CN103451284A

CN103451284A - Group of novel molecular markers of one group of human myocardial cells, and applications of novel molecular markers

Info

Publication number: CN103451284A
Application number: CN2013103702533A
Authority: CN
Inventors: 刘光慧; 顾颖; 胡安·卡洛斯·伊斯毕华·贝尔蒙特; 曲静; 杨济平; 张维琦; 任若通
Original assignee: Institute of Biophysics of CAS
Current assignee: Institute of Biophysics of CAS
Priority date: 2013-08-22
Filing date: 2013-08-22
Publication date: 2013-12-18
Anticipated expiration: 2033-08-22
Also published as: CN103451284B

Abstract

The invention discloses a group of novel molecular markers of human myocardial cells, and applications of the novel molecular markers. The group of markers comprises the following 29 genes: POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC and F2RL2. The markers play an important role in screening and identifying the myocardial cells, and have potential effect and huge significance on the early development research of human hearts, the construction of heart disease models, treatment of heart diseases, and the development of heart disease medicament targets or in research and development of medicaments.

Description

Lineup's class myocardial cell's New molecular marker thing and application thereof

Technical field

The present invention relates to lineup's class myocardial cell's New molecular marker thing and application thereof.

Background technology

Heart trouble is the killer who threatens human health, has every year up to ten million people to lose one's life because suffering from all kinds of heart diseases, has brought great pressure and burden to family and public health service.No matter in developed country or developing country, cardiopathic sickness rate and case fatality rate all remain high, yet in the face of acid test like this, the treatment of heart disease at present but allows of no optimist, pharmacological agent rests on the stage of relief of symptoms, operative treatment is as large and have certain risk and possible side effect as spendings such as bypass surgeries, and interventional therapy, also still in the exploratory stage, rarely has the methods for the treatment of for the treatment of both principal and secondary aspect of disease to come out.Trace it to its cause, very large one side is the deficiencies of the mankind to heart and heart disease understanding.The trace to its source disorder of the disappearance or the function that are the myocardial cell of the cause of disease of heart disease.Thereby a thinking of following radical cure heart disease is the molecular basis of the pathogenesis done some research on heart diseases, find the decisive factor that affects cardiac fibrosis or cardiomyocyte proliferation, realize that disorderly myocardial cell is carried out to artificial adjustment makes it recover the purpose (1) of normal function.

In recent years, along with induction type multipotential stem cell (induced Pluripotency Stem Cells, iPSCs) generation of technology, people can obtain in vitro iPSCs and be divided into the special myocardial cell of patient, by gene, correct or other means obtain the myocardial cell (1) in the patient source of " health "; Utilize the cell type that transdifferentiation (transdifferentiation) technology can be convenient to obtain by other without the iPSCs process directly to obtain myocardial cell (2), the cellular transplantation therapy of realizing in the future in the patient body that develops into of these technology provides possibility.

1.Mordwinkin?NM,Burridge?PW,Wu?JC.2013.A?review?of?human?pluripotent?stem?cell-derived?cardiomyocytes?for?high-throughput?drug?discovery,cardiotoxicity?screening,and?publication?standards.Journal?of?cardiovascular?translational?research6:22-30.

2.Wada?R,Muraoka?N,Inagawa?K,Yamakawa?H,Miyamoto?K,Sadahiro?T,Umei?T,Kaneda?R,Suzuki?T,Kamiya?K,Tohyama?S,Yuasa?S,Kokaji?K,Aeba?R,Yozu?R,Yamagishi?H,Kitamura?T,Fukuda?K,Ieda?M.2013.Induction?of?human?cardiomyocyte-like?cells?from?fibroblasts?by?defined?factors.Proceedings?of?the?National?Academy?of?Sciences110：12667-12672.

Summary of the invention

The purpose of this invention is to provide lineup's class myocardial cell's New molecular marker thing and application thereof.

Provided by the invention one group for the identification of or the marker of assistant identification human myocardium cell, by following 29 kinds of genomic constitution: POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.

Described 29 kinds of genes meet following condition: with human embryos multipotential stem cell and/or human nerve stem cell, compare, in human myocardium's cell the promoter region CpG island methylation level of these 29 kinds of genes all significantly reduce and in human myocardium's cell the mrna expression amount of these 29 kinds of genes be significantly increased.

