CN103224981A - Primer group and method for detecting non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by mass-spectrography method - Google Patents
Primer group and method for detecting non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by mass-spectrography method Download PDFInfo
- Publication number
- CN103224981A CN103224981A CN2013100276214A CN201310027621A CN103224981A CN 103224981 A CN103224981 A CN 103224981A CN 2013100276214 A CN2013100276214 A CN 2013100276214A CN 201310027621 A CN201310027621 A CN 201310027621A CN 103224981 A CN103224981 A CN 103224981A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- dna
- primer sets
- extension
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a primer group and a method for detecting a non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by a mass-spectrography method. The primer group comprises an amplification primer pair and corresponding extension primers respectively for an amplification reaction and an extension reaction in detection. The primer group can effectively detect the non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype, has a low detection cost and high flux, utilizes a 384-well plate for the experiment, realizes simultaneous detection of 190 samples (except contrasts in contrast apertures), has high accuracy and avoids false positive detection results.
Description
Technical field
The present invention designs a kind of polynucleotide and method of mass spectrometric detection of gene pleiomorphism, particularly relates to primer sets and method that mass spectroscopy detects non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism loci gene type.
Background technology
(single nucleotide polymorphism SNP), mainly is meant on genomic level by the caused dna sequence polymorphism of the variation of single Nucleotide single nucleotide polymorphism.It is modal a kind of in human heritable variation.Account for more than 90% of all known polymorphisms.SNP extensively exists in human genome, just has 1 in average per 500～1000 base pairs, estimates that its sum can reach 3,000,000 even more.The polymorphism that SNP showed only relates to the variation of single base, and this variation can be caused by the conversion (transition) or the transversion (transversion) of single base, also can be by due to the insertion or disappearance of base.Generally speaking, SNP is meant that variation frequency is greater than 1% single nucleotide variations.SNP becomes third generation genetic marker, the many phenotypic differences of human body, to the susceptibility and the tolerance of disease, poisonous substance, the diversity of disease clinical manifestation (clinical phenotype diversity), and all play an important role on the reactivity to pharmacological agent.
Radiotherapy is to use the X line, and γ high-power electron beam isoradial is radiated at cancerous tissue because the biological action of radioactive rays, can maximum kill and wound cancerous tissue, destroy cancerous tissue, it is dwindled.Its principle be according to a large amount of radioactive rays with energy can destroy the karyomit(e) of cell, the cell growth is stopped.So can be used for resisting quick growth splitted cancer cells.The Chang Zuowei of radiation cure directly or the mode of auxiliary for treating cancer.
It can produce better effects as an important means of treatment malignant tumour for many cancers, but the radiotherapy meeting produces radiation pneumonia, radiation esophagitis, and many toxic side effecties such as appetite descends, feels sick, vomiting, stomachache, diarrhoea or constipation.
At non-small cell type lung cancer, common and chemotherapy combined treatment tumour.
In the radiotherapy of lung tumors, lung tissue tends to be subjected to the irradiation of doses, causes radiotherapy damage in various degree.The complication that the lung radiotherapy damage is produced-acute radiation pneumonia and radiation fibrosis of lung is the limiting factor of breast tumor radiotherapy dosage.Animal experiment shows, after giving full radix pulmonis and controlling dose irradiation, will produce in several weeks to several months in the tangible lung and be full of transudate in hyperemia, alveolar interstitial edema, the alveolar.Follow by inflammatory cell infiltration, alveolar epithelial cells comes off.After several weeks, a matter pulmonary edema changes collegen filament into, and alveolar septum thickens, and the result causes gas interchange disturbance.In the radiotherapy of lymphoma, mediastinal tumor lung cancer and mammary cancer, the clinical symptom of radiation pneumonia appears in about 5～15% patient, often show as low-heat, cough, uncomfortable in chest, having difficulty in breathing can appear in weight person, pectoralgia, persistence dry cough, sputum mixed with blood, x-ray chest radiograph can show and radiation is wild consistent diffusivity sheet increase in density shadow, CT can show the change of interstitial lung increase in density, when surpassing tolerance dose, can produce serious radiation pneumonia, clinical symptom is serious, acute respiratory distress, high heat occur, often can cause death.The patient spends acute phase, and symptoms of pneumonia can continue the several months, but Histological change will continue development, progress into the pulmonary fibrosis phase, still easily produce the complication threat to life in this stage.
Can cause radioactivity esophagitis, mucosal ulcer after oesophagus is shone, the patient burning sensation behind the breastbone occurs, swallows pain, esophageal stricture, fibrosis, causes dysphagia, even esophageal perforation and threat to life.Behind report such as the Phillips single high-dose irradiation, the stratum basale of the 3rd day oesophagus just has cavity to form and lacks mitotic division, the squamous cell layer attenuation of angling simultaneously.7～14 days outgrowth basal cells and re-epithelialize zone occur simultaneously with the zone of stripping off fully, occur after 21 days that the basal cell layer hyperplasia is quickened and squamous cell layer thickens, and make tube wall stiff, follow the string, and tube chamber is further narrow.
Document shows, the pleomorphism site of human body genes involved have 20, genes involved and corresponding location point are: the polymorphism position point of IL6 is rs180079,: rs11556218, the polymorphism position point of PGTS is rs5275, rs20417, rs689470, the polymorphism position point of IL4R is: rs1801275, the polymorphism position point of IL10 is: rs1800872, the polymorphism position point of IL10RA is rs3135932, the polymorphism position point of IL1A is rs1800587, rs17561, the polymorphism position point of IL8 is rs4073, the polymorphism position point of TNFRSF1B is rs1061622, the polymorphism position point of MIF is rs755622, the polymorphism position point of NOS3 is rs1799983, the polymorphism position point of IL4 is rs2070874, the polymorphism position point of NFKB1A is rs8904, and the polymorphism position point of IL13 is rs20541, the polymorphic site that rs180925 and other gene pairss are answered etc.The genotype of genes involved may be types such as T/C type, G/T, if can determine the genotype of pleomorphism site, just can realize individualized treatment, thereby realizes the optimization of result of treatment.
Document shows, the cytokine that inflammatory reaction is relevant, and the individual difference of the single nucleotide polymorphism of its gene, the pneumonia, the esophagitis susceptibility that cause with radiotherapy are relevant.There is dosage effect in the risk probability that the gene type of these single nucleotide polymorphism and the individual inflammation that radiation therapy is caused take place.
To sum up tell, should select during complex therapy as far as possible, and use the radiotherapy dosage of reasonable individuation at patient the little chemotherapeutics of institute's radiotherapy internal organs toxicity.
