CN100457181C - Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist - Google Patents

Abstract

The present invention provides a method of reducing or inhibiting tumor growth in a mammal comprising treating the mammal with an effective amount of a combination of a vegf receptor antagonist and radiation, chemotherapy, and/or an additional receptor antagonist.

Description

Conjoint therapy with vascular endothelial growth factor receptor antagonist for inhibiting growth of tumor

The application is still unratified, the part continuation application of the application number 09/798,689 that submit to March 2 calendar year 2001, application number 09/798, the 689th, still unratified, the part continuation application of the application number 09/401,163 of JIUYUE in 1999 submission on the 22nd, application number 09/401, the 163rd, still unratified, the part continuation application of the application number 08/967,113 that on November 10th, 1997 submitted to, application number 08/967,113 is part continuation applications of the patent No. 5,861,499 of JIUYUE in 1996 submission on the 3rd, the patent No. 5,861,499th, abandoned the application number 08/476 that submit to June 7 nineteen ninety-five, 533 part continuation application, application number 08/476,533 is patent No.s 5,840 of submitting on October 20th, 1994,301 part continuation application, the patent No. 5,840,301st has been abandoned, the part continuation application of the application number 08/196,041 that on February 10th, 1994 submitted to.Above-mentioned full content in first to file is all introduced herein as a reference.

Invention field

The present invention relates to utilize VEGF (VEGF) receptor antagonist and chemotherapeutics, radiotherapy, and/or the method for other growth factor receptor antagonist therapeutic alliance tumor.

Background of invention

Blood vessel is meant the vascularization of blood capillary from preexist in embryo and adult biology, and known blood vessel is a tumor growth, survival and the key factor that shifts.Somatomedin and receptor thereof, comprise epidermal growth factor (EGF), transforminggrowthfactor-(TGF-α), transforming growth factor-beta (TGF-β), acidity and basic fibroblast growth factor (aFGF and bFGF), platelet-derived somatomedin (PDGF), and VEGF (VEGF) plays a role in the blood vessel of tumor takes place.See Klagsbrun ﹠amp; D ' Amore, Annual Rev.Physiol., 53:217-239 (1991).These somatomedin can be induced receptor activation with combining of its cell surface receptor, cause and the modification signal transduction pathway, cause cell proliferation and differentiation.VEGF, a kind of endotheliocyte-specificity mitogen, then different with these factors, this is to promote endothelial cell proliferation and work as blood vessel generation derivant by specificity because of it.

VEGF is a kind of isotype biglycan albumen of being made up of the subunit of two 23kD, and it is a kind of stronger vascular permeability derivant, and the stimulant of endothelial cell migration and propagation is important surviving factor for the blood vessel of new formation.VEGF has 4 kinds of different monomer isotypes, and they are to produce from the alternative splicing of mRNA.They comprise two kinds of film combining form (VEGF ₂₀₆And VEGF ₁₈₉) and two kinds of soluble form (VEGF ₁₆₅And VEGF ₁₂₁).In removing extraplacental all human tissues, VEGF ₁₆₅The content of isotype is the highest.

VEGF is the important regulator that blood vessel takes place, blood vessel is meant neovascularity because the original position of endothelium precursor is broken up (angioblast) and from the beginning grown, VEGF is at (the Breier etc. of embryonal tissue, Development (Camb.), 114:521 (1992)), macrophage, and the propagation epidermal keratinocytes (Brown etc. in the wound healing process, J.Exp.Med., 176:1375 (1992)) expresses in, and relate to tissue edema (Ferrara etc., Endocr.Rev., 13:18 (1992)) with inflammation-related.In situ hybridization research is verified, VEGF is high level expression in a lot of people's tumors are, comprises glioblastoma multiforme, hemangioblastoma, central nervous system's tumor and AIDS-dependency Kaposi (Plate etc., (1992) Nature 359:845-848; Plate etc. (1993) CancerRes.53:5822-5827; Berkman etc. (1993) J.Clin.Invest.91:153-159; Nakamura etc. (1992) AIDS Weekly, 13 (1)).High-caliber VEGF observes (Shweiki etc., (1992) Nature359:843-845) in also can taking place at the blood vessel of hypoxia inducible.

The biological respinse of VEGF is by its high-affinity receptor mediation, and they are the selective expression on the endotheliocyte in embryo's generation (Millauer, Cell, 72:835-846 (1993)) and the neoplastic process.Vegf receptor (VEGFRs) is III receptoroid type tyrosine kinase normally, it is characterized in that having in the outer receptor ligand binding domain of they aminoterminal born of the same parents some, the ring of 5 or 7 immunoglobulin-likes (Kaipainen etc., J.Exp.Med., 178:2077-2088 (1993)) normally.Two other district comprises that one is striden film district and the interior catalytic domain of carboxyl terminal born of the same parents, it can be by the insertion of kinases (interkinase) sequence in the hydrophilic of different length, be also referred to as kinases and insert territory disconnection (Terman etc., Oncogene, 6:1677-1683 (1991)).VEGFRs comprises by Shibuya etc., Oncogene, the fins sample tyrosine kinase receptor (flt-1) of 5:519-524 (1990) order-checking, or VEGFR-1, the WO92/14248 that submits on February 20th, 1992, with Terman etc., Oncogene describes among the 6:1677-1683 (1991), and by Matthews etc., Proc.Natl.Acad.Sci.USA, 88:9026-9030 (1991) order-checking, contain receptor/fetal livers kinases (KDR/flk-1) that kinases inserts the territory, or VEGFR-2, certain other receptor also can be in conjunction with VEGF as neuropilin-1 and-2.Other tyrosine kinase receptor, VEGFR-3 (flt-4) can be in conjunction with congener VEGF-C and the VEGF-D of VEGF, and even more important in vasculolymphatic growth.

High-caliber Flk-1 expresses (Plate etc., (1992) Nature 359:845-848) by soaking into gliomatous endotheliocyte.The level of Flk-1 can be raised (Plate etc., (1993) CancerRes.53:5822-5827) by the VEGF specificity that people's glioblastoma produces.The high level expression of Flk-1 in the glioblastoma relevant with endotheliocyte (GAEC) shows that it is derivative in neoplastic process that receptor active is likely, this is because almost detect the transcript less than Flk-1 in normal brain endothelial cell.This rise is limited at and the very near vascular endothelial cell of tumor.With in and anti-VEGF monoclonal antibody (mAbs) the blocking VEGF activity xenograft that can the suppress people's tumor (Kim etc. that in nude mice, grow, (1993) Nature 362:841-844), thus show the direct effect of VEGF in the blood vessel relevant with tumor takes place.

Though the VEGF part raises in tumor cell, and its receptor also raises in soaking into the vascular endothelial cell of tumor, and VEGF part and receptor thereof the expression in the normal cell that takes place to have nothing to do with blood vessel is lower.Therefore, this normal cell can not be affected owing to the interaction between blocking VEGF and receptor thereof, takes place and tumor growth thereby suppress blood vessel.

The antagonist that the purpose of this invention is to provide vegf receptor.Another object of the present invention provides uses this vegf receptor antagonist, particularly uses this vegf receptor antagonist and radiotherapy, and chemotherapy or other receptor antagonist are united and suppressed the blood vessel generation, suppress or alleviate the method for mammal tumor growth thus.

The invention summary

The associating that the invention provides vegf receptor antagonist by treating effective dose and other receptor antagonist alleviates or suppresses the method that mammal tumor is grown.The present invention also provides the method that alleviates or suppress the mammal tumor growth by the associating of vegf receptor antagonist for the treatment of effective dose and radiotherapy.In addition, the associating that the invention provides vegf receptor antagonist by treating effective dose and chemotherapeutics alleviates or suppresses the method for mammal tumor growth.

The accompanying drawing summary

Fig. 1: make the Western blotting of flk-1 (VEGFR-2)/SEAPS immunoprecipitation confirm that DC-101 can make Mus flk-1:SEAPS immunoprecipitation with monoclonal antibody DC-101, but can not make independent SEAPS immunoprecipitation.

Fig. 2 a and 2b: Fig. 2 a: the competitive inhibition algoscopy, represent that anti--flk-1 (VEGFR-2) monoclonal antibody DC-101 is to VEGF ₁₆₅The effect of flk-1 (VEGFR-2)/fms receptor phosphorylation in the inductive transfection 3T3 cell.The sensitivity of the inductive flk-1 of Fig. 2 b:VEGF (VEGFR-2)/fms receptor phosphorylation to suppressing due to the monoclonal antibody DC-101.The C441 cell is the VEGF in maximal stimulus concentration ₁₆₅(40ng/ml) and measure under the condition of varying level antibody.

Fig. 3 a and 3b: Fig. 3 a: when having mAb DC-101 to exist, the titration of the inductive flk-1 of VEGF-(VEGFR-2)/fms receptor phosphorylation.The C441 cell is when (1-4 road) being arranged or do not have (5-8 road) 5 μ g/ml mAb DC-101 to exist, and the VEGF of usefulness prescribed concentration stimulates.At the unprovoked cell that has antibody (9 road) to measure when existing with comparing.Fig. 3 b: draw with respect to each VEGF concentration, the spectrodensitometry scintigram of phosphorylation acceptor levels in each road of Fig. 3 a, this figure show the inhibition degree of excess ligand concentration to mAb.The cell lysates that is used to detect is described according to following embodiment, prepares by anti--phosphotyrosine.

Fig. 4: suppress the activation of VEGF-flk-1 (VEGFR-2)/fms by pre-bonded mAb DC-101.The C441 cell is when not having (3 roads and 4 roads) and (5 roads and 6 roads) DC-101 is arranged, and the VEGF of usefulness prescribed concentration stimulates.Unprovoked cell (1 road and 2 roads) is with comparing.MAb measures under two set conditions.For P, cell combines with mAb is pre-, and then room temperature stimulated 15 minutes with VEGF.For C, add mAb and part simultaneously, and according to top described mensuration.

Fig. 5: handle the inductive flk-1 of VEGF-(VEGFR-2)/fms receptor phosphorylation with the monoclonal antibody DC-101 of variable concentrations and the conditioned medium (GB CM) of spongioblast oncocyte.

Fig. 6: antagonism-flk-1 (VEGFR-2) mAb carries out facs analysis with the combining of 3T3 cell (C441) of flk-1 (VEGFR-2)/fms transfection.The flk-1 of transfection (VEGFR-2)/fms3T3 cell was placed on ice incubation 60 minutes with irrelevant anti--flk-1 mAb 23H7 of anti--flk-1 (VEGFR-2) the mAb DC-101 of 10 μ g/ml or isotype coupling.Washed cell, with 5 μ g and the link coupled goat of FITC anti--mice IgG incubation again, antibodies is determined in washing, and analyze by flow cytometry.Data representation has nothing to do with use, and mAb 23H7 is detected to be compared, and DC-101 is to the fluorescence level of C441 cell.

Fig. 7: mAb DC-101 and saturated combine of flk-1 (VEGFR-2)/fms receptor on the 3T3cells C441 of transfection.In the time of 4 ℃, make mAb DC-101 (50ng/ml-2 μ g/ml) that the C441 cell that converges and concentration increases gradually incubation 2 hours in 24 hole flat boards.Washed cell resists-rat IgG-biotin conjugates incubation with 5 μ g.In order to detect combination, washed cell, with the streptavidin-HRP incubation of dilution in 1: 1000, washing, and in colorimetric detection system (TMB) incubation.When the concentration of data represented mAb DC-101 increases gradually, the absorbance at 540nm place.Remove in each mensuration second antibody and combining of separate cell and be for to non--specificity in conjunction with adjusting.The meansigma methods of data represented three independent experiments.

The immunoprecipitation of Fig. 8: phosphorylation flk-1 (VEGFR-2)/fms from the 3T3 cell of flk-1 (the VEGFR-2)/fms transfection of VEGF stimulation.Cell stimulates with VEGF according to experimentation is described, and lysate has nothing to do or the associated antibodies immunoprecipitation with following: 1. rat anti-FLK2 IgG2a (mAb 2A13); 2. rat anti-flk-1 (VEGFR-2) IgG1 (mAb DC-101); 3. rat anti-FLK2 IgG1 (mAb 23H7); 4. rabbit resists-the fms polyclonal antibody.Immunoprecipitation albumen is through SDS PAGE, then through western blot analysis.The immunoprecipitation of VEGF activated receptor detects by surveying trace with anti--phosphotyrosine antibody.

The sensitivity that the inductive flk-1 of Fig. 9: VEGF-(VEGFR-2)/fms receptor phosphorylation suppresses mAb DC-101.Pre-combination and competitive assays are to specify under the antibody concentration, carrying out with 40ng/ml VEGF.The cell lysates that is used for the receptor detection is according to the anti-phosphotyrosine preparation of the described usefulness of following embodiment.

Figure 10: mAb DC-101 is to the effect of the inductive fms receptor phosphorylation of CSF-1.In (B), the 3T3cells of fms/FLK-2 transfection, 10A2 is when not having (3 roads and 4 roads) and the mAb DC-101 of (5 roads and 6 roads) 5 μ g/ml is arranged, and stimulates with the CSF-1 of optimum irritation level.The unprovoked cell of measuring when not having (1 road) or (2 road) antibody is arranged is with comparing.The cell lysates that is used to detect is described by anti-phosphotyrosine preparation according to following embodiment.

Figure 11: the neutral specificity of mAb DC-101 of activation flk-1 (VEGFR-2)/fms receptor.The C441 cell is DC-101 (IgG1) or irrelevant anti--FLK-2 rat monoclonal antibody 2A13 (IgG2a) or 23H7 (IgG1) to be arranged when existing, with 20 or 40ng/ml VEGF stimulation.Algoscopy is under competitive (4-8 road) or pre-combination (9-11 road) condition, when not having VEGF (1-3 road) and having VEGF to exist, carries out with each antibody.The cell lysates that is used to detect is described according to following embodiment, prepares by anti-phosphotyrosine.Separate trace, and use the rabbit polyclonal antibody of fms receptor C-end region that trace is surveyed once more, thereby detect flk-1 (VEGFR-2)/fms receptor.

Figure 12: the immunoprecipitation of phosphorylation receptor band from the HUVEC cell that VEGF stimulates.The HUVEC cell was grown 3 days in endothelial growth culture medium (EGM), during do not change culture medium, converge up to the cell Asia.The receptor form is to utilize mAb DC-101 from unprovoked cell (1 road), VEGF stimulated cells (2 road), and 1 μ g/ml heparin (3 road) being arranged when existing, come out with immunoprecipitation in the lysate of VEGF stimulated cells.The phosphorylation assay method of phosphorylation receptor form, immuno-precipitation and detection are carried out according to experimentation is described.

Figure 13: mAb DC-101 is to the effect of the HUVEC cell proliferation that reacts on VEGF.Cell was grown 48 hours according to the explanation of Fig. 6.Cell passes through following condition determination then: do not add any material (untreated) in culture medium; Change fresh endothelial growth culture medium (complete medium); Not or when having 1 μ g/ml heparin to exist, add 10ng/ml VEGF; When having 1 μ g/ml DC-101 to exist, measure the cell that VEGF and VEGF-heparin were handled.The cell that is used to carry out proliferation assay is to use cell proliferating determining test kit (Promega), and colorimetric detection measures by carrying out at the 550nm place.

Figure 14 a and 14b: Figure 14 a: the tumor growth that alleviates individual animals with DC-101 (rat anti-flk-1 monoclonal antibody).Figure 14 b: the tumor growth that alleviates individual animals with the 2A13 group (rat anti-flk-2 monoclonal antibody) of contrast.

Figure 15: the cell line GBM-18 of personnel selection glioblastoma gives the nude mouse subcutaneous injection, and they are divided into three groups: PBS matched group, irrelevant rat IgG1 contrast 23H7 group, and DC-101.Treatment gives with tumor xenogeneic graft is subcutaneous, and continues for 4 weeks.

Figure 16: represent different scFv antibody (p1C11, p1F12, p2A6 and p2A7) and the direct bonded curve chart of immobilization KDR (VEGFR-2).

Figure 17: expression suppresses KDR (VEGFR-2) and immobilization VEGF by different scFv antibody (p1C11, p1F12, p2A6 and p2A7) ₁₆₅Bonded curve chart.

Figure 18: expression suppresses the curve chart of the inductive HUVEC propagation of VEGF-by scFv antibody (p2A6 and p1C11).

The V of Figure 19: c-p1C11 _HAnd V _LThe nucleotide of chain and the aminoacid sequence of deduction.

Figure 20: (c-p1C11, p1C11 is p2A6) with the direct bonded curve chart of immobilization KDR (VEGFR-2) for expression antibody.

Figure 21: expression c-p1C11 and the bonded facs analysis curve chart of KDR-(VEGFR-2) of expressing HUVEC.

Figure 22: expression suppresses KDR (VEGFR-2) receptor and immobilization VEGF by different scFv antibody (c-p1C11, p1C11, and p2A6) ₁₆₅Bonded curve chart.

Figure 23: expression is by c-p1C11 and cold VEGF ₁₆₅Suppress radiolabeled VEGF ₁₆₅Curve chart with immobilization KDR (VEGFR-2) receptors bind.

Figure 24: (c-p1C11 p1C11) suppresses the curve chart that the inductive HUVEC of VEGF-breeds by anti--KDR (VEGFR-2) antibody in expression.

Detailed Description Of The Invention

The invention provides and use radiotherapy, chemotherapy, and/or other receptor antagonist and vegf receptor are short of money Unite the method that alleviates or suppress the mammal tumor growth for anti-dose.

In preferred embodiments, when using vegf receptor antagonist and chemotherapeutics, radiotherapy, or other receptor antagonist or its combinatorial association treatment tumor when comprising people's tumor, can produce synergy.In other words, when vegf receptor antagonist and chemotherapeutics, radiotherapy, or other receptor antagonist or its combinatorial association be when suppressing tumor growth, can produce than desired also will good therapeutic effect.When using conjoint therapy to suppress effect that tumor growth produced than using vegf receptor antagonist and chemotherapeutics, radiotherapy, or the effect sum that other receptor antagonist produced shows synergy when also wanting big.Preferably, synergy is that the alleviation by cancer is confirmed that wherein this alleviation is to use vegf receptor antagonist and chemotherapeutics, radiotherapy, or other receptor antagonist is not predicted when carrying out therapeutic alliance.(seeing example VII A I.)

The vegf receptor antagonist is before beginning chemotherapy or radiotherapy, among, or afterwards, and combination in any, that is, before beginning chemotherapy and/or the radiotherapy and among, before and afterwards, among and afterwards, or before, among and give afterwards.For example, when the vegf receptor antagonist is antibody, antibody usually between 1-30 days before beginning radiotherapy and/or the chemotherapy, between preferred 3-20 days, more preferably administration in 5-12 days.

Radiotherapy

The radioactive source that uses with the vegf receptor antagonist combination can be external or intrinsic for the patient who is treated.When radioactive source when being external to the patient, this therapy is called as external ray radiotherapy (EBRT).When radioactive source when being intrinsic for the patient, this therapy is called as brachytherapy (BT).

Radiotherapy is according to the standard technique of knowing, and uses the standard device of making for this purpose, gives as AECL Theratron and Varian Clinac.The dosage of radiotherapy depends on multiple factor, and this is well known in the art.This factor comprises the organ that will treat, the healthy organ in the radiotherapy approach, because these healthy organ may be adversely affected unintentionally, the patient is to the toleration of radiotherapy and the body area that need treat.Described dosage is generally 1-100Gy, more preferably 2-80Gy.Some dosage of having reported comprises spinal cord 35Gy, kidney 15Gy, liver 20Gy, prostate 65-80Gy.Yet what should emphasize is that the present invention is not restricted to any specific dosage.Dosage can comprise that above-mentioned factor is definite by the doctor in charge according to the specific factor in the known case.

External radioactive source and the distance that enters between the point in the patient can be any distance, and its representative is being killed target cell and made side effect reach acceptable balance between the minimum.Usually, external radioactive source distance enters the some 70-100cm in the patient.

Usually, brachytherapy is undertaken by radioactive source is placed among the patient.Usually, radioactive source is placed on the about 0-3cm of the tissue place that distance will be treated.Known technology comprises a matter, intracavity and surperficial brachytherapy.Radioactive source can forever or temporarily be implanted.Some the typical radioactive atom that uses in the permanent implant comprises iodine-125 and radon.The typical radioactive atom of some that use in the temporary implant comprises radium, caesium-137, and iridium-192.Some other radioactive atom that has been used for brachytherapy comprises americium-241 and gold-198.

The radiotherapy dosage of brachytherapy can be identical with above-mentioned external ray radiotherapy.Except above-mentioned, be used for determining when determining the dosage of brachytherapy, also will considering the character of used radioactive atom outside the factor of external ray radiotherapy dosage.

Chemotherapy

Chemotherapeutics comprises all chemical compounds that can effectively suppress tumor growth.

The administration of chemotherapeutics can be carried out in every way, comprises by parenteral and the administration of enteral approach whole body.In embodiment, vegf receptor antagonist and chemotherapeutics can be used as independently molecule separate administration therein.In another embodiment, the vegf receptor antagonist is by being connected with the chemotherapeutics coupling.

The example of chemotherapeutics comprises alkylating agent, for example, and nitrogen mustards, ethylenimine compound and alkylsulfonate; Antimetabolite, for example, folic acid, purine or pyrimidine antagonist; Mitosis division inhibitor, as, vinblastine and podophyllotoxin derivative; Cytotoxic antibiotic; Infringement or the chemical compound that disturbs DNA to express.

In addition, chemotherapeutics comprises antibody described herein, biomolecule and micromolecule.

The object lesson of chemotherapeutics comprises cisplatin, dacarbazine (DTIC), dactinomycin, chlormethine (chlormethine); streptozotocin, cyclophosphamide, carmustine (BCNU), chlorethyl cyclohexyl nitrosourea (CCNU); amycin (adriamycin), daunorubicin, procarbazine, mitomycin; cytarabine, etoposide, methotrexate, 5-fluorouracil; vincaleucoblastine, vincristine, bleomycin, paclitaxel (taxol); docetaxel (deacetylation paclitaxel), Ah Di flows Tianjin, asparaginase, busulfan; carboplatin, cladribine, dacarbazine, floxuridine; fludarabine, hydroxyurea, ifosfamide, interferon-ALPHA; Acetate, megestrol, melphalan, purinethol; plicamycin, mitotane, Pegaspargase, pentostatin; pipobroman, mithramycin, streptozotocin; tamoxifen, teniposide, testolactone; thioguanine, thiophene is for group, uracil mustard; Vinorelbine, chlorambucil, taxol and combination thereof.

Growth factor receptor antagonist

The used growth factor receptor antagonist (except the vegf receptor antagonist) of the present invention comprises all substances that the part that can suppress growth factor receptors stimulates growth factor receptors.The inhibition of this stimulation can suppress to express the cell growth of growth factor receptors.

Some example that relates to tumorigenic growth factor receptors is epidermal growth factor (EGFR), platelet-derived somatomedin (PDGFR), insulin like growth factor (IGFR), nerve growth factor (NGFR), and the receptor of fibroblast growth factor (FGF).

Preferably, the used growth factor receptor antagonist of the present invention is the EGFR antagonist.EGFR antagonist of the present invention is a biomolecule, micromolecule, or any other material, they can suppress the EGFR activation, suppress the tyrosine kinase activity of EGFR thus, and prevent the receptor autophosphorylation, and other protein phosphorylation that relates to various EGFR signal pathways.The activatory inhibition of EGFR is meant the activatory any reduction of EGFR, and it need not to stop fully or stop the activation of EGFR.

In addition, the activatory inhibition of EGFR of the present invention's definition is meant because the EGFR that EGFR antagonist and acceptor interaction produce suppresses.Interaction is meant sufficient physics or chemical interaction between EGFR antagonist and the receptor, so could suppress the activity of tyrosine kinase.Those skilled in the art should understand this chemically interactive example, and it is included between EGFR antagonist and the receptor, and association known in the art or bonding also comprise covalent bonding, ionic bonding, hydrogen bonding etc.Form contrast with the EGF antagonist, it and ligand interaction suppress activation thus.

According to the concrete condition of other somatomedin, the activatory increase of EGFR may be because ligand level raises, EGFR gene amplification, and receptor transcription increases or causes that the sudden change increase of raising receptor signal causes.The amplification of coding EGFR gene causes increasing with the bonded part number of EGFR, thereby further stimulates cellular proliferation.EGFR also can not have overexpression under the situation of gene amplification, is to transcribe by increasing EGFR by inference, mRNA translation, or the sudden change of protein stability is finished.The EGFR mutant is in glioma, and nonsmall-cell lung cancer identifies in ovarian cancer and the carcinoma of prostate that they have the tyrosine kinase of constitutive activity, shows the active effect of high-level EGFR, rather than the effect of EGFR overexpression in these cancers.See, for example, Pedersen etc., Ann.Oncol., 12 (6): 745-60 (2001).(EGFRvIII of III type EGFR sudden change-various name, de2-7EGFR or AEGFR-lack the part by the outer ligand binding domain of born of the same parents of exon 2-7 coding); See Wikstrand etc., Cancer Res., 55:3140-3148 (1995).

In one of them embodiment of the present invention, the EGFR antagonist suppresses EGFR and combines with its part.But the extracellular domain of part and EGFR outside combine the costimulatory receptor dimerization, EGFR autophosphorylation, the activation of the inside cytoplasmic tyrosine kinase domain of receptor and relate to the initiation of the synthetic and a plurality of signal transduction pathways that cell division is regulated of DNA.The part of EGFR comprises, for example, and EGF, TGF-α, amphiregulin, heparin-in conjunction with EGF (HB-EGF) and betarecullulin.EGF and TGF-α are the main endogenic ligands that can cause the stimulation of EGFR-mediation, although TGF-α promote aspect the blood vessel generation more effective.

In another embodiment of the present invention, the EGFR antagonist is in conjunction with EGFR.Should understand the EGFR antagonist can divide outside the combination with the born of the same parents outside of EGFR, suppresses or does not suppress the combination of part, or combine with tyrosine kinase domain is inner.Example in conjunction with the EGFR antagonist of EGFR comprises, but is not restricted to, and biomolecule as the antibody special to EGFR (and function equivalent), directly acts on the synthetic inhibitors of kinases of EGFR cytoplasm domain, as micromolecule.

The biomolecule that EGFR antagonist of the present invention is preferably special to EGFR, more preferably antibody, or its function equivalent.Description to the used antibody of the present invention can be found in the part of " antibody " by name.In addition, after antibodies, preferably make EGFR-antibody complex internalization and degraded, prevent that receptor from being utilized by cell again.

Known biomolecule EGFR antagonist is ERBITUX ^TM(IMC-C225), it is chimeric (people/mice) monoclonal antibody special to EGFR.See, for example, U.S. Patent number 4,943,533 (Mendelsohn etc.); U.S. Patent number 6,217,866 (Schlessinger etc.); U. S. application number 08/973,065 (Goldstein etc.) and 09/635,974 (Teufel); WO99/60023 (Waksal etc.) and WO00/69459 (Waksal).Monoclonal antibody ERBITUX ^TMSpecificity is in conjunction with EGFR, and block ligand, for example the combination of EGF.This blocking-up can suppress tumor growth, comprises by disturbing the EGFR activation to suppress tumor invading, and shifts, and cytothesis and blood vessel take place.In addition, or optionally, monoclonal antibody ERBITUX ^TMThe internalization of receptor-antibody complex be can promote, its part or the further costimulatory receptor of any other mechanism prevented.

Other example of biomolecule EGFR antagonist is ABX-EGF, and it is the complete human IgG special to EGFR ₂Monoclonal antibody.ABX-EGF in conjunction with EGFR, blocks EGFR and two part, the combination of EGF and TGF-α with higher specificity.See, for example, Figlin etc., the summary 1102 of ASCO the 37th phase annual meeting, San Francisco, CA, 12-15 day May calendar year 2001.Before be known as the sequence of the ABX-EGF that clones E7.6.3 and be described in U.S. Patent number 6,235,883 (Abgenix, Inc.) open among the 28th hurdle the 62nd row-Di 29 hurdles the 36th row and Figure 29-34.See Yang etc., Critical Rev.Oncol./Hematol., 38 (1): 17-23,2001.

In alternative, but also be in the embodiment preferred, EGFR antagonist of the present invention is micromolecular tyrosine kinase inhibitor.Micromolecular description can be found in the part of " micromolecule " by name.Described and used a lot of micromolecule to suppress EGFR.

For example, Spada etc., United States Patent (USP) 5,656,655 discloses the heteroaryl compound that the styryl that can suppress EGFR replaces.Described heteroaryl is to have one or two heteroatomic monocycle, or has about 4 the heteroatomic dicyclos of 1-, and this chemical compound can be optionally substituted or be polysubstituted.United States Patent (USP) 5,656,655 disclosed chemical compounds are introduced herein as a reference.

Spada etc., United States Patent (USP) 5,646,153 disclose two monocycles and/or the aryl heteroaryl of dicyclo, carbocyclic ring and the assorted carbocyclic compound that can suppress EGFR.United States Patent (USP) 5,646,153 disclosed chemical compounds are introduced herein as a reference.

Bridges etc., United States Patent (USP) 5,679,683 disclose the tricyclic pyrimidine chemical compound that can suppress EGFR.Described chemical compound is the condensed heterocycle pyrimidine derivatives, at the 35th row-Di 5 hurdles, the 3rd hurdle the 6th line description.These chemical compounds of the 35th row-Di 5 hurdles, the 3rd hurdle the 6th line description are introduced herein as a reference.

Barker, United States Patent (USP) 5,616,582 disclose and have receptor tyrosine kinase and suppress active quinazoline derivant.United States Patent (USP) 5,616,582 disclosed chemical compounds are introduced herein as a reference.

Fry etc., Science, 265:1093-1095 (1994) disclose the chemical compound with the structure that suppresses EGFR.Structure provides in Fig. 1.Fry etc. show the chemical compound shown in article Fig. 1 and introduce herein as a reference.

Osherov etc., J.Biol.Chem., 268 (15): 11,134-42 (1993) discloses the tyrphostin that can suppress EGFR/HER1 and HER2.Osherov etc. show disclosed chemical compound in the article, particularly Table I, II, and those among III and the IV are introduced herein as a reference.

Levitzki etc., United States Patent (USP) 5,196,446 disclose heteroaryl ethylene two bases or the heteroaryl ethylene two basic aryl compounds that can suppress EGFR.United States Patent (USP) 5,196, the 42nd row-Di 3 hurdles the 40th row disclosed chemical compound in 446 the 2nd hurdles is introduced herein as a reference.

Panek etc., J.Pharma.Exp.Thera., 283:1433-1444 (1997) discloses the chemical compound that is accredited as PD166285, and it can suppress the EGFR of receptor, PDGFR and FGFR family.PD166285 be accredited as 6-(2, the 6-Dichlorobenzene base)-2-(4-(2-diethylamino ethoxy) phenylamino)-8-methyl-8H-pyrido (2,3-d) pyrimidin-7-ones, it has the 1436th page of structure shown in Figure 1.The chemical compound of describing in the 1436th page of Fig. 1 of institutes such as Panek work article is introduced herein as a reference.

One of them example of micromolecule EGFR antagonist is IRESSA ^TM(ZD1939), it is the quinozaline derivant, can be used as the ATP-analogies and suppresses EGFR.See U.S. Patent number 5,616,582 (Zeneca Limited); WO 96/33980 (Zeneca Limited) page 4; See Rowinsky etc., the summary 5 of ASCO the 37th phase annual meeting, San Francisco, CA, 12-15 day May calendar year 2001; Anido etc., the summary 1712 of ASCO the 37th phase annual meeting, San Francisco, CA, 12-15 day May calendar year 2001.

TARCEVA ^TMIt is another example of micromolecule EGFR antagonist.TARCEVA ^TM(OSI-774) be the phenylamino quinozaline derivant [6 that 4-replaces, two (2-methoxyl group-ethyoxyl)-quinazolines of 7--4-yl]-(3-acetenyl-phenyl) amine hydrochlorate] the EGFR inhibitor, it is at WO 96/30347 (Pfizer Inc.) page 2 the 12nd row-page 4 the 34th row and the 19th page of 14-17 line description.Also see Moyer etc., Cancer Res., 57:4838-48 (1997); Pollack etc., J.Pharmacol., 291:739-48 (1999).TARCEVA ^TMBy suppressing EGFR and downstream PI3/Akt phosphorylation thereof and causing MAP (mitogen activated protein) the signal transduction of kinases approach of the cell cycle arrest of p27-mediation to play a role.See Hidalgo etc., the summary 281 of ASCO the 37th phase annual meeting, San Franscio, CA, 12-15 day May calendar year 2001.

Also have a lot of other micromolecule also can suppress EGFR.Some examples of micromolecule EGFR antagonist are at WO 91/116051, WO 96/30347, WO 96/33980, WO 97/27199 (Zeneca Limited), WO 97/30034 (Zeneca Limited), WO 97/42187 (Zeneca Limited), WO 97/49688 (Pfizer Inc.), WO 98/33798 (Warner Lambert Company), WO 00/18761 (American CyanamidCompany) and WO 00/31048 (Warner Lambert Company) describe.The object lesson of micromolecule EGFR antagonist comprises C1-1033, it is a tyrosine kinase, the quinozaline of EGFR (N-[4-(3-chloro-4-fluoro-phenylamino)-7-(3-morpholine-4-base-propoxyl group)-quinazoline-6-yl]-acrylamide) inhibitor particularly is at the 8th page of 22-6 line description of WO 00/31048 (Warner-Lambert Company); PKI166, it is the pyrrolopyrimidine inhibitor of EGFR, describes at WO 97/27199 (Novartis AG) 10-12 page or leaf; GW2016, it is the inhibitor of EGFR and HER2; With E κ B569.

