Die vorliegende Erfindung betrifft allgemein das Gebiet der Molekularbiologie und befasst sich mit einem Verfahren zur Erhöhung von verschiedenen Pflanzenertragsmerkmalen durch Erhöhung der Expression in Pflanzen von (i) einer Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und von (ii) einer Nukleinsäuresequenz, die für ein „synovial sarcoma translocation”(SYT)-Polypeptid kodiert, wobei die Ertragsmerkmale im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden erhöht sind: (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Die vorliegende Erfindung betrifft auch Pflanzen mit einer erhöhten Expression von (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und von (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, wobei die Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einer der folgenden: (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen. Die Erfindung stellt auch Konstrukte bereit, die für die erfindungsgemäßen Verfahren nützlich sind.The present invention relates generally to the field of molecular biology and is directed to a method for increasing various plant yield traits by increasing expression in plants of (i) a nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) a nucleic acid sequence encoding a synovial sarcoma translocation (SYT) polypeptide, wherein the yield-related traits are increased compared to plants having increased expression of any of the following: (i) a nucleic acid sequence encoding a GRF Polypeptide, or (ii) a nucleic acid sequence encoding a SYT polypeptide. The present invention also relates to plants having increased expression of (i) a nucleic acid sequence encoding a GRF polypeptide; and (ii) a nucleic acid sequence encoding a SYT polypeptide, said plants comprising, in comparison to plants having increased expression, any of the following: (i) a nucleic acid sequence encoding a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide has increased yield-related traits. The invention also provides constructs useful in the methods of the invention.

Dadurch, dass die Weltbevölkerung ständig zunimmt und immer weniger Kulturfläche für die Landwirtschaft vorhanden ist, wird die Wissenschaft gezwungen, sich mit der Verbesserung der Schlagkräftigkeit der Landwirtschaft zu befassen. Bei traditionellen Mitteln für die pflanzen- und gartenbauliche Züchtung verwendet man Selektionszüchtungstechniken, um Pflanzen mit wünschenswerten Eigenschaften zu identifizieren. Diese Selektionszüchtungstechniken weisen jedoch mehrere Nachteile auf, nämlich, dass diese Techniken typischerweise arbeitsintensiv sind und zu Pflanzen führen, die häufig heterogene genetische Komponenten enthalten, die nicht immer dazu führen, dass das wünschenswerte Merkmal von den Elternpflanzen weiter vererbt wird. Durch Fortschritte in der Molekularbiologie ist es der Menschheit nun möglich, das Erbmaterial von Tieren und Pflanzen zu modifizieren. Die pflanzliche Gentechnik beinhaltet die Isolation und Manipulation von genetischem Material (typischerweise in Form von DNA oder RNA) und die anschließende Einführung von diesem genetischen Material in eine Pflanze. Mit dieser Technologie kann man Pflanzen, auch Kulturpflanzen, mit verschiedenen erhöhten wirtschaftlichen, agronomischen oder gartenbaulichen Merkmalen zu produzieren.As the world population grows and there is less and less agricultural land available for agriculture, science is forced to focus on improving the impact of agriculture. Traditional plant and horticultural breeding techniques use selection breeding techniques to identify plants with desirable characteristics. However, these selection breeding techniques have several disadvantages, namely that these techniques are typically labor-intensive and result in plants that often contain heterogeneous genetic components that do not always result in the desirable trait being inherited from the parent plants. Advances in molecular biology have allowed humanity to modify the genetic material of animals and plants. Plant genetic engineering involves the isolation and manipulation of genetic material (typically in the form of DNA or RNA) and the subsequent introduction of this genetic material into a plant. With this technology one can produce plants, also crops, with different increased economic, agronomic or horticultural characteristics.

Ein Merkmal von besonderem wirtschaftlichem Interesse ist erhöhter Ertrag. Ertrag wird normalerweise als messbares Kulturpflanzenprodukt mit wirtschaftlichem Wert definiert. Dies kann bezüglich Quantität und/oder Qualität definiert werden. Der Ertrag hängt direkt von verschiedenen Faktoren ab, wie zum Beispiel Anzahl und Größe der Organe, der Pflanzenarchitektur (zum Beispiel die Anzahl an Verzweigungen), der Samenproduktion, der Blattalterung und anderen. Weitere wichtige Faktoren, die den Ertrag bestimmen, sind Wurzelentwicklung, Nährstoffaufnahme, Stresstoleranz und Jungpflanzenvitalität. Eine Optimierung der oben genannten Faktoren kann daher zur Erhöhung des Kulturpflanzenertrags beitragen.A feature of particular economic interest is increased yield. Yield is usually defined as a measurable crop product with economic value. This can be defined in terms of quantity and / or quality. The yield depends directly on several factors, such as organ number and size, plant architecture (for example, the number of branches), seed production, leaf aging and others. Other important factors that determine yield are root development, nutrient uptake, stress tolerance and early vigor. Optimization of the above factors may therefore contribute to increasing crop yield.

Der Samenertrag ist deshalb ein besonders wichtiges Merkmal, weil die Samen von vielen Pflanzen wichtig für die menschliche und tierische Ernährung sind. Kulturpflanzen wie Mais, Reis, Weizen, Canola-Raps und Sojabohne machen mehr als die Hälfte der Gesamtkalorienaufnahme des Menschen aus, und zwar entweder durch direkten Verzehr der Samen selbst oder durch den Verzehr von Fleischprodukten, die mit verarbeiteten Samen erzeugt wurden. Sie bilden weiterhin eine Quelle von Zuckern, Ölen und vielen Arten von Stoffwechselprodukten, die in industriellen Verfahren eingesetzt werden. Samen enthalten einen Embryo (den Ursprung für neue Sprosse und Wurzeln) und ein Endosperm (die Nährstoffquelle für das Embryowachstum während der Keimung und des frühen Wachstums der Keimpflanzen). An der Entwicklung eines Samens sind viele Gene beteiligt; er erfordert den Transfer von Stoffwechselprodukten von den Wurzeln, Blättern und Stängeln in den wachsenden Samen. Insbesondere das Endosperm assimiliert die Stoffwechselvorstufen von Kohlenhydraten, Ölen und Proteinen und synthetisiert daraus Speichermakromoleküle, die das Korn ausfüllen.Seed yield is a particularly important feature because the seeds of many plants are important for human and animal nutrition. Crops such as corn, rice, wheat, canola oilseed rape and soybean account for more than half of the total human calorie intake, either by direct consumption of the seeds themselves or by eating meat products produced with processed seeds. They continue to be a source of sugars, oils and many types of metabolic products used in industrial processes. Seeds include an embryo (the source of new shoots and roots) and an endosperm (the source of nutrients for embryo growth during germination and early growth of the seedlings). Many genes are involved in the development of a seed; it requires the transfer of metabolic products from the roots, leaves and stems in the growing seeds. In particular, the endosperm assimilates the metabolic precursors of carbohydrates, oils and proteins and synthesizes from them memory macromolecules that fill the grain.

Die pflanzliche Biomasse bedeutet für Futterkulturen wie Luzerne, Silomais und Heu den Ertrag. In Getreidekulturen sind für den Ertrag viele Ersatzparameter verwendet worden. Unter diesen sind Schätzwerte für die Pflanzengröße am wichtigsten. Die Pflanzengröße kann je nach Art und Entwicklungsstadium auf vielerlei Art und Weise bestimmt werden; hierzu zählen Gesamtpflanzentrockengewicht, oberirdisches Trockengewicht, oberirdisches Frischgewicht, Blattfläche, Stängelvolumen, Pflanzenhöhe, Rosettendurchmesser, Blattlänge, Wurzellänge, Wurzelmasse, Anzahl der Bestockungstriebe sowie Anzahl der Blätter. Bei vielen Arten wird das Verhältnis zwischen der Größe von unterschiedlichen Pflanzenteilen zu einem bestimmten Entwicklungsstadium beibehalten. Diese allometrischen Beziehungen werden für die Extrapolation von einem dieser Messwerte auf einen anderen eingesetzt (z. B. Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 ). Die Pflanzengröße zu einem frühen Entwicklungsstadium korreliert typischerweise mit der Pflanzengröße zu einem späteren Zeitpunkt in der Entwicklung. Eine größere Pflanze mit einer größeren Blattfläche kann typischerweise mehr Licht und Kohlendioxid als eine kleinere Pflanze absorbieren, und es ist daher wahrscheinlich, dass diese Pflanze über denselben Zeitraum mehr Gewicht zunimmt ( Fasoula & Tollenaar 2005 Maydica 50: 39 ), was zusätzlich zu der potentiellen Weiterführung des Vorteils bezüglich der Mikroumwelt bzw. des genetischen Vorteils, den die Pflanze hatte, um von vornherein die größere Größe zu erzielen. Bezüglich Pflanzengröße und Wachstumsrate existiert eine starke genetische Komponente (z. B. ter Steege et al. 2005 Plant Physiology 139: 1078 ), und es ist daher für verschiedene unterschiedliche Genotypen wahrscheinlich, dass die Pflanzengröße unter einer Umweltbedingung mit der Größe unter einer anderen Bedingung korreliert ( Hittalmani et al. 2003 Theoretical Applied Genetics 107: 679 ). Auf diese Weise wird eine Standardumwelt als Ersatzparameter für die unterschiedlichen und dynamischen Umwelten, denen Kulturen auf dem Feld an unterschiedlichen Orten und zu unterschiedlichen Zeitpunkten begegnen.Plant biomass means yield for feed crops such as alfalfa, silage maize and hay. In cereal crops many replacement parameters have been used for the yield. Among these, estimates of plant size are most important. Plant size can be determined in many ways depending on the species and stage of development; These include total plant dry weight, above-ground dry weight, above-ground fresh weight, leaf area, stem volume, plant height, rosette diameter, leaf length, root length, root mass, number of tillers and number of leaves. In many species, the relationship between the size of different plant parts is maintained at a particular stage of development. These allometric relationships are used to extrapolate one of these metrics to another (eg. Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 ). Plant size at an early stage of development typically correlates with plant size at a later stage in development. A larger plant with a larger leaf area can typically absorb more light and carbon dioxide than a smaller plant, and it is therefore likely that this plant increases in weight over the same period of time ( Fasoula & Tollenaar 2005 Maydica 50: 39 ), in addition to the potential continuation of the microenvironment advantage or genetic advantage that the plant had in order to obtain the larger size from the outset. There is a strong genetic component in plant size and growth rate (eg. Steege et al. 2005 Plant Physiology 139: 1078 ), and it is therefore probable for several different genotypes that plant size under one environmental condition correlates with size under another condition ( Hittalmani et al. 2003 Theoretical Applied Genetics 107: 679 ). In this way, a standard environment becomes a substitute parameter for the different and dynamic environments that crops encounter in the field at different locations and at different times.

Ein weiteres wichtiges Merkmal für viele Kulturpflanzen ist die Jungpflanzenvitalität. Eine Erhöhung der Jungpflanzenvitalität ist ein wichtiges Ziel von modernen Reiszüchtungsprogrammen für Sorten von tropischem Reis, aber auch Reis für gemäßigte Zonen. Lange Wurzeln sind wichtig für Reis, der in Wasser gesät wird, für eine ordentliche Verankerung im Boden. Dort, wo Reis direkt in angestaute Felder gesät wird und wo die Pflanzen rasch durch das Wasser auflaufen müssen, sind längere Triebe mit Vitalität assoziiert. Wird das Saatgut gedrillt, so sind längere Mesokotyle und Koleoptilen wichtig für eine gutes Auflaufen der Keimpflanzen. Die Fähigkeit, Jungpflanzenvitalität in Pflanzen mittels Gentechnik einzubringen, wäre in der Landwirtschaft von großer Wichtigkeit. So bildete zum Beispiel eine schlechte Jungpflanzenvitalität eine Einschränkung für die Einführung von Maishybriden (Zea mays L.), die auf Erbmaterial des „Corn Belt” beruhten, in die europäische Atlantikregion.Another important feature of many crops is early vigor. An increase in early vigor is an important goal of modern rice breeding programs for tropical rice varieties, but also rice for temperate zones. Long roots are important for rice sown in water for proper anchoring in the soil. Where rice is sown directly into patches and where the plants have to run quickly through the water, longer shoots are associated with vitality. If the seeds are drilled, longer mesocotyles and coleoptiles are important for a good emergence of the seedlings. The ability to introduce early vigor in plants through genetic engineering would be of great importance in agriculture. For example, poor early vigor was a limitation for the introduction of maize hybrids (Zea mays L.) based on genetic material from the Corn Belt into the European Atlantic region.

Der Harvest Index, das Verhältnis von Samenertrag zu oberirdischem Trockengewicht, ist unter vielen Umweltbedingungen relativ stabil, und man gelangt daher häufig zu einer guten Korrelation zwischen Pflanzengröße und Samenertrag (z. B. Rebetzke et al. 2002 Crop Science 42: 739 ). Diese Vorgänge sind deshalb intrinsisch miteinander verbunden, da der Großteil der Kornbiomasse von der stattfindenden bzw. gespeicherten Photosyntheseproduktivität der Blätter und Stängel der Pflanze abhängt ( Gardener et al. 1985 Physiology of Crop Plants. Iowa State University Press, S. 68–73 ). Ein Selektieren auf Pflanzengröße bereits in frühen Entwicklungsstadien ist daher als Indikator für den potentiellen Ertrag in der Zukunft verwendet worden (z. B. Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 ). Beim Testen auf den Einfluss von genetischen Unterschieden auf Stresstoleranz ist die Fähigkeit, die Bodeneigenschaften, Temperatur, Verfügbarkeit von Wasser und Nährstoffen sowie Lichtintensität zu standardisieren, ein intrinsischer Vorteil von Gewächshaus- oder Pflanzenwuchskammerumwelten im Vergleich zum Feld. Künstliche Begrenzungen des Ertrags aufgrund von schlechter Bestäubung, die durch das Fehlen von Wind oder von Insekten verursacht wird, oder ungenügender Raum für das Wachstum der reifen Wurzeln oder der Bestandesdecke kann jedoch die Verwendung dieser kontrollierten Umwelten für das Austesten von Ertragsunterschieden einschränken. Messungen der Pflanzengröße während der frühen Entwicklung unter standardisierten Bedingungen in einer Wachstumskammer oder im Gewächshaus sind daher Standardpraktiken, um einen Hinweis auf mögliche genetische Ertragsvorteile zu erhalten.The Harvest Index, the ratio of seed yield to above-ground dry weight, is relatively stable under many environmental conditions, and therefore, there is often a good correlation between plant size and seed yield (eg. Rebetzke et al. 2002 Crop Science 42: 739 ). These processes are intrinsically linked because most of the grain biomass depends on the photosynthetic productivity of the leaves and stems of the plant ( Gardener et al. 1985 Physiology of Crop Plants. Iowa State University Press, pp. 68-73 ). Selecting for plant size at an early stage of development has therefore been used as an indicator of the potential yield in the future (eg. Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 ). When tested for the influence of genetic differences on stress tolerance, the ability to standardize soil properties, temperature, availability of water and nutrients, and light intensity is an intrinsic advantage of greenhouse or plant growth chamber environments compared to the field. However, artificially limiting the yield due to poor pollination caused by the absence of wind or insects, or insufficient room for the growth of mature roots or stand blanket, may limit the use of these controlled environments for testing yield differentials. Measurements of plant size during early development under standardized conditions in a growth chamber or in the greenhouse are therefore standard practices to obtain an indication of possible genetic yield advantages.

Ein weiteres wichtiges Merkmal ist das der erhöhten Toleranz für abiotischen Stress. Abiotischer Stress ist eine Hauptursache für weltweite Erntesverluste und reduziert die durchschnittlichen Erträge bei den meisten Hauptkulturpflanzenarten um mehr als 50% ( Wang et al. (2003) Planta 218: 1–14 ). Abiotischer Stress kann durch Trockenheit, Salinität, Temperaturextrema, chemische Toxizität, Überangebot oder Mangel an Nährstoffen (Makro- und/oder Mikroelemente), Strahlung und oxidativen Stress verursacht werden. Die Fähigkeit, die pflanzliche Toleranz für abiotischen Stress zu erhöhen, wäre weltweit von großem wirtschaftlichem Vorteil für die Landwirte und würde den Anbau von Kulturpflanzen unter ungünstigen Bedingungen und in Gebieten, wo ein Anbau von Kulturpflanzen sonst nicht möglich wäre, gestatten.Another important feature is the increased tolerance for abiotic stress. Abiotic stress is a major cause of global crop loss and reduces average crop yields by more than 50% for most major crop species ( Wang et al. (2003) Planta 218: 1-14 ). Abiotic stress can be caused by dryness, salinity, temperature extremes, chemical toxicity, oversupply or lack of nutrients (macro and / or microelements), radiation and oxidative stress. The ability to increase plant tolerance for abiotic stress would be of great economic benefit to farmers worldwide and would permit the cultivation of crops under unfavorable conditions and in areas where cultivation of crops would not otherwise be possible.

Der Kulturpflanzenertrag kann daher durch Optimieren von einem der oben genannten Faktoren erhöht werden.Crop yield can therefore be increased by optimizing one of the above factors.

Je nach dem Endzweck kann man die Modifikation von bestimmten Ertragsmerkmalen im Vergleich zu anderen bevorzugen. Für Anwendungen wie zum Beispiel Feldfutter- oder Holzproduktion oder als Quelle für Biokraftstoff kann zum Beispiel eine Zunahme der vegetativen Pflanzenteile wünschenswert sein, und für Anwendungen wie die Mehl-, Stärke- oder Ölproduktion kann eine Zunahme bei den Samenparametern besonders wünschenswert sein. Auch unter den Samenparametern selbst können je nach Anwendungszweck manche im Vergleich zu anderen bevorzugt werden. Zur Erhöhung des Samenertrags können verschiedene Mechanismen beitragen, egal, ob in Form von erhöhter Samengröße oder erhöhter Anzahl an Samen.Depending on the end use one may prefer the modification of certain yield characteristics compared to others. For example, for applications such as forage or timber production or as a biofuel source, an increase in vegetative plant parts may be desirable, and for applications such as flour, starch or oil production, an increase in seed parameters may be particularly desirable. Also among the semen parameters themselves, depending on the purpose of use, some may be preferred over others. To increase seed yield, various mechanisms may contribute, whether in the form of increased seed size or increased numbers of seeds.

Ein Ansatz für die Erhöhung von Ertragsmerkmalen (Samenertrag und/oder Biomasse) bei Pflanzen kann durch Modifizieren der pflanzeneigenen Wachstumsmechanismen, wie des Zellzyklus oder von verschiedenen Signalleitungswegen, die am Pflanzenwachstum oder an Abwehrmechanismen beteiligt sind, erfolgen. One approach to increasing yield-related traits (seed yield and / or biomass) in plants may be by modifying the plant's own growth mechanisms, such as the cell cycle, or from various signaling pathways involved in plant growth or defense mechanisms.

Es wurde nun gefunden, dass verschiedene Ertragsmerkmale in Pflanzen dadurch erhöht werden können, dass man die Expression von folgendem in einer Pflanze erhöht: (i) Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) Nukleinsäuresequenz, die für ein „synovial sarcoma translocation”(SYT)-Polypeptid kodiert, wobei die Ertragsmerkmale im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden erhöht sind: (i) Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Die erhöhten Ertragsmerkmale umfassen einen oder mehrere der folgenden Faktoren: erhöhte Jungpflanzenwüchsigkeit, erhöhte oberirdische Biomasse, erhöhter Gesamtsamenertrag pro Pflanze, erhöhte Samenfüllungsrate, erhöhte Anzahl (gefüllter) Samen, erhöhter Harvest Index sowie erhöhtes Tausendkorngewicht (TKG).It has now been found that various yield-related traits in plants can be increased by increasing the expression of the following in a plant: (i) nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) a nucleic acid sequence encoding a synovial sarcoma translocation (SYT) polypeptide, wherein the yield-related traits are increased as compared to plants having increased expression of any of the following: (i) a nucleic acid sequence encoding a GRF polypeptide , or (ii) nucleic acid sequence encoding a SYT polypeptide. The increased yield-related traits include one or more of the following factors: increased seedling vigor, increased aboveground biomass, increased total seed yield per plant, increased seed filling rate, increased number of (filled) seeds, increased harvest index, and increased thousand kernel weight (TKG).

Hintergrund der Growth-Regulating Factor(GRF)-PolypeptideBackground of the Growth Regulating Factor (GRF) polypeptides

Bei den DNA-Bindungsproteinen handelt es sich um Proteine, die beliebige von vielen DNA-Bindungsdomänen umfassen und so eine spezifische oder allgemeine Affinität für DNA aufweisen. Zu den DNA-Bindungsproteinen zählen zum Beispiel Transkriptionsfaktoren, die den Transkriptionsvorgang modulieren, Nukleasen, die DNA-Moleküle spalten, sowie Histone, die an der Verpackung der DNA im Zellkern beteiligt sind.The DNA binding proteins are proteins that comprise any of many DNA binding domains and thus have a specific or general affinity for DNA. For example, DNA binding proteins include transcription factors that modulate the transcription process, nucleases that cleave DNA molecules, and histones that are involved in the packaging of DNA in the nucleus.

Transkriptionsfaktoren werden üblicherweise als Proteine definiert, die eine sequenzspezifische DNA-Bindungsaffinität aufweisen und die fähig sind, die Transkription zu aktivieren bzw. zu reprimieren. Das Arabidopsis-thaliana-Genom kodiert für mindestens 1533 Transkriptionsregulatoren, was ~5,9% seiner geschätzten Gesamtanzahl Gene ausmacht ( Riechmann et al. (2000) Science 290: 2105–2109 ). Die „Database of Rice Transcription Factors” (DRTF) ist eine Sammlung von bekannten und vorhergesagten Transkriptionsfaktoren von Oryza sativa L. ssp. indica und Oryza sativa L. ssp. japonica, und enthält derzeit Genmodelle für 2025 mutmaßliche Transkriptionsfaktoren (TF) in indica und 2384 in japonica, die auf 63 Familien verteilt sind ( Gao et al. (2006) Bioinformatics 2006, 22(10): 1286–7 ).Transcription factors are commonly defined as proteins that have sequence-specific DNA binding affinity and are capable of activating transcription. The Arabidopsis thaliana genome encodes at least 1533 transcriptional regulators, which represents ~ 5.9% of its estimated total number of genes ( Riechmann et al. (2000) Science 290: 2105-2109 ). The Database of Rice Transcription Factors (DRTF) is a collection of known and predicted transcription factors of Oryza sativa L. ssp. indica and Oryza sativa L. ssp. japonica, and currently contains gene models for 2025 putative transcription factors (TF) in indica and 2384 in japonica, distributed among 63 families ( Gao et al. (2006) Bioinformatics 2006, 22 (10): 1286-7 ).

Eine dieser Familien ist die „Growth-Regulating Factor”(GRF)-Transkriptionsfaktorfamilie, die für Pflanzen spezifisch ist. In Arabidopsis thaliana sind mindestens neun GRF-Polypeptide identifiziert worden ( Kim et al. (2003) Plant J. 36: 94–104 ) und in Oryza sativa mindestens zwölf ( Choi et al. (2004) Plant Cell Physiol. 45(7): 897–904 ). Die GRF-Polypeptide sind dadurch gekennzeichnet, dass sie in ihrer N-terminalen Hälfte mindestens zwei hochkonservierte Domänen aufweisen, die nach den am stärksten konservierten Aminosäuren innerhalb von jeder Domäne benannt sind: (i) eine QLQ-Domäne (InterPro-Eintrag IPR014978, PFAM-Eintrag PF08880), wo die am stärksten konservierten Aminosäuren der Domäne Gln-Leu-Gln sind; und (ii) eine WRC-Domäne (InterPro-Eintrag IPR014977, PFAM-Eintrag PF08879), wo die am stärksten konservierten Aminosäuren der Domäne Trp-Arg-Cys sind. Die WRC-Domäne enthält weiterhin zwei kennzeichnende Strukturmerkmale; die WRC-Domäne ist nämlich an den basischen Aminosäuren Lys und Arg angereichert und umfasst weiterhin drei Cys- und einen His-Rest in konservierter Beabstandung (CX₉CX₁₀CX₂H), was als „Effector of Transcription”(ET)-Domäne bezeichnet wird ( Ellerstrom et al. (2005) Plant Molec. Biol. 59: 663-681 ). Die konservierte Beabstandung der Cystein- und Histidinreste in der ET-Domäne erinnert an die Zinkfingerproteine (Zinkbindungsproteine). Außerdem umfassen die GRF-Polypeptidsequenzen üblicherweise ein Kernlokalisierungssignal (Nuclear Localisation Signal (NLS)).One of these families is the Growth Regulating Factor (GRF) family of transcription factors specific to plants. At least nine GRF polypeptides have been identified in Arabidopsis thaliana ( Kim et al. (2003) Plant J. 36: 94-104 ) and in Oryza sativa at least twelve ( Choi et al. (2004) Plant Cell Physiol. 45 (7): 897-904 ). The GRF polypeptides are characterized by having in their N-terminal half at least two highly conserved domains named after the most conserved amino acids within each domain: (i) a QLQ domain (InterPro entry IPR014978, PFAM Entry PF08880), where the most conserved amino acids of the domain are Gln-Leu-Gln; and (ii) a WRC domain (InterPro entry IPR014977, PFAM entry PF08879) where the most conserved amino acids of the domain are Trp-Arg-Cys. The WRC domain also contains two distinctive structural features; Namely, the WRC domain is enriched in the basic amino acids Lys and Arg, and also includes three conserved-spaced Cys and His residues (CX ₉ CX ₁₀ CX ₂ H), which act as an effector of transcription (ET) domain referred to as ( Ellerstrom et al. (2005) Plant Molec. Biol. 59: 663-681 ). The conserved spacing of cysteine and histidine residues in the ET domain is reminiscent of zinc finger proteins (zinc binding proteins). In addition, the GRF polypeptide sequences usually include a nuclear localization signal (NLS).

Mit einem Hefe-zwei-Hybrid-Interaktionsassay ( Kim & Kende (2004) Proc. Natl. Acad. Sci. 101: 13374–13379 ) wurde die Interaktion von einigen GRF-Polypeptiden mit einer kleinen Familie von Transkriptionscoaktivatoren, den „GRF-Interacting”-Faktoren (GIF1 bis GIF3, auch „synovial sarcoma translocation” SYT1 bis SYT3 genannt) nachgewiesen.With a yeast two-hybrid interaction assay ( Kim & Kende (2004) Proc. Natl. Acad. Sci. 101: 13374-13379 ), the interaction of some GRF polypeptides with a small family of transcriptional coactivators, the "GRF interacting" factors (GIF1 to GIF3, also called "synovial sarcoma translocation" SYT1 to SYT3) has been demonstrated.

Die Bezeichnung GRF wurde auch für eine andere Art von Polypeptiden, die zu der 14-3-3-Polypeptidfamilie ( de Vetten & Ferl (1994) Plant Physiol. 106: 1593–1604 ) gehören und die mit den GRF-Polypeptiden, die für die Durchführung der erfindungsgemäßen Verfahren nützlich sind, überhaupt nicht verwandt sind, verwendet.The term GRF has also been used for another type of polypeptides belonging to the 14-3-3 polypeptide family ( de Vetten & Ferl (1994) Plant Physiol. 106: 1593-1604 ) and which are not related to the GRF polypeptides useful for performing the methods of the invention.

Transgene Arabidopsis-thaliana-Pflanzen, die mit einem Reis-GRF(OsGRF1)-Polypeptid unter der Kontrolle eines konstitutiven 35S-CaMV-Viruspromoters transformiert wurden, wiesen gekräuselte Blätter, eine stark reduzierte Elongation der Primärinfloreszenz sowie verzögertes Schossen auf ( van der Knapp et al. (2000) Plant Physiol. 122: 695–704 ). Im Vergleich zu Wildtyppflanzen entwickelten transgene Arabidopsis-thaliana-Pflanzen, die mit einem beliebigen der beiden Arabidopsis-GRF-Polypeptide (AtGRF1 bzw. AtGRF2) transformiert worden waren, größere Blätter und Kotyledonen, wiesen verzögertes Schossen auf und waren (aufgrund des Fehlens von lebensfähigem Pollen) teilweise steril ( Kim et al. (2003) Plant J. 36: 94–104 ).Transgenic Arabidopsis thaliana plants transformed with a rice GRF (OsGRF1) polypeptide under the control of a constitutive 35S CaMV virus promoter exhibited ruffled leaves, greatly reduced elongation of primary fluorescence, and delayed shoots (Fig. van der Knapp et al. (2000) Plant Physiol. 122: 695-704 ). In comparison to wild-type plants, transgenic Arabidopsis developed Thaliana plants transformed with any of the two Arabidopsis GRF polypeptides (AtGRF1 and AtGRF2, respectively), larger leaves and cotyledons, exhibited delayed firing and were partially sterile (due to the lack of viable pollen). Kim et al. (2003) Plant J. 36: 94-104 ).

In der US-Patentanmeldung US2006/0048240 wird ein Arabidopsis-thaliana-GRF-Polypeptid als SEQ ID NO: 33421 identifiziert. In der US-Patentanmeldung US2007/0022495 wird ein Arabidopsis-thaliana-GRF-Polypeptid als SEQ ID NO: 1803 (in jenem Dokument auch G1438 genannt) identifiziert. Transgene Arabidopsis-Pflanzen, die G1438 mit dem 35S-CaMV-Promoter überexprimieren, weisen dunkelgrüne Blätter auf.In US patent application US2006 / 0048240 an Arabidopsis thaliana GRF polypeptide is identified as SEQ ID NO: 33421. In US patent application US2007 / 0022495 an Arabidopsis thaliana GRF polypeptide is identified as SEQ ID NO: 1803 (also called G1438 in that document). Transgenic Arabidopsis plants overexpressing G1438 with the 35S CaMV promoter have dark green leaves.

Hintergrund bezüglich der „Synovial Sarcoma Translocation”(SYT)-PolypeptideBackground on "Synovial Sarcoma Translocation" (SYT) polypeptides

Bei SYT handelt es sich um einen Transkriptionscoaktivator, der in Pflanzen mit Transkriptionsaktivatoren der GRF(Growth-Regulating Factor)-Proteinfamilie einen funktionellen Komplex bildet ( Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374–9 ). SYT wird in dieser Arbeit GIF genannt, was für GRF-Interacting Factor steht, und AN3 steht für angustifolia3 bei Horiguchi et al. (2005) Plant J. 43: 68–78 . Den GRF-Transkriptionsaktivatoren sind strukturelle Domänen (in der N-terminalen Region) mit den SWI/SNF-Proteinen der „chromatin-remodelling”-Komplexe in der Hefe gemeinsam ( van der Knaap E et al., (2000) Plant Phys. 122: 695–704 ). Es wurde vorgeschlagen, dass Transkriptionscoaktivatoren dieser Komplexe an dem Transport von SWI/SNF-Komplexen an Enhancer- und Promoterregionen beteiligt sind, wo sie ein lokales chromatin-Remodelling bewirken (Übersichtsartikel Näär AM et al., (2001) Annu. Rev. Biochem. 70: 475–501 ). Die Veränderung der lokalen Chromatinstruktur moduliert die Transkriptionsaktivierung. Genauer gesagt wurde vorgeschlagen, dass SYT mit dem pflanzlichen SWI/SNF-Komplex dahingehend interagiert, dass die Transkriptionsaktivierung des GRF-Ziel-Gens bzw. der GRF-Ziel-Gene beeinflusst wird ( Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374–9 ).SYT is a transcriptional coactivator that forms a functional complex in plants with the GRF (Growth-Regulating Factor) protein family of transcriptional activators ( Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374-9 ). SYT is called GIF in this work, which stands for GRF Interacting Factor, and AN3 is for angustifolia3 Horiguchi et al. (2005) Plant J. 43: 68-78 , The GRF transcriptional activators share structural domains (in the N-terminal region) with the SWI / SNF proteins of the "chromatin remodeling" complexes in yeast ( van der Knaap E et al., (2000) Plant Phys. 122: 695-704 ). It has been proposed that transcriptional co-activators of these complexes are involved in the transport of SWI / SNF complexes to enhancer and promoter regions, where they cause local chromatin remodeling (for review) Näär AM et al., (2001) Annu. Rev. Biochem. 70: 475-501 ). The change in local chromatin structure modulates transcriptional activation. More specifically, it has been suggested that SYT interacts with the plant SWI / SNF complex to affect transcriptional activation of the GRF target gene (s) ( Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374-9 ).

Bei Arabidopsis gehört SYT zu einer Genfamilie mit drei Mitgliedern. Die SYT-Polypeptide weisen eine Homologie zu dem Human-SYT auf. Es wurde nachgewiesen, dass das Human-SYT-Polypeptid einen Transkriptionscoaktivator darstellt ( Thaete et al. (1999) Hum. Molec. Genet. 8: 585–591 ). Das Säugetier-SYT-Polypeptid wird durch drei Domänen charakterisiert:

• (i) die N-terminale SNH (SYT N-terminal Homology)-Domäne, die in Säugetieren, Pflanzen, Nematoden und Fischen konserviert ist;
• (ii) die C-terminale QPGY-reiche Domäne, die in erster Linie aus Glycin, Prolin, Glutamin und Tyrosin besteht und die in unterschiedlichen Abständen vorkommt;
• (iii) eine methioninreiche („Met-rich”) Domäne, die zwischen den beiden vorgenannten Domänen liegt.

• (i) the N-terminal SNH (SYT N-terminal homology) domain conserved in mammals, plants, nematodes and fish;
• (ii) the C-terminal QPGY-rich domain, which consists primarily of glycine, proline, glutamine and tyrosine, occurring at different distances;
• (iii) a methionine rich ("Met-rich") domain located between the two aforementioned domains.

Bei pflanzlichen SYT-Polypeptiden ist die SNH-Domäne gut konserviert. Die C-terminale Domäne ist reich an Glycin und Glutamin, jedoch nicht an Prolin und Tyrosin. Sie wurde daher im Gegensatz zu der QPGY-Domäne der Säugetiere QG-reiche Domäne genannt. Wie bei Säugetier-SYT lässt sich am N-terminalen Ende der QG-Domäne eine Met-reiche Domäne identifizieren. Die QG-reiche Domäne kann im Wesentlichen als der C-terminale Rest des Polypeptids (minus der SHN-Domäne) angesehen werden; die Met-reiche Domäne liegt typischerweise innerhalb der ersten Hälfte der QG-reichen vor (vom N-terminalen Ende Richtung C-terminales Ende). Bei pflanzlichen SYT-Polypeptiden kann eine zweite Met-reiche Domäne der SNH-Domäne vorangehen (siehe 1).In plant SYT polypeptides, the SNH domain is well conserved. The C-terminal domain is rich in glycine and glutamine but not proline and tyrosine. It was therefore called QG-rich domain in contrast to mammalian QPGY domain. As with mammalian SYT, a Met-rich domain can be identified at the N-terminal end of the QG domain. The QG-rich domain can be viewed essentially as the C-terminal residue of the polypeptide (minus the SHN domain); the Met-rich domain is typically present within the first half of the QG-rich (from the N-terminal end toward the C-terminal end). In plant SYT polypeptides, a second Met-rich domain may precede the SNH domain (see 1 ).

Von einer SYT-„Loss-of-Function”-Mutante und transgenen Pflanzen mit verringerter SYT-Expression wurde berichtet, dass sie kleine schmale Blätter und Blütenblätter mit weniger Zellen entwickeln ( Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374–9 ).A SYT "loss-of-function" mutant and transgenic plants with reduced SYT expression have been reported to develop small narrow leaves and petals with fewer cells ( Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374-9 ).

Die Überexpression von AN3 in Arabidopsis thaliana hat zu Pflanzen mit Blättern, die 20–30% größer als diejenigen des Wildtyps waren, geführt ( Horiguchi et al. (2005) Plant J. 43: 68–78 ).The overexpression of AN3 in Arabidopsis thaliana has resulted in plants with leaves 20-30% larger than those of the wild-type ( Horiguchi et al. (2005) Plant J. 43: 68-78 ).

In der japanischen Patentanmeldung 2004-350553 wird ein Verfahren zur Steuerung der Blattgröße in horizontaler Richtung durch Steuerung der Expression des AN3-Gens beschrieben.In the Japanese Patent Application 2004-350553 For example, a method of controlling leaf size in the horizontal direction by controlling the expression of the AN3 gene is described.

Überraschenderweise wurde nun gefunden, dass Erhöhen der Expression in einer Pflanze von: (i) Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) Nukleinsäuresequenz, die für ein „synovial sarcoma translocation”(SYT)-Polypeptid kodiert, zu Pflanzen mit erhöhten Ertragsmerkmalen im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden führt: (i) Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Gemäß einer Ausführungsform wird ein Verfahren zur Erhöhung von verschiedenen Pflanzenertragsmerkmalen bereitgestellt, dadurch, dass man in einer Pflanze die Expression von (i) Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) Nukleinsäuresequenz, die für ein „synovial sarcoma translocation”(SYT)-Polypeptid kodiert, erhöht, wobei die Ertragsmerkmale im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden erhöht sind: (i) Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Die erhöhten Ertragsmerkmale umfassen einen oder mehrere der folgenden Faktoren: erhöhte Jungpflanzenwüchsigkeit, erhöhte oberirdische Biomasse, erhöhter Gesamtsamenertrag pro Pflanze, erhöhte Samenfüllungsrate, erhöhte Anzahl (gefüllter) Samen, erhöhter Harvest Index sowie erhöhtes Tausendkorngewicht (TKG).Surprisingly, it has now been found that increasing expression in a plant of: (i) nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide results in plants having enhanced yield-related traits relative to plants having increased expression of any of the following: (i) nucleic acid sequence encoding a GRF polypeptide or (ii) nucleic acid sequence encoding a SYT polypeptide. According to one embodiment, a method for increasing various Plant yield traits, characterized in that in a plant expression of (i) nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, wherein the yield-related traits are increased compared to plants having increased expression of any of the following: (i) nucleic acid sequence encoding a GRF gene; Polypeptide, or (ii) nucleic acid sequence encoding a SYT polypeptide. The increased yield-related traits include one or more of the following factors: increased seedling vigor, increased aboveground biomass, increased total seed yield per plant, increased seed filling rate, increased number of (filled) seeds, increased harvest index, and increased thousand kernel weight (TKG).

Definitionendefinitions

Polypeptid(e)/Protein(e)Polypeptide (s) / protein (s)

Die Begriffe „Polypeptid” und „Protein” werden im vorliegenden Text austauschbar eingesetzt und beziehen sich auf Aminosäuren in polymerer Form mit beliebiger Länge, die miteinander über Peptidbindungen verbunden sind.The terms "polypeptide" and "protein" are used interchangeably herein to refer to amino acids in polymeric form of any length linked together via peptide bonds.

Polvnukleotid(e)/Nukleinsäure(n)/Nukleinsäuresequenz(en)/Nukleotidsequenz(en)Polvnukleotid (s) / nucleic acid (s) / Nucleic acid sequence (s) / nucleotide sequence (s)

Die Begriffe „Polynukleotid(e)”, „Nukleinsäuresequenz(en)”, „Nukleotidsequenz(en)”, „Nukleinsäure(n)” werden im vorliegenden Text austauschbar eingesetzt und beziehen sich auf Nukleotide, und zwar entweder Ribonukleotide oder Desoxyribonukleotide oder eine Kombination davon, in polymerer, unverzweigter Form mit einer beliebigen Länge.The terms "polynucleotide (s)", "nucleic acid sequence (s)", "nucleotide sequence (s)", "nucleic acid (s)" are used interchangeably herein to refer to nucleotides, either ribonucleotides or deoxyribonucleotides, or a combination of which, in polymeric, unbranched form of any length.

Kontrollpflanze(n)Control plant (s)

Die Wahl von geeigneten Kontrollpflanzen ist ein Routinebestandteil eines Versuchsaufbaus und kann entsprechende Wildtyppflanzen oder entsprechende Pflanzen ohne das interessierende Gen beinhalten. Typischerweise gehört die Kontrollpflanze zur selben Pflanzenart oder sogar derselben Sorte wie die zu beurteilende Pflanze. Bei der Kontrollpflanze kann es sich auch um eine Nullizygote der zu beurteilenden Pflanze handeln. Eine „Kontrollpflanze” bedeutet im vorliegenden Zusammenhang nicht nur ganze Pflanzen, sondern auch Pflanzenteile, darunter Samen und Samenteile.The choice of suitable control plants is a routine part of an experimental set-up and may include corresponding wild type plants or corresponding plants without the gene of interest. Typically, the control plant belongs to the same plant species or even the same variety as the plant to be assessed. The control plant may also be a null zygote of the plant to be assessed. A "control plant" in the present context means not only whole plants, but also plant parts, including seeds and seed parts.

