~
U
O :.~
."
t .f ,' .
~' t ~
+, .
~
O ..
w SS
,~ ~4 C
X
'C
O
Q
Z yn ~~, h a~ N
U
-p ~ V7 N
O U
a~
a Mb a ~~y ~ U
a Q. ~
~ .
b ~
m v> j ~ 4, ~~"
O .
"' ~ O
cd ~G
N
N d' ~', 'd O
111 ~ .
~ U
M ~
"
d ~ ~
. -!
, U O
''d O
d.
C
A
~I' V7 .N N N
O
p O cV
~ O
v W ''>.~
y0y~' c~C
U
d; e' C/~
v ~ N N
~
U
~ ~ ~ o b w + 'n d ~ N
w + j i.Jl1 ~
vi ..
b ~
a ~
c '+
, U
b O ~"
7-a ..~
O m o a~
p o ~
U ._ C9 ~ a>
b U ~
,-.
o O
O
c~3 m ~ Q
a~ F, '~ ~ O
7 U ~
cd a>
v~
U
c~C
U ' '' ' ~ ~ b S.~
Q
m U (~ O
w ~
~ ~ U ~
!~"
C
~ a a .o M
ea ~ a~ c o s...
N tn c-O ~ U
~ CO O
~
~l-N M , b c~i O
'' , CO U
U
A
bA
O
N
~
C
dN.
LLJ U v o a a a a a m a a ~ ~ a c~ e~ c~
N O M ~ ~ ~ ~
V
' IJ E M ~ ' ~
~
- C M 'V't~DLn ct~ m ~ LL (.b O M ~
M
N
N M ~ ~ ~ M
N O N C CO CO
O
t~ O d' ~ tOLf7t1~ h. tI~lI~
CO N M OD V O CO I~ CO (O M N
~
h O O h N O~ N N h O N
U M m rr cfl ~ co co r~.~ co co ~ r~
=
c > > c ~ j U U U
n ~ >
F H H > C9 C~a=nU' U CH ~
-a a a a v ~ U C9 U'U U' U' Q
Q a a a a a a a c~ c~ c~c~ e~ c~ ~ c~ a a a Q ~ ~ a ~ ~ a a a ~
~o o v a U >
~ -~oC'J> > C~ ~ > > > C9 C~ C~
Q U U Q U U Q ~ U U U
U U = U V U C~
a a a U U U U ~
C9 C7 C~ C~ C7 C7 a ~ ~.a N N N U N N U N N N N N N
a a a c~ a a c~ a a a e~ a a a V d' ~ CO CO I~ N CO d' lI~M N M d' N
M ~ ~ N N N
' N
M M M ~ M M M M M M M M M M
a a a Q a a a Q Q Q Q a a a o s O N
'.d O
N
a ~, x o .~ W
~ E1 .
o ~
~
v ~
w v7 ~ a~ r-' o ~r - ~ ~ 'd ~c N
E
C
w ~ ~ ~ b d' c W ' V O % j a .~ ~ ~ U ~
d.
a~ ~
~ '~
+,.~.. N
N
~ .~
~
.
'd 4a cOn O
~ ~ ~ J
> ~ > ~ ~ ~ N C
U U
v c>> ~, a u, a~ ~
~ c~~ ~ o ~ ~ ~
c~~
c~ a c~
-d H M
-O ,~ ~ N
i V V V U , , o O O
c fn N 'C
~ ~
n"~
a N ~'L!
Ox.~,ON
~X ~"~
y ~"' a O .-~~ ~ ~r ~ .~"~, 00 h ~fih O '~
C ' -~r ~ ~ ~ ~
r M ~ r p .
. ,-, . ~
60 ~ ~ ~ ~
~
O
~j J J J ~ o ~ ~ ~ O ~
J W ~ N
~
~' a a a a c a G
~-~
~.'y N
d~cNNNU
-U
7. ~ ~- ~ W ..
o 7.-n _~
O N
X
' ' ~
C
' "
, (~
,-tr E-.Ti ~, .fir C j, ~ ~~, E"~ H h (~
O E"~ ~
E -= -Y r.
r, r.
o m n mvy~U ~1 ~'' ~ C7 a a a NNNN
aaaa c) 07 N Is ~ N N c0 O O
o N M M M M M M
C ~ ' U
f" U
~
by ~. p7 ct W m O O ~ 07 .
r O ~ ~ ~ ~ ~ ~
l 'd't t t t u7 fi '~
~
N
M
, x U
'b ~
o I~ M M N 'd' COO W t~N I~ O
O - N
N
.-~ o e0 M N CD O N N M I~ N
' '~ N I OD r t N lttt~O
L ; r ~ CO fD n W ~ 7 I~ N ~
~ [' O O O O -~
O O
'.f, y M M r r r N r N r r L r U
W
~
M
e~ i - N
~
'd m ~ ~ cfl~ ~ ~
~ O ~ O 'd ' M~ O O _ ~ O N ~ M O v ~
C' V p O N O tn ~ N N~ O O M
M M N ~
O M N
z aMONc00r - c00c - Nc00~ NN b NN r N r N
N s.
O b N
O
.O
~
O O ~ M ~ V M V V ~
W
In CO t0 lOr Lnr 4r .S''.~
,~,~' O N M ~ I~~. O)O O O)O O b0 '- O O
iS I~ r CO CflN ~ CON I~ p N ~ r N N N
~' N
N
~
~' ~
N
W
~
-a [-~
'~
Pi e .
x w ~, ~ ~ ~
~, ~'' ~
"
c9 ~ w a Ts m ~ ~ t- ~
o o a~
o - !L ~ ~ Q a o Q
a Y ~
~
y ~
., o Y o a .
,-.
cV ~ N I-CO(~ N N N ~ ~ y.., ~ V Z Z Z tea-'S~
N N N N N ~ U~ bp .
Z Z > Z Z Z ~ ~ a-iyM'r z Z Z z z - V U o.ti.a a a a ~ ~ a ~ = x x ~ o.b a o _ ~
"' j > > ~ U Q
> > ~ a > > ~ c~= a a a ~
~
~nC7 C7 V U U U U , ~
o ~
O
b ~
~
~
~
, Q '~
a U > > > o 'Ua U U U ~
~
~ ~
a a ~ ,, ~
M
b U' U' U ~ V >
o a a ~ ~ ~ COU ' COC7 CO ''~
~C
~' .~
,~
'~tw a ~ ~ a~
' ~ Q Q Q Q = = .7 ~
C M
.~v.-~~
~' Q Q Q ~ N = U U U ~~
O
~
M
~
a a U U U U = Z C9C9 U' .
~ in cd v ' a > ' Z U U U ~
w oo ~
~"
~' O
~ a a a = c~ a a a a a a U U ~ r ~ Z Y o c r n n n ~
C/sC7 U' U' C~ C~ Z u~N U U U
O
~
ty ~
,-~~, ~
o r ~
~
Oc~
N
~
~
U' ~ o ~ o 0 0 ~, :~
~
N
' ~
~
C C C C C C C O
U U
.C~
-' ~~ U U U U U U U U U
Cc f ~
z ~t ~ d' O r c0f~a0 ~ N M
O O (O H t~ M Opa0 M t~ h r r' r T r ~ r r' ~ r t-' M M M M M N M M N M M ~
~
~
U
U
O
U
b (~
o o H
~
~
~
Z
~ ~r ~r r~ t~ r~ 0 0 0 0 0 0 p o~ o~ cflco cfl o 0 0 0 0 0 o~ o~ ~ ~ ~ 0 0 0 0 0 0 p, U
_ n O
U ~ o o N M M ~ M M M U
a ~ c o n U
~
E'~ , 7-n O
O
a~
U
Mb N ., .C L _C 7 7 7 7 .C ,.C ..CN
d N d ~ UfpUW Ufn~ O O _ U U UO ~ bU
O O O
~ ~~ ~~ ~N L O ~ ~ ON
N N
O N U U O O O O U ~ N
V ~ O O 7 N O O
~ ~ ~ 4=~ ~ ;--.~ ~ ~ ~ a~
m c ~
o D D D D
O
V
'i,' O c d 'd c~ ..~
at O
~.
p H H H H H H H H H H
H ''d'rJ''d~3b 'd b ~d b 'ri~. +~
.
ea b '.d~ ~i ~ ~ 'Hdb ~ ''d ''ci ~.r O
"
b ~
, N
4 C7 U' C7 U'C7 U' C7 C7 C7 O
U U
(7 i7 C7 U U U U U U U U -~ ~ ~C C7 L7C7 L7 C7 C7 C7 C7 H ~
~ ~ ~ ~ r~~c ~c ~ x ~ ~ sc ' ~ ~ ~ ~ ~ ~ ~ ~
' ' b FC U C7 C7 U U C7 ~ C7 t7 C7 a~ p ~ ~ ~ ".~~ ~ FC ~ ~ ~
~C FC FC ~CFC FC ~ ~C FC
.