Other EGFR antagonist can use the method for knowing to determine at an easy rate.EGFR antagonist of the present invention can suppress the tyrosine kinase activity of EGFR, and it is usually directed to phosphorylation event.Therefore, the phosphorylation assay method can be used for determining the used antagonist of the present invention.Some algoscopy of tyrosine kinase activity is at Panek etc., and (1997) and Batley etc. describe among the Life Sci., 62:143-50 (1998).In addition, the method that can use specific detection EGFR to express.These comprise the immunohistochemistry (HIC) that detects protein expression, detect the fluorescence in situ hybridization (FISH) of gene amplification, competitive radioligand binding assay, solid matrix engram technology, as RNA and southern blotting technique, reverse transcriptase-polymerase chain reaction (RT-PCR) and ELISA.See, for example, Grandis etc., Cancer, 78:1284-1292 (1996); Shimizu etc., Japan J.Cancer Res., 85:567-571 (1994); Sauter etc., Am.J.Path., 148:1047-1053 (1996); Collins, Glia, 15:289-296 (1995); Radinsky etc., Clin.Cancer.Res., 1:19-31 (1995); Petrides etc., Cancer Res., 50:3934-3939 (1990); Hoffmann etc., Anticancer Res., 17:4419-4426 (1997); Wikstrand etc., Cancer Res., 55:3140-3148 (1995).

The vegf receptor antagonist

In embodiment, vegf receptor antagonist specificity is in conjunction with the epitope on the vegf receptor extracellular domain therein.The extracellular domain of vegf receptor is a part-in conjunction with the territory.Part-can find at any one end of receptor in conjunction with the territory, but be usually located at amino terminal.

Some examples of vegf receptor comprise protein tyrosine kinase receptor, as the flt-1 (VEGFR-1) that mentions in the document, KDR and flk-1 (VEGFR-2).Illustrate that clearly this description will be followed the conventional document nomenclature of vegf receptor except as otherwise noted or otherwise.KDR (VEGFR-2) is known as the human form (Terman etc., above-mentioned) of the vegf receptor with MW 180kD.Flk-1 (VEGFR-2) is known as the Mus homologue (Matthews etc., above-mentioned) of KDR.Flt-1 (VEGFR-1) is known as the multi-form of vegf receptor, but receptor related with KDR/flk-1 (VEGFR-2).See Shibuya etc., above-mentioned.

Other vegf receptor comprises with those of VEGF crosslinked labeling, or with KDR (VEGFR-2) altogether-those of immunoprecipitation.The molecular weight of these some form known of vegf receptor is approximately 170KD, and 150KD, 130-135KD, 120-125KD and 85KD. see, for example, and Quinn etc., Proc.Nat ' l Acad.Sci USA, 90:7533-7537 (1993); Scher etc., J.Biol.Chem., 271:5761-5767 (1996).

Common and the cell of vegf receptor is as the endotheliocyte combination.Vegf receptor also can with non--endotheliocyte, as the tumor cell combination.Optionally, vegf receptor can be free on cell, preferred soluble form.

But antagonist neutralize VEGF receptor of the present invention.In this manual, in and receptor be the inherent kinase activity deactivation of instigating receptor, thereby transduction signal.The neutral reliable determination method of vegf receptor is to suppress receptor phosphorylation.

The present invention is not subjected to the restriction of the neutral any special mechanism of vegf receptor.When this application of application, also do not understand mechanism, by wherein the neutral mechanism of a kind of antagonist need not be with identical by the neutral mechanism of another kind of antagonist by antibody neutralize VEGF receptor.Some possible mechanism comprises that hindering the VEGF part combines the territory combination with the born of the same parents of vegf receptor are outer, and prevents receptor dimerization or oligomerization.Yet, can not get rid of other mechanism.

Vegf receptor of the present invention (or VEGFR) antagonist is a biomolecule, micromolecule, or any other material of inhibition receptor VEGFR subfamily.The activatory inhibition of receptor VEGFR subfamily is meant the activatory any reduction of VEGFR.That is, when hindering activation, need not to stop fully the VEGFR activation.In addition, after the activatory inhibition of the defined VEGFR of the present invention is meant that VEGFR antagonist and VEGFR interact, the inhibition of VEGFR antagonist.Association is meant sufficient physics or chemical interaction between VEGFR antagonist and the VEGFR, thereby suppresses the tyrosine kinase activity of receptor.Those skilled in the art should understand this chemically interactive example, comprise association known in the art or bonding, comprise covalent bonding, ionic bonding, hydrogen bonding etc.Therefore, VEGFR antagonist of the present invention can suppress the tyrosine kinase activity of receptor, hinders receptor autophosphorylation and various other protein phosphorylations that relate to the VEGFR signal pathway.This approach that relates to blood vessel generation and angiopoietic adjusting comprises following any: phospholipase C γ (PLC γ) approach or phosphatidylinositols 3 ' kinases (PI3-K)/Akt and the activated protein kinase of mitogen (MAPK) approach.See, for example, Larriv é e etc., Int ' l J.Mol.Med., 5:447-56 (2000).

Receptor VEGFR subfamily is characterised in that 7 immunoglobulin-like rings in the extracellular domain, single exist (III receptoroid tyrosine kinase) of striding the tyrosine kinase domain that ruptures in film district and the intracellular region.Receptor VEGFR subfamily also has a lot of known members, and its example comprises VEGFR-1, VEGFR-2, and VEGFR-3.It is believed that KDR (VEGFR-2) is main VEGF signal transducer, it can cause the propagation of endotheliocyte, migration, and differentiation, pipe forms, the keeping of the increase of vascular permeability and vascular integrity.VEGFR-1 has more weak kinase activity, and when being subjected to the VEGF stimulation, can not produce mitogenic response, combines with VEGF though it can be higher than the about 10 times affinity of KDR (VEGFR-2).VEGFR-1 also relates to the generation of VEGF and the inductive mononuclear cell of placental growth factor (PIGF) and macrophage migration and tissue factor.

For above-mentioned EGFR, the activatory increase of VEGFR may be by high-caliber part, the amplification of VEGFR gene, the increase of receptor transcription or cause that the sudden change of raising receptor signal causes.

In one of them embodiment of the present invention, the VEGFR antagonist suppresses VEGFR and combines with its part.But part combines the costimulatory receptor dimerization with the extracellular domain of VEGFR outside, VEGFR autophosphorylation, the activation of the inner cytoplasmic tyrosine kinase domain of receptor and relate to vascularization and the initiation of a plurality of signal transduction pathways of the adjusting that blood vessel takes place.

The part of VEGFR comprises VEGF and congener P1GF thereof, VEGF-B, VEGF-C, VEGF-D, and VEGF-E.For example, P1GF, it is a dimerization secreting type factor in conjunction with VEGFR-1, and it is by the villus cell trophoderm, and the outer trophoderm of syntrophoblast and fine hair produces in a large number, and the homology of its aminoacid sequence and VEGF is very high.The mankind have 3 kinds of isotypes, P1GF-1, P1GF-2, and P1GF-3.To lacking studies confirm that of P1GF mice, this somatomedin itself takes place to have nothing to do with blood vessel, but but the blood vessel in the specificity adjusting pathological process takes place and the osmosis of VEGF.And VEGF-D and VEGF-C are closely related, and this is to can not find N-and the terminal existence of extending of C-because be in other VEGF family member.In adult tissue, the mRNA of VEGF-D is at heart, lung, and skeletal muscle, the content in colon and the small intestinal is the abundantest.The analysis that the VEGF-D receptor-specific is carried out discloses, and VEGF-D is the part of VEGFR-2 (Flk1) and VEGFR-3 (Flt4), and can activate these receptors; Yet VEGF-D is not in conjunction with VEGFR-1.In addition, VEGF-D is the mitogen of endotheliocyte.

In another embodiment of the present invention, the VEGFR antagonist is in conjunction with VEGFR.Will be appreciated that the VEGFR antagonist can divide outside the combination with the born of the same parents outside of VEGFR, suppresses or do not suppress the combination of part, the VEGFR antagonist also can combine with tyrosine kinase domain is inner.Example in conjunction with the VEGFR antagonist of VEGFR comprises, but is not restricted to, and biomolecule is as receptor ribozyme and the antibody (or its function equivalent) special to VEGFR with directly act on the synthetic inhibitors of kinases in VEGFR cytoplasmic structure territory, as micromolecule.Preferred VEGFR antagonist of the present invention is the biomolecule special to VEGFR, and more preferably antibody or its function equivalent below will be for a more detailed description to them.Optionally, VEGFR antagonist of the present invention is the micromolecule inhibitors of kinases, will be described in detail it below.

In preferred embodiment, VEGFR receptor antagonist specificity is in conjunction with VEGFR-1 therein.Special preferred antigens is conjugated protein, and it can be in conjunction with the ectodomain of VEGFR-1, and by its one or two part, VEGF and P1GF blocking-up combination, and/or neutralize VEGF-inductive or inductive VEGFR-1 activation of P1GF.For example, mAb 6.12 is and solubility the bonded scFv of the VEGFR-1 of cell surface expression.ScFv 6.12 contains the V of mouse monoclonal antibody mAb 6.12 _LAnd V _HDomain.Produce the hybridoma cell line preservation of mAb 6.12, ATCC number is PTA-3344.Preservation is the regulation according to budapest treaty, carries out in the microbial preservation mechanism that is used for proprietary program and regulations thereof (budapest treaty).Making the culture of can guaranteeing to live like this kept 30 years from preservation.According to budapest treaty, under the situation of reaching an agreement between applicant and the ATCC, can obtain organism from ATCC, can guarantee like this related U.S. patent openly after, use it without restriction.According to the regulation of Patent Law, when carrying out this invention, need not under the mandate of any administrative organization, use preservation strain.

Other preferred antibody is at embodiment, embodiment XII particularly, and XIII, and XIV, and describe among the SEQ ID NO:1-83.In addition, the wherein part of these preferred VEGFR antibody antagonisies is described among Int ' the l J.Cancer, 97:393-399 (2002) at Lu etc.

The hybridoma that also has various generation VEGFR-2 antibody.For example, the preserving number of the hybridoma cell line (DC101) of generation rat anti-mouse VEGFR-2 monoclonal antibody is ATCC HB11534; The preserving number that produces the hybridoma cell line (M25.18A1) of mouse anti mice VEGFR-2 monoclonal antibody mAb 25 is ATCC HB 12152; The preserving number that produces the hybridoma cell line (M73.24) of mouse anti mice VEGFR-2 monoclonal antibody mAb 73 is ATCC HB12153.

In addition, the various hybridomas that produce anti-VEGFR-1 antibody comprise, but are not restricted to hybridoma KM1730 (preserving number FERM BP-5697), KM1731 (preserving number FERM BP-5718), hybridoma KM1732 (preserving number FERM BP-5698), KM1748 (preserving number FERMBP-5699), hybridoma KM1750 (preserving number FERM BP-5700), they are at WO98/22616, WO 99/59636, describes among Australian application number AU 1,998 50666 B2 and the Canadian application number CA 2328893.

A lot of other VEGFR antagonisies also are known in the art.Some example of VEGFR antagonist is at U. S. application number 07/813,593; 07/906,397; 07/946,507; 07/977,451; 08/055,269; 08/252,517; 08/601,891; 09/021,324; 09/208,786; With 09/919,408 (all belong to Lemischka etc.); U.S. Patent number 5,840,301 (Rockwell etc.); U. S. application number 08/706,804; 08/866,969; 08/967,113; 09/047,807; 09/401,163; With 09/798,689 (all belong to Rockwell etc.); U. S. application number 09/540,770 (Witte etc.); And describe among the PCT/US01/06966 (Liao etc.).U.S. Patent number 5,861,301 (Terman etc.), Terman etc., Oncogene 6:1677-1683 (in JIUYUE, 1991), WO 94/10202 (Ferrara etc.) and WO 95/21865 (Ludwig) disclose VEGFR antagonist, particularly anti-VEGFR-2 antibody.In addition, PCT/US95/01678 (Kyowa Hakko) has described anti-VEGFR-2 antibody.Anti-VEGFR antibody is also described in U. S. application number 09/976,787 (Zhu etc.).U.S. Patent number 6,177,401 (Ullrich etc.), the VEGFR antagonist that 5,712,395 (App etc.) and 5,981,569 (App etc.) describe is an organic molecule.In addition, bi-specific antibody (BsAbs) is known, and it is the antibody with two kinds of different antigen-binding specificities or site, at KDR (VEGFR-2) and VEGFR-1.See, for example, U. S. application number 09/865,198 (Zhu); 60/301,299 (Zhu).

Hennequin etc. at J.Med.Chem.42, disclose some and can be used as the quinazoline of vegf receptor antagonist, quinoline and cinnolines among the 5369-5389 (1999).See Annie etc., Journal of Acquired Immune Deficiency Syndromes and HumanRetrovirology 17, A41 (1998).Disclosed vegf receptor antagonist is introduced herein as a reference in the article that Hennequin etc. is shown.

In addition, App etc. (USPN:5,849,742) disclose and can be used as the quinazoline that tyrosine kinase inhibitor works, quinoxiline, substituted aniline ， isoxazole, acrylonitrile and phenyl acrylonitrile compound.Hennequin etc., Annie etc. also can be used as vegf receptor antagonist of the present invention with the micromolecule of descriptions such as App.

In addition, the algoscopy of determining the VEGFR antagonist is well known in the art, therefore, is applicable to that candidate antagonist of the present invention can identify at an easy rate.VEGFR antagonist of the present invention can suppress the tyrosine kinase activity of VEGFR, and it is usually directed to phosphorylation event.Therefore, the phosphorylation assay method can be used for determining VEGFR antagonist of the present invention.Some algoscopy of tyrosine kinase activity is at Panek etc., J.Pharmacol.Exp.Thera., and 283:1433-44 (1997) and Batley etc. describe among the Life Sci., 62:143-50 (1998).In addition, the method that also can use specific detection VEGFR to express.

Antibody

Antibody of the present invention can be by methods known in the art production.These methods comprise immunological method, by Kohler and Milstein, Nature, 256:495-497 (1975) and Campbell, monoclonal antibody technique, the production of rodent and human hybridoma and description, Burdon etc., Eds., biochemistry and molecular biological laboratory technique, 13 volumes, Elsevier Science Publishers, Amsterdam (1985) describes; And Huse etc., Science, 246, the recombinant DNA method that 1275-1281 (1989) describes.

Antibody of the present invention can be the antibody of monoclonal antibody or polyclonal antibody or any other suitable type, fragment or derivant as antibody, the synthetic homologue of single-chain antibody (scFv) or antibody is as long as antibody has and the same or analogous associativity of those complete antibodies.Maybe can know clearly except as otherwise noted from context, the domain of antibody used herein, the district is consistent with standard definition well known in the art with fragment.See, for example, Abbas etc., cell and molecular immunology, W.B.Saunders Company, Philadelphia, PA (1991).Preferred antibody of the present invention is monoclonal antibody.

Antibody fragment can be by the cracking complete antibody, or should segmental DNA generation by expressing coding.Antibody fragment can be by Lamoyi etc., J.Immunol.Methods, 56:235-243 (1983) and Parham, the described method preparation of J.Immunol.131:2895-2902 (1983).This fragment can contain one or two Fab fragment or F (ab ') ₂Fragment.This fragment also can contain single-chain fragment variable region antibody, that is, and and scFv, double antibody, or other antibody fragment.Produce the method for this function equivalent and apply for WO93/21319, European Patent Application No. 239,400 at PCT; PCT applies for WO 89/09622; European patent application 338,745; With open in the European patent application EP 332,424.

Single-chain antibody (scFv) is made up of antibody heavy chain variable region that uses the joint that maybe need not interconnect to connect and variable region of light chain.Therefore, scFv contains complete antibody combining site.These chains can be on antibacterial, or produces in the eukaryotic cell.An example of single-chain antibody is p1C11.(the example I X of face as follows.) interaction of p1C11 VEGF-KDR capable of blocking (VEGF-VEGFR-2), suppress receptor phosphorylation and HUVEC mitosis that VEGF-stimulates.This scFv both can be in conjunction with the solubility KDR on the HUVEC (VEGFR-2), again can be in conjunction with the KDR (VEGFR-2) of cell surface expression.The sequence of p1C11 is shown in SEQ ID No:21.Can constitute chimeric antibody or humanized antibody to above-mentioned single-chain antibody by methods known in the art, for example, the example I X-3 of face as follows.One of them example of chimeric scFv is chimeric p1C11, that is, and and c-p1C11.

Preferred described antibody fragment contains whole 6 complementary determining regions of complete antibody, although the contained this district of fragment is less, as contains 3,4 or 5 CDRs, and it also can be functional.If antibody is too short so that be not immunogenic, so it can with the carrier molecule coupling.Some suitable carrier molecules comprise keyhole limpet hemocyanin and bovine serum albumin.Coupling can be undertaken by methods known in the art.

Antibody of the present invention also comprises can be by directly sudden change, affinity maturation, and phage display, or chain mixing method improves associativity those.By making CDRs sudden change, and screening has the antigen binding site of desirable characteristics, can modify or improve affinity and specificity (see, for example, Yang etc., J.Mol.Bio., 254:392-403 (1995)).CDRs suddenlys change with the whole bag of tricks.One of them method is the combining randomization that makes single residue or residue, in other identical antigen binding site group, just can find whole 20 seed amino acids at ad-hoc location like this.Optionally, sudden change can be passed through the fallibility PCR method, on multiple CDR residue, induce (see, for example, Hawkins etc., J.Mol.Bio., 226:889-896 (1992)).The Vector for Phage Display that contains heavy chain and chain variable region gene is bred (see, for example, Low etc., J.Mol.Bio., 250:359-368 (1996)) in colibacillary mutator strain.The method of these mutation is illustrating of several different methods well known by persons skilled in the art.

Antibody of the present invention can also be to have class species, for example antibody variable region of mice, and different plant species, for example chimeric antibody of people's antibody constant region.Optionally, antibody of the present invention can be humanized antibody, and it has and derives from wherein class species, for example the framework variable region and the constant region of the hypermutation of the antibody of mice or complementary determining region (CDRs) and human antibodies.Optionally, antibody of the present invention can be the human antibodies with human antibodies constant region and variable region.

Antibody, particularly monoclonal antibody can be by methods known in the art productions.The example of producing antibody comprises, but is not restricted to, and produces in hybridoma and with the DNA transformed mammalian cell of the receptor antagonist of encoding.These methods are open in various publications, comprise immunological method, by Kohler and Milstein, Nature, 256:495-497 (1975) and Campbell, " monoclonal antibody technique, the production of rodent and human hybridoma and description ", Burdon etc., Eds., biochemistry and molecular biological laboratory technique, 13 volumes, Elsevie Science Publishers, Amsterdam (1985); With Huse etc. at Science, the recombinant DNA method of describing among the 246:1275-1281 (1989).

The antibody equivalent also can prepare by methods known in the art.For example, antibody fragment can prepare from the complete antibody enzymatic.Preferably, the antibody equivalent is from the DNA of this equivalent of encoding preparation.The segmental DNA of encoding antibody is by the excalation except that the required part of DNA of coding full length antibody is prepared.The DNA of coding chimeric antibody can prepare by the DNA reorganization that makes the coding human constant region, they derive from corresponding people's antibody district basically or only, also can prepare by the DNA reorganization that makes the coding variable region, they derive from the mammal variable region sequences except that the people basically or only.The DNA of coding humanized antibody can recombinate by the DNA that makes the constant region of coding except that complementary determining region (CDRs) and variable region and prepare, they derive from corresponding people's antibody district basically or only, also can prepare by the DNA reorganization that makes coding CDRs, they derive from the mammal except that the people basically or only.

The suitable source of the segmental dna molecular of encoding antibody comprises cell, and as hybridoma, it can express full length antibody.Self can be used as the antibody equivalent this fragment, or according to the top described equivalent that is rearranged into.The DNA disappearance and the reorganization of this part description can be undertaken by known method, as those disclosed in the listed patent application of " function equivalent of antibody " part by name, and/or other standard recombinant dna technology, those as describing below.

Being used to carry out the preferred host cell that carrier transforms and receptor antagonist of the present invention is expressed is mammalian cell, for example, the COS-7 cell, the cell line in Chinese hamster ovary (CHO) cell and lymph source, as lymphoma, myeloma, or hybridoma.Also alternative other eucaryon host that uses is as yeast.For example, mouse fetal liver stromal cell lines 2018 can be in conjunction with AP labelling-flk1 and Ap labelling-flk-2 fusion rotein, promptly, contain VEGFR-2 and flk-2 (ATCC, Manassas, VA, CRL 10907) part, spleen of human fetus cell line Fsp 62891 contains flk-2 part (ATCC CRL 10935) and people's substrate fetal thymus cell line, and F.thy62891 contains VEGFR-2 part (ATCC CRL 10936).

Transformed host cells is utilized in the methods known in the art liquid medium within and is cultivated, described fluid medium contains assimilable carbon source (carbohydrate is as glucose or lactose), nitrogenous source (aminoacid, peptide, albumen or their catabolite, as peptone, ammonium salt etc.), and inorganic salt (sodium, potassium, the sulfate of magnesium and calcium, phosphate and/or carbonate).In addition, culture medium also contains, and for example, promotes the material of growth, as trace element, for example, ferrum, zinc, manganese etc.

When needs were expressed gene construct in yeast, the suitable selection gene that is used for yeast was the trp1 gene that is present among the yeast plasmid YRp7.Stinchcomb etc., Nature, 282:39 (1979); Kingsman etc., Gene, 7:141 (1979).The trp1 gene can be yeast mutant selected marker is provided, and described yeast lacks the ability of growing in tryptophan, for example, and ATCC No.44076 or PEP4-1.Jones，Genetics，85：12(1977)。The infringement of trp1 can be to detect to transform by the growth under the deficiency of tryptophan situation in the yeast host cell genome provides effective environmental.Equally, Leu2-defective yeast strains (ATCC 20,622 or 38,626) is to be replenished by the known plasmid that contains the Leu2 gene.

Optionally, the DNA of coding receptor antagonist can be cloned into and be derived from virus, and as the adenovirus adeno associated virus, herpesvirus is in the carrier of retrovirus or slow virus.Gene expression can be regulated sequence control by induction type or non-induction type.

Briefly, select to contain and express required DNA, as antibody, the suitable cell source of the nucleic acid molecules of antibody equivalent or vegf receptor.Total RNA prepares from suitable source by standard procedure.Total RNA is used to instruct cDNA synthetic.The standard method of isolation of RNA and synthetic cDNA provides in molecular biological manual of standards, for example, above-mentioned those.

CDNA can increase by known method.For example, cDNA can be used as the template that increases by polymerase chain reaction (PCR); See Saiki etc., Science, 239, 487 (1988) or Mullis etc., United States Patent (USP) 4,683,195.The oligonucleotide primers sequence of carrying out pcr amplification derives from the known array that is amplified.Oligonucleotide is synthetic by methods known in the art.Suitable method comprises by Caruthers at Science 230, those that 281-285 (1985) describes.

Pcr amplification uses the mixture of upstream and downstream oligonucleotide.According to standard procedure, according to each specific primer to optimal conditions.Utilize the cDNA of electrophoretic analysis PCR product, described cDNA have and primer between the corresponding suitable size of sequence.Optionally, can increase in two or more overlapping fragmentses in the coding region.Overlapping fragments is designed to include a restriction site, thereby makes segmental global cDNA assembling.

In order to separate the complete protein-coding region of vegf receptor, for example, the sequence complementation of the PCR oligonucleotide primers of upstream and 5 ' end preferably contains 5-10 at least upstream nucleotide of ATG start codon and start codon.3 ' terminal sequence complementation of the PCR oligonucleotide primers in downstream and required DNA sequence.The outer part of the whole born of the same parents of required DNA sequence optimized encoding vegf receptor, and optional coding strides the film district all or part of, and/or all or part of of intracellular region comprise termination codon.

The DNA of amplification, as encoding antibody, the antibody equivalent, or the DNA of vegf receptor can duplicate in the various cloning vehicles in various host cells.Host cell can be prokaryotic cell or eukaryotic cell.

Wherein the carrier of montage DNA can contain chromosome, the fragment of non--chromosome and synthetic DNA sequence.Some suitable procaryotic clone carriers comprise and derive from colibacillary plasmid, as colE1, and pCR1, pBR322, pMB9, pUC, pKSM, and RP4.Prokaryotic vector also comprises the derivant of phage DNA, as M13 and other thread single stranded DNA phage.The preferred vector that is used for the nucleic acid of clones coding vegf receptor is a baculovirus vector.

The carrier transfection that contains DNA to be expressed in suitable host cells.Host cell is kept in the suitable culture base, and grows under the condition that cell and carrier duplicate.Carrier can reclaim from cell.DNA to be expressed can be from carrier recovery.

DNA to be expressed, as encoding antibody, the antibody equivalent, or the DNA of receptor is inserted in the suitable expression vector, and in suitable protokaryon or eukaryotic cell, express.

For example, be inserted into the outer part of whole born of the same parents of the DNA codified vegf receptor in the host cell, or the soluble fragments of the outer part of coding vegf receptor born of the same parents.The outer part of the vegf receptor born of the same parents of dna encoding is chosen wantonly at 5 ' end or 3 ' end or two ends and is connected with additional aminoacid sequence.Additional aminoacid sequence can be connected with the extracellular region of vegf receptor, as the targeting sequencing of vegf receptor, strides film district and/or intracellular region.Additional aminoacid sequence also can be the sequence that is not connected with vegf receptor.Preferably, this additional aminoacid sequence can be brought into play special effect, as improving expression, secretion, dissolubility, or immunogenicity.

Be used on antibacterial, particularly the proteic carrier of expression in escherichia coli is known.This carrier comprises by Dieckmann and Tzagoloff at J.Biol.Chem. 260, the PATH carrier of describing among the 1513-1520 (1985).These carriers contain the DNA sequence of coding anthranilate synthetase (TrpE), are the carboxyl terminal polylinker then.Other expression vector system is with beta galactosidase (pEX); λ P _LMaltose-binding protein (pMAL); And glutathione S-transferase (pGST) be the basis, see Gene 67, 31 (1988) and PeptideResearch 3, 167 (1990).

The carrier that uses in yeast also is available.Suitable example is 2 μ plasmids.

The appropriate carrier that is used for expressing at mammalian cell also is known.This carrier comprises the SV-40 derivant of knowing, adenovirus, the deutero-DNA sequence of retrovirus and derive from the shuttle vector of functional mammal carrier combinations, those and functional plasmid and phage DNA as described above.

Other carrier for expression of eukaryon be known in the art (for example, P.J.Southern and P.Berg, J.Mol.Appl.Genet., 1, 327-341 (1982); Subramani etc., Mol.Cell.Biol., 1:854-864 (1981); Kaufmann and Sharp, " using the amplification and the expression of the sequence of instrumentality dihydrofolate reductase complementary DNA gene co-transfection ", J.Mol.Biol. 159, 601-621 (1982); ) Kaufmann and Sharp, Mol.Cell.Biol. 159, 601-664 (1982); Scahill etc., " expression and the description of people's immune interferon DNA gene outcome in the Chinese hamster ovary cell ", Proc.Nat ' lAcad.Sci.USA 80, 4654-4659 (1983); Urlaub and Chasin, Proc.Nat ' lAcad.Sci.USA 77, 4216-4220, (1980).

The used expression vector of the present invention contains at least one expression control sequenc, and it is connected with DNA sequence to be expressed or fragment operability.Control sequence is inserted in the carrier, thus the expression of control and adjusting cloned dna sequence.The example of effectively expressing control sequence is the lac system, trp system, tac system, the trc system, the main operon and the promoter region of phage, the control zone of fd coat protein, zymic glycolysis promoter, for example, the kinase whose promoter of 3-phoshoglyceric acid, the promoter of leavening acid phosphatase, for example, Pho5, the promoter of yeast α-mating factor and derive from polyoma, adenovirus, retrovirus, with the promoter of simian virus, for example, early stage and late promoter or SV40, with other sequence, known their may command protokaryons or eukaryotic cell and their virus or the gene expression of its combination.

Containing control signal and DNA to be expressed, as encoding antibody, the antibody equivalent, or the carrier of the DNA of vegf receptor is inserted in the host cell and expresses.Some effectively expressing host cells comprise protokaryon and the eukaryotic cell of knowing.Some suitable prokaryotic hosts comprises, for example, escherichia coli, as escherichia coli SG-936, escherichia coli HB101, escherichia coli W3110, escherichia coli X1776, escherichia coli X2282, escherichia coli DHI and escherichia coli MRC1, Rhodopseudomonas, Bacillus, as bacillus subtilis, and streptomyces.Suitable eukaryotic cell comprises yeast and other fungus in the tissue culture, insecticide, and zooblast, as COS cell and Chinese hamster ovary celI, human cell and plant cell.

Behind the host cell invading the exterior soothing the liver in being maintained at appropriate media, can from culture medium, separate polypeptide to be expressed or peptide, as encoding antibody, antibody equivalent, or the polypeptide of vegf receptor or peptide, and utilize methods known in the art to carry out purification.If polypeptide or peptide are not secreted in the culture medium, before separation and purification, dissolve host cell earlier so.

In addition, antibody of the present invention can inoculation prepares to mammalian immune by using soluble recepter.Self can be used as immunogen described soluble recepter, or with carrier protein or other object, as pearl, that is, sepharose 4B connects.After mammal produces antibody, separate the cell mixture that produces antibody, as splenocyte.Monoclonal antibody can be by separate producing each cell of antibody from mixture, and by cell and tumor cell, makes their infinite multiplications and prepare as myeloma cell's fusion.The gained hybridoma is kept in the culture medium, and expresses monoclonal antibody, and they are gathered from culture medium.

Antibody also can be from preparing with the bonded receptor of cell surface, and described cell can be expressed the target specific receptor.With the cell of receptors bind can be the cell of natural expressed receptor, as be used for the vascular endothelial cell of VEGF expression R.Optionally, with the cell of the DNA of the cell of the receptors bind coding receptor that can be wherein transfection, as the 3T3 cell, it has used the VEGFR transfection.

Receptor can be used as immunogen, thereby obtains antibody of the present invention.The receptor peptide can obtain from natural origin, obtains as the cell from expressed receptor.For example, the vegf receptor peptide can obtain from vascular endothelial cell.Optionally, synthetic receptor peptide can use commercially available machine preparation.In this embodiment, the vegf receptor aminoacid sequence of flt-1 (VEGFR-1) for example by Shibuya etc. at Oncogene 5,519-524 provides in (1990); The vegf receptor aminoacid sequence of KDR (VEGFR-2) is by PCT/US92/01300 and Terman etc., and Oncogene6:1677-1683 (1991) provides; The vegf receptor aminoacid sequence of flk-1 is by Mattews etc., Proc.Nat ' l Acad.Sci.USA, and 88:9026-9030 (1991) provides.

Select as another, the DNA of coding receptor can be cloned and be expressed as cDNA or its fragment, reclaims the gained polypeptide, used as immunogen, thereby obtains antibody of the present invention.For example, in order to prepare vegf receptor, can use the standard recombinant dna technology at antibody, as describing below those, the nucleic acid molecules of code book invention vegf receptor, or outer partly being inserted into of its part, particularly its born of the same parents is used in the known receptor that host cell is expressed.The suitable source of this nucleic acid molecules comprises the cell of express VEGF receptors, that is, and and vascular endothelial cell.

Antibody can prepare in any mammal; Suitable mammal except that the people comprises, for example, and rabbit, rat, mice, horse, goat, or primate.Preferred mice.Antibody can be the following wherein member of an immunoglobulin like protein: IgG, IgM, IgA, IgE, and subclass, preferred IgG1 antibody.Antibody of the present invention and equivalent thereof can be member or its combinations of any immunoglobulin like protein.

Non-antibody VEGFR antagonist

Except antibody discussed above, or outside the function equivalent of antibody, the used receptor antagonist of the present invention can also be other biomolecule and micromolecule, particularly with above-mentioned therapy associating.

Biomolecule comprises all lipids and monosaccharide polymer, and aminoacid and molecular weight are greater than 450 nucleotide.Therefore, biomolecule comprises, for example, and oligosaccharide and polysaccharide; Oligopeptide, polypeptide, peptide, and albumen; And oligonucleotide and polynucleotide.Oligonucleotide and polynucleotide comprise, for example, and DNA and RNA.

Biomolecule also comprises the derivant of above-mentioned any molecule.For example, the derivant of biomolecule comprises lipid and oligopeptide, polypeptide, peptide and proteic glycosylated derivative.The derivant of biomolecule also comprises the lipid derivant of oligosaccharide and polysaccharide, for example, and liopopolysaccharides.

In this manual, not that any molecule of biomolecule all is considered to micromolecule.Micromolecule of the present invention is to have carbon and hydrogen atom, and heteroatomic material, and wherein hetero atom comprises, but is not restricted to, nitrogen, sulfur, oxygen and phosphorus.Atom in the micromolecule is connected with ionic bond via covalent bond; The former is generally used for little organic compound, and for example, the micromolecule tyrosine kinase inhibitor is as Iressa ^TMAnd Tarceva ^TM, the latter is generally used for little inorganic compound.Atomic arrangement in the little organic molecule can be a chain, for example, and carbon carbon bond or carbon-hetero atom chain, or contain the ring of carbon atom, for example, benzene, or carbon and heteroatomic combination, that is, and heterocycle, for example, pyrimidine or quinazoline.The loop systems in conjunction with the formation replacement of one or more chains in the little organic molecule that is connected with loop systems, condensing of two rings constitutes condensed multi-loop system, and they can simply be called multi-loop system, and one of them example is Iressa ^TMThe parent framework.Micromolecule comprises naturally occurring chemical compound, as hormone, and neurotransmitter, nucleotide, aminoacid, sugar, lipid, and derivant and, biosynthesis, or synthetic those chemical compounds of its combination by conventional organic synthesis.See, for example, Ganesan, Drug Discov.Today, 7 (1): 47-55 (in January, 2002); Lou, Drug Discov.Today, 6 (24): 1288-1294 (calendar year 2001 December).