Homolog(e)Homologue (e)

„Homologe” eines Proteins umfassen Peptide, Oligopeptide, Polypeptide, Proteine und Enzyme mit Aminosäuresubstitutionen, -deletionen und/oder -insertionen im Vergleich zu dem jeweiligen nichtmodifizierten Protein, sie weisen eine ähnliche biologische und funktionelle Aktivität wie das nichtmodifizierte Protein, von dem sie abstammen, auf."Homologues" of a protein include peptides, oligopeptides, polypeptides, proteins, and enzymes having amino acid substitutions, deletions, and / or insertions relative to the respective unmodified protein; they have similar biological and functional activity to the unmodified protein from which they are derived , on.

Eine Deletion bezieht sich auf die Entfernung von einer oder mehreren Aminosäuren aus einem Protein.A deletion refers to the removal of one or more amino acids from a protein.

Eine Insertion bezieht sich auf einen oder mehrere Aminosäurereste, die in eine vorbestimmte Stelle in ein Protein eingeführt werden. Insertionen können N-terminale und/oder C-terminale Fusionen sowie Insertionen von einzelnen oder multiplen Aminosäuren in eine Sequenz hinein umfassen. Im Allgemeinen sind Insertionen innerhalb der Aminosäuresequenz kleiner als N- oder C-terminale Fusionen, und zwar in einer Größenordnung von ungefähr 1 bis 10 Resten. Zu Beispielen für N- oder C-terminale Fusionsproteine oder -peptide zählen die Bindungsdomäne oder Aktivierungsdomäne eines Transkriptionsaktivators, wie er im Hefe-Zwei-Hybrid-System verwendet wird, Phagen-Hüllproteine, (Histidin)-6-Tag, Glutathion-S-Transferase-Tag, Protein A, Maltose-Bindungsprotein, Dihydrofolatreduktase, Tag·100-Epitop, c-myc-Epitop, FLAG^®-Epitop, lacZ, CMP (calmodulin-binding peptide), HA-Epitop, Protein-C-Epitop und VSV-Epitop.An insertion refers to one or more amino acid residues introduced into a predetermined site in a protein. Insertions may include N-terminal and / or C-terminal fusions as well as insertions of single or multiple amino acids into a sequence. In general, insertions within the amino acid sequence are smaller than N- or C-terminal fusions, on the order of about 1 to 10 residues. Examples of N- or C-terminal fusion proteins or peptides include the binding domain or activation domain of a transcriptional activator as used in the yeast two-hybrid system, phage coat proteins, (histidine) 6-day, glutathione-S transferase-tag, protein A, maltose-binding protein, dihydrofolate reductase, Tag · 100 epitope, c-myc epitope, FLAG ^® -epitope, lacZ, CMP (calmodulin-binding peptide), HA epitope, protein C epitope and VSV epitope.

Eine Substitution bezieht sich auf den Ersatz von Aminosäuren des Proteins durch andere Aminosäuren mit ähnlichen Eigenschaften (wie ähnlicher Hydrophobie, Hydrophilie, Antigenität, Neigung zur Bildung oder zum Bruch von α-Helixstrukturen oder β-Faltblattstrukturen).Substitution refers to the replacement of amino acids of the protein with other amino acids having similar properties (such as similar hydrophobicity, hydrophilicity, antigenicity, tendency to form or break α-helix structures or β-sheet structures).

Aminosäuresubstitutionen sind typischerweise solche von einzelnen Resten, sie können jedoch in Abhängigkeit von funktionellen Zwängen, die dem Polypeptid auferlegt werden, in Form von Clustern vorliegen. Insertionen liegen üblicherweise in der Größenordnung von ungefähr 1 bis 10 Aminosäureresten. Bei den Aminosäuresubstitutionen handelt es sich vorzugsweise um konservative Aminosäuresubstitutionen. Konservative Substitutionstabellen sind in der Fachwelt gut bekannt (siehe zum Beispiel Creighton (1984), Proteins. W. H. Freeman and Company (Hrsg.) and Tabelle 1 unten). Tabelle 1: Beispiele für konservierte Aminosäuresubstitutionen Rest konservative Substitutionen Rest konservative Substitutionen Ala Ser Leu Ile; Val Arg Lys Lys Arg; Gln Asn Gln; His Met Leu; Ile Asp Glu Phe Met; Leu; Tyr Gln Asn Ser Thr; Gly Cys Ser Thr Ser; Val Glu Asp Trp Tyr Gly Pro Tyr Trp; Phe His Asn; Gln Val Ile; Leu Ile Leu, Val Amino acid substitutions are typically those of single residues, but may be in the form of clusters, depending on functional constraints imposed on the polypeptide. Insertions are usually on the order of about 1 to 10 amino acid residues. The amino acid substitutions are preferably conservative amino acid substitutions. conservative Substitution tables are well known in the art (see for example Creighton (1984), Proteins. WH Freeman and Company (ed.) and Table 1 below). Table 1: Examples of conserved amino acid substitutions rest conservative substitutions rest conservative substitutions Ala Ser Leu Ile; Val bad Lys Lys Arg; Gln Asn Gln; His mead Leu; Ile Asp Glu Phe Met; Leu; Tyr Gln Asn Ser Thr; Gly Cys Ser Thr Ser; Val Glu Asp Trp Tyr Gly Per Tyr Trp; Phe His Asn; Gln Val Ile; Leu Ile Leu, Val

Aminosäuresubstitutionen, -deletionen und/oder -insertionen lassen sich leicht mit Hilfe von fachbekannten Techniken der Peptidsynthese, wie Festphasen-Peptidsynthese und dergleichen, oder durch rekombinante DNA-Manipulation herstellen. Verfahren für die Manipulation von DNA-Sequenzen zur Herstellung von Substitutions-, Insertions- oder Deletionsvarianten eines Proteins sind in der Fachwelt gut bekannt. So sind dem Fachmann zum Beispiel Techniken zur Herstellung von Substitutionsmutationen an vorbestimmten Stellen in DNA gut bekannt; dazu zählen M13-Mutagenese, T7-Gen-in-vitro-Mutagenese (USB, Cleveland, OH), QuickChange Site Directed Mutagenese (Stratagene, San Diego, CA), PCR-vermittelte ortsgerichtete Mutagenese oder sonstige Protokolle für die ortsgerichtete Mutagenese.Amino acid substitutions, deletions and / or insertions are readily prepared by art-known peptide synthesis techniques, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation. Methods for the manipulation of DNA sequences for the production of substitution, insertion or deletion variants of a protein are well known in the art. For example, techniques for preparing substitution mutations at predetermined sites in DNA are well known to those skilled in the art; these include M13 mutagenesis, T7 gene in vitro mutagenesis (USB, Cleveland, OH), QuickChange Site Directed Mutagenesis (Stratagene, San Diego, CA), PCR-mediated site-directed mutagenesis, or other protocols for site-directed mutagenesis.

Derivatederivatives

„Derivate” beinhalten Peptide, Oligopeptide, Polypeptide, die im Vergleich zu der Aminosäuresequenz der natürlich vorkommenden Form des Proteins, wie des interessierenden Proteins, Substitutionen von Aminosäuren durch nichtnatürlich vorkommende Aminosäurereste oder Additionen von nichtnatürlich vorkommenden Aminosäureresten umfassen. „Derivate” eines Proteins umfassen auch Peptide, Oligopeptide, Polypeptide, die natürlich vorkommende veränderte (glykosylierte, acetylierte, prenylierte, phosphorylierte, myristoylierte, sulfatierte usw.) oder nichtnatürlich veränderte Aminosäurereste im Vergleich zu der Aminosäuresequenz einer natürlich vorkommenden Form des Polypeptids umfassen. Ein Derivat kann auch eine(n) oder mehrere nicht-Aminosäure-Substituenten oder Additionen im Vergleich zu der Aminosäuresequenz, von der es abstammt, umfassen, zum Beispiel ein Reportermolekül oder einen anderen Liganden, das/der kovalent oder nichtkovalent an die Aminosäuresequenz gebunden ist, wie ein Reportermolekül, das gebunden ist, um seinen Nachweis zu gestatten, und nichtnatürlich vorkommende Aminosäurereste im Vergleich zu der Aminosäuresequenz eines natürlich vorkommenden Proteins."Derivatives" include peptides, oligopeptides, polypeptides which comprise substitutions of amino acids by non-naturally occurring amino acid residues or additions of unnaturally occurring amino acid residues, as compared to the amino acid sequence of the naturally occurring form of the protein, such as the protein of interest. "Derivatives" of a protein also include peptides, oligopeptides, polypeptides that include naturally occurring altered (glycosylated, acetylated, prenylated, phosphorylated, myristoylated, sulfated, etc.) or unnaturally altered amino acid residues as compared to the amino acid sequence of a naturally occurring form of the polypeptide. A derivative may also comprise one or more non-amino acid substituents or additions relative to the amino acid sequence from which it is derived, for example a reporter molecule or other ligand covalently or non-covalently linked to the amino acid sequence such as a reporter molecule bound to allow its detection and non-naturally occurring amino acid residues as compared to the amino acid sequence of a naturally occurring protein.

Ortholog(e)/Paralog(e)Orthologue (s) / paralogue (e)

Orthologe und Paraloge umfassen Evolutionskonzepte, mit denen die Vorfahrenbeziehungen von Genen beschrieben werden. Paraloge sind Gene innerhalb derselben Art, die durch Duplikation eines Vorfahrengens entstanden sind; Orthologe sind Gene von unterschiedlichen Organismen, die durch Artbildung entstanden sind und die auch von einem gemeinsamen Vorfahrengen abstammen.Orthologues and paralogues include evolutionary concepts that describe the ancestral relationships of genes. Paralogues are genes within the same species that have arisen through duplication of an ancestral gene; Orthologues are genes of different organisms that have arisen through speciation and that are also descended from a common ancestor gene.

Domänedomain

Der Begriff „Domäne” bezieht sich auf einen Satz von Aminosäuren, die an spezifischen Positionen entlang eines Alignments von Sequenzen von evolutionsmäßig verwandten Proteinen konserviert sind. Während Aminosäuren an anderen Positionen zwischen Homologen schwanken können, zeigen Aminosäuren, die an spezifischen Positionen stark konserviert sind, Aminosäuren an, die wahrscheinlich für die Struktur, Stabilität oder Funktion eines Proteins essentiell sind. Sie werden durch ihren hohen Konservierungsgrad in als Alignment dargestellten Sequenzen einer Familie von Proteinhomologen identifiziert und können als Identifikationsmittel verwendet werden, um zu bestimmen, ob irgendein Polypeptid zu einer bereits identifizierten Polypeptidfamilie gehört.The term "domain" refers to a set of amino acids conserved at specific positions along an alignment of sequences of evolutionarily related proteins. While amino acids can vary at other positions between homologues, amino acids that are highly conserved at specific positions indicate amino acids that are likely to be essential for the structure, stability or function of a protein. They are characterized by their high degree of conservation identified as alignment sequences of a family of protein homologs and can be used as identification means to determine whether any polypeptide belongs to an already identified polypeptide family.

Motiv/Konsensussequenz/SignaturMotif / Consensus sequence / Signature

Der Begriff „Motiv” oder „Konsensussequenz” oder „Signatur” bezieht sich auf eine kurze konservierte Region in der Sequenz von evolutionsmäßig verwandten Proteinen. Bei Motiven handelt es sich häufig um hochkonservierte Teile von Domänen, sie können jedoch auch nur einen Teil der Domäne beinhalten oder außerhalb einer konservierten Domäne lokalisiert sein (wenn alle Aminosäuren des Motivs außerhalb einer definierten Domäne liegen).The term "motif" or "consensus sequence" or "signature" refers to a short conserved region in the sequence of evolutionarily related proteins. Motifs are often highly conserved parts of domains, but they can also contain only part of the domain or be located outside a conserved domain (if all amino acids of the motif are outside a defined domain).

Hybridisierunghybridization

Der Begriff „Hybridisierung” ist wie hier definiert ein Vorgang, bei dem sich im Wesentlichen homologe komplementäre Nukleotidsequenzen aneinander anlagern. Der Hybridisierungsvorgang kann vollständig in Lösung stattfinden, d. h. beide komplementären Nukleinsäuremoleküle liegen in Lösung vor. Der Hybridisierungsvorgang kann auch stattfinden, wenn eines der komplementären Nukleinsäuremoleküle auf einer Matrix wie magnetischen Perlen, Sepharose-Perlen oder einem sonstigen Harz immobilisiert ist. Der Hybridisierungsvorgang kann weiterhin stattfinden, wenn eines der komplementären Nukleinsäuremoleküle an einen festen Träger wie eine GRFozellulose- oder Nylonmembran immobilisiert ist oder mittels z. B. Photolithographie auf z. B. einen kieselsäurehaltigen Glasträger immobilisiert ist (wobei letzteres als Nukleinsäuresequenz-Arrays oder „micorarrays” oder Nukleinsäuresequenz-Chips bekannt ist). Die Nukleinsäuremoleküle werden im Allgemeinen thermisch oder chemisch denaturiert, um einen Doppelstrang zu zwei Einzelsträngen aufzuschmelzen und/oder um „hairpins” oder sonstige Sekundärstrukturen aus einzelsträngigen Nukleinsäuremolekülen zu entfernen, so dass die Hybridisierung stattfinden kann.The term "hybridization" as defined herein is a process in which substantially homologous complementary nucleotide sequences anneal to one another. The hybridization process can take place completely in solution, i. H. both complementary nucleic acid molecules are in solution. The hybridization process can also take place when one of the complementary nucleic acid molecules is immobilized on a matrix such as magnetic beads, Sepharose beads or other resin. The hybridization process may further take place when one of the complementary nucleic acid molecules is immobilized on a solid support such as a GR cellulose or nylon membrane, or immobilized by e.g. B. photolithography on z. B. a siliceous glass carrier is immobilized (the latter being known as nucleic acid sequence arrays or "micorarrays" or nucleic acid sequence chips). The nucleic acid molecules are generally thermally or chemically denatured to fuse a duplex to two single strands and / or to remove hairpins or other secondary structures from single-stranded nucleic acid molecules so that hybridization can take place.

Der Begriff „Stringenz” bezieht sich auf diejenigen Bedingungen, unter denen eine Hybridisierung stattfindet. Die Stringenz der Hybridisierung wird von Bedingungen wie Temperatur, Salzkonzentration, Ionenstärke und Zusammensetzung des Hybridisierungspuffers beeinflusst. Im Allgemeinen werden niedrige Stringenzbedingungen so gewählt, dass sie ungefähr 30°C niedriger sind als die Schmelzpunkttemperatur (T_m) für die spezifische Sequenz bei einer definierten Ionenstärke und einem definierten pH-Wert. Mittlere Stringenzbedingungen liegen dann vor, wenn die Temperatur 20°C unter T_m liegt, und hohe Stringenzbedingungen dann, wenn die Temperatur 10°C unter T_m liegt. Hochstringente Hybridisierungsbedingungen werden typischerweise für die Isolation von hybridisierenden Sequenzen, die eine hohe Sequenzähnlichkeit mit der Zielnukleinsäuresequenz aufweisen, eingesetzt. Nukleinsäuresequenzen können jedoch aufgrund der Degeneration des genetischen Codes sequenzmäßig abweichen und trotzdem noch für ein im Wesentlichen identisches Polypeptid kodieren. Zum Identifizieren von solchen Nukleinsäuresequenzmolekülen können daher manchmal Hybridisierungsbedingungen mit mittlerer Stringenz erforderlich sein.The term "stringency" refers to those conditions under which hybridization occurs. The stringency of the hybridization is affected by conditions such as temperature, salt concentration, ionic strength and composition of the hybridization buffer. Generally, low stringency conditions are chosen to be about 30 ° C lower than the melting point temperature (T _m ) for the specific sequence at a defined ionic strength and pH. Medium stringency conditions are when the temperature is 20 ° C below T _m and high stringency conditions when the temperature is 10 ° C below T _m . High stringency hybridization conditions are typically used for the isolation of hybridizing sequences that have high sequence similarity to the target nucleic acid sequence. However, nucleic acid sequences may differ sequentially due to the degeneracy of the genetic code and still code for a substantially identical polypeptide. Therefore, hybridization conditions of intermediate stringency may sometimes be required to identify such nucleic acid sequence molecules.

Bei dem T_m-Wert handelt es sich um diejenige Temperatur bei definierter Ionenstärke und definiertem pH-Wert, bei der 50% der Zielsequenz mit einer perfekt zusammenpassenden Sonde hybridisiert. Der T_m-Wert hängt von den Lösungsbedingungen und der Basenzusammensetzung und Länge der Sonde ab. Längere Sequenzen zum Beispiel hybridisieren spezifisch bei höheren Temperaturen. Die maximale Hybridisierungsrate wird bei 16°C bis 32°C unter dem T_m-Wert erzielt. Das Vorliegen von einwertigen Kationen in der Hybridisierungslösung reduziert die elektrostatische Abstoßung zwischen den beiden Nukleinsäuresequenzsträngen und fördert so die Hybridbildung; dieser Effekt wird für Natriumkonzentrationen von bis zu 0,4 M beobachtet (bei höheren Konzentrationen kann dieser Effekt außer Acht gelassen werden). Formamid verringert die Schmelztemperatur von DNA-DNA- und DNA-RNA-Doppelsträngen mit 0,6 bis 0,7°C pro Prozent Formamid, und bei zusätzlich 50% Formamid ermöglicht es, bei 30 bis 45°C hybridisieren zu können, obwohl die Hybridisierungsrate erniedrigt wird. Basenpaar-Fehlpaarungen verringern die Hybridisierungsrate und die Hitzestabilität der Doppelstränge. Durchschnittlich, und für längere Sonden, sinkt der T_m-Wert um ungefähr 1°C pro Prozent Basen-Fehlpaarung. Der T_m-Wert kann je nach der Art der Hybride mit den folgenden Gleichungen berechnet werden:

• 1) DNA-DNA-Hybride ( Meinkoth und Wahl, Anal. Biochem., 138: 267–284, 1984 ): T_m = 81,5°C + 16,6xlog₁₀[Na⁺]^a + 0,41x%[G/C^b] – 500x[L^c]^–1 – 0,61x% Formamid
• 2) DNA-RNA- oder RNA-RNA-Hybride: T_m = 79,8 + 18,5(log₁₀[Na⁺]^a) + 0,58(%G/C^b) + 11,8(%G/C^b)² – 820/L^c
• 3) oligo-DNA- oder oligo-RNA^d-Hybride: Für < 20 Nukleotide: T_m = 2(l_n) Für 20–35 Nukleotide: T_m = 22 + 1,46 (l_n)

• ^aoder für ein anderes einwertiges Kation, jedoch nur im Bereich von 0,01–0,4 M genau.
• ^bnur für %GC im 30%- bis 75%-Bereich genau.
• ^cL = Länge des Doppelstrangs in Basenpaaren.
• ^doligo, Oligonukleotid; l_n, = effektive Länge des Primers = 2 × (Anz. G/C) + (Anz. A/T).

• 1) DNA-DNA hybrids ( Meinkoth and Wahl, anal. Biochem., 138: 267-284, 1984 ): T _m = 81.5 ° C + 16,6xlog ₁₀ [Na ^{+] a} + 0.41x% [G / C ^b] - 500x [L ^{c] -1} - 0,61x% formamide
• 2) DNA-RNA or RNA-RNA hybrids: T _m = 79.8 + 18.5 (log ₁₀ [Na ⁺ ] ^a ) + 0.58 (% G / C ^b ) + 11.8 (% G / C ^b ) ² - 820 / L ^c
• 3) oligo-DNA or oligo RNA ^d hybrids: For <20 nucleotides: T _m = 2 (l _n ) For 20-35 nucleotides: T _m = 22 + 1.46 (l _n )

• ^a or another monovalent cation, but only in the range of 0.01-0.4 M.
• ^b only for% GC in the 30% to 75% range.
• ^c L = length of the double strand in base pairs.
• ^d oligo, oligonucleotide; l _n , = effective length of the primer = 2 × (number G / C) + (number A / T).

Eine unspezifische Bindung kann dadurch bekämpft werden, dass man eine von mehreren bekannten Techniken einsetzt, wie zum Beispiel Blockieren der Membran mit proteinhaltigen Lösungen, Zusätze von heterologer RNA, DNA und SDS zum Hybridisierungspuffer und Behandlung mit Rnase. Für nichthomologe Sonden können eine Reihe von Hybridisierungen durchgeführt werden, und zwar dadurch, dass man entweder (i) die Anlagerungstemperatur nach und nach erniedrigt (zum Beispiel von 68°C auf 42°C) oder (ii) dass man die Formamidkonzentration nach und nach erniedrigt (zum Beispiel von 50% auf 0%). Der Fachmann ist mit verschiedenen Parametern vertraut, die während der Hybridisierung verändert werden können und die die Stringenzbedingungen entweder aufrechterhalten oder verändern werden.Non-specific binding can be controlled by employing one of several known techniques, such as blocking the membrane with proteinaceous solutions, adding heterologous RNA, DNA and SDS to the hybridization buffer, and treating with Rnase. For non-homologous probes, a series of hybridizations can be performed by either (i) gradually lowering the annealing temperature (for example, from 68 ° C to 42 ° C) or (ii) gradually increasing the formamide concentration decreased (for example, from 50% to 0%). One skilled in the art will be familiar with various parameters that may be altered during hybridization and that will either maintain or alter stringency conditions.

Abgesehen von den Hybridisierungsbedingungen hängt die Spezifität der Hybridisierung typischerweise auch von der Funktion der Waschvorgänge nach der Hybridisierung ab. Um einen Hintergrund, der das Ergebnis von unspezifischer Hybridisierung ist, zu entfernen, werden die Proben mit verdünnten Salzlösungen gewaschen. Zu kritischen Faktoren von solchen Waschvorgängen zählen die Ionenstärke und Temperatur der letzten Waschlösung: Je niedriger die Salzkonzentration und je höher die Waschtemperatur ist, desto höher ist die Stringenz des Waschvorgangs. Die Waschbedingungen werden typischerweise bei oder unter Hybridisierungsstringenz durchgeführt. Eine positive Hybridisierung ergibt ein Signal, das mindestens zweimal so stark wie das Hintergrundsignal ist. Im Allgemeinen sind geeignete Stringenzbedingungen für Nukleinsäuresequenzhybridisierungs-Assays oder Genamplifizierungsnachweisevorgänge wie oben dargestellt. Es können auch Bedingungen mit höherer oder niedrigerer Stringenz ausgewählt werden. Der Fachmann ist mit verschiedenen Parametern vertraut, die während des Waschens verändert werden können und die die Stringenzbedingungen entweder aufrechterhalten oder verändern werden.In addition to the hybridization conditions, the specificity of hybridization typically also depends on the function of the washes after hybridization. To remove a background that is the result of nonspecific hybridization, the samples are washed with dilute salt solutions. Critical factors of such washes include the ionic strength and temperature of the final wash solution: the lower the salt concentration and the higher the wash temperature, the higher the stringency of the wash. The washing conditions are typically performed at or below hybridization stringency. Positive hybridization gives a signal that is at least twice as strong as the background signal. In general, suitable stringency conditions for nucleic acid sequence hybridization assays or gene amplification detection procedures are as set forth above. It is also possible to select conditions with higher or lower stringency. Those skilled in the art will be familiar with various parameters that may be changed during washing and that will either maintain or alter stringency conditions.

So umfassen zum Beispiel typische hochstringente Hybridisierungsbedingungen für DNA-Hybride, die länger als 50 Nukleotide sind, die Hybridisierung bei 65°C in 1 × SSC oder bei 42°C in 1 × SSC und 50% Formamid, wonach Waschen bei 65°C in 0,3 × SSC erfolgt. Beispiele für Hybridisierungsbedingungen mit mittlerer Stringenz für DNA-Hybride, die länger als 50 Nukleotide sind, umfassen Hybridisierung bei 50°C in 4 × SSC oder bei 40°C in 6 × SSC und 50% Formamid, und anschließendes Waschen bei 50°C in 2 × SSC. Die Länge des Hybrids ist die erwartete Länge für die hybridisierende Nukleinsäure. Werden Nukleinsäuremoleküle mit einer bekannten Sequenz hybridisiert, so kann die Hybridlänge dadurch bestimmt werden, dass man mit den Sequenzen ein Alignment durchführt und die darin beschriebenen konservierten Regionen identifiziert. 1 × SSC ist 0,15 M NaCl und 15 mM Natriumcitrat; die Hybridisierungslösung und die Waschlösungen können zusätzlich 5 × Denhardt-Reagens, 0,5–1,0% SDS, 100 μg/ml denaturierte, fragmentierte Lachssperma-DNA und 0,5% Natriumpyrophosphat beinhalten.For example, typical high stringency hybridization conditions for DNA hybrids longer than 50 nucleotides include hybridization at 65 ° C in 1 x SSC or at 42 ° C in 1 x SSC and 50% formamide, followed by washing at 65 ° C in 0.3 × SSC takes place. Examples of intermediate stringency hybridization conditions for DNA hybrids longer than 50 nucleotides include hybridization at 50 ° C in 4 x SSC or at 40 ° C in 6 x SSC and 50% formamide followed by washing at 50 ° C in 2 × SSC. The length of the hybrid is the expected length for the hybridizing nucleic acid. If nucleic acid molecules are hybridized with a known sequence, the hybrid length can be determined by aligning with the sequences and identifying the conserved regions described therein. 1 × SSC is 0.15 M NaCl and 15 mM sodium citrate; the hybridization solution and washings may additionally contain 5x Denhardt's reagent, 0.5-1.0% SDS, 100 μg / ml denatured, fragmented salmon sperm DNA and 0.5% sodium pyrophosphate.

Um das Ausmaß der Stringenz zu bestimmen, kann Sambrook et al, (2001), Molecular Cloning: a laboratory manual, 3. Ausgabe, Cold Spring Harbor Laboratory Press, CSH, New York , oder Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989 und jährliche Neufassungen) herangezogen werden.To determine the extent of stringency, can Sambrook et al, (2001), Molecular Cloning: a laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, CSH, New York , or Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989 and Annual Recasts) be used.

Spleißvariantesplice variant

Der Begriff „Spleißvariante” umfasst im vorliegenden Zusammenhang Varianten einer Nukleinsäuresequenz, in denen ausgewählte Introns und/oder Exons herausgeschnitten, ersetzt, verdrängt oder hinzugefügt wurden oder in denen Introns verkürzt oder verlängert wurden. Bei solchen Varianten wird die biologische Aktivität des Proteins im Wesentlichen erhalten bleiben; dies kann dadurch erzielt werden, dass man funktionelle Abschnitte des Proteins selektiv beibehält. Solche Spleißvarianten können in der Natur vorkommen oder vom Menschen hergestellt werden. Verfahren für die Prognostizierung und für das Isolieren von solchen Spleißvarianten sind in der Fachwelt gut bekannt (siehe zum Beispiel Foissac und Schiex (2005), BMC Bioinformatics 6: 25 ).The term "splice variant" as used herein includes variants of a nucleic acid sequence in which selected introns and / or exons have been excised, replaced, displaced or added, or in which introns have been truncated or extended. In such variants, the biological activity of the protein will be substantially retained; this can be achieved by selectively retaining functional portions of the protein. Such splice variants can occur in nature or be produced by humans. Methods for prognosticating and isolating such splice variants are well known in the art (see for example Foissac and Schiex (2005), BMC Bioinformatics 6: 25 ).

Allelvariante allelic variant

Allele oder Allelvarianten sind alternative Formen eines bestimmten Gens, die an derselben chromosomalen Lage lokalisiert sind. Allelvarianten umfassen Single Nucleotide Polymorphisms (SNPs), aber auch Small Insertion/Deletion Polymorphisms (INDELs). Die Größe der INDELs beträgt üblicherweise weniger als 100 Bp. SNPs und INDELs bilden den größten Satz von Sequenzvarianten in natürlich vorkommenden polymorphen Stämmen der meisten Organismen.Allelic or allelic variants are alternative forms of a particular gene located at the same chromosomal location. Allelic variants include single nucleotide polymorphisms (SNPs), but also small insertion / deletion polymorphisms (INDELs). The size of the INDELs is usually less than 100 bp. SNPs and INDELs constitute the largest set of sequence variants in naturally occurring polymorphic strains of most organisms.

„Gen-Shuffling”/gerichtete Evolution"Gene shuffling" / directed evolution

„Gen-Shuffling” oder „gerichtete Evolution” besteht aus iterativem DNA-Shuffling und anschließendem entsprechendem Screening und/oder Selektieren, um Varianten von Nukleinsäuresequenzen oder Teilen davon zu erzeugen, die für Proteine mit modifizierter biologischer Aktivität kodieren ( Castle et al, (2004), Science 304(5674): 1151–4 ; US-Patente 5,811,238 und 6,395,547 )."Gene shuffling" or "directed evolution" consists of iterative DNA shuffling followed by appropriate screening and / or selection to generate variants of nucleic acid sequences or portions thereof which code for proteins with modified biological activity ( Castle et al, (2004), Science 304 (5674): 1151-4 ; U.S. Patents 5,811,238 and 6,395,547 ).

Regulationselement/Kontrollsequenz/PromoterRegulatory element / Control sequence / Promoter

Die Begriffe „Regulationselement”, „Kontrollsequenz” und „Promoter” werden im vorliegenden Text alle austauschbar verwendet und sollen dahingehend breit interpretiert werden, dass sie regulatorische Nukleinsäuresequenzen bedeuten, die fähig sind, eine Expression derjenigen Sequenzen, mit denen sie ligiert sind, zu bewirkten. Der Begriff „Promoter” bezieht sich typischerweise auf eine Nukleinsäuresequenzkontrollsequenz, die sich stromaufwärts vom Transkriptionsstart eines Gens befindet und die am Erkennen und an der Bindung der RNA-Polymerase und anderer Proteine beteiligt ist, wodurch die Transkription einer operativ verknüpften Nukleinsäure gesteuert wird. Die oben genannten Begriffe umfassen auch Transkriptionsregulationssequenzen, die sich von einem klassischen eukaryontischen genomischen Gen ableiten (darunter auch die TATA-Box, die für eine präzise Initiation der Transkription erforderlich ist, mit oder ohne CCAAT-Box-Sequenz) sowie zusätzliche Regulationselemente (d. h. stromaufwärts aktivierende Sequenzen, Erhöher und Silencer), die die Genexpression als Reaktion auf Umweltreize und/oder von außen wirkende Reize oder auf gewebespezifische Art und Weise verändern. Der Begriff beinhaltet auch eine Transkriptionsregulationssequenz eines klassischen prokaryontischen Gens, und hier können eine -35-Box-Sequenz und/oder -10-Box-Transkriptionsregulationssequenzen beinhaltet sein. Der Begriff „Regulationselement” umfasst auch ein synthetisches Fusionsmolekül oder Derivat, das die Expression eines Nukleinsäuresequenzmoleküls in einer Zelle, einem Gewebe oder einem Organ vermittelt, aktiviert oder erhöht.The terms "regulatory element", "control sequence" and "promoter" are all used interchangeably herein and are to be broadly interpreted to mean regulatory nucleic acid sequences capable of effecting expression of those sequences to which they are ligated , The term "promoter" typically refers to a nucleic acid sequence control sequence that is upstream of the transcriptional start of a gene and that participates in recognition and binding of the RNA polymerase and other proteins, thereby controlling the transcription of an operably linked nucleic acid. The above terms also include transcriptional regulatory sequences derived from a classical eukaryotic genomic gene (including the TATA box, which is required for precise initiation of transcription, with or without the CCAAT box sequence), as well as additional regulatory elements (ie, upstream activating sequences, enhancers and silencers) that alter gene expression in response to environmental and / or extrinsic stimuli or in a tissue-specific manner. The term also includes a transcriptional regulatory sequence of a classical prokaryotic gene, and may include a -35 box sequence and / or 10-box transcriptional regulatory sequences. The term "regulatory element" also includes a synthetic fusion molecule or derivative that mediates, activates or enhances the expression of a nucleic acid sequence molecule in a cell, tissue or organ.

Ein „pflanzlicher Promoter” umfasst Regulationselemente, die die Expression eines Kodiersequenzabschnitts in pflanzlichen Zellen vermitteln. Der „pflanzliche Promoter” stammt vorzugsweise von einer Pflanzenzelle, z. B. von der Pflanze, die mit der bei dem erfindungsgemäßen Verfahren zu exprimierenden und hier beschriebenen Nukleinsäuresequenz transformiert wird. Dies trifft auch auf andere „pflanzliche” Regulationssignale, wie „pflanzliche” Terminatoren zu. Die stromaufwärts der bei den Verfahren der vorliegenden Erfindung nützlichen Nukleotidsequenzen gelegenen Promoter können durch eine oder mehrere Nukleotidsubstitution(en), -insertion(en) und/oder -deletion(en) modifiziert werden, ohne die Funktionsfähigkeit oder Aktivität der Promoter, des offenen Leserasters (ORF) oder der 3'-Regulationsregion wie Terminatoren oder anderen 3'-Regulationsregionen, die vom ORF beabstandet liegen, zu stören. Weiterhin kann man auch die Aktivität der Promoter durch Modifizieren ihrer Sequenz modifizieren oder sie vollständig durch aktivere Promoter ersetzen, sogar durch Promoter von heterologen Organismen. Für die Expression in Pflanzen muss das Nukleinsäuresequenzmolekül wie oben beschrieben operativ mit einem geeigneten Promoter verbunden sein oder einen geeigneten Promoter umfassen, der das Gen zum richtigen Zeitpunkt und mit dem erforderlichen räumlichen Expressionsmuster exprimiert.A "plant promoter" includes regulatory elements that mediate the expression of a coding sequence segment in plant cells. The "plant promoter" is preferably derived from a plant cell, e.g. From the plant which is transformed with the nucleic acid sequence to be expressed in the method of the invention and described herein. This also applies to other "plant" regulatory signals, such as "plant" terminators. The promoters upstream of the nucleotide sequences useful in the methods of the present invention may be modified by one or more nucleotide substitution (s), insertion (s) and / or deletion (s), without the operability or activity of the promoters, the open reading frame (ORF) or the 3 'regulatory region such as terminators or other 3' regulatory regions that are spaced from the ORF. Furthermore, one can also modify the activity of the promoters by modifying their sequence or replace them completely with more active promoters, even promoters of heterologous organisms. For expression in plants, the nucleic acid sequence molecule as described above must be operably linked to a suitable promoter or comprise a suitable promoter that expresses the gene at the right time and with the required spatial expression pattern.

Für ein Identifizieren von funktionell äquivalenten Promotern kann die Promoterstärke und/oder das Expressionsmuster eines potentiellen Promoters zum Beispiel dadurch analysiert werden, dass man den Promoter operativ mit einem Reportergen verbindet und das Expressionsausmaß und -muster des Reportergens in verschiedenen Geweben der Pflanze testet. Zu geeigneten gut bekannten Reportergenen zählen zum Beispiel die beta-Glukoronidase oder die beta-Galaktosidase. Die Promoteraktivität wird dadurch getestet, dass man die enzymatische Aktivität der beta-Glukoronidase oder der beta-Galaktosidase misst. Die Promoterstärke und/oder das Expressionsmuster können dann mit derjenigen/demjenigen eines Referenzpromoters (wie demjenigen, der bei den Verfahren der vorliegenden Erfindung eingesetzt wird) verglichen werden. Die Promoterstärke kann jedoch auch dadurch getestet werden, dass man die mRNA-Mengen quantitativ bestimmt oder dadurch, dass man die mRNA-Mengen der in den erfindungsgemäßen Verfahren eingesetzten Nukleinsäuresequenz mit den mRNA-Mengen von „housekeeping”-Genen wie 18S rRNA unter Verwendung von fachbekannten Verfahren wie Northern-Blotting unter densitometrischer Analyse von Autoradiogrammen, quantitativer Echtzeit-PCR oder RT-PCR ( Neid et al, 1996, Genome Methods 6: 986–994 ) vergleicht. Im Allgemeinen versteht man unter „schwachem Promoter” einen Promoter, der die Expression einer Kodiersequenz auf niedrigem Niveau vorantreibt. Unter „niedrigem Niveau” versteht man Mengen von ungefähr 1/10 000 Transkripte bis 1/100 000 Transkripte bis ungefähr 1/500 0000 Transkripte pro Zelle. Im Gegensatz dazu treibt ein „starker Promoter” die Expression einer Kodiersequenz auf hohem Niveau bzw. mit ungefähr 1/10 Transkripten bis 1/100 Transkripte bis ungefähr 1/1 Transkripte pro Zelle voran. Im Allgemeinen versteht man unter „mittelstarkem Promoter” einen Promoter, der die Expression einer Kodiersequenz auf einem Niveau vorantreibt, das in allen Fällen unter demjenigen Niveau liegt, das unter der Kontrolle eines 35S-CaMV-Promoters erzielt wird.For example, to identify functionally equivalent promoters, the promoter strength and / or expression pattern of a potential promoter may be analyzed by operatively linking the promoter to a reporter gene and testing the expression level and pattern of the reporter gene in various tissues of the plant. Suitable well known reporter genes include, for example, beta-glucuronidase or beta-galactosidase. The promoter activity is tested by measuring the enzymatic activity of beta-glucuronidase or beta-galactosidase. The promoter strength and / or expression pattern can then be compared to that of a reference promoter (such as that used in the methods of the present invention). However, the promoter strength can also be tested by quantifying mRNA levels or by measuring the mRNA levels of the nucleic acid sequence used in the methods of the invention with the mRNA levels of housekeeping genes such as 18S rRNA using known in the art Methods such as Northern blotting under densitometric analysis of autoradiograms, quantitative real-time PCR or RT-PCR ( Neid et al, 1996, Genome Methods 6: 986-994 ) compares. Generally, by "weak promoter" is meant a promoter that promotes the expression of a coding sequence at a low level. By "low level" is meant amounts of from about 1/10 000 transcripts to 1/100 000 transcripts to about 1/500 0000 transcripts per cell. In contrast, a "strong promoter" promotes the expression of a high level coding sequence, or about 1/10 transcripts to 1/100 transcripts to about 1/1 transcripts per cell. Generally, by "moderate promoter" is meant a promoter that promotes the expression of a coding sequence at a level that is, in all cases, below the level achieved under the control of a 35S CaMV promoter.

Operativ verknüpftOperatively linked

Der Begriff „operativ verknüpft” bedeutet im vorliegenden Zusammenhang eine funktionelle Verknüpfung zwischen der Promotersequenz und dem interessierenden Gen, so dass die Promotersequenz fähig ist, die Transkription des interessierenden Gens zu initiieren.The term "operably linked" in the present context means a functional linkage between the promoter sequence and the gene of interest such that the promoter sequence is capable of initiating transcription of the gene of interest.

Konstitutiver PromoterConstitutive promoter

Ein „konstitutiver Promoter” bedeutet einen Promoter, der während den meisten, jedoch nicht unbedingt allen, Wachstums- und Entwicklungsphasen und unter den meisten Umweltbedingungen in mindestens einer Zelle, einem Gewebe oder einem Organ transkriptionmäßig aktiv ist. Beispiele für konstitutive Promoter finden sich in Tabelle 2a unten. Tabelle 2a: Beispiele für pflanzliche konstitutive Promoter Herkunftsgen Literaturangabe Actin McElroy et al, Plant Cell, 2: 163–171, 1990 HMGP WO 2004/070039 GOS2 de Pater et al, Plant J. Nov.; 2(6): 837–44, 1992 , WO 2004/065596 Ubiquitin Christensen et al, Plant Mol. Biol. 18: 675–689, 1992 Reis-Cyclophilin Buchholz et al, Plant Mol. Biol. 25(5): 837–43, 1994 Mais-H3-Histon Lepetit et al, Mol. Gen. Genet. 231: 276–285, 1992 Luzerne-H3-Histon Wu et al, Plant Mol. Biol. 11: 641–649, 1988 Actin 2 An et al, Plant J. 10(1); 107–121, 1996 34S FMV Sanger et al, Plant. Mol. Biol., 14, 1990: 433–443 Kleine Rubisco-Untereinheit US 4,962,028 OCS Leisner (1988), Proc. Natl. Acad. Sci. USA 85(5): 2553 SAD1 Jain et al, Crop Science, 39 (6), 1999: 1696 SAD2 Jain et al, Crop Science, 39 (6), 1999: 1696 nos Shaw et al, (1984), Nucleic Acids Res. 12(20): 7831–7846 V-ATPase WO 01/14572 Superpromoter WO 95/14098 G-Box-Proteine WO 94/12015 A "constitutive promoter" means a promoter that is transcriptionally active during most, but not necessarily all, stages of growth and development and under most environmental conditions in at least one cell, tissue or organ. Examples of constitutive promoters can be found in Table 2a below. Table 2a: Examples of plant constitutive promoters Herkunftsgen citation actin McElroy et al, Plant Cell, 2: 163-171, 1990 HMGP WO 2004/070039 GOS2 de Pater et al, Plant J. Nov .; 2 (6): 837-44, 1992 . WO 2004/065596 ubiquitin Christensen et al, Plant Mol. Biol. 18: 675-689, 1992 Rice cyclophilin Buchholz et al, Plant Mol. Biol. 25 (5): 837-43, 1994 Maize H3 histone Lepetit et al, Mol. Gen. Genet. 231: 276-285, 1992 Luzerne H3 histone Wu et al, Plant Mol. Biol. 11: 641-649, 1988 Actin 2 An et al, Plant J. 10 (1); 107-121, 1996 34S FMV Sanger et al, Plant. Mol. Biol., 14, 1990: 433-443 Small rubisco subunit US 4,962,028 OCS Leisner (1988), Proc. Natl. Acad. Sci. USA 85 (5): 2553 SAD1 Jain et al, Crop Science, 39 (6), 1999: 1696 SAD2 Jain et al, Crop Science, 39 (6), 1999: 1696 nos Shaw et al, (1984), Nucleic Acids Res. 12 (20): 7831-7846 V-ATPase WO 01/14572 Super promoter WO 95/14098 G-box proteins WO 94/12015

Ubiquitärer PromoterUbiquitous promoter

Ein ubiquitärer Promoter ist in im Wesentlichen allen Geweben oder Zellen eines Organismus aktiv.A ubiquitous promoter is active in essentially all tissues or cells of an organism.