C7 C7 C7 C7 L7C7 L7 C7 U' U' C7 ~ b U U U U U U U C7 L7 U' ~ ~ U ~ ~ ~ ~ ~ U ~ O
N O
U FC FC ~ FCC FC ~C C C C
D ~ ~ C " ~ ~ " ~ D ~
~ ~ ~
G ~U ~U ~ . F~ U . F ~ F ~a U
U ~U U ~U U 0 U U ~U
U U U U U
~ U U U C U C C C C
7 7 7 7 7 7 7 .7 7 7 U U U U
7 ' 7 y U' 7 ' 7 7 7 7 7 ' C7 C7 U U U U U U U U
H H H H H H H H U U U 'd H H H
U' zf 'd rt3rd~d 'b ''~2i d ~d 'd H H H H H H H H H H H
A ~ ~d b 2S ~J2S ~d ~d b zi ~
c d N O
~k, .
a Qi N N N N N N N N M d~ LO
o I~ eo o~ N M ~t u~ o o o cn v~
r- ~- ~ - - - ~ c- ~ ~ ~ 'b of l0 tW W fmI~ !~ t~.N e0 N
r' t- t- T t-'T T v- O) O) O) N ~
d' ~ ~ O) CY~' '~'V~ T r' T I-I
d' d' ~h d' d'~i'~Y ~Y N N N
N N N N N N N V' rt d' U
+~ N
,-~~
O
A
v v~~ ~ v ,.~
v o ' ~' cc~
V O
U
U
i, V' Wit'd_'d' ~hWit'd' d' d' d' d' L;
Pa T t~ i~ t-'i~ ~ -' ~C
i t r r T
x~
N N ~
r ~" e~C t~ M ~ f~ a0 'a ~ C~O C~O CEO C~O
?~S
b O
U
~i-1 m O O O) O) T
N d I~ t~ co c0 co N
co co co co co O
O
v + + t -F + f -I-N
b O
~J, U
U
~.~'' ~ O
H ~ ~ ~ ~
b U N
U U U' ~ ~
U U w o V N ?N UH ~H H b 0' U
u-U ~
, 4, C9U~ ~~ ~~ m~C Q ~ U
o ~ U ~U ~U ~U
L~ L
= U U U U ~ O
+' p = ~ ? U c ~ U~' U (0 C9 d c~
~ C7 'LC7 mL7 ~'-C7 ~ (7 +' w ~ ~ y 'cU7~~ ~~ U ~ ~
A
- U
~
d U
O
a a~ a~ a~ a~ ~ o M
C/~ C ~ C~ CN CN ~ ~ CS
(9 N N f0 c0 N
N
N
aoN O~N ON ~-N d-O
I~r' I~s- a0~- ODt-'T Op ~ ' ' ' ' ' ' 1 ~r dT ~r ~ T V]
Vj N ~t NV N~t N~Y N ~t U
"C
A dN' dM' V~' ~' '~' .c;
d ch d ' 'd' d' sN.~
d N
U
W dw h d' d' N
N
' .~ ~
'd V
a~
w a~
a ~ ~ a' +~
. U
W O ~
O !~d' u7Ood: i-.
r ~ Ln U
V ~ ~ ~
a r C ( n O O
C~
U~
bn x .., a~
I- o I-~n-0 0 canU
U U
U ~ a cd a a ~b U = _ -U.
N
.
U .
a C9C~
a a o E COU
U
.~ E U
a 'o ~ _ ~ M
y c o b ~a N N N
Q.
~
O
O
p p Q.
C A w-~- ~
'~' y , O O O O
,.L", ~t~Y~t Or ~r o U
O
W
."
cd N O
M d: ''-' U
O
C~
U ~ i ~
a~
bn x H o a ~ o v , C~ U o U U p.
U
Q
CO
U
m N
b 'b ~
U
Q ~
~
w ~ U
DC
~tt m ~ O
cct M
U
e~C O
;
v ~' N
N N
N
p C C O
'~
N
cOEN ~
~".
O
.d cd U
a .~.
' N N
O
F~
t~" d0''~ N
~ ,~', O o I't~ O t~ O) lO o N I~ c0o O I~m O m c0a0 d'O 00OJ N CO tn CD COr In v COCVN OOO CO(~d' O O O M O O O M M O O O O O M N O M M M
Cpr N O O) ~ N lI~M COM M M o CON M d'COr ' N d'd'd M O M of ~ ~ N t~.N O cod N O d' t -d'N t~h ~ _ h. M _ tno0 N r ~ 'V'_ Wit'I~f~t~
a0u7O o N N CO CO 1~!~o I~O ~ f~.COr 1~t~N
p c0c0c0c0 cflGO c0 O c0O O O tf~O c0o c0 c0c0c0 O
w M ChO ~ d' O O ~ d;M N r d;M t(7M d: LnInr LnIn In O In O L(7O M N M O t~COM ~-In ' ' V CC ~.00h 1' Ln N i~ M r (ON N r COd ~t I~I~.
o O N ~ O ~ ~ ~ O r O ~ ~ o N ~
o O O O O O o o O O O O ~ O O O O O O
U ~ts H
~.a a a a ~ a 1-- ~ ~ ~ ~ ~ I- ~ ~ ~-E-~ (ja U
f"'-a~ - ~n u~ I- ~ u~a U ~ 0 0 0 U ~ U N cUn!- ~ N ~ ~ j U Q U U Q U Q
C c n U ~ Q Q U U U ~
p U ~ C9 V a U U COa o ~ o o ~ (~C~C9 U ? U U U = V U = U a ~
Q Q ~ U
Q Q ~ Q ~ ~ V Q U Q U ~ U o U U
U'U' ~ U > > (9a (9> > > > >
~o Q U a a U ~ > V j U U
= ? ~ j U U U U
U C? U a U U U U
U = a ~ U U
Q U j ~ U ~ Q ~ a U ~ >
C U'C ~ ~ _ ~
y > > a = ~ U a ~ a a a a a a a _ a a a U a C9 C9 = U (9 = ~ U U C9 C7COC~
a ~ ~ a =y. U U U U U ~ U U U = U ~ U ~ U U U U U U
v~m m ~n cn v~ U ~ m ~n~n ~n~ m u~vo~n ~nu~m v~ COC9(~C~ CO ~ C9 ~ C9~ U > > > C9C9C9 C9C9CO
N N _C N .C N N
.~ L
N C ~ C N C N ~ N ~ N C N N ~ N N N N d V .~ U ~
fn fn M (0 fn (D fn fn tnInfnfnIn N (nfl!
(9 (0 ~ ~ ~ N
N ~ N 4D .+~d N N N N N N N N N
i ~ ~ ~
C tnC InC In C fn ~ fnC fn ~ fnInInfnfn N fnfn ~ N N . . . .
E CO E E
E
m (0 m N M 'd'CO r N O O O r N M f0(~O N M CtInO
O 07O O 00 00 O O O O O O O O r r N N N O) C/~ N N ' N N r r N N N M N N N N N N N N M M M d N N N N N N N N N N N N N N N N
i I~I~I~I~ ~Y ~t'~Y d' ~Yd'~Y V r o~V~V~V d'V ~Y
O O O O r r ~- r r r r r I(]LL~r r r _ r r r r r T O O O O O O O O M M O O O O O O
(O O N M O
N
aNO~ aoo~m ~ ~
cd ~n N
U
CO M V. O ~ b ~ O
C~OM aN0 V
N
~
"
a 'cYd:M M M M n N dj . . . .
r-O M by ~
N ~
vi O ~
N
'~o E- O
u WO ,r;
N
h N 'o tin ~ O v~
a .~
H ~ ~ U o j ~ ~
P
-oc C7 N Q ~ .
n m v~ ca ~
U p ~ .
U U U U CO
U w C9 U U U m m Y ,~
b ~ U U Q ~ Q
a ~
a aU' ~
U 7 ~. > > > U ~ P.
C :, ~ a U d ~ ~~ "'u.U ~ CO cn a U ~
U ~ d ~ ~ ~ ~s rj Q ,O
U .-n U U ~
U C9 U'U
U a Q Q Q U Q p c~ j a ~ a .~
N ~ N
ca ~ ~ a ~ a ~
~
, o H
0 0 ~ N ~
U ~ ~ ~ ~ U U
7 ~ > > > ~ Q
C U' N ~ N d d N N N N ~ ~ d "
fnf f f f f ~., ~ n n n U n VJ .
~r N N (B ca t0 t0 ~
C
.d ~
0 0 0 O 0 000O O ~
N N N N N N N N U
U U
b U
~ ~
d' d'd' ~t d' O p O bD
;-, , O U
N
rt d'd' d' d' d ' U H
'b ..
E o0 000000000000000 oooooao oo~o O O O N 'd' O d' M d' CO c- O M O ~ d' 1~ I~ N M M C~ O d- fs op f~ N M ~ d' a0 N O) N O M N N CO ~ V ~t -~ 'ct' O) lid O o_O r 'a .~ (0 (w (0 O CMO~ CMO~~M CMOM CMOM~M~fN~.CMOMCMO~CMDMC00~C0~ I-~ ~C~O
r M M d' M ch M '~1' (~ d~ N ~t M d' M d' M d~ M 'd~ M d~ 00 Ln O N r M O
~ O O O N d' O d' d' ~ Cfl N O 'd' O O C4 a0 00 M 'd' d' d' lf~ O r [v LIB I' O
1~ N M LO d- Op 00 O N O M N N CO CO 'd' d' LI~ cf O Ltd O 00 r 00 ~ Cp [w tv ~ CO N 00 N 00 N 00 N 00 M 00 M 00 N 00 N 00 N 00 N ~ d' r 07 V ~ W M W W W O N O W N O W N O ~ O O M W
O
U U !~- ~ u. u. ti ~ ~ j N N N t~ d M ~ O O ~- 7;
N ~ N ~ ~ N N N ~ N ~ ~ N N ~ ~0..