In above-mentioned marker, the promoter region CpG island methylation level of described these 29 kinds of genes all significantly reduces the methylated amount in promoter region CpG island that refers to every kind of gene in human myocardium's cell and all reduces more than 5% than the methylated amount in the promoter region CpG island of homologous genes in human embryos multipotential stem cell and/or human nerve stem cell.

The mrna expression amount of described these the 29 kinds of genes mrna expression amount that refers to every kind of gene in human myocardium's cell that is significantly increased is all more than 2 times of homologous genes mrna expression amount in human embryos multipotential stem cell and/or human nerve stem cell.

The application of above-mentioned arbitrary described marker in identifier myocardial cell also belongs to protection scope of the present invention.

In above-mentioned application, described non-disease treatment or the diagnostic method of being applied as.

The application of above-mentioned arbitrary described marker in preparation, exploitation or design identifier myocardial cell's product also belongs to protection scope of the present invention.

The application of above-mentioned arbitrary described marker in from Human Cardiomyocytes, people's embryonic pleuripotent stem cell and human nerve stem cell, identifying Human Cardiomyocytes also belongs to protection scope of the present invention.

The application of above-mentioned arbitrary described marker in from Human Cardiomyocytes and people's embryonic pleuripotent stem cell, identifying Human Cardiomyocytes also belongs to protection scope of the present invention.

The application of above-mentioned arbitrary described marker in preparing, develop or designing the product with following function also belongs to protection scope of the present invention: from Human Cardiomyocytes, people's embryonic pleuripotent stem cell and human nerve stem cell, identify Human Cardiomyocytes.

The application of above-mentioned arbitrary described marker in preparing, develop or designing the product with following function also belongs to protection scope of the present invention: from Human Cardiomyocytes and people's embryonic pleuripotent stem cell, identify Human Cardiomyocytes.

In above-mentioned arbitrary described application, described Human Cardiomyocytes is differentiated by described people's embryonic pleuripotent stem cell; Described human nerve stem cell is differentiated by described people's embryonic pleuripotent stem cell.

The material that detects the promoter region CpG island methylation level of 29 kinds of genes also belongs to protection scope of the present invention with the application of material in the test kit of characterization human myocardium cell of the mrna expression amount that detects 29 kinds of genes.

Described 29 kinds of genes are POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.

Detect 29 kinds of genes promoter region CpG island methylation level material and detect the application that the material of the mrna expression amount of 29 kinds of genes has in the test kit of following function in preparation and also belong to protection scope of the present invention: identify Human Cardiomyocytes from Human Cardiomyocytes, people's embryonic pleuripotent stem cell and human nerve stem cell.

Detect 29 kinds of genes promoter region CpG island methylation level material and detect the application that the material of the mrna expression amount of 29 kinds of genes has in the test kit of following function in preparation and also belong to protection scope of the present invention: identify Human Cardiomyocytes from Human Cardiomyocytes and people's embryonic pleuripotent stem cell.

In above-mentioned arbitrary described application, in the described Human Cardiomyocytes differentiated by people's embryonic pleuripotent stem cell and in the described human nerve stem cell differentiated by people's embryonic pleuripotent stem cell, people's embryonic pleuripotent stem cell that described people's embryonic pleuripotent stem cell is same strain.

Due to H9-ESC, H9-NSC and H9-CM have identical genotype and genetic background, by H9-ESC or H9-NSC in contrast, are transcribed group and the complete genome DNA methylation analysis has strict without prejudice.By extensive relatively H9-ESC, the gene expression profile of H9-NSC and H9-CM and complete genome DNA methylome, filter out 29 kinds of New molecular marker things.The New molecular marker thing the present invention relates to has vital role on myocardial cell's screening and identification, and all has potential effect and meaning greatly in the treatment of heart disease model construction, heart disease and the exploitation of heart disease drug target or medicament research and development.

The accompanying drawing explanation

The evaluation that Fig. 1 is mankind myocardial cell.

Fig. 2 is mankind's embryonic pleuripotent stem cell, human nerve stem cell and human myocardium's cellular gene expression thermal map and qPCR checking.

Fig. 3 is full genomic promoter region CpG island methylation level thermal map in mankind's embryonic pleuripotent stem cell, human nerve stem cell and human myocardium's cell.

DNA demethylation and gene expression dose positive correlation that Fig. 4 is the gene of coding myocardial structural albumen and heart transcription factor are analyzed.

Fig. 5 is that double-core is stablized regulated and control network.

Fig. 6 is the functional dependency network analysis.

Fig. 7 is gene-disease network analysis.

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.