The genotypic detection method of human body pleomorphism site has direct sequencing, liquid chip method etc. usually at present.Wherein, the detection cost of direct sequencing is higher, and flux is little; The specificity of liquid chip method and accuracy rate height, but need be at mutational site designing probe and corresponding microballoon, cost height.
Therefore, we need find a kind of flux height, and are easy and simple to handle, and the method that cost is low is in the hope of realizing the detection to non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism.
Summary of the invention
In order to overcome above-mentioned the deficiencies in the prior art, the invention provides the polynucleotide and the method for the mass spectrometric detection of non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism.Be intended to solve the problem that the prior art flux is low, cost is high.
A kind of polynucleotide primer sets that is used for the mass spectrometric detection of non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism, comprise amplimer to and corresponding extension primer, it is characterized in that, described primer sets is selected from the primer sets of following table group number correspondence, can be the above primer sets of one group of following table or two groups, amplimer to extend primer correspond to respectively choose the pairing amplimer of group number to extend primer:
| Group number | Amplimer is right | Extend primer |
| 1 | SEQ ID NO:1 and SEQ ID NO:2 | SEQ ID NO：37 |
| 2 | SEQ ID NO:3 and SEQ ID NO:4 | SEQ ID NO：38 |
| 3 | SEQ ID NO:5 and SEQ ID NO:6 | SEQ ID NO：39 |
| 4 | SEQ ID NO:7 and SEQ ID NO:8 | SEQ ID NO：40 |
| 5 | SEQ ID NO:9 and SEQ ID NO:10 | SEQ ID NO：41 |
| 6 | SEQ ID NO:11 and SEQ ID NO:12 | SEQ ID NO：42 |
| 7 | SEQ ID NO:13 and SEQ ID NO:14 | SEQ ID NO：43 |
| 8 | SEQ ID NO:15 and SEQ ID NO:16 | SEQ ID NO：44 |
| 9 | SEQ ID NO:17 and SEQ ID NO:18 | SEQ ID NO：45 |
| 10 | SEQ ID NO:19 and SEQ ID NO:20 | SEQ ID NO：46 |
| 11 | SEQ ID NO:21 and SEQ ID NO:22 | SEQ ID NO：47 |
| 12 | SEQ ID NO:23 and SEQ ID NO:24 | SEQ ID NO：48 |
| 13 | SEQ ID NO:25 and SEQ ID NO:26 | SEQ ID NO：49 |
| 14 | SEQ ID NO:27 and SEQ ID NO:28 | SEQ ID NO：50 |
| 15 | SEQ ID NO:29 and SEQ ID NO:30 | SEQ ID NO：51 |
| 16 | SEQ ID NO:31 and SEQ ID NO:32 | SEQ ID NO：52 |
| 17 | SEQ ID NO:33 and SEQ ID NO:34 | SEQ ID NO：53 |
| 18 | SEQ ID NO:35 and SEQ ID NO:36 | SEQ ID NO：54 |
As exemplary illustration: being selected from the table group number as primer sets is 15 primer sets, and then Dui Ying amplimer is to being SEQ ID NO:29 and SEQ ID NO:30, and the extension primer is SEQ ID NO:51; Being selected from the trade mark group number as primer sets is 12,18 primer sets, and then Dui Ying amplimer is to being SEQ ID NO:23 and SEQ ID NO:24, SEQ ID NO:35 and SEQ ID NO:36, and extending primer is SEQ ID NO:48, SEQ ID NO:54.
A kind of mass spectroscopy detects the relevant genotypic method of pleomorphism site of non-small cell type lung cancer radiotherapy toxic side effect, and step is as follows:
(1) gathers whole blood sample to be checked, extract genomic dna;
(2) in the DNA that obtains, add the gene of amplimer, carry out amplified reaction carrying out;
(3) use SAP enzyme (alkaline phosphatase) to handle amplified production, remove and remain in deoxynucleotide unnecessary in the reaction system;
(4) add to the product of after treatment amplified reaction and extend primer, carry out extension;
(6) use the resin purification extension products;
(7) extension products is transferred on the special chip;
(8) chip is positioned in the mass spectrograph detects, read and analysis detecting data, the genotype in confirmatory sample radiotherapy toxic side effect related gene polymorphism site is characterized in that: the primer that is used for amplified reaction to and corresponding extension be selected from more than a group or two groups of above-mentioned primer sets.
As preferred version, behind the completing steps (1), extract is divided into two groups finishes (2) to (8) step, be used in first group amplified reaction and extension primer sets be above-mentioned primer sets be selected from table group number 2 with or group number 8 in primer sets; Second group of primer sets that is used for amplified reaction and derivatization reaction is that above-mentioned primer sets is selected from table one group or two groups of above primer sets except that group number sequence number 2 and group number 8.
As preferred version, the employed raw material of described extension step is the dideoxyribonucleoside triphosphate of modifying through quality (ddNTP).
Compared with prior art, advantage of the present invention is:
(1) primer of the present invention can effectively detect the genotype of non-small cell type lung cancer radiotherapy toxic side effect genes involved, and it is low to detect cost;
(2) flux height uses 384 orifice plates to experimentize, and can disposablely detect (removing control wells) simultaneously to 190 routine samples;
False-positive detected result does not appear in (3) accuracy rate height.
Description of drawings
Fig. 1 uses and extends primer SEQ ID NO:37 to detecting the result that sample IL6 gene polymorphism sites rs1800795 detects;
Fig. 2 uses and extends primer SEQ ID NO:38 to detecting the result that sample IL16 gene polymorphism sites rs11556218 detects.