c ~ ~ ~ ~ ~ LL ~ LL ~ ~ L~ ~ ~ ~ ~ c c o OpOOOO XO XOO XOOOO ~ ~ o V r X ~ C~ M if r CO In d- M Lf7 N r N 'd' (Lf (0 ~ N N
N
v'= Cn (n Cn f~ (n tn (n fn f!J fn fn fn fn fn f~ Cn fO -~-~ +W'= Cn Cn o aaa~~a~aXaa~a~aXaoXaXaanX ~ ~ oaa x N N N N r N r r N r r r r r r r r r r r "p ~ ~ r r r M jn N
t *~ UI
M M *u.U' ~ M NM U' 1 ~ M I M N ~ U I = 1 M
U ~~; ~i;~UU~C~-?U*=U' MCP * U? v<''> >U*~~~U-° >>~~? ~ ~"~ i~in Qt->U~Uj ~C9 ~U ~~ ~UC~U~U~M ' i~in ~~ NE-U~U~* QUU ~ I~ U NUUC7 ~ ' *~ I . I-(~ ~Q
U ~~C9UQC9 NU ~ ~. »UU Q
C9U UUQUUC9 ~ ~U ~~ ~~QQ NQC~ ~ ~~U UC9 ~C~~
~ Q U Q U ~ Q C9 > C~ Q ~ ~ N ~ Q ~ Q U ~ a ~
>> QUQ U~QQU~QUC9U~ N~
~U C9UUUQUQU~UQ~~?UQ' UQU' ?> jQU' ? j~ ~V V
QU QU' U(9UUVU~Q~U~QU~~~UC~~QU Q~ ~QCQ.7 ~U Q~Q~Q~~UUU~UU~QUQ~ ca=C?U UU
C9UUUUU ~~CJ~Q~UU(~~(9UC~ c~Q~ QU v N
C9~C9~~~QUQUjQ ~Q(JUUQ~ ~UU' ? CPU ~UC~
~n co Q QQ ~QUQU~ N~QUQ u~Q~Q ~ CjC9 U ~ U U U Q = Q I>_ -a u. N ~- Q ~ N oW Q U ~ U C9 Q~Q~ ~~-° ~Q ~ cV NUj U~U ~V=~ U' Q ~U~ U
a~ QC9 UUUUQUQ~U~U~U> > > as c~c~ c~
cn UU QUQV, tiVr UUQUQUQU tiU tiU ti~jUU ~(~ U' U' a> ~ V~ UQUQ tiQ-vUUU~jU~jU ~U ~U ~QUU UU ~I-U-.°~
c-.~-~ C9~ (~Q~QC~QC7~C7~U~C9~C9~C9~C9coC9(~
C ~ ~ I I I I I I I I I I I I I I I I I I I I I i I I I I I
Q Ln M Lf7 In L(7 In Ln Ln Lf7 Ln Ln lW.f> Lf7 LC> L(~ In L(] Ln L(7 In L(7 L(7 ~ Ln M Ln M L(7 CO I' ''' d' 1' ~ 00 CO O M O cf' r Ln N CO 00 I' W h O r N N M r O 4= O r ~
N N ~ LO tn LSD Ln Lf7 Lf~ CO (O t0 C~ C~ Cfl CO CO (fl CO t0 1~ 1~ IW f7 Ln CO lO ~ 00 d' M
M M ~ L(7 Ln LC7 Ln Ln LO LC) Ln Ltd LO Lf7 Ln In lf7 Lt7 Ln Ln L(7 L(7 L(7 M
M O r ~ Ln (O
Q ~r et ~ d' d' d' d' d' ~r ~r d- ~r ~r d- ~r d' ~r d- ~r ~r d- ~r d' ~r ~r ~r ~r ~ N N 'd' "'' X p~_, p~_, C
N Q ~ ~ D O
d ~ Q d' Q d' O O 07 O O O O O O O O O O O O O 00 L(7 O O In M
I~ ~ fW O 'd' d' O 'd' LO lf7 Ln LO tn O cj- d' r M O O V' O
[~. 00 1' 'L5 r ~ 'D ~ M d' -O d' O 'D O Cfl O 00 N ~ r N O M M M
I~ d' f' .O ~ op CO .O (p lO CO -Q ~ 00 CO .Q CO Lf~ CO I~ (O ~ r- 07 ~ W N CD
(O
co r. c~ !-- ° co c~ f- co N co F- ° co co I-- co ~ co cfl co ° co m cfl e0 ~ co co M O M r O N O r O r O N O M r N r N r M r M M ~(7 M O d' M r r I~ CO I~ N CO O d' LIB d' ~- d' N CO CO d' r d' 1~ 'ct' O d' 00 M N ~ M O r ~
O
I' 00 1' W O N d' N ~t' d' d' M CO d' O 1.n O CO O O N N ~ r N N O M M I~
f~ d' !~ Cfl CO 00 ffl LO CO L(~ ~O I~ LC) 00 CO Lf) CO tf~ Cfl i~ CO 00 r- O
00 Ln O N C~ CO
O ~ ~ ~ O O O ~ O N O O O O O ~ O ~ O O O O O ~ O O O N O O
O O O O
L L ~, L
U U o_.
in in a~ ai ai ~ o' ~: ~ a~ a~ a~
a~~ ~pa.papa ~~~~ ~@~o.''. pp ~ 00 O N N N ~ O ~ ~ ~ ~ N N O N N
LL ~ ~ :~. X LL X LL X LL :p O LL O LL ~ LL X X :~. X X
N N N V ao N oo N ap CV ~ N cV CV _ N N cV M M ~ d' d' ~ (!j Uj 4= fn (~ fn (O ~ (n v'= (n f~ fO ~ (n fn fn tn "_ -~ .~-. .~-. .,.., fn fn n.~,~ oaaaaaa oo_a.a. jdaa. a. o. 0 3 ~ ~ ~a~
X x x X X X X X X X X X X X X X X X X
r N r ~ r r r r N r ~ r r r Ln r N r r r ~ .fl ..Q .Q ..O r r N N N
i~ in U U U
N N N N N
> > U U U
C~ C~ C~ C~ C~
N N N
a a~a Lf7 N ~ N I-, N I-, U M ~ M U ~ tn ~. i ~ f =Q Q =Q ~- ~ U O c~'~ lO , = M M = , Q~ f-U ~aU'' QUQ ~U i-. ~ v ~U U~ o?~'?UQC')~ ~~
V Q t-' ~ ~C9 u. U~ * ~~in Ur inU~ ~? ~U~U* V aU' UU Q U ~ ~U ~UQU ~U~C9 U~ UUU~~= UQ~
UQ UVQV ~V ~~ ~~ ~~ Q~U~ C~ ~ UU= QQ
U UU jQ ~ N~ N3 N QU U~Q ~ U ~UQ ~U ~Q~U ~ UC9 NQ N~., QQ U~ ~~Q~ UQ Q ~C~ ~ Q =Q= U= UU
UUU » ~~~~C~~ >> >UQU C9UCJU UU UC9UU UU U~
~ NQ NQ N QU Q ~Q ~ Q ~Q~ Q= Q=Q~U ~ U~
ti(jU Q~ ~Q ~QC9Q UU U ~C9 ~ U ~(9U UU UUUC~a(~ ~~
N ~ N ~ ~ ~ N ~ N = N
U ~U UQ Q~Q= ~= QU Q U j U O UUU C7~ C9C9C7~ ~
Q U Q (,r = U C~ U U~ U U~ ()r V Vr U Q U Q U Q 7 c~e~~c~~c~~Q ~Q~Q ~Q~~ ~Q ~~~~~Q ~U
U' o '~U QU a~ o= o~ a~ Q ~ o ~ o ~Qt9 C9U C9UC9~ U UU
1-.~I- UH Cj~..cF-.cH QC9 QU~-.~~ L~ ~H =Q »» ~Q UU~--I ~I- QI- cvl-~I-Uf- U~ UI-UI- UI- ~I- C9~ C9=(~UC9~ U
i ~ ~ i ~ i ~ ~ ~ i i i , i i ~ i Y i i ~ i i i ~ ~ i ~ , <'~ i.n t~'~ icy M ~ iY7 lI~ M lC> M ~ M ~ M in M in ch it7 M ~ (~'7 in ic7 in in icy M ~ M
O N N
r O ~- CO M '~ CO f~ LO I~ r I~ O I~ '= CO f~ CO I~ I~ f~ Cfl I~ 00 O '~= O r OD d' d' N N O
d' d' d' N 07 ~ 00 'd' M d' d' d' r 00 o O ~ M ~ M ~ N N M M p ~ r.(~ M d' r N
r 00 (0 O CO O O Ln Cp O CO 07 CO r r L(7 (p p> (p p) (p ~p (fl M M M M M M f~ t~ r r N d' N ~t d' ~ N N d' N ~t N 'd' d' ~ N N ~Y N 'ct N N N d' '~t' ~ d' d' d' d' N N d' d' i i ~ i a a a n. n. a pcc~ ~cro ~c~ Do ~i ~~
Q° Q° a~ Q° Q~ a°
bn M ~ M ao 0 o mn ~ o ~.c> ao ~ o ch CO r d' d' O o0 N O N ~ Cfl f~
-O M N i' ~ -O O r- .O C~ d' -a CO CO LO M .D N
~ CO O O f' ~ f~ ~ _p Ln 00 ~p (fl M O O ~ 1~
.,... CO Cfl CO CO .~. (O CO r.~ (p (fl .,r Cfl f~ Cfl CO .n-. CO O N
U
N O I~ c0 d~ M N ~ N O d~ ~ ~- ~ f~ Is ~ t- r~, f~ ~- Lf> O d' ~ d' 00 ~ ~ N d' O r O CO r- I' O
~ 00 N I' r ~ O) t- O CO d' 1' I' CO Ln M I~ N '~"' ~ .-~~
I~ CO O O f~ t~ 1~ ~ I~ ~ 00 00 CO M O O f0 f' O O O O O O O O O O O O O ~ O O O O
O
b H
N
b0 x C C C
O O O O
U _d 0.. V d d_ _U ~~.' O
'O C C C C M c? 'O C N M 'O C C C C .b ..r:
O 3 O ~ ~ -I- -H O O -IwF O _~ O O 7 O
~.Q.fl~~~N ~ ~'-N ~m.n~~ ~~ O
a0~ ' V, ,~
U
b ~' i~ i~
i~ ~ ? i~? I= U
UUU' in~aU M~ =U~U UU i~i~UU °~
UaU ~ UQ? U? UjUC9 U~ UUU~
~U~~U~ (9U U(~Qa aC~ aUaU
U~UUUa as Q> C9 » »»
UQUUQ(~ (9~ (9aU~ C~a C9 C7C9a aUa~UU ~(~ »>a aU a~aU
UjU~ V~ a~ aU~C~ C9~ C9aUQ
~ C9 (~ C9 U a a C9 U C9 CQ9 C9 U
UUU~~~ aU' V U~' U~Q UU UaUC9 Q aU a~~C~ U~ UC~U~ N m C~ ~ C~ U C~ ~ U ~ C9 ~ U a~
~~~UUU (9a C9~Ua ~U ~»U ~~'~d U~UQ~U Q~ aaa~ U~ UUU~
~C'J~C'~a ~~ ~U=a ~U ~U~U
QUa~UU Q= a>VU as a~aa U~UU~U UU UU a U~ UUU~
C9~UC'7U~ aU aC9UU ~C9 Ua' ~aU''C9 ~ ~ o U a UU'~ U ~ ~ ~ I~ U t~- C9 Q (9 (9 C9 C9 C9 C~ C9 C9 -o ~
in iW .c~ icW .n ih in i~ ip in in in in ip in in ip in ~ .fl s.., ,b a~
3 ~o a-. O o u~
00 N (D t' 00 e- N LW'= CO L(7 d' Cfl (O IW'= 00 O CO M ~ cn ~ ~-~, ~ ~- d' 'ch d' ~ O v- 00 ~ N d' tn Ln 00 00 ~ d' ~ 00 d' vW-a t-a O
N ~ i ~~~~~ ~~~~~~~d a~
d d O_ ~ h Q f~ ~ M N ~ ~
J T J o J p .9 ~ Q.W, a~r a~ a~ ~a~~'~~
OTHER EMBODIMENTS
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.