Entwicklungsregulierter PromoterDevelopment-regulated promoter

Ein entwicklungsregulierter Promoter ist während gewissen Entwicklungsstadien oder in Teilen der Pflanze, bei denen entwicklungsmäßige Veränderungen auftreten, aktiv.A developmentally regulated promoter is active during certain stages of development or in parts of the plant where developmental changes occur.

Induzierbarer Promoter Inducible promoter

Ein induzierbarer Promoter weist eine induzierte oder erhöhte Transkriptionsinitiation als Reaktion auf einen chemischen Reiz (siehe Übersichtsartikel von Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48: 89–108 ), einen Umweltreiz oder einen physikalischen Reiz auf, oder kann „stressinduzierbar” sein, d. h. dann aktiviert werden, wenn eine Pflanze verschiedenen Stressbedingungen ausgesetzt ist, oder „pathogen induzierbar”, d. h. wird dann aktiviert, wenn eine Pflanze verschiedenen Pathogenen ausgesetzt ist.An inducible promoter has an induced or increased transcription initiation in response to a chemical stimulus (see reviews of Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48: 89-108 ), an environmental stimulus or a physical stimulus, or may be "stress inducible", ie activated when a plant is exposed to various stress conditions, or "pathogen inducible", ie activated when a plant is exposed to various pathogens.

Organspezifische/gewebespezifische PromoterOrgan specific / tissue specific promoters

Ein organspezifischer oder gewebespezifischer Promoter ist ein Promoter, der fähig ist, die Transkription bevorzugt in gewissen Organen oder Geweben, wie den Blättern, Wurzeln, dem Samengewebe usw. zu initiieren. So ist zum Beispiel ein „wurzelspezifischer Promoter” ein Promoter, der in erster Linie in Pflanzenwurzeln transkriptionsmäßig aktiv ist, und zwar im Wesentlichen unter Ausschluss von jeglichen anderen Teilen einer Pflanze, obwohl trotzdem noch „leaky”-Expression in diesen anderen Pflanzenteilen möglich ist. Promoter, die fähig sind, die Transkription nur in gewissen Zellen zu initiieren, werden im vorliegenden Text als „zellspezifisch” bezeichnet.An organ specific or tissue specific promoter is a promoter that is capable of preferentially initiating transcription in certain organs or tissues, such as the leaves, roots, seed tissue, etc. For example, a "root specific promoter" is a promoter that is transcriptionally active primarily in plant roots, essentially excluding any other parts of a plant, although still "leaky" expression is possible in these other plant parts. Promoters capable of initiating transcription only in certain cells are referred to herein as "cell-specific."

Beispiele für wurzelspezifische Promoter sind in Tabelle 2b unten angegeben: Tabelle 2b: Beispiele für wurzelspezifische Promoter Herkunftsgen Literaturangabe Reis-RCc3 Xu et al. (1995) Plant Mol. Biol. 27(2): 237– 48 Arabidopsis-PHT1-Phosphattransporter Kovama et al., 2005 Phosphattransporter aus Medicago Xiao et al., 2006 Arabidopsis-Pyk10 Nitz et al. (2001) Plant Sci. 161(2): 337–346 Wurzelspezifische Gene RB7, RD2, RD5, RH12 aus Tabak Conkling et at. (1990) Plant Phys. 93(3): 1203–1211 Wurzelspezifisches Lectin aus der Gerste Lerner & Raikhel (1989) Plant Phys. 91: 124–129 Wurzelspezifisches hydroxyprolinreiches Protein Keller & Lamb (1989) Genes & Dev. 3: 1639–1646 Arabidopsis-CDC27B/hobbit Blilou et al. (2002) Genes & Dev. 16: 2566–2575 Examples of root specific promoters are given in Table 2b below: TABLE 2b Examples of root specific promoters Herkunftsgen citation Rice RCc3 Xu et al. (1995) Plant Mol. Biol. 27 (2): 237-48 Arabidopsis PHT1-phosphate transporter Kovama et al., 2005 Phosphate transporter from Medicago Xiao et al., 2006 Arabidopsis Pyk10 Nitz et al. (2001) Plant Sci. 161 (2): 337-346 Root specific genes RB7, RD2, RD5, RH12 from tobacco Conkling et al. (1990) Plant Phys. 93 (3): 1203-1211 Root-specific lectin from barley Lerner & Raikhel (1989) Plant Phys. 91: 124-129 Root-specific hydroxyproline-rich protein Keller & Lamb (1989) Genes & Dev. 3: 1639-1646 Arabidopsis CDC27B / hobbit Blilou et al. (2002) Genes & Dev. 16: 2566-2575

Ein samenspezifischer Promoter ist in erster Linie in Samengewebe, jedoch nicht unbedingt ausschließlich in Samengewebe (bei „leaky”-Expression) transkriptionsmäßig aktiv. Der samenspezifische Promoter kann während der Samenentwicklung und/oder während der Keimung aktiv sein. Beispiele für samenspezifische Promoter sind in Tabelle 2c unten angegeben. Weitere Beispiele für samenspezifische Promoter sind bei Qing Qu und Takaiwa (Plant Biotechnol. J. 2, 113–125, 2004 ) angegeben, und diese Beschreibung wird hiermit durch Bezugnahme als ob hier vollständig beschrieben aufgenommen. Tabelle 2c: Beispiele für samenspezifische Promoter Herkunftsgen Literaturangabe Samenspezifische Gene Simon et al, Plant Mol. Biol. 5: 191, 1985 ; Scofield et al, J. Biol. Chem. 262: 12202, 1987 ; Baszczynski et al, Plant Mol. Biol. 14: 633, 1990 Paranuss-Albumin Pearson et al, Plant Mol. Biol. 18: 235–245, 1992 Legumin Ellis et al, Plant Mol. Biol. 10: 203–214, 1988 Glutelin (Reis) Takaiwa et al, Mol. Gen. Genet. 208: 15–22, 1986 ; Takaiwa et al, FEBS Letts. 221: 43–47, 1987 Zein Matzke et al, Plant Mol. Biol., 14(3): 323–32, 1990 NapA Stalberg et al, Planta 199: 515–519, 1996 LMW- und HMW-Glutenin-1 aus Weizen Mol. Gen. Genet. 216: 81–90, 1989; NAR 17:4 61–2, 1989 Weizen-SPA Albani et al, Plant Cell, 9: 171–184, 1997 α-, β-, γ-Gliadine aus Weizen EMBO J. 3: 1409–15, 1984 Itr1-Promoter aus der Gerste Diaz et al, (1995), Mol. Gen. Genet. 248(5): 592–8 B1, C, D, Hordein aus der Gerste Theor. Appl. Gen. 98: 125362, 1999; Plant J. 4: 34355, 1993 ; Mol. Gen. Genet. 250: 75060, 1996 Gerste-DOF Mena et al, The Plant Journal, 116(1): 53–62, 1998 blz2 EP99106056.7 Synthetischer Promoter Vicente-Carbajosa et al, Plant J. 13: 629–640, 1998 Reis-Prolamin NRP33 Wu et al, Plant Cell Physiology 39(8) 885–889, 1998 α-Globulin Glb-1 aus Reis Wu et al, Plant Cell Physiology 39(8) 885–889, 1998 Reis-OSH1 Sato et al, Proc. Natl. Acad. Sci. USA, 93: 8117–8122, 1996 α-Globulin REB/OHP-1 aus Reis Nakase et al, Plant Mol. Biol. 33: 513–522, 1997 Reis-ADP-Glukosepyrophosphorylase Trans. Res. 6: 15768, 1997 Mais-ESR-Genfamilie Plant J. 12: 23546, 1997 α-Kafirin aus Sorghumhirse DeRose et al, Plant Mol. Biol. 32: 1029–35, 1996 KNOX Postma-Haarsma et al, Plant Mol. Biol. 39: 25771, 1999 Reis-Oleosin Wu et al, J. Biochem. 123: 386, 1998 Sonnenblumen-Oleosin Cummins et al, Plant Mol. Biol. 19: 873–876, 1992 PRO0117, mutmaßliches 40S-Ribosomenprotein aus Reis WO 2004/070039 PRO0136, Reis-Alaninaminotransferase unveröffentlicht PRO0147, Trypsinhemmer ITR1 (Gerste) unveröffentlicht PRO0151, Reis-WSI18 WO 2004/070039 PRO0175, Reis-RAB21 WO 2004/070039 PRO005 WO 2004/070039 PRO0095 WO 2004/070039 α-Amylase (Amy32b) Lanahan et al, Plant Cell 4: 203–211, 1992 ; Skriver et al, Proc. Natl. Acad. Sci., USA 88: 7266–7270, 1991 Cathepsin-β-artiges Gen Cejudo et al, Plant Mol. Biol. 20: 849856, 1992 Gerste-Ltp2 Kalla et al, Plant J. 6: 849–60, 1994 Chi26 Leah et al, Plant J. 4: 579–89, 1994 Mais B-Peru Selinger et al, Genetics 149; 1125–38, 1998 A seed-specific promoter is transcriptionally active primarily in seed tissue, but not necessarily exclusively in seed tissue (in "leaky" expression). The seed specific promoter may be active during seed development and / or during germination. Examples of seed-specific promoters are given in Table 2c below. Further examples of seed-specific promoters are included Qing Qu and Takaiwa (Plant Biotechnol., J. 2, 113-125, 2004 ), and this description is hereby incorporated by reference as if fully set forth herein. Table 2c: Examples of seed-specific promoters Herkunftsgen citation Semen-specific genes Simon et al, Plant Mol. Biol. 5: 191, 1985 ; Scofield et al, J. Biol. Chem. 262: 12202, 1987 ; Baszczynski et al, Plant Mol. Biol. 14: 633, 1990 Brazil nut albumin Biol. 18: 235-245, 1992 legumin Ellis et al, Plant Mol. Biol. 10: 203-214, 1988 Glutelin (rice) Takaiwa et al, Mol. Gen. Genet. 208: 15-22, 1986 ; Takaiwa et al, FEBS Letts. 221: 43-47, 1987 zein Matzke et al, Plant Mol. Biol., 14 (3): 323-32, 1990 Napa Stalberg et al, Planta 199: 515-519, 1996 LMW and HMW glutenin-1 from wheat Mol. Gen. Genet. 216: 81-90, 1989; NAR 17: 4 61-2, 1989 Wheat SPA Albani et al, Plant Cell, 9: 171-184, 1997 α-, β-, γ-gliadins from wheat EMBO J. 3: 1409-15, 1984 Itr1 promoter from the barley Diaz et al, (1995), Mol. Genet. 248 (5): 592-8 B1, C, D, Hordein from the barley Theor. Appl. Gene. 98: 125362, 1999; Plant J. 4: 34355, 1993 ; Mol. Gen. Genet. 250: 75060, 1996 Barley DOF Mena et al, The Plant Journal, 116 (1): 53-62, 1998 blz2 EP99106056.7 Synthetic promoter Vicente-Carbajosa et al, Plant J. 13: 629-640, 1998 Rice prolamin NRP33 Wu et al, Plant Cell Physiology 39 (8) 885-889, 1998 α-globulin Glb-1 from rice Wu et al, Plant Cell Physiology 39 (8) 885-889, 1998 Rice OSH1 Sato et al, Proc. Natl. Acad. Sci. USA, 93: 8117-8122, 1996 α-globulin REB / OHP-1 from rice Biol. 33: 513-522, 1997 Rice ADP Glukosepyrophosphorylase Trans. Res. 6: 15768, 1997 Corn ESR gene family Plant J. 12: 23546, 1997 Sorghum sorghum α-kafirin DeRose et al, Plant Mol. Biol. 32: 1029-35, 1996 KNOX Postma-Haarsma et al, Plant Mol. Biol. 39: 25771, 1999 Rice oleosin Wu et al, J. Biochem. 123: 386, 1998 Sunflower oleosin Cummins et al, Plant Mol. Biol. 19: 873-876, 1992 PRO0117, putative rice 40S ribosome protein WO 2004/070039 PRO0136, rice alanine aminotransferase unpublished PRO0147, trypsin inhibitor ITR1 (barley) unpublished PRO0151, Rice WSI18 WO 2004/070039 PRO0175, rice RAB21 WO 2004/070039 PRO005 WO 2004/070039 PRO0095 WO 2004/070039 α-amylase (Amy32b) Lanahan et al, Plant Cell 4: 203-211, 1992 ; Skriver et al, Proc. Natl. Acad. Sci., USA 88: 7266-7270, 1991 Cathepsin β-like gene Biol. 20: 849856, 1992 Barley Ltp2 Kalla et al, Plant J. 6: 849-60, 1994 Chi26 Leah et al, Plant J. 4: 579-89, 1994 Corn B-Peru Selinger et al, Genetics 149; 1125-38, 1998

Ein für grünes Gewebe spezifischer Promoter wie im vorliegenden Text definiert ist ein Promoter, der in erster Linie in grünem Gewebe transkriptionsmäßig aktiv ist, und zwar im Wesentlichen unter Ausschluss von jeglichen anderen Teilen einer Pflanze, obwohl trotzdem noch „leaky”-Expression in diesen anderen Pflanzenteilen möglich ist.A green tissue-specific promoter as defined herein is a promoter that is primarily transcriptionally active in green tissue, essentially excluding any other parts of a plant, although still having "leaky" expression in these others Plant parts is possible.

Beispiele für für grünes Gewebe spezifische Promoter, die für die Durchführung der erfindungsgemäßen Verfahren eingesetzt werden können, sind in Tabelle 2d unten dargestellt. Tabelle 2d: Beispiele für für grünes Gewebe spezifische Promoter Gen Expression Literaturangabe Orthophosphatdikinase aus dem Mais blattspezifisch Fukavama et al., 2001 Phosphoenolpyruvatcarboxylase aus dem Mais blattspezifisch Kausch et al., 2001 Phosphoenolpyruvatcarboxylase aus dem Reis blattspezifisch Liu et al., 2003 Kleine Rubisco-Untereinheit aus dem Reis blattspezifisch Nomura et al., 2000 Beta-Expansiv EXBP9 aus dem Reis sprossspezifisch WO 2004/070039 Kleine Rubisco-Untereinheit aus der Straucherbse blattspezifisch Panguluri et al., 2005 Erbsen-RBCS3A blattspezifisch Examples of green tissue-specific promoters that can be used to perform the methods of the invention are shown in Table 2d below. Table 2d: Examples of Green Tissue Specific Promoters gene expression citation Orthophosphate dikinase from corn Leaf specific Fukavama et al., 2001 Phosphoenolpyruvate carboxylase from the corn Leaf specific Kausch et al., 2001 Phosphoenolpyruvate carboxylase from the rice Leaf specific Liu et al., 2003 Small rubisco subunit from the rice Leaf specific Nomura et al., 2000 Beta-expansive EXBP9 from the rice sprouted specifically WO 2004/070039 Small Rubisco subunit from the shrub pea Leaf specific Panguluri et al., 2005 Pea RBCS3A Leaf specific

Ein weiteres Beispiel für einen gewebespezifischen Promoter ist ein meristemspezifischer Promoter, der in erster Linie in Meristemgewebe transkriptionsmäßig aktiv ist, und zwar im Wesentlichen unter Ausschluss von jeglichen anderen Teilen einer Pflanze, obwohl trotzdem noch „leaky”-Expression in diesen anderen Pflanzenteilen möglich ist. Beispiele für Promoter mit Spezifität für das Meristem, die für die Durchführung der erfindungsgemäßen Verfahren eingesetzt werden können, sind in Tabelle 2e unten dargestellt. Tabelle 2e: Beispiele für meristemspezifische Promoter Herkunftsgen Expressionsmuster Literaturangabe Reis-OSH1 Sprossapikalmeristem, vom globulärem Embryonenstadium bis zum Keimlingsstadium Sato et al. (1996) Proc. Natl. Acad. Sci. USA, 93: 8117–8122 Metallothionein aus dem Reis meristemspezifisch BAD87835.1 WAK1 & WAK 2 Spross- und Wurzelapikalmeristeme, und in expandierenden Blättern und Sepalen Wagner & Kohorn (2001) Plant Cell 13(2): 303–318 Another example of a tissue specific promoter is a meristem specific promoter which is primarily transcriptionally active in meristem tissue, essentially excluding any other parts of a plant, although still "leaky" expression is possible in these other plant parts. Examples of promoters with specificity for the meristem which can be used to carry out the methods according to the invention are shown in Table 2e below. Table 2e: Examples of meristemspecific promoters Herkunftsgen expression patterns citation Rice OSH1 Sprout apical meristem, from the globular embryonic stage to the seedling stage Sato et al. (1996) Proc. Natl. Acad. Sci. USA, 93: 8117-8122 Metallothionein from the rice meristemspezifisch BAD87835.1 WAK1 & WAK 2 Shoot and root apical meristems, and in expanding leaves and sepals Wagner & Kohorn (2001) Plant Cell 13 (2): 303-318

Terminatorterminator

Der Begriff „Terminator” umfasst eine Kontrollsequenz, bei der es sich um eine DNA-Sequenz am Ende einer Transkriptionseinheit handelt, die die 3'-Prozessierung und Polyadenylierung eines primären Transkripts und die Transkriptionstermination signalisiert. Der Terminator kann von dem natürlichen Gen, von verschiedenen anderen pflanzlichen Genen oder von T-DNA abstammen. Der hinzuzufügende Terminator kann zum Beispiel vom Nopalinsynthasegen oder vom Octopinsynthasegen oder auch von einem anderen pflanzlichen Gen oder, was weniger bevorzugt ist, von einem beliebigen anderen eukaryontischen Gen abstammen.The term "terminator" includes a control sequence that is a DNA sequence at the end of a transcription unit that signals the 3 'processing and polyadenylation of a primary transcript and the transcription termination. The terminator may be derived from the natural gene, various other plant genes, or T-DNA. The terminator to be added may be derived, for example, from the nopaline synthase gene or from the octopine synthase gene or also from another plant gene or, less preferably, from any other eukaryotic gene.

Modulationmodulation

Der Begriff „Modulation” bedeutet in Bezug auf die Expression oder Genexpression einen Vorgang, bei dem das Expressionsniveau durch diese Genexpression im Vergleich zu der Kontrollpflanze verändert wird; das Expressionsniveau wird vorzugsweise erhöht. Bei der ursprünglichen, nichtmodulierten Expression kann es sich um eine beliebige Art von Expression einer Struktur-RNA (rRNA, tRNA) oder mRNA mit anschließender Translation handeln. Unter dem Begriff „Modulieren der Aktivität” versteht man jegliche Veränderung der Expression der erfindungsgemäßen Nukleinsäuresequenzen oder der kodierten Proteine, die zu erhöhtem Ertrag und/oder erhöhtem Wachstum der Pflanzen führt.The term "modulation" in terms of expression or gene expression means a process in which the level of expression is altered by that gene expression as compared to the control plant; the level of expression is preferably increased. The original, unmodulated expression can be any type of expression of a structural RNA (rRNA, tRNA) or mRNA with subsequent translation. The term "modulating the activity" means any change in the expression of the nucleic acid sequences of the invention or the encoded proteins, which leads to increased yield and / or increased growth of the plants.

Erhöhte Expression/ÜberexpressionIncreased expression / overexpression

Der Begriff „erhöhte Expression” oder „Überexpression” bedeutet im vorliegenden Zusammenhang jegliche Form von Expression, die zusätzlich zu dem ursprünglichen Expressionsniveau des Wildtyps ist.The term "increased expression" or "overexpression" in the present context means any form of expression which is in addition to the original expression level of the wild-type.

Verfahren zur Erhöhung der Expression von Genen oder Genprodukten sind in der Fachwelt gut bekannt; dazu zählen zum Beispiel die von entsprechenden Promotern vorangetriebene Überexpression, die Verwendung von Transkriptions-Erhöhern oder Translations-Erhöhern. Isolierte Nukleinsäuresequenzen, die als Promoter- oder Erhöherelemente dienen, können in einer geeigneten Lage (typischerweise stromaufwärts) einer nichtheterologen Form eines Polynukleotids eingeführt werden, um die Expression einer Nukleinsäuresequenz, die für das interessierende Polypeptid kodiert, hinaufzuregulieren. So können zum Beispiel endogene Promoter in vivo durch Mutation, Deletion und/oder Substitution (siehe Kmiec, US 5,565,350 ; Zarling et al, WO9322443 ) verändert werden, oder es können isolierte Promoter in eine Pflanzenzelle in der korrekten Orientierung und in korrektem Abstand von einem Gen der vorliegenden Erfindung eingeführt werden, um die Expression des Gens zu kontrollieren. Methods for increasing the expression of genes or gene products are well known in the art; These include, for example, promoted by corresponding promoters overexpression, the use of transcription enhancers or translation enhancers. Isolated nucleic acid sequences which serve as promoter or enhancer elements can be introduced in a suitable location (typically upstream) of a non-heterologous form of polynucleotide to upregulate the expression of a nucleic acid sequence encoding the polypeptide of interest. For example, endogenous promoters can be generated in vivo by mutation, deletion, and / or substitution (see Kmiec. US 5,565,350 ; Zarling et al. WO9322443 ), or isolated promoters can be introduced into a plant cell in the correct orientation and at the correct distance from a gene of the present invention to control the expression of the gene.

Wünscht man, ein Polypeptid zu exprimieren, so ist es im Allgemeinen wünschenswert, am 3'-Ende einer Polynukleotid-Kodierregion eine Polyadenylierungsregion mitzuverwenden. Die Polyadenylierungsregion kann von dem natürlichen Gen, von verschiedenen anderen pflanzlichen Genen oder von T-DNA stammen. Die hinzuzufügende 3'-terminale Sequenz kann zum Beispiel von dem Nopalinsynthasegen oder dem Octopinsynthasegen oder alternativ von einem anderen pflanzlichen Gen, oder, was weniger bevorzugt wird, von jeglichem sonstigen eukaryontischen Gen abstammen.If it is desired to express a polypeptide, it is generally desirable to include a polyadenylation region at the 3 'end of a polynucleotide coding region. The polyadenylation region may be derived from the natural gene, various other plant genes, or T-DNA. The 3'-terminal sequence to be added may be derived, for example, from the nopaline synthase gene or the octopine synthase gene, or alternatively from another plant gene, or, less preferably, from any other eukaryotic gene.

Um die Menge der reifen Information, die im Cytosol akkumuliert, zu erhöhen, kann der 5'-untranslatierten Region (UTR) oder der Kodiersequenz der Partialkodiersequenz auch eine Intronsequenz hinzugefügt werden. Es wurde gezeigt, dass die Mitverwendung eines spleißbaren Introns in der Transkriptionsunit sowohl bei pflanzlichen als auch bei tierischen Expressionskonstrukten die Genexpression sowohl auf dem mRNA-Niveau als auch dem Proteinniveau bis um das 1000fache erhöht ( Buchman und Berg (1988), Mol. Cell biol. 8: 4395–4405 ; Callis et al, (1987), Genes Dev. 1: 1183–1200 ). Solch eine Intronerhöhung der Genexpression ist typischerweise dann am größten, wenn sie in der Nähe des 5'-Endes der Transkriptionsunit platziert wird. Die Verwendung der Mais-Introns Adh1-S Intron 1, 2, und 6, das Bronze-1-Intron, sind in der Fachwelt gut bekannt. Allgemeine Informationen finden sich in: The Maize Handbook, Kapitel 116, Freeling und Walbot, Hrsg., Springer, N. Y. (1994) .In order to increase the amount of mature information accumulating in the cytosol, the 5'-untranslated region (UTR) or the coding sequence of the partial coding sequence may also be added with an intron sequence. It has been shown that the use of a spliceable intron in the transcription unit increases gene expression at both the mRNA level and the protein level up to a thousandfold, both in plant and in animal expression constructs ( Buchman and Berg (1988), Mol. Cell biol. 8: 4395-4405 ; Callis et al, (1987), Genes Dev. 1: 1183-1200 ). Such intron enhancement of gene expression is typically greatest when placed near the 5 'end of the transcription unit. The use of the maize introns Adh1-S intron 1, 2, and 6, the bronze 1 intron, are well known in the art. General information can be found in: The Maize Handbook, Chapter 116, Freeling and Walbot, eds., Springer, NY (1994) ,

Endogenes GenEndogenous gene

Wird im vorliegenden Text ein „endogenes” Gen erwähnt, so bezieht sich dies nicht nur auf das jeweilige Gen, wie es in einer Pflanze in seiner natürlichen Form vorkommt (d. h. ohne menschlichen Eingriff), sondern auch auf dasselbe Gen (oder eine im Wesentlichen homologe Nukleinsäure/ein im Wesentlichen homologes Gen) in isolierter Form, das anschließend in eine Pflanze (erneut) eingeführt wird (ein Transgen). So kann zum Beispiel bei einer transgenen Pflanze, die solch ein Transgen enthält, eine wesentliche Reduktion der Transgenexpression und/oder eine wesentliche Reduktion der Expression des endogenen Gens stattfinden.When mention is made herein of an "endogenous" gene, this refers not only to the particular gene as found in a plant in its natural form (ie, without human intervention) but also to the same gene (or a substantially homologous one) Nucleic acid / a substantially homologous gene) in isolated form, which is subsequently (re) introduced into a plant (a transgene). For example, in a transgenic plant containing such a transgene, there can be a substantial reduction in transgene expression and / or a substantial reduction in expression of the endogenous gene.

Verringerte ExpressionDecreased expression

Wird im vorliegenden Text von „verringerter Expression” oder „Verringerung oder im Wesentlichen stattfindender Elimination” der Expression gesprochen, so bedeutet dies eine Verringerung der Expression des endogenen Gens und/oder der Polypeptidmengen und/oder Polypeptidaktivität im Vergleich zu Kontrollpflanzen. Die Reduktion oder im Wesentlichen stattfindende Elimination ist mit ansteigender Bevorzugung im Vergleich zu derjenigen der Kontrollpflanzen um mindestens 10%, 20%, 30%, 40% oder 50%, 60%, 70%, 80%, 85%, 90% oder 95%, 96%, 97%, 98%, 99% oder mehr reduziert.As used herein, the term "reduced expression" or "reduction or substantial elimination" of expression refers to a reduction in endogenous gene expression and / or polypeptide levels and / or polypeptide activity relative to control plants. The reduction or substantial elimination is with increasing preference compared to that of the control plants by at least 10%, 20%, 30%, 40% or 50%, 60%, 70%, 80%, 85%, 90% or 95 %, 96%, 97%, 98%, 99% or more reduced.

Für die Reduktion oder im Wesentlichen stattfindende Elimination der Expression eines endogenen Gens in einer Pflanze ist eine ausreichende Länge von im Wesentlichen unmittelbar aufeinanderfolgenden Nukleotiden einer Nukleinsäuresequenz erforderlich. Um ein „gene silencing” durchzuführen, muss diese nur 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 oder weniger Nukleotide lang sein; sie kann jedoch sogar die Länge des ganzen Gens (einschließlich der 5'- und/oder 3'-UTR, entweder ganz oder teilweise) betragen. Der Abschnitt von im Wesentlichen unmittelbar aufeinanderfolgenden Nukleotiden kann von der Nukleinsäuresequenz, die für das interessierende Protein kodiert (Zielgen) oder von jeglicher Nukleinsäuresequenz, die fähig ist, für ein Ortholog, Paralog oder Homolog des interessierenden Proteins zu kodieren, abstammen. Vorzugsweise ist der Abschnitt der im Wesentlichen unmittelbar aufeinanderfolgenden Nukleotide fähig, mit dem Zielgen (entweder dem sense- oder antisense-Strang) Wasserstoffbrückenbindungen zu bilden; stärker bevorzugt weist der Abschnitt der im Wesentlichen unmittelbar aufeinanderfolgenden Nukleotide eine Sequenzidentität mit dem Zielgen (entweder dem sense- oder antisense-Strang) von mit ansteigender Bevorzugung 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% Sequenzidentität auf. Für die verschiedenen Verfahren, die im vorliegenden Text für die Reduktion oder im Wesentlichen stattfindende Elimination der Expression eines endogenen Gens diskutiert werden, ist eine Nukleinsäuresequenz, die für ein (funktionelles) Polypeptid kodiert, nicht Voraussetzung.For the reduction or substantial elimination of the expression of an endogenous gene in a plant, a sufficient length of essentially immediately successive nucleotides of a nucleic acid sequence is required. To perform gene silencing, this must be only 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 or less nucleotides long; however, it may even be the length of the whole gene (including the 5 'and / or 3' UTR, either in whole or in part). The portion of substantially contiguous nucleotides may be derived from the nucleic acid sequence encoding the protein of interest (target gene) or from any nucleic acid sequence capable of encoding an orthologue, paralogue or homologue of the protein of interest. Preferably, the portion of the substantially contiguous nucleotides is capable of forming hydrogen bonds with the target gene (either the sense or antisense strand); more preferably, the portion of the substantially contiguous nucleotides has a sequence identity to the target gene (either the sense or antisense strand) of increasing preference 50%, 60%, 70%, 80%, 85%, 90%, 95%. , 96%, 97%, 98%, 99%, 100% sequence identity. For the different procedures, the present discussion for the reduction or substantial elimination of the expression of an endogenous gene, a nucleic acid sequence encoding a (functional) polypeptide is not a prerequisite.

Diese Reduktion oder im Wesentlichen stattfindende Elimination der Expression kann unter Verwendung von Routinemaßnahmen und -techniken erzielt werden. Ein Verfahren für die Reduktion oder im Wesentlichen stattfindende Elimination der endogenen Genexpression besteht in RNA-vermitteltem Silencing unter Verwendung einer invertierten Wiederholung einer Nukleinsäuresequenz oder eines Teils davon (in diesem Fall einem Abschnitt von im Wesentlichen aufeinander folgenden Nukleotiden, die von dem interessierenden Gen oder von einer beliebigen Nukleinsäuresequenz, die fähig ist, für ein Ortholog, Paralog oder Homolog des interessierenden Proteins zu kodieren, abstammen), die bzw. der vorzugsweise fähig ist, eine „hairpin”-Struktur auszubilden. Bei einem weiteren Beispiel für ein RNA-Silencing-Verfahren führt man Nukleinsäuresequenzen oder Teile davon (in diesem Fall einen Abschnitt von mit im Wesentlichen unmittelbar aufeinanderfolgenden Nukleotiden, abgeleitet von dem interessierenden Gen oder von einer beliebigen Nukleinsäuresequenz, die fähig ist, für ein Ortholog, Paralog oder Homolog des interessierenden Proteins zu kodieren) in sense-Orientierung in eine Pflanze ein. Bei einem weiteren Beispiel für ein RNA-Silencing-Verfahren verwendet man antisense-Nukleinsäuresequenzen. Ein Gen-Silencing kann auch mittels Insertionsmutagenese (zum Beispiel T-DNA-Insertion oder Transposon-Insertion) oder durch Strategien, wie sie unter anderen bei Angell und Baulcombe ((1999), Plant J. 20(3): 357–62 ), (Amplicon VIGS WO 98/36083 ) oder Baulcombe ( WO 99/15682 ) beschrieben sind, erreicht werden. Der Fachmann wird mit anderen Methoden, wie der Verwendung von Antikörpern, die gegen ein endogenes Polypeptid gerichtet sind, um dessen Funktion in planta zu hemmen, oder dem Eingreifen in den Signalleitungsweg, an dem ein Polypeptid beteiligt ist, gut vertraut sein. Künstliche und/oder natürliche mikroRNAs (miRNAs) können dazu verwendet werden, um ein Knock-Out der Genexpression und/oder mRNA-Translation durchzuführen. Endogene miRNAs sind einzelsträngige kleine RNAs, die typischerweise 19–24 Nukleotide lang sind. Künstliche microRNAs (amiRNAs), die typischerweise 21 Nukleotide lang sind, können dahingehend einem Genetic Engineering unterworfen werden, dass sie spezifisch die Genexpression von einzelnen oder mehreren interessierenden Genen negativ regulieren. Determinanten der pflanzlichen microRNA-Zielauswahl sind in der Fachwelt gut bekannt. Es wurden empirische Parameter für die Zielerkennung definiert, und diese können als Hilfe beim Entwickeln von spezifischen amiRNAs verwendet werden ( Schwab et al., (2005) Dev. Cell 8(4): 517–27 ). Praktische Werkzeuge für die Entwicklung und Erzeugung von amiRNAs und ihren Vorstufen sind ebenfalls für die Allgemeinheit verfügbar ( Schwab et al., (2006) Plant Cell 18(5): 1121–33 ).This reduction or substantial elimination of expression can be achieved using routine measures and techniques. One method for the reduction or substantial elimination of endogenous gene expression is by RNA-mediated silencing using an inverted repeat of a nucleic acid sequence or portion thereof (in this case, a portion of substantially contiguous nucleotides derived from the gene of interest or of any nucleic acid sequence capable of encoding an orthologue, paralogue or homologue of the protein of interest) which is preferably capable of forming a "hairpin" structure. In another example of an RNA silencing method, nucleic acid sequences or portions thereof (in this case, a portion of substantially contiguous nucleotides derived from the gene of interest or from any nucleic acid sequence capable of orthologue, Paralogue or homologue of the protein of interest) in sense orientation into a plant. In another example of an RNA silencing method, antisense nucleic acid sequences are used. Genetic silencing can also be achieved by insertion mutagenesis (for example, T-DNA insertion or transposon insertion) or by strategies such as those used in others Angell and Baulcombe ((1999), Plant J. 20 (3): 357-62 ), (Amplicon VIGS WO 98/36083 ) or Baulcombe ( WO 99/15682 ) are achieved. One skilled in the art will be well versed in other methods, such as the use of antibodies directed against an endogenous polypeptide to inhibit its function in planta, or the intervention in the signal pathway involving a polypeptide. Artificial and / or natural microRNAs (miRNAs) can be used to knock out gene expression and / or mRNA translation. Endogenous miRNAs are single-stranded small RNAs, typically 19-24 nucleotides in length. Artificial microRNAs (amiRNAs), typically 21 nucleotides in length, may be genetically engineered to specifically negatively regulate gene expression of single or multiple genes of interest. Determinants of plant microRNA targeting are well known in the art. Empirical parameters have been defined for target recognition, and these can be used as an aid in developing specific amiRNAs ( Schwab et al., (2005) Dev. Cell 8 (4): 517-27 ). Practical tools for the development and generation of amiRNAs and their precursors are also available to the general public ( Schwab et al., (2006) Plant Cell 18 (5): 1121-33 ).

Für eine optimale Leistung ist bei den Gen-Silencing-Techniken, die für die Reduktion der Expression eines endogenen Gens in einer Pflanze verwendet werden, die Verwendung von Nukleinsäuresequenzen von monokotylen Pflanzen für die Transformation von monokotylen Pflanzen und von Nukleinsäuresequenzen von dikotylen Pflanzen für die Transformation von dikotylen Pflanzen erforderlich. Vorzugsweise wird eine Nukleinsäuresequenz von einer beliebigen Pflanzenart in dieselbe Art eingeführt. So wird zum Beispiel eine Nukleinsäuresequenz aus dem Reis in einer Reispflanze hineintransformiert. Es ist jedoch nicht unbedingt erforderlich, dass die einzuführende Nukleinsäuresequenz von derselben Pflanzenart wie diejenige Pflanze, in die sie eingeführt werden wird, stammt. Es reicht aus, dass eine Art wesentliche Homologie zwischen dem endogenen Zielgen und der einzuführenden Nukleinsäuresequenz besteht.For optimal performance, gene silencing techniques used to reduce the expression of an endogenous gene in a plant include the use of monocotyledonous nucleic acid sequences for the transformation of monocotyledonous plants and of dicotyledonous nucleic acid sequences for transformation required by dicotyledonous plants. Preferably, a nucleic acid sequence of any plant species is introduced in the same manner. For example, a nucleic acid sequence is transformed from the rice into a rice plant. However, it is not essential that the nucleic acid sequence to be introduced be from the same plant species as the plant into which it will be introduced. It is sufficient that there is some sort of substantial homology between the endogenous target gene and the nucleic acid sequence to be introduced.

Im obigen Text sind Beispiele für verschiedene Verfahren für die Reduktion oder im Wesentlichen stattfindende Elimination der Expression eines endogenen Gens in einer Pflanze beschrieben. Ein Fachmann wäre leicht fähig, die oben genannten Silencing-Verfahren dahingehend zu adaptieren, dass eine Reduktion der Expression eines endogenen Gens in einer ganzen Pflanze oder in Teilen davon durch die Verwendung von z. B. einem entsprechenden Promoter erzielt wird.In the above text, examples of various methods for the reduction or substantial elimination of the expression of an endogenous gene in a plant are described. A person skilled in the art would readily be able to adapt the abovementioned silencing methods in such a way that a reduction of the expression of an endogenous gene in a whole plant or in parts thereof by the use of e.g. B. a corresponding promoter is achieved.

Selektionsmarker(gen)/ReportergenSelection markers (gen) / reporter

„Selektionsmarker”, „Selektionsmarkergen” oder „Reportergen” beinhaltet jegliches Gen, das einer Zelle, in der es exprimiert wird, um die Identifikation und/oder Selektion von Zellen, die mit einem erfindungsgemäßen Nukleinsäuresequenzkonstrukt transfiziert sind oder transformiert sind, zu erleichtern, einen Phänotyp verleiht. Mit diesen Markergenen kann ein erfolgreicher Transfer der Nukleinsäuresequenzmoleküle mittels einer Reihe von unterschiedlichen Prinzipien identifiziert werden. Geeignete Marker können aus Markern ausgewählt werden, die Antibiotika- oder Herbizidresistenz verleihen, die ein neues Stoffwechselmerkmal einführen oder die eine visuelle Selektion gestatten. Zu Selektionsmarkergenen zählen zum Beispiel Gene, die Resistenz gegen Antibiotika (wie nptII, das Neomycin und Kanamycin phosphoryliert, oder hpt, das Hygromycin phosphoryliert, oder Gene, die Resistenz gegen zum Beispiel Bleomycin, Streptomycin, Tetracyclin, Chloramphenicol, Ampicillin, Gentamycin, Geneticin (G418), Spectinomycin oder Blasticidin verleihen), gegen Herbizide (zum Beispiel bar, das Resistenz gegen Basta^® vermittelt; aroA oder gox, die Resistenz gegen Glyphosate vermitteln, oder die Gene, die Resistenz gegen z. B. Imidazolinon, Phosphinothricin oder Sulfonylharnstoff verleihen), oder Gene, die ein Stoffwechselmerkmal bereitstellen (wie manA, das es Pflanzen ermöglicht, Mannose als einzige Kohlenstoffquelle zu verwerten, oder Xyloseisomerase für die Verwertung von Xylose, oder Antinährstoffmarker, wie Resistenz gegen 2-Desoxyglucose), vermitteln. Die Expression von visuellen Markergenen führt zur Bildung von Farbe (zum Beispiel β-Glucuronidase, GUS oder β-Galactosidase mit ihren gefärbten Substraten, zum Beispiel X-Gal), Lumineszenz (wie das Luziferin/Luziferase-System) oder Fluoreszenz (Green Fluorescent Protein, GFP, und seine Derivate). Diese Aufzählung stellt nur eine kleine Anzahl von möglichen Markern dar. Der Fachmann ist mit solchen Markern vertraut. Je nach dem Organismus und dem Selektionsverfahren werden unterschiedliche Marker bevorzugt."Selection marker", "selection marker gene" or "reporter gene" includes any gene which is a cell in which it is expressed to facilitate the identification and / or selection of cells transfected or transformed with a nucleic acid sequence construct according to the invention Confers phenotype. With these marker genes, successful transfer of the nucleic acid sequence molecules can be identified by a number of different principles. Suitable markers may be selected from markers conferring antibiotic or herbicide resistance, introducing a novel metabolic trait or allowing for visual selection. Selection marker genes include, for example, genes that are resistant to antibiotics (such as nptII, which phosphorylates neomycin and kanamycin, or hpt, which phosphorylates hygromycin, or genes that are resistant to, for example, bleomycin, streptomycin, tetracycline, Chloramphenicol, ampicillin, gentamycin, geneticin (G418), spectinomycin or blasticidin confer), to herbicides (for example bar which provides resistance to Basta ^®; aroA or gox providing resistance against glyphosate, or the genes conferring resistance to such. Imidazolinone, phosphinothricin or sulfonylurea), or genes that provide a metabolic trait (such as mana that allows plants to utilize mannose as their sole carbon source, or xylose isomerase for the utilization of xylose, or anti-nutrient markers such as resistance to 2-deoxyglucose ), convey. Expression of visual marker genes results in the formation of color (e.g., β-glucuronidase, GUS or β-galactosidase with their stained substrates, for example, X-gal), luminescence (such as the luciferin / luciferase system), or fluorescence (Green Fluorescent Protein , GFP, and its derivatives). This list represents only a small number of possible markers. The person skilled in the art is familiar with such markers. Depending on the organism and the selection method, different markers are preferred.