The human embryos multipotential stem cell be H9 purchased from U.S. WiCell Research Institute, article No. is WA09 (H9)-DL-7;

Mitomycin is purchased from U.S. Sigma company, and article No. is M0503;

Mouse embryo fibroblasts is purchased from U.S. Millipore company, and article No. is PMEF-CFL;

Extracellular matrix (qualified-Matrigel) is purchased from U.S. BD Biosciences, and article No. is 354277;

The DMEM/F12 substratum is purchased from Invitrogen company, and article No. is 11320-033;

The CDF12 culture medium prescription is as follows:

DMEM/F12 is (purchased from Invitrogen, article No. is 11320-033), 0.1mM non-essential amino acid is (purchased from Invitrogen, article No. is 11140-050), 1mM GlutaMAXTM dipeptides is (purchased from Invitrogen, article No. is 35050-061), the 20%Knockout serum substitute is (purchased from Invitrogen, article No. is N10828-028), 1% penicillin/streptomycin is (purchased from Invitrogen, article No. is 15070-063), 55 μ M beta-mercaptoethanols are (purchased from Invitrogen, article No. is 21985-023) and 10ng/ml Human FGF2 (purchased from Joint Protein Central),

The RPMI1640 substratum is purchased from Invitrogen company, and article No. is 11875119;

The B27 additive is purchased from Invitrogen company, and article No. is 0080085SA;

B27(is not containing Insulin) additive is purchased from Invitrogen company, and article No. is 0050129SA;

The mTeSR substratum is purchased from U.S. StemCell Technologies;

ROCK inhibitor Y-27632 is purchased from Sigma-Aldrich, and article No. is Y0503;

CHIR99021 is purchased from Selleck;

Wnt inhibitor IWP4 is purchased from Stemgent;

Triton X-100 is purchased from Sigma, article No. T-8787;

Mouse-anti cTnT is purchased from Lab Vision;

Mouse-anti MF20 is purchased from Developmental Studies Hybridoma Bank;

The anti-MLC2v of rabbit is purchased from ProteinTech Group;

Mouse-anti α-Actinin is purchased from Sigma-Aldrich;

Two anti-Alex Fluor488goat anti-mouse IgG are purchased from Life Technologies;

Two anti-Alex Fluor568goat anti-rabbit IgG are purchased from Life Technologies;

The human embryos multipotential stem cell is that the neural stem cell (hNSCs) in H9 source and differentiation scheme are at document " Liu GH, Qu J, Suzuki K, Nivet E, Li M, Montserrat N, Yi F, Xu X, Ruiz S, Zhang W, Wagner U, Kim A, Ren B, Li Y, Goebl A, Kim J, Soligalla RD, Dubova I, Thompson J, Yates J, 3rd, Esteban CR, Sancho-Martinez I, Izpisua Belmonte JC.2012.Progressive degeneration of human neural stem cells caused by pathogenic LRRK2.Nature491:603-607. " in disclosed, the public can obtain from Institute of Biophysics, Academia Sinica the neural stem cell (hNSCs) in human embryos multipotential stem cell source,

RNeasy Mini Kit is purchased from QIAGEN;

AffymetrixGeneChipPrimeView Human Gene Expression Arrays is purchased from Affymetrix, and article No. is 901837.

The cultivation of embodiment 1, human embryos multipotential stem cell

By the human embryos multipotential stem cell, be that H9 utilizes following method to be cultivated:

One, the H9 cell is seeded in the culture plate of the mouse embryo fibroblasts of having cultivated in advance the deactivation of process mitomycin, uses human pluripotent stem cell substratum (CDF12 substratum) and mouse embryo fibroblasts co-cultivation.

Two, with the DMEM/F12 substratum, extracellular matrix is diluted to the concentration that volume fraction is 1%, and is coated with culture plate with the extracellular matrix after dilution.

Three, the H9 cell of step 1 being cultivated is seeded in the coated culture plate of the extracellular matrix that is 1% by volume fraction in advance, uses the mTeSR culture medium culturing.

Embodiment 2, human embryos multipotential stem cell are to human myocardium's cytodifferentiation

The human embryos multipotential stem cell be H9 to human myocardium's cytodifferentiation scheme based on Palecek scheme (Lian X, Hsiao C, Wilson G, Zhu K, Hazeltine LB, Azarin SM, Raval KK, Zhang J, Kamp TJ, Palecek SP.2012.Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling.Proceedings of the National Academy of Sciences of the United States of America109:E1848-1857.) improved, scheme after improvement has further improved the purity of human myocardium's cell, the concrete steps of this scheme are as follows:

One, with the DMEM/F12 substratum, extracellular matrix is diluted to the concentration that volume fraction is 1%, with the coated culture plate of the extracellular matrix after dilution.