Claims (20)
1. An isolated iRNA agent, comprising a sense sequence and an antisense sequence, wherein the sense and the antisense sequences form an RNA duplex, and wherein the antisense sequence comprises a nucleotide sequence sufficiently complementary to a target sequence of about 19 to 23 nucleotides of a VEGF
nucleotide sequence and wherein said target sequence differs by no more than 1, 2, or 3 nucleotides from a sequence selected from the group consisting of SEQ ID NOs:1-401.
nucleotide sequence and wherein said target sequence differs by no more than 1, 2, or 3 nucleotides from a sequence selected from the group consisting of SEQ ID NOs:1-401.
2. The iRNA agent of claim 1, wherein the sense sequence comprises a sequence that differs by no more than 1, 2, or 3 nucleotides from a sequence selected from the group consisting of SEQ ID NOs:2-401.
3. The iRNA agent of claim 1, wherein the sense sequence comprises a sequence that differs by no more than 1, 2, or 3 nucleotides from a sequence selected from the group consisting of SEQ ID NO:456, SEQ ID NO:546, SEQ ID NO:548, SEQ ID
NO:550, SEQ ID NO:552, SEQ ID NO:590, SEQ ID NO:592, SEQ ID NO:594, SEQ ID
NO:596, SEQ ID NO:608, SEQ ID NO:610, SEQ ID NO:612, SEQ ID NO:614, SEQ ID
NO:634, SEQ ID NO:636, SEQ ID NO:638, SEQ ID NO:640, SEQ ID NO:646, SEQ ID
NO: 648, and SEQ ID NO:650.
NO:550, SEQ ID NO:552, SEQ ID NO:590, SEQ ID NO:592, SEQ ID NO:594, SEQ ID
NO:596, SEQ ID NO:608, SEQ ID NO:610, SEQ ID NO:612, SEQ ID NO:614, SEQ ID
NO:634, SEQ ID NO:636, SEQ ID NO:638, SEQ ID NO:640, SEQ ID NO:646, SEQ ID
NO: 648, and SEQ ID NO:650.
4. The sense sequence of claim 3, wherein the sequence differs by no more than 1, 2, or 3 nucleotides from SEQ ID NO:608.
5. The iRNA agent of claim 1, wherein the antisense sequence comprises a sequence that differs by no more than 1, 2, or 3 nucleotides from a sequence selected from the group consisting of SEQ ID NO:457, SEQ ID NO:547, SEQ ID NO:549, SEQ
ID NO:551, SEQ ID NO:553, SEQ ID NO:591, SEQ ID NO:593, SEQ ID NO:595, SEQ
ID NO:597, SEQ ID NO:609, SEQ ID NO:611, SEQ ID NO:613, SEQ ID NO:615, SEQ
ID NO:635, SEQ ID NO:637, SEQ ID NO:639, SEQ ID NO:641, SEQ ID NO:647, SEQ
ID NO: 649, and SEQ ID NO:651.
ID NO:551, SEQ ID NO:553, SEQ ID NO:591, SEQ ID NO:593, SEQ ID NO:595, SEQ
ID NO:597, SEQ ID NO:609, SEQ ID NO:611, SEQ ID NO:613, SEQ ID NO:615, SEQ
ID NO:635, SEQ ID NO:637, SEQ ID NO:639, SEQ ID NO:641, SEQ ID NO:647, SEQ
ID NO: 649, and SEQ ID NO:651.
6. The antisense sequence of claim 5, wherein the sequence differs by no more than 1, 2, or 3 nucleotides from SEQ ID NO:609.
7. The iRNA agent of claim 1, wherein the iRNA agent further comprises a non-nucleotide moiety.
8. The iRNA of claim 7, wherein the sense and antisense sequences are stabilized against nucleolytic degradation.
9. The iRNA agent of claim 1, further comprising one 3'-overhang wherein said 3'-overhang comprises from 1 to 6 nucleotides.
10. The iRNA of claim 9, further comprising a second 3'-overhang wherein said second 3'-overhang comprises from 1 to 6 nucleotides.
11. The iRNA agent of claim 1, further comprising a phosphorothioate at the first internucleotide linkage at the 5' end of the antisense and sense sequences.
12. The iRNA agent of claim 1, further comprising a phosphorothioate at the first internucleotide linkage at the 3' end of the antisense and sense sequences.
13. The iRNA agent of claim 1, further comprising a phosphorothioate at the first internucleotide linkage at the 5' end of the antisense and sense sequences, and a phosphorothioate at the first internucleotide linkage at the 3' end of the antisense and sense sequences.
14. The iRNA agent of claim 1, further comprising a 2'-modified nucleotide.
15. The iRNA agent of claim 14, wherein the 2'-modified nucleotide comprises a modification selected from the group consisting of: 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), and 2'-O-N-methylacetamido (2'-O-NMA).
16. A method of reducing the amount of VEGF RNA in a cell of a subject, comprising contacting the cell with an iRNA agent of any one of the claims 1-15.
17. A method of making an iRNA agent of any of claims 1-15, the method comprising the synthesis of the iRNA agent, wherein the sense and antisense strands comprise at least one modification that stabilizes the iRNA agent against nucleolytic degradation.
18. A pharmaceutical composition comprising an iRNA agent of claim 1 and a pharmaceutically acceptable carrier.
19. A method of inhibiting VEGF expression comprising administering an effective amount of an iRNA agent of claim 1.
20. A method of treating a human diagnosed as having or at risk for having adult macular degeneration (AMD), comprising administering to a subject in need of such treatment a therapeutically effective amount of an iRNA agent of claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA2815554A CA2815554A1 (en) | 2004-03-12 | 2005-03-11 | Irna agents targeting vegf |
Applications Claiming Priority (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US55262004P | 2004-03-12 | 2004-03-12 | |
US60/552,620 | 2004-03-12 | ||
US55982404P | 2004-04-05 | 2004-04-05 | |
US60/559,824 | 2004-04-05 | ||
US64719105P | 2005-01-25 | 2005-01-25 | |
US60/647,191 | 2005-01-25 | ||
PCT/US2005/008182 WO2005089224A2 (en) | 2004-03-12 | 2005-03-11 | iRNA AGENTS TARGETING VEGF |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA2815554A Division CA2815554A1 (en) | 2004-03-12 | 2005-03-11 | Irna agents targeting vegf |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2559161A1 true CA2559161A1 (en) | 2005-09-29 |
CA2559161C CA2559161C (en) | 2013-06-11 |
Family
ID=34994206
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA2559161A Expired - Fee Related CA2559161C (en) | 2004-03-12 | 2005-03-11 | Irna agents targeting vegf |
Country Status (8)
Country | Link |
---|---|
US (5) | US7947659B2 (en) |
EP (4) | EP2365077B1 (en) |
JP (4) | JP4937899B2 (en) |
AU (2) | AU2005222902B2 (en) |
CA (1) | CA2559161C (en) |
ES (1) | ES2423060T3 (en) |
HK (1) | HK1160484A1 (en) |
WO (1) | WO2005089224A2 (en) |
Families Citing this family (111)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2832154B1 (en) | 2001-11-09 | 2007-03-16 | Centre Nat Rech Scient | OLIGONUCLEOTIDES INHIBITORS AND THEIR USE FOR SPECIFICALLY REPRESSING A GENE |
WO2003087367A2 (en) * | 2002-04-18 | 2003-10-23 | Lynkeus Biotech Gmbh | Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye |
US7148342B2 (en) | 2002-07-24 | 2006-12-12 | The Trustees Of The University Of Pennyslvania | Compositions and methods for sirna inhibition of angiogenesis |
AU2003260370B2 (en) | 2002-08-05 | 2008-05-22 | Silence Therapeutics Gmbh | Further novel forms of interfering RNA molecules |
US9719094B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting SEC61G |
US7951935B2 (en) | 2002-11-14 | 2011-05-31 | Dharmacon, Inc. | siRNA targeting v-myc myelocytomatosis viral oncogene homolog (MYC) |
US7691998B2 (en) | 2002-11-14 | 2010-04-06 | Dharmacon, Inc. | siRNA targeting nucleoporin 62kDa (Nup62) |
US10011836B2 (en) | 2002-11-14 | 2018-07-03 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9719092B2 (en) | 2002-11-14 | 2017-08-01 | Thermo Fisher Scientific Inc. | RNAi targeting CNTD2 |
WO2006006948A2 (en) | 2002-11-14 | 2006-01-19 | Dharmacon, Inc. | METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY |
US7612196B2 (en) | 2002-11-14 | 2009-11-03 | Dharmacon, Inc. | siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B) |
US7592442B2 (en) | 2002-11-14 | 2009-09-22 | Dharmacon, Inc. | siRNA targeting ribonucleotide reductase M2 polypeptide (RRM2 or RNR-R2) |
US9879266B2 (en) | 2002-11-14 | 2018-01-30 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US7781575B2 (en) | 2002-11-14 | 2010-08-24 | Dharmacon, Inc. | siRNA targeting tumor protein 53 (p53) |
US7977471B2 (en) | 2002-11-14 | 2011-07-12 | Dharmacon, Inc. | siRNA targeting TNFα |
US7635770B2 (en) | 2002-11-14 | 2009-12-22 | Dharmacon, Inc. | siRNA targeting protein kinase N-3 (PKN-3) |
US9839649B2 (en) | 2002-11-14 | 2017-12-12 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
US9228186B2 (en) | 2002-11-14 | 2016-01-05 | Thermo Fisher Scientific Inc. | Methods and compositions for selecting siRNA of improved functionality |
JP2006507841A (en) | 2002-11-14 | 2006-03-09 | ダーマコン, インコーポレイテッド | Functional and ultrafunctional siRNA |
US8198427B1 (en) | 2002-11-14 | 2012-06-12 | Dharmacon, Inc. | SiRNA targeting catenin, beta-1 (CTNNB1) |
US9771586B2 (en) | 2002-11-14 | 2017-09-26 | Thermo Fisher Scientific Inc. | RNAi targeting ZNF205 |