Fig. 3 uses and extends primer SEQ ID NO:39 to detecting the result that sample PGTS gene polymorphism sites rs5275 detects;
Fig. 4 uses and extends primer SEQ ID NO:40 to detecting the result that sample PGTS gene polymorphism sites rs20417 detects;
Fig. 5 uses and extends primer SEQ ID NO:41 to detecting the result that sample PGTS gene polymorphism sites rs689470 detects;
Fig. 6 uses and extends primer SEQ ID NO:42 to detecting the result that sample IL4R gene polymorphism sites rs1801275 detects;
Fig. 7 uses and extends primer SEQ ID NO:43 to detecting the result that sample IL10 gene polymorphism sites rs1800872 detects;
Fig. 8 uses and extends primer SEQ ID NO:44 to detecting the result that sample IL10RA gene polymorphism sites rs3135932 detects;
Fig. 9 uses and extends primer SEQ ID NO:45 to detecting the result that sample IL1A gene polymorphism sites rs1800587 detects;
Figure 10 uses and extends primer SEQ ID NO:46 to detecting the result that sample IL1A gene polymorphism sites rs17561 detects.The extension primer size that rs17561 is detected is 7423.9Da, and its base is G; Extending the primer size is 7447.9Da, and its base is T.So this detection sample genotype is G/T;
Figure 11 uses and extends primer SEQ ID NO:47 to detecting the result that sample TNFRSF1B gene polymorphism sites rs4073 detects;
Figure 12 uses and extends primer SEQ ID NO:48 to detecting the result that sample IL8 gene polymorphism sites rs1061622 detects;
Figure 13 uses and extends primer SEQ ID NO:49 to detecting the result that sample mif gene pleomorphism site rs755622 detects;
Figure 14 uses and extends primer SEQ ID NO:50 to detecting the result that sample NOS3 gene polymorphism sites rs1799983 detects;
Figure 15 uses and extends primer SEQ ID NO:51 to detecting the result that sample IL4 gene polymorphism sites rs2070874 detects;
Figure 16 uses and extends primer SEQ ID NO:52 to detecting the result that sample NFKB1A gene polymorphism sites rs8904 detects;
Figure 17 uses and extends primer SEQ ID NO:53 to detecting the result that sample IL13 gene polymorphism sites rs20541 detects;
Figure 18 uses and extends primer SEQ ID NO:54 to detecting the result that sample IL13 gene polymorphism sites rs180925 detects;
Embodiment:
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experiment condition of the unreceipted actual conditions in the following example and method, usually according to the conventional method that adopts of affiliated field experimenter,
Experimental example 1 design of primers
Design of primers is followed principle: mononucleotide polymorphism site design extension primer, follow every mutual difference of molecular weight of extending primer and be greater than 30Da, each molecular weight difference that extends between primer and each extension products is not less than 9Da, extends the principle that the molecular weight of primer and extension products will be between 4500 ~ 8500Da.
The common online design tool of use that uses sequenom company to provide.
Land https: //www.mysequenom.com/Home, the input account number cipher, use this online design software, import the title of mononucleotide polymorphism site (such as rs1800872 at specified location, rs1061622 etc.), perhaps comprise mononucleotide polymorphism site interior with and each 100 base of upstream and downstream about sequence, waiting for server computing and return results.
Return results comprises 2 of the amplimers of any one mononucleotide polymorphism site that need detect and extends 1 of primer.
Primer table such as table 1:
Table 1
| The primer title | Primer sequence (5 '-3 ') |
| SEQ ID NO：1 | ACGTTGGATGAGCCTCAATGACGACCTAAG |
| SEQ ID NO：2 | ACGTTGGATGGATTGTGCAATGTGACGTCC |
| SEQ ID NO：3 | ACGTTGGATGGCTCAGGTTCACAGAGTGTT |
| SEQ ID NO：4 | ACGTTGGATGTGGAAAGAACCTCATTGCCC |
| SEQ ID NO：5 | ACGTTGGATGCCATGATGCATTAGAAGTAAC |
| SEQ ID NO：6 | ACGTTGGATGAATAATGCACTGATACCTG |
| SEQ ID NO：7 | ACGTTGGATGACAGGGTAACTGCTTAGGAC |
| SEQ ID NO：8 | ACGTTGGATGACTGTTCTCCGTACCTTCAC |
| SEQ ID NO：9 | ACGTTGGATGTGATCTGCTGACAAAACCTG |
| SEQ ID NO：10 | ACGTTGGATGTACACATTTGTCTGAGGCAC |
| SEQ ID NO：11 | ACGTTGGATGATCCTCCGCCGAAATGTCCT |
| SEQ ID NO：12 | ACGTTGGATGACCCTGCTCCACCGCATGTA |
| SEQ ID NO：13 | ACGTTGGATGAAAGGAGCCTGGAACACATC |
| SEQ ID NO：14 | ACGTTGGATGTCCTCAAAGTTCCCAAGCAG |
| SEQ ID NO：15 | ACGTTGGATGTCATCCTCGGGAAGATTCAG |
[0058]
| SEQ ID NO：16 | ACGTTGGATGCATACTCTCGGAAGTGACTG |
| SEQ ID NO：17 | ACGTTGGATGGGCTGGCCACAGGAATTATA |
| SEQ ID NO：18 | ACGTTGGATGAGGAAGGCATGGATTTTTAC |
| SEQ ID NO：19 | ACGTTGGATGGGTTTTAGAAATCATCAAGCC |
| SEQ ID NO：20 | ACGTTGGATGGAATTCGTATTTGATGATCC |
| SEQ ID NO：21 | ACGTTGGATGGCCACTCTAGTACTATATCTG |
| SEQ ID NO：22 | ACGTTGGATGCTGAAGCTCCACAATTTGGT |
| SEQ ID NO：23 | ACGTTGGATGTGGTGGCCATCCCTGGGAAT |
| SEQ ID NO：24 | ACGTTGGATGGGTAAGTGTACTGCCCCTG |
| SEQ ID NO：25 | ACGTTGGATGTCCAGCAACCGCCGCTAAG |
| SEQ ID NO：26 | ACGTTGGATGCGATTTCTAGCCGCCAAGTG |
| SEQ ID NO：27 | ACGTTGGATGTGCATTCAGCACGGCTGGAC |
| SEQ ID NO：28 | ACGTTGGATGGGGGCAGAAGGAAGAGTTC |
| SEQ ID NO：29 | ACGTTGGATGTGCATCGTTAGCTTCTCCTG |
| SEQ ID NO：30 | ACGTTGGATGGAGGTGAGACCCATTAATAG |
| SEQ ID NO：31 | ACGTTGGATGTGCCCTATGATGACTGTGTG |
| SEQ ID NO：32 | ACGTTGGATGTGTACAAATATACAAGTCC |
| SEQ ID NO：33 | ACGTTGGATGTGATGCTTTCGAAGTTTCAG |
| SEQ ID NO：34 | ACGTTGGATGAGGTGGCCCAGTTTGTAAAG |
| SEQ ID NO：35 | ACGTTGGATGGTGTTCCCAACTTTTATGTC |
| SEQ ID NO：36 | ACGTTGGATGGGAGAGCCTTCCACATGAAA |
| SEQ ID NO：37 | GTGACGTCCTTTAGCAT |
| SEQ ID NO：38 | TCACAGAGTGTTTCCAAA |
| SEQ ID NO：39 | TTTTGTTTGATGACAGAAAAAT |
| SEQ ID NO：40 | TTGTTTCTTGGAAAGAGAGG |
| SEQ ID NO：41 | gGGGAATTTGGGTTGTGTATG |
| SEQ ID NO：42 | CCACCAGTGGCTATC |
| SEQ ID NO：43 | ccgcGACTGGCTTCCTACAG |
| SEQ ID NO：44 | GGAAGTGACTGAAGATGC |
| SEQ ID NO：45 | TTTTTACATATGAGCCTTCAATG |
[0059]