Micromolecular some example includes organic compounds, organo-metallic compound, the salt of organic compound and organo-metallic compound, sugar, aminoacid, nucleoside and nucleotide.What should emphasize is that micromolecule can have any molecular weight.They be known as micromolecule only be because their molecular weight usually less than 450.Micromolecule comprises naturally occurring chemical compound and synthetic chemical compound.

Micromolecule and biological medicine are undertaken by methods known in the art the administration of human patients.For micromolecule, the example of this method is at Spada, United States Patent (USP) 5,646, the 47th row-Di 59 hurdles, 153 the 57th hurdles the 67th line description.Giving micromolecular description introduces herein as a reference.

The VEGF activation of neutralize VEGF receptor

Endothelium or non-endotheliocyte can carry out in external or body as the activatory neutralization of vegf receptor in the tumor cell sample.The VEGF of vegf receptor activation comprises and makes cell and antagonist of the present invention in neutralize VEGF-expression of receptor cell sample, and for example antibody contacts.Cell is before joining VEGF in the cell sample, and simultaneously, or afterwards, at external and antagonist, for example antibody contacts.

Antagonist of the present invention, for example antibody is realized with interior the contact by giving mammal it of the body of vegf receptor.Give mammiferous method and comprise, for example oral, intravenous, intraperitoneal, subcutaneous, or intramuscular administration.

Neutralisation can be used for suppressing the generation of mammal blood vessel in this body.The inhibition that blood vessel takes place is a kind of effective Therapeutic Method, as is used for prevention or inhibition and pathological condition, and the blood vessel relevant as tumor growth takes place.Therefore, antagonist of the present invention, for example antibody is that anti--blood vessel takes place and the antineoplastic immunotherapeutic agent.

Term mammal is meant any mammal.More mammiferous examples comprise house pet, as Canis familiaris L. and cat; Letting animals feed, as pig, cattle, sheep and goat; Laboratory animal is as mice and rat; Primate, as monkey, ape, chimpanzee; And it is human.

Vegf receptor can-endotheliocyte non-at certain, as finding on the tumor cell, shows that autocrine and/or the paracrine ring accident in these cells exists.Antagonist of the present invention, for example, can the neutralize activity of vegf receptor on this cell of antibody is blocked autocrine and/or paracrine ring thus, and is suppressed tumor growth.

Suppress the mammal blood vessel and take place and pathological condition, comprise that as the method for tumor growth whole body gives mammal, or directly give any antagonist of the present invention of the tumor effective dose in the mammal, for example antibody comprises its any function equivalent.The preferred people of mammal.This method can effectively be treated suffers from solid tumor, the patient of preferred hemangioma and non-solid tumor.

The inhibition of tumor growth or alleviate comprises and stops or suppress tumor, as the progress of cancerous tumour or non-cancerous tumour.The progress of tumor comprises intrusion, shifts the increase of recurrence and tumor size.The inhibition of tumor growth or alleviate and also comprise the destruction tumor.

All types of tumors all can be treated by method of the present invention.Tumor can be solid tumor or non-solid tumor.

Some examples of the solid tumor of available antagonist for treating of the present invention comprise cancer, sarcoma, blastoma or glioma.Some examples of this tumor comprise the epiderm-like tumor, squamous cell tumor, and as head and tumor colli, the colorectum tumor, tumor of prostate, breast tumor, lung tumor comprises minicell and non--small cell lung tumor, pancreas tumor, thyroid tumor, ovarian tumor, and liver tumor.Other example comprises Kaposi, cns tumor, neuroblastoma, blood capillary hemangioblastoma, meningioma and metastatic encephaloma, melanoma, human primary gastrointestinal cancers and renal carcinoma, and sarcoma, rhabdomyosarcoma, glioblastoma, preferred glioblastoma multiforme, and leiomyosarcoma.Can use the example of the vascularization skin carcinoma of the effective treatment of antagonist of the present invention to comprise squamous cell cancer, basal cell carcinoma, and skin carcinoma, they are by suppressing pernicious keratinocyte, as the pernicious keratinocyte treatment of people.

Some examples of non-solid tumor comprise leukemia, multiple myeloma and lymphoma.More leukemic examples comprise acute myeloid leukemia (AML), chronic granulocytic leukemia (CML), acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), fragility of erythrocytes leukemia or monocytic leukemia.More lymphadenomatous examples comprise and Hokdkin disease and the sick relevant lymphoma of Fei Hejiejinshi.

The experimental result of describing subsequently confirms, but antibody specific inhibition VEGF of the present invention is inductive, expresses in the 3T3 of transfection cell, the outer flk-1 (VEGFR-2) of mice born of the same parents (VEGFR-2)/born of the same parents in the phosphorylation of fms Chimerical receptor.Not effect of FLK-2 receptor in the outer fms/ born of the same parents of the chimeric born of the same parents that described antibody stimulates fully to CSF-1.Studies show that in the body described below that described antibody can significantly suppress the tumor growth of nude mice.

The vegf receptor antagonist, for example, the mixture of monoclonal antibody can be the inhibition growth of tumour cell a kind of special effective method is provided.This mixture can contain few to 2,3 or 4 kind of antibody, as many as 6,8 or 10 kind of antibody.

Prevention or inhibition blood vessel take place also to can be used for treating the non-tumor sexually transmitted disease (STD) reason disease that is characterised in that excessive blood vessel takes place, as neovascular glaucoma, and proliferative retinopathy, comprise proliferative diabetic retinopathy, arthritis, degeneration of macula, hemangioma, fibrohemangioma, and psoriasis.

Use antagonist of the present invention to separate and the purification vegf receptor

Use conventional method, as affinity chromatography, antagonist of the present invention can be used for separating and purification vegf receptor (Dean etc., Affinity Chromatography:A PracticalApproach, IRL Press, Arlington, VA (1985)).Other method well known in the art comprises the magnetic separation technique of the magnetic bead that uses antibody sandwich, uses " elutriation " technology of the antibody that is connected with solid matrix, and flow cytometry.

The source of vegf receptor is vascular cell, particularly vascular endothelial cell normally, but its express VEGF receptors.The suitable source of vascular endothelial cell is a blood vessel, as cord blood cell, and human umbilical endothelial cell (HUVEC) particularly.

Vegf receptor can be used as the parent material of producing other material, as is used to make the antigen of other monoclonal and polyclonal antibody, and described antibody can be discerned and in conjunction with other antigen on the cell surface of vegf receptor or VEGF expression.

Use antagonist of the present invention to separate and purification flk-1 (VEGFR-2) positive tumor cell

Use conventional method, as affinity chromatography, antagonist of the present invention can be used for separating and (VEGFR-2) positive tumor cell of purification flk-1 (VEGFR-2), promptly, express tumor cell (Dean etc., Affinity Chromatography:APractical Approach, the IRL Press of flk-1 (VEGFR-2) receptor, Arlington, VA (1985)).Other method well known in the art comprises the magnetic separation technique of the magnetic bead that uses antibody sandwich, cytotoxic agent, as with the complement of antibody coupling, use " elutriation " technology of the antibody that is connected with solid matrix and flow cytometry.

The interior level of monitoring VEGF and vegf receptor of external or body

Use standard test method and methods known in the art, antagonist of the present invention, for example antibody is used in external or the body level of VEGF in the monitoring bio sample or vegf receptor.Some examples of biological sample comprise body fluid, as blood.The standard test method comprises, for example, and traget antibody go forward side by side column criterion immunoassay, radioimmunoassay as known in the art.

Be used to carry out standard recombinant dna technology of the present invention by Sambrook etc., at " molecular cloning ", second edition, among the Cold Spring Harbor Laboratory Press (1987) and Ausubel etc. (Eds.) in " molecular biological current scheme ", describe among the Green PublishingAssociates/Wiley-Interscience, New York (1990).

Administration

For treating, can give tumor patient receptor antagonist of the present invention, dosage is enough to prevention, suppresses, or the progress of ameliorate tumor, for example, growth of tumor is invaded, and shifts and/or recurrence.The amount that is enough to reach this purpose is defined as treating effective dose.The effective dose that is used for this purposes depends on the order of severity of disease and the general situation of patient's autoimmune system.Dosage regimen also can change according to disease condition and patient's state, is administered once or continuous infusion multiple dosing (for example) every day usually every 4-6 hour, or by the situation decision of the doctor in charge according to the patient.Yet, should be noted that to the invention is not restricted to any specific dosage.

The present invention can be used for treating any suitable tumor, comprises, for example, mammary gland, heart, lung, small intestinal, colon, spleen, kidney, bladder, head and neck, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, uterus, testis, the tumor of cervix uteri or liver.Preferably, when tumor is colon tumor or nonsmall-cell lung cancer (NSCLC), use method of the present invention.

In addition, the preferred overexpression EGFR of tumor of the present invention.In a lot of human tumors, the EGFR that can both detect rising expresses; For example, head and neck (80-100%), knot rectum (25-77%), pancreas (30-50%), lung (40-80%), esophagus (43-89%), nephrocyte (50-90%), prostate (65%), bladder (31-48%), cervix uteri/uterus (90%), ovary (35-70%) and mammary gland (14-91%).The expression of EGFR has been proved to be prognosis mala, and survival rate reduces and some tumor type shifts the index that increases.

In addition, tumor of the present invention preferably has unconventionality expression or the signal transmission of VEGFR.The raising of VEGFR signal transmission can be observed in multiple different human cancer.High level VEGFR-2 expresses (Plate etc., (1992) Nature 359:845-848) by soaking into gliomatous endotheliocyte.The level of VEGFR-2 can raise (Plate etc., (1993) Cancer Res.53:5822-5827) by the VEGF specificity that people's glioblastoma produces.The high level expression of VEGFR-2 in glioblastoma dependency endotheliocyte (GAEC) shows, it is derivative in neoplastic process that receptor active is likely, this is because in normal brain endothelial cell, almost detect the transcript less than VEGFR-2.This rise is limited at the vascular endothelial cell contiguous with tumor.

The present invention can be used for suppressing or the ameliorate tumor growth.The inhibition of tumor growth or alleviate and be meant prevention suppresses, or the development of ameliorate tumor, and for example growth of tumor is invaded, and shifts and/or recurrence.In addition, the present invention also can be used for treating the blood vessel situation occurred, as atherosclerosis, and arthritis, degeneration of macula and psoriasis.The present invention of evaluation those patients that can treat with to(for) institute's trouble situation is the thing within those skilled in the art's ability and the ken.

In the present invention, any suitable method or approach all can be used for giving EGFR antagonist and/or VEGFR antagonist, and be for example oral, intravenous, and intraperitoneal, subcutaneous, or intramuscular administration.The dosage of antagonist depends on multiple factor, comprises, for example, the type of antagonist, the tumor type for the treatment of and the order of severity, and the route of administration of antagonist.Yet what should emphasize is to the invention is not restricted to any specific medication or approach.

Therein in selectivity embodiment, EGFR antagonist and VEGFR antagonist can with one or more antitumor agent administering drug combinations.See, for example, U.S. Patent number 6,217,866 (Schlessinger etc.) (anti-egfr antibodies and antitumor agent administering drug combinations); U. S. application number 09/312,286 (Waksal etc.) (anti-egfr antibodies and radiotherapy therapeutic alliance).Any suitable antitumor agent all can use, as chemotherapeutics or radiotherapy.The example of chemotherapeutics comprises, but is not restricted to cisplatin, amycin, paclitaxel, irinotecan (CPT-11), topotecan or its combination.When antitumor agent is meant when carrying out radiotherapy, radioactive source can be external (external light beam radiotherapy-EBRT) or intrinsic (brachytherapy-BT) for the patient who is treated.The dosage of antitumor agent depends on multiple factor, comprises, for example, the type of medicament, the tumor type for the treatment of and the order of severity, and the route of administration of medicament.Yet what should emphasize is that the present invention is not restricted to any specific dosage.

In other selectivity embodiment, EGFR antagonist and VEGFR antagonist can with one or more suitable adjuvants, for example, cytokine (for example, IL-10 and IL-13) or other immunostimulant administering drug combinations.See, for example, Larriv é e etc., supra.Yet, should be appreciated that the treatment effective means that only gives EGFR antagonist and VEGFR antagonist just is enough to prevention, suppress, or the progress of ameliorate tumor.

In addition, EGFR antagonist and/or VEGFR antagonist can be used as the ligand conjugates administration, its specificity bind receptor, and after part-toxin internalization, transmit the deadly loading of toxic.Conjugate between toxin and receptor is in order to study the special toxic agent of tumor cell to EGFR-or VEGFR-overexpression, makes non-specific toxicity reach minimum and design simultaneously.For example, the conjugate of being made up of EGF and pseudomonas endotoxin (PE) is toxic at external HeLa cell to expression EGFR.Various medicaments comprise thioridazine and adenovirus, all can improve the picked-up of cell to conjugate, and increase the cytotoxicity of conjugate.

Should be appreciated that described compositions also contains pharmaceutically acceptable carrier for prevention or therapeutic purposes are used for the form administration that the EGFR of the present invention of mammal and/or VEGFR antagonist can compositionss.Suitable pharmaceutically acceptable carrier comprises, for example, and water, normal saline, the saline of phosphate-buffered, glucose, glycerol, one or more of ethanol etc., and combination.Pharmaceutically acceptable carrier also can comprise the auxiliary substance of trace, as wetting agent or emulsifying agent, and antiseptic or buffer agent, they can improve protein-bonded storage life or effectiveness.As well known in the art, can be mixed with injection to compositions, thereby after giving mammal, fast, continue or delayed release of active elements.

EGFR antagonist of the present invention and/or VEGFR antagonist can be various forms.These forms comprise, for example, and solid, half-solid and liquid dosage form, as tablet, pill, powder, liquid solution, dispersion liquid or suspension, liposome, suppository, but the solution of injectable and infusion.Preferred form depends on target mode of administration and treatment application.

This antagonist can prepare according to the method that pharmaceutical field is known.When making compositions, active component mixes with carrier usually, or dilutes with carrier, and/or is enclosed in the carrier, for example, encloses capsule, and medicated bag is in paper or other container.When carrier used as diluent, it can be a solid, half-solid, or fluent material, and it also can be used as the carrier of active component, excipient or medium.Therefore, compositions can be a tablet, lozenge, medicated bag, cachet, elixir, suspension, aerosol (solid or fluid matrix) contains the ointment of 10 weight % reactive compounds, Perle and hard gelatin capsule, suppository, injection, suspension, the powder of aseptic packaging and local application's cream.

The test kit that suppresses tumor growth

The present invention also comprises the test kit that suppresses tumor growth, contains EGFR antagonist for the treatment of effective dose and the VEGFR antagonist for the treatment of effective dose in the test kit.The EGFR of test kit of the present invention or VEGFR antagonist can be any suitable antagonisies, and their example is described in the above.Preferably, the EGFR antagonist of test kit comprises the antibody special to EGFR, or its function equivalent.Optionally, the EGFR antagonist of going back the preferred reagent box comprises the micromolecule special to EGFR.The VEGFR antagonist of test kit preferably comprises the antibody special to VEGFR, or its function equivalent.Optionally, the VEGFR antagonist of test kit preferably comprises the micromolecule special to VEGFR.In addition, test kit of the present invention also can contain antitumor agent.The example of the antitumor agent that the present invention suits is here described.Test kit of the present invention also can contain adjuvant, and their example is also described in the above.

Therefore, receptor antagonist of the present invention can be used for the research of vivo and vitro, diagnosis, and prevention or Therapeutic Method, they are well known in the art.Certainly, should understand and expect that those skilled in the art can change according to the principle of the invention disclosed herein, this change also falls within the scope of the present invention.

Here all lists of references of mentioning are all introduced herein as a reference.

Embodiment

The purpose that proposes the following example is in order to help to understand the present invention, rather than, should not be interpreted as limiting the scope of the invention by any way yet.The detailed description that does not comprise conventional method among the embodiment for example at carrier construction and plasmid, is inserted into the gene of coded polypeptide in this carrier and the plasmid, or used those methods when being incorporated into plasmid in the host cell.This method is that those of ordinary skill in the art know, and in a lot of public publications, described, comprise Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) molecular cloning: lab guide, second edition, Cold Spring Harbor LaboratoryPress.

Embodiment 1. cell lines and culture medium

NIH 3T3 cell obtains from American type culture collection (Rockville MD).C441 cell line is with Chimerical receptor mice flk-1 (VEGFR-2)/people fms transfection 3T3 cell construction.10A2 is the 3T3 transfectant that contains Chimerical receptor people fms/ mice FLK-2, and its separation and characteristic were described (Dosil etc., Mol.Cell.Biol.13:6572-6585 (1993)).Cell maintains in Dulbecco ' s improvement Eagle ' the s culture medium (DME) usually, has wherein replenished 10% calf serum (CS), 1mML-glutamine, antibiotic and 600 μ g/ml G418 (Geneticin; Sigma, St LouisMO).

Glioblastoma cell line, GBM-18 maintains and has replenished 5% calf serum, among 1mM L-glutaminate and the antibiotic DME.

Produce secretion solubility chimeric protein, the stable 3T3 of mice flk-1 (VEGFR-2): SEAPs (secreting type alkali phosphatase) is, and it is maintained in DMEM and 10% calf serum.The collection condition culture medium.From conditioned medium, isolate solubility flk-1 (VEGFR-2): SEAP.

Example II. the separation of monoclonal antibody

Rat anti-mouse flk-1 (VEGFR-2) the monoclonal antibody DC-101 (IgG1) of example II-1.

Make Lewis rat (Charles River Labs) hyperimmune with immune complex, described immune complex contains mice flk-1:SEAPs soluble recepter, and rabbit resists-alkali phosphatase polyclonal antibody and G albumen sepharose 4B.Animal in 3 months, 7 this complex of peritoneal injection (the 0th, 14,21,28,49,63,77 days).In the different time, gather blood from animal tail vein, and screen and mflk-1 (VEGFR-2): the bonded immune serum of SEAPs high-titer by ELISA.Last injection was killed rat, the aseptic spleen of removing after 5 days.The washing splenocyte, counting, and to be NS1 with rat bone marrow tumour cell merge with 2: 1 ratio.In the HAT culture medium, select hybridoma, and by ELISA screening specificity in conjunction with mflk-1 (VEGFR-2): SEAPs not in conjunction with the proteic colony of SEAPs.Many positive hybridomas further increase and are cloned three times by the restriction dilution.Study one of them below and be called as the sub-clone of DC-101.

Example II-2 mouse anti mice flk-1 (VEGFR-2) monoclonal antibody Mab25 and Mab73

Mouse-anti flk-1 (VEGFR-2) monoclonal antibody (Mabs) is according to producing with the used similar method of DC-101.Briefly, use in conjunction with anti-SEAP-albumen/A agarose complex or flk-1 (VEGFR-2)/SEAP soluble recepter of deriving from the wheat germ agglutinin agarose of transfection NIH 3T3 cell conditioned medium and give injected in mice.In 6 months, regularly make the mice hyperimmune.Collect immune spleen cell, with rat bone marrow tumour cell be that NSI merges.Select hybridoma in the HAT culture medium, after the incubation, screening produces the colony of mice Mab.The method used with DC-101 is different, at first screen positive supernatant in conjunction with flk-1 (VEGFR-2)/fms receptor, the C441 cell lysates of described receptor capture on the ELISA flat board, described ELISA flat board are coated with the polyclonal antibody at the peptide generation of fms C-end region.Measure and complete C441 cell and purification flk-1 (VEGFR-2)/SEAP and the independent bonded active Mabs of SEAP by ELISA then.Make in conjunction with C441, with flk-1 (VEGFR-2)/SEAP reaction, and not with the hybridoma supernatant amplification of SEAP reaction, in ascites, grow, and purification (EZ-PREP, Pharmacia).Mabs to purification on the C441 cell measures, and measures their cell surface binding ability by FACS, and measures them and suppress the inductive flk-1 of VEGF (VEGFR-2)/activatory ability of fms in the phosphorylation assay method.The result of these researchs has obtained the clone (isotype IgG1) of Mabs 25 and 73, is used for according to they specificitys in conjunction with flk-1 (VEGFR-2), and with the ability of the level blocking-up receptor activation similar to DC-101 and further characterize.

The EXAMPLE III algoscopy

EXAMPLE III-1.ELISA method

Antibody screens by solid-state ELISA, has wherein compared various mAbs and flk-1 (VEGFR-2): the proteic feature that combines of SEAP and SEAP.With the 50-100ng/ hole, wrap by microtitration plate with flk-1:SEAP in the pH9.6 carbonate buffer solution or AP, 4 ℃ are spent the night.In the time of 37 ℃, with dull and stereotyped 1 hour of the phosphate buffered saline (PBS) sealing that is supplemented with 10% newborn calf serum (NB10).In the time of 37 ℃, hybridoma supernatant or antibody purification were joined in the flat board incubation 2 hours, add then with the link coupled goat of horseradish peroxidase (Tago) anti--rat IgG incubation 1 hour.Behind the thorough washing, add TMB (Kirkegaard and Perry, GaithersburgMD) and hydrogen peroxide as chromogen, at the 450nm place of ELISA reader to dull and stereotyped reading.

The analysis of EXAMPLE III-2 isotype

The isotype analysis of each monoclonal antibody is according to previous described (Songsakphisarn, R. and Goldstein, N.I., Hybridoma 12:343-348,1993) use rat isotype specific reagent (Zymed Labs, South San Francisco CA) to carry out.

EXAMPLE III-3 phosphorylation, immunoprecipitation and immunoblotting algoscopy

After preceding method (Tessler etc.) improved, use C441 and 10A2 cell to carry out phosphorylation assay and western blot analysis.Briefly, cell grows to 90% and converges in DME-10%CS, then before experiment, makes serum in DME-0.5%CS hungry 24 hours.The HUVEC cell grows to the Asia and converges in the EGM basal medium.For in and for the algoscopy, when having and do not have mAb DC-101 to exist, do not having (DME-0.1%BSA) under the condition of serum, with the suitable part room temperature irritation cell of various concentration 15 minutes.Part VEGF and CSF-1 measure with the concentration of 10-80ng/ml and 20-40ng/ml respectively.Monoclonal antibody is with the concentration determination of 0.5 μ g/ml-10 μ g/ml.In order to assess the effect of mAb DC-101, add antibody (competitive inhibition) simultaneously or before adding part, make antibody combine 15 minutes in advance with cell to the inductive flk-1 of VEGF (VEGFR-2)-fms receptor activation.Do not have and when having DC-101 to exist, the cell of incubation is used separately as in not having the culture medium of serum does not have and the contrast of the receptor autophosphorylation when having antibody to exist.Make the control cells system of expressing fms/FLK-2 Chimerical receptor (10A2) hungry, with 20 and 40ng/ml CSF-1 stimulate, measure under the situation of 5 μ g/ml DC-101 existence having and do not have.

After the stimulation, with the ice-cold PBS washed cell monolayer that contains the 1mM sodium orthovanadate.Then, cytolysis is being dissolved buffer (20mM Tris-HCl, pH7.4,1%Triton X-100,137mM NaCl, 10% glycerol, 10mM EDTA, the 2mM sodium orthovanadate, 100mM NaF, 100mM tetrasodium pyrophosphate, 5mM Pefabloc (Boehringer Mannheim Biochemicals, Indianapolis IN)), 100 μ g aprotiniies and 100 μ g/ml leupeptins) in, centrifugal 10 minutes of 14000xg.Utilize polyclonal antibody, albumen immunoprecipitation from the clarification lysate of transfectional cell is come out, wherein said polyclonal antibody be by with people fms receptor C-end region (Tessler etc., J.Biol.Chem.269,12456-12461,1994) or with the link coupled Mus FLK-2 of A albumen sepharose 4B in kinase domain (Small etc., Proc.Nat ' lAcad.Sci.USA, 91,459-463,1994) corresponding peptide generation.Carry out with 10 μ g and the link coupled antibody of G albumen pearl with the immunoprecipitation of DC-101 or irrelevant rat IgG.Use 0.2%Triton X-100 then, 10mM Tris-HCl pH8.0,150mM NaCl, 2mM EDTA (buffer A) washing pearl once with the buffer A washing pearl twice that contains 500mM NaCl, use Tris-HCl, twice on pH8.0 washing pearl.The pearl of drip-dry is mixed with 30 μ l 2x SDS sample loading buffers, and middle at 4-12% gradient gel (Novex, San DiegoCA) through SDS PAGE.After carrying out electrophoresis, albumen is imprinted on the nitrocellulose filter analyzes.(sealing is spent the night among the Biorad, sealing buffer CA) (50mM Tris-HCl, pH7.4,150mM NaCl (TBS)) containing 5% bovine serum albumin and 10% defatted milk powder to make filter membrane.In order to detect the phosphorylation receptor, in the sealing buffer, (NY) room temperature is surveyed trace 1 hour for UBI, Lake Placid at the monoclonal antibody of phosphotyrosine.Then with the 0.5x TBS washing trace that contains 0.1% tween 20 (TBS-T), and use with the link coupled goat of horseradish peroxidase (Amersham) anti--mice Ig incubation.Wash trace with TBS, and (ECL, Amersham) incubation is 1 minute with chemical illuminating reagent.The anti-phosphotyrosine that reacts with phosphorylated protein is that (Hyperfilm-ECL Amersham) detected in 0.5-10 minute by the efficient luminous detection film that exposes.

In order to detect the acceptor levels of flk-1 in the C441 cell (VEGFR-2)/fms, separate trace according to the method that manufacturer (Amersham) provides, and survey once more with anti--fms rabbit polyclonal antibody.

EXAMPLE III-4 flow cytometry binding assay

The C441 cell grows to closely in the 10cm flat board and converges.With non--enzymatic buffer (Sigma) that dissociates cell is shifted out, do not wash in having the cold culture medium of serum, and be resuspended in the Hanks balanced salt solution that has replenished 1%BSA (HBSS-BSA), concentration is 100 ten thousand cells of every test tube.In every test tube, add the anti-FLK-2 23H7 of irrelevant antibody of 10 μ g monoclonal Ab DC-101 or isotype coupling, kept again 60 minutes on ice.After the washing, add 5 μ l and the link coupled goat of FITC (TAGO) and resist-mice IgG, kept 30 minutes on ice.Washed cell 3 times, resuspension in 1ml HBSS-BSA, and on Coulter Epics Elite cell counter, analyze.The non-specific binding of fluorescence second antibody is according to the sample determination that lacks first antibody.

The binding assay of EXAMPLE III-5 intact cell

Use grows to the cell that converges the C441 cell is measured in 24 hole culture dishs.The HUVEC cell grows in 6 hole culture dishs and converges.With 4 ℃ of incubation cell monolayers of mAb DC-101 not commensurability in the binding buffer liquid (DMEM, 50mMHEPES pH7.0,0.5% bovine serum albumin) 2 hours.Using cold phosphate buffered saline (PBS) washed cell then, is 2.5 μ g/ml with final concentration, with biotin link coupled second anti--rat IgG antibody incubation.4 ℃ of incubations are after 1 hour, washed cell, and with 4 ℃ of incubations of streptavidin-horseradish peroxidase complex 30 minutes.After the washing, by measuring the absorbance at 540nm place and measure cell-bound antibody with colorimetric detection system (TMB, Kirkeggard and Perry).The OD 540nm of independent second antibody is as the contrast of non-specific binding.

EXAMPLE III-6 cell proliferating determining method

The mitogenesis algoscopy is that (Promega Corp., Madison WI) carries out with Cell Titer 96 reagent for determination of non-radioactive cell proliferation boxes.In this algoscopy, tetrazolium salts is reduced into first according to living cells

The value colorimetric measurement propagation that product obtained.Briefly, the HUVEC cell is grown in the flat board of 24 hole gelatin bag quilts in the EGM basal medium with the density of 1000 cells/well.Behind the incubation 48 hours, Xiang Kongzhong adds various compositions.When having and do not have 1 μ g/ml mAb DC-101 to exist, in culture medium, add 10ng/ml VEGF.Adding heparin (Sigma) to ultimate density is 1 μ g/ml.And then this cell of incubation 3 days.Be to measure the cell growth, in each hole, add the aliquot of 20 μ l tetrazolium dyes, 37 ℃ of these cells of incubation 3 hours.Dissolved cell is measured first

The absorbance of product (OD570), thus quantize propagation.

EXAMPLE IV. the active determination in vitro method

EXAMPLE IV-1. mouse-anti-flk-1 (VEGFR-2) Mabs 25 and 73 causes the specificity neutralization of the inductive flk-1 of VEGF (VEGFR-2)/fms receptor activation

Algoscopy is to use FLK/fms and the pdgf receptor that immunoprecipitation comes out from the 3T3cells C441 of isoconcentration flk-1 (VEGFR-2)/fms transfection to carry out, and people EGFR immunoprecipitation from tumor cell line KB comes out.Cell is when having and do not have 10 μ g/ml mouse-anti-flk-1Mabs 25 and 37 to exist, with containing 20ng/ml VEGF (flk-1/fms), DMEM-10% calf serum (PDGFR), or the RPMI-0.5%BSA of 10ng/ml EGF (EGFR) stimulation.After the stimulation, with PBS-1mM sodium orthovanadate washed cell and dissolving.Flk-1/fms and PDGFR immunoprecipitation from lysate, described lysate have respectively the polyclonal antibody that the peptide at c-fms (IM133) C-end region and PDGF (UBI) receptor produces.Mab (C225) immunoprecipitation of EGFR at people's receptor N-end region incubation.The lysate of immunoprecipitation then carries out western blot analysis through SDS polyacrylamide electrophoresis.Survey trace with anti--PTyr Mab (UBI), to detect receptor activation.Receptor neutralization with respect to irrelevant Mab and unprovoked matched group assessment irriate cell.

EXAMPLE IV-2 uses Mab25 and Mab73 as probe, detects flk-1 (VEGFR-2)/fms receptor by Western blotting

Receptor is to detect on the Western blotting of flk-1 (VEGFR-2)/fms receptor with mouse-anti-flk-1 (VEGFR-2) Mabs, described flk-1 (VEGFR-2)/fms receptor is sedimentary by the polyclonal antibody that produces at the peptide of c-fms receptor C-end region, and the c-fms receptor then derives from the lysate of the 3T3cells C441 of isoconcentration transfection.Behind sds gel electrophoresis and western blot analysis, trace is divided into four parts, every part all uses anti--flk-1 (VEGFR-2) Mabs 25 and 73 of 50 μ g/ml to survey.Separate trace then, and survey once more, to confirm representing flk-1 (VEGFR-2) fms receptor by the band that each Mab detects with anti--fms polyclonal antibody.

EXAMPLE IV-3 derives from the HUVEC of VEGF stimulation and the activation KDR (VEGFR-2) of OVCAR-3 cell by using anti--flk-1 (VEGFR-2) Mabs immunoprecipitation to detect

Albumen is the different antibodies immunoprecipitation with the HUVEC lysate that derives from fresh separated.Before dissolving,, and wash with the PBS that contains the 1mM sodium orthovanadate with the 20ng/ml VEGF room temperature irritation cell among the RPMI-0.5%BSA 10 minutes.Each time immunoprecipitation carries out with the equal-volume lysate, passes through the sds polyacrylamide electrophoresis then, then carries out Western blotting.Survey trace with anti--PTyr Mab (UBI) at first, separate subsequently, and use (VEGFR-1/VEGFR-2 at flk-1/KDR, IM 142) in the polyclonal antibody that produces of kinase whose peptide survey once more, then use polyclonal antibody (Santa CruzBiotechnology, Inc.) detection at flk-1 (VEGFR-2) C-end region.Immunoprecipitation is with irrelevant rat Mab, 23H7, and irrelevant mice Mab, DAB8 and anti-flk-1 (VEGFR-2) Mabs, DC-101,73,25 and anti-flk-1/KDR (VEGFR-1/VEGFR-2) polyclonal antibody, IM142 carries out.In some cases, separate trace, and survey once more, to detect the cross reaction band with anti-flk-1Mabs 73 and 25.

Similar approach is used to detect KDR (VEGFR-2) the receptor form of ovarian cancer cell line OVCAR-3.

The activity of EXAMPLE V antibody

EXAMPLE V-1 ELISA and use the DC-101 immunoprecipitation

It is found that rat IgG1 monoclonal antibody DC-101 is special to Mus tyrosine kinase receptor flk-1 (VEGFR-2).The ELISA data show, the flk-1 (VEGFR-2) of antibody and purification: SEAP combines, but do not combine with alkali phosphatase or other receptor tyrosine kinase such as FLK-2.As shown in Figure 1, DC-101 can make Mus flk-1 (VEGFR-2): the SEAPS immunoprecipitation, and can not make independent SEAPS immunoprecipitation.