US7619081B2 (en) | 2002-11-14 | 2009-11-17 | Dharmacon, Inc. | siRNA targeting coatomer protein complex, subunit beta 2 (COPB2) |
US20090280567A1 (en) * | 2004-02-06 | 2009-11-12 | Dharmacon, Inc. | Stabilized sirnas as transfection controls and silencing reagents |
AU2005222902B2 (en) | 2004-03-12 | 2010-06-10 | Alnylam Pharmaceuticals, Inc. | iRNA agents targeting VEGF |
KR101147147B1 (en) * | 2004-04-01 | 2012-05-25 | 머크 샤프 앤드 돔 코포레이션 | Modified polynucleotides for reducing off-target effects in rna interference |
US7605250B2 (en) | 2004-05-12 | 2009-10-20 | Dharmacon, Inc. | siRNA targeting cAMP-specific phosphodiesterase 4D |
CN105251024A (en) * | 2004-08-23 | 2016-01-20 | 西伦蒂斯私人股份公司 | Treatment of eye disorders |
US20060223777A1 (en) * | 2005-03-29 | 2006-10-05 | Dharmacon, Inc. | Highly functional short hairpin RNA |
US7893244B2 (en) * | 2005-04-12 | 2011-02-22 | Intradigm Corporation | Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases |
CA2604441A1 (en) * | 2005-04-12 | 2006-10-19 | Intradigm Corporation | Composition and methods of rnai therapeutics for treatment of cancer and other neovascularization diseases |
WO2006124726A2 (en) * | 2005-05-12 | 2006-11-23 | The General Hospital Corporation | Novel biotinylated compositions |
GB0521351D0 (en) * | 2005-10-20 | 2005-11-30 | Genomica Sau | Modulation of TRPV expression levels |
GB0521716D0 (en) * | 2005-10-25 | 2005-11-30 | Genomica Sau | Modulation of 11beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases |
CN101365801B (en) | 2005-10-28 | 2013-03-27 | 阿尔尼拉姆医药品有限公司 | Compositions and methods for inhibiting expression of huntingtin gene |
NZ571568A (en) * | 2006-03-31 | 2010-11-26 | Alnylam Pharmaceuticals Inc | Double-stranded RNA molecule compositions and methods for inhibiting expression of Eg5 gene |
US20090130212A1 (en) * | 2006-05-15 | 2009-05-21 | Physical Pharmaceutica, Llc | Composition and improved method for preparation of small particles |
US8598333B2 (en) * | 2006-05-26 | 2013-12-03 | Alnylam Pharmaceuticals, Inc. | SiRNA silencing of genes expressed in cancer |
ES2390499T3 (en) * | 2006-06-12 | 2012-11-13 | Opko Pharmaceuticals, Llc | Compositions and methods for inhibition of angiogenesis by sirna |
US7872118B2 (en) * | 2006-09-08 | 2011-01-18 | Opko Ophthalmics, Llc | siRNA and methods of manufacture |
US8252755B2 (en) * | 2006-09-22 | 2012-08-28 | Dharmacon, Inc. | Duplex oligonucleotide complexes and methods for gene silencing by RNA interference |
EP2121923A1 (en) * | 2007-03-02 | 2009-11-25 | MDRNA, Inc. | Nucleic acid compounds for inhibiting erbb family gene expression and uses thereof |
WO2008109377A1 (en) * | 2007-03-02 | 2008-09-12 | Mdrna, Inc. | Nucleic acid compounds for inhibiting vegf family gene expression and uses thereof |
US20110046206A1 (en) * | 2007-06-22 | 2011-02-24 | Isis Pharmaceuticals, Inc. | Double strand compositions comprising differentially modified strands for use in gene modulation |
EP2198891A4 (en) * | 2007-09-07 | 2011-12-21 | Univ Tokushima | Method for promoting the expression of p53, and p53 expression promoter for use in the method |
US8188060B2 (en) | 2008-02-11 | 2012-05-29 | Dharmacon, Inc. | Duplex oligonucleotides with enhanced functionality in gene regulation |
CA2716793A1 (en) * | 2008-03-05 | 2009-09-11 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of eg5 and vegf genes |
DE102008014318B4 (en) * | 2008-03-14 | 2021-02-04 | Premark Feg L.L.C. | Conveyor dishwasher and method for operating a conveyor dishwasher |
US20100009451A1 (en) * | 2008-05-30 | 2010-01-14 | Sigma Aldrich Company | Compositions and methods for specifically silencing a target nucleic acid |
SG10201510586PA (en) | 2008-06-30 | 2016-01-28 | Mesoblast Inc | Treatment of Eye Diseases And Excessive Neovascularization Using A Combined Therapy |
WO2010042751A2 (en) * | 2008-10-08 | 2010-04-15 | Chimeros Inc. | Chimeric therapeutics, compositions, and methods for using same |
ES2794401T3 (en) * | 2008-10-15 | 2020-11-18 | Axolabs Gmbh | Oligonucleotide detection method |
SG171952A1 (en) * | 2008-12-04 | 2011-07-28 | Opko Ophthalmics Llc | Compositions and methods for selective inhibition of pro-angiogenic vegf isoforms |
WO2010141511A2 (en) | 2009-06-01 | 2010-12-09 | Halo-Bio Rnai Therapeutics, Inc. | Polynucleotides for multivalent rna interference, compositions and methods of use thereof |
WO2011017548A1 (en) * | 2009-08-05 | 2011-02-10 | Alnylam Pharmaceuticals, Inc. | Lipid formulated compositions and methods for inhibiting expression of eg5 and vegf genes |
CN107519133A (en) | 2009-09-15 | 2017-12-29 | 阿尔尼拉姆医药品有限公司 | The method of the expression of composition and suppression Eg5 and VEGF genes that lipid is prepared |
US20110104154A1 (en) * | 2009-10-30 | 2011-05-05 | Alcon Research, Ltd. | Single nucleotide polymorphisms and genes associated with age-related macular degeneration |
WO2011073521A1 (en) | 2009-12-15 | 2011-06-23 | Petri Salven | Methods for enriching adult-derived endothelial progenitor cells and uses thereof |
US9095504B2 (en) | 2010-03-24 | 2015-08-04 | Rxi Pharmaceuticals Corporation | RNA interference in ocular indications |
RU2615143C2 (en) | 2010-03-24 | 2017-04-04 | Адвирна | Self-delivered rnai compounds of reduced size |
WO2012012750A1 (en) | 2010-07-23 | 2012-01-26 | Trustees Of Boston University | ANTI-DEsupR INHIBITORS AS THERAPEUTICS FOR INHIBITION OF PATHOLOGICAL ANGIOGENESIS AND TUMOR CELL INVASIVENESS AND FOR MOLECULAR IMAGING AND TARGETED DELIVERY |
US9290760B2 (en) * | 2010-09-15 | 2016-03-22 | Alnylam Pharmaceuticals, Inc. | Modified iRNA agents |
WO2012044265A1 (en) * | 2010-09-27 | 2012-04-05 | Sabanci Universitesi | Use of mirnas for the diagnosis, prophylaxis, treatment and follow-up of diseases involving macroautophagy abnormalities |
JP5795072B2 (en) | 2010-10-22 | 2015-10-14 | ソンギュングヮン ユニバーシティ ファウンデーション フォー コーポレート コラボレーション | Nucleic acid molecules that induce RNA interference and uses thereof |
CN103370054A (en) | 2010-11-09 | 2013-10-23 | 阿尔尼拉姆医药品有限公司 | Lipid formulated compositions and methods for inhibiting expression of EG5 and VEGF genes |
CA2833870C (en) | 2011-04-22 | 2020-03-10 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
US9255927B2 (en) | 2011-05-05 | 2016-02-09 | Duke University | Methods of developing a prognosis for pancreatic cancer and predicting responsiveness to cancer therapeutics |
US20150299696A1 (en) | 2012-05-02 | 2015-10-22 | Sirna Therapeutics, Inc. | SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS |
CN108148838A (en) * | 2012-05-22 | 2018-06-12 | 奥利克斯医药有限公司 | The nucleic acid molecules and purposes of induction RNA interference with intracellular penetration capacity |
WO2014036427A1 (en) | 2012-08-31 | 2014-03-06 | The General Hospital Corporation | Biotin complexes for treatment and diagnosis of alzheimer's disease |
GB201215857D0 (en) | 2012-09-05 | 2012-10-24 | Sylentis Sau | siRNA and their use in methods and compositions for the treatment and/or prevention of eye conditions |
BR112015004452A2 (en) | 2012-09-05 | 2017-08-08 | Sylentis Sau | sirna and its use in methods and compositions for the treatment and / or prevention of eye conditions |
RU2015133252A (en) * | 2013-01-08 | 2017-02-10 | Бенитек Байофарма Лимитед | TREATMENT OF AGE-RELATED MACULAR DEGENERATION |
AR096203A1 (en) | 2013-05-06 | 2015-12-16 | Alnylam Pharmaceuticals Inc | DOSAGES AND METHODS FOR MANAGING NUCLEIC ACID MOLECULES FORMULATED IN LIPIDS |
EP2865756A1 (en) * | 2013-10-22 | 2015-04-29 | Sylentis, S.A.U. | siRNA and their use in methods and compositions for inhibiting the expression of the FLAP gene. |
EA201691587A1 (en) | 2014-02-11 | 2017-01-30 | Элнилэм Фармасьютикалз, Инк. | COMPOSITIONS BASED ON iRNA FOR KETOGEXOKINASE (KHK) AND METHODS OF THEIR APPLICATION |
GB201403684D0 (en) | 2014-03-03 | 2014-04-16 | King S College London | Vector |
US10011837B2 (en) | 2014-03-04 | 2018-07-03 | Sylentis Sau | SiRNAs and their use in methods and compositions for the treatment and/or prevention of eye conditions |
CN104038000B (en) * | 2014-07-03 | 2016-08-24 | 雷勃电气(无锡)有限公司 | Dismantled and assembled copper cage rotor core laminates hot cover process |
WO2016037163A1 (en) | 2014-09-07 | 2016-03-10 | Selecta Biosciences, Inc. | Methods and compositions for attenuating gene therapy anti-viral transfer vector immune responses |
CA2980337A1 (en) | 2015-04-03 | 2016-10-06 | University Of Massachusetts | Oligonucleotide compounds for targeting huntingtin mrna |