Two, by the human embryos multipotential stem cell, be that H9 digestion is for single cell suspension, with 10 ⁵individual cell/cm ²the coated culture plate of the density extracellular matrix that to be inoculated into through volume fraction be 1% in, add the mTeSR substratum that contains 10 μ M ROCK inhibitor Y-27632.Cultivate 24 hours under 37 ℃, 5% carbon dioxide conditions, then use the mTeSR substratum instead and continue to cultivate 48 hours.

Three, initial myocardial cell's differentiation.

(1) used the RPMI/B27-insulin culture medium culturing 24 hours that contains 12 μ M CHIR99021 instead at the 1st day, be replaced by the RPMI/B27-insulin substratum after 24 hours and continue to cultivate.

Within (two) the 3rd days, use the RPMI/B27-insulin culture medium culturing 48h that contains 5 μ M Wnt inhibitor IWP4 instead, during do not change liquid.

(3) changing the RPMI/B27 substratum every 2-3 days from the 5th day continues to cultivate.

(4) the 15th days, but human myocardium's cell sheet of macroscopic spontaneous contractions or agglomerate are collected by machine sorting or artificial picking.

(5) the cell renewed vaccination of collection, in the culture plate coated to the extracellular matrix that is 1% through volume fraction, is cultivated with the RPMI/B27 substratum.

The evaluation of embodiment 3, human myocardium's cell

Human myocardium's cell in human embryos multipotential stem cell source not only shows the distinctive contractile function of myocardial cell on form, and can further by immunofluorescence and flow cytometry, to the specific biological marker of myocardial cell, be identified.

One, identified by immunofluorescence

(1) human myocardium's cell embodiment 2 obtained is divided into four groups, and each group is fixed through 4% paraformaldehyde respectively, and 0.3%Triton X-100/PBS is penetrating.Then four groups respectively with 4 ℃ of overnight incubation of four kinds of primary antibodies (mouse-anti cTnT, mouse-anti MF20, the anti-MLC2v of rabbit, mouse-anti α-Actinin).After being cleaned, primary antibodie carries out two anti-hatching 1 hour in room temperature, wherein two of first group of use resist the IgG for Alex Fluor488goat anti-mouse, two of second group of use resists the IgG for Alex Fluor488goat anti-mouse, and the 3rd group is used two anti-Alex Fluor488goat anti-mouse IgG and two anti-Alex Fluor568goat anti-rabbit IgG to be hatched simultaneously.

(2) nucleus carries out negative staining with DAPI.Laser confocal microscope gathers image and is analyzed.

CTnT is serum cardiac troponin T (cardiac troponin T);

MF20 is myoglobulin heavy chain;

MLC2v is myosin light chain 2v (myosin light chain2V);

α-Actinin is Actin muscle.

Result as shown in Figure 1A.

In Figure 1A, 1(a-c) mean the coloration result of cTnT under different enlargement ratios, 2(a-c) mean the coloration result of MF20 under different enlargement ratios, 3a means the coloration result of α-Actinin, 3b means the coloration result of MCL2v, and 3c is 3a and the overlapping result of 3b.

Result shows, human myocardium's cell in human embryos multipotential stem cell source can be expressed cardiac muscle special marker serum cardiac troponin T (cardiac troponin T) and myosin, by the immunofluorescence dyeing to myosin and Actin muscle, can be observed the cardiac muscle fibre structure.

Two, flow cytometry is identified

Result as shown in Figure 1B.

Figure 1B shows, in human myocardium's cell mass that differentiation obtains, about 96% is the cTnT positive cell, and about 91% is the cell of the MF20 positive.

Embodiment 4, transcribe group analysis

One, three groups of samples are set: human embryos multipotential stem cell (hESCs) H9(is designated hereinafter simply as H9-ESC), the human embryos multipotential stem cell is that the neural stem cell (hNSCs) (being designated hereinafter simply as H9-NSC) in H9 source and human embryos multipotential stem cell that embodiment 3 identifies are human myocardium's cell (hCMs) (being designated hereinafter simply as H9-CM) in H9 source, every group of cell sample establish altogether three parallel.