EXAMPLE V-2 usefulness DC-101 suppresses Flk-1 (VEGFR-2) receptor phosphorylation

Experimentize so that determine whether DC-101 can pass through its related part VEGF ₁₆₅In and the phosphorylation of flk-1 (VEGFR-2) in the C441 cell.In these researchs, monoclonal antibody and VEGF joined in the cell monolayer 15 minutes simultaneously in room temperature.These conditions are designed to measure antibody to the bonded competitive effect of receptor/ligand (competitive inhibition).These measurement results shown in Fig. 2 a show, when measuring cell under the situation that is having DC-101 to exist, and VEGF ₁₆₅Inductive flk-1 (VEGFR-2)/fms receptor phosphorylation significantly reduces.In addition, these data show, Mab and VEGF ₁₆₅The receptor that competition stops part to cause activates fully.In order to measure the sensitivity that suppresses due to VEGF-flk-1 (VEGFR-2) the interaction partners DC-101, the C441 cell is the VEGF with maximal stimulus concentration ₁₆₅(40ng/ml) in conjunction with the TPPA of various levels.The titrating result of these Mab provides in Fig. 2 b.When the concentration of DC-101 during greater than 0.5 μ g/ml, VEGF ₁₆₅Due to flk-1 (VEGFR-2) phosphorylation significantly reduce.These data show, the antibody of relatively low concentration (＜1 μ g/ml) is enough to suppress the receptor activation due to the part.In that the part of 80ng/ml is excessive when existing, 5 μ g/ml antibody just can neutralize VEGF ₁₆₅Stimulation to flk-1 (VEGFR-2).In contrast, use CSF-1 to go up the effect of test DC-101 at the fms/FLK-2 receptor (10A2 cell line) that stimulates fully.Under these conditions, DC-101 is to not influence of receptor activation.

EXAMPLE V-3 utilizes DC-101 to suppress research

By studying degree and the specificity that further assessment Mab suppresses, wherein before adding part, with cell precincubation DC-101, so that antibody and receptor are fully acted on.In these experiments, with 5 μ g/ml DC-101, (ImClone, NY) Zhi Bei rat anti-FLK-2Mab (2A13) and control rats IgG1 (Zymed Labs) room temperature incubation cell monolayer is 15 minutes, adds 40ng/ml VEGF then by conventional method ₁₆₅Incubation is 15 minutes again.In order relatively to measure, wherein add DC-101 and VEGF simultaneously ₁₆₅(competitive inhibition).The result of these researchs (Fig. 4) shows, can eliminate VEGF fully with anti--flk-1 (VEGFR-2) monoclonal antibody of flk-1 (VEGFR-2)/fms cells transfected precincubation ₁₆₅Due to receptor activation.Similar results is to use VEGF ₁₂₁Stimulate observed.When flk-1 (VEGFR-2) phosphorylation due to the rat antibody that adds irrelevant isotype coupling can not influence VEGF, the activity of the identical trace of surveying with anti--fms polyclonal antibody shows that the level of per pass receptor protein is identical.These data show that the observed phosphorylation inhibition of use DC-101 is the blocking-up owing to receptor activation, rather than lacks receptor protein in the test specimen.

EXAMPLE V-4 combines by facs analysis DC-101 and C441 cell

Measure the combining of 3T3 cell of mAb and flk-1 (VEGFR-2)/fms receptor (C441 cell) transfection by facs analysis.Result shown in Figure 6 proves, chimeric flk-1 (the VEGFR-2)/fms that expresses on the C441 cell surface can be by mAb DC-101 specific recognition, and can not be by at relevant tyrosine kinase receptor, the identification of the isotype antibody of FLK-2 incubation.The mAb-receptor is determined according to algoscopy in the interactional efficient of cell surface, wherein measures the bonded varying level of mAb on complete C441 cell.These results shown in Figure 7 show, mAb with about 500ng/ml relatively than significant affinity and flk-1 (VEGFR-2)/fms receptors bind.These results show that the flk-1 (VEGFR-2) of mAb pair cell surface expression has stronger affinity.

EXAMPLE V-5 is by the reactivity of immune precipitation determination DC-101

The extent of reaction of DC-101 and flk-1 (VEGFR-2)/fms receptor is by after the VEGF activation, measures antibody and makes the ability of receptor immunoprecipitation and further assessment.Fig. 8 represents the immunoprecipitation due to the mAb DC-101 of C441 cells phosphorylation flk-1 (VEGFR-2)/fms receptor that VEGF stimulates.The result shows that the DC-101 monoclonal antibody has similar receptor acting level with anti-fms polyclonal antibody, and rat anti FLK-2 antibody 2H37 (IgG1) and 2A13 (IgG2a) then do not have reactivity.Experimentize then, determine whether mAb DC-101 can be in the inductive flk-1 of maximal stimulus concentration (40ng/ml) neutralize VEGF (the VEGFR-2)/fms phosphorylation of part.In these researchs, monoclonal antibody and part are joined in the cell monolayer simultaneously, or before ligand stimulation, add, room temperature measuring 15 minutes.These conditions are studied, bonded competitive effect of receptor/ligand (competitive inhibition) and pre-binding antibody are stoped the receptor activation effect to determine antibody.These measurement results shown in Figure 4 show that the phosphorylation of flk-1 (VEGFR-2)/fms reduces by adding mAb and VEGF simultaneously, and can obviously be suppressed with the pre-bonded antibody of receptor.The densitometric scan of these data discloses, and mAbDC-101 and flk-1 (VEGFR-2)/fms interacts, suppress phosphorylation to the receptor matched group (4 road) that stimulates fully 6% (5 roads, P) with 40% (6 roads, C).According to our deducibility mAb DC-101 and the ligand-receptor interaction keen competition of these data, in and the activation of flk-1 receptor.For the sensitivity of determining to suppress due to VEGF-flk-1 (VEGFR-2) the interaction partners mAb DC-101, when antibody concentration increases gradually, with maximum VEGF level determination C441 cell.Mensuration is in competition with in advance in conjunction with under the condition, carries out with mAb.The titrating result of these mAb provides in Fig. 9.When mAb DC-101 and concentration during, can be observed the remarkable reduction of flk-1 (VEGFR-2) phosphorylation greater than the VEGF antibody competition of 0.5 μ g/ml.These data also show, the pre-binding antibody of relatively low concentration (＜1 μ g/ml) is enough to suppress fully the receptor activation due to the part.

EXAMPLE V-6 is measured the activity of DC-101 by the phosphorylation assay method

For further assessment mAb DC-101 carries out phosphorylation assay to the antagonism of receptor activation, wherein the antibody of fixed amount (5 μ g/ml) is joined that (Fig. 3 a) in the C441 cell that part stimulated that consumption increases gradually.Reading by light densitometry quantizes to have and the inductive phosphorylation level of each ligand concentration when not having mAb DC-101.The figure of these data that Fig. 3 b provides shows, even there is excessive VEGF to exist, antibody also can part in and receptor phosphorylation.In order to assess the specificity of mAb DC-101, tested among the antibody competition inhibition 3T3 transfectional cell series 10A2 ability of the inductive fms/FLK-2 receptor activation of CSF-1 to receptor activation.In these experiments, the mAb DC-101 and the known complete activatory CSF-1 concentration of receptor (20-40ng/ml) that causes of having tested 5 μ g/ml.These results shown in Figure 10 show that mAb DC-101 is to the not effect of fms/FLK-2 receptor phosphorylation of CSF-1 mediation.

EXAMPLE V-7 is by the inhibitory action of precincubation research DC-101

By studying degree and the specificity that further assessment antibody suppresses, wherein DC-101 or irrelevant antibody are used cell precincubation before adding part, fully act on to guarantee antibody and receptor.In these experiments, cell monolayer is before adding 40ng/ml VEGF, with 5 μ g/mlDC-101, rat anti FLK-2mAb (2A13) or control rats IgG1 (Zymed Labs) precincubation.In order to compare, also carried out competitive assay, wherein add antibody and VEGF simultaneously.The result of these researchs shows, have only and can eliminate the receptor activation due to the VEGF to anti-flk-1 (VEGFR-2) monoclonal antibody and flk-1 (VEGFR-2)/fms cells transfected precincubation fully, the rat antibody of the irrelevant isotype coupling of adding then can not influence flk-1 (VEGFR-2) phosphorylation due to the VEGF.The activity (Figure 11) of surveying same trace with anti--fms polyclone shows that the receptor protein of per pass is on level terms.These data show, the cell observation of handling with mAb DC-101 to the phosphorylation deficiency be owing to blocked the phosphorylation of the inductive equivalent expressed receptor of VEGF-.

The interaction of EXAMPLE V-8 antibody and homoreceptor form

Experimentize then, determine anti-flk-1 (VEGFR-2) monoclonal antibody whether with human endothelial cell on the homoreceptor form interact.On clone's HUVEC cell (ATCC), the titration that the DC-101 that concentration is increased gradually carries out shows, antibody has complicated in conjunction with behavior.Data representation different antibodies and the interaction (Vaisman etc., J.Biol.Chem.265,19461-19466,1990) that is present in the vegf receptor on the endotheliocyte.Then to those similar conditions of Fig. 8 report under, utilize the phosphorylation assay method to describe the specificity of DC-101 and the HUVEC cell interaction of VEGF stimulation.In these researchs, when deduction during ligand component, DC-101 can make the protein band immunoprecipitation of HUVEC cell, those similar (Figure 12) of described protein band molecular weight and crosslinked VEGF-receptor band.When the VEGF irritation cell (relatively 1 road and 2 roads among Figure 12), these bands show the increase of phosphorylation.In addition, the inductive receptor band of VEGF phosphorylation is to strengthen (3 roads among Figure 12) by add 1 μ g/ml heparin when measuring.These find and had before reported, when having the low concentration heparin, VEGF consistent with the bonded increase of endotheliocyte (Gitay-Goren etc., J.Biol.Chem.267,6093-6098.1992).

Be difficult to determine that immunoprecipitation albumen and DC-101 interaction can produce the phosphorylation band of the observed complexity of Figure 12, Figure 12 has provided various receptor forms and has gone up combining of VEGF with HUVEC, and stimulates their associating probabilities of back.It is reported that molecular weight is about 180 (KDR (VEGFR-2)), 155,130-135, the receptor form of 120-125 and 85 cell surface expression can be in conjunction with the VEGF on the HUVEC.The probability of some not isoacceptor forms different dimerization behind ligand stimulation has been emphasized in this discovery, and the mode of its different dimerization is similar to KDR-flk-1 (VEGFR-2/VEGFR-1).Yet except KDR (VEGFR-2), the accurate characteristic of these receptor forms and effect are also indeterminate.So, antibody response may because with the vegf receptor that does not wherein rely on KDR (VEGFR-2) in one of interact and to cause.

By facs analysis as can be known, DC-101 neither with the people KDR (VEGFR-2) of ELISA form reaction, do not combine with the HUVEC of fresh separated yet.These results show that DC-101 and people KDR (VEGFR-2) directly effect are unlikely.

By facs analysis as can be known, different with DC-101, Mab 25 and Mab 73 all with the people KDR (VEGFR-2) of ELISA form reaction, and in conjunction with the HUVEC of fresh separated.

The mitogenesis algoscopy of EXAMPLE V-9 HUVEC

Have and when not having antibody to exist, antagonist is tested in the mitogenesis algoscopy of the HUVEC cell (ATCC) that stimulates with VEGF, can be observed the inhibitory action of DC-101 to endotheliocyte.These results show, the remarkable increase of the cell proliferation due to the VEGF can approximately be reduced 35% by DC-101.Under the growth conditions that these algoscopys are used, the heparin cell growth does not have different effects.

Because DC-101 can work to the receptor phosphorylation of inductive propagation of VEGF and HUVEC, therefore can expect that these results are because Mab and indefinite receptor form interact, wherein indefinite receptor form is difficult near cell surface, but can be to some effect of HUVEC growth performance, although this effect is very little.And DC-101 can show the suitable phosphorylation band of the molecular weight fact that immunoprecipitation comes out from the HUVEC that VEGF-stimulates, DC-101 can with indefinite flk-1 (VEGFR-2) the sample protein-interacting relevant with activated receptor.

EXAMPLE V-10 Mab 25 and Mab 73 combine with C441 cell and HUVEC's

By facs analysis as can be known, Mabs 25 and 73 can be in conjunction with C441 and HUVEC, and can be in two cell lines internalization.The result of Western blotting shows that two kinds of anti-flk-1Mabs can detect the FLK/fms receptor band that immunoprecipitation comes out from the C441 cell by anti-fms polyclonal antibody.(seeing the method for top EXAMPLE IV-2).These antibody can cause the specificity neutralization of the inductive flk-1 of VEGF (VEGFR-2)/fms receptor, and mice pdgf receptor phosphorylation or the people EGF receptor phosphorylation due to the EGF due to the PDGF do not acted on.(seeing the method for the foregoing description IV-1).By proliferation assay as can be known, they have the ability of the HUVEC to 50% that suppresses the VEGF stimulation, and DC-101 then influences the very little degree that grows to.

The immunoprecipitation of EXAMPLE V-11 KDR (VEGFR-2) and Mab25 and Mab73

On behalf of a class, KDR (VEGFR-2) can utilize Mab 25 and Mab 73 phosphoprotein that immunoprecipitation comes out from activation HUVEC.KDR (VEGFR-2) detects in Western blotting, and uses anti-flk-1/KDR (VEGFR-1/VEGFR-2) polyclonal antibody (IM142) to carry out immunoprecipitation analysis from the HUVEC that goes down to posterity in early days that VEGF-stimulates.On the contrary, utilize these antibody immunoprecipitation comes out from the HUVEC that VEGF-stimulates band and IM142 cross reaction, and not with resist-flt-1 (anti-VEGFR-1) polyclonal antibody cross reaction.Based on experimental evidence, infer that according to these discoveries Mabs can influence the activity of KDR among the HUVEC (VEGFR-2), and hint is relevant with the breeder reaction in the activation endotheliocyte as the KDR (VEGFR-2) of vegf receptor.(seeing the method for top EXAMPLE IV-3)

The existence of vegf receptor form on the non-endothelium of example VI (tumor) cell

By immunoprecipitation some tumors system is screened, determining they and the albumino reaction of DC-101, and with anti-phosphotyrosine detection.The immunoblotting of cell line 8161 (melanoma) and A431 (epidermoid carcinoma) can produce molecular weight and be about 170 and the phosphorylation band of 120kd.These results show that people's vegf receptor form is at non-endotheliocyte, as expressing in the tumor cell.

Similarly experiment shows that KDR (VEGFR-2) sample receptor is expressed among the OVCAR-3 at ovarian cancer cell line.As if these cells also secretion of VEGF.The phosphorylation band is to utilize anti--KDR (VEGFR-2) polyclonal antibody immunoprecipitation from the OVCAR-3 cell that VEGF-stimulates to come out, and by western blot analysis as can be known, it can react with anti-flk-1 (VEGFR-2) Mabs.And, utilize the Mus Mabs band that immunoprecipitation comes out from these cells can with same polyclonal antibody cross reaction.In addition, by proliferation assay as can be known, some mouse-anti-flk-1 (VEGFR-2) Mabs can cause these cell inhibiting effects.These results have confirmed the non-endothelium expression (that is, expressing) of people's vegf receptor form on tumor cell.The data of phosphorylation and proliferation assay also show, in the VEGF scalable tumor generating process, and the receptor active of autocrine and paracrine mode.(seeing the method for the foregoing description IV-3)

Example VII A uses DC-101 to carry out research in the body

Example VII A-1 is utilized and is suppressed the blood vessel generation in the DC-101 body

Can design is carried out studying in the body be the growth of tumour cell that block VEGF expression for definite anti-flk-1 (VEGFR-2) monoclonal antibody.In these experiments, used people's glioblastoma multiforme cell line, it has high-caliber VEGF information, and can not handle after 24 hours in having the culture medium of serum, secretes the VEGF somatomedin (Fig. 5) of about 5ng/ml.

The 0th day, give nude mouse (nu/nu; Charles River Labs) 1,000,000 spongioblast oncocytes of flank injection 1-2.Beginning on the same day, giving animal peritoneal injection DC-101 or control antibodies (100 μ g/ animal).Subsequently, the 3rd, 5,7,10,12,14,17,19 and 21 days, mice was accepted Antybody therapy.The 0th, 3,5,7,10,12,14,17,19 and 21 days, inject the control rats antibody of 100 μ g DC-101 or Mus FLK-2 (2A13) receptor to animal, every animal inoculates 1mg altogether.Tumor began at the 5th day to occur, and continued 50 days always.Measure tumor size with caliber gauge every day, and utilize following formula to calculate gross tumor volume: p/6x than major diameter x (than minor diameter) ²(Baselga J.Nat ' l CancerInst.85:1327-1333).At least measure weekly 3 times, and according to top described calculating gross tumor volume.In the DC-101 group, an early stage death of suffering from the animal of tumor in research is arranged, can not be used to measure the statistically-significant difference between two groups.

After Figure 14 a and 14b represent 38 days, between DC-101 and the 2A13 matched group, the comparison that each animal tumor growth alleviates.Though in research process, variation has all taken place for the size of all animal tumors and quantity, the mice for the treatment of with DC-101 shows comprehensive delay in the tumour progression process.Wherein mice of DC-101 group keeps not having tumor until the 49th talent finds less growth.Even then, tumor growth is still significantly suppressed.Data are carried out statistical analysis, so that assess the difference of tumor size between two groups.Data are carried out the standard analysis of covariance, and wherein the tumor size reduced with treatment time.The result shows, the tumor size reduce in time aspect, DC-101 group and the mice obviously different (p＜0.0001) of injecting 2A13.

Figure 15 represents the therapeutic effect of DC-101 to nude mouse, has transplanted people's glioblastoma cell line GBM-18 of secretion of VEGF in the described nude mouse.Give mouse bare subcutaneous injection GBM-18 cell, and they are divided into 3 treatment groups: PBS matched group, irrelevant rat IgG1 matched group, and DC-101.Treatment is carried out simultaneously with the xenotransplantation of tumor, and continues for 4 weeks.The result shows, compares with matched group, and the GBM-18 tumor growth in the nude mice for the treatment of with DC-101 significantly reduces.This experiment shows, DC-101 suppresses tumor growth by the VEGF activation of flk-1 (VEGFR-2) on the blocking-up cancer-related vascular endothelial cell, and DC-101 is as having therapeutic value at the resisting of the vascularized tumors of secretion of VEGF-blood vessel propellant.

The tumor intrusion can take place to suppress by eliminating blood vessel in the monoclonal antibody of flk-1 (VEGFR-2) receptor tyrosine kinase.Invasive growth and blood vessel are the key characters of malignant tumor.Two phenomenons all are proved and are suitable for distinguishing benign and virulent keratinocyte in the surface transplantation algoscopy.After being transplanted on the nude mice dorsal muscles with the bonded cell monolayer of collagen gel, initial all tumor cells that form constitute squamous epithelial cancer, but have only pernicious keratinocyte in 2-3 invasive growth in week.But optimum and all induction of vascular generations of malignant cell.Yet the blood vessel of malignant cell reacts and takes place early, and is stronger, and blood capillary is towards pernicious epithelial growth.In addition, in the graft of benign tumor cells, blood capillary disappears after week at 2-3, and pernicious keratinocyte is then kept continual blood vessel occurred level.VEGF (VEGF) and related part thereof play a part crucial in tumor vessel takes place.The administration of DC-101 can destroy continual blood vessel and take place, and invades thereby suppress tumor.Antibody can stop vasoganglion ripe of new formation and further expand, but can not significantly disturb initial blood vessel to induce.These results confirm that the tumor intrusion needs blood vessel formerly to take place, and vegf receptor is most important in the blood vessel of keeping this model system takes place.

The DC-101 of example VII A-2 variable concentrations is to the effect of the glioblastoma (gbm-18) of being established

Give athymic mouse (nu/nu) subcutaneous vaccination GBM-18 (people's glioblastoma multiforme).When the average external volume of tumor reaches 100-200mm ³The time, the beginning Antybody therapy.Treatment comprises following 6 injections (2 times weekly, injected for 3 weeks): (i) DC-101 of per injection 200,400 or 800 μ g; The rat IgG (per injection 400 μ g) of (ii) irrelevant isotype coupling; Or (iii) PBS.Measure gross tumor volume with caliber gauge.Compare with irrelevant monoclonal antibody group with PBS, the tumor suppression of DC-101 group is (*) relatively significantly.

Other experiment susceptible of proof rat anti flk-1 (VEGFR-2) monoclonal antibody DC-101 is to the effect of nude mice GBM-18 tumor growth.The 0th day, give animal (nu/nu; Charles RiverLabs; 10 animal/groups) subcutaneous injection GBM-18 cell (people's glioblastoma [100]; 100 a ten thousand/animal).Began treatment on the 7th day with PBS or DC-101 (per injection 200 μ g), weekly twice, continue 3 weeks (6x).The mean tumour volume and the data that disappear that each group of graphical representation changes in time, (slope is represented with λ to give their tumor growth rates separately among the figure; Solid line) and 99% confidence limit (dotted line).The slope of curve of the animal of handling with DC-101 and obviously different (p＜0.01) of PBS.It should be noted that irrelevant rat IgG1 monoclonal antibody (anti-mice IgA; Pharmigen) growth to the GBM-18 xenograft does not influence, its result and use PBS observed similar (not providing data).

The cure rate of people's tumor xenogeneic graft in the nude mice of the alternative increase of the anti-flk-1 of example VII A I (VEGFR-2) antibody radiotherapy-induced

This embodiment is in order to assess the important vegf receptor-2 on the Mus tumor vascular endothelial cell capable of blocking, can the monoclonal antibody DC-101 of flk-1 (VEGFR-2) increase the curability of the tumor xenogeneic graft that fractionated radiotherapy (RT) causes, and can this antibody regulate the radiotherapy side effect of normal structure (mouse skin) simultaneously.

Cai Liao ﹠amp; Method: in the subcutaneous back leg that is implanted to nude mice of human small cell lung carcinoma 54A and glioblastoma multiforme U87.(the 0th day) begin treatment when diameter of tumor reaches 8mm.The DC-101 of per 3 days peritoneal injections 20 or 40mg/kg body weight injects 6 times altogether.Continuous 5 days, the fractionated radiotherapy accumulated dose that equates every day.The 0th day, mice is injection of antibodies for the first time, or beginning RT.For conjoint therapy, the DC-101 administration was beginning in the 0th day, and RT was beginning in the 1st day.After the treatment, measure the tumor size weekly 2-3 time.After in arbitrary group, observing tumor recurrence, follow the tracks of the mice 90 days that local control tumor is arranged.In preceding 30 days behind beginning RT, use the acute skin reaction in score scale assessment tumor radiotherapy zone.

The result: separately the mode that the antibody that uses can dose dependent suppresses two kinds of growth of tumor (but can not disappear).This acting among the 54A than more remarkable in the U87 xenograft.In arbitrary model, compare with carrying out RT separately, can further postpone growth of tumor to the radiotherapy and the DC-101 associating of lowest dose level (25-30Gy altogether).Antibody also is the curative effect that increases RT in the mode of dose dependent.For example, the DC-101 of higher dosage can make the required radiotherapy dosage of local control 50% tumor reduce: be 1.7 times (67.6Gy when carrying out RT separately reduces to the 39.1Gy of conjoint therapy) in the 54A xenograft; In U87 1.3 times (from 97.8-74.8Gy).Also have some particular importances, that this effect that is exactly DC-101 is optionally to tumor.That is, do not detect the parallel change of antibody to the skin radiotherapy side effect.As assessment in other experiment, the raising of the inductive tumor radiotherapy of DC-101 reaction has nothing to do with the change of their radiosensitization or oxidation, and significantly to reduce mesenchyma stroma of tumors hydraulic pressure relevant with antibody.

Conclusion: the result shows jointly, at the antibody of these growth factor molecule major receptors the alternative tumor of strengthening gradation RT of the blocking-up of VEGF-signal pipeline is cured reaction; Therefore and provide a kind of therapy.

Example I X. manufacture order chain antibody

Example I X-1 material

Example I X-1 (a) cell line and albumen

The former foster HUVEC that is commissioned to train maintains 37 ℃, 5%CO ₂The EBM-2 culture medium in.Use the cell in 2-5 generation to carry out all mensuration.VEGF ₁₆₅Albumen is expressed in baculovirus and purification.From the mRNA of human foetus's kidney, separate the complementary DNA of encoded K DR (VEGFR-2) extracellular domain by RT-PCR, and its sub-clone in the BglII and BspEI site of carrier A P-Tag.In this plasmid, the cDNA of KDR (VEGFR-2) extracellular domain merges with the cDNA of people's Placenta Hominis AP in frame.Described plasmid with neomycin expression vector pSV-Neo by electroporation in the NIH3T3 cell, and select stable cell clone with G418.Use the immobilization monoclonal antibody of AP, from cell culture supernatant liquid, be purified into soluble fusion protein KDR-AP by affinity chromatography.

The structure of example I X-1 (b) mouse immune method and single-chain antibody phage display library

Give 10 μ g KDR-AP twice in female BALB/C mice intraperitoneal (i.p.) the injection 200 μ l RIBI adjuvant systems, follow in 2 months, under the condition that does not have the RIBI adjuvant system, peritoneal injection 1 time.In first time during immunity inoculation, give 10 μ g KDR-AP among mice subcutaneous (s.c.) the injection 200 μ l RIBI.Before practising mercy killing, give and strengthen 20 μ g KDR-AP three days in the mouse peritoneum.Remove the spleen of donor mice, and isolated cell.Extract RNA and from total RNA of splenocyte, be purified into mRNA.Use mRNA to make up the scFv phage display library, it is at the surface display of filobactivirus M13.

ScFv when the filobactivirus surface display, the V of antibody _HAnd V _LDomain is by the joint of 15 amino acid longs (GGGGS) ³Link together, and merge with the N-of phage protein I II is terminal.In order to detect and to analyze, the E labelling of 15 amino acid longs (its back is amber codon (TAG)) is inserted into V _LThe C-end and protein I II between.The amber codon that is arranged between E labelling and protein I II can make this construct when transferring to inhibition host (as the TGI cell), constitute the scFv of surface-display form, and in transferring to non-inhibition host (as the HB2151 cell) time, constitute the scFv of soluble form.

The scFv DNA of assembling is connected in the pCANTAB 5E carrier.Be laid on the TG1 cell that transforms on the 2YTAG flat board and carry out incubation.Colony is scraped in 10ml 2YT culture medium, mixed with 5ml 50% glycerol ,-70 ℃ of storages are as the stock solution in library.

The biological elutriation of example I X-1 (c)

When library stock solution grows to logarithmic (log) phase, it is incorporated in the M13K07 helper phage, and in the time of 30 ℃, the amplification of in 2YTAK culture medium (2YT contains 100 μ g/ml ampicillins and 50 μ g/ml kanamycin), spending the night.The phage goods precipitate in 4%PEG/0.5M NaCl, and at 3% defatted milk/contain resuspension among the proteic PBS of 500 μ g/ml AP, 37 ℃ of incubations 1 hour are to catch the phage of showing anti-AP scFv and to block other non-specific binding.

(Nunc Denmark) 1 hour, uses phage goods room temperature incubation 1 hour then at first to seal the Maxisorp Star test tube that is coated with KDR-AP (10 μ g/ml) with 3% milk/PBS in the time of 37 ℃.Wash test tube 10 times with PBST, use PBS (PBS contains 0.1% polysorbas20) washing 10 times then.With the 100mM triethylamine solution room temperature elution of bound phage of 1ml prepared fresh 10 minutes.37 ℃ with the phage of the TG1 cell incubation eluting of 10ml mid-log phase 30 minutes, left standstill jolting 30 minutes.Then the TG1 cell that infects is laid on the 2YTAG flat board 30 ℃ of incubations that spend the night.

The clone who screens after the third round elutriation has 99% (185/186) to be specific KDR (VEGFR-2) bonding agent.Yet, in these bonding agent, have only 15 (8%) individually can block combining of KDR (VEGFR-2) and immobilization VEGF.These 15 clones' DNA BstN I fingerprint shows 2 kinds of different digestion patterns of existence; And 21 non-blockeres of the VEGF that randomly draws have produced 4 kinds of different patterns.Second takes turns after the elutriation, can see all digestion patterns in the clone who has identified.Each representative clone who digests pattern takes turns from second to select the clone who reclaims after the elutriation, and carries out dna sequencing.In 15 clones that surveyed preface, VEGF blocker and 3 non-blockeres of 2 uniquenesses have been identified.One of them scFv, p2A7 be neither in conjunction with KDR (VEGFR-2), and therefore combining of blocking VEGF and KDR (VEGFR-2) not be selected as the negative control of all researchs again.

The ELISA of example I X-1 (d) phage

In 96 hole flat boards, grow during 37 ℃ of each TG1 clones, and described it is incorporated in the M13K07 helper phage according to top.With the phage goods of 18% milk/PBS room temperature of 1/6 volume blocking-up amplification 1 hour, join then in the Maxi-sorp 96 hole microtitration plates (Nunc) that are coated with KDR-AP or AP (1 μ g/ml x, 100 μ l).Behind the room temperature incubation 1 hour, wash this flat board 3 times with PBST, and with the anti-M13 phage of rabbit Ab-HRP conjugate incubation.Dull and stereotyped 5 times of washing adds the TMB peroxidase substrate, uses micro-plate reader to read the OD at 450nm place, and evaluation is also checked order to scFv antibody.

The preparation of example I X-1 (e) solubility scFv

Each clone's phage is used to the infectious agent that infects non-inhibition escherichia coli host HB2151 and select on the 2YTAG-N flat board.The expression of scFv in the HB2151 cell is during by 30 ℃, and cultured cell is inductive in the 2YTA culture medium that contains 1mM isopropyl-1-sulfo--B-D-galactopyranoside.The kytoplasm extract of cell is by cell precipitation being resuspended among the 25mM Tris (pH 7.5), and in the time of 4 ℃, the jolting incubation prepared in 1 hour gently, and wherein 25mM Tris (pH 7.5) contains 20% (w/v) sucrose, 200mM NaCl, 1mM EDTA and 0.1mM PMSF.15,000rpm uses RPAS PurificationModule (Pharmacia Biotech) to be purified into solubility scFv by affinity chromatography from supernatant after centrifugal 15 minutes.

Example I X-2 algoscopy

Example I X-2 (a) is KDR (VEGFR-2) binding assay quantitatively

Use the solubility scFv of two kinds of algoscopy detection by quantitative purification and combining of KDR (VEGFR-2).

4 different clones comprise two VEGF blockeres, p1C11 and p1F12, and a non-blocker, advantage clone p2A6 and non-binding dose of p2A7 utilize non-inhibition host e. coli HB2151 cell to express in shaking bottle.Solubility scFv comes out by anti--E labelling affinity chromatography purification from colibacillary kytoplasm extract.The productive rate of these clones' purification scFv is a 100-400 μ g/l culture.

In direct binding assay, not commensurability solubility scFv is joined in the 96 hole Maxi-sorp microtitration flat boards of KDR (VEGFR-2) bag quilt, room temperature incubation 1 hour is with dull and stereotyped 3 times of PBST washing.Use the 100 μ l mouse anti E traget antibody room temperature incubations should flat board 1 hour then, then with the 100pl rabbit anti--mouse antibodies-HRP conjugate cultivates.After carrying out above-mentioned phage E LISA process, the dull and stereotyped and development of washing.

In another algoscopy, in the promptly competitive VEGF blocking-up algoscopy, not commensurability solubility scFv is mixed room temperature incubation 1 hour with the KDR-AP of fixed amount (50ng).Then mixture is transferred to and be coated with VEGF ₁₆₅In the 96 hole microtitration flat boards in (200ng/ hole), room temperature incubation 2 hours, dull and stereotyped 5 times of washing afterwards adds the substrate of AP, thereby quantizes bonded KDR-AP molecule.Calculate IC then ₅₀, that is, suppress the required scFv concentration of KDR (VEGFR-2) and VEGF bonded 50%.

Figure 16 represents that scFv combines with the dose dependent of immobilization KDR (VEGFR-2) by directly measuring in conjunction with ELISA.As shown in figure 17, clone p1C11 and p1F12 KDR also capable of blocking (VEGFR-2) combine with immobilization VEGF's, but p2A6 can not.Data shown in Figure 17 are three meansigma methods ± SD that measure.Negative control clone p2A7 neither in conjunction with KDR (VEGFR-2), does not block combine (Figure 16 and 17) of KDR (VEGFR-2) and VEGF yet.Clone p1C11, promptly every advantage clone who takes turns after the elutriation demonstrates the bonded efficient (table 1) of the highest KDR (VEGFR-2) binding ability and blocking VEGF and KDR (VEGFR-2).Make clone p1C11 combine maximum 50% required antibody concentration and inhibition KDR (VEGFR-2) and VEGF bonded 50% required concentration with KDR (VEGFR-2) and be respectively 0.3nM and 3nM (Figure 17).Facs analysis confirms that p1C11, p1F12 and p2A6 also can be combined in the receptor of HUVEC cell surface expression.

The BIAcore of example I X-2 (b) solubility scFv analyzes

The binding kinetics of solubility scFv and KDR (VEGFR-2) is measured with BIAcore biosensor (Pharmacia Biosensor).The KDR-AP fusion rotein is fixed on the sensor chip solubility scFv of injection 62.5nM-1000nM concentration.Obtain the sensing figure of each concentration, and use the assessment of BIA Evaluation 2.0 programs, to measure rate constants k on and koff.Kd is according to the ratio calculation of rate constants k off/kon.

The result of table 1 expression BIAcore instrument upper surface plasma resonance.The scFv of blocking VEGF, p1C11 and p1F12 respectively with 2.1 and the Kd of 5.9nM combine with immobilized KDR (VEGFR-2).Non-barrier scFv, p2A6 and KDR (VEGFR-2) be when combining, its affinity than best bonding agent p1C11 a little less than 6 times, this mainly is because its dissociation rate faster.As desired, p2A7 does not combine with immobilization KDR (VEGFR-2) on the BIAcore.