Es ist bekannt, dass bei der stabilen oder transienten Integration von Nukleinsäuresequenzen in Pflanzenzellen nur ein kleiner Teil der Zellen die Fremd-DNA aufnimmt und gewünschtenfalls in ihr Genom integriert, was von dem verwendeten Expressionsvektor und der verwendeten Transfektionstechnik abhängt. Um diese Integranten zu identifizieren und auszuselektieren, wird üblicherweise ein Gen, das für einen Selektionsmarker (wie die oben beschriebenen) kodiert, gemeinsam mit dem interessierenden Gen in die Wirtszellen eingebracht. Diese Marker können zum Beispiel bei Mutanten verwendet werden, in denen diese Gene nichtfunktionell sind, und zwar zum Beispiel durch Deletion mit traditionellen Verfahren. Weiterhin können Nukleinsäuresequenzmoleküle, die für einen Selektionsmarker kodieren, in einer Wirtszellen auf demselben Vektor, der die Sequenz, die die erfindungsgemäßen Polypeptide oder die bei den erfindungsgemäßen Verfahren verwendeten Polypeptide kodiert, umfasst, oder auch in einem separaten Vektor in eine Wirtszelle eingeführt werden. Zellen, die mit der eingeführten Nukleinsäuresequenz stabil transfiziert worden sind, können zum Beispiel durch Selektion identifiziert werden (zum Beispiel überleben Zellen, die den Selektionsmarker integriert haben, während die anderen Zellen absterben).It is known that in stable or transient integration of nucleic acid sequences in plant cells, only a small portion of the cells will take up the foreign DNA and, if desired, integrate into its genome, depending on the expression vector used and the transfection technique used. To identify and select these integrants, a gene encoding a selection marker (such as those described above) is commonly introduced into the host cells together with the gene of interest. These markers can be used, for example, in mutants in which these genes are non-functional, for example by deletion with traditional methods. Furthermore, nucleic acid sequence molecules which code for a selection marker can be introduced into a host cell on the same vector which encodes the sequence which codes for the polypeptides according to the invention or the polypeptides used in the method according to the invention, or also in a separate vector in a host cell. For example, cells stably transfected with the introduced nucleic acid sequence can be identified by selection (for example, cells that have integrated the selection marker survive while the other cells die).

Da, sobald die Nukleinsäuresequenzen erfolgreich eingeführt worden sind, die Markergene, insbesondere Gene für Resistenz gegen Antibiotika und Herbizide, in der transgenen Wirtszelle nicht mehr erforderlich sind oder unerwünscht sind, werden bei dem erfindungsgemäßen Verfahren für die Einführung der Nukleinsäuresequenzen vorteilhaft Techniken verwendet, die die Entfernung oder das Herausschneiden dieser Markergene gestatten. Eines dieser Verfahren ist die so genannten Cotransformation. Bei dem Cotransformationsverfahren werden zwei Vektoren gleichzeitig für die Transformation verwendet, wobei ein Vektor die erfindungsgemäße Nukleinsäuresequenz trägt und ein zweiter Vektor das Markergen bzw. die Markergene trägt. Ein Großteil der Transformanten erhält oder, im Fall von Pflanzen, umfasst (bis zu 40% oder mehr der Transformanten) beider Vektoren. Bei der Transformation mit Agrobakterien erhalten die Transformanten üblicherweise nur einen Teil des Vektors, d. h. diejenige Sequenz, die von der T-DNA flankiert ist, die üblicherweise die Expressionskassette darstellt. Die Markergene können anschließend von der transformierten Pflanze mittels Kreuzen entfernt werden. Bei einem anderen Verfahren werden für die Transformation Markergene, die in ein Transposon integriert sind, gemeinsam mit der gewünschten Nukleinsäuresequenz eingesetzt (dies ist unter der Bezeichnung Ac/Ds-Technologie bekannt). Die Transformanten können mit einer Transposasequelle gekreuzt werden, oder die Transformanten werden mit einem Nukleinsäuresequenzkonstrukt, das transient oder stabil die Expression einer Transposase vermittelt, transformiert. In manchen Fällen (ungefähr 10%) springt das Transposon, sobald die Transformation erfolgreich stattgefunden hat, aus dem Genom der Wirtszelle heraus und geht verloren. In einer weiteren Anzahl von Fällen springt das Transposon an einen anderen Locus. In diesen Fällen muss das Markergen durch Kreuzen entfernt werden. In der Mikrobiologie wurden Techniken entwickelt, die den Nachweis solcher Ereignisse möglich machen oder erleichtern. Ein weiteres vorteilhaftes Verfahren beruht auf den so genannten Rekombinationssystemen, deren Vorteil darin besteht, dass ein Entfernen durch Kreuzen nicht erforderlich ist. Das bekannteste System dieses Typs ist unter der Bezeichnung Cre/Iox-System bekannt. Cre1 ist eine Rekombinase, die die Sequenzen, die sich zwischen den IoxP-Sequenzen befinden, entfernt. Ist das Markergen zwischen den IoxP-Sequenzen integriert, so wird es, sobald die Transformation erfolgreich stattgefunden hat, durch Expression der Rekombinase entfernt. Weitere Rekombinationssysteme sind das HIN/HIX-, FLP/FRT- und REP/STB-System ( Tribble et al, J. Biol. Chem., 275, 2000: 22255–22267 ; Velmurugan et al, J. Cell Biol., 149, 2000: 553–566 ). Eine ortsspezifische Integration der erfindungsgemäßen Nukleinsäuresequenzen in das Pflanzengenom ist möglich. Natürlich können diese Verfahren auch auf Mikroorganismen wie Hefe, Pilze oder Bakterien angewandt werden.Since, once the nucleic acid sequences have been successfully introduced, the marker genes, in particular genes for resistance to antibiotics and herbicides, are no longer required or undesirable in the transgenic host cell, the method according to the invention advantageously uses techniques for the introduction of the nucleic acid sequences Allow removal or excision of these marker genes. One of these methods is the so-called cotransformation. In the cotransformation method, two vectors are used simultaneously for the transformation, one vector carrying the nucleic acid sequence according to the invention and a second vector carrying the marker gene or the marker genes. Much of the transformant is maintained or, in the case of plants, comprises (up to 40% or more of the transformants) of both vectors. In the transformation with Agrobacteria, the transformants usually receive only a part of the vector, ie the sequence flanked by the T-DNA, which usually represents the expression cassette. The marker genes can then be removed from the transformed plant by crossing. In another method, marker genes incorporated into a transposon are used together with the desired nucleic acid sequence for the transformation (this is known as Ac / Ds technology). The transformants can be crossed with a transposase source, or the transformants are transformed with a nucleic acid sequence construct which transiently or stably mediates the expression of a transposase. In some cases (about 10%), once the transformation has been successful, the transposon jumps out of the genome of the host cell and is lost. In a further number of cases, the transposon jumps to another locus. In these cases, the marker gene must be removed by crossing. Techniques have been developed in microbiology that make it possible or easier to detect such events. Another advantageous method is based on the so-called recombination systems, the advantage of which is that removal by crossing is not required. The best known system of this type is known as the Cre / Iox system. Cre1 is a recombinase that removes the sequences located between the IoxP sequences. If the marker gene is integrated between the IoxP sequences, it will be removed by expression of the recombinase once the transformation has been successful. Further recombination systems are the HIN / HIX, FLP / FRT and REP / STB systems ( Tribble et al, J. Biol. Chem., 275, 2000: 22255-22267 ; Velmurugan et al, J. Cell Biol., 149, 2000: 553-566 ). A site-specific integration of the nucleic acid sequences of the invention in the plant genome is possible. Of course, these methods can also be applied to microorganisms such as yeast, fungi or bacteria.

Transgen/transgen/rekombinantTransgenic / transgenic / recombinant

Im Zusammenhang mit der vorliegenden Erfindung bedeutet „transgen”, „Transgen” oder „rekombinant” eine Nukleinsäuresequenz, eine Expressionskassette, ein Genkonstrukt oder einen Vektor umfassend die Nukleinsäuresequenz oder einen Organismus, der mit den erfindungsgemäßen Nukleinsäuresequenzen, Expressionskassetten oder Vektoren transformiert ist, wobei alle diese Konstrukte mittels rekombinanter Verfahren entstehen, in denen entweder

• (a) die Nukleinsäuresequenzen für Proteine kodieren, die bei den erfindungsgemäßen Verfahren nützlich sind, oder
• (b) genetische Kontrollsequenz(en) in operativer Verknüpfung mit der erfindungsgemäßen Nukleinsäuresequenz, zum Beispiel einem Promoter, oder
• (c) a) und b)

• (a) the nucleic acid sequences encode proteins useful in the methods of the invention, or
• (B) genetic control sequence (s) in operative association with the nucleic acid sequence of the invention, for example a promoter, or
• (c) a) and b)

Unter einen transgenen Pflanze versteht man im Zusammenhang mit der vorliegenden Erfindung wie oben, dass die bei dem erfindungsgemäßen Verfahren verwendeten Nukleinsäuresequenzen nicht an ihrem natürlichen Locus im Genom dieser Pflanze vorliegen, wobei die Nukleinsäuresequenzen homolog oder heterolog exprimiert werden können. Wie erwähnt bedeutet transgen auch, dass die Sequenz in Bezug auf die natürliche Sequenz modifiziert worden ist und/oder dass die Regulationssequenzen der natürlichen Sequenzen modifiziert worden sind, obwohl die erfindungsgemäßen Nukleinsäuresequenzen oder die Nukleinsäuresequenzen, die in dem erfindungsgemäßen Verfahren verwendet werden, in ihrer natürlichen Position im Genom einer Pflanze vorliegen. Transgen bedeutet vorzugsweise die Expression der erfindungsgemäßen Nukleinsäuresequenzen an einem unnatürlichen Locus in dem Genom, d. h. dass eine homologe, oder vorzugsweise, heterologe Expression der Nukleinsäuresequenzen stattfindet. Bevorzugte transgene Pflanze werden im vorliegenden Text erwähnt.As used herein, a transgenic plant is understood to mean that the nucleic acid sequences used in the method of the invention are not present at their natural locus in the genome of that plant, which nucleic acid sequences can be expressed homologously or heterologously. As mentioned, transgene also means that the sequence has been modified relative to the natural sequence and / or that the regulatory sequences of the natural sequences have been modified, although the nucleic acid sequences of the invention or the nucleic acid sequences used in the method of the invention are in their natural state Position in the genome of a plant. Transgene preferably means the expression of the nucleic acid sequences of the invention at an unnatural locus in the genome, i. H. that a homologous, or preferably, heterologous expression of the nucleic acid sequences takes place. Preferred transgenic plants are mentioned herein.

Transformationtransformation

Der Begriff „Einführung” oder „Transformation” umfassen im vorliegenden Zusammenhang den Transfer eines Fremdpolynukleotids in eine Wirtszelle, und zwar unabhängig von dem für den Transfer eingesetzten Verfahren. Pflanzengewebe, das anschließend durch Klonieren vermehrt werden kann, egal ob durch Organogenese oder Embryogenese, kann mit einem erfindungsgemäßen Genkonstrukt transformiert werden und eine ganze Pflanze daraus regeneriert werden. Das jeweilige ausgewählte Gewebe hängt von den jeweiligen Klonierungsvermehrungssytemen ab, die für die jeweilige zu transformierende Art verfügbar und am besten geeignet sind. Zu Zielgeweben zählen zum Beispiel Blattscheiben, Pollen, Embryonen, Kotyledonen, Hypokotyle, Megagametophyten, Kallusgewebe, existierendes Meristemgewebe (z. B. Apikalmeristem, Achelknospen und Wurzelmeristeme) und induziertes Meristemgewebe (z. B. Kotyledonenmeristem und Hypokotylmeristem). Das Polynukleotid kann in. eine Wirtszelle transient oder stabil eingeführt werden und kann in nichtintegrierter Form, zum Beispiel als Plasmid, aufrechterhalten werden. Es kann jedoch auch in das Wirtsgenom integriert werden. Mit den erhaltenen transformierten Pflanzenzellen kann man dann eine transformierte Pflanze auf fachbekannte Art und Weise regenerieren.The term "introduction" or "transformation" in the present context encompasses the transfer of a foreign polynucleotide into a host cell, regardless of the method used for the transfer. Plant tissue, which can subsequently be propagated by cloning, whether by organogenesis or embryogenesis, can be transformed with a gene construct according to the invention and an entire plant can be regenerated therefrom. The particular tissue selected will depend on the particular cloning propagation systems that are available and most suitable for the particular species being transformed. Target tissues include, for example, leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristem tissue (eg, apical meristem, achy buds, and root meristems), and induced meristem tissue (eg, cotyledon meristem and hypocotyl meristem). The polynucleotide may be transiently or stably introduced into a host cell and may be maintained in unintegrated form, for example as a plasmid. However, it can also be integrated into the host genome. The transformed plant cells obtained can then be used to regenerate a transformed plant in a manner known to those skilled in the art.

Der Transfer von Fremdgenen in das Genom einer Pflanze wird Transformation genannt. Die Transformation von Pflanzenarten ist heutzutage eine ziemliche Routineangelegenheit. Um das interessierende Gen in eine geeignete Vorfahrenzelle einzuführen, kann vorteilhafterweise irgendeine von verschiedenen Transformationsmethoden eingesetzt werden. Die für die Transformation und Regeneration von Pflanzen aus Pflanzengeweben oder Pflanzenzellen beschriebenen Methoden können für die transiente oder für die stabile Transformation eingesetzt werden. Zu Transformationsmethoden zählen die Verwendung von Liposomen, die Elektroporation, Chemikalien, die die freie DNA-Aufnahme verstärken, die Injektion der DNA direkt in die Pflanze, der Beschuss mit der Genkanone, die Transformation mit Viren oder Pollen und die Mikroprojektion. Die Methoden können aus den folgenden ausgewählt werden: Calcium/Polyethylenglycol-Methode für Protoplasten ( Krens, F. A. et al, (1982), Nature 296, 72–74 ; Negrutiu I et al, (1987), Plant Mol. Biol. 8: 363–373 ); Elektroporation von Protoplasten ( Shillito R. D. et al, (1985), Bio/Technol. 3, 1099–1102 ); Mikroinjektion in Pflanzenmaterial ( Crossway A et al, (1986), Mol. Gen. Genet. 202: 179–185 ); Beschuss mit mit DNA oder RNA beschichteten Partikeln ( Klein TM et al, (1987), Nature 327: 70 ), Infektion mit (nichtintegrierenden) Viren und dergleichen. Transgene Pflanzen, darunter auch transgene Kulturpflanzen, werden vorzugsweise mittels Agrobacterium-vermittelter Transformation erzeugt. Eine vorteilhafte Transformationsmethode ist die Transformation in planta. Zu diesem Zweck kann man zum Beispiel die Agrobakterien auf Pflanzensamen einwirken lassen oder das Pflanzenmeristem mit Agrobakterien inokulieren. Erfindungsgemäß hat sich besonders günstig erwiesen, eine Suspension von transformierten Agrobakterien auf die intakte Pflanze oder zumindest die Blütenprimordien einwirken zu lassen. Die Pflanze wird anschließend weiter herangezogen, bis man die Samen der behandelten Pflanze erhält ( Clough und Bent, Plant J. (1998), 16, 735–743 ). Zu den Methoden für die Agrobacterium-vermittelte Transformation des Reises zählen gut bekannte Methoden für die Reistransformation, wie diejenigen, die in einer der folgenden Schriften beschrieben sind: Europäische Patentanmeldung EP 1198985 A1 , Aldemita und Hodges (Planta 199: 612–617, 1996) ; Chan et al, (Plant Mol. Biol. 22 (3): 491–506, 1993) , Hiei et al, (Plant J. 6 (2): 271–282, 1994) , die hiermit durch Bezugnahme als ob vollständig beschrieben in den vorliegenden Text aufgenommen werden. Bei der Transformation des Maises ist die bevorzugte Methode entweder wie bei Ishida et al, (Nat. Biotechnol. 14(6): 745–50, 1996) oder bei Frame et al, (Plant Physiol. 129(1): 13–22, 2002) beschrieben, die hiermit durch Bezugnahme als ob vollständig beschrieben in den vorliegenden Text aufgenommen werden. Diese Methoden sind weiterhin zum Beispiel bei B. Jenes et al, Techniques for Gene Transfer, in: Transgenic Plants, Band 1, Engineering and Utilization, Hrsg. S. D. Kung und R. Wu, Academic Press (1993), 128–143 und in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205–225 ) beschrieben. Die zu exprimierenden Nukleinsäuresequenzen bzw. das zu exprimierende Konstrukt werden/wird vorzugsweise in einen Vektor kloniert, der sich für die Transformation von Agrobacterium tumefaciens eignet, zum Beispiel pBin19 ( Bevan et al, Nucl. Acids Res. 12 (1984) 8711 ). Agrobakterien, die mit solch einem Vektor transformiert wurden, können dann auf bekannte Weise für die Transformation von Pflanzen eingesetzt werden, wie Pflanzen, die als Modell verwendet werden, wie Arabidopsis (Arabidopsis thaliana zählt im Zusammenhang mit der vorliegenden Erfindung nicht als Kulturpflanze), oder Kulturpflanzen, wie zum Beispiel Tabakpflanzen, und zwar zum Beispiel dadurch, dass man verletzte Blätter oder zerkleinerte Blätter in einer Agrobakterienlösung badet und sie dann in geeigneten Medien kultiviert. Die Transformation von Pflanzen mittels Agrobacterium tumefaciens wird zum Beispiel bei Höfgen und Willmitzer in Nucl. Acid Res. (1988), 16, 9877 beschrieben oder ist unter anderem aus F. F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Band 1, Engineering and Utilization, Hrsg. S. D. Kung und R. Wu, Academic Press, 1993, S. 15–38 bekannt.The transfer of foreign genes into the genome of a plant is called transformation. The transformation of plant species is quite a routine matter nowadays. To introduce the gene of interest into a suitable ancestral cell, any of various transformation methods can be advantageously employed. The methods described for the transformation and regeneration of plants from plant tissues or plant cells can be used for transient or stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that enhance free DNA uptake, injection of DNA directly into the plant, gene gun bombardment, virus or pollen transformation, and microprojection. The methods can be selected from the following: Calcium / polyethylene glycol method for protoplasts ( Krens, FA et al, (1982), Nature 296, 72-74 ; Negrutiu I et al, (1987), Plant Mol. Biol. 8: 363-373 ); Electroporation of protoplasts ( Shillito RD et al, (1985), Bio / Technol. 3, 1099-1102 ); Microinjection in plant material ( Crossway A et al, (1986), Mol. Genet. 202: 179-185 ); Bombardment with DNA or RNA coated particles ( Klein TM et al, (1987), Nature 327: 70 ), Infection with (non-integrating) viruses and the like. Transgenic plants, including transgenic crops, are preferably produced by Agrobacterium-mediated transformation. An advantageous transformation method is transformation into planta. For this purpose, for example, the agrobacteria can be allowed to act on plant seeds or to inoculate the plant meristem with agrobacteria. According to the invention, it has proved particularly favorable to allow a suspension of transformed agrobacteria to act on the intact plant or at least the flower primordia. The plant is then further grown until the seeds of the treated plant are obtained ( Clow and Bent, Plant J. (1998), 16, 735-743 ). Methods for Agrobacterium-mediated transformation of rice include well-known methods of rice transformation, such as those described in any of the following references: European Patent Application EP 1198985 A1 . Aldemita and Hodges (Planta 199: 612-617, 1996) ; Chan et al, (Plant Mol. Biol. 22 (3): 491-506, 1993) . Hiei et al, (Plant J. 6 (2): 271-282, 1994) , which are hereby incorporated by reference as if fully set forth in the present text. In the transformation of maize, the preferred method is either as in Ishida et al, (Nat. Biotechnol., 14 (6): 745-50, 1996) or at Frame et al, (Plant Physiol. 129 (1): 13-22, 2002) which are hereby incorporated by reference as if fully set forth in the present specification. These methods are still included, for example Genes Transfer, Transgenic Plants, Vol. 1, Engineering and Utilization, eds. SD Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205-225 ). The nucleic acid sequences to be expressed or the construct to be expressed is / are preferably cloned into a vector which is suitable for the transformation of Agrobacterium tumefaciens, for example pBin19 (FIG. Bevan et al, Nucl. Acids Res. 12 (1984) 8711 ). Agrobacteria transformed with such a vector can then be used in a known manner for the transformation of plants, such as plants used as a model, such as Arabidopsis (Arabidopsis thaliana is not counted as a crop in the context of the present invention), or Crop plants, such as tobacco plants, for example, by bathing injured leaves or crushed leaves in an Agrobakterienlösung and then cultivated in suitable media. The transformation of plants by means of Agrobacterium tumefaciens is, for example, in Hofgen and Willmitzer in Nucl. Acid Res. (1988), 16, 9877 described or is among others FF White, Vectors for Gene Transfer to Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, Ed. SD Kung and R. Wu, Academic Press, 1993, pp. 15-38 known.

Zusätzlich zu der Transformation von somatischen Zellen, die dann zu intakten Pflanzen regeneriert werden müssen, kann man auch Zellen von pflanzlichen Meristemen transformieren, insbesondere solche Zellen, die sich zu Gameten entwickeln. In diesem Fall folgen die transformierten Gameten der natürlichen Pflanzenentwicklung und ergeben tansgene Pflanze. So werden zum Beispiel Samen von Arabidopsis mit Agrobakterien behandelt, und man erhält von den sich entwickelnden Pflanzen, von denen ein gewisser Teil transformiert und daher transgen ist, Samen [ Feldman, KA und Marks MD (1987). Mol. Gen. Genet. 208: 274–289 ; Feldmann K (1992). In: C Koncz, N-H Chua und J Shell, Hrsg., Methods in Arabidopsis Research. Word Scientific, Singapur, S. 274–289 ]. Andere Methoden beruhen auf der wiederholten Entfernung der Infloreszenzen und Inkubation der Exzisionsstelle in der Mitte der Rosette mit transformierten Agrobakterien, wodurch ebenfalls später transformierte Samen erhalten werden können ( Chang (1994). Plant J. 5: 551–558; Katavic (1994). Mol. Gen. Genet., 245: 363–370 ). Eine besonders wirksame Methode ist jedoch die Vakuuminfiltrationsmethode mit ihren Modifikationen, wie der „floral dip”-Methode. Bei der Vakuuminfiltration von Arabidopsis werden intakte Pflanzen unter verringertem Druck mit einer Agrobakteriensuspension behandelt [ Bechthold, N (1993). C. R. Acad. Sci. Paris Life Sci., 316: 1194–1199 ], während bei der „floral dip”-Methode das sich entwickelnde Blütengewebe kurz mit einer mit Tensid behandelten Agrobakteriensuspension inkubiert wird [ Clough, SJ und Bent AF (1998), The Plant J. 16, 735–743 ]. Ein gewisser Anteil transgener Samen wird in beiden Fällen geerntet, und diese Samen lassen sich von nichttransgenen Samen dadurch unterscheiden, dass man sie unter den oben beschriebenen Selektionsbedingungen heranzieht. Außerdem ist die stabile Transformation von Plastiden vorteilhaft, da Plastide bei den meisten Kulturpflanzen mütterlich vererbt werden, wodurch die Gefahr des Transgenflusses durch Pollen reduziert oder eliminiert wird. Die Transformation des Chloroplastengenoms erfolgt im Allgemeinen durch ein Verfahren, das schematisch bei Klaus et al, 2004, [Nature Biotechnology 22 (2), 225–229 ] gezeigt wurde. Kurz gesagt werden die zu transformierenden Sequenzen gemeinsam mit einem Selektionsmarkergen zwischen flankierende Sequenzen, die zu dem Chloroplastengenom homolog sind, kloniert. Diese homologen flankierenden Sequenzen dirigieren die ortsgerichtete Integration in das Plastom. Die Plastidentransformation ist für viele unterschiedliche Pflanzenarten beschrieben worden, und eine Übersicht findet sich bei Bock (2001) Transgenic plastids in basic research and plant biotechnology. J. Mol. Biol. 2001 Sept. 21; 312 (3): 425–38 oder Maliga, P (2003), Progress towards commercialization of plastid transformation technology. Trends Biotechnol. 21, 20–28 . Über einen weiteren Fortschritt in der Biotechnologie ist in jüngster Zeit in Form von markerfreien Plastidentransformanten, die durch ein transientes cointegriertes Markergen erzeugt werden können, berichtet worden ( Klaus et al, 2004, Nature Biotechnology 22(2), 225–229 ).In addition to the transformation of somatic cells, which then have to be regenerated to intact plants, one can also transform cells of plant meristems, especially those cells that develop into gametes. In this case, the transformed gametes follow the natural plant development and yield the transgenic plant. For example, seeds of Arabidopsis are treated with Agrobacteria, and seed of the developing plants, some of which are transformed and therefore transgenic, is obtained. Feldman, KA and Marks MD (1987). Mol. Gen. Genet. 208: 274-289 ; Feldmann K (1992). In: C Koncz, NH Chua and J Shell, eds., Methods in Arabidopsis Research. Word Scientific, Singapore, pp. 274-289 ]. Other methods are based on the repeated removal of the inflorescences and incubation of the excision site in the middle of the rosette with transformed agrobacteria, whereby subsequently later transformed seeds can be obtained ( Chang (1994). Plant J. 5: 551-558; Katavic (1994). Mol. Gen. Genet., 245: 363-370 ). A particularly effective method, however, is the vacuum infiltration method with its modifications, such as the "floral dip" method. In Arabidopsis vacuum infiltration, intact plants are treated under reduced pressure with an Agrobacterium suspension [ Bechthold, N (1993). CR Acad. Sci. Paris Life Sci., 316: 1194-1199 ], while in the "floral dip" method, the developing flower tissue is incubated briefly with a surfactant-treated Agrobacterium suspension [ Clow, SJ and Bent AF (1998), The Plant J. 16, 735-743 ]. A certain proportion of transgenic seeds are harvested in both cases, and these seeds can be differentiated from non-transgenic seeds by using them under the selection conditions described above. In addition, the stable transformation of plastids is advantageous because plastids are maternally inherited in most crops, thereby reducing or eliminating the danger of transgene flow through pollen. The transformation of the chloroplast genome is generally carried out by a method which is schematically in Klaus et al, 2004, [Nature Biotechnology 22 (2), 225-229 ] was shown. Briefly, the sequences to be transformed are cloned together with a selection marker gene between flanking sequences homologous to the chloroplast genome. These homologous flanking sequences direct the site-directed integration into the plastome. Plastid transformation has been described for many different plant species, and an overview is found at Bock (2001) Transgenic plastids in basic research and plant biotechnology. J. Mol. Biol. 2001 Sept. 21; 312 (3): 425-38 or Maliga, P (2003), Progress towards commercialization of plastid transformation technology. Trends Biotechnol. 21, 20-28 , Further progress in biotechnology has recently been reported in the form of label-free plastid transformants that can be generated by a transient cointegrate marker gene ( Klaus et al, 2004, Nature Biotechnology 22 (2), 225-229 ).

T-DNA-Aktivierungs-TaggingT-DNA activation tagging

T-DNA-Aktivierungs-Tagging ( Hayashi et al, Science (1992), 1350–1353 ) beinhaltet die Insertion von T-DNA, die üblicherweise einen Promoter (kann auch ein Translationserhöher oder ein Intron sein) enthält, in die Genomregion des interessierenden Gens oder 10 kB stromaufwärts oder stromabwärts von der Kodierregion eines Gens in solch einer Anordnung, dass der Promoter die Expression des Zielgens dirigiert. Typischerweise wird die Regulation der Expression des Zielgens unterbrochen, und das Gen gelangt unter die Kontrolle des neu eingeführten Promoters. Typischerweise ist der Promoter in eine T-DNA eingebettet. Diese T-DNA wird in das pflanzliche Genom zufallsmäßig insertiert, zum Beispiel mittel Agrobacferium-Infektion, und führt zu einer modifizierten Expression von Genen in der Nähe der inserierten T-DNA. Die entstehenden transgenen Pflanzen weisen aufgrund der modifizierten Expression von Genen in der Nähe des eingeführten Promoters dominante Phänotypen auf.T-DNA activation tagging ( Hayashi et al, Science (1992), 1350-1353 ) includes the insertion of T-DNA, which usually contains a promoter (may also be a translation enhancer or an intron) into the genome region of the gene of interest or 10 kb upstream or downstream of the coding region of a gene in such an arrangement that the promoter directs the expression of the target gene. Typically, the regulation of the expression of the target gene is interrupted, and the gene comes under the control of the newly introduced promoter. Typically, the promoter is embedded in a T-DNA. This T-DNA is randomly inserted into the plant genome, for example, by means of Agrobacterium infection, and results in modified expression of genes in the vicinity of the inserted T-DNA. The resulting transgenic plants have dominant phenotypes due to the modified expression of genes in the vicinity of the introduced promoter.

TILLINGTILLING

Der Begriff „TILLING” ist eine Abkürzung von „Targeted Induced Local Lesions In Genomes” und bezieht sich auf eine Mutagenesetechnologie, die sich dazu eignet, Nukleinsäuresequenzen, die für Proteine mit modifizierter Expression und/oder Aktivität kodieren, zu erzeugen und/oder zu identifizieren. TILLING ermöglicht auch die Selektion von Pflanzen, die solche Mutantenvarianten tragen. Diese Mutantenvarianten können eine modifizierte Expression aufweisen, und zwar entweder bezüglich der Stärke oder der Lokalisierung oder des Zeitpunkts (wenn die Mutationen zum Beispiel den Promoter betreffen). Diese Mutantenvarianten können eine höhere Aktivität aufweisen als sie von dem Gen in seiner natürlichen Form aufgewiesen wird. Beim TILLING wird Mutagenese in hoher Dichte mit Screening-Methoden mit hohem Durchsatz kombiniert. Die Schritte, die beim TILLING typischerweise durchlaufen werden, lauten: (a) EMS-Mutagenese ( Redei GP und Koncz C (1992), In Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, Hrsg. Singapur, World Scientific Publishing Co, S. 16–82 ; Feldmann et al, (1994) In Meyerowitz EM, Somerville CR, Hrsg, Arabidopsis. Cold Spring Harbor Laborstory Press, Cold Spring Harbor, NY, S. 137–172 ; Lightner J und Caspar T (1998), In J Martinez-Zapater, J Salinas, Hrsg., Methods an Molecular Biology, Band 82. Humana Press, Totowa, NJ, S. 91–104 ); (b) DNA-Herstellung und Poolen von Individuen; (c) PCR-Amplifikation einer interessierenden Region; (d) Denaturieren und Annealing, um die Bildung von Heteroduplexen zu ermöglichen; (e) DHPLC, wo das Vorhandensein eines Heteroduplex in einem Pool als zusätzlicher Peak im Chromatogramm nachgewiesen wird; (f) Identifizieren der einzelnen Mutante; und (g) Sequenzieren des PCR-Produkts der Mutante. TILLING-Methoden sind in der Fachwelt gut bekannt ( McCallum et al, (2000), Nat. Biotechnol. 18: 455–457 ; in einem Übersichtsartikel von Stemple (2004), Nat. Rev. Genet. 5(2): 145–50 ) erwähnt.The term "TILLING" is an abbreviation of "Targeted Induced Local Lesions In Genomes" and refers to a mutagenesis technology that is capable of generating and / or identifying nucleic acid sequences encoding proteins having modified expression and / or activity , TILLING also allows the selection of plants bearing such mutant variants. These mutant variants may have modified expression, either in terms of potency or localization or timing (for example, if the mutations concern the promoter). These mutant variants may have higher activity than that exhibited by the gene in its natural form. TILLING combines high density mutagenesis with high throughput screening methods. The steps typically followed in TILLING are: (a) EMS mutagenesis ( Redei GP and Koncz C (1992), In Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, eds. Singapore, World Scientific Publishing Co, pp. 16-82 ; Feldmann et al, (1994) In Meyerowitz EM, Somerville CR, Eds, Arabidopsis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 137-172 ; Lightner J and Caspar T (1998), In J Martinez-Zapater, J Salinas, eds., Methods on Molecular Biology, Vol. 82. Humana Press, Totowa, NJ, pp. 91-104 ); (b) DNA production and pooling of individuals; (c) PCR amplification of a region of interest; (d) denaturing and annealing to allow the formation of heteroduplexes; (e) DHPLC, where the presence of a heteroduplex in a pool is detected as an additional peak in the chromatogram; (f) identifying the single mutant; and (g) sequencing the PCR product of the mutant. TILLING methods are well known in the art ( McCallum et al, (2000), Nat. Biotechnol. 18: 455-457 ; in a review article from Stemple (2004), Nat. Rev. Genet. 5 (2): 145-50 ) mentioned.

Homologe RekombinationHomologous recombination

Die homologe Rekombination gestattet die Einführung einer ausgewählten Nukleinsäuresequenz in ein Genom in einer definierten ausgewählten Position. Die homologe Rekombination ist eine Standardtechnik, die routinemäßig in den Biowissenschaften für niedere Organismen wie Hefe oder das Moos Physcomitrella eingesetzt wird. Methoden für die Durchführung der homologen Rekombination in Pflanzen sind nicht nur für Modellpflanzen ( Offringa et al, (1990), EMBO J. 9(10): 3077–84 ), sondern auch für Kulturpflanzen, zum Beispiel Reis ( Terada et al, (2002), Nat. Biotech. 20(10): 1030–4 ; Iida und Terada (2004), Curr. Opin. Biotech. 15(2): 132–8 ) beschrieben worden.Homologous recombination allows introduction of a selected nucleic acid sequence into a genome in a defined selected position. Homologous recombination is a standard technique routinely used in the life sciences for lower organisms such as yeast or the moss Physcomitrella. Methods for carrying out homologous recombination in plants are not limited to model plants ( Offringa et al, (1990), EMBO J. 9 (10): 3077-84 ), but also for crops, for example rice ( Terada et al, (2002), Nat. Biotech. 20 (10): 1030-4 ; Iida and Terada (2004), Curr. Opin. Biotech. 15 (2): 132-8 ).

Ertragearnings

Der Begriff „Ertrag” bedeutet im Allgemeinen ein messbares Produkt von wirtschaftlichem Wert, das typischerweise mit einer bezeichneten Kulturpflanze, einem Ort und einem Zeitraum in Relation steht. Die einzelnen Pflanzenteile tragen direkt aufgrund ihrer Anzahl, Größe und/oder ihres Gewichts zum Ertrag bei, bzw. ist der tatsächliche Ertrag der Ertrag pro Acre für eine Kultur und ein Jahr, der dadurch bestimmt wird, dass man die Gesamtproduktion (was sowohl geerntete als auch geschätzte Produktion beinhaltet) durch die bepflanzten Acres dividiert. Der Begriff „Ertrag” einer Pflanze kann sich auf die vegetative Biomasse, auf die Reproduktionsorgane und/oder auf Vermehrungsmaterial (wie Samen) derjenigen Pflanze beziehen.The term "yield" generally means a measurable product of economic value, typically related to a designated crop, place and period. The individual plant parts directly contribute to the yield by virtue of their number, size and / or weight, or the actual yield is the yield per acre for a crop and a year, determined by measuring the total production (which is harvested as well) also includes estimated production) divided by the planted acres. The term "yield" of a plant may refer to the vegetative biomass, to the reproductive organs and / or to propagating material (such as seeds) of that plant.

Jungpflanzenvitalität Early vigor

„Jungpflanzenvitalität” bezieht sich auf aktives gesundes balanciertes Wachstum, insbesondere während der Frühstadien des Pflanzenwachstums, und kann das Ergebnis einer erhöhten pflanzlichen Anpassungsfähigkeit aufgrund von z. B. einer besseren Adaption der Pflanzen an ihre Umwelt (d. h. Optimieren der Nutzung von Energieressourcen und Aufteilung zwischen Spross und Wurzel) sein. Pflanzen mit Jungpflanzenvitalität weisen auch ein erhöhtes Überleben der Keimpflanzen und eine besseres Etablieren der Kultur auf, was häufig zu stark einheitlichen Feldern (wobei die Kultur einheitlich heranwächst, d. h. wobei der Großteil der Pflanzen die verschiedenen Entwicklungsstadien im Wesentlichen gleichzeitig erreicht) und häufig zu einem besseren und höheren Ertrag führt. Jungpflanzenvitalität lässt sich daher dadurch bestimmen, dass man verschiedene Faktoren misst, wie Tausendkorngewicht, Keimungsprozentsatz, Prozentsatz des Auflaufens, Keimpflanzenwachstum, Keimpflanzenhöhe, Wurzellänge, Wurzel- und Sprossbiomasse und viele andere mehr."Early vigor" refers to active healthy balanced growth, especially during the early stages of plant growth, and may be the result of increased plant adaptability due to e.g. B. better adaptation of the plants to their environment (i.e., optimizing the use of energy resources and division between shoot and root). Plants with early vigor also exhibit increased seed survival and better culture establishment, often resulting in highly uniform fields (with culture growing uniformly, ie, with most of the plants reaching the different stages of development substantially simultaneously), and often a better one and higher yield leads. Therefore, early vigor can be determined by measuring various factors such as thousand kernel weight, germination percentage, percentage of casserole, seedling growth, seedling height, root length, root and shoot biomass, and many others.

Erhöhen/Verbessern/ErhöhenIncrease / Improve / Increase

Die Begriffe „erhöhen”, „verbessern” oder „erhöhen” sind untereinander austauschbar und sollen im Rahmen der vorliegenden Erfindung mindestens 5%, 6%, 7%, 8%, 9% oder 10%, vorzugsweise mindestens 15% oder 20%, stärker bevorzugt 25%, 30%, 35% oder 40% mehr Ertrag und/oder Wachstum im Vergleich zu Kontrollpflanzen wie im vorliegenden Text definiert bedeuten.The terms "increase", "improve" or "increase" are interchangeable and are intended in the context of the present invention to be at least 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more yield and / or growth compared to control plants as defined herein.

Samenertragseed yield

Ein erhöhter Samenertrag kann sich als eine oder mehrere der folgenden Erscheinungen äußern: a) Erhöhung der Samenbiomasse (Samengesamtgewicht), entweder auf Grundlage der einzelnen Samen und/oder pro Pflanze und/oder pro Hektar oder Acre; b) erhöhte Anzahl Blüten pro Rispe und/oder Pflanze; c) erhöhte Anzahl (gefüllte) Samen; d) erhöhte Samenfüllungsrate (die als Verhältnis zwischen der Anzahl gefüllter Samen dividiert durch die Gesamtzahl Samen ausgedrückt wird); e) erhöhter Harvest Index, der als Verhältnis des Ertrags von Erntegut wie Samen dividiert durch die Gesamtbiomasse ausgedrückt wird; f) erhöhte Anzahl Primärrispen; (g) erhöhtes Tausendkorngewicht (TKG), das aufgrund der Anzahl der gezählten gefüllten Samen und ihres Gesamtgewichts extrapoliert wird. Ein erhöhtes TKG kann das Ergebnis einer erhöhten Samengröße und/oder eines erhöhten Samengewichts sein und kann auch das Ergebnis einer Erhöhung der Embryo- und/oder Endospermgröße sein.Increased seed yield may be expressed as one or more of the following: a) increase in seed biomass (total seed weight), either based on individual seeds and / or per plant and / or per hectare or acre; b) increased number of flowers per panicle and / or plant; c) increased number (filled) seeds; d) increased seed filling rate (expressed as the ratio between the number of filled seeds divided by the total number of seeds); e) increased harvest index, expressed as the ratio of crop yield such as seed divided by total biomass; f) increased number of primary panicles; (g) increased Thousand Grain Weight (TKG) extrapolated based on the number of filled seeds counted and their total weight. Increased TKG may be the result of increased seed size and / or seed weight, and may also be the result of an increase in embryo and / or endosperm size.