Two, use the Trizol method to extract the total RNA that respectively organizes each sample of cell, and use RNeasy Mini Kit to be further purified.

Three, the sample of three groups of cells is processed with " AffymetrixGeneChipPrimeView Human Gene Expression Arrays " gene chip.

Four, differential expression relatively

Analyze and respectively organize the expression of different genes in H9-ESC, H9-NSC and H9-CM in cell.Expression signal by AffymetrixGeneChip Scanner30007G cdna collection chip.Utilize R/Bioconductor to process expression signal, according to being converted to corresponding genetic expression value after the normalization method of RMA algorithm, and draw the expression thermal map (heatmap) of H9-ESC, H9-NSC and each 3 duplicate samples of tri-kinds of cells of H9-CM, result as shown in Figure 2 A.

In Fig. 2 A,

HESC#1, hESC#2 and hESC#3 are respectively three parallel sample of H9-ESC;

HNSC#1, hNSC#2 and hNSC#3 are respectively three parallel sample of H9-NSC;

HCM#1, hCM#2 and hCM#3 are respectively three parallel sample of H9-CM;

1/4x means that the expression level of gene is lowered to 4 times;

1/2x means that the expression level of gene is lowered to 2 times;

1x means that the expression level of gene is without noticeable change;

2x means to be transferred to 2 times on the expression level of gene;

4x means to be transferred to 4 times on the expression level of gene.

In figure, be to using human embryo stem cell H9-ESC as being in harmonious proportion the standard of lowering on gene.

By analysis, with gene, at H9-ESC, with the expression amount in H9-NSC, compare, have the expression amount of 695 genes in H9-CM is more than 2 times of expression amount in H9-ESC and H9-NSC simultaneously, has half of expression amount in the equal not enough H9-ESC of the expression amount of 401 genes in H9-CM and H9-NSC.

Five, the expression of results of real-time fluorescence quantitative PCR checking key gene, the primer that table 1 is each key gene.Wherein partial results is as shown in Fig. 2 B, and the result that the result obtains with chip analysis is consistent.

Table 1 checking primer

Gene	Forward primer sequence (5 '-3 ')	Reverse primer sequence (5 '-3 ')
			ACTA2	GTGTTGCCCCTGAAGAGCAT	GCTGGGACATTGAAAGTCTCA
CASQ2	GGCAGAAGAGGGGCTTAATTT	GAAGACACCGGCTCATGGTAG
			CREM	ACACCACCTAGTATTGCTACCA	GGATTGTTCCACCTTGGGCTAT
CSRP3	CCTGTGAAAAGACCGTCTACC	GTCGTGCTGTCAAGAGCCT
			DTNA	TACCCACGGAAGTTTTGGAGG	GGATCTGACATAAGCGTGTCC
EYA4	CTTCTTGCAGTCAAAACAGAGC	GTGGATAGGGCTTGGAAGGAT
			FBXO32	GCCTTTGTGCCTACAACTGAA	CTGCCCTTTGTCTGACAGAAT
GATA4	CGACACCCCAATCTCGATATG	GTTGCACAGATAGTGACCCGT
			GATA5	CTTCGTGTCCGACTTCTTGGA	CCGAGGCATTCCTTGTGGA
GATA6	CTCAGTTCCTACGCTTCGCAT	GTCGAGGTCAGTGAACAGCA
			HAND2	CGCCGACACCAAACTCTCC	TCGCCATTCTGGTCGTCCT
HECW2	AAATCCCCAGATGCGGTACAC	CGGCTCTCAGAAGTCACCA
			ISL1	GCGGAGTGTAATCAGTATTTGGA	GCATTTGATCCCGTACAACCT
KCNA5	CGCGTCCACATCAACATCTC	GGTAGAAGCGTATCTCGTCCG
			LBH	GCCCCGACTATCTGAGATCG	GCGGTCAAAATCTGACGGGT
LDB3	CTATCTCCCGGATCACACCAG	GTGAGGCTCAAGTTGTAGCTG
			leftY2	TGGACCTCAGGGACTATGGAG	CCGAGGCGATACACTGTCG
MARCH11	CCGGGGAGAGTCTTCCACA	GCCTCATCCGATTGAACAGGT
			MEF2A	ACTACAGACCTCACAGTGCCA	GCCTAAGCTATTTGCACCAGT
MEF2C	CCAACTTCGAGATGCCAGTCT	GTCGATGTGTTACACCAGGAG