Example I X-2 (c) phosphorylation assay method

The phosphorylation assay method is according to preceding method, carries out with the HUVEC that goes down to posterity in early days.Briefly,, replenishing 0.5% bovine serum albumin, do not having in the EBM-2 basal medium of serum room temperature incubation HUVEC 10 minutes, then using 20ng/ml VEGF being with or without 5 μ g/ml scFv antibody when existing ₁₆₅Room temperature stimulated 15 minutes.Dissolved cell, use with rabbit anti--the link coupled protein A sepharose 4B of KDR (anti-VEGFR-2) polyclonal antibody (ImClone Systems Incorporated) comes out KDR (VEGFR-2) receptor immunoprecipitation from cell lysates.The washing pearl mixes with the SDS sample loading buffer, and supernatant is carried out western blot analysis.In order to detect the phosphorylation of KDR (VEGFR-2), with anti--phosphotyrosine Mab, 4G10 surveys trace.For the map kinase activation measurement, differentiate cell lysates with SDS-PAGE, then use phosphoric acid-specificity map kinase antibody to carry out western blot analysis.All signals all detect with ECL.

The result shows that the scFv p1C11 of blocking VEGF can suppress KDR (VEGFR-2) receptor phosphorylation that VEGF stimulates, but not barrier scFv p2A6 then can not.In addition, p1C11 also can effectively suppress the map kinase p44/p42 activation that VEGF-stimulates.On the contrary, p1C11 and p2A6 can not suppress the map kinase p44/p42 activation that FGF-stimulates.

Example I X-2 (d) resisting mitosis algoscopy

HUVEC (5x10 ³Individual cells/well) the 200 μ l that are laid on the 96 hole tissue culture plate do not have VEGF, in the EBM-2 culture medium of bFGF or EGF, and 37 ℃ of incubations 72 hours.Not commensurability antibody is added in the hole in duplicate, and 37 ℃ of precincubation 1 hour adds VEGF afterwards ₁₆₅Final concentration to 16ng/ml.Behind the incubation 18 hours, in each hole, add 0.25 μ Ci [ ³H]-TdR (Amersham), incubation is 4 hours again.Cell is placed on ice,, uses 10%TCA incubation 10 minutes in the time of 4 ℃ then with containing the culture medium washed twice of serum.Wash cell then with water 1 time, and in the 2%SDS of 25 μ l, dissolve.Add scintillation solution (150 μ l/ hole), go up the radioactivity that mensuration has been mixed DNA at scintillation counter (Wallach, Model 1450 Microbeta ScintillationCounter).

ScFv antibody blocking HUVEC goes up the ability of the mitogenic activity of VEGF-stimulation and represents in Figure 18.The scFv p1C11 of blocking VEGF can suppress HUVEC effectively, and upward the inductive DNA of VEGF is synthetic, its EC ₅₀, the mitogenetic antibody concentration of HUVEC that promptly suppressing 50%VEGF-stimulates is about 5nM.Non-barrier scFv p2A6 does not have inhibitory action .p1C11 and p2A6 can not suppress the inductive DNA of bFGF synthetic (not marking) among the HUVEC to the mitogenic activity due to the VEGF.At least 3 independently experiments of data representation shown in Figure 180.(! ) VEGF only arranged; (A) there is not VEGF.

Example I X-3 produces chimeric antibody from p1C11

Example I X-3 (a) cell line and albumen

The former foster Human umbilical vein endothelial cells (HUVEC) of being commissioned to train is at 37 ℃, 5%CO ₂The EBM-2 culture medium in keep.Cell with 2-5 generation is all measured.VEGF ₁₆₅And KDR (VEGFR-2) alkaline phosphatase enzyme fusion proteins (KDR-AP) expresses in baculovirus and NIH 3T3 cell respectively, and presses the said process purification.Anti--KDR (anti-VEGFR-2) scFv p1C11 and scFvp2A6, a kind of in conjunction with KDR (VEGFR-2), but do not block KDR (VEGFR-2)-interactional antibody of VEGF, from phage display library, separate, phage display library is by top described, makes up from using KDR (VEGFR-2) mice immunized.C225 is a kind of chimeric IgG1 antibody at epidermal growth factor (EGF) receptor.See above.

The clone of example I X-3 (b) scFv p1C11 variable domains

Light chain (the V of p1C11 _L) (SEQ ID NO:8 and SEQ ID NO:16) and heavy chain (V _H) variable domains of (SEQ ID NO:7 and SEQ ID NO:15) is to use primer 1 and 2 respectively, primer 3 and 4, by PCR from scFv expression vector clone 's.Use primer 5 and 2 then respectively, primer 5 and 4 is added to V to the excretory albumen leader peptide sequences of mammalian cell by PCR _LAnd V _H5 ' end.

Primer 1:5 ' CTA GTA GCA ACT GCA ACT GGA GTA CAT TCA GAC ATC GAGCTC 3 ' [SEQ ID No:37]

Primer 2: 5 ' TCG ATC TAG AA G GAT CCA CTC ACG TTT TAT TTC CAG 3 ' BamHI[SEQ ID No:38]

Primer 3:5 ' CTA GTA GCA ACT GCA ACT GGA GTA CAT TCA CAG GTC AAGCTG 3 ' [SEQ ID No:39]

Primer 4:5 ' TCG AA G GAT CCA CTC ACC TGA GGA GAC GGT 3 ' BamHI[SEQ ID No:40]

Primer 5:5 ' GGT CAA AAG CTTATG GGA TGG TCA TGT ATC ATC CTT TTTHind III CTA GTA GCA ACT 3 ' [SEQ ID No:41]

The structure of the chimeric p1C11 IgG of example I X-3 (c) expression vector

Structure is used to express the separate carrier of chimeric IgG light chain and heavy chain.Clone V _LGene is with Hind III and BamH I digestion, and is connected to and contains human kappa light chain constant region (C _L) carrier pKN100 in, thereby make chimeric p1C11 light chain, the expression vector of c-p1C11-L.Clone V _HGene is with Hind III and BamH I digestion, and is connected to and contains human IgG1 (γ) CH (C _H) carrier pGID105 in, thereby make chimeric p1C11 heavy chain, the expression vector of c-p1C11-H.Two structures are all checked by restriction endonuclease digestion, and are confirmed by the dideoxy nucleotide order-checking.

As shown in figure 19, V _HAnd V _LDomain accurately merges at their the 5 ' end and the genetic fragment of the coding leader peptide sequences of marking (SEQ ID NO:23 and SEQ ID NO:24).V _HAnd V _LDomain is connected among the expression vector pG1D105 via Hind III/BamH I site respectively, contains in the cDNA form and expression pKN100 of people γ 1 constant region gene, contains the cDNA form of people κ chain constant region gene.In both cases, expressing all is to carry out under the control of HCMVi promoter, and is stopped by artificial terminator sequence.According to regulations in the hypervariable sequence definition such as Kabat, light chain and heavy chain complementary determining region (CDR) residue are the parts of underscoring, and have marked CDR-H1 to H3 respectively, CDR-L1 to L3.CDR-H1 (SEQ ID NO:1 and SEQID NO:9); CDR-H2 (SEQ ID NO:2 and SEQ ID NO:10); CDR-H3 (SEQ IDNO:3 and SEQ ID NO:11); CDR-L1 (SEQ ID NO:4 and SEQ ID NO:12); CDR-L2 (SEQ ID NO:5 and SEQ ID NO:13); CDR-L3 (SEQ ID NO:6 and SEQID NO:14).

Expression and the purification of example I X-3 (d) IgG

COS cell and equivalent c-p1C11-L and c-p1C11-H plasmid co-transfection carry out instantaneous IgG and express.The COS cell is converged in the Asia of growing in the DMEM/10%FCS of 150mm culture dish to be washed once with the DMEM that 20ml contains 40mM Tris (pH 7.4), (DMEM contains 40mM Tris to use 4mlDMEM/DEAE-glucosan/DNA mixture then, 0.4mg/ml DEAE-glucosan (Sigma) and 20 μ g c-p1C11-L and c-p1C11-H plasmid) 37 ℃ of incubations 4.5 hours.The 2%FCS that cell is contained 100nM chloroquine (Sigma) with 4ml DMEM/ cultivated 1 hour in the time of 37 ℃, then with 1.5ml 20% glycerol/PBS room temperature incubation 1 minute.With DMEM/5%FCS washed cell twice, 37 ℃ of incubations that spend the night in the identical culture medium of 20ml.After using twice of pure DMEM washed cell then, cell culture medium is replaced with the DMEM/HEPES that does not have serum.After transfection the 48th and 120 hour, the supernatant of collecting cell culture.Method according to manufacturer (Pharmacia Biotech) description, use G albumen post to collect the part that contains IgG from the chimeric IgG. of the supernatant purification that merges by affinity chromatography, buffer exchange is become PBS, and with Centricon 10 concentrators (Amicon Corp., Beverly MA) concentrates.IgG purity is analyzed by SDS-PAGE.The concentration of antibody purification is to use goat Anti-Human y chain specific antibody as trapping agent, uses the link coupled goat Anti-Human of HRP-k chain antibody as detection agent, utilizes ELISA to measure.Use clinical grade antibody C225 calibration standard curve.

After carrying out affinity purification with G albumen, in SDS-PAGE, see the single protein band of an about 150kD.The western blot analysis that uses the link coupled anti-human IgG1 Fc specific antibody of HRP-to carry out confirms, has the Fc part (not marking) of human IgG in the purifying protein.

The result of ELISA shows that scFv compares with parental generation, and c-p1C11 can be more effectively in conjunction with immobilized KDR (VEGFR-2) (Figure 20).

Example I X-4 measures and analyzes

Example I X-4 (a) facs analysis

The HUVEC cell of early generation is grow overnight in the EBM-2 culture medium of disappearance somatomedin, thus the expression of inducing KDR (VEGFR-2).Gather cell, and with PBS washing 3 times, with 4 ℃ of incubations of c-p1C11 IgG (5 μ g/ml) 1 hour, then with the anti-people Fc of the rabbit antibody of FITC labelling (Capper, Organon Teknika Corp., West Chester, PA) incubation 60 minutes again.Washed cell utilizes flow cytometry (Model EPICS

, CoulterCorp., Edison NJ) analyzes.

Figure 21 is the bonded facs analysis curve chart of HUVEC of expression c-p1C11 and expressing K DR (VEGFR-2).As previous use parental generation scFv p1C11 finding, the HUVEC that the c-p1C11 specificity is combined in early generation goes up the KDR (VEGFR-2) that expresses.

The quantitative KDR of example I X-4 (b) (VEGFR-2) binding assay

Not commensurability antibody is joined in the 96 hole Maxi-sorp microtitration flat boards (Nunc.Danmark) that are coated with KDR (VEGFR-2), and room temperature incubation 1 hour is then with dull and stereotyped 3 times of the PBS washing that contains 0.1% polysorbas20.Room temperature makes the mouse anti E traget antibody-HRP conjugate (Phannacia Biotech) of this flat board with 100 μ l scFv, or rabbit anti-human igg Fc specific antibody-HRP conjugate of chimeric IgG (Cappel, Organon Teknika Corp.) incubation 1 hour.Dull and stereotyped 5 times of washing, (MD), (Molecular Device, Sunnyvale CA) read the OD at 450nm place to utilize micro-plate reader for KPL, Gaithersburg to add the TMB peroxidase substrate.

Figure 20 is expression antibody and the direct bonded curve chart of immobilization KDR (VEGFR-2).ScFv compares with parental generation, and c-p1C11 can be more effectively in conjunction with immobilized KDR (VEGFR-2) receptor.

Example I X-4 (c) BIAcore analyzes

The binding kinetics of antibody and KDR (VEGFR-2) is measured with BIAcore biosensor (Pharmacia Biosensor).KDR (VEGFR-2)-AP fusion rotein is fixed on the sensor chip antibody or the VEGF of injection 25nM-200nM concentration.Obtaining the sensing figure of each concentration, and with BIA Evaluation 2.0 programs assessments, is with the ratio calculation of rate constants k off/kon thereby measure rate constants k on and koff.Kd.

BIAcore analyzes announcement, and scFv compares with parental generation, the binding affinity higher (table 2) of c-p1C11 and KDR (VEGFR-2).The Kd of c-p1C11 is 0.82nM, and the Kd of scFv be the increase of 2.1nM.c-p1C11 affinity mainly is because the dissociation rate (koff) of the chimeric IgG of bivalence is lower.Binding affinity that it should be noted that the binding affinity of c-p1C11 and KDR (VEGFR-2) and native ligand VEGF and KDR (VEGFR-2) is similar, is determined as 0.93nM (table 2) in BIAcore analyzes.

The competitive VEGF binding assay of example I X-4 (d)

In first algoscopy, not commensurability antibody is mixed room temperature incubation 1 hour with KDR (the VEGFR-2)-AP (50ng) of fixed amount.Then mixture is transferred to and be coated with VEGF ₁₆₅In the 96-hole microtitration plate in (200ng/ hole), room temperature incubation 2 hours, washing is dull and stereotyped 5 times then, the substrate of adding AP (right-nitrobenzophenone phosphoric acid, Sigma), thereby quantize bonded KDR (VEGFR-2)-AP molecule.Calculate EC then ₅₀, that is, suppress the required antibody concentration of KDR (VEGFR-2) and VEGF bonded 50%.

Figure 22 represents that c-p1C11 KDR capable of blocking (VEGFR-2) receptor combines with the dose dependent of immobilization VEGF.IC with scFv 2.0nM ₅₀Value is compared, and chimeric antibody is the interaction of blocking VEGF-KDR (VEGFR-2) more effectively, its IC ₅₀Value (that is, suppressing the required antibody concentration of KDR (VEGFR-2) and VEGF bonded 50%) is 0.8nM.Contrast scFv p2A6 also can be in conjunction with KDR (VEGFR-2) (Figure 20), but the not interaction (Figure 22) of blocking VEGF-KDR (VEGFR-2).

In second algoscopy, not commensurability c-p1C11 antibody or cold VEGF ₁₆₅Albumen and fixed amount ¹²⁵The VEGF of I labelling ₁₆₅Mix, join in the 96 hole microtitration plates that are coated with KDR (VEGFR-2) receptor.The room temperature incubation should flat board 2 hours, washs the radiolabeled VEGF of calculations incorporated immobilization KDR (VEGFR-2) receptor 5 times ₁₆₅Amount.Measure 50% required c-p1C11 and cold VEGF of radiolabeled VEGF of blocking-up and immobilization KDR (VEGFR-2) receptors bind ₁₆₅Concentration.

Radiolabeled VEGF ₁₆₅Represent in Figure 23 in conjunction with suppressing the result.Shown in data be the meansigma methods of measuring for three times.C-p1C11 can the dose dependent mode with ¹²⁵The VEGF of I labelling competes the receptor in conjunction with immobilization KDR (VEGFR-2) effectively.As desired, C225, a kind of chimeric antibody at the EGF receptor be neither in conjunction with KDR (VEGFR-2) receptor, the also not interaction of blocking VEGF-KDR (VEGFR-2) (not expression).

Example I X-4 (e) phosphorylation assay method

Before experimentizing, the HUVEC cell that the Asia is converged was grown 24-48 hour in the EBM-2 culture medium of disappearance somatomedin.With the pretreatment of 50nM sodium orthovanadate after 30 minutes, be with or without antibody when existing, this cell of incubation 15 minutes is then with the VEGF of 20ng/ml ₁₆₅Or the FGF room temperature of 10ng/ml stimulated 15 minutes.Then at dissolving buffer (50nM Tris, 150mM NaCl, 1%NP-40,2mM EDTA, 0.25% NaTDC, 1mM PMSF, 1 μ g/ml leupeptin, 1 μ g/ml pepsin inhibitor, 10 μ g/ml aprotiniies, pH7.5) this cell of dissolving in, cell lysates is used for KDR (VEGFR-2) and map kinase phosphorylation assay.KDR (VEGFR-2) receptor is to use the antibody with anti-KDR (VEGFR-2), the link coupled A albumen sepharose 4B of Mab4.13 (ImClone Systems) (Santa CruzBiotechnology, Inc., what CA) immunoprecipitation came out from cell lysates.Albumen is differentiated with SDS-PAGE, and through western blot analysis.In order to detect KDR (VEGFR-2) phosphorylation, with anti-phosphotyrosine Mab, (ICN Biomedicals, Inc.Aurora OH) survey trace to PY20.For the map kinase determination of activity, cell lysates is differentiated with SDS-PAGE, and (NewEngland BioLabs, Beverly MA) carry out western blot analysis then to use phosphoric acid specificity map kinase antibody.All signals all are that (Amersham, Arlington Heights IL.) detect with ECL.In two algoscopys, survey this trace once more with the anti-KDR of polyclone (VEGFR-2) antibody (ImClone Systems), thereby guarantee the albumen of application of sample equivalent in each road of SDS-PAGE gel.

C-p1C11 can effectively suppress KDR (VEGFR-2) receptor phosphorylation and the kinase whose activation of p44/p42MAP that VEGF-stimulates.On the contrary, KDR (VEGFR-2) receptor activation that then VEGF-stimulated of C225 and map kinase are without any inhibitory action.Independent c-p1C11 and C225 to the activity of KDR (VEGFR-2) receptor and p44/p42 map kinase without any effect.Use scFv p1C11 seen as the front, c-p1C11 can not suppress the p44/p42MAP kinase activation (not expression) that FGF-stimulates.In addition, the chimeric IgG form (c-p2A6) of scFv p2A6 and p2A6 all can not suppress the activation (not expression) of KDR (VEGFR-2) receptor and the map kinase of VEGF-stimulation.

Example I X-4 (f) resisting mitosis is measured

Anti-KDR (VEGFR-2) antibody is to use HUVEC to the mitotic effect of human endothelial cell that VEGF-stimulates, by [ ³H]-TdR DNA mixes that algoscopy measures.HUVEC (5x10 ³Individual cells/well) is plated on that 200 μ l do not have VEGF on the tissue culture plate of 96-hole, the EBM-2 culture medium Shen of bFGF or EGF, 37 ℃ of incubations 72 hours.Not commensurability antibody is joined in the hole in duplicate, and 37 ℃ of precincubation 1 hour adds VEGF then ₁₆₅Final concentration to 16ng/ml.Behind the incubation 18 hours, in each hole, add 0.25 μ Ci [ ³H]-TdR, incubation is 4 hours again.Measure the radioactivity of having mixed DNA with scintillation counter.The independent experiment that data representation shown in Figure 24 is at least 3 times.

C-p1C11 and scFv p1C11 can effectively suppress the HUVEC mitosis (Figure 24) that VEGF stimulates.ScFv compares with parental generation, and c-p1C11 is a kind of stronger inhibitor for the inductive HUVEC mitosis of VEGF-.Suppressing the inductive HUVEC of VEGF-mitotic 50% required antibody concentration is respectively: c-p1C11 is 0.8nM, and scFv is 6nM.As desired, the endothelial cell proliferation that scFv p2A6 stimulates VEGF-is without any inhibitory action.

According to the above description and list of references that is easy to obtain and parent material, the present invention is feasible.Yet the applicant is in American type culture collection, 12301Parklawn Drive, Rockville, Md., among the 20852USA (ATCC), preservation the hybridoma cell line of following generation monoclonal antibody:

Preservation on January 26 in 1994, the hybridoma cell line DC-101 (ATCC preserving number HB11534) of generation rat anti-mouse flk-1 (VEGFR-2) monoclonal antibody.

Preservation on July 19 in 1996, the hybridoma cell line M25.18A1 (ATCC registration number HB12152) of generation mouse anti mice flk-1 (VEGFR-2) monoclonal antibody Mab 25.

Preservation on July 19 in 1996, the hybridoma cell line M73.24 (ATCC preserving number HB12153) of generation mouse anti mice flk-1 (VEGFR-2) monoclonal antibody Mab 73.

Preservation is the regulation according to budapest treaty, carries out in the international microbial preservation mechanism that is used for proprietary program and regulations thereof (budapest treaty).Making the culture of can guaranteeing to live like this kept 30 years from preservation.According to budapest treaty, under the situation of reaching an agreement between applicant and the ATCC, can obtain organism from ATCC, can guarantee like this related U.S. patent openly after, use it without restriction.According to the regulation of Patent Law, when carrying out this invention, need not under the mandate of any administrative organization, use preservation strain.

Table 1 is anti--KDR (VEGFR-2) binding analysis of KDR (VEGFR-2) scFv antibody

1. by directly measuring in conjunction with ELISA, the digitized representation in the bracket produces the scFv concentration of 50% maximum combined;

2. measure by competitive VEGF blocking-up ELISA, the digitized representation in the bracket suppresses the required scFv concentration of KDR and immobilization VEGF bonded 50%;

3. by the BIAcore assay determination.N/A=can not use.

Table 2p1C11 scFv and c-p1C11 and

The binding kinetics * of KDR (VEGFR-2) receptor

* all ratios all are to use the BIAcore system, measure by surface plasma resonance, and be the meansigma methods of at least 3 independent measurements

Embodiment X

Present embodiment susceptible of proof VEGFR antagonist, promptly anti--flt-1 (anti-VEGFR-1) monoclonal antibody, the production of MF-1.

Rat anti VEGFR-1 monoclonal antibody is developed by the standard hybridoma technology.(i.p.) perfusion and blended 100 μ g VEGFR-1Fc (constant region) recombiant protein (R﹠amp of Freund's complete adjuvant in the rat peritoneum of giving for 8 ages in week; D Systems, Minneapolis MN) excites.Then, with before the same protein of having mixed incomplete Freund merges, give rat booster injection 3 times.

Hybridoma is by the splenocyte of myeloma cell P3x63Ag8.653 and immune rat and medullary cell fusion are produced.Based in the combination of ELISA and the blocking-up algoscopy, use VEGFR-1 alkali phosphatase (AP) recombiant protein to select the specificity clone of anti-VEGFR-1.Positive colony is sub-clone by the restriction dilution.

Anti-VEGFR-1 monoclonal antibody (mAbs) that derives from hybridoma is to obtain by raise fermentation continuously in not having the culture medium of serum.Use γ-, by affinity chromatography purification mAbs in the conditioned medium of serum never in conjunction with G albumen agarose.Use Pyrogentplus

Limulus Amebocyte Lysate test kit (Bio Whittaker, Walkersville, MD) the interior institute of the test body endotoxin of mAbs.All used antibody preparations of zooscopy all contain≤endotoxin of 1.25EU/ml.Anti-VEGFR-1 polyclonal antibody is that the rabbit from the inoculation of reorganization VEGFR-1AP protein immunization produces, and by γ-in conjunction with G albumen post (Amersham Pharmacia Biotech, Uppsala, Sweden) purification.

The immunochemistry of anti-VEGFR-1 mAbs is in combination and blocking-up algoscopy based on ELISA, and identify in the BIAcore of the affinity analysis.When binding assay was 4 ℃, spending the night with the VEGFR-1AP in 50ng/ hole or VEGFR-2AP albumen, (Bedford MA) carried out bag for Falcon Flexible plate, Becton Dickinson by 96 hole microtitration plates.Add 200 μ l and contain 5% Ox blood serum, the phosphate buffered saline (PBS) of 0.05% polysorbas20 (sealing buffer) seals the hole, room temperature (RT) incubation 2 hours.Wash this hole (5x), during room temperature, the variable concentrations mAbs incubation that dilutes in the buffer in sealing with 50 μ l 1 hour.Wash this hole (5x) once more, (CA) incubation is 1 hour for BioSourceInternational, Camarillo with the 50 μ l goat Mus IgG-HRP of the Chinese People's Anti-Japanese Military and Political College for room temperature.Wash this hole (5x) at last, (MD) incubation is 15 minutes for Kirkegaard andPerry Lab Inc., Gaithersburg with 50 μ l 3,3 ', 5,5 '-tetramethyl benzidine (TMB) substrate for room temperature.Add 50 μ l 1M phosphoric acid (H ₃PO ₄) cessation reaction, at the 450nm place of microtitration plate reader to this hole reading.

For VEGFR-1/VEGF or P1GF blocking-up mensuration, when the hole is 4 ℃, with 100ngVEGF or P1GF (R﹠amp; D Systems, Minneapolis, MN) bag is spent the night.According to this hole of top described sealing, use 100ng VEGFR-1AP room temperature incubation 1 hour then, wherein said VEGFR-1AP used variable concentrations mAb precincubation 1 hour.Wash this hole, and with right-nitrobenzophenone phosphoric acid (PNPP, Sigma, St.Louis, MO) incubation.Color development at room temperature 30 minutes is at the 405nm place of microtitration plate reader reading.

The binding kinetics of anti-VEGFR-1mAbs and VEGFR-1 is measured with BIAcore biosensor (Fharmacia Biosensor).The VEGFR-1Fc fusion rotein is fixed on the chip of pick off the mAbs of injection 3.125nM-50nM concentration.Obtain the sensing figure of each concentration, with the assessment of BIA Evaluation 2.0 programs, thereby mensuration is as the Kd value of the ratio of rate constants k on/koff.

Embodiment XI

Present embodiment has confirmed giving EGF-R ELISA (EGFR) antagonist, monoclonal antibody ERBITUX ^TMVascular endothelial growth factor receptor (VEGFR) antagonist of (being also referred to as IMC-C225 or C225) and treatment effective dose behind the anti-VEGFR-1 monoclonal antibody DC101, can suppress tumor growth.

The antibody that carries out immunohistochemical analysis and angiogenesis inhibitor therapy is as follows: derive from Pharmingen (SanDiego, rat anti CA)-mice CD31/PECAM-1 antibody; Derive from DAKO Corp. (Carpinteria, mouse anti-proliferating cell nuclear antigen CA) (PCNA) clone PC10 DAKO A/S; Derive from Jackson Research Laboratories (WestGrove, peroxidase PA)-link coupled goat is anti--rat immunoglobulin (IgG) (H+L) and the link coupled goat of the texas Red Mus IgG of the Chinese People's Anti-Japanese Military and Political College; Derive from Serotec HarlanBioproducts for Science, Inc. (Indianapolis, the link coupled rat anti-mouse IgG2a of peroxidase IN); With derive from ImClone Systems, Inc. (NewYork, NY) (Prewett etc., 1999; Witte etc., 1998) rat anti-mouse vegf receptor-2 monoclonal antibody (Prewett etc., 1999; Witte etc., 1998) and chimeric anti-people EGF acceptor monoclonal antibody (Goldstein etc., 1995).

Use No. 30 pins that are connected with the 1ml syringe to give male nude mouse (National Cancer Institute, Animal Production Area, Frederick, MD) 1.0x10 among the peritoneal injection 500 μ l HBSS in 8 ages in week ⁶Individual KM12L4 colon cancer cell.Then mice is divided into 4 groups (every group of 10 mices) at random: matched group, DC101, C225, or DC101 and C225.All zooscopies all are at Animal Care andUse Committee of MD Anderson Cancer Center and UKCCCR, carry out under 1998 the approval.

From the injection tumor cell after 3 days, use No. 27 pins that are connected with the 1ml syringe to give (i.p.) injection control vehicle (saline of phosphate-buffered [PBS]) in the mouse peritoneum in per 3 days, DC101 (0.8mg), C225 (1.0mg), or DC101 (0.8mg) and C225 (1.0mg) (cumulative volumes of per injection 700 μ l).Weigh to mice weekly.(approximately the treatment beginning is back 30 days) kill mice when matched group is dying, carry out postmortem completely, quantize tumor load, gather tumor, according to following described the analysis.

All to perform an autopsy on sb to every mice,, determine the tumor mean size, excise representational pathological changes with the size of caliber gauge measurement peritoneal tumor.By the degree of the research worker assessment ascites of not knowing to treat the set of dispense scheme, standard is as follows: 0 grade, do not have ascites; 1 grade, slight ascites; 2 grades, moderate ascites; 3 grades, severe ascites; 4 grades, the serious ascites that abdominal part is tightened (Aparicio etc., 1999).Tumor biopsy is embedded in the OCT chemical compound, and-70 ℃ freezing, or it is fixed in the formalin, is embedded in the paraffin then.

Tissue slice is to handle by carrying out standard dewaxing (for formalin fixed and paraffin-embedded tissue) or it is fixed in acetone and the chloroform (for the tissue in being chilled in OCT), according to the immunohistochemical analysis (Shaheen etc., 1999) that carries out noted earlier.Briefly, with the 3%H in the methanol ₂O ₂The sealing endogenous peroxydase is used the PBS washed, and incubation is 20 minutes in protein blocking solution (having replenished the PBS of 1% normal goats serum and 5% notmal horse sera), is incubated overnight for 4 ℃ with first antibody at CD31 or PCNA.Then, washed, with albumen-lock solution incubation, room temperature was cultivated 1 hour with peroxidase-link coupled second antibody, the DAB incubation is used in washing, and the hematoxylin negative staining is used in washing, washing, and with Universal Mount sealing, dry on 56 ℃ flat plate heat.Using with the link coupled second antibody of texas Red (red fluorescence) replaces peroxidase-link coupled antibody incubation to the painted frozen section of CD31.The omission of first antibody can be used as negative control.

Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling otch-end labelling (TUNEL) dyeing is to carry out according to the method that manufacturer provides.Briefly, there is not the paraformaldehyde of methanol to fix section, washing with 4%, permeate with 0.2%Triton X-100, washing is with the level pad incubation of test kit, with containing level pad, mixture of ribonucleotides, and 37 ℃ of incubations of reactant mixture of TdT enzyme 1 hour, stop the TdT reaction with 2x standard citrate hydroecium temperature incubation 15 minutes, wash, with DAPI sealing dyeing (with observation of cell nuclear), covered.

Some tumor vessels and PCNA-positive cell are to utilize optical microscope (with 100 times amplification, at 5 0.159-mm at random ²Count in the zone) assessment, and with the Optimas image analysis software (Biscan, Edmond, WA) carry out digital image and the processing.The cell of programmatic death is describedly observed with immunofluorescence according to following.(Adobe Systems, Mountain View CA) carry out digital image and processing to section with Adobe Photoshop software.The positive endotheliocyte of CD311-(ECs) is used the rhodamine light filter, by the local red fluoroscopic examination.Programmed cell death is to use the fluorescence filter, is had by the local green fluorescence of tumor cell (TCs) or Ecs that red green fluorescence measures.Nucleus is to detect with the blue-fluorescence of filter by DAPI.With 400 times amplification, 5 successive 0.011-mm in microscope slide ²Non--overlapping region pair cell counting, first zone is to select at random in the downright bad at once part of tumor.Calculate the ECs of programmatic death in each zone and the percentage ratio of TCs then, [the cell %=of programmatic death (cell number of programmatic death/total cell number) x100].

Treat after 30 days, measure the diameter of peritoneum pathological changes, assess total tumor load.Compare with matched group, the average peritoneal tumor size of DC101 group (little 55.3%) and DC101+C225 group (little 66.7%) is smaller.Though 100% contrast and C225 mice suffer from disease of peritoneum when research finishes, 10% DC101 mice and 30% mice that the carries out therapeutic alliance disease that do not take a disease.Finally, compare with control group mice, the average ascites grade of DC101 (low 66.7%) and therapeutic alliance group (low 100%) is low.In addition, the DC101+C225 group is compared with the DC101 group, and ascites obviously still less; In the therapeutic alliance group, almost do not see ascites.

PCNA is dyeed to tumor cell, assess the propagation of tumor cell then by immunohistochemical analysis.Compare with matched group, the peritoneal tumor of DC101 (little 50.3%) group and DC101+C225 group (little 66.7%) is little.

To the section statining of CD31, utilize immunofluorescence to detect the ECs number, as the measured value of programmed cell death to the mouse peritoneum pathological changes.Compare with matched group, in DC101 and DC101+C225 group, can be observed significantly less ECs.

Having and CD31 is not being carried out under the painted situation simultaneously, in the section of peritoneal metastases, carrying out immunofluorescence TUNEL dyeing, thereby quantizing the programmed cell death of TC and EC.With the matched group ratio, can organize that (TCs is many 14.3 times at DC101, Ecs is many 226 times) and DC101+C225 organizes, and (TCs is many 23.6 times, Ecs is many 331 times) see the TCs and the ECs of more programmatic death, and with independent DC101 group ratio, the TCs and the ECs (TCs is 1.7 times, and ECs is 1.46 times) of the death of DC101+C225 group programmatic are more.

Embodiment XII human Fab's production

Embodiment XII (a) albumen and cell line

The former foster HUVEC that is commissioned to train is from Dr.S.Rafii, Cornell Medical Center, and New York obtains, and at 37 ℃, 5%CO ₂The EBM-2 culture medium (Clonetics, Walkersville keep in MD).Soluble fusion protein KDR (VEGFR-2)-AP, the variant of its disappearance immunoglobulin (Ig) domain, with Flk-1-AP is to express in the NIH3T3 of stable transfection, and according to Lu etc. described in the J.Biol.Chem.275:14321-30 (2000), use the immobilization monoclonal antibody of AP, by affinity chromatography from cell culture supernatant liquid purification.VEGF ₁₆₅Albumen is expressed in baculovirus, and the process purification of describing in Cancer Res.58:3209-14 (1998) according to Zhu etc.The leukaemia is that HL60 and HEL maintain among the RPMI that contains 10% hyclone.

Embodiment XII (b) phage E LISA

Select each TG1 clone, in 96 hole flat boards, grow in the time of 37 ℃, and described it is incorporated in the M13K07 helper phage according to top.With the phage goods of 18% milk/PBS room temperature of 1/6 volume sealing amplification 1 hour, join bag then by in the Maxi-sorp 96 hole microtitration plates (Nunc) of KDR (VEGFR-2)-AP or AP (1 μ g/mlx100 μ l).Behind the room temperature incubation 1 hour, wash this flat board 3 times, and resist-M13 phage-HRP conjugate (Amersham Pharmacia Biotech, Piscataway, NJ) incubation with rabbit with PBST.Wash this flat board 5 times, (KPL, Gaithersburg MD), use micro-plate reader (Molecular Devices, Sunnyvate, CA) absorbance at measurement 450nm place to add the TMB peroxidase substrate.