| SEQ ID NO：46 | gttgaTCAGGAAGCTAAAAGGTG |
| SEQ ID NO：47 | CACAATTTGGTGAATTATCAA |
| SEQ ID NO：48 | CGTGCAGACTGCATCC |
| SEQ ID NO：49 | GCCAAGTGGAGAACAG |
| SEQ ID NO：50 | GCAGGCCCCAGATGA |
| SEQ ID NO：51 | gTGCAGTGACAATGTGAG |
| SEQ ID NO：52 | CAGCGTCTGACGTTATGAG |
| SEQ ID NO：53 | AACTTTTTCGCGAGGGAC |
| SEQ ID NO：54 | AGGAAGGAATGAAGGAG |
Above-mentioned primer according to the form below is carried out combo, forms primer sets:
Table 2
| Sequence number | Amplimer is right | Extend primer |
| 1 | SEQ ID NO:1 and SEQ ID NO:2 | SEQ ID NO：37 |
| 2 | SEQ ID NO:3 and SEQ ID NO:4 | SEQ ID NO：38 |
| 3 | SEQ ID NO:5 and SEQ ID NO:6 | SEQ ID NO：39 |
| 4 | SEQ ID NO:7 and SEQ ID NO:8 | SEQ ID NO：40 |
| 5 | SEQ ID NO:9 and SEQ ID NO:10 | SEQ ID NO：41 |
| 6 | SEQ ID NO:11 and SEQ ID NO:12 | SEQ ID NO：42 |
| 7 | SEQ ID NO:13 and SEQ ID NO:14 | SEQ ID NO：43 |
| 8 | SEQ ID NO:15 and SEQ ID NO:16 | SEQ ID NO：44 |
| 9 | SEQ ID NO:17 and SEQ ID NO:18 | SEQ ID NO：45 |
| 10 | SEQ ID NO:19 and SEQ ID NO:20 | SEQ ID NO：46 |
| 11 | SEQ ID NO:21 and SEQ ID NO:22 | SEQ ID NO：47 |
| 12 | SEQ ID NO:23 and SEQ ID NO:24 | SEQ ID NO：48 |
| 13 | SEQ ID NO:25 and SEQ ID NO:26 | SEQ ID NO：49 |
| 14 | SEQ ID NO:27 and SEQ ID NO:28 | SEQ ID NO：50 |
| 15 | SEQ ID NO:29 and SEQ ID NO:30 | SEQ ID NO：51 |
| 16 | SEQ ID NO:31 and SEQ ID NO:32 | SEQ ID NO：52 |
| 17 | SEQ ID NO:33 and SEQ ID NO:34 | SEQ ID NO：53 |
| 18 | SEQ ID NO:35 and SEQ ID NO:36 | SEQ ID NO：54 |
[0063]Because primer of the present invention is directly to design at the online design tool of use that sequenom company provides according to the related gene polymorphism site, it is used for the genotypic detection of gene polymorphism sites, in use, the primer sets that we choose in above-mentioned any group number is carried out the relevant genotypic detection of pleomorphism site of non-small cell type lung cancer radiotherapy toxic side effect, as the pleomorphism site of choosing the primer sets detection in the group number 18 is rs180925, if choose many groups, then detect a plurality of loci gene types, concrete detection method is as described below.When detecting, can once choose the genotype that one group of primer sets only detects a pleomorphism site, also can choose many group primer sets, detect the genotype of a plurality of pleomorphism sites.
The extraction of experimental example 2 detected object DNA
Use the Omega whole blood DNA to extract test kit:
Blood sample is added in the 2ml centrifuge tube, adds the long-pending ERL buffer(dilution back of triploid), room temperature is placed 5min, during suitable mixing; The centrifugal 30s of room temperature 14000g removes supernatant, does not break up white precipitate, stays 10ul liquid; The resuspended white corpuscle precipitation of vibration centrifuge tube, the WTL buffer of adding 240ul, the 30s lysing cell that vibrates at a high speed, solution becomes gets thickness, if still have obvious grumeleuse behind the solution mixing, then can disappear until grumeleuse in 37 degree water-baths; Add the 3ul Proteinase K, 55 degree water-bath 10-30min; Add 2ul RNase A solution mixing, room temperature is placed 10min; Add 250ul Buffer BL, the vibration mixing, 65 degree 10min, during put upside down mixing 2 times; Add the 250ul dehydrated alcohol, complete mixing vibrates; HiBind DNA column sleeve in the 2ml centrifuge tube, is all injected post with the solution that obtains in the step 7, and the centrifugal 1min of 10000g discards filtrate; Add 500ul Buffer HB, the centrifugal 1min of 10000g discards filtrate; HiBind DNA post is recovered in the 2ml centrifuge tube again, added 650ul DNA Wush buffer (containing ethanol) to pillar, the centrifugal 1min of 10000g discards filtrate; Repeat previous step suddenly once; HiBind DNA post is recovered in the 2ml centrifuge tube again high speed centrifugation 2min, the centrifugal post of finish-drying.This step is most important to subsequent operations; Pillar is placed the centrifuge tube of 2ml nuclease free, add the film central authorities of the DNA Elution Buffer of 50-100ul70 degree preheating to pillar, room temperature is placed 2min; Under the room temperature, 10000g is centrifugal
Extend between the primer in the extension and form dimer, the DNA that extracts is divided into two groups of experiments of carrying out subsequent step: first group is used to detect pleomorphism site rs11556218 and the pairing genotype of rs3135932, and second group is used to detect rs1800795, rs5275, rs20417, rs689470, rs1801275, rs1800872, rs1800587, rs17561, rs4073, rs1061622, MIF:rs755622, rs1799983, rs2070874, rs8904, the pairing genotype of rs20541, rs180925.
The DNA of 3 pairs of extractions of experimental example carries out amplified reaction
Amplification system such as following table 3:
Table 3
Reaction conditions such as following table 4:
Table 4
With amplimer to being divided into two groups: the amplimer in first group to for amplimer in the primer sets in the sequence number 2 and/or 8 in the form 2 right; Second group of amplimer to be in the form 2 in the primer sets except that sequence number 2 and 8 amplimer right more than one group or two groups; Amplimer working fluid concentration is 1 μ M.
The processing of experimental example 4 amplified reaction products
Use SAP enzyme (alkaline phosphatase) to handle amplified production, remove and remain in deoxynucleotide unnecessary in the reaction system; Reaction system such as form 5:
Table 5
| Reagent | Final concentration | Application of sample volume (μ l) |
| Ultrapure water | / | 1.53 |
| The SAP damping fluid | 0.243x | 0.17 |
| SAP enzyme (1.7U/ul) | 0.5U | 0.30 |
| Cumulative volume [uL] | / | 2 |
[0081]Mixed solution in the table is added in the amplified production, and final volume is 7 μ l.