Eine Erhöhung des Samenertrags kann sich auch als Erhöhung der Samengröße und/oder des Samenvolumens äußern. Eine Erhöhung des Ertrags kann sich auch als Erhöhung der Samenfläche und/oder Samenlänge und/oder Samenbreite und/oder des Samenumfangs äußern. Ein erhöhter Samenertrag kann auch zu einer modifizierten Architektur führen oder kann aufgrund einer modifizierten Architektur vorliegen.An increase in seed yield may also be manifested as an increase in seed size and / or seed volume. Increasing the yield may also be manifested as an increase in seed area and / or seed length and / or seed width and / or seed size. Increased seed yield may also result in a modified architecture or may be due to a modified architecture.

„Greenness”-Index"Greenness" index

Der „Greenness-Index” wird im vorliegenden Zusammenhang aufgrund von digitalen Bildern von Pflanzen berechnet. Für jedes Pixel, das zu dem pflanzlichen Subjekt des Bilds gehört, wird das Verhältnis zwischen dem Grünwert und dem Rotwert (im RGB-Modell für die Farbkodierung) berechnet. Der „Greenness-Index” wird als Prozentsatz Pixel, bei denen das Grün/Rot-Verhältnis einen gegebenen Schwellenwert übersteigt, ausgedrückt. Unter normalen Wachstumsbedingungen, unter Salzstress-Wachstumsbedingungen und unter Nährstoffmangel-Wachstumsbedingungen wird der „Greenness-Index” von Pflanzen beim letzten Imaging vor der Blüte gemessen. Im Gegensatz dazu wird der „Greenness-Index” von Pflanzen unter Trockenstress-Wachstumsbedingungen beim ersten Imaging nach der Trockenheit gemessen.The "greenness index" is calculated in the present context on the basis of digital images of plants. For each pixel belonging to the vegetable subject of the image, the ratio between the green value and the red value (in the RGB model for color coding) is calculated. The greenness index is expressed as a percentage of pixels where the green / red ratio exceeds a given threshold. Under normal growth conditions, under salt stress growth conditions and under nutrient deficiency growth conditions, the plants' greenness index is measured at the time of the last pre-bloom imaging. In contrast, the greenness index of plants is measured under dry stress growth conditions at the first post-dryness imaging.

Pflanzeplant

Der Begriff „Pflanze” umfasst im vorliegenden Zusammenhang ganze Pflanzen, Vorfahren und Nachfahren der Pflanzen und Pflanzenteile, darunter Samen, Sprosse, Stängel, Blätter, Wurzeln (einschließlich Knollen), Blüten und Gewebe und Organe, wobei jedes der genannten Objekte das interessierende Gen bzw. die interessierende Nukleinsäuresequenz umfasst. Der Begriff „Pflanze” umfasst auch Pflanzenzellen, Suspensionskulturen, Kallusgewebe, Embryonen, meristematische Regionen, Gametophyten, Sporophyten, Pollen und Mikrosporen, wobei wiederum jedes der genannten Objekte das interessierende Gen bzw. die interessierende Nukleinsäuresequenz umfasst.The term "plant" as used herein includes whole plants, ancestors and descendants of the plants and plant parts including seeds, shoots, stems, leaves, roots (including tubers), flowers and tissues and organs, each of said objects including the gene of interest comprising the nucleic acid sequence of interest. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, wherein in turn each of said objects comprises the gene of interest or the nucleic acid sequence of interest.

Zu Pflanzen, die sich für die erfindungsgemäßen Verfahren besonders eignen, zählen all diejenigen Pflanzen, die zu der Überfamilie Viridiplantae gehören, insbesondere monokotyle und dikotyle Pflanzen, darunter Futterleguminosen, Zierpflanzen, Nahrungsmittelpflanzen, Bäume oder Sträucher aus der Liste, die folgende umfasst: Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp., Artocarpus spp., Asparagus officinalis, Avena spp. (z. B. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (z. B. Brassica napus, Brassica rapa ssp. [Canola-Raps, normaler Raps, Rübsen]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (z. B. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (z. B. Glycine max, Soja hispida oder Soja max), Gossypium hirsutum, Helianthus spp. (z. B. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (z. B. Hordeum vulgare), lpomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (z. B. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (z. B. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (z. B. Solanum tuberosum, Solanum integrifolium oder Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tricale sp., Triticosecale rimpaui, Triticum spp. (z. B. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum oder Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp. und viele andere mehr. Plants which are particularly suitable for the methods of the invention include all those plants belonging to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants, including forage legumes, ornamentals, food plants, trees or shrubs from the list, comprising: Acer spp , Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp., Artocarpus spp., Asparagus officinalis, Avena spp. Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (eg Brassica napus, Brassica rapa ssp. [canola oilseed rape, normal oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya Spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus Spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (eg Glycine max, soy hispida or soy max), Gossypium hirsutum, Helianthus spp. (eg Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (eg, Hordeum vulgare), lpomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g., Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp. Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g., Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis spp., Solanum spp. (e.g., Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tricale sp., Triticosecale rimpaui, Triticum spp. (eg Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp ., Zea mays, Zizania palustris, Ziziphus spp. and many more.

Genaue Beschreibung der ErfindungDetailed description of the invention

Überraschenderweise wurde nun gefunden, dass die Erhöhung der Expression einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, in einer Pflanze zu Pflanzen führt, die im Vergleich zu Kontrollpflanzen erhöhte Ertragsmerkmale aufweisen. Gemäß einer ersten Ausführungsform stellt die vorliegende Erfindung ein Verfahren für die Erhöhung von Ertragsmerkmalen bei Pflanzen im Vergleich zu Kontrollpflanzen, bei dem man in einer Pflanze die Expression einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, erhöht, bereit.Surprisingly, it has now been found that increasing the expression of a nucleic acid sequence encoding a GRF polypeptide in a plant results in plants having increased yield-related traits relative to control plants. In a first aspect, the present invention provides a method of enhancing yield-related traits in plants relative to control plants by increasing the expression in a plant of a nucleic acid sequence encoding a GRF polypeptide.

Überraschenderweise wurde nun gefunden, dass Erhöhen der Expression in einer Pflanze von: (i) Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) Nukleinsäuresequenz, die für ein „unovial sarcoma translocation”(SYT)-Polypeptid kodiert, zu Pflanzen mit erhöhten Ertragsmerkmalen im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden führt: (i) Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Gemäß einer ersten Ausführungsform wird ein Verfahren zur Erhöhung von verschiedenen Pflanzenertragsmerkmalen bereitgestellt, dadurch, dass man in einer Pflanze die Expression von (i) Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) Nukleinsäuresequenz, die für ein „Synovial sarcoma translocation”(SYT)-Polypeptid kodiert, erhöht, wobei die Ertragsmerkmale im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden verbessert sind: (i) Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert.Surprisingly, it has now been found that increasing expression in a plant of: (i) nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) nucleic acid sequence encoding an unoviral sarcoma translocation (SYT) polypeptide results in plants having enhanced yield-related traits relative to plants having increased expression of any of the following: (i) nucleic acid sequence encoding a GRF polypeptide or (ii) nucleic acid sequence encoding a SYT polypeptide. According to a first embodiment, there is provided a method of increasing various plant yield traits by expressing in a plant the expression of (i) nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, wherein the yield-related traits are improved compared to plants having increased expression of any of the following: (i) nucleic acid sequence encoding a GRF Polypeptide, or (ii) nucleic acid sequence encoding a SYT polypeptide.

Die erhöhten Ertragsmerkmale umfassen einen oder mehrere der folgenden Faktoren: erhöhte Jungpflanzenwüchsigkeit, erhöhte oberirdische Biomasse, erhöhter Gesamtsamenertrag pro Pflanze, erhöhte Samenfüllungsrate, erhöhte Anzahl (gefüllter) Samen, erhöhter Harvest Index sowie erhöhtes Tausendkorngewicht (TKG).The increased yield-related traits include one or more of the following factors: increased seedling vigor, increased aboveground biomass, increased total seed yield per plant, increased seed filling rate, increased number of (filled) seeds, increased harvest index, and increased thousand kernel weight (TKG).

Detaillierte Beschreibung der „Growth-Regulating Factor(GRF)”-Polypeptide Detailed Description of "Growth Regulating Factor (GRF)" Polypeptides

Ein bevorzugtes Verfahren zur Erhöhung der Expression einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, besteht darin, dass man eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, in einer(r) Pflanze einführt und exprimiert.A preferred method of enhancing the expression of a nucleic acid sequence encoding a GRF polypeptide is by introducing and expressing a nucleic acid sequence encoding a GRF polypeptide in a plant.

Wird im folgenden Text ein „GRF-Protein, das für die erfindungsgemäßen Verfahren nützlich ist,” erwähnt, so versteht man darunter ein GRF-Polypeptid wie im vorliegenden Text definiert. Wird im folgenden Text eine „GRF-Nukleinsäuresequenz, die für die erfindungsgemäßen Verfahren nützlich ist,” erwähnt, so bedeutet dies eine Nukleinsäuresequenz, die fähig ist, für solch ein GRF-Polypeptid zu kodieren. Die in eine Pflanze einzuführende Nukleinsäuresequenz (und die daher beim Durchführen der erfindungsgemäßen Verfahren nützlich ist) ist jede beliebige Nukleinsäuresequenz, die für die Art von Polypeptid, die nun beschrieben werden wird, kodiert, und wird im Folgenden auch „GRF-Nukleinsäuresequenz” oder „GRF-Gen” genannt.When mention is made in the following of a "GRF protein useful in the methods of the invention", it is meant to include a GRF polypeptide as defined herein. When mention is made in the following text of a "GRF nucleic acid sequence useful for the methods of the invention", it means a nucleic acid sequence capable of encoding such a GRF polypeptide. The nucleic acid sequence to be introduced into a plant (and therefore useful in carrying out the methods of the invention) is any nucleic acid sequence encoding the type of polypeptide that will now be described, and will hereinafter also be referred to as "GRF nucleic acid sequence" or " Called GRF gene ".

Ein „GRF-Polypeptid” wie im vorliegenden Text definiert bezieht sich auf ein beliebiges Polypeptid, das Folgendes umfasst: (i) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer QLQ-Domäne gemäß SEQ ID NO: 115 (in SEQ ID NO: 2 umfasst); und (ii) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer WRC-Domäne gemäß SEQ ID NO: 116 (in SEQ ID NO: 2 umfasst).A "GRF polypeptide" as defined herein refers to any polypeptide comprising: (i) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a QLQ domain according to SEQ ID NO: 115 (included in SEQ ID NO: 2); and (ii) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a WRC. A domain according to SEQ ID NO: 116 (included in SEQ ID NO: 2).

Alternativ oder zusätzlich bezieht sich ein „GRF-Polypeptid” wie im vorliegenden Text definiert auf ein beliebiges Polypeptid, das Folgendes umfasst: (i) eine QLQ-Domäne mit einem InterPro-Eintrag IPR014978 (PFAM-Eintrag PF08880); (ii) eine WRC-Domäne mit einem InterPro-Eintrag IPR014977 (PFAM-Eintrag PF08879); sowie (iii) eine „Effector of Transcription”(ET)-Domäne umfassend drei Cys- und einen His-Rest in konservierter Beabstandung (CX₉CX₁₀CX₂H).Alternatively or additionally, a "GRF polypeptide" as defined herein refers to any polypeptide comprising: (i) a QLQ domain having an InterPro entry IPR014978 (PFAM entry PF08880); (ii) a WRC domain with an InterPro entry IPR014977 (PFAM entry PF08879); and (iii) an Effector of Transcription (ET) domain comprising three conserved-spaced Cys and His residues (CX ₉ CX ₁₀ CX ₂ H).

Alternativ oder zusätzlich bezieht sich ein „GRF-Polypeptid” wie im vorliegenden Text definiert auf ein beliebiges Polypeptid, mit in ansteigender Bevorzugung mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu dem GRF-Polypeptid gemäß SEQ ID NO: 2 oder zu einer beliebigen Volllängenpolypeptidsequenz gemäß Tabelle A.1 im vorliegenden Text.Alternatively or additionally, a "GRF polypeptide" as defined herein refers to any polypeptide with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% in increasing preference, 90%, 95%, 98%, 99% or more amino acid sequence identity to the GRF polypeptide of SEQ ID NO: 2 or to any full length polypeptide sequence according to Table A.1 herein.

Alternativ oder zusätzlich interagiert ein „GRF-Polypeptid” mit einem „GRF-Interacting Factor” (GIF; (GIF1 bis GIF3; auch „Synovial Sarcoma Translocation” SYT1 bis SYT3) genannt)-Polypeptiden wie denjenigen, die in Tabelle A.2 im vorliegenden Text dargestellt sind, in einem Hefe-zwei-Hybrid-Interaktions-Assay.Alternatively or additionally, a "GRF polypeptide" interacts with a "GRF Interacting Factor" (GIF; GIF1 to GIF3; also called "Synovial Sarcoma Translocation" SYT1 to SYT3) polypeptides, such as those described in Table A.2 in FIG present in a yeast two-hybrid interaction assay.

Die Begriffe „Domäne” und „Motiv” werden im vorliegenden Text in dem Abschnitt „Definitionen” definiert. Für die Identifikation von Domänen gibt es Spezialdatenbanken, zum Beispiel SMART ( Schultz et al, (1998), Proc. Natl. Acad. Sci. USA 95, 5857–5864 ; Letunic et al, (2002), Nucleic Acids Res. 30, 242–244 , InterPro ( Mulder et al, (2003), Nucl. Acids Res. 31, 315-318 ), Prosite ( Sucher und Bairoch (1994) , A generalized Profile syntax for biomolecular sequences motifs und its function in automatic sequence interpretation. (In) ISMB-94; Proceedings 2nd International Conference an Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Hrsg., S. 53-61 , AAAI Press, Menlo Park; Hulo et al, Nucl. Acids Res. 32: D134–D137, (2004) , oder Pfam ( Bateman et al, Nucleic Acids Research 30(1): 276280 (2002) . Ein Satz Werkzeuge für die in-silico-Analyse von Proteinsequenzen findet sich auf dem ExPASY-Proteomics-Server (Swiss Institute of Bioinformatics ( Gasteiger et al, ExPASy: the proteomics server for in-depth Protein knowledge and analysis, Nucleic Acids Res. 31: 3784–3788 (2003) ).The terms "domain" and "motif" are defined herein in the section "Definitions". For the identification of domains there are special databases, for example SMART ( Schultz et al, (1998), Proc. Natl. Acad. Sci. USA 95, 5857-5864 ; Letunic et al, (2002), Nucleic Acids Res. 30, 242-244 , InterPro ( Mulder et al, (2003), Nucl. Acids Res. 31, 315-318 ), Prosite ( Seeker and Bairoch (1994) A generalized profile syntax for biomolecular sequence motifs and its function in automatic sequence interpretation. (In) ISMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., eds, pp. 53-61 , AAAI Press, Menlo Park; Hulo et al, Nucl. Acids Res. 32: D134-D137, (2004) , or Pfam ( Bateman et al, Nucleic Acids Research 30 (1): 276280 (2002) , A set of tools for in-silico analysis of protein sequences can be found on the ExPASY Proteomics server (Swiss Institute of Bioinformatics ( Gasteiger et al, ExPASy: the proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res. 31: 3784-3788 (2003) ).

Die Analyse der Polypeptidsequenz von SEQ ID NO: 2 ist unten in den Beispielen 2 und 4 im vorliegenden Text dargestellt. So umfasst zum Beispiel ein GRF-Polypeptid gemäß SEQ ID NO: 2 eine QLQ-Domäne mit einem InterPro-Eintrag IPR014978 (PFAM-Eintrag PF08880) und eine WRC-Domäne mit einem InterPro-Eintrag IPR014977 (PFAM-Eintrag PF08879) in der InterPro-Domänendatenbank. Domänen können auch unter Verwendung von Routinetechniken, wie zum Beispiel mittels Sequenz-Alignment, identifiziert werden. Ein Alignment der QLQ-Domäne der Polypeptide von Tabelle A.1 im vorliegenden Text ist in dargestellt, und ein Alignment der WRC-Domäne der Polypeptide von Tabelle A.1 im vorliegenden Text ist in dargestellt. Solche Alignments eignen sich zum Identifizieren der am zwischen dem GRF-Polypeptiden am stärksten konservierten Aminosäuren, wie den QLQ- und WRC-Aminosäureresten.Analysis of the polypeptide sequence of SEQ ID NO: 2 is shown below in Examples 2 and 4 herein. For example, a GRF polypeptide of SEQ ID NO: 2 comprises a QLQ domain with an InterPro entry IPR014978 (PFAM entry PF08880) and a WRC domain with an InterPro entry IPR014977 (PFAM entry PF08879) in the InterPro -Domänendatenbank. Domains can also be identified using routine techniques, such as by means of sequence alignment. An alignment of the QLQ domain of the polypeptides of Table A.1 in the present text is in and an alignment of the WRC domain of the polypeptides of Table A.1 hereinabove is described in U.S. Pat shown. Such alignments are useful for identifying the most conserved amino acids between the GRF polypeptide, such as the QLQ and WRC amino acid residues.

Verfahren für das Alignment von Sequenzen für Vergleichszwecke sind in der Fachwelt gut bekannt, dazu zählen GAP, BESTFIT, BLAST, FASTA und TFASTA. Bei GAP wird der Algorithmus von Needleman und Wunsch ((1970), J. Mol. Biol. 48: 443–453 ) verwendet, um das globale Alignment (d. h. das Alignment, das sich über die vollständigen Sequenzen erstreckt) von zwei Sequenzen, das die Anzahl der „matches” maximiert und die Anzahl der „gaps” minimiert.Methods for aligning sequences for comparison purposes are well known in the art, including GAP, BESTFIT, BLAST, FASTA, and TFASTA. For GAP, the algorithm of Needleman and Wunsch ((1970), J. Mol. Biol. 48: 443-453 ) is used to estimate the global alignment (ie, the alignment that extends over the complete sequences) of two sequences that maximizes the number of matches and minimizes the number of gaps.

Beim BLAST-Algorithmus ( Altschul et al., (1990), J. Mol. Biol. 215: 403–10 ) wird die Sequenzidentität in Prozent berechnet, und es wird eine statistische Analyse der Ähnlichkeit zwischen den beiden Sequenzen durchgeführt. Die Software für die Durchführung einer BLAST-Analyse ist der Öffentlichkeit über das National Centre for Biotechnology Information (NCBI) zugänglich. Homologe können leicht unter Verwendung von zum Beispiel dem multiplen Sequenz-Alignment-Algorithmus ClustalW (Version 1.83) identifiziert werden, und zwar mit den Default-Parametern für paarweises Alignment und einer Scoring-Methode in Prozent. Die Gesamtprozentsätze der Ähnlichkeit und der Identität können auch unter Verwendung von einer der in dem MatGAT-Software-Paket verfügbaren Methoden bestimmt werden (( Campanella et al., (2003) BMC Bioinformatics, 10: 29 . MatGAT: an application that generstes similarity/identity matrices using Protein or DNA sequences.). Für eine Optimierung des Alignments zwischen konservierten Motiven können, wie dem Fachmann klar wird, kleine händische Veränderungen vorgenommen werden. So können außerdem statt Volllängensequenzen für die Identifikation von Homologen auch spezifische Domänen verwendet werden. Die Sequenzidentitätswerte können mit den oben erwähnten Programmen unter Einstellung der Default-Parameter über die gesamte Nukleinsäuresequenz oder Polypeptidsequenz oder über ausgewählte Domänen oder konservierte Motiv(e) bestimmt. Außerhalb der QLQ-Domäne und der WRC-Domäne weisen die GRF-Polypeptide angeblich eine niedrige Aminosäuresequenzidentität auf. Beispiel 3 im vorliegenden Text beschreibt in Tabelle B.1 den Prozentsatz der Identität zwischen dem GRF-Polypeptid gemäß SEQ ID NO: 2 und den GRF-Polypeptiden in Tabelle A, welcher nur 15% Aminosäuresequenzidentität betragen kann. Der Prozentsatz der Identität kann wesentlich gesteigert werden, wenn die Identitätsberechnung zwischen der QLQ-Domäne SEQ ID NO: 2 (gemäß SEQ ID NO: 115 innerhalb SEQ ID NO: 2; QLQ-Domäne der GRF-Polypeptide von Tabelle A.1 gemäß ) und den QLQ-Domänen der Polypeptide, die bei der Durchführung der Erfindung nützlich sind, durchgeführt wird. Auf ähnliche Art und Weise kann der Prozentsatz der Identität wesentlich gesteigert werden, wenn die Identitätsberechnung zwischen der WRC-Domäne SEQ ID NO: 2 (gemäß SEQ ID NO: 116 innerhalb SEQ ID NO: 2; WRC-Domäne der GRF-Polypeptide von Tabelle A.1 gemäß ) und den WRC-Domänen der Polypeptide, die bei der Durchführung der Erfindung nützlich sind, durchgeführt wird. Der Prozentsatz der Identität über die QLQ-Domäne liegt bei den Polypeptidsequenzen, die für die Durchführung der erfindungsgemäßen Verfahren nützlich sind, zwischen 25% und 99% Aminosäureidentität, und der Prozentsatz der Identität über die WRC-Domäne beträgt bei dem Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, zwischen 60% und 99% Aminosäureidentität. Auch ist, wie aus hervorgeht, die WRC-Domäne bei den unterschiedlichen GRF-Polypeptiden besser konserviert als die QLQ-Domäne, siehe .In the BLAST algorithm ( Altschul et al., (1990), J. Mol. Biol. 215: 403-10 ) the sequence identity is calculated in percent and a statistical analysis of the similarity between the two sequences is made. The software for performing a BLAST analysis is available to the public via the National Center for Biotechnology Information (NCBI). Homologs can be easily identified using, for example, the multiple sequence alignment algorithm ClustalW (version 1.83), with the default parameters for paired alignment and a scoring method in percent. The total percentages of similarity and identity may also be determined using one of the methods available in the MatGAT software package (( Campanella et al., (2003) BMC Bioinformatics, 10: 29 , MatGAT: an application that generates the most similarity / identity matrices using protein or DNA sequences.). As will be apparent to those skilled in the art, small hand modifications can be made to optimize alignment between conserved subjects. Thus, instead of full-length sequences for the identification of homologues, specific domains can also be used. Sequence identity values may be determined using the programs mentioned above, adjusting the default parameters throughout the nucleic acid sequence or polypeptide sequence, or via selected domains or conserved motif (s). Outside the QLQ domain and the WRC domain, the GRF polypeptides are reported to have low amino acid sequence identity. Example 3 herein describes in Table B.1 the percentage of identity between the GRF polypeptide of SEQ ID NO: 2 and the GRF polypeptides in Table A which may be as low as 15% amino acid sequence identity. The percentage of identity can be significantly increased if the identity calculation between the QLQ domain SEQ ID NO: 2 (according to SEQ ID NO: 115 within SEQ ID NO: 2; QLQ domain of the GRF polypeptides of Table A.1 according to ) and the QLQ domains of the polypeptides useful in the practice of the invention. Similarly, if the identity computation between the WRC domain SEQ ID NO: 2 (SEQ ID NO: 116 within SEQ ID NO: 2; WRC domain of GRF polypeptides of Table A.1 according to ) and the WRC domains of the polypeptides useful in the practice of the invention. The percentage of identity across the QLQ domain is between 25% and 99% amino acid identity for the polypeptide sequences useful in practicing the methods of the invention, and the percentage of identity across the WRC domain in the polypeptide sequences used in the Implementation of the methods of the invention are useful, between 60% and 99% amino acid identity. Also, how is out shows that the WRC domain is more conserved among the different GRF polypeptides than the QLQ domain, see ,

Bei der Vorhersage der subzellulären Lokalisation eines Proteins handelt es sich um eine wichtige Aufgabe, die gut untersucht ist. Die Kenntnis der Lokalisation eines Proteins hilft bei der Aufklärung seiner Funktion. Experimentelle Methoden für die Lokalisierung von Proteinen reichen von der Immunlokalisierung bis zum Tagging von Proteinen mit Green Fluorescent Protein (GFP) oder beta-Glucuronidase (GUS). Diese Methoden sind zwar präzise, jedoch im Vergleich zu computergestützten Methoden arbeitsaufwendig. In jüngster Zeit sind bei der computergestützten Vorhersage der Lokalisierung von Protein aufgrund von Sequenzdaten große Erfolge erzielt worden. Zu den Algorithmen, mit denen der Fachmann gut vertraut ist und die am ExPASy Proteomics-Server, das vom Swiss Institute for Bioinformatics gehustet wird, zählen zum Beispiel PSort, TargetP, ChloroP, LocTree, Predotar, LipoP, MITOPROT, PATS, PTS1, Signale sowie andere.Predicting the subcellular localization of a protein is an important task that has been well studied. Knowledge of the localization of a protein helps to elucidate its function. Experimental methods for the localization of proteins range from immunolocalization to tagging of proteins with Green Fluorescent Protein (GFP) or beta-glucuronidase (GUS). While these methods are precise, they are laborious compared to computerized methods. Recently, great promise has been made in computerized prediction of protein localization based on sequence data. Some of the algorithms well known to those skilled in the art and the ExPASy Proteomics server coughed by the Swiss Institute for Bioinformatics include, for example, PSort, TargetP, ChloroP, LocTree, Predotar, LipoP, MITOPROT, PATS, PTS1, signals as well as others.

Die GRF-Polypeptide, die bei den erfindungsgemäßen Verfahren nützlich sind (zumindest in ihrer nativen Form), weisen außerdem typischerweise, jedoch nicht zwingend, Transkriptionsregulationsaktivität sowie die Fähigkeit, mit anderen Proteinen zu interagieren, auf. GRF-Polypeptide mit reduzierter Transkriptionsregulationsaktivität, ohne Transkriptionsaktivität, mit reduzierter Fähigkeit für die Protein-Protein-Interaktion oder mit keiner Fähigkeit zur Protein-Protein-Interaktion können daher bei den Methoden der vorliegenden Erfindung ebenfalls nützlich sein. Die DNA-Bindungsaktivität und die Protein-Protein-Interaktionen können leicht in vitro oder in vivo unter Verwendung von fachbekannten Techniken bestimmt werden (zum Beispiel in Current Protocols in Molecular Biology, Band 1 und 2, Ausubel et al. (1994), Current Protocols ). Die GRF-Polypeptide sind zur transkriptionellen Aktivierung von Reportergenen in Hefezellen befähigt ( Kim & Kende (2004) Proc. Natl. Acad. Sci. 101(36): 13374–13379 ). Die GRF-Polypeptide sind auch zur in-vivo-Interaktion mit „GRF-Interacting Factor”-Polypeptiden (GIF1 bis GIF3; auch „Synovial Sarcoma Translocation” (SYT) genannt) in Hefezellen befähigt, und zwar unter Verwendung eines Hefe-zwei-Hybrid-Protein-Protein-Interaktions-Assays (Kim & Kende, oben). In-vitro-Bindungsassays werden auch verwendet, um nachzuweisen, dass es sich bei den GRF-Polypeptiden und SYT-(oder GIF-)Polypeptiden um interagierende Partner handelt (Kim & Kende, oben).The GRF polypeptides useful in the methods of the invention (at least in their native form) also typically, but not necessarily, exhibit transcriptional regulatory activity as well as the ability to interact with other proteins. GRF polypeptides having reduced transcriptional regulatory activity, no transcriptional activity, reduced protein-protein interaction ability, or no protein-protein interaction ability may therefore also be useful in the methods of the present invention. DNA binding activity and protein-protein interactions can be readily determined in vitro or in vivo using art-known techniques (for example, in U.S. Pat Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel et al. (1994), Current Protocols ). The GRF polypeptides are capable of transcriptional activation of reporter genes in yeast cells ( Kim & Kende (2004) Proc. Natl. Acad. Sci. 101 (36): 13374-13379 ). The GRF polypeptides are also capable of interacting in vivo with "GRF Interacting Factor" polypeptides (GIF1 to GIF3, also called "synovial sarcoma translocation" (SYT)) in yeast cells, using a yeast two- Hybrid protein-protein interaction assays (Kim & Kende, supra). In vitro binding assays are also used to demonstrate that the GRF polypeptides and SYT (or GIF) polypeptides are interacting partners (Kim & Kende, supra).

Die vorliegende Erfindung wird dadurch, dass man Pflanzen mit der Nukleinsäuresequenz gemäß SEQ ID NO: 1, die für die GRF-Polypeptidsequenz gemäß SEQ ID NO: 2 kodiert, transformiert, dargestellt. Die Durchführung der Erfindung ist jedoch nicht auf diese Sequenzen beschränkt; die erfindungsgemäßen Verfahren können vorteilhaft mit jeder Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, wie sie im vorliegenden Text definiert ist, durchgeführt werden. The present invention is represented by transforming plants with the nucleic acid sequence according to SEQ ID NO: 1, which codes for the GRF polypeptide sequence according to SEQ ID NO: 2. However, the practice of the invention is not limited to these sequences; the methods of the invention may be advantageously carried out with any nucleic acid sequence encoding a GRF polypeptide as defined herein.

Beispiele für Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, finden sich in Tabelle A.1 des hier angegebenen Beispiels 1. Solche Nukleinsäuresequenzn sind bei der Durchführung der erfindungsgemäßen Verfahren nützlich. Die in Tabelle A.1 des Beispiels 1 angegebenen Polypeptidsequenzen sind Beispielsequenzen für Orthologe und Paraloge des GRF-Polypeptids gemäß SEQ ID NO: 2, wobei die Begriffe „Orthologe” und „Paraloge” wie im vorliegenden Text definiert sind. Weitere Orthologe und Paraloge können leicht durch Durchführen einer so genannten reziproken Blast-Suche identifiziert werden. Dies beinhaltet typischerweise eine erste BLAST, bei der mit einer Abfragesequenz ein „BLASTing” gegen eine beliebige Sequenzdatenbank, wie die öffentlich zugängliche NCBI-Datenbank, durchgeführt wird (zum Beispiel unter Verwendung beliebiger der in Tabelle A.1 des Beispiels 1 aufgeführten Sequenzen). BLASTN oder TBLASTX (unter Verwendung von Standard-Default-Werten) werden im Allgemeinen dann verwendet, wenn man von einer Nukleotidsequenz ausgeht, und BLASTP oder TBLASTN (unter Verwendung von Standard-Default-Werten), wenn man von einer Proteinsequenz ausgeht. Die BLAST-Ergebnisse können gewünschtenfalls gefiltert werden. Mit den Volllängen-Sequenzen der gefilterten oder ungefilterten Ergebnisse wird anschließend ein zweites BLASTing gegen Sequenzen des Organismus, von dem die Abfragesequenz stammt, durchgeführt (ist die Abfragesequenz SEQ ID NO: 1 oder SEQ ID NO: 2, dann wäre das zweite BLASTing daher gegen Sequenzen aus Arabidopsis thaliana). Die Ergebnisse des ersten und des zweiten BLASTing werden dann verglichen. Ein Paralog wird dann identifiziert, wenn ein hochrangiger Hit von dem ersten BLASTing von derselben Art ist, von der die Abfragesequenz stammt, in diesem Fall führt ein zweites BLASTing idealerweise zu der Abfragesequenz unter den höchstrangigen Hits; ein Ortholog wird dann identifiziert, wenn ein hochrangiger Hit in dem ersten BLASTing nicht von derselben Art wie derjenigen, von der die Abfragesequenz stammt, ist, und führt vorzugsweise beim zweiten BLASTing dazu, dass die Abfragesequenz unter den höchstrangigen Hits ist.Examples of nucleic acid sequences encoding GRF polypeptides are found in Table A.1 of Example 1 herein. Such nucleic acid sequences are useful in carrying out the methods of the invention. The polypeptide sequences set forth in Table A.1 of Example 1 are example sequences for orthologues and paralogues of the GRF polypeptide of SEQ ID NO: 2, the terms "orthologues" and "paralogues" being as defined herein. Other orthologues and paralogues can be easily identified by performing a so-called reciprocal blast search. This typically includes a first BLAST in which a query sequence BLASTs against any sequence database, such as the publicly accessible NCBI database (for example, using any of the sequences listed in Table A.1 of Example 1). BLASTN or TBLASTX (using default default values) are generally used when assuming a nucleotide sequence, and BLASTP or TBLASTN (using default default values), assuming a protein sequence. The BLAST results can be filtered if desired. With the full-length sequences of the filtered or unfiltered results, a second BLASTing is then performed against sequences of the organism from which the interrogation sequence originated (if the interrogation sequence is SEQ ID NO: 1 or SEQ ID NO: 2, then the second BLASTing would be against Sequences from Arabidopsis thaliana). The results of the first and second BLASTing are then compared. A paralog is identified when a high-ranking hit from the first BLASTing is of the same type as the query sequence, in which case a second BLAST ideally leads to the query sequence among the highest ranking hits; an ortholog is identified when a high-ranking hit in the first BLASTing is not of the same kind as that from which the query sequence originated, and preferably results in the second BLASTing making the query sequence below the highest ranking hits.

Hochrangige Hits sind solche mit niedrigem E-Wert. Je niedriger der E-Wert, desto signifikanter der „Score” (anders ausgedrückt, desto niedriger die Wahrscheinlichkeit, dass der Hit durch Zufall gefunden wurde). Die Berechnung des E-Werts ist in der Fachwelt gut bekannt. Das „Scoring” der Vergleiche erfolgt nicht nur mittels E-Werten, sondern auch mittels dem Prozentsatz der Identität. Der Prozentsatz der Identität bezieht sich auf die Anzahl der identischen Nukleotide (oder Aminosäuren) zwischen den zwei verglichenen Nukleinsäure-(oder Polypeptid-)Sequenzen über eine bestimmte Länge. Bei großen Familien kann man ClustalW und anschließend einen Neighbour-Joining-Tree verwenden, um die Cluster der verwandten Gene leichter sichtbar zu machen und um Orthologe und Paraloge zu identifizieren.High-ranking hits are those with a low E value. The lower the E value, the more significant the "score" (in other words, the lower the probability that the hit was found by chance). The calculation of the E value is well known in the art. The "scoring" of the comparisons is done not only by means of e-values, but also by means of the percentage of the identity. Percent identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a given length. Large families can use ClustalW followed by a neighbour-joining tree to make the clusters of related genes more visible and to identify orthologues and paralogues.

Bei der Durchführung der erfindungsgemäßen Verfahren können auch Nukleinsäurevarianten nützlich sein. Zu Beispielen für solche Varianten zählen Nukleinsäuresequenzen, die für Homologe und Derivate von einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen, wobei die Begriffe „Homolog„ und „Derivat” wie im vorliegenden Text definiert sind. Für die erfindungsgemäßen Verfahren sind auch Nukleinsäuresequenzen nützlich, die für Homologe und Derivate von Orthologen oder Paralogen beliebiger der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen kodieren. Homologe und Derivate, die bei den erfindungsgemäßen Verfahren nützlich sind, weisen im Wesentlichen dieselbe biologische und funktionelle Aktivität wie das unmodifizierte Protein, von dem sie abstammen, auf.When carrying out the methods according to the invention, nucleic acid variants may also be useful. Examples of such variants include nucleic acid sequences encoding homologs and derivatives of any of the polypeptide sequences set forth in Table A.1 of Example 1, wherein the terms "homologue" and "derivative" are as defined herein. Also useful in the methods of the invention are nucleic acid sequences encoding homologs and derivatives of orthologues or paralogues of any of the polypeptide sequences set forth in Table A.1 of Example 1. Homologs and derivatives useful in the methods of the invention have substantially the same biological and functional activity as the unmodified protein from which they are derived.

Zu weiteren Nukleinsäurevarianten, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, zählen Abschnitte von Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, Nukleinsäuresequenzen, die mit Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, hybridisieren, Spleißvarianten von Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, Allelvarianten von Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, und Varianten von Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, die mittels „gene shuffling” erhalten wurden. Die Begriffe hybridisierende Sequenz, Spleißvariante, Allelvariante und „gene shuffling” sind wie im vorliegenden Text definiert.Other nucleic acid variants useful in practicing the methods of the invention include portions of nucleic acid sequences encoding GRF polypeptides, nucleic acid sequences that hybridize to nucleic acid sequences encoding GRF polypeptides, splice variants of nucleic acid sequences encoding GRF polypeptides encoding allelic variants of nucleic acid sequences encoding GRF polypeptides and variants of nucleic acid sequences encoding GRF polypeptides obtained by gene shuffling. The terms hybridizing sequence, splice variant, allelic variant and gene shuffling are as defined herein.

Nukleinsäuresequenzen die für GRF-Polypeptide kodieren, müssen nicht unbedingt Volllängennukleinsäuresequenzen sein, da die Durchführung der erfindungsgemäßen Verfahren nicht auf die Verwendung von Volllängen-Nukleinsäuresequenzen angewiesen ist. Erfindungsgemäß wird daher ein Verfahren für die Erhöhung von Ertragsmerkmalen bei Pflanzen bereitgestellt, bei dem man in eine(r) Pflanze einen Abschnitt einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Nukleinsäuresequenzen oder einen Abschnitt von einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen kodiert, einführt und exprimiert.Nucleic acid sequences encoding GRF polypeptides need not necessarily be full-length nucleic acid sequences, as performance of the methods of the invention does not rely on the use of full-length nucleic acid sequences. Thus, according to the present invention, there is provided a method for enhancing yield-related traits in plants comprising, in a plant, a portion of any one of the nucleic acid sequences set forth in Table A.1 of Example 1, or a portion of a nucleic acid sequence encoding, expressing and expressing an orthologue, paralogue or homolog of any of the polypeptide sequences set forth in Table A.1 of Example 1.

Ein Abschnitt einer Nukleinsäuresequenz kann zum Beispiel dadurch hergestellt werden, dass man eine oder mehrere Deletionen bei der Nukleinsäuresequenz durchführt. Die Abschnitte können in isolierter Form verwendet werden oder können an andere Kodiersequenzen (oder Nichtkodiersequenzen) fusioniert werden, um zum Beispiel ein Protein herzustellen, bei dem mehrere Aktivitäten kombiniert sind. Bei der Fusion an andere Kodiersequenzen kann das bei der Translation hergestellte Polypeptid größer sein, als für den Proteinabschnitt vorhergesagt wurde.For example, a portion of a nucleic acid sequence may be prepared by performing one or more deletions on the nucleic acid sequence. The segments may be used in isolated form or may be fused to other coding sequences (or non-coding sequences) to produce, for example, a protein in which several activities are combined. When fused to other coding sequences, the polypeptide produced during translation may be larger than predicted for the protein portion.

Abschnitte, die bei den erfindungsgemäßen Verfahren nützlich sind, kodieren für ein GRF-Polypeptid wie im vorliegenden Text definiert und weisen im Wesentlichen dieselbe biologische Aktivität wie die in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen auf. Vorzugsweise handelt es sich bei dem Abschnitt um einen Abschnitt von einer der Nukleinsäuresequenzen in Tabelle A.1 von Beispiel 1 oder um einen Abschnitt einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog von einer der Polypeptidsequenzen in Tabelle A.1 von Beispiel 1 kodiert. Vorzugsweise beträgt die Länge des Abschnitts mit ansteigender Bevorzugung mindestens 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1190 aufeinanderfolgende Nukleotide, wobei es sich bei den aufeinanderfolgenden Nukleotiden um beliebige der Nukleinsäuresequenzen in Tabelle A.1 von Beispiel 1 oder um eine Nukleinsäuresequenz, die für ein Ortholog oder Paralog von einer beliebigen der Polypeptidsequenzen in Tabelle A.1 von Beispiel 1 kodiert, handelt. Vorzugsweise handelt es sich bei dem Abschnitt um einen Abschnitt einer Nukleinsequenz, die für ein Polypeptidsequenzpolypeptid umfassend Folgendes kodiert: (i) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer QLQ-Domäne gemäß SEQ ID NO: 115 (in SEQ ID NO: 2 umfasst); und (ii) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer WRC-Domäne gemäß SEQ ID NO: 116 (in SEQ ID NO: 2 umfasst). Am stärksten bevorzugt ist der Abschnitt ein Abschnitt der Nukleinsäuresequenz gemäß SEQ ID NO: 1Sections useful in the methods of the invention encode a GRF polypeptide as defined herein and have substantially the same biological activity as the polypeptide sequences set forth in Table A.1 of Example 1. Preferably, the segment is a portion of one of the nucleic acid sequences in Table A.1 of Example 1 or a portion of a nucleic acid sequence encoding an orthologue or paralogue of one of the polypeptide sequences in Table A.1 of Example 1. Preferably, the length of the increasing preference portion is at least 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1190 consecutive nucleotides the successive nucleotides to any of the nucleic acid sequences in Table A.1 of Example 1, or a nucleic acid sequence encoding an orthologue or paralogue of any of the polypeptide sequences in Table A.1 of Example 1. Preferably, the segment is a segment of a nucleic sequence encoding a polypeptide sequence polypeptide comprising: (i) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85 %, 90%, 95%, 98%, 99% or more amino acid sequence identity to a QLQ domain according to SEQ ID NO: 115 (included in SEQ ID NO: 2); and (ii) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a WRC. A domain according to SEQ ID NO: 116 (included in SEQ ID NO: 2). Most preferably, the portion is a portion of the nucleic acid sequence of SEQ ID NO: 1

Eine andere Nukleinsäuresequenzvariante, die bei den erfindungsgemäßen Verfahren nützlich ist, ist eine Nukleinsäuresequenz, die fähig ist, unter reduzierten Stringenzbedingungen, vorzugsweise unter stringenten Bedingungen, mit einer Nukleinsäuresequenz, die für ein GRF-Polypeptid wie im vorliegenden Text definiert kodiert, oder mit einem Abschnitt wie im vorliegenden Text zu hybridisieren vermag.Another nucleic acid sequence variant useful in the methods of the invention is a nucleic acid sequence capable of encoding under reduced stringency conditions, preferably under stringent conditions, a nucleic acid sequence encoding a GRF polypeptide as defined herein or a portion thereof as can hybridize in the present text.