EP3277815B1 (en) * | 2015-04-03 | 2021-09-22 | University of Massachusetts | Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders |
EP3315608B1 (en) * | 2015-06-26 | 2020-09-16 | Suzhou Ribo Life Science Co., Ltd. | Sirna, pharmaceutical composition and conjugate which contain sirna, and uses thereof |
CA2995110A1 (en) | 2015-08-14 | 2017-02-23 | University Of Massachusetts | Bioactive conjugates for oligonucleotide delivery |
MX2018002090A (en) | 2015-08-24 | 2018-09-12 | Halo Bio Rnai Therapeutics Inc | Polynucleotide nanoparticles for the modulation of gene expression and uses thereof. |
KR20180071362A (en) | 2015-11-16 | 2018-06-27 | 올릭스 주식회사 | Treatment of age-related macular degeneration with RNA complex targeting MyD88 or TLR3 |
CA3005937C (en) | 2015-12-13 | 2021-11-09 | Nitto Denko Corporation | Sirna structures for high activity and reduced off target |
CA3011894A1 (en) | 2016-01-31 | 2017-08-03 | University Of Massachusetts | Branched oligonucleotides |
CN108779463B (en) | 2016-02-02 | 2022-05-24 | 奥利克斯医药有限公司 | Treatment of atopic dermatitis and asthma using RNA complexes targeting IL4R α, TRPA1, or F2RL1 |
WO2017134526A1 (en) | 2016-02-02 | 2017-08-10 | Olix Pharmaceuticals, Inc. | Treatment of angiogenesis-associated diseases using rna complexes that target angpt2 and pdgfb |
CA3020487C (en) | 2016-04-11 | 2022-05-31 | Olix Pharmaceuticals, Inc. | Treatment of idiopathic pulmonary fibrosis using rna complexes that target connective tissue growth factor |
ES2908467T3 (en) | 2016-04-29 | 2022-04-29 | Adverum Biotechnologies Inc | Evasion of neutralizing antibodies by a recombinant adeno-associated virus |
US11499973B2 (en) | 2016-05-17 | 2022-11-15 | Duke University | Methods of predicting responsiveness of a cancer to a VEGF targeting agent and methods of prognosing and treating cancer |
KR101916652B1 (en) | 2016-06-29 | 2018-11-08 | 올릭스 주식회사 | Compounds improving RNA interference of small interfering RNA and use thereof |
KR101961332B1 (en) * | 2016-07-28 | 2019-03-22 | 기초과학연구원 | Pharmaceutical Composition for Treating or Preventing Eye Disease Comprising Cas9 Protein and Guide RNA |
EP3827812A1 (en) | 2016-07-29 | 2021-06-02 | The Regents of the University of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
CA3033368A1 (en) | 2016-08-12 | 2018-02-15 | University Of Massachusetts | Conjugated oligonucleotides |
RU2019103691A (en) * | 2016-08-19 | 2020-09-22 | Тулджен Инкорпорейтед | ARTIFICIALLY DESIGNED SYSTEM OF ANGIOGENESIS REGULATION |
AU2017345470B2 (en) | 2016-10-19 | 2023-08-03 | Adverum Biotechnologies, Inc. | Modified AAV capsids and uses thereof |
US11203755B2 (en) * | 2016-11-28 | 2021-12-21 | Napajen Pharma, Inc. | Chemically-modified siRNA |
KR20190108167A (en) | 2017-02-10 | 2019-09-23 | 성균관대학교산학협력단 | Long double stranded RNA for RNA interference |
JPWO2019022250A1 (en) * | 2017-07-28 | 2020-07-09 | 国立大学法人九州大学 | Transdermal absorption composition with controlled release of water-soluble active ingredient |
WO2019075360A1 (en) | 2017-10-13 | 2019-04-18 | Selecta Biosciences, Inc. | Methods and compositions for attenuating anti-viral transfer vector igm responses |
JP2021533762A (en) | 2018-08-10 | 2021-12-09 | ユニバーシティ・オブ・マサチューセッツUniversity Of Massachusetts | Modified oligonucleotides that target SNPs |
BR112021023594A2 (en) | 2019-05-28 | 2022-02-08 | Selecta Biosciences Inc | Methods and compositions for attenuated antiviral transfer vector immune response |
AU2020313914A1 (en) * | 2019-07-12 | 2022-01-20 | Oregon Health & Science University | Therapeutic constructs for co-delivery of mitotic kinase inhibitor and immune checkpoint inhibitor |
WO2021117009A2 (en) * | 2019-12-11 | 2021-06-17 | Moore Tara | Allele-specific silencing of transforming growth factor beta induced gene with r124h mutation using short interfering rna |
KR102324428B1 (en) * | 2020-04-16 | 2021-11-09 | 건국대학교 산학협력단 | The shRNA downregulating vascular endothelial growth factor for treatment of tumor and use thereof |
US20230190956A1 (en) | 2020-04-24 | 2023-06-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for preventing induction of immune responses to the transduced cells expressing a transgene product after ocular gene therapy |
EP4359539A1 (en) | 2021-06-23 | 2024-05-01 | University Of Massachusetts | Optimized anti-flt1 oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders |
WO2023064367A1 (en) | 2021-10-12 | 2023-04-20 | Selecta Biosciences, Inc. | Methods and compositions for attenuating anti-viral transfer vector igm responses |
WO2023172624A1 (en) | 2022-03-09 | 2023-09-14 | Selecta Biosciences, Inc. | Immunosuppressants in combination with anti-igm agents and related dosing |
Family Cites Families (132)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4426330A (en) * | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
KR840001915A (en) * | 1981-10-13 | 1984-06-07 | 그레이험 워커 존 | Self-adjusting sail set |
US4980286A (en) * | 1985-07-05 | 1990-12-25 | Whitehead Institute For Biomedical Research | In vivo introduction and expression of foreign genetic material in epithelial cells |
DE3681787D1 (en) * | 1985-07-05 | 1991-11-07 | Whitehead Biomedical Inst | EXPRESSION OF FOREIGN GENETIC MATERIAL IN EPITHELIC CELLS. |
US5139941A (en) * | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
US4837028A (en) * | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US4888116A (en) * | 1987-01-15 | 1989-12-19 | The Dow Chemical Company | Method of improving membrane properties via reaction of diazonium compounds or precursors |
DE3852823T2 (en) | 1987-09-11 | 1995-05-24 | Whitehead Biomedical Inst | TRANSDUCTION-CHANGED FIBROBLASTS AND THEIR USE. |
DE3851153T2 (en) | 1987-12-11 | 1995-01-05 | Whitehead Biomedical Inst | GENETIC MODIFICATION OF ENDOTHELIAL CELLS. |
WO1989007136A2 (en) | 1988-02-05 | 1989-08-10 | Whitehead Institute For Biomedical Research | Modified hepatocytes and uses therefor |
GB8824593D0 (en) | 1988-10-20 | 1988-11-23 | Royal Free Hosp School Med | Liposomes |
US5328470A (en) * | 1989-03-31 | 1994-07-12 | The Regents Of The University Of Michigan | Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor |
JP3058686B2 (en) | 1989-08-31 | 2000-07-04 | シティ・オブ・ホープ | Chimeric DNA-RNA catalytically active sequence |
US5225212A (en) * | 1989-10-20 | 1993-07-06 | Liposome Technology, Inc. | Microreservoir liposome composition and method |
US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5356633A (en) * | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
US5665710A (en) * | 1990-04-30 | 1997-09-09 | Georgetown University | Method of making liposomal oligodeoxynucleotide compositions |
US5962219A (en) | 1990-06-11 | 1999-10-05 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: chemi-selex |
DE552178T1 (en) | 1990-10-12 | 1994-02-03 | Max Planck Gesellschaft | MODIFIED RIBOZYMS. |
WO1992007943A1 (en) | 1990-10-31 | 1992-05-14 | Somatix Therapy Corporation | Retroviral vectors useful for gene therapy |
JP3220180B2 (en) * | 1991-05-23 | 2001-10-22 | 三菱化学株式会社 | Drug-containing protein-bound liposomes |
DE4216134A1 (en) * | 1991-06-20 | 1992-12-24 | Europ Lab Molekularbiolog | SYNTHETIC CATALYTIC OLIGONUCLEOTIDE STRUCTURES |
US5252479A (en) * | 1991-11-08 | 1993-10-12 | Research Corporation Technologies, Inc. | Safe vector for gene therapy |
US5652094A (en) | 1992-01-31 | 1997-07-29 | University Of Montreal | Nucleozymes |
WO1993023569A1 (en) | 1992-05-11 | 1993-11-25 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting viral replication |
US5587308A (en) | 1992-06-02 | 1996-12-24 | The United States Of America As Represented By The Department Of Health & Human Services | Modified adeno-associated virus vector capable of expression from a novel promoter |
EP0786522A2 (en) | 1992-07-17 | 1997-07-30 | Ribozyme Pharmaceuticals, Inc. | Enzymatic RNA molecules for treatment of stenotic conditions |
US5478745A (en) | 1992-12-04 | 1995-12-26 | University Of Pittsburgh | Recombinant viral vector system |
US5672659A (en) | 1993-01-06 | 1997-09-30 | Kinerton Limited | Ionic molecular conjugates of biodegradable polyesters and bioactive polypeptides |
JP3351476B2 (en) * | 1993-01-22 | 2002-11-25 | 三菱化学株式会社 | Phospholipid derivatives and liposomes containing the same |
CA2154363A1 (en) * | 1993-01-22 | 1994-08-04 | Bruce A. Sullenger | Localization of therapeutic agents |
WO1994018987A1 (en) * | 1993-02-19 | 1994-09-01 | Nippon Shinyaku Co., Ltd. | Drug composition containing nucleic acid copolymer |
US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