MIR21	CTGCCTGACTGTCTGCTTGTTT	AGATTCAACAGTCAACATCAGTCTGA
			MITF	CAGTCCGAATCGGGGATCG	TGCTCTTCAGCGGTTGACTTT
MYBPC3	CCATGACGCTGAGGTCAAATG	GCTTGGCACCGATGGACTC
			MYOCD	ACGGATGCTTTTGCCTTTGAA	AACCTGTCGAAGGGGTATCTG
MYOZ2	CCAGGCTATTTAAGATGCGTCA	CCTTCCAAGTTACTTCCATCCAC
			NEXN	ACTGTGAAGGGTAGATTTGCTG	TTCTGCGTTTTCGTTCCTCCT
NKX2	CCAAGGACCCTAGAGCCGAA	ATAGGCGGGGTAGGCGTTAT
			NPPA	CAACGCAGACCTGATGGATTT	AGCCCCCGCTTCTTCATTC
NPPB	TGGAAACGTCCGGGTTACAG	CTGATCCGGTCCATCTTCCT
			PCGF5	AGCCAACAACAGTGACGGAAT	TGAACTTGGTTGCCACACCTT
PLN	ACCTCACTCGCTCAGCTATAA	CATCACGATGATACAGATCAGCA
			PPAPDC3	AGCTGAACCCCTCCTTCAAG	CCGATGACAAAGCCGGAGA
PPARGC1A	TCTGAGTCTGTATGGAGTGACAT	CCAAGTCGTTCACATCTAGTTCA
			PRICKLE1	TTTGCTTGCTTACCAGAGGAAA	ACTGGCAATACCGTACCTCAT
RARB	TCCGAAAAGCTCACCAGGAAA	GGCCAGTTCACTGAATTTGTCC
			SMAD6	GCTACCAACTCCCTCATCACT	CGTACACCGCATAGAGGCG
SMAD7	TTCCTCCGCTGAAACAGGG	CCTCCCAGTATGCCACCAC
			SNTA1	TGCTCCTCTACTTGTCTCTCC	TCTGCATCGTAGGGCACTGA
STAT4	TGTTGGCCCAATGGATTGAAA	GGAAACACGACCTAACTGTTCAT
			TBX2	GCTGACGATTGCCGCTATAAG	GGCTGTCTGGGTGGATGTA
TCEA3	AAGAGCACGGACATGAAGTACC	CTCTGCCGTCATCTTGGCTA
			TNNT2	GGAGGAGTCCAAACCAAAGCC	TCAAAGTCCACTCTCTCTCCATC
TRIM63	CTTCCAGGCTGCAAATCCCTA	ACACTCCGTGACGATCCATGA

TTN	CCCCATCGCCCATAAGACAC	CCACGTAGCCCTCTTGCTTC
			XPO4	ATTTCAGCGTTACCTTGCACT	CAGCACATTTTGCGAGGATTC
ZFPM2	GGCCTGAAAATCTGAGCTGC	CAGTCGTCTGTCTCAACTCCA

Embodiment 5, DNA methylation analysis

One, three groups of sample: H9-ESC are set, H9-NSC and H9-CM, every group of cell sample establish altogether three parallel.

Two, extract the DNA that respectively organizes each sample cell, DNA methylation sequencing technologies and methylation level method of calculation (the Diep D of utilization based on bisulfite padlock-probe (bisulfite padlock probes), Plongthongkum N, Gore A, Fung HL, Shoemaker R, Zhang is methylation sequencing with bisulfite padlock probes.Nature methods9:270-272. K.2012.Library-free) analysis H9-ESC, the complete genome DNA methylation level of H9-NSC and H9-CM, the portion gene detected result as shown in Figure 3.

In Fig. 3,

HESC is H9-ESC;

HNSC is H9-NSC;

HCM is H9-CM;

-10% means the promoter region CpG island methylation level downward 10% of gene;

-5% means the promoter region CpG island methylation level downward 5% of gene;

0 means that the promoter region CpG island of gene methylates without noticeable change;

5% means that the promoter region CpG island methylation level of gene raises 5%;

10% means that the promoter region CpG island methylation level of gene raises 10%.

In figure, be to using the standard that human embryo stem cell H9-ESC lowers as the upper mediation of methylating.

Fig. 3 shows, with H9-ESC, with H9-NSC, compares, and H9-CM has the highest complete genome DNA methylation level.