The analysis and the nucleotide sequencing of embodiment XII (c) DNA BstN I pattern

Every take turns selection after, analyze anti--KDR (VEGFR-2) Fab clone's multiformity by restriction endonuclease digestion pattern (that is dna fingerprint).Each clone's Fab gene insert increases with primer PCR, and described primer is: reverse PUC19, i.e. 5 ' AGCGGATAACAATTTC ACACAGG3 '; With the fdtet sequence, i.e. 5 ' GTCGTCTTTCCAGACGTTAGT 3 '.Amplified production is to digest with common nickase BstN I, and analyzes on 3% agarose gel.Measure the representative clone's of each digestion pattern DNA sequence by the dideoxy nucleotide order-checking.

Segmental expression of embodiment XII (d) solubility Fab and purification

Each clone's plasmid is used for transforming non-inhibition escherichia coli host HB2151.Fab fragment when the expression of HB2151 is 30 ℃, by (IPTG, cultured cell is inductive in 2YTA culture medium Sigma) containing 1mM isopropyl-1-sulfo--β-D-galactopyranoside.The pericentral siphon extract of cell is by cell granulations shape thing is resuspended among the 25mM Tris (pH7.5), and in 4 ℃ gently jolting cultivate preparation in 1 hour, wherein 25mM Tris (pH7.5) contains 20% (w/v) sucrose, 200mM NaCl, 1mM EDTA and 0.1mM PMSF.15,000rpm be after centrifugal 15 minutes, the method that provides according to manufacturer (Amersham Pharmacia Biotech), use G albumen post, by affinity chromatography from supernatant purification of soluble scFv albumen.

Embodiment XII (e) selects the anti-KDR of people (VEGFR-2) Fab from phage display library

Use contains 3.7x10 ¹⁰Human Fab's phage display library of individual clone is selected (DeHaard etc., J.Biol.Chem.274:18218-30 (1999)).This library comprises the variable light chain gene and the variable heavy chain gene of PCR-amplification antibody, they respectively with constant light chain gene of people (κ and λ) and coding IgG1 heavy chain C _HThe DNA of l domain merges.Heavy chain and light chain construct all are positioned at signal sequence---promptly, and before the gene III signal sequence of the pelB of light chain and heavy chain.The heavy chain construct is further encoded and is used for the proteic part of gene III of phage display, and the c-myc labelling of six histidine marks and 11 amino acid longs is amber codon (TAG) then.Six histidine and c-myc labelling can be used for purification or detection.Amber codon can use and suppress that host's (as TG1 cell) carries out phage display or in being transformed into non-inhibitions host (as the HB2151 cell) time, the Fab fragment of generation soluble form.

Library stock solution grows to logarithmic (log) phase, it is incorporated in the M13-K07 helper phage, and in the time of 30 ℃, increases in 2YTAK culture medium (2YT contains 100 μ g/ml ampicillins and 50 μ g/ml kanamycin) and spend the night.The phage goods are precipitated in 4%PEG/0.5M NaCl, and at 3% defatted milk/contain resuspension among the proteic PBS of 500 μ g/ml AP, 37 ℃ of incubations 1 hour are showed anti--segmental phage of AP Fab to catch, and are blocked other non-specific binding.

At first, in the time of 37 ℃, (Nunc, Rosklide Denmark) 1 hour, use phage goods room temperature incubation 1 hour then to seal the Maxisorp Star test tube that is coated with KDR (VEGFR-2)-AP (being 10 μ g/ml) in PBS with 3% milk/PBS.Wash test tube 10 times with PBST, use PBS (PBS contains 0.1% polysorbas20) washing 10 times then.(MO) phage of room temperature elution of bound is 10 minutes for Sigma, St.Louis with the 100mM triethylamine solution of 1ml prepared fresh.With the phage of 37 ℃ of incubation eluting of TG1 cell of 10ml mid-log phase 30 minutes, leave standstill jolting 30 minutes.Make the TG1 cell precipitation of infection, it is laid on several big 2YTAG flat boards 30 ℃ of incubations that spend the night.In the 2YTA culture medium of scraping at 3-5ml, mix (10% final concentration) five equilibrium ,-70 ℃ of storages with glycerol at all colonies of growing on the flat board.For next round is selected, 100 μ l phage stock solutions are joined 25ml

In the 2YTAG culture medium, grow to mid-log phase.Culture is incorporated in the M13K07 helper phage, and amplification precipitates, and is used for selecting according to said process, and along with the increase of cohesive process after scouring number of times, the concentration that is fixed on KDR (the VEGFR-2)-AP on the immune test tube is more and more littler.

3 selections are all carried out on immobilized KDR (VEGFR-2) altogether, and protein concentration and washing times change behind the original cohesive process.Every take turns selection after, 93 clones of random choose measure they and the combining of KDR (VEGFR-2) by phage E LISA.After selecting for the second time, in 93 clones, selected 70 (75%), after selecting for the third time, the recovery above 90% is cloned in KDR (VEGFR-2) combination and is positive, and shows the efficient of selection course.The Fab of whole 70 kinds of bonding agent that amplification of DNA fragments, described dna fragmentation are identified in being coded in and selecting for the second time is with BstN I digestion, relatively fingerprint pattern.42 kinds of different modes are altogether observed, shown that the multiformity of anti--KDR (VEGFR-2) Fab that separates is fine.Cross reactivity detect to confirm, 19 in 42 antibody is specific FLT-1 (VEGFR-1)-bonding agent, and remaining 23 then can combine with KDR (VEGFR-2) and Mus congener Flk-1 thereof.Further select to utilize competitive VEGF-binding assay to carry out, wherein measured and be with or without anti--KDR (VEGFR-2) Fab fragment when existing, solubility KDR (VEGFR-2) combines with immobilization VEGF's.This algoscopy has been identified 4 Fab clone, they can both blocking VEGF and KDR (VEGFR-2) between combination.Wherein there are 3 to be the specific-binding agent of KDR (VEGFR-2), 1 and Flk-1 cross reaction are arranged.Dna fingerprint and sequencing analysis confirm that these 4 KDR (the VEGFR-2)/VEGF blocking antibodies with unique dna and aminoacid sequence are different.

4 clones' V _HAnd V _LCDR1, CDR2, the aminoacid sequence of CDR3 provides in table 3.

The CDR sequence of the selected human Fab s in conjunction with KDR (VEGFR-2) of table 3-

V _HAnd V _LThe complete sequence of chain provides in sequence table.For D1F7, V _HNucleotide and aminoacid sequence respectively by SEQ ID NOS:19 and 20 the expression, V _LNucleotide and aminoacid sequence respectively by SEQ ID NOS:21 and 22 the expression.

For D2C6, V _HNucleotide and aminoacid sequence respectively by SEQ ID NOS:23 and 24 the expression, V _LNucleotide and aminoacid sequence respectively by SEQ ID NOS:25 and 26 the expression.

For D2H2, V _HNucleotide and aminoacid sequence respectively by SEQ ID NOS:30 and 31 the expression, V _LNucleotide and aminoacid sequence respectively by SEQ ID NOS:32 and 33 the expression.

For D1H4, V _HNucleotide and aminoacid sequence respectively by SEQ ID NOS:27 and 24 the expression, V _LNucleotide and aminoacid sequence respectively by SEQ ID NOS:28 and 29 the expression.

Second library is the single heavy chain of D2C6 to be combined with the different groups of original library light chain create.10 additional Fabs have been identified, called after SA1, SA3, SB10, SB5, SC7, SD2, SF2, SF7 and 1121.The V of these 10 Fabs _LNucleotide and aminoacid sequence provide below.For SA1, V _LNucleotide and aminoacid sequence by SEQ IDNOS:34 and 35 the expression.For SA3, V _LNucleotide and aminoacid sequence by SEQ IDNOS:36 and 37 the expression.For SB10, V _LNucleotide and aminoacid sequence by SEQ IDNOS:38 and 39 the expression.For SB5, V _LNucleotide and aminoacid sequence by SEQ IDNOS:40 and 41 the expression.For SC7, V _LNucleotide and aminoacid sequence by SEQ IDNOS:42 and 43 the expression.For SD2, V _LNucleotide and aminoacid sequence by SEQ IDNOS:44 and 45 the expression.For SD5, V _LNucleotide and aminoacid sequence by SEQ IDNOS:46 and 47 the expression.For SF2, V _LNucleotide and aminoacid sequence by SEQ IDNOS:48 and 49 the expression.For SF7, V _LNucleotide and aminoacid sequence by SEQ IDNOS:50 and 51 the expression.For 1121, V _LNucleotide and aminoacid sequence by SEQ IDNOS:52 and 53 the expression.

V _LThe CDR sequence in table 4, provide.

Table 4-is in conjunction with the light chain CDR sequence of the human Fab s of KDR (VEGFR-2)

Embodiment XIII algoscopy

The quantitative KDR of embodiment XIII (a) (VEGFR-2) combination and KDR (VEGFR-2)/interactional blocking-up of VEGF

In direct binding assay, not commensurability solubility Fab albumen is joined in the 96 hole Maxi-sorp microtitration flat boards of KDR (VEGFR-2) bag quilt, room temperature incubation 1 hour is then with dull and stereotyped 3 times of PBST washing.(PA) the room temperature incubation should flat board 1 hour for Jackson ImmunoResearch Laboratory Inc., West Grove with the anti-human Fab's antibody of 100 μ l rabbits-HRP conjugate.Washing is dull and stereotyped, and develops according to the process of above-mentioned phage E LISA.In competitive KDR (VEGFR-2)/VEGF blocking-up algoscopy, not commensurability Fab albumen is mixed room temperature incubation 1 hour with KDR (the VEGFR-2)-AP (100ng) of fixed amount.Then mixture is transferred to and be coated with VEGF in advance ₁₆₅In the 96 hole microtitration plates in (200ng/ hole), the room temperature incubation is 2 hours again, dull and stereotyped 5 times of washing, the substrate of adding AP (right-Nitrobenzol phosphoric acid, Sigma).Measure the absorbance at 405nm place, quantize bonded KDR (VEGFR-2)-AP molecule (8).Calculate IC then ₅₀, that is, suppress the required Fab protein concentration of KDR (VEGFR-2) and VEGF bonded 50%.

(D1H4 D1F7) is expressed as the Fab of solubility, and passes through G albumen affinity chromatography purification from the colibacillus periplasm extract 4 VEGF-blocking-up clones for D2C6, D2H2.These clones' the proteic output of purification Fab is that 60-400 μ g/ rises culture.The SDS-PAGE of each purification Fab goods analyzes and has produced a single protein band with expection molecular size.

Clone D2C6 and D2H2 are more effective bonding agent, are clone D1H4 and D1F7 then.All these four Fabs can both block combining of KDR (VEGFR-2) and immobilization VEGF.For clone D2C6, D2H2 and D1H4 suppress KDR (VEGFR-2) and VEGF bonded 50% required antibody concentration and are about 2nM, for clone D1F7, are about 20nM.That has only D1F7 VEGF capable of blocking and Flk-1 combines its IC ₅₀Value is about 15nM.

The BIAcore of embodiment XIII (b) solubility scFv analyzes

The binding kinetics of solubility Fab albumen and KDR (VEGFR-2) is with BIAcore biosensor (Pharmacia Biosensor), measures by surface plasma resonance.KDR (VEGFR-2)-AP fusion rotein is fixed on the sensor chip solubility Fab albumen of injection 1.5nM-100nM concentration.Obtaining the sensing figure of each concentration, use the assessment of BIA Evaluation2.0 program, is according to the ratio calculation of rate constants k off/kon thereby measure rate constants k on and koff.Kd.

All these 3 KDR (VEGFR-2)-specificity Fab fragments are all with Kd and the immobilization receptors bind (table 5) of 2-4nM.The Kd of cross reaction clone D1F7 is 45nM, approximately than those weak 10-15 of KDR (VEGFR-2) specificity clone doubly.Though it should be noted that the segmental Kd of this three KDR (VEGFR-2) specificity Fab is similar, the binding kinetics of these antibody, that is, kon is very much not different with koff, for example, D2C6 has the fastest toggle speed, and D1H4 then has the slowest closing velocity (table 5).

Among four of the 5-of table and the people anti--the segmental binding kinetics of KDR (VEGFR-2) Fab

All numerical value are represented the meansigma methods ± SE of at least three measurements all by the BIAcore assay determination.

Embodiment XIII (c) is in conjunction with the mapping of epi-position

Produce the variant in the outer Ig-spline structure territory of disappearance KDR (VEGFR-2) born of the same parents according to (Lu etc., (2000)) noted earlier.In the epitope mapping algoscopy, at first use rabbit to resist-AP antibody (DAKO-immunoglobulin, Glostrup, Denmark) as capture agent, total length KDR (VEGFR-2)-AP, the AP of the variant of two disappearance KDR (VEGFR-2) Ig-domains merges and Flk-1-AP is fixed on the 96 hole flat boards (Nunc).Then with various anti--KDR (VEGFR-2) Fab albumen incubated at room temperature should flat board 1 hour, then cultivate with rabbit Anti-Human Fab antibody-HRP conjugate.Washing is dull and stereotyped, according to top described development.

Anti--KDR (VEGFR-2) Fab is segmental to be to map with the variant of total length KDR (VEGFR-2) and two disappearance KDR (VEGFR-2) Ig domains in conjunction with epi-position.KDR (VEGFR-2) is KDR (VEGFR-2) variant that contains the terminal Ig domain of first three N-(1-3).KDR (VEGFR-2) (3) is the variant that only contains the 3rd Ig domain.Clone D2C6 and D1H4 be on an equal basis in conjunction with KDR (VEGFR-2), and KDR (VEGFR-2) (1-3) and KDR (VEGFR-2) (3) so is positioned at Ig domain 3 in conjunction with epi-position.Clone D2H2 and D1F7 more can be effectively in conjunction with total length KDR (VEGFR-2) and KDR (VEGFR-2) (1-3), show that the conjugated antigen in KDR (VEGFR-2) the Ig domain 1-3 determines that the position is a lot.Have only clone DIF7 and Flk-1 cross reaction.

Embodiment XIII (d) resisting mitosis is measured

HUVEC (5x10 ³Individual cells/well) be laid on that 200 μ l do not have VEGF on the 96 hole tissue culture plate, in the EBM-2 culture medium of basic fibroblast growth factor (bFGF) or epidermal growth factor (EGF), 37 ℃ of incubations 72 hours.Not commensurability Fab albumen is joined in the hole in duplicate, and 37 ℃ of precincubation 1 hour adds VEGF then ₁₆₅Final concentration to 16ng/ml.Behind the incubation 18 hours, in each hole, add 0.25 μ Ci [ ³H] TdR (Amersham), incubation is 4 hours again.With the PBS washed cell once, make it through trypsinization, and with cell harvestor (Harvester 96, MACH III, TOMTEC, Orange CT) is collected on the glass filter.Use H ₂O washs this film 3 times, and is air-dry.Add scintillation solution, go up the radioactivity that mensuration has been mixed DNA at scintillation counter (Wallach, Model 1450 Microbeta Scintillation Counter).

The people is anti--and KDR (VEGFR-2) Fab has the ability that blocking-up HUVEC goes up the mitogen activation that VEGF-stimulates.It is synthetic that all these 4 human Fab's fragments can the dose dependent mode suppress among the HUVEC the inductive DNA of VEGF.VEGF-stimulates among the inhibition HUVEC [ ³H]-50% required Fab concentration (EC that TdR mixes ₅₀), for clone D2C6 and D1H4, be about 0.5nM, for clone D2H2, be about 0.8nM, for clone D1F7, be about 15nM.Matched group only contains VEGF (1500cpm) and pure culture base (60cpm).Measure in duplicate.Shown in the independent experiment of data representation at least 3 times.

Embodiment XIII (e) leukemia migration assay

With the pure RPMI 1640 culture medium washings HL60 that does not have serum and hel cell 3 times, with 1x10 ⁶/ ml is suspended in the culture medium.The aliquot of 100 μ l cell suspensions is joined 3 μ m-aperture hole inserts of HL60 cell or (Costar in the 8 μ m-aperture hole inserts of hel cell , Corning Incorporated, Corning, NY), in the time of 37 ℃ and anti-KDR (VEGFR-2) Fab albumen (5 μ g/ml) incubation 30 minutes.Then insert is placed in the hole of 24 hole flat boards, described 24 hole flat boards contain 0.5ml and are with or without VEGF ₁₆₅, there is not the RPMI 1640 of serum.Migration is at 37 ℃, 5%CO ₂Condition under carry out, the HL60 cell carried out 16-18 hour, hel cell carried out 4 hours.Gather the cell of migration from the compartment bottom, with Coulter enumerator (Model Z1, Coulter Electronics Ltd., Luton, England) counting.

VEGF can the dose dependent mode induces the migration of HL60 and hel cell, and maximal stimulus obtains at 200ng/.All anti-KDR (VEGFR-2) Fab fragments all can significantly suppress HL60 and the hel cell migration that VEGF-stimulates.In this algoscopy, in contrast, C225, a kind of Fab fragment of the antibody at the EGF receptor does not demonstrate significant inhibitory effect.

The production of embodiment XIV.IgG

Embodiment XIV (a) expresses the structure of the carrier of IgG

The separate carrier of construction expression IgG light chain and heavy chain.Digestion clone's V _LGene, and it is connected among the carrier pKN100.Digestion clone's V _HGene, and it is connected among the carrier pGID105, described pGID105 contains human IgG I (γ) heavy chain constant domain.Structure detects by restriction endonuclease digestion, and is confirmed by the dideoxy nucleotide order-checking.In both of these case, expressing all is to carry out under the control of HCMV promoter, and is stopped by artificial terminator sequence.

Then the heavy chain and the light chain gene of assembling are cloned among Lonza GS expression vector pEE6.1 and the pEE12.1.Heavy chain and light chain carrier are reassembled as single carrier, are used for the stable transfection of Chinese hamster ovary celI and NSO cell.In lacking the culture medium of glutamine, cultivate cells transfected, and with the horizontal expression antibody up to 1g/L.

Sequence table

＜110〉Patricia. Rockwell

Neil I. Goldstein

＜120〉conjoint therapy of usefulness vascular endothelial growth factor receptor antagonist for inhibiting growth of tumor

<130>11245/46276

<140>PCT/US02/06762

<141>04-03-2002

<160>85

<170>WordPerfect?8.0?for?Windows

<210>1

<211>11

<212>PRT

＜213〉people

<400>1

Arg?Ala?Ser?Gln?Ser?Val?Ser?Ser?Tyr?Leu?Ala

5 10

<210>2

<211>7

<212>PRT

＜213〉people

<400>2

Asp?Ser?Ser?Asn?Arg?Ala?Thr

5

<210>3

<211>9

<212>PRT

＜213〉people

<400>3

Leu?Gln?His?Asn?Thr?Phe?Pro?Pro?Thr

5

<210>4

<211>11

<212>PRT

＜213〉people

<400>4

Arg?Ala?Ser?Gln?Gly?Ile?Ser?Ser?Arg?Leu?Ala

5 10

<210>5

<211>7

<212>PRT

＜213〉people

<400>5

Ala?Ala?Ser?Ser?Leu?Gln?Thr

5

<210>6

<211>9

<212>PRT

＜213〉people

<400>6

Glu?Gln?Ala?Asn?Arg?Phe?Pro?Pro?Thr

5

<210>7

<211>14

<212>PRT

＜213〉people

<400>7

Ala?Gly?Thr?Thr?Thr?Asp?Leu?Thr?Tyr?Tyr?Asp?Leu?Val?Ser

5 10

<210>8

<211>7

<212>PRT

＜213〉people

<400>8

Asp?Gly?Asn?Lys?Arg?Pro?Ser

5

<210>9

<211>10

<212>PRT

＜213〉people

<400>9

Asn?Ser?Tyr?Val?Ser?Ser?Arg?Phe?Tyr?Val

5 10

<210>10

<211>13

<212>PRT

＜213〉people

<400>10

Ser?Gly?Ser?Thr?Ser?Asn?Ile?Gly?Thr?Asn?Thr?Ala?Asn

5 10

<210>11

<211>7

<212>PRT

＜213〉people

<400>11

Asn?Asn?Asn?Gln?Arg?Pro?Ser

5

<210>12

<211>12

<212>PRT

＜213〉people

<400>12

Ala?Ala?Trp?Asp?Asp?Ser?Leu?Asn?Gly?His?Trp?Val

5 10

<210>13

<211>10

<212>PRT

＜213〉people

<400>13

Gly?Phe?Thr?Phe?Ser?Ser?Tyr?Ser?Met?Asn

5 10

<210>14

<211>17

<212>PRT

＜213〉people

<400>14

Ser?Ile?Ser?Ser?Ser?Ser?Ser?Tyr?Ile?Tyr?Tyr?Ala?Asp?Ser?Val?Lys

5 10 15

Gly

17

<210>15

<211>7

<212>PRT

＜213〉people

<400>15

Val?Thr?Asp?Ala?Phe?Asp?Ile

5

<210>16

<211>10

<212>PRT

＜213〉people

<400>16

Gly?Gly?Thr?Phe?Ser?Ser?Tyr?Ala?Ile?Ser

5?1 10

<210>17

<211>18

<212>PRT

＜213〉people

<400>17

Gly?Gly?Ile?Ile?Pro?Ile?Phe?Gly?Thr?Ala?Asn?Tyr?Ala?Gln?Lys?Phe

5 10 15

Gln?Gly

18

<210>18

<211>16

<212>PRT

＜213〉people

<400>18

Gly?Tyr?Asp?Tyr?Tyr?Asp?Ser?Ser?Gly?Val?Ala?Ser?Pro?Phe?Asp?Tyr

5 10 15

<210>19

<211>375

<212>DNA

＜213〉people

<400>19

gag?gtc?cag?ctg?gtg?cag?tct?ggg?gct?gag?gtg?aag?aag?cct?ggg?gcc 48

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Ala?Glu?Val?Lys?Lys?Pro?Gly?Ala

5 10 15

tca?gtg?aag?gtc?tcc?tgc?aag?gct?tct?gga?ggc?acc?ttc?agc?agc?tat 96

Ser?Val?Lys?Val?Ser?Cys?Lys?Ala?Ser?Gly?Gly?Thr?Phe?Ser?Ser?Tyr

20 25 30

gct?atc?agc?tgg?gtg?cga?cag?gcc?cct?gga?caa?ggg?ctt?gag?tgg?atg 144

Ala?Ile?Ser?Trp?Val?Arg?Gln?Ala?Pro?Gly?Gln?Gly?Leu?Glu?Trp?Met

35 40 45

gga?ggg?atc?atc?cct?atc?ttt?ggt?aca?gca?aac?tac?gca?cag?aag?ttc 192

Gly?Gly?Ile?Ile?Pro?Ile?Phe?Gly?Thr?Ala?Asn?Tyr?Ala?Gln?Lys?Phe

50 55 60

cag?ggc?aga?gtc?act?ttt?acc?gcg?gac?aaa?tcc?acg?agt?aca?gcc?tat 240

Gln?Gly?Arg?Val?Thr?Phe?Thr?Ala?Asp?Lys?Ser?Thr?Ser?Thr?Ala?Tyr

65 70 75 80

atg?gag?ttg?agg?agc?ctg?aga?tct?gac?gac?acg?gcc?gtg?tat?tac?tgt 288

Met?Glu?Leu?Arg?Ser?Leu?Arg?Ser?Asp?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

gcg?aga?gga?tac?gat?tac?tat?gat?agt?agt?ggc?gtg?gct?tcc?ccc?ttt 336

Ala?Arg?Gly?Tyr?Asp?Tyr?Tyr?Asp?Ser?Ser?Gly?Val?Ala?Ser?Pro?Phe

100 105 110

gac?tac?tgg?ggc?cag?gga?acc?ctg?gtc?acc?gtc?tca?agc 375

Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Leu?Val?Thr?Val?Ser?Ser

115 120 125

<210>20

<211>125

<212>PRT

＜213〉people

<400>20

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Ala?Glu?Val?Lys?Lys?Pro?Gly?Ala

5 10 15

Ser?Val?Lys?Val?Ser?Cys?Lys?Ala?Ser?Gly?Gly?Thr?Phe?Ser?Ser?Tyr

20 25 30

Ala?Ile?Ser?Trp?Val?Arg?Gln?Ala?Pro?Gly?Gln?Gly?Leu?Glu?Trp?Met

35 40 45

Gly?Gly?Ile?Ile?Pro?Ile?Phe?Gly?Thr?Ala?Asn?Tyr?Ala?Gln?Lys?Phe

50 55 60

Gln?Gly?Arg?Val?Thr?Phe?Thr?Ala?Asp?Lys?Ser?Thr?Ser?Thr?Ala?Tyr

65 70 75 80

Met?Glu?Leu?Arg?Ser?Leu?Arg?Ser?Asp?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

Ala?Arg?Gly?Tyr?Asp?Tyr?Tyr?Asp?Ser?Ser?Gly?Val?Ala?Ser?Pro?Phe

100 105 110

Asp?Tyr?Trp?Gly?Gln?Gly?Thr?Leu?Val?Thr?Val?Ser?Ser

115 120 125

<210>21

<211>333

<212>DNA

＜213〉people

<400>21

cag?tct?gtg?ctg?act?cag?cca?ccc?tca?gcg?tct?ggg?acc?ccc?ggg?cag 48

Gln?Ser?Val?Leu?Thr?Gln?Pro?Pro?Ser?Ala?Ser?Gly?Thr?Pro?Gly?Gln

5 10 15

agg?gtc?acc?atc?tct?tgt?tct?gga?agc?acc?tc?cac?atc?ggt?act?aat 96

Arg?Val?Thr?Ile?Ser?Cys?Ser?Gly?Ser?Thr?Ser?Asn?Ile?Gly?Thr?Asn

20 25 30

act?gca?aac?tgg?ttc?cag?cag?ctc?cca?gga?acg?gcc?ccc?aaa?ctc?ctc 144

Thr?Ala?Asn?Trp?Phe?Gln?Gln?Leu?Pro?Gly?Thr?Ala?Pro?Lys?Leu?Leu

35 40 45

atc?cac?aat?aat?aat?cag?cgg?ccc?tca?ggg?gtc?cct?gac?cga?ttc?tct 192

Ile?His?Asn?Asn?Asn?Gln?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe?Ser

50 55 60

ggc?tcc?aag?tct?ggc?acc?tca?gcc?tcc?ctg?gcc?atc?agt?ggg?ctc?cag 240

Gly?Ser?Lys?Ser?Gly?Thr?Ser?Ala?Ser?Leu?Ala?Ile?Ser?Gly?Leu?Gln

65 70 75 80

tct?gag?gat?gag?gct?gat?tat?tac?tgt?gca?gca?tgg?gat?gac?agc?ctg 288

Ser?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Ala?Ala?Trp?Asp?Asp?Ser?Leu

85 90 95

aat?ggc?cat?tgg?gtg?ttc?ggc?gga?ggg?acc?aag?ctg?aac?gtc?ctg 333

Asn?Gly?His?Trp?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>22

<211>111

<212>PRT

＜213〉people

<400>22

Gln?Ser?Val?Leu?Thr?Gln?Pro?Pro?Ser?Ala?Ser?Gly?Thr?Pro?Gly?Gln

5 10 15

Arg?Val?Thr?Ile?Ser?Cys?Ser?Gly?Ser?Thr?Ser?Asn?Ile?Gly?Thr?Asn

20 25 30

Thr?Ala?Asn?Trp?Phe?Gln?Gln?Leu?Pro?Gly?Thr?Ala?Pro?Lys?Leu?Leu

35 40 45

Ile?His?Asn?Asn?Asn?Gln?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe?Ser

50 55 60

Gly?Ser?Lys?Ser?Gly?Thr?Ser?Ala?Ser?Leu?Ala?Ile?Ser?Gly?Leu?Gln

65 70 75 80

Ser?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Ala?Ala?Trp?Asp?Asp?Ser?Leu

85 90 95

Asn?Gly?His?Trp?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>23

<211>348

<212>DNA

＜213〉people

<400>23

gag?gtg?cag?ctg?gtg?cag?tct?ggg?gga?ggc?ctg?gtc?aag?cct?ggg?ggg 48

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Gly?Gly?Leu?Val?Lys?Pro?Gly?Gly

5 10 15

tcc?ctg?aga?ctc?tcc?tga?gca?gcc?tct?gga?ttc?acc?ttc?agt?agc?tat 96

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Ser?Ser?Tyr

20 25 30

agc?atg?aac?tgg?gtc?cgc?cag?gct?cca?ggg?aag?ggg?ctg?gag?tgg?gtc 144

Ser?Met?Asn?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val

35 40 45

tca?tcc?att?agt?agt?agt?agt?agt?tac?ata?tac?tac?gca?gac?tca?gtg 192

Ser?Ser?Ile?Ser?Ser?Ser?Ser?Ser?Tyr?Ile?Tyr?Tyr?Ala?Asp?Ser?Val

50 55 60

aag?ggc?cga?ttc?acc?atc?tcc?aga?gac?aac?gcc?aag?aac?tca?ctg?tat 240

Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr

65 70 75 80

ctg?caa?atg?aac?agc?ctg?aga?gcc?gag?gac?acg?gct?gtg?tat?tac?tgt 288

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

gcg?aga?gtc?aca?gat?gct?ttt?gat?atc?tgg?ggc?caa?ggg?aca?atg?gtc 336

Ala?Arg?Val?Thr?Asp?Ala?Phe?Asp?Ile?Trp?Gly?Gln?Gly?Thr?Met?Val

100 105 110

acc?gtc?tca?agc 348

Thr?Val?Ser?Ser

115

<210>24

<211>116

<212>PRT

＜213〉people

<400>24

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Gly?Gly?Leu?Val?Lys?Pro?Gly?Gly

5 10 15

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Ser?Ser?Tyr

20 25 30

Ser?Met?Asn?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val

35 40 45

Ser?Ser?Ile?Ser?Ser?Ser?Ser?Ser?Tyr?Ile?Tyr?Tyr?Ala?Asp?Ser?Val

50 55 60

Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr

65 70 75 80

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

Ala?Arg?Val?Thr?Asp?Ala?Phe?Asp?Ile?Trp?Gly?Gln?Gly?Thr?Met?Val

100 105 110

Thr?Val?Ser?Ser

115

<210>25

<211>321

<212>DNA

＜213〉people

<400>25

gaa?att?gtg?atg?aca?cag?tct?cca?gcc?acc?ctg?tct?ttg?tct?cca?ggg 48

Glu?Ile?Val?Met?Thr?Gln?Ser?Pro?Ala?Thr?Leu?Ser?Leu?Ser?Pro?Gly

5 10 15

gaa?aga?gcc?acc?ctc?tcc?tgc?agg?gcc?agt?tcg?agt?gtt?agc?agc?tac 96

Glu?Arg?Ala?Thr?Leu?Ser?Cys?Arg?Ala?Ser?Gln?Ser?Val?Ser?Ser?Tyr

20 25 30

tta?gcc?tgg?tac?caa?cag?aaa?cct?ggc?cag?gct?ccc?agg?ctc?ctc?atc 144

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Gln?Ala?Pro?Arg?Leu?Leu?Ile

35 40 45

tat?gat?tca?tcc?aac?agg?gcc?act?ggc?atc?cca?gcc?aga?ttc?agt?ggc 192

Tyr?Asp?Ser?Ser?Asn?Arg?Ala?Thr?Gly?Ile?Pro?Ala?Arg?Phe?Ser?Gly

50 55 60

agt?ggg?tct?ggg?aca?gac?ttc?act?ctc?acc?atc?agc?agc?cta?gag?cct 240

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Glu?Pro

65 70 75 80

gaa?gat?ttt?gca?act?tat?tac?tgt?cta?cag?cat?aac?act?ttt?cct?ccg 288

Glu?Asp?Phe?Ala?Thr?Tyr?Tyr?Cys?Leu?Gln?His?Asn?Thr?Phe?Pro?Pro

85 90 95

acg?ttc?ggc?caa?ggg?acc?aag?gtg?gaa?atc?aaa 321

Thr?Phe?Gly?Gln?Gly?Thr?Lys?Val?Glu?Ile?Lys

100 105

<210>26

<211>107

<212>PRT

＜213〉people

<400>26

Glu?Ile?Val?Met?Thr?Gln?Ser?Pro?Ala?Thr?Leu?Ser?Leu?Ser?Pro?Gly

5 10 15

Glu?Arg?Ala?Thr?Leu?Ser?Cys?Arg?Ala?Ser?Gln?Ser?Val?Ser?Ser?Tyr

20 25 30

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Gln?Ala?Pro?Arg?Leu?Leu?Ile

35 40 45

Tyr?Asp?Ser?Ser?Asn?Arg?Ala?Thr?Gly?Ile?Pro?Ala?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Glu?Pro

65 70 75 80

Glu?Asp?Phe?Ala?Thr?Tyr?Tyr?Cys?Leu?Gln?His?Asn?Thr?Phe?Pro?Pro

85 90 95

Thr?Phe?Gly?Gln?Gly?Thr?Lys?Val?Glu?Ile?Lys

100 105

<210>27

<211>348

<212>DNA

＜213〉people

<400>27

gag?gtc?cag?ctg?gtg?cag?tct?ggg?gga?ggc?ctg?gtc?aag?cct?ggg?ggg 48

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Gly?Gly?Leu?Val?Lys?Pro?Gly?Gly