Gemäß der vorliegenden Erfindung wird ein Verfahren zur Erhöhung von Ertragsmerkmalen bei Pflanzen bereitgestellt, bei dem man in eine(r) Pflanze eine Nukleinsäuresequenz, die mit einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Nukleinsäuresequenzen zu hybridisieren vermag, einführt und exprimiert, oder bei dem man in eine(r) Pflanze eine Nukleinsäuresequenz, die mit einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog von einer beliebigen der in Tabelle A.1 des Beispiels 1 angegebenen Nukleinsäuresequenzen kodiert, zu hybridisieren vermag, einführt und exprimiert.According to the present invention, there is provided a method of increasing yield-related traits in plants comprising introducing and expressing in a plant a nucleic acid sequence capable of hybridizing with any of the nucleic acid sequences set forth in Table A.1 of Example 1, or introducing and expressing in a plant a nucleic acid sequence capable of hybridizing to a nucleic acid sequence encoding an orthologue, paralogue or homologue of any of the nucleic acid sequences set forth in Table A.1 of Example 1.

Hybridisierende Sequenzen, die bei den erfindungsgemäßen Verfahren nützlich sind, kodieren für ein GRF-Polypeptid wie im vorliegenden Text definiert und weisen im Wesentlichen dieselbe biologische Aktivität wie die in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen auf. Vorzugsweise ist die hybridisierende Sequenz fähig, mit einer beliebigen der in Tabelle A.1 des Beispiels 1 angegebenen Nukleinsäuresequenzen oder einem Abschnitt von einer dieser Sequenzen zu hybridisieren, wobei ein Abschnitt wie oben definiert ist, oder worin die hybridisierende Sequenz fähig ist, mit einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog von einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen kodiert, zu hybridisieren. Vorzugsweise ist die hybridisierende Sequenz fähig, mit einer Nukleinsäuresequenz zu hybridisieren, die für eine Polypeptidsequenz, die Folgendes umfasst, kodiert: (i) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer QLQ-Domäne gemäß SEQ ID NO: 115 (in SEQ ID NO: 2 umfasst); und (ii) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer WRC-Domäne gemäß SEQ ID NO: 116 (in SEQ ID NO: 2 umfasst). Am stärksten bevorzugt ist die hybridisierende Sequenz fähig, mit einer Nukleinsäuresequenz gemäß SEQ ID NO: 1 oder einem Abschnitt davon zu hybridisieren.Hybridizing sequences useful in the methods of the invention encode a GRF polypeptide as defined herein and have substantially the same biological activity as the polypeptide sequences set forth in Table A.1 of Example 1. Preferably, the hybridizing sequence is capable of hybridizing to any of the nucleic acid sequences set forth in Table A.1 of Example 1 or a portion of one of these sequences, a portion as defined above, or wherein the hybridizing sequence is capable of having a nucleic acid sequence which hybridizes to an orthologue or paralogue of any of the polypeptide sequences set forth in Table A.1 of Example 1. Preferably, the hybridizing sequence is capable of hybridizing to a nucleic acid sequence encoding a polypeptide sequence comprising: (i) a domain of at least 50%, 55%, 60%, 65%, 70%, 75%, 80 %, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a QLQ domain according to SEQ ID NO: 115 (included in SEQ ID NO: 2); and (ii) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a WRC. A domain according to SEQ ID NO: 116 (included in SEQ ID NO: 2). Most preferably, the hybridizing sequence is capable of hybridizing to a nucleic acid sequence of SEQ ID NO: 1 or a portion thereof.

Eine andere Nukleinsäuresequenzvariante, die bei dem erfindungsgemäßen Verfahren nützlich ist, ist eine Spleißvariante, die für ein GRF-Polypeptid wie oben definiert kodiert, wobei eine Spleißvariante wie im vorliegenden Text definiert ist.Another nucleic acid sequence variant useful in the method of the invention is a splice variant encoding a GRF polypeptide as defined above, wherein a splice variant is as defined herein.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen bereitgestellt, bei dem man in eine(r) Pflanze eine Spleißvariante einer beliebigen der in Tabelle A.1 des Beispiels 1 angegebenen Nukleinsäuresequenzen oder eine Spleißvariante von einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen kodiert, einführt und exprimiert. In accordance with the present invention, there is provided a method of enhancing yield-related traits comprising: splicing a variant of any of the nucleic acid sequences set forth in Table A.1 of Example 1 or a splice variant of a nucleic acid sequence encoding an orthologue; Paralogue or homolog of any of the polypeptide sequences set forth in Table A.1 of Example 1, introduced and expressed.

Bevorzugte Spleißvarianten sind Spleißvarianten einer Nukleinsäuresequenz gemäß SEQ ID NO: 1 oder eine Spleißvariante einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog von SEQ ID NO: 2 kodiert. Vorzugsweise handelt es sich bei der Spleißvariante um eine Spleißvariante einer Nukleinsäuresequenz, die für eine Polypeptidsequenz kodiert, die Folgendes umfasst: (i) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer QLQ-Domäne gemäß SEQ ID NO: 115 (in SEQ ID NO: 2 umfasst); und (ii) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer WRC-Domäne gemäß SEQ ID NO: 116 (in SEQ ID NO: 2 umfasst).Preferred splice variants are splice variants of a nucleic acid sequence according to SEQ ID NO: 1 or a splice variant of a nucleic acid sequence which encodes an orthologue or paralogue of SEQ ID NO: 2. Preferably, the splice variant is a splice variant of a nucleic acid sequence encoding a polypeptide sequence comprising: (i) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80% , 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a QLQ domain as shown in SEQ ID NO: 115 (encompassed in SEQ ID NO: 2); and (ii) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a WRC. A domain according to SEQ ID NO: 116 (included in SEQ ID NO: 2).

Eine andere Nukleinsäuresequenzvariante, die bei dem erfindungsgemäßen Verfahren nützlich ist, ist eine Allelvariante einer Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert, wobei eine Allelvariante wie im vorliegenden Text definiert ist.Another nucleic acid sequence variant useful in the method of the invention is an allelic variant of a nucleic acid sequence encoding a GRF polypeptide as defined above, wherein an allelic variant is as defined herein.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen bereitgestellt, bei dem man in eine(r) Pflanze eine Allelvariante einer beliebigen der in Tabelle A.1 des Beispiels 1 angegebenen Nukleinsäuresequenzen oder eine Allelvariante von einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen kodiert, einführt und exprimiert.In accordance with the present invention, there is provided a method of enhancing yield-related traits by comprising in a plant an allelic variant of any of the nucleic acid sequences set forth in Table A.1 of Example 1 or an allelic variant of a nucleic acid sequence encoding an orthologue, Paralogue or homolog of any of the polypeptide sequences set forth in Table A.1 of Example 1, introduced and expressed.

Die Allelvarianten, die bei den erfindungsgemäßen Verfahren nützlich sind, weisen im Wesentlichen dieselbe biologische Aktivität wie das GRF-Polypeptid von SEQ ID NO: 2 und einer beliebigen der in Tabelle A.1 von Beispiel 1 dargestellten Polypeptidsequenzen auf. Allelvarianten kommen in der Natur vor, und die Verwendung dieser natürlichen Allele ist von den erfindungsgemäßen Verfahren umfasst. Bevorzugt ist die Allelvariante eine Allelvariante gemäß SEQ ID NO: 1 oder eine Allelvariante einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog von SEQ ID NO: 2 kodiert. Vorzugsweise handelt es sich bei der Allelvariante um eine Allelvariante einer Polypeptidsequenz, die Folgendes umfasst: (i) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer QLQ-Domäne gemäß SEQ ID NO: 115 (in SEQ ID NO: 2 umfasst); und (ii) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer WRC-Domäne gemäß SEQ ID NO: 116 (in SEQ ID NO: 2 umfasst).The allelic variants useful in the methods of the invention have substantially the same biological activity as the GRF polypeptide of SEQ ID NO: 2 and any of the polypeptide sequences set forth in Table A.1 of Example 1. Allelic variants occur naturally, and the use of these natural alleles is encompassed by the methods of the invention. Preferably, the allelic variant is an allelic variant of SEQ ID NO: 1 or an allelic variant of a nucleic acid sequence encoding an orthologue or paralogue of SEQ ID NO: 2. Preferably, the allelic variant is an allelic variant of a polypeptide sequence comprising: (i) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 95%, 98%, 99% or more amino acid sequence identity to a QLQ domain according to SEQ ID NO: 115 (encompassed in SEQ ID NO: 2); and (ii) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a WRC. A domain according to SEQ ID NO: 116 (included in SEQ ID NO: 2).

„Gene shuffling” oder gerichtete Evolution kann ebenfalls dazu verwendet werden, um Varianten von Nukleinsäuresequenzen, die für GRF-Polypeptide wie oben definiert kodieren, zu erzeugen, wobei der Begriff „gene shuffling” wie oben definiert ist.Gene shuffling or directed evolution can also be used to generate variants of nucleic acid sequences encoding GRF polypeptides as defined above, the term "gene shuffling" being as defined above.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen bereitgestellt, bei dem man in eine(r) Pflanze eine Variante einer beliebigen der in tAbelle A.1 des Beispiels 1 angegebenen Nukleinsäuresequenzen oder eine Variante von einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.1 von Beispiel 1 angegebenen Polypeptidsequenzen kodiert, einführt und exprimiert, wobei die Nukleinsäuresequenz mittels „gene shuffling” erhalten wird.In accordance with the present invention, there is provided a method of enhancing yield-related traits by comprising in a plant a variant of any one of the nucleic acid sequences set forth in Table 1A of Example 1 or a variant of a nucleic acid sequence encoding an orthologue. Paralogue or homolog of any of the polypeptide sequences set forth in Table A.1 of Example 1, introduced and expressed, the nucleic acid sequence being obtained by gene shuffling.

Vorzugsweise kodiert die durch Gen-Shuffling erhaltene Nukleinsäuresequenzvariante für eine Polypeptidsequenz, die Folgendes umfasst: (i) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer QLQ-Domäne gemäß SEQ ID NO: 115 (in SEQ ID NO: 2 umfasst); und (ii) eine Domäne mit mindestens 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu einer WRC-Domäne gemäß SEQ ID NO: 116 (in SEQ ID NO: 2 umfasst).Preferably, the gene shuffling nucleic acid sequence variant encodes a polypeptide sequence comprising: (i) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 95%, 98%, 99% or more amino acid sequence identity to a QLQ domain according to SEQ ID NO: 115 (encompassed in SEQ ID NO: 2); and (ii) a domain having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to a WRC. A domain according to SEQ ID NO: 116 (included in SEQ ID NO: 2).

Nukleinsäuresequenzvarianten können weiterhin auch durch ortsgerichtete Mutagenese erhalten werden. Zur Erzielung einer ortsgerichteten Mutagenese sind verschiedene Verfahren verfügbar, von denen die häufigsten Methoden auf PCR-Basis sind ( Current Protocols in Molecular Biology. Verlegt bei Wiley ).Nucleic acid sequence variants can furthermore be obtained by site-directed mutagenesis. Several methods are available for site-directed mutagenesis, the most common being PCR based ( Current Protocols in Molecular Biology. Published by Wiley ).

Nukleinsäuresequenzen, die für GRF-Polypeptide kodieren, können von einer beliebigen natürlichen oder künstlichen Quelle abstammen. Die Nukleinsäuresequenz kann von ihrer nativen Form in ihrer Zusammensetzung und/oder genomischen Umgebung durch gezieltes menschliches Eingreifen modifiziert werden. Vorzugsweise stammt die Nukleinsäuresequenz, die für das GRF-Polypeptid kodiert, von einer Pflanze, weiterhin vorzugsweise von einer dikotylen Pflanze, stärker bevorzugt von der Familie Brassicaceae, am stärksten bevorzugt stammt die Nukleinsäuresequenz von Arabidopsis thaliana.Nucleic acid sequences encoding GRF polypeptides can be derived from any natural or artificial source. The nucleic acid sequence may differ from its native form in its Composition and / or genomic environment can be modified by targeted human intervention. Preferably, the nucleic acid sequence encoding the GRF polypeptide is from a plant, further preferably from a dicotyledonous plant, more preferably from the family Brassicaceae, most preferably the nucleic acid sequence is from Arabidopsis thaliana.

Detaillierte Beschreibung der „Synovial Sarcoma Translocation(SYT)”-PolypeptideDetailed Description of "Synovial Sarcoma Translocation (SYT)" Polypeptides

Ein bevorzugtes Verfahren zur Erhöhung der Expression einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, besteht darin, dass man eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, in eine(r) Pflanze einführt und exprimiert.A preferred method of enhancing the expression of a nucleic acid sequence encoding a SYT polypeptide is by introducing and expressing a nucleic acid sequence encoding a SYT polypeptide into a plant.

Wird im vorliegenden Text ein „SYT-Protein, das in den erfindungsgemäßen Methoden nützlich ist” erwähnt, so bedeutet dies ein SYT-Polypeptid wie im vorliegenden Text definiert. Wird im vorliegenden Text eine „SYT-Nukleinsäuresequenz, die in den erfindungsgemäßen Verfahren nützlich ist” erwähnt, so bedeutet dies eine Nukleinsäuresequenz, die fähig ist, für solch ein SYT-Polypeptid zu kodieren. Die in eine Pflanze einzuführende Nukleinsäuresequenz (und die daher bei der Durchführung der erfindungsgemäßen Verfahren nützlich ist) ist jede Nukleinsäuresequenz, die für die Art von Polypeptid, die nun beschrieben werden soll und die im Folgenden auch „SYT-Nukleinsäure” oder „SYT-Gen” genannt wird, kodiert.As used herein, a "SYT protein useful in the methods of the invention" refers to a SYT polypeptide as defined herein. As used herein, a "SYT nucleic acid sequence useful in the methods of the invention" means a nucleic acid sequence capable of encoding such a SYT polypeptide. The nucleic acid sequence to be introduced into a plant (and therefore useful in carrying out the methods of the invention) is any nucleic acid sequence that is representative of the type of polypeptide to be described, and which hereinafter also includes "SYT nucleic acid" or "SYT gene "Is encoded.

Der Begriff „SYT-Polypeptid” wie im vorliegenden Text definiert bezieht sich auf ein Polypeptid, das vom N-terminalen Ende Richtung C-terminales Ende Folgendes umfasst: (i) eine SNH-Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SNH-Domäne von SEQ ID NO: 262; und (ii) eine Met-reiche Domäne; und (iii) eine QG-reiche Domäne. Vorzugsweise umfasst die SNH-Domäne die am stärksten konservierten Reste gemäß SEQ ID NO: 263, und ist in schwarz dargestellt.The term "SYT polypeptide" as defined herein refers to a polypeptide comprising from the N-terminal end towards the C-terminal end: (i) an SNH domain of increasing preference at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, 99% sequence identity to the SNH domain of SEQ ID NO: 262; and (ii) a Met-rich domain; and (iii) a QG-rich domain. Preferably, the SNH domain comprises the most conserved residues of SEQ ID NO: 263, and is in shown in black.

Alternativ dazu oder zusätzlich betrifft ein „SYT-Polypeptid” wie im vorliegenden Text definiert ein beliebiges Polypeptid umfassend eine Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SSXT-Domäne mit einem InterPro-Eintrag IPR007726 (PFAM-Eintrag PF05030, SSXT-Protein (N-terminale Region)) von SEQ ID NO: 264.Alternatively, or additionally, a "SYT polypeptide" as defined herein refers to any polypeptide comprising a domain of increasing preference at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%. , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the SSXT domain with an InterPro entry IPR007726 (PFAM entry PF05030, SSXT protein (N-terminal region)) of SEQ ID NO: 264.

Alternativ dazu oder zusätzlich betrifft ein „SYT-Polypeptid” wie im vorliegenden Text definiert ein beliebiges Polypeptid umfassend eine Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% oder mehr Aminosäuresequenzidentität zu dem SYT-Polypeptid gemäß SEQ ID NO: 121 oder zu einer beliebigen der Volllängenpolypeptidsequenzen in Tabelle A.2 im vorliegenden Text.Alternatively, or additionally, a "SYT polypeptide" as defined herein refers to any polypeptide comprising a domain of increasing preference at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%. , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more amino acid sequence identity to the SYT polypeptide of SEQ ID NO: 121 or to any of the full length polypeptide sequences in Table A.2 in the present text.

Alternativ dazu oder zusätzlich interagiert ein „SYT-Polypeptid” mit „Growth-Regulating Factor”(GRF)-Polypeptiden in einem Hefe-zwei-Hybrid-Interaktionsassay, zum Beispiel mit den GRF-Polypeptidsequenzen in Tabelle A.1 im vorliegenden Text.Alternatively, or in addition, a "SYT polypeptide" interacts with "Growth Regulating Factor" (GRF) polypeptides in a yeast two-hybrid interaction assay, for example, with the GRF polypeptide sequences in Table A.1 herein.

Die Analyse der SYT-Polypeptidsequenz von SEQ ID NO: 121 ist unten in den Beispielen 2 und 4 im vorliegenden Text dargestellt. So umfasst zum Beispiel ein SYT-Polypeptid gemäß SEQ ID NO: 121 eine SSXT-Domäne mit einem InterPro-Eintrag IPR007726 (PFAM-Eintrag PF05030) in der InterPro-Domänendatenbank. Domänen können auch unter Verwendung von Routinetechniken, wie zum Beispiel mittels Sequenz-Alignment, identifiziert werden. Ein Alignment der SNH-Domäne der Polypeptide von Tabelle A.2 im vorliegenden Text ist in dargestellt. Solche Alignments eignen sich zum Identifizieren der zwischen den SYT-Polypeptiden am stärksten konservierten Aminosäuren, wie den am stärksten konservierten Resten gemäß SEQ ID NO: 263Analysis of the SYT polypeptide sequence of SEQ ID NO: 121 is shown below in Examples 2 and 4 herein. For example, a SYT polypeptide of SEQ ID NO: 121 comprises an SSXT domain with an InterPro entry IPR007726 (PFAM entry PF05030) in the InterPro domain database. Domains can also be identified using routine techniques, such as by means of sequence alignment. An alignment of the SNH domain of the polypeptides of Table A.2 hereinabove is in shown. Such alignments are useful in identifying the most conserved amino acids between the SYT polypeptides, such as the most conserved residues of SEQ ID NO: 263

Verfahren für das Alignment von Sequenzen für Vergleichszwecke sind in der Fachwelt gut bekannt, wie vorstehend kurz beschrieben. Die Sequenzidentitätswerte können mit den oben erwähnten Programmen unter Einstellung der Default-Parameter über die gesamte Nukleinsäuresequenz oder Polypeptidsequenz oder über ausgewählte Domänen oder konservierte Motiv(e) bestimmt werden. Außerhalb der SNH-Domäne und der SSXT-Domäne weisen die SYT-Polypeptide angeblich eine niedrige Aminosäuresequenzidentität auf. Beispiel 3 im vorliegenden Text beschreibt in Tabelle B.2 den Prozentsatz der Identität zwischen dem SYT-Polypeptid gemäß SEQ ID NO: 121 und den SYT-Polypeptiden in Tabelle A.2, welcher nur 25% Aminosäuresequenzidentität betragen kann. Der Prozentsatz der Aminosäureidentität kann wesentlich gesteigert werden, wenn die Identitätsberechnung zwischen der SNH-Domäne SEQ ID NO: 262 (in SEQ ID NO: 121 umfasst) und der SNH-Domäne der SYT-Polypeptide von Tabelle A.2 (in dargestellt) erfolgt. Auf ähnliche Weise kann der Prozentsatz der Identität wesentlich erhöht werden, wenn die Identitätsberechnung zwischen der SSXT-Domäne gemäß SEQ ID NO: 264 (in SEQ ID NO: 121 umfasst) und den SSXT-Domänen der SYT-Polypeptide, die bei der Durchführung der Erfindung nützlich sind, erfolgt. Die SNH-Domäne, die in der SSXT-Domäne umfasst ist, ist zwischen den unterschiedlichen SYT-Polypeptiden besser konserviert als die SSXT-Domäne.Methods for the alignment of sequences for comparison purposes are well known in the art, as briefly described above. The sequence identity values may be determined using the programs mentioned above, adjusting the default parameters throughout the nucleic acid sequence or polypeptide sequence, or via selected domains or conserved motif (s). Outside the SNH domain and the SSXT domain, the SYT polypeptides are reported to have low amino acid sequence identity. Example 3 herein describes in Table B.2 the percent identity between the SYT polypeptide of SEQ ID NO: 121 and the SYT polypeptides in Table A.2 which may be as small as 25% amino acid sequence identity. The percentage of amino acid identity can be substantially increased if the identity calculation between the SNH domain SEQ ID NO: 262 (included in SEQ ID NO: 121) and the SNH domain of the SYT polypeptides of Table A.2 (in shown) takes place. Similarly, if the identity calculation between the SSXT domain of SEQ ID NO: 264 (in SEQ ID NO: 121) and the SSXT domains of the SYT polypeptides used in the performance of the Invention are useful, takes place. The SNH domain, which is included in the SSXT domain, is more conserved between the different SYT polypeptides than the SSXT domain.

Die SYT-Polypeptide, die bei den erfindungsgemäßen Verfahren nützlich sind (zumindest in ihrer nativen Form), weisen außerdem typischerweise, jedoch nicht zwingend, Transkriptionsregulationsaktivität sowie die Fähigkeit, mit anderen Proteinen zu interagieren, auf SYT-Polypeptide mit reduzierter Transkriptionsregulationsaktivität, ohne Transkriptionsaktivität, mit reduzierter Fähigkeit für die Protein-Protein-Interaktion oder mit keiner Fähigkeit zur Protein-Protein-Interaktion können daher bei den Methoden der vorliegenden Erfindung ebenfalls nützlich sein. Die DNA-Bindungsaktivität und die Protein-Protein-Interaktionen können leicht in vitro oder in vivo unter Verwendung von fachbekannten Techniken bestimmt werden (zum Beispiel in Current Protocols in Molecular Biology, Band 1 und 2, Ausubel et al. (1994), Current Protocols ). Die SYT-Polypeptide sind auch zu in-vivo-Interaktion mit GRF-Polypeptiden in Hefezellen befähigt, und zwar unter Verwendung eines Hefe-zwei-Hybrid-Protein-Protein-Interaktions-Assays (Kim & Kende, oben). In-vitro-Bindungsassays werden auch verwendet, um nachzuweisen, dass es sich bei den GRF-Polypeptiden und SYT-Polypeptiden um interagierende Partner handelt (Kim & Kende, oben).The SYT polypeptides useful in the methods of the invention (at least in their native form) also typically, but not necessarily, have transcriptional regulatory activity, as well as the ability to interact with other proteins, on SYT polypeptides having reduced transcriptional regulatory activity, without transcriptional activity, therefore, with reduced ability for protein-protein interaction or with no ability for protein-protein interaction may also be useful in the methods of the present invention. DNA binding activity and protein-protein interactions can be readily determined in vitro or in vivo using art-known techniques (for example, in U.S. Pat Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel et al. (1994), Current Protocols ). The SYT polypeptides are also capable of in vivo interaction with GRF polypeptides in yeast cells using a yeast two-hybrid protein-protein interaction assay (Kim & Kende, supra). In vitro binding assays are also used to demonstrate that the GRF polypeptides and SYT polypeptides are interacting partners (Kim & Kende, supra).

Die vorliegende Erfindung wird dadurch erläutert, dass man Pflanzen mit der Nukleinsäuresequenz gemäß SEQ ID NO: 120, die für die SYT-Polypeptidsequenz von SEQ ID NO: 121 kodiert, transformiert. Die Durchführung der Erfindung ist jedoch nicht auf diese Sequenzen beschränkt; die erfindungsgemäßen Verfahren können vorteilhaft mit einer beliebigen ein SYT-Polypeptid wie im vorliegenden Text definiert kodierenden Nukleinsäuresequenz durchgeführt werden.The present invention is illustrated by transforming plants with the nucleic acid sequence according to SEQ ID NO: 120 which codes for the SYT polypeptide sequence of SEQ ID NO: 121. However, the practice of the invention is not limited to these sequences; the methods of the invention may be advantageously carried out with any nucleic acid sequence encoding a SYT polypeptide as defined herein.

Beispiele für Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, sind in Tabelle A.2 des Beispiels 1 des vorliegenden Textes angegeben. Solche Nukleinsäuresequenzen eignen sich bei der Durchführung der erfindungsgemäßen Verfahren. Die in Tabelle A.2 von Beispiel 1 angegebenen Polypeptidsequenzen sind beispielhafte Sequenzen für Orthologe und Paraloge des SYT-Polypeptids gemäß SEQ ID NO: 121, wobei die Begriffe „Orthologe” und „Paraloge” wie im vorliegenden Text definiert sind. Weitere Orthologe und Paraloge können leicht durch Durchführen einer (wie im Vorstehenden beschrieben) reziproken Blast-Suche identifiziert werden.Examples of nucleic acid sequences encoding SYT polypeptides are given in Table A.2 of Example 1 of the present text. Such nucleic acid sequences are useful in carrying out the methods of the invention. The polypeptide sequences set forth in Table A.2 of Example 1 are exemplary orthologues and paralogues of the SYT polypeptide of SEQ ID NO: 121, the terms "orthologues" and "paralogues" being as defined herein. Other orthologues and paralogs can be easily identified by performing a reciprocal blast search (as described above).

Nukleinsäurevarianten können ebenfalls bei der Durchführung der erfindungsgemäßen Verfahren nützlich sein. Zu Beispielen für solche Varianten zählen Nukleinsäuresequenzen, die für Homologe und Derivate von einer beliebigen der Polypeptidsequenzen, die in Tabelle A.2 von Beispiel 1 angegeben sind, kodieren, wobei die Begriffe „Homolog” und „Derivat” wie im vorliegenden Text definiert sind. Nützlich in den erfindungsgemäßen Verfahren sind auch Nukleinsäuresequenzen, die für Homologe und Derivate von Orthologen oder Paralogen einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodieren. Homologe und Derivate, die in den Verfahren der vorliegenden Erfindung nützlich sind, weisen im Wesentlichen dieselbe biologische und funktionelle Aktivität auf wie das unmodifizierte Protein, von dem sie abstammen.Nucleic acid variants may also be useful in carrying out the methods of the invention. Examples of such variants include nucleic acid sequences encoding homologs and derivatives of any of the polypeptide sequences set forth in Table A.2 of Example 1, the terms "homologue" and "derivative" being as defined herein. Also useful in the methods of the invention are nucleic acid sequences encoding homologs and derivatives of orthologues or paralogues of any of the polypeptide sequences set forth in Table A.2 of Example 1. Homologs and derivatives useful in the methods of the present invention have substantially the same biological and functional activity as the unmodified protein from which they are derived.

Zu weiteren Nukleinsäurevarianten, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, zählen Abschnitte von Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, Nukleinsäuresequenzen, die mit Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, hybridisieren, Spleißvarianten von Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, Allelvarianten von Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, und Varianten von Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, die mittels „gene shuffling” erhalten wurden. Die Begriffe „hybridisierende Sequenz”, „Spleißvariante”, „Allelvariante” und „gene shuffling” sind wie im vorliegenden Text beschrieben.Other nucleic acid variants useful in practicing the methods of the invention include portions of nucleic acid sequences encoding SYT polypeptides, nucleic acid sequences that hybridize to nucleic acid sequences encoding SYT polypeptides, splice variants of nucleic acid sequences encoding SYT polypeptides encoding allelic variants of nucleic acid sequences encoding SYT polypeptides and variants of nucleic acid sequences encoding SYT polypeptides obtained by gene shuffling. The terms "hybridizing sequence", "splice variant", "allelic variant" and "gene shuffling" are as described herein.

Bei den Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, muss es sich nicht um Volllängen-Nukleinsäuresequenzen handeln, da die Durchführung der erfindungsgemäßen Verfahren nicht von der Verwendung von Volllängen-Nukleinsäuresequenzen abhängig ist. Gemäß der vorliegenden Erfindung wird ein Verfahren zur Erhöhung der Ertragsmerkmale in Pflanzen bereitgestellt, wobei das Verfahren umfasst, dass man in eine(r) Pflanze einen Teil einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Nukleinsäuresequenzen oder einen Teil einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodiert, einführt und exprimiert.The nucleic acid sequences encoding SYT polypeptides are not required to be full-length nucleic acid sequences, as performance of the methods of the invention is not dependent on the use of full-length nucleic acid sequences. According to the present invention, there is provided a method of enhancing yield-related traits in plants, the method comprising introducing into a plant a portion of any one of the nucleic acid sequences set forth in Table A.2 of Example 1 or a portion of a nucleic acid sequence comprising for an orthologue, paralogue or homolog of any of the polypeptide sequences set forth in Table A.2 of Example 1, introduced and expressed.

Ein Abschnitt einer Nukleinsäuresequenz kann zum Beispiel dadurch hergestellt werden, dass man eine oder mehrere Deletionen bei der Nukleinsäuresequenz durchführt. Die Abschnitte können in isolierter Form verwendet werden oder können an andere Kodiersequenzen (oder Nichtkodiersequenzen) fusioniert werden, um zum Beispiel ein Protein herzustellen, bei dem mehrere Aktivitäten kombiniert sind. Bei der Fusion an andere Kodiersequenzen kann das bei der Translation hergestellte Polypeptid größer sein, als für den Proteinabschnitt vorhergesagt wurde.For example, a portion of a nucleic acid sequence may be prepared by performing one or more deletions on the nucleic acid sequence. The sections can be isolated Or may be fused to other coding sequences (or non-coding sequences) to produce, for example, a protein in which several activities are combined. When fused to other coding sequences, the polypeptide produced during translation may be larger than predicted for the protein portion.

Abschnitte, die in den erfindungsgemäßen Verfahren nützlich sind und die für ein SYT-Polypeptid wie im vorliegenden Text definiert kodieren, weisen im Wesentlichen dieselbe biologische Aktivität wie die Polypeptidsequenz gemäß Tabelle A.2 des Beispiels 1 auf. Vorzugsweise handelt es sich bei dem Abschnitt um einen Abschnitt einer beliebigen der in Tabelle A.2 von Beispiel 1 angegebenen Nukleinsäuresequenzen oder um einen Abschnitt einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodiert. Vorzugsweise beträgt die Länge des Abschnitts in steigender Bevorzugung mindestens 100, 125, 150, 175, 200 oder 225 aufeinanderfolgende Nukleotide, vorzugsweise mindestens 250, 275, 300, 325, 350, 375, 400, 425, 450 oder 475 aufeinanderfolgende Nukleotide, weiter bevorzugt mindestens 500, 525, 550, 575, 600, 625, 650, 675, 700 oder 725 aufeinanderfolgende Nukleotide oder die Länge einer Volllängen-SYT-Nukleinsäuresequenz, wobei es sich bei den aufeinanderfolgenden Nukleotiden um eine beliebige der Nukleinsäuresequenzen in Tabelle A.2 von Beispiel 1 oder um eine Nukleinsäuresequenz, die für ein Ortholog oder Paralog von einer der Polypeptidsequenzen in Tabelle A.2 von Beispiel 1 kodiert, handelt. Vorzugsweise handelt es sich bei dem Abschnitt um einen Nukleinsäuresequenzabschnitt, der für ein Polypeptidsequenzpolypeptid kodiert, das vom N-terminalen Ende in Richtung C-terminales Ende Folgendes umfasst: (i) eine SNH-Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SNH-Domäne von SEQ ID NO: 262; und (ii) eine Met-reiche Domäne; und (iii) eine QG-reiche Domäne. Vorzugsweise umfasst die SNH-Domäne die meisten konservierten Reste gemäß SEQ ID NO: 263 und ist in schwarz dargestellt. Am stärksten bevorzugt handelt es sich beim dem Abschnitt um einen Abschnitt der Nukleinsäuresequenz von SEQ ID NO: 120.Sections which are useful in the methods of the invention and which encode a SYT polypeptide as defined herein have substantially the same biological activity as the polypeptide sequence of Table A.2 of Example 1. Preferably, the portion is a portion of any of the nucleic acid sequences set forth in Table A.2 of Example 1, or a portion of a nucleic acid sequence that encodes an orthologue or paralogue of any of the polypeptide sequences set forth in Table A.2 of Example 1 , Preferably, the length of the segment in increasing preference is at least 100, 125, 150, 175, 200 or 225 contiguous nucleotides, preferably at least 250, 275, 300, 325, 350, 375, 400, 425, 450 or 475 contiguous nucleotides, more preferred at least 500, 525, 550, 575, 600, 625, 650, 675, 700 or 725 contiguous nucleotides or the length of a full length SYT nucleic acid sequence, wherein the contiguous nucleotides are any of the nucleic acid sequences in Table A.2 of Example 1 or a nucleic acid sequence encoding an orthologue or paralogue of one of the polypeptide sequences in Table A.2 of Example 1. Preferably, the segment is a nucleic acid sequence portion encoding a polypeptide sequence polypeptide comprising from the N-terminal end toward the C-terminal end: (i) an SNH domain having at least 20%, preferably 25%, preference 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, 99% sequence identity to the SNH domain of SEQ ID NO: 262; and (ii) a Met-rich domain; and (iii) a QG-rich domain. Preferably, the SNH domain comprises the most conserved residues as shown in SEQ ID NO: 263 and is disclosed in U.S. Pat shown in black. Most preferably, the portion is a portion of the nucleic acid sequence of SEQ ID NO: 120.

Eine andere Nukleinsäuresequenzvariante, die bei den erfindungsgemäßen Verfahren nützlich ist, ist eine Nukleinsäuresequenz, die fähig ist, unter reduzierten Stringenzbedingungen, vorzugsweise unter stringenten Bedingungen, mit einer Nukleinsäuresequenz, die für ein SYT-Polypeptid wie im vorliegenden Text definiert kodiert, oder mit einem Abschnitt wie im vorliegenden Text definiert zu hybridisieren.Another nucleic acid sequence variant useful in the methods of the invention is a nucleic acid sequence capable of encoding, under reduced stringency conditions, preferably under stringent conditions, a nucleic acid sequence encoding a SYT polypeptide as defined herein or a portion thereof as defined herein to hybridize.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen in Pflanzen bereitgestellt, wobei das Verfahren umfasst, das man eine Nukleinsäuresequenz, die fähig ist, mit einer beliebigen der in Tabelle A.2 von Beispiel 1 angegebenen Nukleinsäuresequenzen zu hybridisieren, in eine(r) Pflanze einführt und exprimiert, oder wobei das Verfahren umfasst, dass man eine Nukleinsäuresequenz, die fähig ist, an eine Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.2 von Beispiel 1 angegebenen Nukleinsäuresequenzen kodiert, zu hybridisieren, in eine(r) Pflanze einführt und exprimiert.According to the present invention, there is provided a method of enhancing yield-related traits in plants, the method comprising: subjecting a nucleic acid sequence capable of hybridizing to any of the nucleic acid sequences set forth in Table A.2 of Example 1 to a r) introducing and expressing the plant, or wherein the method comprises allowing a nucleic acid sequence capable of encoding a nucleic acid sequence encoding an orthologue, paralogue or homolog of any one of the nucleic acid sequences set forth in Table A.2 of Example 1 hybridize, introduce into a plant and express.

Hybridisierende Sequenzen, die in den erfindungsgemäßen Verfahren nützlich sind, kodieren für ein SYT-Polypeptid wie im vorliegenden Text definiert, das im Wesentlichen dieselbe biologische Aktivität wie die Polypeptidsequenzen gemäß Tabelle A.2 von Beispiel 1 aufweist. Vorzugsweise ist die hybridisierende Sequenz fähig, mit einer beliebigen der in Tabelle A.2 von Beispiel 1 angegebenen Nukleinsäuresequenzen oder einem Abschnitt von einer dieser Sequenzen zu hybridisieren, wobei ein Abschnitt wie oben definiert ist, oder wobei die hybridisierende Sequenz fähig ist, mit einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodiert, zu hybridisieren. Vorzugsweise ist die hybridisierende Sequenz fähig, mit einer Nukleinsäuresequenz zu hybridisieren, die für eine Polypeptidsequenz kodiert, welche vom N-terminalen Ende in Richtung C-terminales Ende Folgendes umfasst: (i) eine SNH-Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SNH-Domäne von SEQ ID NO: 262; und (ii) eine Met-reiche Domäne; und (iii) eine QG-reiche Domäne. Vorzugsweise umfasst die SNH-Domäne die meisten konservierten Reste gemäß SEQ ID NO: 263 und ist in schwarz dargestellt. Am stärksten bevorzugt ist die hybridisierende Sequenz fähig, mit einer Nukleinsäuresequenz gemäß SEQ ID NO: 120 oder einem Abschnitt davon zu hybridisieren.Hybridizing sequences useful in the methods of the invention encode a SYT polypeptide as defined herein having substantially the same biological activity as the polypeptide sequences of Table A.2 of Example 1. Preferably, the hybridizing sequence is capable of hybridizing to any of the nucleic acid sequences set forth in Table A.2 of Example 1 or a portion of one of these sequences, a portion as defined above or wherein the hybridizing sequence is capable of having a nucleic acid sequence which hybridizes to an orthologue or paralogue of any of the polypeptide sequences set forth in Table A.2 of Example 1. Preferably, the hybridizing sequence is capable of hybridizing to a nucleic acid sequence encoding a polypeptide sequence comprising from the N-terminal end toward the C-terminal end: (i) an SNH domain of at least 20%, more preferably 25% %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the SNH domain of SEQ ID NO: 262; and (ii) a Met-rich domain; and (iii) a QG-rich domain. Preferably, the SNH domain comprises the most conserved residues as shown in SEQ ID NO: 263 and is disclosed in U.S. Pat shown in black. Most preferably, the hybridizing sequence is capable of hybridizing to a nucleic acid sequence of SEQ ID NO: 120 or a portion thereof.

Eine weitere Nukleinsäuresequenzvariante, die bei den erfindungsgemäßen Verfahren nützlich ist, ist eine Spleißvariante, die für ein SYT-Polypeptid wie oben definiert kodiert, wobei eine Spleißvariante wie im vorliegenden Text definiert ist.Another nucleic acid sequence variant useful in the methods of the invention is a splice variant encoding a SYT polypeptide as defined above, wherein a splice variant is as defined herein.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen bereitgestellt, wobei das Verfahren umfasst, dass man eine Spleißvariante einer beliebigen der in Tabelle A.2 von Beispiel 1 angegebenen Nukleinsäuresequenzen oder eine Spleißvariante von einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodiert, in eine(r) Pflanze einführt und exprimiert. According to the present invention, there is provided a method of enhancing yield-related traits, the method comprising using a splice variant of any one of the nucleic acid sequences set forth in Table A.2 of Example 1, or a splice variant of a nucleic acid sequence encoding an orthologue, paralogue or Homologs of any of the polypeptide sequences set forth in Table A.2 of Example 1 are introduced into a plant and expressed.

Bevorzugte Spleißvarianten sind Spleißvarianten einer Nukleinsäuresequenz gemäß SEQ ID NO: 120 oder eine Spleißvariante einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog von SEQ ID NO: 121 kodiert. Vorzugsweise handelt es sich bei der Spleißvariante um eine Spleißvariante einer Nukleinsäuresequenz, die für eine Polypeptidsequenz kodiert, die vom N-terminalen Ende in Richtung C-terminales Ende Folgendes umfasst: (i) eine SNH-Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SNH-Domäne von SEQ ID NO: 262; und (ii) eine Met-reiche Domäne; und (iii) eine QG-reiche Domäne. Vorzugsweise umfasst die SNH-Domäne die meisten konservierten Reste gemäß SEQ ID NO: 263 und ist in schwarz dargestellt.Preferred splice variants are splice variants of a nucleic acid sequence according to SEQ ID NO: 120 or a splice variant of a nucleic acid sequence which encodes an orthologue or paralogue of SEQ ID NO: 121. Preferably, the splice variant is a splice variant of a nucleic acid sequence encoding a polypeptide sequence comprising from the N-terminal end toward the C-terminal end: (i) an SNH domain of at least 20%, more preferably 25% %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the SNH domain of SEQ ID NO: 262; and (ii) a Met-rich domain; and (iii) a QG-rich domain. Preferably, the SNH domain comprises the most conserved residues as shown in SEQ ID NO: 263 and is disclosed in U.S. Pat shown in black.

