(3) summary of the invention
The object of the invention is to provide a strain and can be used for the novel bacterial that microorganism catalysis asymmetric reduction 5-(4-fluorobenzene)-5-ketovaleric acid is prepared high-optical-purity (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid--Candida parapsilosis (Candida parapsilosis) ZJPH1305, and the application of this bacterial classification in catalytic asymmetric reduction preparation (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid.
The technical solution used in the present invention is:
The invention provides the new bacterial strain of a strain--Candida parapsilosis (Candida parapsilosis) ZJPH1305, this bacterial strain is preserved in Chinese Typical Representative culture collection center, preservation date is on November 8th, 2013, address: China, Wuhan, Wuhan University, deposit number: CCTCCNO:M2013559.
New bacterial strain of the present invention screens and obtains as follows:
(1) bacterial strain screening
1) enrichment culture: will be inoculated into enrichment medium from the soil sample of the ground collections such as Zhejiang Lanxi, Yiwu, Wenzhou, Anqing, Hubei Xiaogan, Datong, put 30 DEG C, the shaking table of 200rpm is cultivated 5 days, after nutrient solution becomes muddiness, getting 1mL nutrient solution is forwarded in fresh enrichment medium, continue to cultivate 5 days, so repeat 3 circulations.Enrichment culture based formulas is as follows: 5-(4-fluorobenzene)-5-ketovaleric acid 50mmol/L, (NH
4)
2sO
42g/L, KH
2pO
42g/L, NaCl1g/L, MgSO
4.7H
2o0.5g/L, solvent is water, pH6.5.
2) dull and stereotyped cultivation: spread plate substratum after last enrichment culture liquid is diluted to 1000 times, cultivate 5 days for 30 DEG C.Plate culture medium final concentration consists of the agar that adds 15-20g/L in enrichment medium.
3) Candida parapsilosis (Candida parapsilosis) ZJPH1305 bacterial strain screening
Bacterial classification source: Candida parapsilosis (Candida parapsilosis) ZJPH1305 bacterial strain is that the soil sample from picking up from Zhejiang Lanxi, separation screening obtains.Concrete screening method is as follows: will join from the soil sample of Zhejiang Lanxi collection the 250ml shaking flask that 50ml enrichment medium is housed, 30 DEG C, 200rpm, cultivate 4~5 days, after nutrient solution becomes muddiness, get 1ml nutrient solution and be forwarded in fresh enrichment medium, continue to cultivate 4~5 days, so repeat enrichment culture 3~4 times.In enrichment medium, taking 5-(4-fluorobenzene)-5-ketovaleric acid as sole carbon source, described enrichment medium final concentration consists of: 5-(4-fluorobenzene)-5-ketovaleric acid 50mmol/L, (NH
4)
2sO
42g/L, KH
2pO
42g/L, NaCl1g/L, MgSO
4.7H
2o0.5g/L, solvent is water, pH6.5.
Spread plate substratum after last enrichment culture liquid is diluted to 1000 times, cultivates 5 days for 30 DEG C, after separating for several times is cultivated, obtains single bacterium colony bacterial strain.Plate culture medium final concentration consists of the agar that adds 15-20g/L in enrichment medium.Picking list bacterium colony inoculation to seed culture medium, is cultivated 20 hours for 30 DEG C, then is forwarded in culture medium 30 DEG C and cultivates 44 hours, and 9000rpm,, obtains wet thallus for centrifugal 10 minutes by 4 DEG C.Taking 5-(4-fluorobenzene)-5-ketovaleric acid as substrate, the wet thallus of centrifugal acquisition is catalyzer, in phosphoric acid buffer, 30 DEG C of conversions are after 24 hours, adopt liquid phase chromatography to detect the enantiomeric excess value (e.e. value) of object product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid in conversion fluid, therefrom screening obtain the having highly-solid selectively new bacterial strain of microorganism of (e.e. value > 99%), is designated as bacterial strain ZJPH1305.
(2) physiological and biochemical property of bacterial strain ZJPH1305
Colonial morphology: 30 DEG C of dull and stereotyped 48h that cultivate, bacterium colony is rounded, and surface wettability is smooth, slightly protuberance.Bacterium colony is white in color, opaque, glossy.
Cellular form: cell ovalize, can arrange or be gathered into single, in pairs clump.