5 10 15

tcc?ctg?aga?ctc?tcc?tgt?gca?gcc?tct?gga?ttc?acc?ttc?agt?agc?tat 96

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Ser?Ser?Tyr

20 25 30

agc?atg?aac?tgg?gtc?cgc?cag?gct?cca?ggg?aag?ggg?ctg?gag?tgg?gtc 144

Ser?Met?Asn?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val

35 40 45

tca?tc?att?agt?agt?agt?agt?agt?tac?ata?tac?tac?gca?gac?tca?gtg 192

Ser?Ser?Ile?Ser?Ser?Ser?Ser?Ser?Tyr?Ile?Tyr?Tyr?Ala?Asp?Ser?Val

50 55 60

aag?ggc?cga?ttc?acc?atc?tcc?aga?gac?aac?gcc?aag?aac?tca?ctg?tat 240

Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asn?Ser?Leu?Tyr

65 70 75 80

ctg?caa?atg?aac?agc?ctg?aga?gcc?gag?gac?acg?gct?gtg?tat?tac?tgt 288

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

gcg?aga?gtc?aca?gat?gct?ttt?gat?atc?tgg?ggc?caa?ggg?aca?atg?gtc 336

Ala?Arg?Val?Thr?Asp?Ala?Phe?Asp?Ile?Trp?Gly?Gln?Gly?Thr?Met?Val

100 105 110

acc?gtc?tca?agc 348

Thr?Val?Ser?Ser

115

<210>28

<211>330

<212>DNA

＜213〉people

<400>28

cag?tct?gcc?ctg?act?cag?cct?gcc?tcc?ctg?tct?ggg?tct?cct?gga?cag 48

Gln?Ser?Ala?Leu?Thr?Gln?Pro?Ala?Ser?Leu?Ser?Gly?Ser?Pro?Gly?Gln

5 10 15

tcg?atc?acc?atc?tcc?tgc?gct?gga?acc?acc?act?gat?ctt?aca?tat?tat 96

Ser?Ile?Thr?Ile?Ser?Cys?Ala?Gly?Thr?Thr?Thr?Asp?Leu?Thr?Tyr?Tyr

20 25 30

gac?ctt?gtc?tcc?tgg?tac?caa?cag?cac?cca?ggc?cca?gca?ccc?aaa?ctc 144

Asp?Leu?Val?Ser?Trp?Tyr?Gln?Gln?His?Pro?Gly?Gln?Ala?Pro?Lys?Leu

35 40 45

gtg?att?tat?gac?ggc?aat?aag?cgg?ccc?tca?gga?gtt?tct?aat?cgc?ttc 192

Val?Ile?Tyr?Asp?Gly?Asn?Lys?Arg?Pro?Ser?Gly?Val?Ser?Asn?Arg?Phe

50 55 60

tct?ggc?tcc?aag?tct?ggc?aac?acg?gcc?tcc?ctg?aca?atc?tct?gga?ctc 240

Ser?Gly?Ser?Lys?Ser?Gly?Asn?Thr?Ala?Ser?Leu?Thr?Ile?Ser?Gly?Leu

65 70 75 80

cag?gct?gag?gac?gag?gct?gat?tat?tac?tgc?aac?tca?tat?gta?agc?agc 288

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Asn?Ser?Tyr?Val?Ser?Ser

85 90 95

agg?ttt?tat?gtc?ttc?gga?act?ggg?acc?aag?gtc?acc?gtc?cta 330

Arg?Phe?Tyr?Val?Phe?Gly?Thr?Gly?Thr?Lys?Val?Thr?Val?Leu

100 105 110

<210>29

<211>110

<212>PRT

＜213〉people

<400>29

Gln?Ser?Ala?Leu?Thr?Gln?Pro?Ala?Ser?Leu?Ser?Gly?Ser?Pro?Gly?Gln

5 10 15

Ser?Ile?Thr?Ile?Ser?Cys?Ala?Gly?Thr?Thr?Thr?Asp?Leu?Thr?Tyr?Tyr

20 25 30

Asp?Leu?Val?Ser?Trp?Tyr?Gln?Gln?His?Pro?Gly?Gln?Ala?Pro?Lys?Leu

35 40 45

Val?Ile?Tyr?Asp?Gly?Asn?Lys?Arg?Pro?Ser?Gly?Val?Ser?Asn?Arg?Phe

50 55 60

Ser?Gly?Ser?Lys?Ser?Gly?Asn?Thr?Ala?Ser?Leu?Thr?Ile?Ser?Gly?Leu

65 70 75 80

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Asn?Ser?Tyr?Val?Ser?Ser

85 90 95

Arg?Phe?Tyr?Val?Phe?Gly?Thr?Gly?Thr?Lys?Val?Thr?Val?Leu

100 105 110

<210>30

<211>348

<212>DNA

＜213〉people

<400>30

gaa?gtg?cag?ctg?gtg?cag?tct?ggg?gga?ggc?ctg?gtc?aag?cct?ggg?ggg 48

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Gly?Gly?Leu?Val?Lys?Pro?Gly?Gly

5 10 15

tcc?ctg?aga?ctc?tcc?tgt?gca?gcc?tct?gga?ttc?acc?ttc?agt?agc?tat 96

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Ser?Ser?Tyr

20 25 30

agc?atg?aac?tgg?gtc?cgc?cag?gct?cca?ggg?aag?ggg?ctg?gag?tgg?gtc 144

Ser?Met?Asn?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val

35 40 45

tca?tcc?att?agt?agt?agt?agt?agt?tac?ata?tac?tac?gca?gac?tca?gtg 192

Ser?Ser?Ile?Ser?Ser?Ser?Ser?Ser?Tyr?Ile?Tyr?Tyr?Ala?Asp?Ser?Val

50 55 60

aag?ggc?cga?ttc?acc?atc?tcc?aga?gac?aac?gcc?aag?gac?tca?ctg?tat 240

Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asp?Ser?Leu?Tyr

65 70 75 80

ctg?caa?atg?aac?agc?ctg?aga?gcc?gag?gac?acg?gct?gtg?tat?tac?tgt 288

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

gcg?aga?gtc?aca?gat?gct?ttt?gat?atc?tgg?ggc?caa?ggg?aca?atg?gtc 336

Ala?Arg?Val?Thr?Asp?Ala?Phe?Asp?Ile?Trp?Gly?Gln?Gly?Thr?Met?Val

100 105 110

acc?gtc?tca?agc 348

Thr?Val?Ser?Ser

115

<210>31

<211>116

<212>PRT

＜213〉people

<400>31

Glu?Val?Gln?Leu?Val?Gln?Ser?Gly?Gly?Gly?Leu?Val?Lys?Pro?Gly?Gly

5 10 15

Ser?Leu?Arg?Leu?Ser?Cys?Ala?Ala?Ser?Gly?Phe?Thr?Phe?Ser?Ser?Tyr

20 25 30

Ser?Met?Asn?Trp?Val?Arg?Gln?Ala?Pro?Gly?Lys?Gly?Leu?Glu?Trp?Val

35 40 45

Ser?Ser?Ile?Ser?Ser?Ser?Ser?Ser?Tyr?Ile?Tyr?Tyr?Ala?Asp?Ser?Val

50 55 60

Lys?Gly?Arg?Phe?Thr?Ile?Ser?Arg?Asp?Asn?Ala?Lys?Asp?Ser?Leu?Tyr

65 70 75 80

Leu?Gln?Met?Asn?Ser?Leu?Arg?Ala?Glu?Asp?Thr?Ala?Val?Tyr?Tyr?Cys

85 90 95

Ala?Arg?Val?Thr?Asp?Ala?Phe?Asp?Ile?Trp?Gly?Gln?Gly?Thr?Met?Val

100 105 110

Thr?Val?Ser?Ser

115

<210>32

<211>321

<212>DNA

＜213〉people

<400>32

gac?atc?cag?ttg?acc?cag?tct?cca?tct?tct?gtg?tct?gca?tct?gta?gga 48

Asp?Ile?Gln?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Val?Gly

5 10 15

gac?aga?gtc?acx?atx?act?tgt?cgg?gcg?agt?cag?ggt?att?agt?agt?cgg 96

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Gly?Ile?Ser?Ser?Arg

20 25 30

tta?gcc?tgg?tat?cag?cag?aaa?cca?ggg?aaa?gcc?cct?aag?ctc?ctg?atc 144

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

tat?gct?gca?tcc?agt?ttg?caa?act?ggg?gtc?cca?tca?agg?ttc?agc?ggc 192

Tyr?Ala?Ala?Ser?Ser?Leu?Gln?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

agt?gga?tct?ggg?aca?gat?ttc?act?ctc?act?atc?agc?agc?ctg?cag?cct 240

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Pro

65 70 75 80

gaa?gat?ttt?gca?act?tac?tat?tgt?caa?cag?gct?aac?agg?ttc?cct?ccg 288

Glu?Asp?Phe?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Ala?Asn?Arg?Phe?Pro?Pro

85 90 95

act?ttc?ggc?cct?ggg?acc?aaa?gtg?gat?atc?aaa 321

Thr?Phe?Gly?Pro?Gly?Thr?Lys?Val?Asp?Ile?Lys

100 105

<210>33

<211>107

<212s?PRT

＜213〉people

<400>33

Asp?Ile?Gln?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Val?Gly

5 10 15

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Gly?Ile?Ser?Ser?Arg

20 25 30

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu Ile

35 40 45

Tyr?Ala?Ala?Ser?Ser?Leu?Gln?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Pro

65 70 75 80

Glu?Asp?Phe?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Ala?Asn?Arg?Phe?Pro?Pro

85 90 95

Thr?Phe?Gly?Pro?Gly?Thr?Lys?Val?Asp?Ile?Lys

100 105

<210>34

<211>333

<212>DNA

＜213〉people

<400>34

cag?tct?gtc?gtg?acg?cag?ccg?ccc?tca?gtg?tct?ggg?gcc?cca?ggg?cag 48

Gln?Ser?Val?Val?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

agg?gtc?acc?atc?tcc?tgc?act?ggg?agc?cac?tcc?aac?ttc?ggg?gca?gga 96

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Ser?His?Ser?Asn?Phe?Gly?Ala?Gly

20 25 30

act?gat?gta?cat?tgg?tac?caa?cac?ctt?cca?gga?aca?gccc?ccc?aga?ctc 144

Thr?Asp?Val?His?Trp?Tyr?Gln?His?Leu?Pro?Gly?Thr?Ala?Pro?Arg?Leu

35 40 45

ctc?att?cat?gga?gac?agt?aat?cgg?ccc?tcc?ggg?gtc?cct?gac?cga?ttc 192

Leu?Ile?His?Gly?Asp?Ser?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

tct?ggc?tcc?agg?tct?ggc?acc?tca?gcc?tcc?ctg?gcc?atc?act?ggg?ctc 240

Ser?Gly?Ser?Arg?Ser?Gly?Thr?Ser?Ala?Ser?Leu?Ala?Ile?Thr?Gly?Leu

65 70 75 80

cgg?gtt?gag?gat?gag?gct?gat?tat?tac?tgt?cag?tcg?tat?gac?tat?ggc 288

Arg?Val?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Tyr?Gly

85 90 95

ctg?aga?ggt?tgg?gtg?ttc?ggc?ggc?ggg?acc?aag?ctg?acc?gtc?ctt 333

Leu?Arg?Gly?Trp?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>35

<211>111

<212>PRT

＜213〉people

<400>35

Gln?Ser?Val?Val?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Ser?His?Ser?Asn?Phe?Gly?Ala?Gly

20 25 30

Thr?Asp?Val?His?Trp?Tyr?Gln?His?Leu?Pro?Gly?Thr?Ala?Pro?Arg?Leu

35 40 45

Leu?Ile?His?Gly?Asp?Ser?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

Ser?Gly?Ser?Arg?Ser?Gly?Thr?Ser?Ala?Ser?Leu?Ala?Ile?Thr?Gly?Leu

65 70 75 80

Arg?Val?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Tyr?Gly

85 90 95

Leu?Arg?Gly?Trp?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>36

<211>321

<212>DNA

＜213〉people

<400>36

gta?gtt?gtg?atg?act?cag?tct?cca?tcg?tcc?ctg?tct?gca?tct?gta?ggg 48

Asp?Val?Val?Met?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ser?Ala?Ser?Val?Gly

5 10 15

gac?aga?gtc?acc?atc?act?tgc?cgg?gac?agt?cag?aac?att?aac?aac?tat 96

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Asn?Ile?Asn?Asn?Tyr

20 25 30

tta?aat?tgg?tat?caa?cag?aaa?cca?gga?aaa?gcc?cct?aag?ctc?ctg?atc 144

Leu?Asn?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

tat?gct?gcc?tcc?act?ttg?caa?agt?ggg?gtc?cca?tca?agg?ttc?agt?ggc 192

Tyr?Ala?Ala?Ser?Thr?Leu?Gln?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

agt?gga?tct?ggg?aca?gat?ttc?act?ctc?acc?atc?acc?agc?tca?cag?cct 240

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Thr?Ser?Leu?Gln?Pro

65 70 75 80

gaa?gat?tct?gca?act?tat?tac?tgc?caa?cag?tat?tcc?cgt?tat?cct?ccc 288

Glu?Asp?Ser?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Tyr?Ser?Arg?Tyr?Pro?Pro

85 90 95

act?ttc?ggc?gga?ggg?acc?aag?gtg?gag?atc?aca 321

Thr?Phe?Gly?Gly?Gly?Thr?Lys?Val?Glu?Ile?Thr

100 105

<210>37

<211>107

<212>PRT

＜213〉people

<400>37

Asp?Val?Val?Met?Thr?Gln?Ser?Pro?Ser?Ser?Leu?Ser?Ala?Ser?Val?Gly

5 10 15

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Asn?Ile?Asn?Asn?Tyr

20 25 30

Leu?Asn?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

Tyr?Ala?Ala?Ser?Thr?Leu?Gln?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Thr?Ser?Leu?Gln?Pro

65 70 75 80

Glu?Asp?Ser?Ala?Thr?Tyr?Tyr?Cys?Gln?Gln?Tyr?Ser?Arg?Tyr?Pro?Pro

85 90 95

Thr?Phe?Gly?Gly?Gly?Thr?Lys?Val?Glu?Ile?Thr

100 105

<210>38

<211>330

<212>DNA

＜213〉people

<400>38

cag?tct?gcc?ctg?act?cag?cct?gcc?tcc?gtg?tct?ggg?tct?cgt?gga?cag 48

Gln?Ser?Ala?Leu?Thr?Gln?Pro?Ala?Ser?Val?Ser?Gly?Ser?Arg?Gly?Gln

5 10 15

tcg?atc?acc?ctc?tcc?tgc?acc?ggc?tcc?agc?act?gat?gtg?ggt?aat?tat 96

Ser?Ile?Thr?Leu?Ser?Cys?Thr?Gly?Ser?Ser?Thr?Asp?Val?Gly?Asn?Tyr

20 25 30

aac?tat?atc?tcc?tgg?tac?caa?caa?cac?cca?ggc?caa?gcc?ccc?aaa?ctc 144

Asn?Tyr?Ile?Ser?Trp?Tyr?Gln?Gln?His?Pro?Gly?Gin?Ala?Pro?Lys?Leu

35 40 45

ttg?att?tac?gat?gtc?act?agt?cgg?ccc?tca?ggt?gtt?tct?gat?cgc?ttc 192

Leu?Ile?Tyr?Asp?Val?Thr?Ser?Arg?Pro?Ser?Gly?Val?Ser?Asp?Arg?Phe

50 55 60

tct?ggc?tcc?aag?tca?ggc?ctc?acg?gcc?tcc?ctg?acc?atc?tct?gga?ctc 240

Ser?Gly?Ser?Lys?Ser?Gly?Leu?Thr?Ala?Ser?Leu?Thr?Ile?Ser?Gly?Leu

65 70 75 80

cag?cct?gaa?gac?gag?gct?gac?tat?tac?tgc?aac?tcc?tat?tct?gcc?acc 288

Gln?Pro?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Asn?Ser?Tyr?Ser?Ala?Thr

85 90 95

gac?act?ctt?gtt?ttt?ggc?gga?ggg?acc?aag?ctg?acc?gtc?cta 330

Asp?Thr?Leu?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>39

<211>110

<212>PRT

＜213〉people

<400>39

Gln?Ser?Ala?Leu?Thr?Gln?Pro?Ala?Ser?Val?Ser?Gly?Ser?Arg?Gly?Gln

5 10 15

Ser?Ile?Thr?Leu?Ser?Cys?Thr?Gly?Ser?Ser?Thr?Asp?Val?Gly?Asn?Tyr

20 25 30

Asn?Tyr?Ile?Ser?Trp?Tyr?Gln?Gln?His?Pro?Gly?Gln?Ala?Pro?Lys?Leu

35 40 45

Leu?Ile?Tyr?Asp?Val?Thr?Ser?Arg?Pro?Ser?Gly?Val?Ser?Asp?Arg?Phe

50 55 60

Ser?Gly?Ser?Lys?Ser?Gly?Leu?Thr?Ala?Ser?Leu?Thr?Ile?Ser?Gly?Leu

65 70 75 80

Glu?Pro?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Asn?Ser?Tyr?Ser?Ala?Thr

85 90 95

Asp?Thr?Leu?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>40

<211>333

<212>DNA

＜213〉people

<400>40

cag?gct?gtg?ctg?act?cag?ccg?tcc?tca?gtg?tct?ggg?gcc?cca?gga?cag 48

Glu?Ala?Val?Leu?Thr?Gln?Pro?Ser?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

agg?gtc?acc?at?tcc?tgc?act?ggg?caa?agc?tcc?aat?atc?ggg?gca?gat 96

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Gln?Ser?Ser?Asn?Ile?Gly?Ala?Asp

20 25 30

tat?gat?gta?cat?tgg?tac?cag?caa?ttt?cca?gga?aca?gcc?ccc?aaa?ctc 144

Tyr?Asp?Val?His?Trp?Tyr?Gln?Gln?Phe?Pro?Gly?Thr?Ala?Pro?Lys?Leu

35 40 45

ctc?atc?tat?ggt?cac?aac?aat?cgg?ccc?tca?ggg?gtc?cct?gac?cga?ttc 192

Leu?Ile?Tyr?Gly?His?Ash?Ash?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

tct?ggc?tcc?aag?tct?ggc?acc?tca?gtc?tcc?ctg?gtc?atc?agt?ggg?ctc 240

Ser?Gly?Ser?Lys?Ser?Gly?Thr?Ser?Val?Ser?Leu?Val?Ile?Ser?Gly?Leu

65 70 75 80

cag?gct?gag?gat?gag?gct?gat?tat?tat?tgc?cag?tcc?tat?gac?agc?agt 288

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Ser?Ser

85 90 95

cta?agt?ggt?ttg?gta?ttc?ggc?gga?ggg?acc?aag?gtg?acc?gtc?cta 333

Leu?Ser?Gly?Leu?Val?Phe?Gly?Gly?Gly?Thr?Lys?Val?Thr?Val?Leu

100 105 110

<210>41

<211>111

<212>PRT

＜213〉people

<400>41

Gln?Ala?Val?Leu?Thr?Gln?Pro?Ser?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Gln?Ser?Ser?Asn?Ile?Gly?Ala?Asp

20 25 30

Tyr?Asp?Val?His?Trp?Tyr?Gln?Gln?Phe?Pro?Gly?Thr?Ala?Pro?Lys?Leu

35 40 45

Leu?Ile?Tyr?Gly?His?Asn?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

Ser?Gly?Ser?Lys?Ser?Gly?Thr?Ser?Val?Ser?Leu?Val?Ile?Ser?Gly?Leu

65 70 75 80

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Ser?Ser

85 90 95

Leu?Ser?Gly?Leu?Val?Phe?Gly?Gly?Gly?Thr?Lys?Val?Thr?Val?Leu

100 105 110

<210>42

<211>321

<212>DNA

＜213〉people

<400>42

gac?atc?cag?ttg?acc?cag?tct?cca?tct?tct?gtg?tct?gca?tct?gtt?gga 48

Asp?Ile?Gln?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Val?Gly

5 10 15

gac?agc?gtc?acc?atc?act?tgt?cgg?gcg?agt?cag?gat?att?agc?agc?tgg 96

Asp?Ser?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Asp?Ile?Ser?Ser?Trp

20 25 30

tta?gcc?tgg?tat?caa?cag?aaa?cca?ggg?gag?gcc?cct?aag?ctc?ctg?atc 144

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Glu?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

tat?gct?gca?tcc?ctt?ctt?caa?agt?ggg?gtc?cca?tca?cgg?ttc?agc?ggc 192

Tyr?Ala?Ala?Ser?Leu?Leu?Gln?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

agt?gga?tct?ggg?aca?gat?ttc?gct?ctc?act?atc?aac?agc?ctg?cag?cct 240

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Ala?Leu?Thr?Ile?Asn?Ser?Leu?Gln?Pro

65 70 75 80

gaa?gat?ttt?gca?act?tac?ttt?tgt?caa?cag?gct?gac?agt?ttc?cct?ccc 288

Glu?Asp?Phe?Ala?Thr?Tyr?Phe?Cys?Gln?Gln?Ala?Asp?Ser?Phe?Pro?Pro

85 90 95

acc?ttc?ggc?caa?ggg?aca?cgg?ctg?gag?att?aaa 321

Thr?Phe?Gly?Gln?Gly?Thr?Arg?Leu?Glu?Ile?Lys

100 105

<210>43

<211>107

<212>PRT

＜213〉people

<400>43

Asp?Ile?Gln?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Val?Gly

5 10 15

Asp?Ser?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Asp?Ile?Ser?Ser?Trp

20 25 30

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Glu?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

Tyr?Ala?Ala?Ser?Leu?Leu?Gln?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Asp?Phe?Ala?Leu?Thr?Ile?Asn?Ser?Leu?Gln?Pro

65 70 75 80

Glu?Asp?Phe?Ala?Thr?Tyr?Phe?Cys?Gln?Gln?Ala?Asp?Ser?Phe?Pro?Pro

85 90 95

Thr?Phe?Gly?Gln?Gly?Thr?Arg?Leu?Glu?Ile?Lys

100 105

<210>44

<211>321

<212>DNA

＜213〉people

<400>44

gac?atc?gag?ttg?acc?cag?tct?cca?tct?tcc?gtg?tct?gca?tct?gtg?gga 48

Asp?Ile?Glu?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Val?Gly

5 10 15

gac?aga?gtc?acc?ctc?act?tgt?cgg?gcg?agt?cag?agt?att?aag?agg?tgg 96

Asp?Arg?Val?Thr?Leu?Thr?Cys?Arg?Ala?Ser?Gln?Ser?Ile?Lys?Arg?Trp

20 25 30

tta?gcc?tgg?tat?cag?cag?aaa?cca?ggg?aag?gcc?cct?agg?ctc?ctc?atc 144

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Arg?Leu?Leu?Ile

35 40 45

tat?gct?gca?tcc?act?ttg?caa?agt?ggg?gtc?cca?tca?agg?ttc?agc?ggc 192

Tyr?Ala?Ala?Ser?Thr?Leu?Gln?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

ggt?gga?tct?ggg?aca?gat?ttc?act?ctc?acc?atc?aac?agc?ctg?cag?cct 240

Gly?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Asn?Ser?Leu?Gln?Pro

65 70 75 80

gaa?gat?ttt?gca?att?tac?tac?tgt?caa?cag?gct?aac?agt?ttc?cct?ccc 288

Glu?Asp?Phe?Ala?Ile?Tyr?Tyr?Cys?Gln?Gln?Ala?Asn?Ser?Phe?Pro?Pro

85 90 95

act?ttc?ggc?cct?ggg?acc?aaa?gtg?gat?atc?aaa 321

Thr?Phe?Gly?Pro?Gly?Thr?Lys?Val?Asp?Ile?Lys

100 105

<210>45

<211>107

<212>PRT

＜213〉people

<400>45

Asp?Ile?Glu?Leu?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Val?Gly

5 10 15

Asp?Arg?Val?Thr?Leu?Thr?Cys?Arg?Ala?Ser?Gln?Ser?Ile?Lys?Arg?Trp

20 25 30

Leu?Ala?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Arg?Leu?Leu?Ile

35 40 45

Tyr?Ala?Ala?Ser?Thr?Leu?Gln?Ser?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Gly?Gly?Ser?Gly?Thr?Asp?Phe?Thr?Leu?Thr?Ile?Asn?Ser?Leu?Gln?Pro

65 70 75 80

Glu?Asp?Phe?Ala?Ile?Tyr?Tyr?Cys?Gln?Gln?Ala?Asn?Ser?Phe?Pro?Pro

85 90 95

Thr?Phe?Gly?Pro?Gly?Thr?Lys?Val?Asp?Ile?Lys

100 105

<210>46

<211>333

<212>DNA

＜213〉people

<400>46

cag?tct?gtc?gtg?acg?cag?ccg?ccc?tca?gtg?tct?ggg?gcc?cca?ggg?cag 48

Gln?Ser?Val?Val?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

agg?gtc?acc?atc?tcc?tgc?agt?ggg?agc?agg?tcc?aac?atc?ggg?gca?cac 96

Arg?Val?Thr?Ile?Ser?Cys?Ser?Gly?Ser?Arg?Ser?Asn?Ile?Gly?Ala?His

20 25 30

tat?gaa?gtc?cag?tgg?tac?cag?cag?ttt?ccg?gga?gca?gcc?ccc?aaa?ctc 144

Tyr?Glu?Val?Gln?Trp?Tyr?Gln?Gln?Phe?Pro?Gly?Ala?Ala?Pro?Lys?Leu

35 40 45

ctc?atc?tat?ggt?gac?acc?aat?cgg?ccc?tca?ggg?gtc?cct?gac?cga?ttc 192

Leu?Ile?Tyr?Gly?Asp?Thr?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

tct?gcc?tcc?cac?tct?ggc?acc?tca?gcc?tcc?ctt?gcc?atc?aca?ggg?ctc 240

Ser?Ala?Ser?His?Ser?Gly?Thr?Ser?Ala?Ser?Leu?Ala?Ile?Thr?Gly?Leu

65 70 75 80

cag?gct?gag?gat?gag?gct?gat?tat?tac?tgc?cag?tcg?tat?gac?acc?agt 288

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Thr?Ser

85 90 95

cta?cgt?ggt?ccg?gtg?ttc?ggc?gga?ggg?acc?aag?ctg?acc?gtc?cta 333

Leu?Arg?Gly?Pro?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>47

<211>111

<212>PRT

＜213〉people

<400>47

Gln?Ser?Val?Val?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

Arg?Val?Thr?Ile?Ser?Cys?Ser?Gly?Ser?Arg?Ser?Asn?Ile?Gly?Ala?His

20 25 30

Tyr?Glu?Val?Gln?Trp?Tyr?Gln?Gln?Phe?Pro?Gly?Ala?Ala?Pro?Lys?Leu

35 40 45

Leu?Ile?Tyr?Gly?Asp?Thr?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

Ser?Ala?Ser?His?Ser?Gly?Thr?Ser?Ala?Ser?Leu?Ala?Ile?Thr?Gly?Leu

65 70 75 80

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Thr?Ser

85 90 95

Leu?Arg?Gly?Pro?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>48

<211>333

<212>DNA

＜213〉people

<400>48

cag?tct?gtc?gtg?acg?cag?ccg?ccc?tca?gtg?tct?ggg?gcc?cca?ggg?cag 48

Gln?Ser?Val?Val?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

agg?gtc?acc?at?tcc?tgc?act?ggg?agc?agc?tcc?aac?atc?ggg?aca?ggt 96

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Ser?Ser?Ser?Asn?Ile?Gly?Thr?Gly

20 25 30

tat?gat?gta?cat?tgg?tac?cag?cag?gtt?cca?gga?tca?gcc?ccc?aaa?ctc 144

Tyr?Asp?Val?His?Trp?Tyr?Gln?Gln?Val?Pro?Gly?Ser?Ala?Pro?Lys?Leu

35 40 45

ctc?atc?tat?gct?tac?acc?aat?cgg?ccc?tca?ggg?gtc?cct?gac?cga?ttc 192

Leu?Ile?Tyr?Ala?Tyr?Thr?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

tct?ggc?tcc?aag?tct?ggc?atg?tca?gcc?tcc?ctg?gtc?atc?ggt?ggt?ctc 240

Ser?Gly?Ser?Lys?Ser?Gly?Met?Ser?Ala?Ser?Leu?Val?Ile?Gly?Gly?Leu

65 70 75 80

cag?gct?gag?gat?gag?gct?gat?tat?tac?tgc?cag?tcc?ttt?gac?gac?agc 288

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Phe?Asp?Asp?Ser

85 90 95

ctg?aat?ggt?ctt?gtc?ttc?gga?cct?ggg?acc?tcg?gtc?acc?gtc?ctc 333

Leu?Asn?Gly?Leu?Val?Phe?Gly?Pro?Gly?Thr?Ser?Val?Thr?Val?Leu

100 105 110

<210>49

<211>111

<212>PRT

＜213〉people

<400>49

Gln?Ser?Val?Val?Thr?Gln?Pro?Pro?ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

Arg?Val?Thr?Ile?Ser?Sys?Thr?Gly?Ser?Ser?Ser?Asn?Ile?Gly?Thr?Gly

20 25 30

Tyr?Asp?Val?His?Trp?Tyr?Gln?Gln?Val?Pro?Gly?Ser?Ala?Pro?Lys?Leu

35 40 45

Leu?Ile?Tyr?Ala?Tyr?Thr?Asn?Arg?Pro?Ser?Gly?Val?Pro?Asp?Arg?Phe

50 55 60

Ser?Gly?Ser?Lys?Ser?Gly?Met?Ser?Ala?Ser?Leu?Val?Ile?Gly?Gly?Leu

65 70 75 80

Gln?Ala?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Phe?Asp?Asp?Ser

85 90 95

Leu?Asn?Gly?Leu?Val?Phe?Gly?Pro?Gly?Thr?Ser?Val?Thr?Val?Leu

100 105 110

<210>50

<211>333

<212>DNA

＜213〉people

<400>50

cag?tct?gtg?ttg?acg?cag?ccg?ccc?tca?gtg?tct?ggg?ggc?cca?ggg?cag 48

Gln?Ser?Val?Leu?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

agg?gtc?acc?atc?tcc?tgc?act?ggg?agc?cac?tcc?aac?ttc?ggg?gca?ggt 96

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Ser?His?Ser?Asn?Phe?Gly?Ala?Gly