Reaction conditions such as form 6:
Table 6
| Temperature | Time |
| 37° |
40 minutes |
| 85° |
5 minutes |
| 4°C | Keep |
SAP is a shrimp alkali Phosphoric acid esterase, can stop it to participate in the subsequent reactions unreacted dNTP dephosphorylation, only extends a base when guaranteeing extension.
Experimental example 5 extensions
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:15 and SEQ ID NO:16 are mixed into a pipe amplimer working fluid, and working fluid concentration is 1 μ M;
Reaction system such as following table 7:
Table 7
| Reagent | Final concentration | Application of sample volume (μ l) |
| Ultrapure water | / | 0.619 |
| The iPLEX damping fluid | 0.222X | 0.200 |
| The iPLEX stop buffer | 1X | 0.200 |
| Extend the primer mixed solution | / | 0.94 |
| The iPLEX enzyme | 1X | 0.041 |
| Cumulative volume [μ l] | / | 2.000 |
Mixed solution in the table is added in the SAP reaction product, and final volume is 9 μ l.
Reaction conditions such as following table 6:
Table 8
The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and the resolving power of total system is improved.
The extension primer of first group of amplified reaction product adding is to being: SEQ ID NO:38 and SEQ ID NO:44; The extension primer that the product of second group of amplified reaction adds is except SEQ ID NO:37 to SEQ ID NO:54(SEQ ID NO:38 and the SEQ ID NO:44).
Extend primer mixed solution proportioning such as following table 9:
Table 9
Reacting hole 1 adds ultrapure water 36.10uL; Reacting hole 2 adds ultrapure water 92.33ul.
During the genotype detection of detected object genes involved, based on the pairing amplimer of the pleomorphism site of correspondence to and extend primer such as following table following table 10:
Table 10
| Genotype | Polymorphism position point | Amplimer is right | Extend primer |
| IL6 | rs1800795 | SEQ ID NO:1 and SEQ ID NO:2 | SEQ ID NO：37 |
| IL16 | rs11556218 | SEQ ID NO:3 and SEQ ID NO:4 | SEQ ID NO：38 |
| PGTS | rs5275 | SEQ ID NO:5 and SEQ ID NO:6 | SEQ ID NO：39 |
| PGTS | rs20417 | SEQ ID NO:7 and SEQ ID NO:8 | SEQ ID NO：40 |
| PGTS | rs689470 | SEQ ID NO:9 and SEQ ID NO:10 | SEQ ID NO：41 |
| IL4R | rs1801275 | SEQ ID NO:11 and SEQ ID NO:12 | SEQ ID NO：42 |
| IL10 | rs1800872 | SEQ ID NO:13 and SEQ ID NO:14 | SEQ ID NO：43 |
| IL10RA | rs3135932 | SEQ ID NO:15 and SEQ ID NO:16 | SEQ ID NO：44 |
| IL1A | rs1800587 | SEQ ID NO:17 and SEQ ID NO:18 | SEQ ID NO：45 |
| IL1A | rs17561 | SEQ ID NO:19 and SEQ ID NO:20 | SEQ ID NO：46 |
| IL8 | rs4073 | SEQ ID NO:21 and SEQ ID NO:22 | SEQ ID NO：47 |
| TNFRSF1B | rs1061622 | SEQ ID NO:23 and SEQ ID NO:24 | SEQ ID NO：48 |
| MIF | rs755622 | SEQ ID NO:25 and SEQ ID NO:26 | SEQ ID NO：49 |
| NOS3 | rs1799983 | SEQ ID NO:27 and SEQ ID NO:28 | SEQ ID NO：50 |
| IL4 | rs2070874 | SEQ ID NO:29 and SEQ ID NO:30 | SEQ ID NO：51 |
| NFKB1A | rs8904 | SEQ ID NO:31 and SEQ ID NO:32 | SEQ ID NO：52 |
| IL13 | rs20541 | SEQ ID NO:33 and SEQ ID NO:34 | SEQ ID NO：53 |
| IL13 | rs180925 | SEQ ID NO:35 and SEQ ID NO:36 | SEQ ID NO：54 |
Experimental example 6 uses the resin purification extension products
In extension products, add 41 μ l ultrapure waters, add the 15mg resin again, turned upside down 15 minutes, make the reaction product desalting and purifying.The supernatant of 3200g after centrifugal 5 minutes can directly be gone up the machine reaction.
Experimental example 7 mass spectrometric detection:
Reaction product is transferred on the special chip, placed mass spectrograph to detect chip again.
Mass spectrometric detection the results are shown in accompanying drawing:
Figure 1 shows that to use and extend primer SEQ ID NO:37 detecting the result that sample IL6 gene polymorphism sites rs1800795 detects.The extension primer size that rs1800795 is detected is 5423.6Da, and its base is G; Extending the primer size is 5463.6Da, and its base is C.So this detection sample genotype is G/G.
Figure 2 shows that to use and extend primer SEQ ID NO:38 detecting the result that sample IL16 gene polymorphism sites rs11556218 detects.The extension primer size that rs11556218 is detected is 5769.8Da, and its base is G; Extending the primer size is 5809.7Da, and its base is T.So this detection sample genotype is T/T.
Figure 3 shows that to use and extend primer SEQ ID NO:39 detecting the result that sample PGTS gene polymorphism sites rs5275 detects.The extension primer size that rs5275 is detected is 7058.7Da, and its base is T; Extending the primer size is 7074.7Da, and its base is C.So this detection sample genotype is T/T.
Figure 4 shows that to use and extend primer SEQ ID NO:40 detecting the result that sample PGTS gene polymorphism sites rs20417 detects.The extension primer size that rs20417 is detected is 6474.2Da, and its base is G; Extending the primer size is 6514.3Da, and its base is C.So this detection sample genotype is G/G.
Figure 5 shows that to use and extend primer SEQ ID NO:41 detecting the result that sample PGTS gene polymorphism sites rs689470 detects.The extension primer size that rs689470 is detected is 6850.5Da, and its base is C; Extending the primer size is 6874.5Da, and its base is A.So this detection sample genotype is C/C.
Figure 6 shows that to use and extend primer SEQ ID NO:42 detecting the result that sample IL4R gene polymorphism sites rs1801275 detects.The extension primer size that rs1801275 is detected is 4784.2Da, and its base is A; Extending the primer size is 4800.2Da, and its base is G.So this detection sample genotype is A/A.
Figure 7 shows that to use and extend primer SEQ ID NO:43 detecting the result that sample IL10 gene polymorphism sites rs1800872 detects.The extension primer size that rs1800872 is detected is 6341.1Da, and its base is C; Extending the primer size is 6381.0Da, and its base is A.So this detection sample genotype is A/A.