Physio-biochemical characteristics: the bacterium colony cream color that is white in color while adopting wort agar slant culture, matt or gloss slightly, soft and smoothly or part have wrinkle.Cultivate 3~5 days bacterium colonies gradually hard and be mycelioid.That cell is is avette 4~8 microns × and 5~11 microns, or spherical 3 microns~6 microns.The sugar-fermenting glucose positive, the D-semi-lactosi positive, the maltose positive, the sucrose positive, the trehalose positive, melibiose feminine gender, lactose feminine gender, cellobiose feminine gender, the melizitose positive, raffinose feminine gender, synanthrin feminine gender, starch feminine gender, D-wood sugar feminine gender; The carbon assimilation glucose positive, the semi-lactosi positive, the D-glucitol positive, the D-ribose positive, the D-wood sugar positive, the L-arabinose positive, L-rhamnosyl feminine gender, the sucrose positive, the maltose positive, the trehalose positive, melibiose feminine gender, lactose feminine gender, raffinose feminine gender, the melizitose positive, synanthrin feminine gender, starch feminine gender, the glycerine positive.Nitrogenous source utilizes saltpetre feminine gender, and the formation feminine gender of kind of starch compound reduces fat and produces acid experiment feminine gender, urea feminine gender, the anti-cycloheximide positive.
(3) the 26s rDNA D1/D2 region sequence characteristic of bacterial strain ZJPH1305
With the total DNA of the quick extraction agent box extraction cell of fungal genomic DNA, and taking it as template, by primer NL1(GCATATCAATAAGCGGAGGAAAAG) and the NL4(GGTCCGTGTTTCAAGACGG) gene in 26s rDNA D1/D2 district of amplification bacterial strain, again PCR product is carried out to 1% agarose gel electrophoresis, acquired results as shown in Figure 4, wherein swimming lane A and B are the 26s rDNA amplified production of bacterial strain ZJPH1305, and both all occur single band at 600bp place.
PCR reaction system:
Reagent |
(μ l) for volume |
Template(genomic dna 20-50ng/ μ l) |
0.5 |
5×Buffer(with?Mg2+) |
2.5 |
The each 2.5mM of dNTP() |
1 |
F(10uM) |
0.5 |
R(10uM) |
0,5 |
Add two H of steaming
2O extremely
|
25 |
? |
? |
PCR cycling condition:
Through Shanghai, 26 of described bacterial strain ZJPH1305 is confirmed in raw work order-checking
srDNA D1/D2 region sequence is as shown in SEQ ID NO:1:
AAAGAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGT
It is No.KF811029 that nucleotide sequence shown in SEQ ID NO:1 has been submitted GenBank(GenBank accession number to), the 26s rDNA D1/D2 region sequence of bacterial strain ZJPH1305 is carried out to homology contrast (BLAST) on NCBI website (http://www.ncbi.nlm.nih.gov), and result shows: the part bacterial strain sequence homology of bacterial strain ZJPH1305 and mycocandida (Candida sp.) is higher.The sequence homology of ZJPH1305 bacterial strain and Candida parapsilosis clone MROJIY04 bacterial strain (GenBank accession number is No.JX441605.1) reaches 100%.
According to physio-biochemical characteristics binding molecule biological assay, this bacterial strain is accredited as Candida parapsilosis, called after Candida parapsilosis (Candida parapsilosis) ZJPH1305.
Adopt Box-Behnken rotation center combination experiment design method to glucose concn, yeast extract paste concentration and KH
2pO
4three factors of concentration affect significant factor to product enzyme and are optimized, the Optimal Medium that obtains Candida parapsilosis (Candida parapsilosis) ZJPH1305 bacterial strain consists of: maltose 20~50g/L, yeast extract paste 20~50g/L, (NH
4)
2sO
41.0~2.5g/L, KH
2pO
41.0~2.5g/L, MgSO
47H
2o0.3~0.6g/L, NaCl0.5~1.5g/L, solvent is water, pH6.0~7.5.
The culture condition of Candida parapsilosis (Candida parapsilosis) ZJPH1305 bacterial strain is: initial pH6.0~7.5, shaking flask liquid amount 80~120mL/250mL Erlenmeyer flask, 30 DEG C of culture temperature, shaking speed 180~220rpm, inoculum size 4~10%(volumetric concentration), incubation time 36~48h.