By analysis, with gene promoter area CpG island, at H9-ESC, with the methylation level in H9-NSC, compare, have 985 methylation level of gene promoter area CpG island in H9-CM has the raising more than 5% than the methylation level of this gene promoter area CpG island in H9-ESC and H9-NSC simultaneously, and have 195 methylation level of gene promoter area CpG island in H9-CM has the reduction more than 5% than the methylation level of this gene promoter area CpG island in H9-ESC and H9-NSC simultaneously.

The group analysis of transcribing of DNA methylation analysis and embodiment 4 is combined and obtains the methylation level of gene and the result of expression level.As shown in Figure 4, Fig. 4 shows the result of portion gene, and cardiac structure becomes positive correlation with the DNA demethylation of heart transcription factor genes involved with gene expression dose.

The group analysis of transcribing of DNA methylation analysis and embodiment 4 is combined and draws: with H9-ESC, with H9-NSC, compare, in H9-CM, the expression level that identifies gene brings up to more than 2 times and promoter region CpG island methylation level reduces by 29 kinds of genes more than 5%.These genes can be used as the molecular marked compound of human myocardium's cell, as shown in table 2.

DNA methylation level and the expression level of 29 kinds of genes of table 2

Embodiment 6, analysis of biological information

The most significant 50 genes of differential expression are carried out to gene-disease network analysis, find that there is 27 kinds of genes at least relevant with known a kind of cardiovascular disorder.Comprising 6 kinds in above-mentioned 29 kinds of human myocardium's cellular elements markers that identify, they are respectively NPPA, MYL4, MYOZ2, ANKRD1, TNNI1, MYH6.

The analysis of biological information of embodiment 7, the remarkable gene of differential expression

To expression level in embodiment 4, exist the gene of significant difference to carry out further analysis of biological information, analyze and comprise gene cluster analysis (Gene Ontology, GO), functional dependency network analysis and gene-disease network analysis etc.

One, gene cluster analysis

Use the BiNGO plug-in unit of Cytoscape software to carry out cluster analysis, analytical results shows that the gene majority significantly raised has been included in the GO classification that heart function is relevant, and this classification comprises myocardial contraction, heart development, muscle segment structure etc.On the contrary, the gene majority of significantly lowering is included into m period, and the classifications such as nucleus division and mitotic division, pointed out the mitotic division of cell in myocardial cell to be subject to strong inhibition.In addition, the significance by modulated gene in analyzing gene regulated and control network upstream and downstream can identify hESCs to the minimum decisive assortment of genes of hCMs differentiation, has determined the stable regulated and control network of a double-core by computation model, as shown in Figure 5.These two cores are relevant with myocardial cell's characteristic to multipotency respectively.The people for a change gene expression dose in double-core can cause the chain reaction of regulation and control, makes hESCs break up to hCMs.May realize equally the transdifferentiation of other cell types to hCMs to the autotelic regulation and control of portion gene in double-core.

Two, functional dependency network analysis

For disclosing the functional dependency of 695 hCMs specific genes that embodiment 4 finds, utilize the GeneMANIA plug-in unit of Cytoscape software to produce the network based on dependency, comprise coexpression, location, interact etc. altogether.In addition, will in above-mentioned GO cluster analysis, be included into myocardial contraction, heart development, the gene group of the classifications such as myocardium transcriptional control produces respectively secondary network, as shown in Figure 6.

Fig. 6 A is myocardial contraction genes involved network.

Fig. 6 B is myocardium transcriptional control network.

Fig. 6 C is heart development genes involved network.

The prediction that network shown in Fig. 6 is the new function of expression of cardiac gene, new dependency etc. provides support.

Three, gene-disease network analysis

To the most significant 50 genes of differential expression in the hCMs specific gene, utilize the DisGeNET plug-in unit of Cytoscape software to carry out gene-disease network analysis.Wherein, 27 genes are at least relevant with known a kind of cardiovascular disorder.In addition, 5 kinds of genes (NPPB, TNNT2, NPPA, RYR2 and PLN) are arranged and be related over 10 kinds of different types of cardiovascular disordeies.The transgenation that surpasses 140 kinds of disease-relateds is proved to be relevant with the most significant hCMs specific gene of these differential expressions, and partial results as shown in Figure 7.The analytical results of gene-disease network has further been emphasized the vital role that these hCMs specific genes are grown maintaining normal heart, for disclosing heart trouble mechanism and even treating heart trouble, provides reference and foundation.