Figure 8 shows that to use and extend primer SEQ ID NO:44 detecting the result that sample IL10RA gene polymorphism sites rs3135932 detects.The extension primer size that rs3135932 is detected is 5859.9Da, and its base is G; Extending the primer size is 5939.8Da, and its base is A.So this detection sample genotype is A/A.
Figure 9 shows that to use and extend primer SEQ ID NO:45 detecting the result that sample IL1A gene polymorphism sites rs1800587 detects.The extension primer size that rs1800587 is detected is 7274.8Da, and its base is T; Extending the primer size is 7290.8Da, and its base is C.So this detection sample genotype is T/C.
Figure 10 shows that to use and extend primer SEQ ID NO:46 detecting the result that sample IL1A gene polymorphism sites rs17561 detects.The extension primer size that rs17561 is detected is 7423.9Da, and its base is G; Extending the primer size is 7447.9Da, and its base is T.So this detection sample genotype is G/T.
Figure 11 shows that to use and extend primer SEQ ID NO:47 detecting the result that sample IL8 gene polymorphism sites rs1061622 detects.The extension primer size that rs1061622 is detected is 5089.3Da, and its base is G; Extending the primer size is 5113.4Da, and its base is T.So this detection sample genotype is A/T.
Figure 12 shows that to use and extend primer SEQ ID NO:48 detecting the result that sample TNFRSF1B gene polymorphism sites rs4073 detects.The extension primer size that rs4073 is detected is 6699.4Da, and its base is T; Extending the primer size is 6755.3Da, and its base is A.So this detection sample genotype is T/T.
Figure 13 shows that to use and extend primer SEQ ID NO:49 detecting the result that sample mif gene pleomorphism site rs755622 detects.The extension primer size that rs755622 is detected is 5211.4Da, and its base is G; Extending the primer size is 5251.5Da, and its base is C.So this detection sample genotype is G/C.
Figure 14 shows that to use and extend primer SEQ ID NO:50 detecting the result that sample NOS3 gene polymorphism sites rs1799983 detects.The extension primer size that rs1799983 is detected is 4874.2Da, and its base is G; Extending the primer size is 4914.1Da, and its base is T.So this detection sample genotype is G/T.
Figure 15 shows that to use and extend primer SEQ ID NO:51 detecting the result that sample IL4 gene polymorphism sites rs2070874 detects.The extension primer size that rs2070874 is detected is 5874.9Da, and its base is T; Extending the primer size is 5890.9Da, and its base is C.So this detection sample genotype is T/C.
Figure 16 shows that to use and extend primer SEQ ID NO:52 detecting the result that sample NFKB1A gene polymorphism sites rs8904 detects.The extension primer size that rs8904 is detected is 6091.0Da, and its base is C; Extending the primer size is 6170.9Da, and its base is T.So this detection sample genotype is C/C.
Figure 17 shows that to use and extend primer SEQ ID NO:53 detecting the result that sample IL13 gene polymorphism sites rs20541 detects.The extension primer size that rs20541 is detected is 5785.8Da, and its base is T; Extending the primer size is 5801.8Da, and its base is C.So this detection sample genotype is C/C.
Figure 18 shows that to use and extend primer SEQ ID NO:54 detecting the result that sample IL13 gene polymorphism sites rs180925 detects.The extension primer size that rs180925 is detected is 5668.7Da, and its base is C; Extending the primer size is 5708.6Da, and its base is A.So this detection sample genotype is C/C.
(9) result's statistics
Relevant pleomorphism site corresponding genotype of radiation esophagitis such as following table 11:
Table 11
| Not beneficial genotype | (+) arranged or do not have (-) | |
| rs1800795 | G/G | + |
| rs11556218 | G/G | - |
[0133]
| rs5275 | T/C or C/C | - |
| rs20417 | G/C or C/C | - |
| rs689470 | C/T or T/T | - |
| rs1801275 | G/G | - |
| rs1800872 | G/A or A/A | + |
| rs3135932 | G/G | - |
Relevant pleomorphism site corresponding genotype of radiation pneumonia such as following table 12:
Table 12
| Not beneficial genotype | (+) arranged or do not have (-) | |
| rs1800587 | C/T or T/T | + |
| rs17561 | G/T or T/T | + |
| rs4073 | A/A | - |
| rs1061622 | G/G | - |
| rs755622 | G/G | - |
| rs1799983 | G/G | - |
| rs2070874 | C/T or T/T | + |
| rs8904 | T/T | - |
| rs20541 | T/T | - |
| rs180925 | T/T | - |
The risk factor that "+" quantity and radiotherapy inflammation take place is relevant, not beneficial genotype quantity the more, risk is more greatly.Radiation esophagitis is correlated with pleomorphism site "+" quantity greater than more than 4, and radiation pneumonia is correlated with pleomorphism site "+" quantity greater than more than 3, and radiotherapy inflammation risk significantly increases.