The invention still further relates to described Candida parapsilosis (Candida parapsilosis) ZJPH1305 and prepare the application in Zetia intermediate (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid at microorganism catalysis asymmetric reduction, described being applied as: taking 5-(4-fluorobenzene)-5-ketovaleric acid as substrate, the wet thallus obtaining through fermentation culture taking Candida parapsilosis (Candida parapsilosis) ZJPH1305 is as enzyme source, at 25 DEG C~35 DEG C, damping fluid (the preferably phosphoric acid salt buffer that is 6.0~8.5 in pH, more preferably the phosphate buffered saline buffer that pH is 6.0) form reaction system (described reaction system is by substrate, enzyme source and damping fluid form) in carry out conversion reaction, after reaction finishes, reaction solution is centrifugal, get supernatant liquor, add isopyknic ethyl acetate extracting twice, merge organic phase, obtain the ethyl acetate solution containing (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid, wash with saturated nacl aqueous solution again, anhydrous sodium sulfate drying, rotary evaporation is except desolventizing, obtain Zetia intermediate (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid, (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid
1h NMR (DMSO, 400MHz): 11.97 (s, 1H), 7.34 (m, 2H), 7.14 (m, 2H), 5.21 (s, 1H), 4.52 (t, 1H), 2.19 (t, 2H), 1.57 (m, 3H), 1.43 (m, 1H).
In described reaction system, the starting point concentration of substrate 5-(4-fluorobenzene)-5-ketovaleric acid is 4.76~119.05mmol/L, preferably 23.81~71.43mmol/L, more preferably 47.62mmol/L, the addition of Candida parapsilosis ZJPH1305 thalline is counted 30.4~91.2g/L with dry cell weight, preferably 30.4~76.0g/L, more preferably 60.8g/L.
Further, preferred described reaction is to react 12~60 hours under 25 DEG C~35 DEG C conditions, more preferably under 30 DEG C, 200rpm condition, reacts 24~48 hours.
For promoting regenerating coenzyme, improve reaction efficiency, in described reaction system, be also added with cosubstrate and form transformation system (described transformation system is to be made up of substrate, enzyme source, cosubstrate and damping fluid), described cosubstrate is one of following: 1. glucose, 2. sucrose, 3. maltose, 4. Virahol, 5. methyl alcohol or 6. ethanol; When described cosubstrate is glucose, sucrose or maltose, cosubstrate final concentration is 20~200g/L transformation system, and when cosubstrate is Virahol, methyl alcohol or ethanol, cosubstrate volume final concentration is 10%~30%.
Preferred, described cosubstrate is glucose, and in transformation system, glucose final concentration is 75~125g/L, initial substrate concentration is 4.76~71.43mmol/L, and the addition of Candida parapsilosis ZJPH1305 thalline is counted 30.4~76.0g/L with dry cell weight.
Wet thallus of the present invention (being enzyme source) can be according to ordinary method by the centrifugal rear acquisition of strain fermentation, and preferred, described wet thallus obtains by the following method:
1) slant culture: mono-Candida parapsilosis ZJPH1305 colony inoculation, to slant medium, is cultivated 2~3 days for 30 DEG C, and 4 DEG C of Refrigerator stores, obtain inclined-plane thalline; Slant medium final concentration consists of: glucose 15g/L, peptone 7.5g/L, yeast extract paste 6g/L, (NH
4)
2sO
43g/L, KH
2pO
41.5g/L, NaCl0.75g/L, MgSO
47H
2o0.75g/L, agar 20g/L, solvent is water, pH6.5;
2) seed culture: choose a ring thalline access and be equipped with the 250mL shaking flask of 100mL seed culture medium from cultivating ripe inclined-plane, 30 DEG C, 200rpm cultivates 24 hours, obtains seed liquor; Seed culture medium final concentration consists of: glucose 15g/L, peptone 20g/L, yeast extract paste 10g/L, (NH
4)
2sO
42g/L, KH
2pO
42g/L, NaCl1.0g/L, MgSO
47H
2o0.5g/L, solvent is water, pH6.5;
3) fermentation culture: the inoculum size with volumetric concentration 10% is transferred to seed liquor in the 250mL shaking flask that 100mL fermention medium is housed, 30 DEG C, 200rpm cultivates 48 hours, obtain fermentation culture, by centrifugal fermentation culture (9000rpm, 4 DEG C, centrifugal 10 minutes), the phosphoric acid buffer washing of pH6.0 for gained precipitation, discards washings, collects wet thallus and is enzyme source; The same seed culture medium of fermentative medium formula.