US5731294A (en) * | 1993-07-27 | 1998-03-24 | Hybridon, Inc. | Inhibition of neovasularization using VEGF-specific oligonucleotides |
CA2137297C (en) * | 1993-12-06 | 2000-04-18 | Tsuyoshi Miyazaki | Reactive vesicle and functional substance-fixed vesicle |
US5902880A (en) | 1994-08-19 | 1999-05-11 | Ribozyme Pharmaceuticals, Inc. | RNA polymerase III-based expression of therapeutic RNAs |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US6054299A (en) * | 1994-04-29 | 2000-04-25 | Conrad; Charles A. | Stem-loop cloning vector and method |
US5543152A (en) * | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
US6150092A (en) * | 1994-06-27 | 2000-11-21 | Taogosei Company, Ltd. | Antisense nucleic acid compound targeted to VEGF |
US6146886A (en) | 1994-08-19 | 2000-11-14 | Ribozyme Pharmaceuticals, Inc. | RNA polymerase III-based expression of therapeutic RNAs |
US5595760A (en) | 1994-09-02 | 1997-01-21 | Delab | Sustained release of peptides from pharmaceutical compositions |
US5885613A (en) | 1994-09-30 | 1999-03-23 | The University Of British Columbia | Bilayer stabilizing components and their use in forming programmable fusogenic liposomes |
US5820873A (en) | 1994-09-30 | 1998-10-13 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
US5753613A (en) | 1994-09-30 | 1998-05-19 | Inex Pharmaceuticals Corporation | Compositions for the introduction of polyanionic materials into cells |
US5716824A (en) | 1995-04-20 | 1998-02-10 | Ribozyme Pharmaceuticals, Inc. | 2'-O-alkylthioalkyl and 2-C-alkylthioalkyl-containing enzymatic nucleic acids (ribozymes) |
US5756122A (en) | 1995-06-07 | 1998-05-26 | Georgetown University | Liposomally encapsulated nucleic acids having high entrapment efficiencies, method of manufacturer and use thereof for transfection of targeted cells |
US7422902B1 (en) | 1995-06-07 | 2008-09-09 | The University Of British Columbia | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer |
US5981501A (en) | 1995-06-07 | 1999-11-09 | Inex Pharmaceuticals Corp. | Methods for encapsulating plasmids in lipid bilayers |
JP4335310B2 (en) | 1995-06-07 | 2009-09-30 | ザ ユニバーシティ オブ ブリティッシュ コロンビア | Lipid-nucleic acid particles prepared through hydrophobic lipid-nucleic acid complex intermediates and use for gene transfer |
DE69629702T2 (en) | 1995-08-01 | 2004-06-17 | Isis Pharmaceuticals, Inc., Carlsbad | LIPOSOMAL OLIGONUCLEOTIDE COMPOSITIONS |
US5858397A (en) | 1995-10-11 | 1999-01-12 | University Of British Columbia | Liposomal formulations of mitoxantrone |
EP1108724B1 (en) | 1996-01-16 | 2007-09-19 | Sirna Therpeutics, Inc. | Synthesis of methoxy nucleosides and enzymatic nucleic acid molecules |
US5994316A (en) | 1996-02-21 | 1999-11-30 | The Immune Response Corporation | Method of preparing polynucleotide-carrier complexes for delivery to cells |
US5849902A (en) | 1996-09-26 | 1998-12-15 | Oligos Etc. Inc. | Three component chimeric antisense oligonucleotides |
US6001311A (en) | 1997-02-05 | 1999-12-14 | Protogene Laboratories, Inc. | Apparatus for diverse chemical synthesis using two-dimensional array |
US6127533A (en) * | 1997-02-14 | 2000-10-03 | Isis Pharmaceuticals, Inc. | 2'-O-aminooxy-modified oligonucleotides |
US6395713B1 (en) | 1997-07-23 | 2002-05-28 | Ribozyme Pharmaceuticals, Inc. | Compositions for the delivery of negatively charged molecules |
US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
ATE507299T1 (en) | 1998-04-08 | 2011-05-15 | Commw Scient Ind Res Org | METHOD AND MEANS FOR OBTAINING ALTERED PHENOTYPES |
JP2003525017A (en) | 1998-04-20 | 2003-08-26 | リボザイム・ファーマシューティカルズ・インコーポレーテッド | Nucleic acid molecules with novel chemical composition that can regulate gene expression |
AR020078A1 (en) | 1998-05-26 | 2002-04-10 | Syngenta Participations Ag | METHOD FOR CHANGING THE EXPRESSION OF AN OBJECTIVE GENE IN A PLANT CELL |
JP2002520038A (en) | 1998-07-20 | 2002-07-09 | アイネックス ファーマシューティカルズ コーポレイション | Liposome encapsulated nucleic acid complex |
BR9914773A (en) | 1998-10-09 | 2002-02-05 | Ingene Inc | Set of generic elements, method for the production of single-stranded DNA, mrna transcription, nucleic acid construction, ssdna transcription, vector, vector system, host cell, set for the production of a single-stranded nucleic acid sequence, method for in vivo or in vitro production of a single-stranded nucleic acid sequence, transcription of single-stranded cdna, inhibitory nucleic acid, heteroduplex molecule, and pharmaceutical composition |
KR20010099682A (en) | 1998-10-09 | 2001-11-09 | 추후보충 | Enzymatic Synthesis of ssDNA |
DE19956568A1 (en) | 1999-01-30 | 2000-08-17 | Roland Kreutzer | Method and medicament for inhibiting the expression of a given gene |
JP2002537828A (en) | 1999-03-10 | 2002-11-12 | フォゲン リミティド | Delivery of substances to cells |
US20050112141A1 (en) | 2000-08-30 | 2005-05-26 | Terman David S. | Compositions and methods for treatment of neoplastic disease |
DE10100586C1 (en) | 2001-01-09 | 2002-04-11 | Ribopharma Ag | Inhibiting gene expression in cells, useful for e.g. treating tumors, by introducing double-stranded complementary oligoRNA having unpaired terminal bases |
WO2001053345A1 (en) * | 2000-01-20 | 2001-07-26 | North Bristol Nhs Trust | Vegf148 isoform, a truncated splice variant of vegf. vegf heterodimers and therapeutical uses thereof |
US20030229037A1 (en) | 2000-02-07 | 2003-12-11 | Ulrich Massing | Novel cationic amphiphiles |
WO2003070918A2 (en) | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | Rna interference by modified short interfering nucleic acid |
SE0003665D0 (en) | 2000-10-11 | 2000-10-11 | Astrazeneca Ab | A delivery device |
JPWO2002033094A1 (en) * | 2000-10-19 | 2004-10-21 | 協和醗酵工業株式会社 | Antibodies that inhibit VPLF activity |
TR200401292T3 (en) | 2000-12-01 | 2004-07-21 | Max@Planck@Gesellschaft�Zur�F�Rderung�Der�Wissenschaften | the rnaágirişimineáyoláaçanáküçükárnaámolekül |
EP1386004A4 (en) | 2001-04-05 | 2005-02-16 | Ribozyme Pharm Inc | Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies |
US20030170891A1 (en) | 2001-06-06 | 2003-09-11 | Mcswiggen James A. | RNA interference mediated inhibition of epidermal growth factor receptor gene expression using short interfering nucleic acid (siNA) |
US20040209832A1 (en) * | 2001-11-30 | 2004-10-21 | Mcswiggen James | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
WO2003070917A2 (en) | 2002-02-20 | 2003-08-28 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of myc and myb genes or genes of their respective pathways |
WO2003070910A2 (en) * | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | INHIBITION OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) AND VEGF RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
US7981863B2 (en) * | 2001-09-19 | 2011-07-19 | Neuronova Ab | Treatment of Parkinson's disease with PDGF |
FR2832154B1 (en) * | 2001-11-09 | 2007-03-16 | Centre Nat Rech Scient | OLIGONUCLEOTIDES INHIBITORS AND THEIR USE FOR SPECIFICALLY REPRESSING A GENE |
EP1432724A4 (en) * | 2002-02-20 | 2006-02-01 | Sirna Therapeutics Inc | Rna interference mediated inhibition of map kinase genes |
US7199107B2 (en) * | 2002-05-23 | 2007-04-03 | Isis Pharmaceuticals, Inc. | Antisense modulation of kinesin-like 1 expression |
NO315435B1 (en) | 2002-06-21 | 2003-09-01 | Hydralift Asa | Compensation Arrangement |
JP4222792B2 (en) | 2002-06-26 | 2009-02-12 | シャープ株式会社 | Ranging sensor, electronic device using the same, and manufacturing method of ranging sensor |
CN1156336C (en) | 2002-07-12 | 2004-07-07 | 清华大学 | Preparation method of titanium dioxide film photocatalyst loaded on surface of flexible base material |
US6679120B1 (en) | 2002-07-15 | 2004-01-20 | Gas Research Institute | System and method for guided boring obstacle detection |
US7148342B2 (en) * | 2002-07-24 | 2006-12-12 | The Trustees Of The University Of Pennyslvania | Compositions and methods for sirna inhibition of angiogenesis |
CA2494621A1 (en) | 2002-07-29 | 2004-02-05 | The Gates Corporation | Belt |
US7036793B2 (en) | 2002-07-31 | 2006-05-02 | Brass-Craft Manufacturing Company | Stop valve |
JP2005534696A (en) * | 2002-08-06 | 2005-11-17 | イントラディグム、コーポレイション | In vivo down-regulation of target gene expression by introduction of interfering RNA |
US7923547B2 (en) | 2002-09-05 | 2011-04-12 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
US20040115201A1 (en) | 2002-09-25 | 2004-06-17 | Paz Einat | Mitotic kinesin-like protein-1, MKLP1, and uses thereof |
JP2006507841A (en) * | 2002-11-14 | 2006-03-09 | ダーマコン, インコーポレイテッド | Functional and ultrafunctional siRNA |
WO2004064737A2 (en) | 2003-01-17 | 2004-08-05 | Alnylam Pharmaceuticals | Therapeutics compositions |