29 genes that embodiment 5 obtains are included into Muscle contraction in cluster analysis, and myoarchitecture forms, and the classifications such as muscle segment structure, be the relevant gene of cardiac structure.Visible, the gene relevant to cardiac structure regulated and controled by DNA methylation mainly.And all the other demethylation genes that generation significantly changes on expression level may be accepted regulation and control on other level.In addition, most genes relevant to cardiac structure show the hyper-methylation on CpG island in hESCs and hNSCs, have pointed out in non-myocardial cell's cell lineage, and the promoter region DNA methylation of these genes is topmost Inhibitory signals.

In addition, exist the special transcription factor of some myocardial cells (as NKX2.5, GATA6, GATA4, MYOCD, HAND2, TBX5, TBX18 etc.) at hESCs, all show similar hypomethylation level in hNSCs and hCMs, but in hCMs expression level far above hESCs and hNSCs.Previous research has also found that these transcription factors to the histone modification H3K27me3 level of inhibition in the atomization of hCMs, reduction have occurred at hESCs.Pointed out these genes, histone modification is only topmost epigenetic regulation factor.

Claims

One group for the identification of or the marker of assistant identification human myocardium cell, by following 29 kinds of genomic constitution: POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2;

Described 29 kinds of genes meet following condition: with human embryos multipotential stem cell and/or human nerve stem cell, compare, in human myocardium's cell the promoter region CpG island methylation level of these 29 kinds of genes all significantly reduce and in human myocardium's cell the mrna expression amount of these 29 kinds of genes be significantly increased.
2. marker according to claim 1 is characterized in that: the promoter region CpG island methylation level of described these 29 kinds of genes all significantly reduces the methylated amount in promoter region CpG island that refers to every kind of gene in human myocardium's cell and all reduces more than 5% than the methylated amount in the promoter region CpG island of homologous genes in human embryos multipotential stem cell and/or human nerve stem cell;

The mrna expression amount of described these the 29 kinds of genes mrna expression amount that refers to every kind of gene in human myocardium's cell that is significantly increased is all more than 2 times of homologous genes mrna expression amount in human embryos multipotential stem cell and/or human nerve stem cell.
3. the application of the described marker of claim 1 or 2 in identifier myocardial cell, described non-disease treatment or the diagnostic method of being applied as;

Or, the application of the described marker of claim 1 or 2 in preparation, exploitation or design identifier myocardial cell's product.
4. the application of the described marker of claim 1 or 2 in from Human Cardiomyocytes, people's embryonic pleuripotent stem cell and human nerve stem cell, identifying Human Cardiomyocytes;

Or, the application of the described marker of claim 1 or 2 in from Human Cardiomyocytes and people's embryonic pleuripotent stem cell, identifying Human Cardiomyocytes.
5. the application of the described marker of claim 1 or 2 in preparing, develop or designing the product with following function: from Human Cardiomyocytes, people's embryonic pleuripotent stem cell and human nerve stem cell, identify Human Cardiomyocytes;

Or, the application of the described marker of claim 1 or 2 in preparing, develop or designing the product with following function: from Human Cardiomyocytes and people's embryonic pleuripotent stem cell, identify Human Cardiomyocytes.
6. according to the arbitrary described application of claim 3-5, it is characterized in that: described Human Cardiomyocytes is differentiated by described people's embryonic pleuripotent stem cell; Described human nerve stem cell is differentiated by described people's embryonic pleuripotent stem cell.
7. detect 29 kinds of genes promoter region CpG island methylation level material and detect the application of material in the test kit of characterization human myocardium cell of the mrna expression amount of 29 kinds of genes;

Described 29 kinds of genes are POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.
8. detect the material of promoter region CpG island methylation level of 29 kinds of genes and the material that detects the mrna expression amount of 29 kinds of genes and there is the application in the test kit of following function in preparation: from Human Cardiomyocytes, people's embryonic pleuripotent stem cell and human nerve stem cell, identify Human Cardiomyocytes;

Described 29 kinds of genes are POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.
9. detect the material of promoter region CpG island methylation level of 29 kinds of genes and the material that detects the mrna expression amount of 29 kinds of genes and there is the application in the test kit of following function in preparation: from Human Cardiomyocytes and people's embryonic pleuripotent stem cell, identify Human Cardiomyocytes;

Described 29 kinds of genes are POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.
10. according to the arbitrary described application of claim 7-9, it is characterized in that: described Human Cardiomyocytes is differentiated by described people's embryonic pleuripotent stem cell; Described human nerve stem cell is differentiated by described people's embryonic pleuripotent stem cell.