Further, the present invention is described Candida parapsilosis ZJPH1305 being applied as in preparation (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid most preferably: the wet thallus that Candida parapsilosis ZJPH1305 is obtained through fermentation culture is added to 0.2M, pH is in 6.0 phosphoric acid buffer, add again 5-(4-fluorobenzene)-5-ketovaleric acid and glucose to form transformation system, 30 DEG C, 200rpm shaking table oscillatory reaction 24~48 hours, after reaction finishes, reaction solution is centrifugal, get supernatant liquor, add isopyknic ethyl acetate extracting twice, merging extract layer is organic phase, obtain the ethyl acetate solution containing (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid, described thalline add-on is counted 30.4~60.8g/L with dry cell weight, and described initial substrate concentration is 4.76~47.62mmol/L, and glucose final concentration is 100g/L.
The optical purity of liquid chromatography for measuring target product and productive rate: the product in conversion reaction extraction liquid and the concentration of residual substrate adopt liquid-phase chromatographic analysis, adopt area normalization method.Get 1mL extraction liquid evaporate to dryness, be heavily dissolved in ethanol, carry out liquid phase analysis.Liquid phase chromatogram condition: Japanese Shimadzu SPD-10A high performance liquid chromatograph, the N2000 of Zhejiang University chromatographic working station, (4.6mm × 250mm × 5 μ is m) for Japanese Daicel CHIRALPAK AD-H positive polysaccharide derivates chiral column; Detect wavelength: 210nm; Moving phase V (normal hexane)/V (ethanol)=86/14; Flow velocity: 0.6ml/min; Column temperature: 25 DEG C; Sample size: 5 μ l.
Calculate respectively substrate in reaction solution and the concentration of product by area normalization method.And then obtain the productive rate (Yield) of reaction.Calculating formula is:
Productive rate=C
i/ C
0× 100% formula (1)
C in formula (1)
0, C
ithe volumetric molar concentration of product when being respectively the volumetric molar concentration of substrate while reacting initial and reacting end.
The optical purity of product is represented by enantiomeric excess value (enantiomeric excess, e.e.).
E.e.=(C
s-C
r)/(C
s+ C
r) × 100% formula (2)
C in formula (2)
sand C
rbe respectively the volumetric molar concentration of S type and R type 5-(4-fluorobenzene)-5-hydroxypentanoic acid.
Beneficial effect of the present invention is mainly reflected in: the invention provides a strain and can be used for microorganism novel bacterial--Candida parapsilosis (Candida parapsilosis) ZJPH1305 that microorganism catalysis asymmetric reduction 5-(4-fluorobenzene)-5-ketovaleric acid is prepared the crucial chiral intermediate of Zetia medicine (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid, adopt this novel bacterial catalysis to prepare that optical purity (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid has concentration of substrate high, stereoselectivity is good, product optical purity advantages of higher; The present invention is by adopting the chirality biocatalysis that Candida parapsilosis (Candida parapsilosis) ZJPH1305 cell is catalyzer, when concentration of substrate is 47.62mmol/L, when cosubstrate glucose final concentration is 100g/L, the e.e value of object product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid reaches 99.9%, and productive rate reaches 95.37%.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1
1) slant culture: single colony inoculation of picking Candida parapsilosis ZJPH1305, to slant medium, is cultivated 2~3 days for 30 DEG C, obtains 4 DEG C of Refrigerator stores of inclined-plane thalline.Slant medium final concentration consists of: glucose 15g/L, peptone 7.5g/L, yeast extract paste 6g/L, (NH
4)
2sO
43g/L, KH
2pO
41.5g/L, NaCl0.75g/L, MgSO
47H
2o0.75g/L, agar 20g/L, solvent is water, pH6.5.
2) seed culture: choose a ring thalline access and be equipped with the 250mL shaking flask of 100mL seed culture medium from cultivating ripe inclined-plane, 30 DEG C, 200rpm cultivates 24 hours, obtains seed liquor.Seed culture medium final concentration consists of: glucose 15g/L, peptone 20g/L, yeast extract paste 10g/L, (NH
4)
2sO
42g/L, KH
2pO
42g/L, NaCl1.0g/L, MgSO
47H
2o0.5g/L, solvent is water, pH6.5.
3) fermentation culture: the inoculum size with volumetric concentration 10% is transferred to seed liquor in the 250mL shaking flask that 100mL fermention medium is housed, 30 DEG C, 200rpm cultivates 48 hours, obtain fermentation culture, by fermentation culture 9000rpm, 4 DEG C, centrifugal 10 minutes, supernatant discarded, the phosphoric acid buffer that collecting precipitation is 6.0 with pH washs once, obtains wet thallus; The same seed culture medium of fermentative medium formula.