20 25 30

act?gat?gtc?cat?tgg?tac?caa?cac?ctt?cca?gga?aca?gcc?ccc?aga?ctc 144

Thr?Asp?Val?His?Trp?Tyr?Gln?His?Leu?Pro?Gly?Thr?Ala?Pro?arg?Leu

35 40 45

ctc?att?cat?gga?gac?act?cat?cgg?ccc?tcc?ggg?gtc?gct?gac?cga?ttc 192

Leu?Ile?His?Gly?Asp?Thr?His?Arg?Pro?Ser?Gly?Val?Ala?Asp?Arg?Phe

50 55 60

tct?ggc?tcc?gg?tct?ggc?gcc?tca?gcc?tcc?ctg?gcc?atc?act?ggg?ctc 240

Ser?Gly?Ser?Arg?Ser?Gly?Ala?Ser?Ala?Ser?Leu?Ala?Ile?Thr?Gly?Leu

65 70 75 80

cgg?gtt?gag?gat?gag?gtc?gat?tat?tac?tgt?cag?tcg?tat?gac?tat?ggc 288

Arg?Val?Leu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Tyr?Gly

85 90 95

ctg?aga?ggt?tgg?gtg?ttc?ggc?ggc?ggg?acc?aag?ctg?acc?gtc?ctt 333

Leu?Arg?Gly?Trp?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>51

<211>111

<212>PRT

＜213〉people

<400>51

Gln?Ser?Val?Leu?Thr?Gln?Pro?Pro?Ser?Val?Ser?Gly?Ala?Pro?Gly?Gln

5 10 15

Arg?Val?Thr?Ile?Ser?Cys?Thr?Gly?Ser?His?Ser?Asn?Phe?Gly?Ala?Gly

20 25 30

Thr?Asp?Val?His?Trp?Tyr?Gln?His?Leu?Pro?Gly?Thr?Ala?Pro?Arg?Leu

35 40 45

Leu?Ile?His?Gly?Asp?Thr?His?Arg?Pro?Ser?Gly?Val?Ala?Asp?Arg?Phe

50 55 60

Ser?Gly?Ser?Arg?Ser?Gly?Ala?Ser?Ala?Ser?Leu?Ala?Ile?Thr?Gly?Leu

65 70 75?80

Arg?Val?Glu?Asp?Glu?Ala?Asp?Tyr?Tyr?Cys?Gln?Ser?Tyr?Asp?Tyr?Gly

85 90 95

Leu?Arg?Gly?Trp?Val?Phe?Gly?Gly?Gly?Thr?Lys?Leu?Thr?Val?Leu

100 105 110

<210>52

<211>321

<212>DNA

＜213〉people

<400>52

gac?atc?cag?atg?acc?cag?tct?cca?tct?tcc?gtg?tct?gca?tct?ata?gga 48

Asp?Ile?Gln?Met?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Ile?Gly

5 10 15

gac?aga?gtc?acc?atc?act?tgt?cgg?gcg?agt?cag?ggt?att?gac?aac?tgg 96

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Gly?Ile?Asp?Asn?Trp

20 25 30

tta?ggc?tgg?tat?cag?cag?aaa?cct?ggg?aaa?gcc?cct?aaa?ctc?ctg?atc 144

Leu?Gly?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

tac?gat?gca?tcc?aat?ttg?gac?aca?ggg?gtc?cca?tca?agg?ttc?agt?gga 192

Tyr?Asp?Ala?Ser?Asn?Leu?Asp?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

agt?gga?tct?ggg?aca?tat?ttt?act?ctc?acc?atc?agt?agc?ctg?caa?gct 240

Ser?Gly?Ser?Gly?Thr?Tyr?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Ala

65 70 75 80

gaa?gat?ttt?gca?gtt?tat?ttc?tgt?caa?cag?gct?aaa?gct?ttt?cct?ccc 288

Glu?Asp?Phe?Ala?Val?Tyr?Phe?Cys?Gln?Gln?Ala?Lys?Ala?Phe?Pro?Pro

85 90 95

act?ttc?ggc?gga?ggg?acc?aag?gtg?gac?atc?aaa 321

Thr?Phe?Gly?Gly?Gly?Thr?Lys?Val?Asp?Ile?Lys

100 105

<210>53

<211>107

<212>PRT

＜213〉people

<400>53

Asp?Ile?Gln?Met?Thr?Gln?Ser?Pro?Ser?Ser?Val?Ser?Ala?Ser?Ile?Gly

5 10 15

Asp?Arg?Val?Thr?Ile?Thr?Cys?Arg?Ala?Ser?Gln?Gly?Ile?Asp?Asn?Trp

20 25 30

Leu?Gly?Trp?Tyr?Gln?Gln?Lys?Pro?Gly?Lys?Ala?Pro?Lys?Leu?Leu?Ile

35 40 45

Tyr?Asp?Ala?Ser?Asn?Leu?Asp?Thr?Gly?Val?Pro?Ser?Arg?Phe?Ser?Gly

50 55 60

Ser?Gly?Ser?Gly?Thr?Tyr?Phe?Thr?Leu?Thr?Ile?Ser?Ser?Leu?Gln?Ala

65 70 75 80

Glu?Asp?Phe?Ala?Val?Tyr?Phe?Cys?Gln?Gln?Ala?Lys?Ala?Phe?Pro?Pro

85 90 95

Thr?Phe?Gly?Gly?Gly?Thr?Lys?Val?Asp?Ile?Lys

100 105

<210>54

<211>13

<212>PRT

＜213〉people

<400>54

Thr?Gly?Ser?His?Ser?Asn?Phe?Gly?Ala?Gly?Thr?Asp?Val

5 10

<210>55

<211>7

<212>PRT

＜213〉people

<400>55

Gly?Asp?Ser?Asn?Arg?Pro?Ser

5

<210>56

<211>11

<212>PRT

＜213〉people

<400>56

Gln?Ser?Tyr?Asp?Tyr?Gly?Leu?Arg?Gly?Trp?Val

5 10

<210>57

<211>11

<212>PRT

＜213〉people

<400>57

Arg?Ala?Ser?Gln?Asn?Ile?Asn?Asn?Tyr?Leu?Asn

5 10

<210>58

<211>7

<212>PRT

＜213〉people

<400>58

Ala?Ala?Ser?Thr?Leu?Gln?Ser

5

<210>59

<211>9

<212>PRT

＜213〉people

<400>59

Gln?Gln?Tyr?Ser?Arg?Tyr?Pro?Pro?Thr

5

<210>60

<211>14

<212>PRT

＜213〉people

<400>60

Thr?Gly?Ser?Ser?Thr?Asp?Val?Gly?Asn?Tyr?Asn?Tyr?Ile?Ser

5 10

<210>61

<211>7

<212>PRT

＜213〉people

<400>61

Asp?Val?Thr?Ser?Arg?Pro?Ser

5

<210>62

<211>10

<212>PRT

＜213〉people

<400>62

Asn?Ser?Tyr?Ser?Ala?Thr?Asp?Thr?Leu?Val

5 10

<210>63

<211>14

<212>PRT

＜213〉people

<400>63

Thr?Gly?Gln?Ser?Ser?Asn?Ile?Gly?Ala?Asp?Tyr?Asp?Val?His

5 10

<210>64

<211>7

<212>PRT

＜213〉people

<400>64

Gly?His?Asn?Asn?Arg?Pro?Ser

5

<210>65

<211>11

<212>PRT

＜213〉people

<400>65

Gln?Ser?Tyr?Asp?Ser?Ser?Leu?Ser?Gly?Leu?Val

5 10

<210>66

<211>10

<212>PRT

＜213〉people

<400>66

Arg?Ala?Ser?Gln?Asp?Ile?Ser?Trp?Leu?Ala

5 10

<210>67

<211>7

<212>PRT

＜213〉people

<400>67

Ala?Ala?Ser?Leu?Leu?Gln?Ser

5

<210>68

<211>9

<212>PRT

＜213〉people

<400>68

Gln?Gln?Ala?Asp?Ser?Phe?Pro?Pro?Thr

5

<210>69

<211>11

<212>PRT

＜213〉people

<400>69

Arg?Ala?Ser?Gln?Ser?Ile?Lys?Arg?Trp?Leu?Ala

5 10

<210>70

<211>7

<212>PRT

＜213〉people

<400>70

Ala?Ala?Ser?Thr?Leu?Gln?Ser

5

<210>71

<211>9

<212>PRT

＜213〉people

<400>71

Gln?Gln?Ala?Asn?Ser?Phe?Pro?Pro?Thr

5

<210>72

<211>14

<212>PRT

＜213〉people

<400>72

Ser?Gly?Ser?Arg?Ser?Asn?Ile?Gly?Ala?His?Tyr?Glu?Val?Gln

5 10

<210>73

<211>7

<212>PRT

＜213〉people

<400>73

Gly?Asp?Thr?Asn?Arg?Pro?Ser

5

<210>74

<211>11

<212>PRT

＜213〉people

<400>74

Gln?Ser?Tyr?Asp?Thr?Ser?Leu?Arg?Gly?Pro?Val

5 10

<210>75

<211>14

<212>PRT

＜213〉people

<400>75

Thr?Gly?Ser?Ser?Ser?Asn?Ile?Gly?Thr?Gly?Tyr?Asp?Val?His

5 10

<210>76

<211>7

<212>PRT

＜213〉people

<400>76

Ala?Tyr?Thr?Asn?Arg?Pro?Ser

5

<210>77

<211>11

<212>PRT

＜213〉people

<400>77

Gln?Ser?Phe?Asp?Asp?Ser?Leu?Asn?Gly?Leu?Val

5 10

<210>78

<211>14

<212>PRT

＜213〉people

<400>78

Thr?Gly?Ser?His?Ser?Asn?Phe?Gly?Ala?Gly?Thr?Asp?Val?His

5 10

<210>79

<211>7

<212>PRT

＜213〉people

<400>79

Gly?Asp?Thr?His?Arg?Pro?Ser

5

<210>80

<211>11

<212>PRT

＜213〉people

<400>80

Gln?Ser?Tyr?Asp?Tyr?Gly?Leu?Arg?Gly?Trp?Val

5 10

<210>81

<211>11

<212>PRT

＜213〉people

<400>81

Arg?Ala?Ser?Gln?Gly?Ile?Asp?Asn?Trp?Leu?Gly

5 10

<210>82

<211>7

<212>PRT

＜213〉people

<400>82

Asp?Ala?Ser?Asn?Leu?Asp?Thr

5

<210>83

<211>9

<212>PRT

＜213〉people

<400>83

Gln?Gln?Ala?Lys?Ala?Phe?Pro?Pro?Thr

5

<210>84

<211>2351

<212>DNA

＜213〉people

<400>84

ggtaccgag?aaagaaccgg?ctcccgagtt?ctgggcattt?cgcccggctc?gaggtgcagg 59

atg?cag?agc?aag?gtg?ctg?ctg?gcc?gtc?gcc?ctg?tgg?ctc?tgc?gtg?gag 107

Met?Gln?Ser?Lys?Val?Leu?Leu?Ala?Val?Ala?Leu?Trp?Leu?Cys?Val?Glu

5 10 15

acc?cgg?gcc?gcc?tct?gtg?ggt?ttg?cct?agt?gtt?tct?ctt?gat?ctg?ccc 155

Thr?Arg?Ala?Ala?Ser?Val?Gly?Leu?Pro?Ser?Val?Ser?Leu?Asp?Leu?Pro

20 25 30

agg?ctc?agc?ata?caa?aaa?gac?ata?ctt?aca?att?aag?gct?aat?aca?act 203

Arg?Leu?Ser?Ile?Gln?Lys?Asp?Ile?Leu?Thr?Ile?Lys?Ala?Asn?Thr?Thr

35 40 45

ctt?caa?att?act?tgc?agg?gga?cag?agg?gac?ttg?gac?tgg?ctt?tgg?ccc 251

Leu?Gln?Ile?Thr?Cys?Arg?Gly?Gln?Arg?Asp?Leu?Asp?Trp?Leu?Trp?Pro

50 55 60

aat?aat?cag?agt?ggc?agt?gag?caa?agg?gtg?gag?gtg?act?gag?tgc?agc 299

Asn?Asn?Gln?Ser?Gly?Ser?Glu?Gln?Arg?Val?Glu?Val?Thr?Glu?Cys?Ser

65 70 75 80

gat?ggc?ctc?ttc?tgt?aag?aca?ctc?aca?att?cca?aaa?gtg?atc?gga?aat 347

Asp?Gly?Leu?Phe?Cys?Lys?Thr?Leu?Thr?Ile?Pro?Lys?Val?Ile?Gly?Asn

85 90 95

gac?act?gga?gcc?tac?aag?tgc?ttc?tac?cgg?gaa?act?gac?ttg?gcc?tcg 395

Asp?Thr?Gly?Ala?Tyr?Lys?Cys?Phe?Tyr?Arg?Glu?Thr?Asp?Leu?Ala?Ser

100 105 110

gtc?att?tat?gtc?tat?gtt?caa?gat?tac?aga?tct?cca?ttt?att?gct?tct 443

Val?Ile?Tyr?Val?Tyr?Val?Gln?Asp?Tyr?Arg?Ser?Pro?Phe?Ile?Ala?Ser

115 120 125

gtt?agt?gac?caa?cat?gga?gtc?gtg?tac?att?act?gag?aac?aaa?aac?aaa 491

Val?Ser?Asp?Gln?His?Gly?Val?Val?Tyr?Ile?Thr?Glu?Asn?Lys?Asn?Lys

130 135 140

act?gtg?gtg?att?cca?tgt?ctc?ggg?tcc?att?tca?aat?ctc?aac?gtg?tca 539

Thr?Val?Val?Ile?Pro?Cys?Leu?Gly?Ser?Ile?Ser?Asn?Leu?Asn?Val?Ser

145 150 155 160

ctt?tgt?gca?aga?tac?cca?gaa?aag?aga?ttt?gtt?cct?gat?ggt?aac?aga 587

Leu?Cys?Ala?Arg?Tyr?Pro?Glu?Lys?Arg?Phe?Val?Pro?Asp?Gly?Asn?Arg

165 170 175

att?tcc?tgg?gac?agc?aag?aag?ggc?ttt?act?att?ccc?agc?tac?atg?atc 635

Ile?Ser?Trp?Asp?Ser?Lys?Lys?Gly?Phe?Thr?Ile?Pro?Ser?Tyr?Met?Ile

180 185 190

agc?tat?gct?ggc?atg?gtc?ttc?tgt?gaa?gca?aaa?att?aat?gat?gaa?agt 683

Ser?Tyr?Ala?Gly?Met?Val?Phe?Cys?Glu?Ala?Lys?Ile?Asn?Asp?Glu?Ser

195 200 205

tac?cag?tct?att?atg?tac?ata?gtt?gtc?gtt?gta?ggg?tat?agg?att?tat 731

Tyr?Gln?Ser?Ile?Met?Tyr?Ile?Val?Val?Val?Val?Gly?Tyr?Arg?Ile?Tyr

210 215 220

gat?gtg?gtt?ctg?agt?ccg?tct?cat?gga?att?gaa?cta?tct?gtt?gga?gaa 779

Asp?Val?Val?Leu?Ser?Pro?Ser?His?Gly?Ile?Glu?Leu?Ser?Val?Gly?Glu

225 230 235 240

aag?ctt?gtc?tta?aat?tgt?aca?gca?aga?act?gaa?cta?aat?gtg?ggg?att 827

Lys?Leu?Val?Leu?Asn?Cys?Thr?Ala?Arg?Thr?Glu?Leu?Asn?Val?Gly?Ile

245 250 255

gac?ttc?aac?tgg?gaa?tac?cct?tct?tcg?aag?cat?cag?cat?aag?aaa?ctt 875

Asp?Phe?Asn?Trp?Glu?Tyr?Pro?Ser?Ser?Lys?His?Gin?His?Lys?Lys?Leu

260 265 270

gta?aac?cga?gac?cta?aaa?acc?cag?tct?ggg?agt?gag?atg?aag?aaa?ttt 923

Val?Asn?Arg?Asp?Leu?Lys?Thr?Gln?Ser?Gly?Ser?Glu?Met?Lys?Lys?Phe

275 280 285

ttg?agc?acc?tta?act?ata?gat?ggt?gta?acc?cgg?agt?gac?caa?gga?ttg 971

Leu?Ser?Thr?Leu?Thr?Ile?Asp?Gly?Val?Thr?Arg?Ser?Asp?Gln?Gly?Leu

290 295 300

tac?acc?tgt?gca?gca?tcc?agt?ggg?ctg?atg?acc?aag?aag?aac?agc?aca 1019

Tyr?Thr?Cys?Ala?Ala?Ser?Ser?Gly?Leu?Met?Thr?Lys?Lys?Asn?Ser?Thr

305 310 315 320

ttt?gtc?agg?gtc?cat?gaa?aaa?cct?ttt?gtt?gct?ttt?gga?agt?ggc?atg 1067

Phe?Val?Arg?Val?His?Glu?Lys?Pro?Phe?Val?Ala?Phe?Gly?Ser?Gly?Met

325 330 335

gaa?tct?ctg?gtg?gaa?gcc?acg?gtg?ggg?gag?cgt?gtc?aga?atc?cct?gcg 1115

Glu?Ser?Leu?Val?Glu?Ala?Thr?Val?Gly?Glu?Arg?Val?Arg?Ile?Pro?Ala

340 345 350

aag?tac?ctt?ggt?tac?cca?ccc?cca?gaa?ata?aaa?tgg?tat?aaa?aat?gga 1163

Lys?Tyr?Leu?Gly?Tyr?Pro?Pro?Pro?Glu?Ile?Lys?Trp?Tyr?Lys?Asn?Gly

355 360 365

ata?ccc?ctt?gag?tcc?aat?cac?aca?att?aaa?gcg?ggg?cat?gta?ctg?acg 1211

Ile?Pro?Leu?Glu?Ser?Asn?His?Thr?Ile?Lys?Ala?Gly?His?Val?Leu?Thr

370 375 380

att?atg?gaa?gtg?agt?gaa?aga?gac?aca?gga?aat?tac?act?gtc?atc?ctt 1259

Ile?Met?Glu?Val?Ser?Glu?Arg?Asp?Thr?Gly?Asn?Tyr?Thr?Val?Ile?Leu

385 390 395 400

acc?aat?ccc?att?tca?aag?gag?aag?cag?agc?cat?gtg?gtc?tct?ctg?gtt 1307

Thr?Asn?Pro?Ile?Ser?Lys?Glu?Lys?Gln?Ser?His?Val?Val?Ser?Leu?Val

405 410 415

gtg?tat?gtc?cca?ccc?cag?att?ggt?gag?aaa?tct?cta?atc?tct?cct?gtg 1355

Val?Tyr?Val?Pro?Pro?Gln?Ile?Gly?Glu?Lys?Ser?Leu?Ile?Ser?Pro?Val

420 425 430

gat?tcc?tac?cag?tac?ggc?acc?act?caa?acg?ctg?aca?tgt?acg?gtc?tat 1403

Asp?Ser?Tyr?Gln?Tyr?Gly?Thr?Thr?Gln?Thr?Leu?Thr?Cys?Thr?Val?Tyr

435 440 445

gcc?att?cct?ccc?ccg?cat?cac?atc?cac?tgg?tat?tgg?cag?ttg?gag?gaa 1451

Ala?Ile?Pro?Pro?Pro?His?His?Ile?His?Trp?Tyr?Trp?Gln?Leu?Glu?Glu

450 455 460

gag?tgc?gcc?aac?gag?ccc?agc?cat?gct?gtc?tca?gtg?aca?aac?cca?tac 1499

Glu?Cys?Ala?Asn?Glu?Pro?Ser?His?Ala?Val?Ser?Val?Thr?Asn?Pro?Tyr

465 470 475 480

cct?tgt?gaa?gaa?tgg?aga?agt?gtg?gag?gac?ttc?cag?gga?gga?aat?aaa 1547

Pro?Cys?Glu?Glu?Trp?Arg?Ser?Val?Glu?Asp?Phe?Gln?Gly?Gly?Asn?Lys

485 490 495

att?gaa?gtt?aat?aaa?aat?caa?ttt?gct?cta?att?gaa?gga?aaa?aac?aaa 1595

Ile?Glu?Val?Asn?Lys?Asn?Gln?Phe?Ala?Leu?Ile?Glu?Gly?Lys?Asn?Lys

500 505 510

act?gta?agt?acc?ctt?gtt?atc?caa?gcg?gca?aat?gtg?tcea?gct?ttg?tac 1643

Thr?Val?Ser?Thr?Leu?Val?Ile?Gln?Ala?Ala?Asn?Val?Ser?Ala?Leu?Tyr

515 520 525

aaa?tgt?gaa?gcg?gtc?aac?aaa?gtc?ggg?aga?gga?gag?agg?gtg?atc?tcc 1691

Lys?Cys?Glu?Ala?Val?Asn?Lys?Val?Gly?Arg?Gly?Glu?Arg?Val?Ile?Ser

530 535 540

ttc?cac?gtg?acc?agg?ggt?cct?gaa?att?act?ttg?caa?cct?gac?atg?cag 1739

Phe?His?Val?Thr?Arg?Gly?Pro?Glu?Ile?Thr?Leu?Gln?Pro?Asp?Met?Gln

545 550 555 560

ccc?act?gag?cag?gag?agc?gtg?tct?ttg?tgg?tgc?act?gca?gac?aga?tct 1787

Pro?Thr?Glu?Gln?Glu?Ser?Val?Ser?Leu?Trp?Cys?Thr?Ala?Asp?Arg?Ser

565 570 575

acg?ttt?gag?aac?ctc?aca?tgg?tac?aag?ctt?ggc?cca?cag?cct?ctg?cca 1835

Thr?Phe?Glu?Asn?Leu?Thr?Trp?Tyr?Lys?Leu?Gly?Pro?Gln?Pro?Leu?Pro

580 585 590

atc?cat?gtg?gga?gag?ttg?ccc?aca?cct?gtt?tgc?aag?aac?ttg?gat?act 1883

Ile?His?Val?Gly?Glu?Leu?Pro?Thr?Pro?Val?Cys?Lys?Asn?Leu?Asp?Thr

595 600 605

ctt?tgg?aaa?ttg?aat?gcc?acc?atg?ttc?tct?aat?agc?aca?aat?gac?att 1931

Leu?Trp?Lys?Leu?Asn?Ala?Thr?Met?Phe?Ser?Asn?Ser?Thr?Asn?Asp?Ile

610 615 620

ttg?atc?atg?gag?ctt?aag?aat?gca?tcc?ttg?cag?gac?caa?gga?gac?tat 1979

Leu?Ile?Met?Glu?Leu?Lys?Asn?Ala?Ser?Leu?Gln?Asp?Gln?Gly?Asp?Tyr

625 630 635 640

gtc?tgc?ctt?gct?caa?gac?agg?aag?acc?aag?aaa?aga?cat?tgc?gtg?gtc 2027

Val?Cys?Leu?Ala?Gln?Asp?Arg?Lys?Thr?Lys?Lys?Arg?His?Cys?Val?Val

645 650 655

agg?cag?ctc?aca?gtc?cta?gag?cgt?gtg?gca?ccc?acg?atc?aca?gga?aac 2075

Arg?Gln?Leu?Thr?Val?Leu?Glu?Arg?Val?Ala?Pro?Thr?Ile?Thr?Gly?Asn

660 665 670

ctg?gaa?aat?cag?acg?aca?agt?att?ggg?gaa?agc?atc?gaa?gtc?tca?tgc 2123

Leu?Glu?Asn?Gln?Thr?Thr?Ser?Ile?Gly?Glu?Ser?Ile?Glu?Val?Ser?Cys

675 680 685

acg?gca?tct?ggg?aat?ccc?cct?cca?cag?atc?atg?tgg?tat?aaa?gat?aat 2171

Thr?Ala?Ser?Gly?Asn?Pro?Pro?Pro?Gln?Ile?Met?Trp?Phe?Lys?Asp?Asn

690 695 700

gag?acc?ctt?gta?gaa?gac?tca?ggc?att?gta?ttg?aag?gat?ggg?aac?cgg 2219

Glu?Thr?Leu?Val?Glu?Asp?Ser?Gly?Ile?Val?Leu?Lys?Asp?Gly?Asn?Arg

705 710 715 720

aac?ctc?act?atc?cgc?aga?gtg?agg?aag?gag?gac?gaa?ggc?ctc?tac?acc 2267

Asn?Leu?Thr?Ile?Arg?Arg?Val?Arg?Lys?Glu?Asp?Glu?Gly?Leu?Tyr?Thr

725 730 735

tgc?cag?gca?tgc?agt?gtt?ctt?ggc?tgt?gca?aaa?gtg?gag?gca?ttt?ttc 2315

Cys?Gln?Ala?Cys?Ser?Val?Leu?Gly?Cys?Ala?Lys?Val?Glu?Ala?Phe?Phe

740 745 750

ata?ata?gaa?ggt?gcc?cag?gaa?aag?acg?aac?ttg?gaa 2351

Ile?Ile?Glu?Gly?Ala?Gln?Glu?Lys?Thr?Asn?Leu?Glu

755 760

<210>85

<211>764

<212>PRT

＜213〉people

<400>85

Met?Gln?Ser?Lys?Val?Leu?Leu?Ala?Val?Ala?Leu?Trp?Leu?Cys?Val?Glu

5 10 15

Thr?Arg?Ala?Ala?Ser?Val?Gly?Leu?Pro?Ser?Val?Ser?Leu?Asp?Leu?Pro

20 25 30

Arg?Leu?Ser?Ile?Gln?Lys?Asp?Ile?Leu?Thr?Ile?Lys?Ala?Asn?Thr?Thr

35 40 45

Leu?Gln?Ile?Thr?Cys?Arg?Gly?Gln?Arg?Asp?Leu?Asp?Trp?Leu?Trp?Pro

50 55 60

Asn?Asn?Gln?Ser?Gly?Ser?Glu?Gln?Arg?Val?Glu?Val?Thr?Glu?Cys?Ser

65 70 75 80

Asp?Gly?Leu?Phe?Cys?Lys?Thr?Leu?Thr?Ile?Pro?Lys?Val?Ile?Gly?Asn

85 90 95

Asp?Thr?Gly?Ala?Tyr?Lys?Cys?Phe?Tyr?Arg?Glu?Thr?Asp?Leu?Ala?Ser

100 105 110

Val?Ile?Tyr?Val?Tyr?Val?Gln?Asp?Tyr?Arg?Ser?Pro?Phe?Ile?Ala?Ser

115 120 125

Val?Ser?Asp?Gln?His?Gly?Val?Val?Tyr?Ile?Thr?Glu?Asn?Lys?Asn?Lys

130 135 140

Thr?Val?Val?Ile?Pro?Cys?Leu?Gly?Ser?Ile?Ser?Asn?Leu?Asn?Val?Ser

145 150 155?160

Leu?Cys?Ala?Arg?Tyr?Pro?Glu?Lys?Arg?Phe?Val?Pro?Asp?Gly?Asn?Arg

165 170 175

Ile?Ser?Trp?Asp?Ser?Lys?Lys?Gly?Phe?Thr?Ile?Pro?Ser?Tyr?Met?Ile

180 185 190

Ser?Tyr?Ala?Gly?Met?Val?Phe?Cys?Glu?Ala?Lys?Ile?Asn?Asp?Glu?Ser

195 200 205

Tyr?Gln?Ser?Ile?Met?Tyr?Ile?Val?Val?Val?Val?Gly?Tyr?Arg?Ile?Tyr

210 215 220

Asp?Val?Val?Leu?Ser?Pro?Ser?His?Gly?Ile?Glu?Leu?Ser?Val?Gly?Glu

225 230 235 240

Lys?Leu?Val?Leu?Asn?Cys?Thr?Ala?Arg?Thr?Glu?Leu?Asn?Val?Gly?Ile

245 250 255

Asp?Phe?Asn?Trp?Glu?Thr?Pro?Ser?Ser?Lys?His?Gln?His?Lys?Lys?Leu

260 265 270

Val?Asn?Arg?Asp?Leu?Lys?Thr?Gln?Ser?Gly?Ser?Glu?Met?Lys?Lys?Phe

275 280 285

Leu?Ser?Thr?Leu?Thr?Ile?Asp?Gly?Val?Thr?Arg?Ser?Asp?Gln?Gly?Leu

290 295 300

Tyr?Thr?Cys?Ala?Ala?Ser?Ser?Gly?Leu?Met?Thr?Lys?Lys?Asn?Ser?Thr

305 310 315?320

Phe?Val?Arg?Val?His?Glu?Lys?Pro?Phe?Val?Ala?Phe?Gly?Ser?Gly?Met

325 330 335

Glu?Ser?Leu?Val?Glu?Ala?Thr?Val?Gly?Glu?Arg?Val?Arg?Ile?Pro?Ala

340 345 350

Lys?Try?Leu?Gly?Tyr?Pro?Pro?Pro?Glu?Ile?Lys?Tyr?Tyr?Lys?Asn?Gly

355 360 365

Ile?Pro?Leu?Glu?Ser?Asn?His?Thr?Ile?Lys?Ala?Gly?His?Val?Leu?Thr

370 375 380

Ile?Met?Glu?Val?Ser?Glu?Arg?Asp?Thr?Gly?Asn?Tyr?Thr?Val?Ile?Leu

385 390 395 400

Thr?Am?Pro?Ile?Ser?Lys?Glu?Lys?Gln?Ser?His?Val?Val?Ser?Leu?Val

405 410 415

Val?Tyr?Val?Pro?Pro?Gln?Ile?Gly?Glu?Lys?Ser?Leu?Ile?Ser?Pro?Val

420 425 430

Asp?Ser?Tyr?Gln?Tyr?Gly?Thr?Thr?Gln?Thr?Leu?Thr?Cys?Thr?Val?Tyr

435 440 445

Ala?Ile?Pro?Pro?Pro?His?His?Ile?His?Trp?Tyr?Trp?Gln?Leu?Glu?Glu

450 455 460

Glu?Cys?Ala?Asn?Glu?Pro?Ser?His?Ala?Val?Ser?Val?Thr?Asn?Pro?Tyr

465 470 475 480

Pro?Cys?Glu?Glu?Trp?Arg?Ser?Val?Glu?Asp?Phe?Gln?Gly?Gly?Asn?Lys

485 490 495

Ile?Glu?Val?Asn?Lys?Asn?Gln?Phe?Ala?Leu?Ile?Glu?Gly?Lys?Asn?Lys

500 505 510

Thr?Val?Ser?Thr?Leu?Val?Ile?Gln?Ala?Ala?Asn?Val?Ser?Ala?Leu?Tyr

515 520 525

Lys?Cys?Glu?Ala?Val?Asn?Lys?Val?Gly?Arg?Gly?Glu?Arg?Val?Ile?Ser

530 535 540

Phe?His?Val?Thr?Arg?Gly?Pro?Glu?Ile?Thr?Leu?Gln?Pro?Asp?Met?Gln

545 550 555 560

Pro?Thr?Glu?Gln?Glu?Ser?Val?Ser?Leu?Trp?Cys?Thr?Ala?Asp?Arg?Ser

565 570 575

Thr?Phe?Glu?Asn?Leu?Thr?Trp?Tyr?Lys?Leu?Gly?Pro?Gln?Pro?Leu?Pro

580 585 590

Ile?His?Val?Gly?Glu?Leu?Pro?Thr?Pro?Val?Cys?Lys?Asn?Leu?Asp?Thr

595 600 605

Leu?Trp?Lys?Leu?Asn?Ala?Thr?Met?Phe?Ser?Asn?Ser?Thr?Asn?Asp?Ile

610 615 620

Leu?Ile?Met?Glu?Leu?Lys?Asn?Ala?Ser?Leu?Gln?Asp?Gln?Gly?Asp?Tyr

625 630 635 640

Val?Cys?Leu?Ala?Gln?Asp?Arg?Lys?Thr?Lys?Lys?Arg?His?Cys?Val?Val

645 650 655

Arg?Gln?Leu?Thr?Val?Leu?Glu?Arg?Val?Ala?Pro?Thr?Ile?Thr?Gly?Asn

660 665 670

Leu?Glu?Asn?Gln?Thr?Thr?Ser?Ile?Gly?Glu?Ser?Ile?Glu?Val?Ser?Cys

675 680 685

Thr?Ala?Ser?Gly?Asn?Pro?Pro?Pro?Gln?Ile?Met?Trp?Phe?Lys?Asp?Asn

690 695 700

Glu?Thr?Leu?Val?Glu?Asp?Ser?Gly?Ile?Val?Leu?Lys?Asp?Gly?Asn?Arg

705 710 715 720

Asn?Leu?Thr?Ile?Arg?Arg?Val?Arg?Lys?Glu?Asp?Glu?Gly?Leu?Tyr?Thr

725 730 735

Cys?Gln?Ala?Cys?Ser?Val?Leu?Gly?Cys?Ala?Lys?Val?Glu?Ala?Phe?Phe

740 745 750

Ile?Ile?Glu?Gly?Ala?Gln?Glu?Lys?Thr?Asn?Leu?Glu

755 760

Claims (36)

1. vascular endothelial growth factor receptor (VEGFR) antagonist of treatment effective dose is used for suppressing with EGF-R ELISA (EGFR) antagonist combination of treatment effective dose the purposes of the medicine of people's tumor growth in preparation.

2. purposes according to claim 1, wherein said tumor overexpression VEGFR.

3. purposes according to claim 1 and 2, wherein said tumor is a mammary gland, heart, lung, small intestinal, colon, spleen, kidney, bladder, head and neck, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, uterus, testis, the tumor of cervix uteri or liver.

4. purposes according to claim 1 and 2, wherein said tumor is a colon tumor.

5. purposes according to claim 1 and 2, wherein said tumor are nonsmall-cell lung cancer (NSCLC).

6. purposes according to claim 1 and 2, wherein said VEGFR antagonist is to be used for intravenous administration.

7. purposes according to claim 1 and 2, wherein said VEGFR antagonist is to be used for oral administration.

8. purposes according to claim 1 and 2, wherein said VEGFR antagonist suppress VEGFR and combine with its part.

9. purposes according to claim 1 and 2, wherein said VEGFR antagonist is in conjunction with VEGFR.

10. purposes according to claim 1 and 2, wherein said VEGFR antagonist comprises the antibody special to VEGFR, or its function equivalent.

11. purposes according to claim 1 and 2, wherein said VEGFR antagonist is DC101.

12. purposes according to claim 1 and 2, wherein said EGFR antagonist is C225.

13. purposes according to claim 1 and 2, wherein said VEGFR antagonist is DC101, and described EGFR antagonist is C225.

14. purposes according to claim 1 and 2, wherein said VEGFR antagonist comprises the micromolecule special to VEGFR.

15. purposes according to claim 1 and 2, wherein said VEGFR antagonist are the antagonisies of fms sample tyrosine kinase receptor (flt-1) VEGFR-1.

16. purposes according to claim 1 and 2, wherein this medicine further comprises a kind of adjuvant.

17. purposes according to claim 1 and 2, wherein said tumor overexpression EGFR.

18. purposes according to claim 1 and 2, wherein said EGFR antagonist is used for intravenous administration.

19. purposes according to claim 1 and 2, wherein said EGFR antagonist is used for oral administration.

20. purposes according to claim 1 and 2, wherein said EGFR antagonist suppress EGFR and combine with its part.

21. purposes according to claim 1 and 2, wherein said EGFR antagonist is in conjunction with EGFR.

22. purposes according to claim 1 and 2, wherein said EGFR antagonist suppress EGFR and combine with ATP.

23. purposes according to claim 1 and 2, wherein said EGFR antagonist comprises the antibody special to EGFR, or its function equivalent.

24. purposes according to claim 1 and 2, wherein said EGFR antagonist comprises the micromolecule special to EGFR.

25. purposes according to claim 23, wherein said antibody contains the constant region of human antibodies.

26. purposes according to claim 23, wherein said antibody are the chimeric antibodys that contains the mouse antibodies variable region.

27. purposes according to claim 23, wherein said antibody are the humanized antibodies that contains the variable region, the complementary determining region (CDRs) of mouse antibodies and the framework region of human antibodies are then contained in the variable region.

28. purposes according to claim 23, wherein said antibody are the human antibodies that contains the human antibodies variable region.

29. purposes according to claim 1, wherein said medicine are used for uniting with antitumor agent.

30. a test kit that is used to suppress tumor growth contains EGFR antagonist for the treatment of effective dose and the VEGFR antagonist for the treatment of effective dose.

31. test kit according to claim 30, wherein said EGFR antagonist comprises the antibody special to EGFR, or its function equivalent.

32. test kit according to claim 30, wherein said EGFR antagonist comprises the micromolecule special to EGFR.

33. according to any one described test kit of claim 30-32, wherein said VEGFR antagonist comprises the antibody special to VEGFR, or its function equivalent.

34. according to any one described test kit of claim 30-32, wherein said VEGFR antagonist comprises the micromolecule special to VEGFR.

35. according to any one described test kit of claim 30-32, wherein this test kit further contains antitumor agent.

36. according to any one described test kit of claim 30-32, wherein this test kit further contains adjuvant.

Images