Sequence table
＜110〉the limited company of Wuhan Kang Shengda medical test
＜120〉a kind of mass spectrometric detection method of non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism
<160>54
<170>PatentIn version3.5
<210>1
<211>30
<212>DNA
＜213〉artificial sequence
<400>1
acgttggatg agcctcaatg acgacctaag 30
<210>2
<211>30
<212>DNA
＜213〉artificial sequence
<400>2
acgttggatg gattgtgcaa tgtgacgtcc 30
<210>3
<211>30
<212>DNA
＜213〉artificial sequence
<400>3
acgttggatg gctcaggttc acagagtgtt 30
<210>4
<211>30
<212>DNA
＜213〉artificial sequence
<400>4
acgttggatg tggaaagaac ctcattgccc 30
<210>5
<211>31
<212>DNA
＜213〉artificial sequence
<400>5
acgttggatg ccatgatgca ttagaagtaac 31
<210>6
<211>29
<212>DNA
＜213〉artificial sequence
<400>6
acgttggatg aataatgcac tgatacctg 29
<210>7
<211>30
<212>DNA
＜213〉artificial sequence
<400>7
acgttggatg acagggtaac tgcttaggac 30
<210>8
<211>30
<212>DNA
＜213〉artificial sequence
<400>8
acgttggatg actgttctcc gtaccttcac 30
<210>9
<211>30
<212>DNA
＜213〉artificial sequence
<400>9
acgttggatg tgatctgctg acaaaacctg 30
<210>10
<211>30
<212>DNA
＜213〉artificial sequence
<400>10
acgttggatg tacacatttg tctgaggcac 30
<210>11
<211>30
<212>DNA
＜213〉artificial sequence
<400>11
acgttggatg atcctccgcc gaaatgtcct 30
<210>12
<211>30
<212>DNA
＜213〉artificial sequence
<400>12
acgttggatg accctgctcc accgcatgta 30
<210>13
<211>30
<212>DNA
＜213〉artificial sequence
<400>13
acgttggatg aaaggagcct ggaacacatc 30
<210>14
<211>30
<212>DNA
＜213〉artificial sequence
<400>14
acgttggatg tcctcaaagt tcccaagcag 30
<210>15
<211>30
<212>DNA
＜213〉artificial sequence
<400>15
acgttggatg tcatcctcgg gaagattcag 30
<210>16
<211>30
<212>DNA
＜213〉artificial sequence
<400>16
acgttggatg catactctcg gaagtgactg 30
<210>17
<211>30
<212>DNA
＜213〉artificial sequence
<400>17
acgttggatg ggctggccac aggaattata 30
<210>18
<211>30
<212>DNA
＜213〉artificial sequence
<400>18
acgttggatg aggaaggcat ggatttttac 30
<210>19
<211>31
<212>DNA
＜213〉artificial sequence
<400>19
acgttggatg ggttttagaa atcatcaagc c 31
<210>20
<211>30
<212>DNA
＜213〉artificial sequence
<400>20
acgttggatg gaattcgtat ttgatgatcc 30
<210>21
<211>31
<212>DNA
＜213〉artificial sequence
<400>21
acgttggatg gccactctag tactatatct g 31
<210>22
<211>30
<212>DNA
＜213〉artificial sequence
<400>22
acgttggatg ctgaagctcc acaatttggt 30
<210>23
<211>30
<212>DNA
＜213〉artificial sequence
<400>23
acgttggatg tggtggccat ccctgggaat 30
<210>24
<211>29
<212>DNA
＜213〉artificial sequence
<400>24
acgttggatg ggtaagtgta ctgcccctg 29
<210>25
<211>29
<212>DNA
＜213〉artificial sequence
<400>25
acgttggatg tccagcaacc gccgctaag 29
<210>26
<211>30
<212>DNA
＜213〉artificial sequence
<400>26
acgttggatg cgatttctag ccgccaagtg 30
<210>27
<211>30
<212>DNA
＜213〉artificial sequence
<400>27
acgttggatg tgcattcagc acggctggac 30
<210>28
<211>29
<212>DNA
＜213〉artificial sequence
<400>28
acgttggatg ggggcagaag gaagagttc 29
<210>29
<211>30
<212>DNA
＜213〉artificial sequence
<400>29
acgttggatg tgcatcgtta gcttctcctg 30
<210>30
<211>30
<212>DNA
＜213〉artificial sequence
<400>30
acgttggatg gaggtgagac ccattaatag 30
<210>31
<211>30
<212>DNA
＜213〉artificial sequence
<400>31
acgttggatg tgccctatga tgactgtgtg 30
<210>32
<211>29
<212>DNA
＜213〉artificial sequence
<400>32
acgttggatg tgtacaaata tacaagtcc 29
<210>33
<211>30
<212>DNA
＜213〉artificial sequence
<400>33
acgttggatg tgatgctttc gaagtttcag 30
<210>34
<211>30
<212>DNA
＜213〉artificial sequence
<400>34
acgttggatg aggtggccca gtttgtaaag 30
<210>35
<211>30
<212>DNA
＜213〉artificial sequence
<400>35
acgttggatg gtgttcccaa cttttatgtc 30
<210>36
<211>30
<212>DNA
＜213〉artificial sequence
<400>36
acgttggatg ggagagcctt ccacatgaaa 30
<210>37
<211>17
<212>DNA
＜213〉artificial sequence
<400>37
gtgacgtcct ttagcat 17
<210>38
<211>18
<212>DNA
＜213〉artificial sequence
<400>38
tcacagagtg tttccaaa 18
<210>39
<211>22
<212>DNA
＜213〉artificial sequence
<400>39
ttttgtttga tgacagaaaa at 22
<210>40
<211>20
<212>DNA
＜213〉artificial sequence
<400>40
<210>41
<211>21
<212>DNA
＜213〉artificial sequence
<400>41
ggggaatttg ggttgtgtat g 21
<210>42
<211>15
<212>DNA
＜213〉artificial sequence
<400>42
ccaccagtgg ctatc 15
<210>43
<211>20
<212>DNA
＜213〉artificial sequence
<400>43
<210>44
<211>18
<212>DNA
＜213〉artificial sequence
<400>44
ggaagtgact gaagatgc 18
<210>45
<211>23
<212>DNA
＜213〉artificial sequence
<400>45
tttttacata tgagccttca atg 23
<210>46
<211>23
<212>DNA
＜213〉artificial sequence
<400>46
gttgatcagg aagctaaaag gtg 23
<210>47
<211>21
<212>DNA
＜213〉artificial sequence
<400>47
cacaatttgg tgaattatca a 21
<210>48
<211>16
<212>DNA
＜213〉artificial sequence
<400>48
cgtgcagact gcatcc 16
<210>49
<211>16
<212>DNA
＜213〉artificial sequence
<400>49
gccaagtgga gaacag 16
<210>50
<211>15
<212>DNA
＜213〉artificial sequence
<400>50
<210>51
<211>18
<212>DNA
＜213〉artificial sequence
<400>51
gtgcagtgac aatgtgag 18
<210>52
<211>19
<212>DNA
＜213〉artificial sequence
<400>52
cagcgtctga cgttatgag 19
<210>53
<211>18
<212>DNA
＜213〉artificial sequence
<400>53
aactttttcg cgagggac 18
<210>54
<211>17
<212>DNA
＜213〉artificial sequence
<400>54
aggaaggaat gaaggag 。17
Claims (4)
1. polynucleotide primer sets that is used for the mass spectrometric detection of non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism, comprise amplimer to and corresponding extension primer, it is characterized in that, described primer sets is selected from the primer sets of following table group number correspondence, can be the above primer sets of one group of following table or two groups, amplimer to extend primer correspond to respectively choose the pairing amplimer of group number to extend primer:
2. the method for the polynucleotide of the mass spectrometric detection of a non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism, step is as follows:
(1) gathers whole blood sample to be checked, extract genomic dna;
(2) in the DNA that obtains, add the gene of amplimer, carry out amplified reaction carrying out;
(3) use SAP enzyme (alkaline phosphatase) to handle amplified production, remove and remain in deoxynucleotide unnecessary in the reaction system;
(4) add to the product of after treatment amplified reaction and extend primer, carry out extension;
(6) use the resin purification extension products;
(7) extension products is transferred on the special chip;
(8) chip is positioned in the mass spectrograph detects, read and analysis detecting data, the genotype in confirmatory sample radiotherapy toxic side effect related gene polymorphism site, it is characterized in that: described amplimer is to right for the amplimer in claim 1 primer sets, and described extension primer is the extension primer in claim 1 primer sets.