Eine weitere Nukleinsäuresequenzvariante, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich ist, ist eine Allelvariante einer Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert, wobei eine Allelvariante wie im vorliegenden Text definiert ist.Another nucleic acid sequence variant useful in practicing the methods of the invention is an allelic variant of a nucleic acid sequence encoding a SYT polypeptide as defined above, wherein an allelic variant is as defined herein.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen bereitgestellt, wobei das Verfahren umfasst, dass man eine Allelvariante von einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Nukleinsäuresequenzen in eine(r) Pflanze einführt und exprimiert, oder wobei das Verfahren umfasst, dass man eine Allelvariante einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog von einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodiert, in eine(r) Pflanze einführt und exprimiert.According to the present invention, there is provided a method of enhancing yield-related traits, the method comprising introducing and expressing an allelic variant of any one of the nucleic acid sequences set forth in Table A.2 of Example 1 into a plant, or wherein: A method comprises introducing and expressing an allelic variant of a nucleic acid sequence encoding an orthologue, paralogue or homologue of any one of the polypeptide sequences set forth in Table A.2 of Example 1 into a plant.

Die Allelvarianten, die in den erfindungsgemäßen Verfahren nützlich sind, weisen im Wesentlichen dieselbe biologische Aktivität wie das SYT-Polypeptid gemäß SEQ ID NO: 121 und einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen auf. Allelvarianten kommen in der Natur vor, und die Verwendung von diesen natürlichen Allelen ist von den Verfahren der vorliegenden Erfindung umfasst. Bevorzugt ist die Allelvariante eine Allelvariante gemäß SEQ ID NO: 120 oder eine Allelvariante einer Nukleinsäuresequenz, die für ein Ortholog oder Paralog von SEQ ID NO: 121 kodiert. Vorzugsweise handelt es sich bei der Allelvariante um eine Allelvariante einer Polypeptidsequenz, die vom N-terminalen Ende in Richtung C-terminales Ende Folgendes umfasst: (i) eine SNH-Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SNH-Domäne von SEQ ID NO: 262; und (ii) eine Met-reiche Domäne; und (iii) eine QG-reiche Domäne. Vorzugsweise umfasst die SNH-Domäne die meisten konservierten Reste gemäß SEQ ID NO: 263 und ist in schwarz dargestellt.The allelic variants useful in the methods of the invention have substantially the same biological activity as the SYT polypeptide of SEQ ID NO: 121 and any of the polypeptide sequences set forth in Table A.2 of Example 1. Allelic variants occur in nature, and the use of these natural alleles is encompassed by the methods of the present invention. Preferably, the allelic variant is an allelic variant of SEQ ID NO: 120 or an allelic variant of a nucleic acid sequence encoding an orthologue or paralogue of SEQ ID NO: 121. Preferably, the allelic variant is an allelic variant of a polypeptide sequence comprising from the N-terminal end towards the C-terminal end: (i) an SNH domain with at least 20%, 25%, 30%, 35 as an increasing preference %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the SNH domain of SEQ ID NO: 262; and (ii) a Met-rich domain; and (iii) a QG-rich domain. Preferably, the SNH domain comprises the most conserved residues as shown in SEQ ID NO: 263 and is disclosed in U.S. Pat shown in black.

„Gene shuffling” oder gerichtete Evolution können ebenfalls eingesetzt werden, um Varianten von Nukleinsäuresequenzen, die für SYT-Polypeptide wie oben definiert kodieren, zu erzeugen, wobei der Begriff „gene shuffling” wie im vorliegenden Text definiert ist.Gene shuffling or directed evolution may also be used to generate variants of nucleic acid sequences encoding SYT polypeptides as defined above, the term "gene shuffling" being defined herein.

Gemäß der vorliegenden Erfindung wird ein Verfahren für die Erhöhung von Ertragsmerkmalen bereitgestellt, wobei das Verfahren umfasst, dass man eine Variante einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Nukleinsäuresequenzen in eine(r) Pflanze einführt und exprimiert, oder wobei das Verfahren umfasst, dass man eine Variante einer Nukleinsäuresequenz, die für ein Ortholog, Paralog oder Homolog einer beliebigen der in Tabelle A.2 des Beispiels 1 angegebenen Polypeptidsequenzen kodiert, wobei diese Nukleinsäuresequenzvariante durch „gene shuffling” erhalten wurde, in eine(r) Pflanze einführt und exprimiert.In accordance with the present invention, there is provided a method of enhancing yield-related traits, the method comprising introducing and expressing a variant of any one of the nucleic acid sequences set forth in Table A.2 of Example 1 into a plant, or wherein the method comprises introducing into a plant a variant of a nucleic acid sequence which codes for an orthologue, paralogue or homolog of any of the polypeptide sequences given in Table A.2 of Example 1, this nucleic acid sequence variant being obtained by gene shuffling and expressed.

Vorzugsweise kodiert die durch „Gene-Shuffling” erhaltene Nukleinsäuresequenzvariante für eine Polypeptidsequenz, die vom N-terminalen Ende in Richtung C-terminales Ende Folgendes umfasst: (i) eine SNH-Domäne mit in steigender Bevorzugung mindestens 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% Sequenzidentität zu der SNH-Domäne von SEQ ID NO: 262; und (ii) eine Met-reiche Domäne; und (iii) eine QG-reiche Domäne. Vorzugsweise umfasst die SNH-Domäne die meisten konservierten Reste gemäß SEQ ID NO: 263 und ist in schwarz dargestellt.Preferably, the nucleic acid sequence variant obtained by gene shuffling encodes a polypeptide sequence comprising from the N-terminal end toward the C-terminal end: (i) an SNH domain with at least 20%, 25%, 30% increasing preference , 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99% sequence identity to the SNH domain of SEQ ID NO: 262; and (ii) a Met-rich domain; and (iii) a QG-rich domain. Preferably, the SNH domain comprises the most conserved residues as shown in SEQ ID NO: 263 and is disclosed in U.S. Pat shown in black.

Nukleinsäuresequenzvarianten können weiterhin auch durch ortsgerichtete Mutagenese erhalten werden. Zur Erzielung einer ortsgerichteten Mutagenese sind verschiedene Verfahren verfügbar, von denen die häufigsten Methoden auf PCR-Basis sind ( Current Protocols in Molecular Biology. Verlegt bei Wiley ). Nucleic acid sequence variants can furthermore be obtained by site-directed mutagenesis. Several methods are available for site-directed mutagenesis, the most common being PCR based ( Current Protocols in Molecular Biology. Published by Wiley ).

Nukleinsäuresequenzen, die für SYT-Polypeptide kodieren, können von einer beliebigen natürlichen oder künstlichen Quelle abstammen. Die Nukleinsäuresequenz kann von ihrer nativen Form in ihrer Zusammensetzung und/oder genomischen Umgebung durch gezieltes menschliches Eingreifen modifiziert werden. Vorzugsweise stammt die Nukleinsäuresequenz, die für das SYT-Polypeptid kodiert, von einer Pflanze, weiter bevorzugt von einer dikotylen Pflanze, stärker bevorzugt von der Familie Brassicaceae, am stärksten bevorzugt stammt die Nukleinsäuresequenz von Arabidopsis thaliana.Nucleic acid sequences encoding SYT polypeptides can be derived from any natural or artificial source. The nucleic acid sequence may be modified from its native form in its composition and / or genomic environment by targeted human intervention. Preferably, the nucleic acid sequence encoding the SYT polypeptide is from a plant, more preferably from a dicotyledonous plant, more preferably from the family Brassicaceae, most preferably the nucleic acid sequence is from Arabidopsis thaliana.

Die Durchführung der erfindungsgemäßen Verfahren, d. h. die Erhöhung der Expression in einer Pflanze von Folgendem: (i) einer Nukleinsäuresequenz, die für ein „Growth-Regulating Factor”(GRF)-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein „Synovial Sarcoma Translocation”(SYT)-Polypeptid kodiert, führt zu Pflanzen, die im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der folgenden (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen. Die Begriffe „Ertrag” und „Samenertrag” sind ausführlicher im Abschnitt „Definitionen” im vorliegenden Text beschrieben.The implementation of the method according to the invention, d. H. increasing expression in a plant of: (i) a nucleic acid sequence encoding a growth-regulating factor (GRF) polypeptide; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide results in plants which, in comparison to plants having an increased expression of one of the following (i) a nucleic acid sequence encoding a GRF Or (ii) a nucleic acid sequence encoding a SYT polypeptide having increased yield-related traits. The terms "yield" and "seed yield" are described in more detail in the "Definitions" section herein.

Wählt man Mais als Beispiel, so kann sich eine Ertragserhöhung als eines oder mehrere der folgenden Merkmale äußern: Erhöhte Anzahl Pflanzen, die pro Hektar oder Acre etabliert sind, Erhöhung der Anzahl Ähren pro Pflanze, Erhöhung der Anzahl Reihen, der Anzahl Körner pro Reihe, des Korngewichts, Tausendkorngewichts, Ährenlänge/-durchmessers, Erhöhung der Samenfüllungsrate (Anzahl gefüllter Samen dividiert durch die Gesamtzahl Samen und multipliziert mit Hundert) und viele andere mehr. Wählt man Reis als Beispiel, so kann sich eine Ertragserhöhung als Erhöhung bezüglich einem oder mehreren der folgenden Merkmale ausdrücken: Anzahl Pflanzen pro Hektar oder Acre, Anzahl Rispen pro Pflanze, Anzahl Ährchen pro Rispe, Anzahl Blüten pro Rispe (ausgedrückt als Verhältnis der Anzahl der gefüllten Samen zu der Anzahl der Primärrispen), erhöhte Samenfüllungsrate (Anzahl gefüllter Samen dividiert durch die Gesamtzahl Samen und multipliziert mit Hundert), erhöhtes Tausendkorngewicht und viele andere mehr.If one chooses corn as an example, an increase in yield may be expressed as one or more of the following: increased numbers of plants established per hectare or acre, increasing the number of ears per plant, increasing the number of rows, the number of grains per row, grain weight, thousand kernel weight, ear length / diameter, increase in seed filling rate (number of filled seeds divided by the total number of seeds and multiplied by one hundred) and many others. By taking rice as an example, an increase in yield may be expressed as an increase in one or more of the following characteristics: number of plants per hectare or acre, number of panicles per plant, number of spikes per panicle, number of flowers per panicle (expressed as the ratio of the number of spikes) filled seed to the number of primary panicles), increased seed filling rate (number of filled seeds divided by the total number of seeds and multiplied by one hundred), increased thousand kernel weight and many others more.

Die Durchführung der erfindungsgemäßen Verfahren, d. h. die Erhöhung der Expression in einer Pflanze von Folgendem: (i) einer Nukleinsäuresequenz, die für ein „Growth-Regulating Factor”(GRF)-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein „Synovial Sarcoma Translocation”(SYT)-Polypeptid kodiert, führt zu Pflanzen, die im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der folgenden (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen. Vorzugsweise handelt es sich bei dem erhöhten Ertragsmerkmal um eines der folgenden Merkmale: (i) erhöhte Jungpflanzenwüchsigkeit; (ii) erhöhte oberirdische Biomasse; (iii) erhöhter Gesamtsamenertrag pro Pflanze; (iv) erhöhte Samenfüllungsrate; (v) erhöhte Anzahl (gefüllter) Samen; (vi) erhöhter Harvest Index; oder (vii) erhöhtes Tausendkorngewicht (TKW).The implementation of the method according to the invention, d. H. increasing expression in a plant of: (i) a nucleic acid sequence encoding a growth-regulating factor (GRF) polypeptide; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide results in plants which, in comparison to plants having an increased expression of one of the following (i) a nucleic acid sequence encoding a GRF Or (ii) a nucleic acid sequence encoding a SYT polypeptide having increased yield-related traits. Preferably, the increased yield-related trait is one of the following: (i) increased seedling vigor; (ii) increased above-ground biomass; (iii) increased total seed yield per plant; (iv) increased seed filling rate; (v) increased number (filled) seeds; (vi) increased harvest index; or (vii) increased Thousand Grain Weight (TKW).

Da die erfindungsgemäßen transgenen Pflanzen erhöhte Ertragsmerkmale aufweisen, ist es wahrscheinlich, dass diese Pflanzen (zumindestens während eines Teils ihres Lebenszyklus) eine im Vergleich zu der Wachstumsrate von Kontrollpflanzen in einem entsprechenden Stadium ihres Lebenszyklus erhöhte Wachstumsrate aufweisen.Because the transgenic plants of the present invention have increased yield-related traits, it is likely that these plants (at least for part of their life cycle) have an increased growth rate compared to the growth rate of control plants at a corresponding stage of their life cycle.

„Kontrollpflanzen” können, wie im Abschnitt „Definitionen” angegeben, entsprechende Wildtypflanzen oder entsprechende Pflanzen ohne das interessierende Gen oder entsprechende Pflanzen mit einer erhöhten Expression von einem der folgenden (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, beinhalten. Eine „Kontrollpflanze” bezieht sich im vorliegenden Zusammenhang nicht nur auf ganze Pflanzen, sondern auch auf Pflanzenteile, darunter Samen und Samenteile."Control plants" may include, as indicated in the "Definitions", corresponding wild-type plants or equivalent plants without the gene of interest or corresponding plants having increased expression of any of the following (i) a nucleic acid sequence encoding a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide. A "control plant" in the present context refers not only to whole plants, but also to plant parts, including seeds and seed parts.

Die erhöhte Wachstumsrate kann für einen oder mehrere Teile einer Pflanze (darunter Samen) spezifisch sein oder kann im Wesentlichen in der ganzen Pflanze stattfinden. Pflanzen mit einer erhöhten Wachstumsrate können einen kürzeren Lebenszyklus aufweisen. Unter dem Lebenszyklus einer Pflanze kann man diejenige Zeit verstehen, die die Pflanze braucht, um von einem trockenen reifen Samen bis zu dem Stadium heranzuwachsen, in dem die Pflanze trockene reife Samen ähnlich dem Ausgangsmaterial produziert hat. Dieser Lebenszyklus kann von Faktoren wie Jungpflanzenvitalität, Wachstumsrate, „Greenness Index”, Blütezeit und Geschwindigkeit der Samenabreifung beeinflusst werden. Die erhöhte Wachstumsrate kann in einem Stadium oder in mehreren Stadien im Lebenszyklus einer Pflanze oder im Wesentlichen während des gesamten Lebenszyklus der Pflanze stattfinden. Eine erhöhte Wachstumsrate während der Frühstadien im Lebenszyklus einer Pflanze kann erhöhte (frühe) Vitalität widerspiegeln. Die erhöhte Wachstumsrate kann den Erntezyklus einer Pflanze verändern, so dass die Pflanzen später gesät werden können und/oder früher geerntet werden können, als dies sonst möglich wäre (ein ähnlicher Effekt lässt sich mit einer früheren Blütezeit erzielen; verzögertes Blühen ist normalerweise kein erwünschtes Merkmal bei Kulturpflanzen). Ist die Wachstumsrate ausreichend erhöht, so kann dies ein weiteres Aussäen von Samen derselben Pflanzenart ermöglichen (zum Beispiel Aussäen und Ernten von Reispflanzen und anschließendes Aussäen und Ernten von weiteren Reispflanzen innerhalb einer traditionellen Wachstumsperiode). Auf ähnliche Weise kann, wenn die Wachstumsrate ausreichend erhöht ist, dies ein weiteres Aussäen von Samen von unterschiedlichen Pflanzenarten ermöglichen (zum Beispiel das Aussäen und Ernten von Maispflanzen und anschließendes z. B. Aussäen und gewünschtenfalls Ernten von Sojabohnen, Kartoffeln oder sonstigen geeigneten Pflanzen). Bei manchen Kulturpflanzen kann es auch möglich sein, dass man zusätzlich mehrmals von demselben Wurzelstock ernten kann. Eine Veränderung des Erntezyklus einer Pflanze kann zu einer Erhöhung der jährlichen Biomasseproduktion pro Acre führen (und zwar aufgrund einer Erhöhung der Häufigkeit (z. B. pro Jahr), mit der eine bestimmte Pflanze herangezogen und geerntet werden kann). Eine erhöhte Wachstumsrate kann auch den Anbau von transgenen Pflanzen in einem weiteren geographischen Bereich als ihre Wildtyp-Gegenstücke ermöglichen, da die räumlichen Begrenzungen für den Anbau einer Kultur häufig von ungünstigen Umweltbedingungen entweder während der Pflanzzeit (früh in der Saison) oder während der Erntezeit (spät in der Saison) bestimmt wird. Solche ungünstigen Bedingungen können vermieden werden, wenn der Erntezyklus verkürzt ist. Die Wachstumsrate kann durch Ableiten von verschiedenen Parametern von Wachstumskurven bestimmt werden, wobei die Parameter folgendes sein können: T-Mid (Zeitdauer, die die Pflanzen benötigen, um 50% ihrer Maximalgröße zu erreichen) und T-90 (Zeitdauer, die die Pflanzen benötigen, um 90% ihrer Maximalgröße zu erreichen) und viele mehr.The increased growth rate may be specific to one or more parts of a plant (including seeds) or may occur substantially throughout the plant. Plants with an increased growth rate may have a shorter life cycle. The life cycle of a plant can be understood as the time it takes for the plant to grow from a dry, ripe seed to the stage where the plant has produced dry mature seeds similar to the starting material. This life cycle can be influenced by factors such as early vigor, growth rate, greenness index, flowering time, and rate of seed maturation. The increased growth rate may be at one stage or at several stages in the life cycle of a plant or substantially throughout Life cycle of the plant take place. An increased rate of growth during early stages of the life cycle of a plant may reflect increased (early) vitality. The increased growth rate may alter the harvest cycle of a plant so that the plants can later be sown and / or harvested earlier than would otherwise be possible (a similar effect can be achieved with an earlier flowering time; delayed flowering is not normally a desirable feature in crops). If the growth rate is sufficiently increased, this may allow further sowing of seeds of the same plant species (for example sowing and harvesting of rice plants and subsequent sowing and harvesting of further rice plants within a traditional growing season). Similarly, if the growth rate is sufficiently elevated, this may allow further sowing of seeds from different plant species (for example, sowing and harvesting corn plants and then, for example, sowing and, if desired, harvesting soybeans, potatoes or other suitable plants). , In some crops, it may also be possible to reap several times from the same rootstock. A change in the harvest cycle of a crop may increase annual biomass production per acre (due to an increase in the frequency (eg per year) that a particular crop can be grown and harvested). An increased rate of growth may also allow the cultivation of transgenic plants in a wider geographic area than their wild-type counterparts, since the spatial limits for the cultivation of a crop are often characterized by unfavorable environmental conditions either during the planting season (early in the season) or during the harvest season ( late in the season). Such unfavorable conditions can be avoided if the harvest cycle is shortened. The growth rate can be determined by deriving various parameters from growth curves, which parameters can be: T-mid (the time it takes the plants to reach 50% of their maximum size) and T-90 (the time the plants require to reach 90% of its maximum size) and many more.

Gemäß einem bevorzugten Merkmal der vorliegenden Erfindung führt die Durchführung der erfindungsgemäßen Verfahren zu Pflanzen mit einer im Vergleich zu Kontrollpflanzen erhöhten Wachstumsrate. Die vorliegende Erfindung stellt daher ein Verfahren zur Erhöhung der Wachstumsrate von Pflanzen bereit, wobei man bei dem Verfahren die Expression von Folgendem in einer Pflanze erhöht: (i) einer Nukleinsäuresequenz, die für ein „Growth-Regulating Factor”(GRF)-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein „Synovial Sarcoma Translocation”(SYT)-Polypeptid kodiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der folgenden: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, eine erhöhte Wachstumsrate aufweisen.In accordance with a preferred feature of the present invention, the practice of the methods of the present invention results in plants having an increased rate of growth compared to control plants. The present invention therefore provides a method for increasing the growth rate of plants, the method comprising increasing expression of the following in a plant: (i) a nucleic acid sequence encoding a growth-regulating factor (GRF) polypeptide ; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, which plants have increased expression of one of the following: (i) a nucleic acid sequence encoding a GRF polypeptide encoding; or (ii) a nucleic acid sequence encoding a SYT polypeptide has an increased growth rate.

Erhöhte Ertragsmerkmale treten auf, egal, ob die Pflanze unter Nichtstressbedingungen steht oder ob die Pflanze im Vergleich zu unter vergleichbaren Bedingungen wachsenden Kontrollpflanzen verschiedenen Stressfaktoren unterworfen wird. Typischerweise reagieren Pflanzen auf Stress dadurch, dass sie langsamer wachsen. Unter starken Stressbedingungen kann die Pflanze sogar ihr Wachstum einstellen. Leichter Stress wiederum wird im vorliegenden Zusammenhang als jeglicher Stress definiert, dem eine Pflanze ausgesetzt ist und der nicht dazu führt, dass die Pflanze ihr Wachstum völlig einstellt, ohne ihr Wachstum wieder aufnehmen zu können. Leichter Stress im Sinne der Erfindung führt zu einer Verringerung des Wachstums der gestressten Pflanzen von weniger als 40%, 35% oder 30%, vorzugsweise weniger als 25%, 20% oder 15%, stärker bevorzugt weniger als 14%, 13%, 12%, 11% oder 10% oder weniger im Vergleich zu der Kontrollpflanze unter Nichtstressbedingungen. Aufgrund der Fortschritte bei den landwirtschaftlichen Kulturmaßnahmen (Bewässerung, Düngung, Pestizidbehandlungen) findet man bei angebauten Kulturpflanzen nicht oft starken Stress. Daher ist das durch leichten Stress induzierte geschwächte Wachstum häufig ein unerwünschtes Merkmal in der Landwirtschaft. Milder Stress ist der alltägliche biotische und/oder abiotische Stress (Umweltstress), dem eine Pflanze ausgesetzt ist. Abiotischer Stress kann durch Trockenheit oder Wasserüberschuss, anaeroben Stress, Salzstress, chemische Toxizität, oxidativen Stress und Hitze, Kälte oder Minustemperaturen verursacht werden. Bei dem abiotischen Stress kann es sich um einen osmotischen Stress handeln, der durch Wasserstress (insbesondere aufgrund von Trockenheit), Salzstress, oxidativen Stress oder ionenbedingten Stress verursacht wird. Biotische Stressfaktoren sind typischerweise Stressfaktoren, die von Pathogenen wie Bakterien, Viren, Pilzen, Nematoden und Insekten verursacht werden. Der Begriff „Nichtstress”-Bedingungen bedeutet im vorliegenden Zusammenhang diejenigen Umweltbedingungen, die ein optimales Wachstum der Pflanzen gestatten. Die Fachwelt ist mit den normalen Bodenbedingungen und Klimabedingungen für einen bestimmten Standort vertraut.Increased yield-related traits occur whether the plant is under non-stress conditions or whether the plant is subjected to various stress factors compared to control plants growing under comparable conditions. Typically, plants respond to stress by growing more slowly. Under heavy stress conditions, the plant can even stop growing. Light stress, on the other hand, is defined herein as any stress a plant is exposed to and that does not cause the plant to completely stop growing without resuming growth. Light stress within the meaning of the invention results in a reduction in the growth of the stressed plants of less than 40%, 35% or 30%, preferably less than 25%, 20% or 15%, more preferably less than 14%, 13%, 12 %, 11% or 10% or less compared to the control plant under non-stress conditions. Due to advances in agricultural cultural measures (irrigation, fertilization, pesticide treatments) crops do not often experience high levels of stress. Therefore, the mild stress-induced debilitated growth is often an undesirable feature in agriculture. Mild stress is the everyday biotic and / or abiotic stress (environmental stress) to which a plant is exposed. Abiotic stress can be caused by dryness or excess water, anaerobic stress, salt stress, chemical toxicity, oxidative stress and heat, cold or minus temperatures. Abiotic stress can be an osmotic stress caused by water stress (especially dryness), salt stress, oxidative stress, or ion-related stress. Biotic stressors are typically stressors caused by pathogens such as bacteria, viruses, fungi, nematodes and insects. The term "non-stress" conditions as used herein means those environmental conditions that allow optimal growth of the plants. The art community is familiar with the normal soil conditions and climatic conditions for a particular location.

Die Durchführung der erfindungsgemäßen Verfahren führt zu Pflanzen, die bei Wachstum unter Nichtstressbedingungen oder unter milden Stressbedingungen einen im Vergleich zu Kontrollpflanzen, die unter vergleichbaren Bedingungen wachsen, erhöhte Ertragsmerkmale aufweisen. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen von Pflanzen, die unter Nichtstressbedingungen oder unter milden Stressbedingungen heranwachsen, bereitgestellt, wobei man bei dem Verfahren in einer Pflanze die Expression von Folgendem erhöht: (i) einer Nukleinsäuresequenz, die für ein „Growth-Regulating Factor”(GRF)-Polypeptid kodiert; und von (ii) einer Nukleinsäuresequenz, die für ein „Synovial Sarcoma Translocation”(SYT)-Polypeptid kodiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der folgenden: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, und die unter vergleichbaren Bedingungen herangezogen werden, erhöhte Ertragsmerkmale aufweisen.Performance of the methods of the present invention results in plants which, when grown under non-stress conditions or under mild stress conditions, have increased yield-related traits relative to control plants growing under comparable conditions. According to the present The invention therefore provides a method for increasing yield-related traits of plants grown under non-stress conditions or under mild stress conditions, wherein said method in a plant increases expression of: (i) a nucleic acid sequence suitable for growth-regulating Factor "(GRF) polypeptide encoded; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, which plants exhibit increased expression of any of the following: (i) a nucleic acid sequence encoding a GRF gene; Polypeptide encoded; or (ii) a nucleic acid sequence encoding a SYT polypeptide raised under comparable conditions having enhanced yield-related traits.

Die Durchführung der erfindungsgemäßen Verfahren führt zu Pflanzen, die bei Wachstum unter abiotischen Stressbedingungen einen im Vergleich zu Kontrollpflanzen, die unter vergleichbaren Stressbedingungen wachsen, erhöhte Ertragsmerkmale aufweisen. Wie von Wang et al, (Planta (2003), 218: 1–14) beschrieben führt abiotischer Stress zu einer Reihe von morphologischen, physiologischen, biochemischen und molekularen Veränderungen, die das Pflanzenwachstum und die Produktivität negativ beeinflussen. Es ist bekannt, dass Trockenheit, Salinität, extreme Temperaturen und oxidativer Stress miteinander in Verbindung stehen und über ähnliche Mechanismen Wachstums- und Zellschäden induzieren können. Rabbani et al, (Plant Physiol. (2003), 133: 1755–1767) beschreibt ein besonders hohes Ausmaß an gegenseitiger Beeinflussung von Trockenheitsstress und durch hohe Salinität verursachtem Stress. So äußern sich Trockenheit und/oder Versalzung in erster Linie als osmotischer Stress, was zur Störung der Homöostase und der Ionenverteilung in der Zelle führt. Oxidativer Stress, der häufig hohe oder niedrige Temperaturen, Salinität oder Trockenheitsstress begleitet, kann zur Denaturierung von funktionellen und strukturellen Proteinen führen. Das Ergebnis ist, dass diese verschiedenen Umweltstressfaktoren häufig ähnliche Signalleitungswege der Zelle und Zellreaktionen aktivieren, wie die Produktion von Stressproteinen, die Hinaufregulation von Antioxidantien, die Akkumulation von kompatiblen gelösten Stoffen und ein Einstellen des Wachstums. Da unterschiedliche Umweltstressfaktoren ähnliche Stoffwechselwege aktivieren, ist die beispielhafte Darstellung der vorliegenden Erfindung bezüglich Trockenheitsstress nicht als Beschränkung auf Trockenheitsstress anzusehen, sondern mehr als ein Screening, das die Beteiligung der GRF-Polypeptide wie oben definiert an der Erhöhung von Ertragsmerkmalen im Vergleich zu Kontrollpflanzen, die unter vergleichbaren Stressbedingungen wachsen, an abiotischem Stress im Allgemeinen anzeigt.Performance of the methods of the present invention results in plants which, when grown under abiotic stress conditions, have increased yield-related traits relative to control plants growing under comparable stress conditions. Like Wang et al, (Planta (2003), 218: 1-14) Abiotic stress leads to a series of morphological, physiological, biochemical and molecular changes that adversely affect plant growth and productivity. It is known that dryness, salinity, extreme temperatures and oxidative stress are related and can induce growth and cell damage through similar mechanisms. Rabbani et al, (Plant Physiol. (2003), 133: 1755-1767) describes a particularly high degree of mutual influence of drought stress and stress caused by high salinity. Thus, dryness and / or salinization primarily expresses as osmotic stress, resulting in disruption of homeostasis and ion distribution in the cell. Oxidative stress, which often accompanies high or low temperatures, salinity, or drought stress, can lead to the denaturation of functional and structural proteins. The result is that these various environmental stressors often activate similar cell signaling pathways and cell responses, such as the production of stress proteins, the upregulation of antioxidants, the accumulation of compatible solutes and cessation of growth. Since different environmental stressors activate similar metabolic pathways, the exemplary presentation of the present invention for dryness stress should not be construed as limiting to drought stress, but more than a screening involving the involvement of GRF polypeptides as defined above in increasing yield-related traits relative to control plants growing under comparable stress conditions, indicating abiotic stress in general.

Der Begriff „abiotischer Stress” wie im vorliegenden Text definiert soll einen oder mehrere Stressfaktoren der folgenden bedeuten: Wasserstress (durch Trockenheit oder zu viel Wasser bedingt), anaerober Stress, Salzstress, Temperaturstress (durch Hitze, Kälte oder Temperaturen unter Null bedingt), durch toxische Chemikalien bedingter Stress sowie oxidativer Stress. Gemäß einem Aspekt der Erfindung handelt es sich bei dem abiotischen Stress um einen osmotischen Stress ausgewählt aus der Reihe Wasserstress, Salzstress, oxidativer Stress und ionenbedingter Stress. Bevorzugt ist der Wasserstress Trockenheitsstress. Der Begriff Salzstress ist nicht auf Kochsalz (NaCl) beschränkt, sondern kann durch einen oder mehrere der folgenden Substanzen verursacht werden: NaCl, KCl, LiCl, MgCl₂, CaCl₂ sowie andere.The term "abiotic stress" as defined herein is intended to mean one or more stress factors of the following: water stress (due to dryness or too much water), anaerobic stress, salt stress, temperature stress (due to heat, cold or subzero temperatures) toxic chemical stress and oxidative stress. According to one aspect of the invention, the abiotic stress is an osmotic stress selected from the series of water stress, salt stress, oxidative stress and ion-induced stress. Preferably, the water stress is dryness stress. The term salt stress is not limited to common salt (NaCl) but may be caused by one or more of the following substances: NaCl, KCl, LiCl, MgCl ₂ , CaCl ₂ and others.

Die Durchführung der erfindungsgemäßen Verfahren führt zu Pflanzen mit erhöhten Ertragsmerkmalen unter abiotischen Stressbedingungen im Vergleich zu Kontrollpflanzen, die unter vergleichbaren Stressbedingungen herangezogen werden. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen, die unter abiotischen Stressbedingungen herangezogen werden, bereitgestellt, wobei das Verfahren umfasst, dass man die Expression von Folgendem in einer Pflanze erhöht: (i) einer Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein „synovial sarcoma translocation”(SYT)-Polypeptid kodiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgendem: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, die unter vergleichbaren Stressbedingungen herangezogen werden, erhöhte Ertragsmerkmale aufweisen.Performance of the methods of the invention results in plants having enhanced yield-related traits under abiotic stress conditions compared to control plants grown under comparable stress conditions. Thus, in accordance with the present invention, there is provided a method of enhancing yield-related traits in plants grown under abiotic stress conditions, the method comprising increasing expression of the following in a plant: (i) a nucleic acid sequence encoding growth Regulating Factor (GRF) polypeptide encodes; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, which plants have increased expression of one of the following: (i) a nucleic acid sequence encoding a GRF polypeptide encoding; or (ii) a nucleic acid sequence encoding a SYT polypeptide raised under comparable stress conditions having enhanced yield-related traits.

Ein weiteres Beispiel für abiotischen Umweltstress ist die reduzierte Verfügbarkeit von einem oder mehreren Nährstoffen, die von den Pflanzen für ihr Wachstum und ihre Entwicklung assimiliert werden müssen. Aufgrund des starken Einflusses der Nährstoffverwertungseffizienz auf den Pflanzenertrag und die Produktqualität wird eine enorme Menge Dünger auf die Felder ausgebracht, um Pflanzenwachstum und -qualität zu optimieren. Die Produktivität von Pflanzen wird üblicherweise von drei Hauptnährstoffen, nämlich Phosphor, Kalium und Stickstoff, begrenzt, wobei von diesen drei Hauptnährstoffen üblicherweise Stickstoff das limitierende Element der Pflanzenwachstumsrate darstellt. Das wichtigste Nährelement, das für das Pflanzenwachstum erforderlich ist, ist daher der Stickstoff (N). Er ist Bestandteil von zahlreichen wichtigen Verbindungen, die in lebenden Zellen auftreten, darunter Aminosäuren, Proteinen (Enzymen), Nukleinsäuren sowie Chlorophyll. 1,5% bis 2% der pflanzlichen Trockenmasse und ungefähr 16% des gesamten pflanzlichen Proteins ist Stickstoff. Die Stickstoffverfügbarkeit ist daher ein wesentlicher limitierender Faktor für das Wachstum und die Produktion von Kulturpflanzen ( Frink et al. (1999) Proc. Natl. Acad. Sci. USA 96(4): 1175–1180 ) und hat auch eine wichtige Auswirkung auf die Proteinakkumulation und die Aminosäurezusammensetzung. Unter Stickstofflimitierungsbedingungen herangezogene Kulturpflanzen mit erhöhten Ertragsmerkmalen sind daher von großem Interesse.Another example of abiotic environmental stress is the reduced availability of one or more nutrients that must be assimilated by the plants for their growth and development. Due to the strong impact of nutrient utilization efficiency on crop yield and product quality, an enormous amount of fertilizer is applied to the fields to optimize crop growth and quality. The productivity of plants is usually limited by three major nutrients, namely phosphorus, potassium and nitrogen, of which these three major nutrients are usually the limiting element of plant growth rate. The most important nutrient element required for plant growth is therefore nitrogen (N). It is part of many important compounds found in living cells, including amino acids, proteins (enzymes), nucleic acids and chlorophyll. 1.5% to 2% of the plant dry matter and about 16% of the total vegetable protein Nitrogen. Nitrogen availability is therefore a major limiting factor for the growth and production of crops ( Frink et al. (1999) Proc. Natl. Acad. Sci. USA 96 (4): 1175-1180 ) and also has an important effect on protein accumulation and amino acid composition. Cultivated plants with increased yield-related traits used under nitrogen limitation conditions are therefore of great interest.

Die Durchführung der erfindungsgemäßen Verfahren führt zu Pflanzen, die, wenn sie unter reduzierten Nährstoffverfügbarkeitsbedingungen, insbesondere unter reduzierten Stickstoffverfügbarkeitsbedingungen, herangezogen werden, im Vergleich zu Kontrollpflanzen, die unter vergleichbaren Stressbedingungen herangezogen werden, erhöhte Ertragsmerkmale aufweisen. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen, die unter reduzierten Nährstoffverfügbarkeitsbedingungen, vorzugsweise unter reduzierten Stickstoffverfügbarkeitsbedingungen, herangezogen werden, bereitgestellt, wobei das Verfahren umfasst, dass man die Expression von Folgendem in einer Pflanze erhöht: (i) einer Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein „synovial sarcoma translocation”(SYT)-Polypeptid kodiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgendem: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, die unter vergleichbaren Stressbedingungen herangezogen werden, erhöhte Ertragsmerkmale aufweisen. Die reduzierte Nährstoffverfügbarkeit kann durch einen Mangel oder einen Überschuss an Nährstoffen wie unter anderem Stickstoff, Phosphaten und anderen phosphorhaltigen Verbindungen, Kalium, Calcium, Kadmium, Magnesium, Mangan, Eisen und Bor bedingt sein. Vorzugsweise bedeutet reduzierte Nährstoffverfügbarkeit reduzierte Stickstoffverfügbarkeit.Performance of the methods of the present invention results in plants which, when grown under reduced nutrient availability conditions, particularly under reduced nitrogen availability conditions, have enhanced yield-related traits relative to control plants grown under comparable stress conditions. Thus, in accordance with the present invention, there is provided a method of increasing yield-related traits in plants grown under reduced nutrient availability conditions, preferably under reduced nitrogen availability conditions, the method comprising increasing the expression of the following in a plant: (i) a Nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, which plants have increased expression of one of the following: (i) a nucleic acid sequence encoding a GRF polypeptide or (ii) a nucleic acid sequence encoding a SYT polypeptide raised under comparable stress conditions having increased yield-related traits. The reduced nutrient availability may be due to a deficiency or excess of nutrients such as nitrogen, phosphates and other phosphorus compounds, potassium, calcium, cadmium, magnesium, manganese, iron and boron, among others. Preferably, reduced nutrient availability means reduced nitrogen availability.

Die vorliegenden Erfindung umfasst Pflanzen oder Teile davon (einschließlich Samen) oder Zellen davon, die nach den erfindungsgemäßen Verfahren erhältlich sind. Die Pflanzen oder Teile davon oder Zellen davon umfassen (i) ein isoliertes Nukleinsäuretransgen, das für ein „Growth-Regulating Factor”(GRF)-Polypeptid kodiert; sowie (ii) ein isoliertes Nukleinsäuretransgen, das für ein „Synovial Sarcoma Translocation”(SYT)-Polypeptid kodiert.The present invention includes plants or parts thereof (including seeds) or cells thereof obtainable by the methods of the invention. The plants or parts thereof or cells thereof comprise (i) an isolated nucleic acid transgene encoding a Growth Regulating Factor (GRF) polypeptide; and (ii) an isolated nucleic acid transgene encoding a "synovial sarcoma translocation" (SYT) polypeptide.

Wie oben erwähnt besteht ein bevorzugtes Verfahren zur Erhöhung der Expression von: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, darin, dass man in eine(r) Pflanze Folgendes einführt und exprimiert: (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen bereitgestellt, wobei das Verfahren umfasst, dass man in eine(r) Pflanze (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid; und (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, einführt und exprimiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgenden: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen.As mentioned above, a preferred method for increasing the expression of: (i) a nucleic acid sequence encoding a GRF polypeptide; and (ii) a nucleic acid sequence encoding a SYT polypeptide by introducing and expressing into a plant: (i) a nucleic acid sequence encoding a GRF polypeptide; and (ii) a nucleic acid sequence encoding a SYT polypeptide. Thus, according to the present invention, there is provided a method of enhancing yield-related traits in plants, the method comprising: in a plant, (i) a nucleic acid sequence encoding a GRF polypeptide; and (ii) introducing and expressing a nucleic acid sequence encoding a SYT polypeptide, which plants have increased expression of any of the following in comparison to plants: (i) a nucleic acid sequence encoding a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide has enhanced yield-related traits.

Verfahren zum Einführen und Exprimieren von zwei oder mehr Transgenen (auch als „Gene Stacking” bezeichnet) in transgene(n) Pflanzen sind in der Fachwelt gut bekannt (siehe zum Beispiel Übersichtsartikel von Halpin (2005) Plant Biotech. J. (3): 141–155 ). Das „Gene Stacking” kann mit Hilfe von iterativen Schritten erfolgen, wobei zwei oder mehr Transgene der Reihe nach in eine Pflanze dadurch eingeführt werden, dass man eine Pflanze, die ein Transgen enthält, mit Einzelpflanzen, die andere Transgene bergen, kreuzt, oder alternativ dadurch, dass man eine Pflanze, die ein Transgen enthält, mit neuen Gene retransformiert (bzw. supertransformiert).Methods for introducing and expressing two or more transgenes (also referred to as "gene stacking") into transgenic plants are well known in the art (see, for example, reviews of Halpin (2005) Plant Biotech. J. (3): 141-155 ). Gene stacking may be accomplished by iterative steps wherein two or more transgenes are sequentially introduced into a plant by crossing a plant containing a transgene with individual plants rescuing other transgenes, or alternatively by retransforming (or supertransforming) a plant containing a transgene with new genes.

Gemäß der vorliegenden Erfindung wird ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen bereitgestellt, wobei das Verfahren umfasst, dass man in eine(r) Pflanze (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, der Reihe nach einführt und exprimiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgenden: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen.According to the present invention, there is provided a method of enhancing yield-related traits in plants, the method comprising: (i) encoding a nucleic acid sequence encoding a GRF polypeptide into a plant; and (ii) sequentially introducing and expressing a nucleic acid sequence encoding a SYT polypeptide, said plants comprising, in comparison to plants having increased expression, any of the following: (i) a nucleic acid sequence encoding a GRF polypeptide encoding; or (ii) a nucleic acid sequence encoding a SYT polypeptide has enhanced yield-related traits.