DE10302421A1 (en) | 2003-01-21 | 2004-07-29 | Ribopharma Ag | New double-stranded interfering RNA, useful for inhibiting hepatitis C virus, has one strand linked to a lipophilic group to improve activity and eliminate the need for transfection auxiliaries |
WO2006018628A1 (en) | 2003-03-07 | 2006-02-23 | Astrazeneca Ab | Enantiomers of selected fused pyrimidones and uses in the treatment and preventi on of cancer |
EP1605978B1 (en) | 2003-03-07 | 2010-09-01 | Alnylam Pharmaceuticals Inc. | Therapeutic compositions |
JP2006522158A (en) | 2003-04-03 | 2006-09-28 | アルナイラム ファーマシューティカルズ インコーポレイテッド | iRNA complex |
EP1625138A4 (en) | 2003-04-17 | 2010-06-23 | Alnylam Pharmaceuticals Inc | Protected monomers |
EP2669377A3 (en) | 2003-04-17 | 2015-10-14 | Alnylam Pharmaceuticals Inc. | Modified iRNA agents |
CA2525243C (en) * | 2003-05-09 | 2014-05-27 | Transfert Plus | Use of melanotransferrin (p97) for regulating plasminogen activation and cell migration |
DK3604537T3 (en) | 2003-06-13 | 2022-02-28 | Alnylam Europe Ag | Double-stranded ribonucleic acid with increased efficiency in an organism |
AU2004257373B2 (en) | 2003-07-16 | 2011-03-24 | Arbutus Biopharma Corporation | Lipid encapsulated interfering RNA |
EP1670955A2 (en) | 2003-09-22 | 2006-06-21 | Rosetta Inpharmatics LLC. | Synthetic lethal screen using rna interference |
AU2005222902B2 (en) | 2004-03-12 | 2010-06-10 | Alnylam Pharmaceuticals, Inc. | iRNA agents targeting VEGF |
EP1781593B1 (en) | 2004-06-07 | 2011-12-14 | Protiva Biotherapeutics Inc. | Cationic lipids and methods of use |
ATE536418T1 (en) | 2004-06-07 | 2011-12-15 | Protiva Biotherapeutics Inc | LIPID ENCAPSULATED INTERFERENCE RNA |
WO2007086883A2 (en) | 2005-02-14 | 2007-08-02 | Sirna Therapeutics, Inc. | Cationic lipids and formulated molecular compositions containing them |
ES2381201T3 (en) | 2005-03-31 | 2012-05-24 | Calando Pharmaceuticals, Inc. | Inhibitors of the subunit 2 of the ribonucleotide reductase and uses thereof |
US7915230B2 (en) | 2005-05-17 | 2011-03-29 | Molecular Transfer, Inc. | Reagents for transfection of eukaryotic cells |
CA2610484A1 (en) | 2005-06-22 | 2007-01-04 | Biocryst Pharmaceuticals, Inc. | Methods for the preparation of 9-deazapurine derivatives |
CA2616877C (en) | 2005-07-27 | 2014-01-28 | Protiva Biotherapeutics, Inc. | Systems and methods for manufacturing liposomes |
EP1948674A4 (en) | 2005-11-02 | 2009-02-04 | Protiva Biotherapeutics Inc | Modified sirna molecules and uses thereof |
NZ571568A (en) | 2006-03-31 | 2010-11-26 | Alnylam Pharmaceuticals Inc | Double-stranded RNA molecule compositions and methods for inhibiting expression of Eg5 gene |
US8598333B2 (en) | 2006-05-26 | 2013-12-03 | Alnylam Pharmaceuticals, Inc. | SiRNA silencing of genes expressed in cancer |
DK2068886T3 (en) | 2006-10-03 | 2013-11-18 | Tekmira Pharmaceuticals Corp | Lipid-containing preparations |
US20080213350A1 (en) | 2007-02-20 | 2008-09-04 | Texas Tech University System | Encapsulation of nucleic acids in liposomes |
US7858592B2 (en) | 2007-02-26 | 2010-12-28 | The Board Of Regents Of The University Of Texas System | Interfering RNAs against the promoter region of P53 |
WO2009082817A1 (en) | 2007-12-27 | 2009-07-09 | Protiva Biotherapeutics, Inc. | Silencing of polo-like kinase expression using interfering rna |
CA2713379A1 (en) | 2008-01-31 | 2009-11-05 | Alnylam Pharmaceuticals, Inc. | Optimized methods for delivery of dsrna targeting the pcsk9 gene |
CA2716793A1 (en) | 2008-03-05 | 2009-09-11 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of eg5 and vegf genes |
AU2009238175C1 (en) | 2008-04-15 | 2023-11-30 | Arbutus Biopharma Corporation | Novel lipid formulations for nucleic acid delivery |
HUE037082T2 (en) | 2008-11-10 | 2018-08-28 | Arbutus Biopharma Corp | Novel lipids and compositions for the delivery of therapeutics |
US20120101148A1 (en) | 2009-01-29 | 2012-04-26 | Alnylam Pharmaceuticals, Inc. | lipid formulation |
US20100267806A1 (en) | 2009-03-12 | 2010-10-21 | David Bumcrot | LIPID FORMULATED COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 AND VEGF GENES |
JP5769701B2 (en) | 2009-05-05 | 2015-08-26 | テクミラ ファーマシューティカルズ コーポレイションTekmira Pharmaceuticals Corporation | Lipid composition |
DK2440183T3 (en) | 2009-06-10 | 2018-10-01 | Arbutus Biopharma Corp | Improved lipid formulation |
WO2011017548A1 (en) | 2009-08-05 | 2011-02-10 | Alnylam Pharmaceuticals, Inc. | Lipid formulated compositions and methods for inhibiting expression of eg5 and vegf genes |
CN107519133A (en) | 2009-09-15 | 2017-12-29 | 阿尔尼拉姆医药品有限公司 | The method of the expression of composition and suppression Eg5 and VEGF genes that lipid is prepared |
-
2005
- 2005-03-11 AU AU2005222902A patent/AU2005222902B2/en not_active Ceased
- 2005-03-11 EP EP11001330.7A patent/EP2365077B1/en not_active Not-in-force
- 2005-03-11 EP EP05725384A patent/EP1735009A4/en not_active Withdrawn
- 2005-03-11 WO PCT/US2005/008182 patent/WO2005089224A2/en active Application Filing
- 2005-03-11 US US11/078,073 patent/US7947659B2/en active Active
- 2005-03-11 EP EP14197031.9A patent/EP2899278A1/en not_active Withdrawn
- 2005-03-11 ES ES11001330T patent/ES2423060T3/en active Active
- 2005-03-11 CA CA2559161A patent/CA2559161C/en not_active Expired - Fee Related
- 2005-03-11 EP EP13156812.3A patent/EP2636739B1/en not_active Not-in-force
- 2005-03-11 JP JP2007503050A patent/JP4937899B2/en active Active
-
2006
- 2006-01-25 US US11/340,080 patent/US7919473B2/en active Active
-
2010
- 2010-08-19 AU AU2010212443A patent/AU2010212443B8/en not_active Ceased
-
2011
- 2011-03-08 US US13/043,228 patent/US8293719B2/en active Active
- 2011-05-30 JP JP2011121050A patent/JP5502025B2/en active Active
-
2012
- 2012-01-20 HK HK12100722.1A patent/HK1160484A1/en unknown
- 2012-09-14 US US13/620,212 patent/US20130018085A1/en not_active Abandoned
-
2014
- 2014-02-13 JP JP2014025057A patent/JP2014094020A/en not_active Withdrawn
- 2014-07-07 US US14/325,087 patent/US20150011608A1/en not_active Abandoned
-
2016
- 2016-04-27 JP JP2016088971A patent/JP2016135144A/en active Pending
Also Published As
Publication number | Publication date |
---|---|
EP1735009A4 (en) | 2011-03-30 |
AU2005222902B2 (en) | 2010-06-10 |
US20110224282A1 (en) | 2011-09-15 |
AU2005222902A1 (en) | 2005-09-29 |
US20150011608A1 (en) | 2015-01-08 |
ES2423060T3 (en) | 2013-09-17 |
WO2005089224A3 (en) | 2007-03-01 |
JP2016135144A (en) | 2016-07-28 |
JP2011188866A (en) | 2011-09-29 |
JP2014094020A (en) | 2014-05-22 |
AU2010212443B8 (en) | 2013-09-12 |
AU2010212443A1 (en) | 2010-09-09 |
AU2010212443B2 (en) | 2013-08-29 |
US20130018085A1 (en) | 2013-01-17 |
HK1160484A1 (en) | 2012-08-17 |
EP2636739B1 (en) | 2014-12-10 |
EP2899278A1 (en) | 2015-07-29 |
AU2010212443A8 (en) | 2013-09-12 |
US7919473B2 (en) | 2011-04-05 |
EP2365077B1 (en) | 2013-05-08 |
US20060223770A1 (en) | 2006-10-05 |
CA2559161C (en) | 2013-06-11 |
US8293719B2 (en) | 2012-10-23 |
US7947659B2 (en) | 2011-05-24 |
JP4937899B2 (en) | 2012-05-23 |
JP5502025B2 (en) | 2014-05-28 |
EP2636739A1 (en) | 2013-09-11 |
EP2365077A1 (en) | 2011-09-14 |
JP2007528736A (en) | 2007-10-18 |
EP1735009A2 (en) | 2006-12-27 |
US20060094032A1 (en) | 2006-05-04 |
WO2005089224A2 (en) | 2005-09-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2010212443B2 (en) | iRNA agents targeting VEGF | |
JP7062623B2 (en) | Ketohexokinase (KHK) iRNA composition and its usage | |
ES2640260T3 (en) | Compositions and methods to inhibit gene expression alas1 | |
CN108064154B (en) | Compositions and methods for inhibiting expression of the HAO1 (glycolate oxidase 1) gene | |
JP2021075554A (en) | Tmprss6 irna compositions and methods for use thereof | |
CN103813810B (en) | Compositions and methods for inhibiting expression of TMPRSS6 gene | |
TW201704472A (en) | Factor XII (Hageman Factor) (F12), kallikrein B, plasma (Fletcher Factor) 1 (KLKB1), and kininogen 1 (KNG1) iRNA compositions and methods of use thereof | |
KR20150003344A (en) | SERPINC1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF | |
KR20160011660A (en) | SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF | |
ES2804510T3 (en) | Compositions and methods to inhibit the expression of the ALAS1 gene | |
CA2815554A1 (en) | Irna agents targeting vegf | |
AU2013213756A1 (en) | iRNA agents targeting VEGF | |
RU2804776C2 (en) | AGENTS FOR RNAi, COMPOSITIONS AND METHODS OF THEIR USE FOR THE TREATMENT OF DISEASES ASSOCIATED WITH TRANSTHYRETIN (TTR) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKLA | Lapsed |
Effective date: 20190311 |