3. the method for the polynucleotide of the mass spectrometric detection of non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism according to claim 2, it is characterized in that: behind the completing steps (1), extract is divided into two groups finishes (2) to (8) step, be used in first group amplified reaction and extension primer sets be claim 1 primer sets be selected from table group number 2 with or group number 8 in primer sets; Second group of primer sets that is used for amplified reaction and derivatization reaction be claim 1 primer sets be selected from table except that group number 2 and group number 8 more than one group or two groups.
4. the method for the polynucleotide of the mass spectrometric detection of non-small cell type lung cancer radiotherapy toxic side effect related gene polymorphism according to claim 2 is characterized in that: the employed raw material of described extension step is the dideoxyribonucleoside triphosphate of modifying through quality (ddNTP).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100276214A CN103224981A (en) | 2013-01-24 | 2013-01-24 | Primer group and method for detecting non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by mass-spectrography method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100276214A CN103224981A (en) | 2013-01-24 | 2013-01-24 | Primer group and method for detecting non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by mass-spectrography method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103224981A true CN103224981A (en) | 2013-07-31 |
Family
ID=48835620
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013100276214A Pending CN103224981A (en) | 2013-01-24 | 2013-01-24 | Primer group and method for detecting non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by mass-spectrography method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103224981A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894269A (en) * | 2015-06-09 | 2015-09-09 | 广东省人民医院 | Lung cancer gene spectrum detection method and kit based on Mass ARRAY platform Iplex analysis and application of kit |
| EP3135771A1 (en) * | 2015-08-27 | 2017-03-01 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | Method for evaluating individual radiosensitivity and the risk of adverse effects |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060281114A1 (en) * | 2005-05-19 | 2006-12-14 | Young Robert P | Methods and compositions for assessment of pulmonary function and disorders |
| US7439019B2 (en) * | 2003-11-03 | 2008-10-21 | Duke University | Methods of identifying individuals at risk of perioperative bleeding, renal dysfunction |
| US20100047775A1 (en) * | 2005-04-22 | 2010-02-25 | Debra A Schwinn | Method of identifying individuals at risk of perioperative myocardial injury, major adverse cardiac events, cognitive decline, arrhythmias, depression or bleeding |
-
2013
- 2013-01-24 CN CN2013100276214A patent/CN103224981A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7439019B2 (en) * | 2003-11-03 | 2008-10-21 | Duke University | Methods of identifying individuals at risk of perioperative bleeding, renal dysfunction |
| US20100047775A1 (en) * | 2005-04-22 | 2010-02-25 | Debra A Schwinn | Method of identifying individuals at risk of perioperative myocardial injury, major adverse cardiac events, cognitive decline, arrhythmias, depression or bleeding |
| US20060281114A1 (en) * | 2005-05-19 | 2006-12-14 | Young Robert P | Methods and compositions for assessment of pulmonary function and disorders |
Non-Patent Citations (4)
| Title |
|---|
| JUSTIN P HART ET AL.: "cytokine profiling for prediction of symptomatic radiation-induced lung injury", 《INTERNATINAL JOURNAL OF RADIATION ONCOLOGY*BIOLOGY*PHYSICS》 * |
| K.SHAHEDI ET AL.: "genetic variation in the COX-2 gene and the association with prostate cancer risk", 《INT. J. CANCER》 * |
| X LI ET AL.: "genetic polymorphisms of HO-1 and COX-1 are associated with aspirin resistance defined by light transmittance aggregation in Chinese Han patients", 《CLIN APPL THROMB HEMOST》 * |
| 张莉: "单核苷酸多态性与肺癌放射治疗后损伤及生存的相关因素研究", 《中国博士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894269A (en) * | 2015-06-09 | 2015-09-09 | 广东省人民医院 | Lung cancer gene spectrum detection method and kit based on Mass ARRAY platform Iplex analysis and application of kit |
| EP3135771A1 (en) * | 2015-08-27 | 2017-03-01 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | Method for evaluating individual radiosensitivity and the risk of adverse effects |
| WO2017032865A1 (en) * | 2015-08-27 | 2017-03-02 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | Method for evaluating individual radiosensitivity and the risk of adverse effects |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nikitaki et al. | Systemic mechanisms and effects of ionizing radiation: A new⿿ old⿿ paradigm of how the bystanders and distant can become the players | |
| CN104946739B (en) | EGFR genetic mutation detection kit and its application | |
| CN102719525B (en) | Primer, probe and detection kit for detection of EML4-ALK fusion gene mutation | |
| CN104818318B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
| Nakka et al. | Biomarker significance of plasma and tumor miR-21, miR-221, and miR-106a in osteosarcoma | |
| CN106148521B (en) | A kind of multipoint mutation single tube rapid detection method and kit | |
| Cilloniz et al. | Functional genomics reveals the induction of inflammatory response and metalloproteinase gene expression during lethal Ebola virus infection | |
| JP2009507918A5 (en) | ||
| CN102140518B (en) | Quantitative detection kit and method for exon mutation of epidermal growth factor receptor (EGFR) relevant to lung cancers | |
| Hovhannisyan et al. | DNA copy number variations as markers of mutagenic impact | |
| Yin et al. | Serum/plasma microRNAs as biomarkers for HBV-related hepatocellular carcinoma in China | |
| CN107513578A (en) | A kind of nucleic acid Mass Spectrometry detection method early sieved for lung cancer driving gene and tumor susceptibility gene | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN108949985A (en) | Circ-WHSC1 is as diagnosis of colorectal carcinoma marker and its application | |
| Deng et al. | A pan‐cancer atlas of cancer hallmark‐associated candidate driver lnc RNA s | |
| Xu et al. | Novel module and hub genes of distinctive breast cancer associated fibroblasts identified by weighted gene co‐expression network analysis | |
| Li et al. | Identification and validation of SNP-containing genes with prognostic value in gastric cancer via integrated bioinformatics analysis | |
| CN105861726A (en) | Braf gene mutation detection kit | |
| CN105256036A (en) | Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| Valadao de Souza et al. | Small RNA profiles of HTLV‑1 asymptomatic carriers with monoclonal and polyclonal rearrangement of the T‑cell antigen receptor γ‑chain using massively parallel sequencing: A pilot study | |
| CN103224981A (en) | Primer group and method for detecting non-small cell lung cancer radiotherapy toxic and side effect-related polymorphic site genotype by mass-spectrography method | |
| CN106498093A (en) | A kind of method that wide spectrum detects carcinogenic pathogenic microorganism | |
| CN105255869B (en) | Application of ABCC4 gene polymorphism site rs3742106 and detection primer and kit thereof | |
| CN108728537A (en) | A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130731 |