Embodiment 2:
1) conversion reaction
The wet thallus of embodiment 1 gained is suspended in 10mL phosphate buffered saline buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, then add the sucrose of final concentration 10g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h.After conversion finishes, equal-volume ethyl acetate extraction 2 times for conversion fluid, merge extraction phase, the ethyl acetate solution that acquisition contains (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid, adopt the content of liquid chromatography analysis object product and residual substrate, and the optical purity of product.
5) analyzing and testing:
Product in conversion reaction extraction liquid and the concentration of residual substrate adopt liquid-phase chromatographic analysis, adopt area normalization method.Get the supernatant liquor evaporate to dryness of 1mL after centrifugal, be heavily dissolved in ethanol, carry out liquid phase analysis.Liquid phase chromatogram condition: Japanese Shimadzu SPD-10A high performance liquid chromatograph, the N2000 of Zhejiang University chromatographic working station, (4.6mm × 250mm × 5 μ is m) for Japanese Daicel CHIRALPAK AD-H positive polysaccharide derivates chiral column; Detect wavelength: 210nm; Moving phase V (normal hexane)/V (ethanol)=86/14; Flow velocity: 0.6ml/min; Column temperature: 25 DEG C; Sample size: 5 μ l.Liquid chromatogram is shown in Fig. 1~Fig. 3.The concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 1.02mmol/L, optical purity ee value 99.9%, productive rate 21.42%.
Embodiment 3:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, do not add cosubstrate (contrast), be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 0.89mmol/L, optical purity ee value 99.9%, productive rate 18.70%.
Embodiment 4:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphate buffered saline buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of 4.76mmol/L as substrate, then add the ethanol of 1mL methyl alcohol (10%, v/v) as cosubstrate, be placed in 30 DEG C, in the shaking table of 200r/min, react 24h.The detection method that adopts embodiment 1, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 1.02mmol/L, optical purity ee value 99.9%, productive rate 18.35%.
Embodiment 5:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphate buffered saline buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of 4.76mmol/L as substrate, then add the ethanol of 1mL Virahol (10%, v/v) as cosubstrate, be placed in 30 DEG C, in the shaking table of 200r/min, react 24h.The detection method that adopts embodiment 1, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 1.02mmol/L, optical purity ee value 99.9%, productive rate 20.43%.
Embodiment 6:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, add again the glucose of final concentration 10g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 1.10mmol/L, optical purity ee value 99.9%, productive rate 23.10%.
Embodiment 7:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, add again the glucose of final concentration 50g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 1.93mmol/L, optical purity ee value 99.9%, productive rate 40.55%.
Embodiment 8
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH7.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 2.85mmol/L, optical purity ee value 99.9%, productive rate 59.88%.
Embodiment 9:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 4.68mmol/L, optical purity ee value 99.9%, productive rate 98.32%.
Embodiment 10:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH8.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 4.76mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 2.92mmol/L, optical purity ee value 99.9%, productive rate 61.34%.
Embodiment 11:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 23.81mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 24h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 19.36mmol/L, optical purity ee value 99.9%, productive rate 81.31%.
Embodiment 12:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 23.81mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 48h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 23.00mmol/L, optical purity ee value 99.9%, productive rate 96.6%.
Embodiment 13:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 47.62mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 48h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 29.82mmol/L, optical purity ee value 99.9%, productive rate 62.62%.
Embodiment 14:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 30.4g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 71.43mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 48h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 30.39mmol/L, optical purity ee value 99.9%, productive rate 42.55%.
Embodiment 15:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 60.8g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 47.62mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 48h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 45.41mmol/L, optical purity ee value 99.9%, productive rate 95.37%.
Embodiment 16:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 76.0g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 95.24mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 48h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 34.84mmol/L, optical purity ee value 99.9%, productive rate 36.58%.
Embodiment 17:
The wet thallus of embodiment 1 gained is suspended in 10mL phosphoric acid buffer (0.2M, pH6.0), and wet thallus is taking dry cell weight concentration as 91.2g/L; Add 5-(4-fluorobenzene)-5-ketovaleric acid of final concentration 119.05mmol/L as substrate, add again the glucose of final concentration 100g/L as cosubstrate, be placed in 30 DEG C, in the shaking table of 200rpm, react 48h, adopt the detection method of embodiment 2, the concentration of product (5S)-(4-fluorobenzene)-5-hydroxypentanoic acid is 29.87mmol/L, optical purity ee value 99.9%, productive rate 25.09%.