Vorzugsweise werden die Nukleinsäuresequenzen von (i) und (ii) durch Kreuzen der Reihe nach eingeführt und exprimiert. Es wird zwischen einer weiblichen Elternpflanze, die eine eingeführte und exprimierte isolierte Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, umfasst, und einer männlichen Elternpflanze, die eine eingeführte und exprimierte isolierte Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, umfasst, oder umgekehrt, eine Kreuzung vorgenommen und durch Selektieren innerhalb der Nachkommenschaft auf das Vorhandensein und die Expression von beiden Transgenen. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen bereitgestellt, und zwar dadurch, dass man zwischen einer weiblichen Elternpflanze, die eine eingeführte und exprimierte isolierte Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, umfasst, und einer männlichen Elternpflanze, die eine eingeführte und exprimierte isolierte Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, umfasst, oder umgekehrt, eine Kreuzung vornimmt und durch Selektieren innerhalb der Nachkommenschaft auf das Vorhandensein und die Expression von beiden Transgenen, wobei die Pflanzen im Vergleich zu den Elternpflanzen oder im Vergleich zu beliebigen sonstigen Kontrollpflanzen wie im vorliegenden Text definiert erhöhte Ertragsmerkmale aufweisen.Preferably, the nucleic acid sequences of (i) and (ii) are introduced and expressed by crossing in sequence. It is comprised of a female parental plant comprising an introduced and expressed isolated nucleic acid sequence encoding a GRF polypeptide, and a parent parental plant comprising an introduced and expressed isolated nucleic acid sequence encoding a SYT polypeptide, or vice versa , made a cross and by selecting within the progeny on the presence and expression of both transgenes. In accordance with the present invention there is therefore provided a method of enhancing yield-related traits in plants by comprising between a female parent comprising an introduced and expressed isolated nucleic acid sequence encoding a GRF polypeptide and a male parent plant, the one introduced and expressed isolated nucleic acid sequence encoding a SYT polypeptide comprises, or vice versa, a cross and by selecting within the progeny for the presence and expression of both transgenes, the plants compared to the parent plants or in the Compared to any other control plants as defined herein have increased yield characteristics.

Alternativ dazu werden die Nukleinsäuresequenzen von (i) und (ii) der Reihe nach durch Retransformation eingeführt und exprimiert. Die Retransformation erfolgt dadurch, dass man eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, in eine(r) Pflanze, in einen/einem Pflanzenteil oder eine(r) Pflanzenzelle umfassend eine eingeführte und exprimierte Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, einführt und exprimiert, oder umgekehrt, und durch Selektieren innerhalb der Nachkommenschaft auf das Vorhandensein und die Expression von beiden Transgenen. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen durch Retransformation bereitgestellt, und zwar dadurch, dass man eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, in eine(r) Pflanze, in einen/einem Pflanzenteil oder eine(r) Pflanzenzelle umfassend eine eingeführte und exprimierte Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, einführt und exprimiert, oder umgekehrt, und durch Selektieren innerhalb der Nachkommenschaft auf das Vorhandensein und die Expression von beiden Transgenen, wobei die Pflanzen im Vergleich zu den Pflanzen mit einer erhöhten Expression von einem der Folgendem: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, bzw. im Vergleich zu beliebigen sonstigen Kontrollpflanzen wie im vorliegenden Text definiert erhöhte Ertragsmerkmale aufweisen.Alternatively, the nucleic acid sequences of (i) and (ii) are sequentially introduced and expressed by retransformation. Retransformation is accomplished by introducing a nucleic acid sequence encoding a GRF polypeptide into a plant, plant part or plant cell comprising an introduced and expressed nucleic acid sequence encoding a SYT polypeptide , introduces and expresses, or vice versa, and by selecting within progeny for the presence and expression of both transgenes. In accordance with the present invention, therefore, there is provided a method for enhancing yield-related traits in plants by retransformation of a nucleic acid sequence encoding a GRF polypeptide into a plant, a plant part or a plant part. r) a plant cell comprising an introduced and expressed nucleic acid sequence encoding, introducing and expressing a SYT polypeptide, or vice versa, and by selecting within the progeny for the presence and expression of both transgenes, said plants being compared to the plants increased expression of any one of: (i) a nucleic acid sequence encoding a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide or having increased yield-related traits relative to any other control plants as defined herein.

Alternativ dazu kann das „Gene Stacking” über gleichzeitige Transformation oder Kotransformation erfolgen, was rascher ist und bei verschiedensten Transformationstechniken eingesetzt werden kann, wie dies im Abschnitt „Definitionen” im vorliegenden Text beschrieben wird.Alternatively, gene stacking may be via simultaneous transformation or co-transformation, which is faster and can be applied to a variety of transformation techniques, as described in the Definitions section herein.

Verwendet man zum Beispiel die Agrobacterium-Transformation, so können die Transgene (mindestens zwei) in verschiedenen Konformationen, die in der Fachwelt gut bekannt sind, vorliegen, von denen nun einige im Folgenden angeführt werden:

• (i) die Nukleinsäurekodiersequenzen sind so fusioniert, dass sie, wenn sie translatiert werden, ein einziges Polypeptid bilden, und werden unter die Kontrolle eines einzigen Promoters gestellt;
• (ii) die Nukleinsäurekodiersequenzen befinden sich der Reihe nach stromabwärts von einem einzigen Promoter, sind durch Nukleinsäuresignale, die die mRNA-Synthese (interne Ribosomeneintrittsstellen IRES, 2A-„stuttering”-Signale usw.) oder die Polypeptidsynthese (Polyproteine, die durch Proteasesubstratstellen getrennt sind, usw.) beeinflussen, getrennt;
• (iii) die Nukleinsäurekodiersequenzen werden unabhängig von separaten Promotern vorangetrieben, und die Promoter/Nukleinsäurekodiersequenz-Kombinationen befinden sich innerhalb einer T-DNA;
• (iv) die Nukleinsäurekodiersequenzen werden unabhängig von separaten Promotern vorangetrieben, und die Promoter/Nukleinsäurekodiersequenz-Kombinationen befinden sich in unterschiedlichen T-DNAs auf einem Plasmid;
• (v) die Nukleinsäurekodiersequenzen werden unabhängig von separaten Promotern vorangetrieben, und die Promoter/Kodiersequenz-Kombinationen befinden sich in unterschiedlichen T-DNAs auf unterschiedlichen Plasmiden, die in einem bzw. in separaten Agrobacterium-Stämmen vorliegen.

• (i) the nucleic acid coding sequences are fused so that when translated, they form a single polypeptide and placed under the control of a single promoter;
• (ii) the nucleic acid coding sequences are sequentially downstream of a single promoter, are by nucleic acid signals that mRNA synthesis (internal ribosome entry sites IRES, 2A "stuttering" signals, etc.) or polypeptide synthesis (polyproteins separated by protease substrate sites are, etc.) influence, separated;
• (iii) the nucleic acid coding sequences are driven independently of separate promoters, and the promoter / nucleic acid coding sequence combinations are within a T-DNA;
• (iv) the nucleic acid coding sequences are driven independently of separate promoters and the promoter / nucleic acid coding sequence combinations are in different T-DNAs on a plasmid;
• (v) the nucleic acid coding sequences are driven independently of separate promoters, and the promoter / coding sequence combinations are in different T-DNAs on different plasmids present in separate Agrobacterium strains.

Bei der direkten genetischen Transformation unter Verwendung von physikalischen oder chemischen Abgabesystemen (z. B. Beschuss mit der Genkanone, PEG, Elektroporation, Liposomen, Glasnadeln usw.) können die Transgene (mindestens zwei) ebenfalls in einer Anzahl von Konformationen vorliegen, müssen jedoch im Wesentlichen nicht in einem Vektor umfasst sein, der fähig ist, in Agrobakterien oder in Viren, den Vermittlern der genetischen Transformation, repliziert zu werden. Die beiden Transgene können in einem oder in mehreren Nukleinsäuremolekülen, die jedoch gleichzeitig für das genetische Transformationsverfahren eingesetzt werden, umfasst sein.In direct genetic transformation using physical or chemical delivery systems (eg, bombardment with the gene gun, PEG, electroporation, liposomes, glass needles, etc.), the transgenes (at least two) may also be in a number of conformations, but must be in the Essentially not be included in a vector capable of being replicated in agrobacteria or in viruses, the agents of genetic transformation. The two transgenes may be included in one or more nucleic acid molecules, but used simultaneously for the genetic transformation process.

Gemäß der vorliegenden Erfindung wird ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen bereitgestellt, wobei das Verfahren umfasst, dass man in eine(r) Pflanze (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, gleichzeitig einführt und exprimiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgenden: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen.According to the present invention, there is provided a method of enhancing yield-related traits in plants, the method comprising: (i) encoding a nucleic acid sequence encoding a GRF polypeptide into a plant; and (ii) simultaneously introducing and expressing a nucleic acid sequence encoding a SYT polypeptide, which plants have increased expression relative to plants of any of the following: (i) a nucleic acid sequence encoding a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide has enhanced yield-related traits.

Die Nukleinsäuresequenzen von (i) und (ii), die gleichzeitig eingeführt und exprimiert werden, sind in einem oder in mehreren Nukleinsäuremolekülen umfasst. Gemäß der vorliegenden Erfindung wird daher ein Verfahren zur Erhöhung von Ertragsmerkmalen in Pflanzen bereitgestellt, wobei das Verfahren umfasst, dass man in eine(r) Pflanze (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, enthalten in ein oder mehreren Nukleinsäuremolekülen, gleichzeitig einführt und exprimiert, wobei diese Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgenden: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen.The nucleic acid sequences of (i) and (ii) introduced and expressed simultaneously are comprised in one or more nucleic acid molecules. In accordance with the present invention, therefore, there is provided a method of enhancing yield-related traits in plants, the method comprising: (i) encoding a nucleic acid sequence encoding a GRF polypeptide into a plant; and (ii) a nucleic acid sequence encoding a SYT polypeptide contained in one or more nucleic acid molecules, simultaneously introduced and expressed, which plants have increased expression of one of the following in comparison to plants: (i) a nucleic acid sequence, the encodes a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide has enhanced yield-related traits.

Die Erfindung stellt auch Genkonstrukte und Vektoren bereit, um die Einführung und/oder erhöhte Expression von Nukleinsäuresequenzn, die für GRF-Polypeptide kodieren, in Pflanzen zu erleichtern. Die Genkonstrukte können in Vektoren insertiert werden, die im Handel erhältlich sein können und die für die Transformation in Pflanzen und für die Expression des interessierenden Gens in den transformierten Zellen geeignet sind. Die Erfindung stellt auch die Verwendung eines wie im vorliegenden Text definierten Genkonstrukts in dem erfindungsgemäßen Verfahren bereit.The invention also provides gene constructs and vectors to facilitate the introduction and / or increased expression of nucleic acid sequences encoding GRF polypeptides in plants. The gene constructs can be inserted into vectors which may be commercially available and which are suitable for transformation into plants and expression of the gene of interest in the transformed cells. The invention also provides the use of a gene construct as defined herein in the method of the invention.

Genauer ausgedrückt stellt die vorliegende Erfindung ein Konstrukt umfassend

• (a) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert;
• (b) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert;
• (c) eine oder mehrere Kontrollsequenzen, die die Erhöhung der Expression der Nukleinsäuresequenz gemäß (a) und gemäß (b) voranzutreiben vermag/vermögen; sowie gegebenenfalls
• (d) eine Transkriptionsterminationssequenz

• (a) a nucleic acid sequence encoding a GRF polypeptide as defined above;
• (b) a nucleic acid sequence encoding a SYT polypeptide as defined above;
• (c) one or more control sequences capable of promoting expression of the nucleic acid sequence of (a) and (b); and optionally
• (d) a transcription termination sequence

Die Nukleinsäuresequenzen von (a) und (b) können in einem Nukleinsäuremolekül gemäß SEQ ID NO: 267 oder gemäß SEQ ID NO: 268 umfasst sein, wobei dieses Nukleinsäuremolekül für eine Polypeptidsequenz gemäß SEQ ID NO: 269 oder gemäß SEQ ID NO: 270 kodiert.The nucleic acid sequences of (a) and (b) can be comprised in a nucleic acid molecule according to SEQ ID NO: 267 or SEQ ID NO: 268, this nucleic acid molecule coding for a polypeptide sequence according to SEQ ID NO: 269 or according to SEQ ID NO: 270 ,

Die Begriffe „Kontrollsequenz” und „Terminationssequenz” sind wie im vorliegenden Text definiert. Vorzugsweise handelt es sich bei einer der Kontrollsequenzen eines Konstrukts um einen konstitutiven Promoter. Ein Beispiel für einen konstitutiven Promoter ist ein GOS2-Promoter, vorzugsweise ein Reis-GOS2-Promoter, stärker bevorzugt ein GOS2-Promoter gemäß SEQ ID NO: 117.The terms "control sequence" and "termination sequence" are as defined herein. Preferably, one of the control sequences of a construct is a constitutive promoter. An example of a constitutive promoter is a GOS2 promoter, preferably a rice GOS2 promoter, more preferably a GOS2 promoter according to SEQ ID NO: 117.

In einem Konstrukt wird eine einzige Kontrollsequenz verwendet, um die Expression von beiden Nukleinsäuresequenzen gemäß (a) und (b), die in einem Nukleinsäuremolekül gemäß SEQ ID NO: 267 oder gemäß SEQ ID NO: 268 umfasst sind, voranzutreiben, wobei dieses Nukleinsäuremolekül für eine Polypeptidsequenz gemäß SEQ ID NO: 269 oder gemäß SEQ ID NO: 270 kodiert.In a construct, a single control sequence is used to drive expression of both of the nucleic acid sequences of (a) and (b) contained in a nucleic acid molecule of SEQ ID NO: 267 or of SEQ ID NO: 268, wherein said nucleic acid molecule is a polypeptide sequence according to SEQ ID NO: 269 or encoded according to SEQ ID NO: 270.

Die vorliegende Erfindung stellt auch eine Mischung von Konstrukten bereit, die sich zum Beispiel für die gleichzeitige Einführung und Expression von (a) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert; und von (b) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert, in Pflanzen eignet, wobei mindestens ein Konstrukt Folgendes umfasst:

• (a) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert;
• (b) eine oder mehrere Kontrollsequenzen, die fähig sind, die Expression der Nukleinsäuresequenz von (a) voranzutreiben; sowie gegebenenfalls
• (c) eine Transkriptionsterminationssequenz, und wobei mindestens das andere Konstrukt Folgendes umfasst:
• (d) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert;
• (e) eine oder mehrere Kontrollsequenzen, die fähig sind, die Expression der Nukleinsäuresequenz von (d) voranzutreiben; sowie gegebenenfalls
• (f) eine Transkriptionsterminationssequenz.

• (a) a nucleic acid sequence encoding a GRF polypeptide as defined above;
• (b) one or more control sequences capable of promoting expression of the nucleic acid sequence of (a); and optionally
• (c) a transcription termination sequence, and wherein at least the other construct comprises:
• (d) a nucleic acid sequence encoding a SYT polypeptide as defined above;
• (e) one or more control sequences capable of promoting expression of the nucleic acid sequence of (d); and optionally
• (f) a transcription termination sequence.

Vorzugsweise handelt es sich bei einer der Kontrollsequenzen eines Konstrukts um einen konstitutiven Promoter. Ein Beispiel für einen konstitutiven Promoter ist ein GOS2-Promoter, vorzugsweise ein Reis-GOS2-Promoter, stärker bevorzugt ein GOS2-Promoter gemäß SEQ ID NO: 117.Preferably, one of the control sequences of a construct is a constitutive promoter. An example of a constitutive promoter is a GOS2 promoter, preferably a rice GOS2 promoter, more preferably a GOS2 promoter according to SEQ ID NO: 117.

Die Erfindung stellt auch die Verwendung eines Konstrukts bereit, das Folgendes umfasst: (a) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert; und (b) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert, oder eine Mischung von Konstrukten umfassend (a) und (b) wie oben definiert in einem Verfahren zur Herstellung von Pflanzen mit erhöhten Ertragsmerkmalen im Vergleich zu Pflanzen mit einer erhöhten Expression von einem der Folgendem: (a) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (b) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, wobei es sich bei den erhöhten Ertragsmerkmalen um eines oder mehrere der Folgenden handelt: (i) erhöhte Jungpflanzenwüchsigkeit; (ii) erhöhte oberirdische Biomasse; (iii) erhöhter Gesamtsamenertrag pro Pflanze; (iv) erhöhte Samenfüllungsrate; (v) erhöhte Anzahl (gefüllter) Samen; (vi) erhöhter Harvest Index; oder (vii) erhöhtes Tausendkorngewicht (TKW). The invention also provides the use of a construct comprising: (a) a nucleic acid sequence encoding a GRF polypeptide as defined above; and (b) a nucleic acid sequence encoding a SYT polypeptide as defined above, or a mixture of constructs comprising (a) and (b) as defined above in a method of producing plants having enhanced yield-related traits relative to plants having one increased expression of any of the following: (a) a nucleic acid sequence encoding a GRF polypeptide, or (b) a nucleic acid sequence encoding a SYT polypeptide, wherein the enhanced yield-related traits are one or more of the following : (i) increased seedling vigor; (ii) increased above-ground biomass; (iii) increased total seed yield per plant; (iv) increased seed filling rate; (v) increased number (filled) seeds; (vi) increased harvest index; or (vii) increased Thousand Grain Weight (TKW).

Die Erfindung stellt auch Pflanzen, Pflanzenteile oder Pflanzenzellen bereit, die mit einem Konstrukt, das Folgendes umfasst: (a) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert; und (b) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert, oder mit einer Mischung von Konstrukten umfassend (a) und (b) wie oben definiert transformiert sind.The invention also provides plants, parts of plants or plant cells comprising a construct comprising: (a) a nucleic acid sequence encoding a GRF polypeptide as defined above; and (b) a nucleic acid sequence encoding a SYT polypeptide as defined above, or a mixture of constructs comprising (a) and (b) as defined above.

Die Pflanzen werden mit einem oder mehreren Vektoren umfassend eine beliebige der oben beschriebenen Nukleinsäuresequenzen transformiert. Der Fachmann ist mit den genetischen Elementen, die in einem Vektor vorhanden sein müssen, um Wirtszellen, die die interessierende Sequenz enthalten, erfolgreich zu transformieren, zu selektieren und zu vermehren, vertraut. Die interessierende Sequenz ist operativ mit einer oder mehreren Kontrollsequenzen (mindestens mit einem Promoter) verbunden.The plants are transformed with one or more vectors comprising any of the above-described nucleic acid sequences. One skilled in the art will be familiar with the genetic elements that must be present in a vector to successfully transform, select, and propagate host cells containing the sequence of interest. The sequence of interest is operatively linked to one or more control sequences (at least one promoter).

Für das Vorantreiben der Expression der Nukleinsäuresequenz kann vorteilhaft jede Art von Promoter, egal, ob natürlich oder synthetisch, verwendet werden. Ein konstitutiver Promoter ist bei den Verfahren besonders nützlich.Advantageously, any type of promoter, whether natural or synthetic, can be used to drive expression of the nucleic acid sequence. A constitutive promoter is particularly useful in the methods.

Sonstige organspezifische Promoter, z. B. für die bevorzugte Expression in Blättern, Stängeln, Knollen, Meristemen, Samen (Embryo und/oder Endosperm), eignen sich für die Durchführung der erfindungsgemäßen Verfahren. Für Definitionen der verschiedenen Promotertypen siehe den Abschnitt „Definitionen” im vorliegenden Text.Other organ-specific promoters, e.g. B. for the preferred expression in leaves, stems, tubers, meristems, seeds (embryo and / or endosperm), are suitable for carrying out the method according to the invention. For definitions of the different types of promoters see the section "Definitions" in this text.

Es ist klar, dass die Anwendbarkeit der vorliegenden Erfindung nicht auf Folgendes beschränkt ist: (i) eine Nukleinsäuresequenz, die für das GRF-Polypeptid gemäß SEQ ID NO: 1 kodiert, wobei die Expression von einem konstitutiven Promoter vorangetrieben wird; oder (ii) eine Nukleinsäuresequenz, die für das SYT-Polypeptid gemäß SEQ ID NO: 120 kodiert, wobei die Expression von einem konstitutiven Promoter vorangetrieben wird.It will be understood that the utility of the present invention is not limited to: (i) a nucleic acid sequence encoding the GRF polypeptide of SEQ ID NO: 1, wherein expression is driven by a constitutive promoter; or (ii) a nucleic acid sequence encoding the SYT polypeptide of SEQ ID NO: 120, wherein expression is driven by a constitutive promoter.

Bei dem Konstrukt, das in eine Pflanze eingeführt wird, kann/können gewünschtenfalls eine oder mehrere Terminatorsequenzen verwendet werden. Zu zusätzlichen Regulationselementen können Transkriptionserhöher sowie Translationserhöher zählen. Die Fachwelt ist mit Terminator- und Enhancer-Sequenzen, wie sie für die Durchführung der Erfindung geeignet sein können, vertraut. Um die Menge der reifen Botschaft, die im Cytosol akkumuliert wird, kann eine Introsequenz auch zu der 5'-untranslatierten Region (UTR) oder der Kodiersequenz hinzugefügt werden, wie im Abschnitt „Definitionen” beschrieben. Andere Kontrollsequenzen (neben Promoter-, Erhöher-, Silencer-, Intron-Sequenzen, 3'UTR- und/oder 5'UTR-Regionen) können Protein- und/oder RNA-stabilisierende Elemente sein. Solche Sequenzen sind dem Fachmann bekannt bzw. können von diesem leicht erhalten werden.In the construct introduced into a plant, if desired, one or more terminator sequences may be used. Additional regulatory elements may include transcriptional enhancers as well as translational enhancers. The art is familiar with terminator and enhancer sequences as may be suitable for the practice of the invention. To the amount of mature message accumulated in the cytosol, an intro sequence may also be added to the 5 'untranslated region (UTR) or coding sequence, as described in the Definitions section. Other control sequences (besides promoter, enhancer, silencer, intron sequences, 3'UTR and / or 5'UTR regions) may be protein and / or RNA stabilizing elements. Such sequences are known or can be easily obtained by the person skilled in the art.

Die erfindungsgemäßen Genkonstrukte können weiterhin eine Replikationsursprungssequenz beinhalten, die für die Aufrechterhaltung und/oder die Replikation in einem bestimmten Zelltyp erforderlich ist. Ein Beispiel ist, wenn ein Genkonstrukt in einer Bakterienzelle als episomales genetisches Element aufrechterhalten werden muss (z. B. Plasmid- oder Cosmidmolekül). Zu bevorzugten Replikationsursprüngen zählen der f1-ori und colE1, sind jedoch hierauf nicht beschränkt.The gene constructs of the invention may further include an origin of replication necessary for maintenance and / or replication in a particular cell type. An example is when a gene construct in a bacterial cell needs to be maintained as an episomal genetic element (eg, plasmid or cosmid molecule). Preferred origins of replication include, but are not limited to, f1-ori and colE1.

Für den Nachweis des erfolgreichen Transfers der Nukleinsäuresequenzen, wie sie bei den erfindungsgemäßen Verfahren verwendet wurden, und/oder für die Selektion der transgenen Pflanze, die diese Nukleinsäuresequenzen umfassen, ist es vorteilhaft, Markergene (bzw. Reportergene) zu verwenden. Das Genkonstrukt kann daher gewünschtenfalls ein Selektionsmarkergen umfassen. Selektionsmarker sind genauer im Abschnitt „Definitionen” im vorliegenden Text beschrieben.For the detection of the successful transfer of the nucleic acid sequences as used in the methods according to the invention and / or for the selection of the transgenic plant comprising these nucleic acid sequences, it is advantageous to use marker genes (or reporter genes). The gene construct may therefore, if desired, comprise a selection marker gene. Selection markers are described in more detail in the Definitions section herein.

Es ist bekannt, dass bei der stabilen oder transienten Integration von Nukleinsäuresequenzen in Pflanzenzellen, je nach dem verwendeten Expressionsvektor und der verwendeten Transfektionstechnik, nur ein kleiner Teil der Zellen die Fremd-DNA aufnimmt und gegebenenfalls in ihre Genom integriert. Um diese Integranten zu identifizieren und zu selektieren, wird üblicherweise gemeinsam mit dem interessierenden Gen ein Gen, das für einen Selektionsmarker (wie die oben beschriebenen Selektionsmarker) kodiert, in die Wirtszelle eingeführt. Diese Marker können zum Beispiel bei Mutanten verwendet werden, in denen diese Gene zum Beispiel durch Deletion mittels traditionellen Verfahren nicht funktionell sind. Weiterhin können auf demselben Vektor, der die Sequenz umfasst, die für die erfindungsgemäßen Polypeptide kodiert oder der bei den erfindungsgemäßen Verfahren verwendet wird, oder auch auf einem separaten Vektor, Nukleinsäuresequenzmoleküle, die für einen Selektionsmarker kodieren, in eine Wirtszelle eingeführt werden. Zellen, die mit der eingeführten Nukleinsäuresequenz stabil transfiziert worden sind, können zum Beispiel durch Selektion identifiziert werden (zum Beispiel überleben Zellen, die den Selektionsmarker integriert haben, während die übrigen Zellen absterben). Die Markergene können, wenn sie nicht mehr gebraucht werden, aus der transgenen Zelle entfernt oder herausgeschnitten werden. Techniken für die Entfernung von Markergenen sind in der Fachwelt bekannt, und nützliche Techniken sind oben im Abschnitt „Definitionen” beschrieben. It is known that in the stable or transient integration of nucleic acid sequences in plant cells, depending on the expression vector used and the transfection technique used, only a small part of the cells absorbs the foreign DNA and optionally integrated into its genome. In order to identify and select these integrants, a gene coding for a selection marker (such as the selectable markers described above) is usually introduced into the host cell along with the gene of interest. These markers can be used, for example, in mutants in which these genes are not functional, for example by deletion by traditional methods. Furthermore, on the same vector comprising the sequence encoding the polypeptides of the invention or used in the methods of the invention or on a separate vector, nucleic acid sequence molecules encoding a selection marker can be introduced into a host cell. For example, cells stably transfected with the introduced nucleic acid sequence can be identified by selection (for example, cells that have integrated the selection marker survive while the remaining cells die). The marker genes, when no longer needed, can be removed or excised from the transgenic cell. Techniques for the removal of marker genes are known in the art, and useful techniques are described above in the "Definitions" section.

Die Erfindung stellt auch ein Verfahren für die Herstellung von transgenen Pflanzen mit erhöhten Ertragsmerkmalen bereit, welches das Einführen und Exprimieren von Folgendem in eine(r) Pflanze umfasst: (i) eine beliebige Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert; und (ii) eine beliebige Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert, wobei die Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von Folgendem: (i) einer beliebigen Nukleinsäuresequenz, die für ein GRF-Polypeptid wie oben definiert kodiert; oder (ii) einer beliebigen Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert erhöhte Ertragsmerkmale aufweisen.The invention also provides a method for the production of transgenic plants having enhanced yield-related traits comprising introducing and expressing the following into a plant: (i) any nucleic acid sequence encoding a GRF polypeptide as defined above; and (ii) any nucleic acid sequence that encodes a SYT polypeptide as defined above, wherein said plants encode increased expression of: (i) any nucleic acid sequence encoding a GRF polypeptide as defined above in comparison to plants ; or (ii) any nucleic acid sequence encoding a SYT polypeptide as defined above having enhanced yield-related traits.

Genauer gesagt stellt die vorliegende Erfindung ein Verfahren für die Herstellung von transgenen Pflanzen mit erhöhten Ertrapmerkmalen im Vergleich zu Pflanzen mit erhöhter Expression entweder (i) einer für ein GRF-Polypeptid kodierenden Nukleinsäuresequenz oder (ii) einer für ein SYT-Polypeptid kodierenden Nukleinsäuresequenz bereit, wobei man

• a. eine für ein GRF-Polypeptid mit der wie oben angegebenen Bedeutung kodierende Nukleinsäuresequenz unter der Steuerung eines konstitutiven Promoters in eine Pflanze, einen Pflanzenteil oder eine Pflanzenzelle einführt und darin exprimiert und
• b. eine für ein SYT-Polypeptid mit der wie oben angegebenen Bedeutung kodierende Nukleinsäuresequenz unter der Steuerung eines konstitutiven Promoters in eine Pflanze, einen Pflanzenteil oder eine Pflanzenzelle einführt und darin exprimiert und
• c. die Pflanzenzelle, den Pflanzenteil oder die Pflanze unter Pflanzenwachstum und -entwicklung fördernden Bedingungen kultiviert.

• a. a nucleic acid sequence encoding a GRF polypeptide having the meaning as defined above, under the control of a constitutive promoter, introduced into and expressed in a plant, a plant part or a plant cell; and
• b. introducing and expressing a nucleic acid sequence encoding a SYT polypeptide having the meaning as defined above under the control of a constitutive promoter in a plant, a plant part or a plant cell;
• c. the plant cell, plant part or plant is cultivated under plant growth and development promoting conditions.

Bei der Nukleinsäuresequenz von (i) kann es sich um eine beliebige Nukleinsäuresequenz, die fähig ist, für ein wie im vorliegenden Text definiertes GRF-Polypeptid zu kodieren, handeln und bei der Nukleinsäuresequenz von (ii) kann es sich um eine beliebige Nukleinsäuresequenz, die fähig ist, für ein wie im vorliegenden Text definiertes SYT-Polypeptid zu kodieren, handeln.The nucleic acid sequence of (i) may be any nucleic acid sequence capable of encoding a GRF polypeptide as defined herein, and the nucleic acid sequence of (ii) may be any nucleic acid sequence, which may be any of the following capable of coding for a SYT polypeptide as defined herein.

Die Nukleinsäuresequenz kann in eine Pflanzenzelle oder in die Pflanze selbst direkt eingeführt werden (was das Einführen in ein Gewebe, Organ oder einen beliebigen sonstigen Teil einer Pflanze beinhaltet). Gemäß einem bevorzugten Merkmal der vorliegenden Erfindung wird die Nukleinsäuresequenz in eine Pflanze vorzugsweise mittels Transformation eingeführt. Der Begriff „Transformation” wird im vorliegenden Text im Abschnitt „Definitionen” genauer beschrieben.The nucleic acid sequence can be introduced directly into a plant cell or into the plant itself (which involves introduction into a tissue, organ or any other part of a plant). According to a preferred feature of the present invention, the nucleic acid sequence is introduced into a plant preferably by transformation. The term "transformation" is described in more detail in the text "Definitions" in the present text.

Die genetisch modifizierten Pflanzenzellen können nach allen Verfahren, mit denen der Fachmann vertraut ist, regeneriert werden. Geeignete Verfahren finden sich in den oben genannten Arbeiten von S. D. Kung und R. Wu, Potrykus oder Höfgen und Willmitzer.The genetically modified plant cells can be regenerated by any of the methods familiar to those skilled in the art. Suitable methods can be found in the above-mentioned work by S. D. Kung and R. Wu, Potrykus or Höfgen and Willmitzer.

Im Allgemeinen werden nach der Transformation die Pflanzenzellen oder Zellgruppen auf das Vorhandensein von einem oder mehreren Markern, die von den mit dem interessierenden Gen gemeinsam transferierten, in Pflanzen exprimierbaren Genen kodiert werden, selektiert, wonach das transformierte Material zu einer ganzen Pflanze regeneriert wird. Für die Selektion von transformierten Pflanzen wird das bei der Transformation erhaltene Pflanzenmaterial im Allgemeinen Selektionsbedingungen unterworfen, so dass man transformierte Pflanzen von untransformierten Pflanzen unterscheiden kann. So können zum Beispiel Samen, die auf die oben beschriebene Art und Weise erhalten wurden, ausgepflanzt werden und nach einer anfänglichen Wachstumsphase durch Spritzen einer geeigneten Selektion unterworfen werden. Eine weitere Möglichkeit besteht darin, dass man die Samen, gegebenenfalls nach Sterilisieren, auf Agarplatten heranzieht, wobei man ein geeignetes Selektionsmittel verwendet, so dass nur die transformierten Samen zu Pflanzen heranwachsen können. Alternativ dazu werden die transformierten Pflanzen auf das Vorhandensein eines Selektionsmarkers wie die oben beschriebenen gescreent.Generally, after transformation, the plant cells or cell groups are selected for the presence of one or more markers encoded by the plant-expressible genes that are shared with the gene of interest, after which the transformed material is regenerated into an entire plant. For the selection of transformed plants, the plant material obtained in the transformation is generally subjected to selection conditions, so that transformed plants can be distinguished from untransformed plants. Thus, for example, seeds obtained in the manner described above can be planted and subjected to an appropriate selection after an initial growth phase by syringes. One more way consists of cultivating the seeds on agar plates, optionally after sterilization, using a suitable selection agent so that only the transformed seeds can grow into plants. Alternatively, the transformed plants are screened for the presence of a selection marker such as those described above.

Nach dem DNA-Transfer und der Regeneration können mutmaßlich transformierte Pflanzen auch zum Beispiel unter Verwendung der Southern-Analyse auf das Vorhandensein des interessierenden Gens, die Kopienzahl und/oder die Genomorganisation ausgewertet werden. Alternativ dazu oder zusätzlich können die Expressionsniveaus der neu eingeführten DNA mittels Northern- und/oder Western-Analyse verfolgt werden; beide Techniken sind dem Durchschnittsfachmann gut bekannt.After DNA transfer and regeneration, putatively transformed plants may also be evaluated for example using Southern analysis for the presence of the gene of interest, copy number and / or genome organization. Alternatively or additionally, the levels of expression of the newly introduced DNA can be monitored by Northern and / or Western analysis; both techniques are well known to those of ordinary skill in the art.

Die erzeugten transformierten Pflanzen können mit unterschiedlichen Mitteln vermehrt werden, wie durch klonale Vermehrung oder durch klassische Züchtungstechniken. So kann zum Beispiel eine transformierte Pflanze der ersten Generation (T1-Pflanze) geselbstet werden, und homozygote Transformanten der zweiten Generation (T2-Pflanze) können selektiert werden, und die T2-Pflanzen können dann mit Hilfe von klassischen Züchtungstechniken weiter vermehrt werden. Die erzeugten transformierten Organismen können in verschiedener Form vorliegen. So kann es sich um Chimären von transformierten Zellen und untransformierten Zellen handeln; um klonale Transformanten (z. B. alle Zellen wurden dahingehend transformiert, dass sie die Expressionskassette enthalten); um Pfropfmaterial von transformiertem und untransformiertem Gewebe (z. B. bei Pflanzen ein transformierter Wurzelstock, der auf einen untransformierten Edelreis gepfropft wurde).The transformed plants produced can be propagated by various means, such as by clonal propagation or by classical breeding techniques. For example, a first generation transformed plant (T1 plant) can be selfed, and second generation homozygous transformants (T2 plant) can be selected, and the T2 plants can then be further propagated using classical breeding techniques. The transformed organisms produced may be in various forms. These may be chimeras of transformed cells and untransformed cells; clonal transformants (e.g., all cells were transformed to contain the expression cassette); grafted material from transformed and untransformed tissue (eg, in plants, a transformed rhizome grafted onto an untransformed gin).

Die vorliegende Erfindung erstreckt sich eindeutig auf jegliche Pflanzenzelle oder Pflanze, die nach einem der im vorliegenden Text beschriebenen Verfahren erzeugt wurde, und auf alle Pflanzenteile und alles Vermehrungsmaterial davon. Die vorliegende Erfindung umfasst weiterhin die Nachkommenschaft einer/eines primär transformierten oder transfizierten Zelle, Gewebes, Organs oder ganzen Pflanze, die/das nach einem der oben genannten Verfahren erzeugt wurde, wobei die einzige Voraussetzung ist, dass die Nachkommenschaft dasselbe/dieselben genotypische(n) und/oder phänotypische(n) Merkmal(e) aufweist, wie es/sie von dem Elter bei den erfindungsgemäßen Verfahren gezeigt wird.The present invention clearly extends to any plant cell or plant produced by any of the methods described herein and to all plant parts and all propagating material thereof. The present invention further includes the progeny of a primary transformed or transfected cell, tissue, organ or whole plant produced by any of the above methods, the sole requirement being that the progeny have the same genotypic (n ) and / or phenotypic trait (s) as exhibited by the parent in the methods of the invention.

Die Erfindung beinhaltet auch Wirtszellen, die (i) eine isolierte Nukleinsäuresequenz, die für ein wie oben definiertes GRF-Polypeptid kodiert, in operativer Verknüpfung mit einem konstitutiven Promoter; und (ii) eine isolierte Nukleinsäuresequenz, die für ein SYT-Polypeptid wie oben definiert kodiert, in operativer Verknüpfung mit einem konstitutiven Promoter enthalten. Bevorzugte erfindungsgemäße Wirtszellen sind Pflanzenzellen. Wirtspflanzen für bei dem erfindungsgemäßen Verfahren verwendete Nukleinsäuresequenzen oder Vektor, für die Expressionskassette oder das Konstrukt oder den Vektor, sind im Prinzip vorteilhafterweise alle Pflanzen, die fähig sind, die bei dem erfindungsgemäßen Verfahren verwendeten Polypeptide zu synthetisieren.The invention also includes host cells comprising (i) an isolated nucleic acid sequence encoding a GRF polypeptide as defined above in operative association with a constitutive promoter; and (ii) an isolated nucleic acid sequence encoding a SYT polypeptide as defined above operably linked to a constitutive promoter. Preferred host cells according to the invention are plant cells. Host plants for the nucleic acid sequences or vector used in the method according to the invention, for the expression cassette or the construct or the vector, are in principle advantageously all plants which are able to synthesize the polypeptides used in the method according to the invention.

Die erfindungsgemäßen Verfahren lassen sich vorteilhaft auf jede beliebige Pflanze anwenden. Zu den Pflanzen, die bei den erfindungsgemäßen Verfahren besonders nützlich sind, zählen alle Pflanzen, die zu der Überfamilie Viridiplantae gehören, insbesondere monokotyle und dikotyle Pflanzen, darunter Futter- oder Weidepflanzenleguminosen, Zierpflanzen, Nahrungsmittelkulturen, Bäume oder Sträucher. Gemäß einer bevorzugten Ausführungsform der vorliegenden Erfindung handelt es sich bei der Pflanze um eine Kulturpflanze. Zu den Kulturpflanzen zählen zum Beispiel Sojabohne, Sonnenblume, Canola-Raps, Luzerne, Raps, Baumwolle, Tomate, Kartoffel und Tabak. Weiter bevorzugt handelt es sich bei der Pflanze um eine monokotyle Pflanze. Zu den monokotylen Pflanzen zählt zum Beispiel das Zuckerrohr. Weiter bevorzugt handelt es sich bei der Pflanze um ein Getreide. Zu den Getreiden zählen zum Beispiel Reis, Mais, Weizen, Gerste, Hirse, Roggen, Triticale, Mohrenhirse und Hafer.The methods of the invention can be advantageously applied to any plant. Among the plants which are particularly useful in the methods of the invention are any of the plants belonging to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants, including forage or flowering legumes, ornamental plants, food crops, trees or shrubs. According to a preferred embodiment of the present invention, the plant is a crop. The crops include, for example, soybean, sunflower, canola rape, alfalfa, rapeseed, cotton, tomato, potato and tobacco. More preferably, the plant is a monocotyledonous plant. The monocot plants include, for example, the sugarcane. More preferably, the plant is a cereal. The cereals include, for example, rice, corn, wheat, barley, millet, rye, triticale, sorghum and oats.

Die Erfindung erstreckt sich auch auf erntbare Teile einer Pflanze umfassend Folgendes: (i) eine isolierte Nukleinsäuresequenz, die für einen GRF (wie oben definiert) kodiert; und (ii) eine isolierte Nukleinsäuresequenz, die für ein SYT (wie oben definiert) kodiert, wie zum Beispiel, jedoch nicht einschränkend, Samen, Blätter, Früchte, Blüten, Stängel, Rhizome, Knollen und Zwiebeln. Die Erfindung betrifft weiterhin Produkte, die von einem erntbaren Teil von solch einer Pflanze abstammen, vorzugsweise direkt abstammen, wie trockene Pellets oder Pulver, Öl, Fett und Fettsäuren, Stärke oder Proteine.The invention also extends to harvestable parts of a plant comprising: (i) an isolated nucleic acid sequence encoding a GRF (as defined above); and (ii) an isolated nucleic acid sequence encoding a SYT (as defined above) such as, but not limited to, seeds, leaves, fruits, flowers, stems, rhizomes, tubers and onions. The invention further relates to products derived from a harvestable part of such a plant, preferably derived directly, such as dry pellets or powders, oil, fat and fatty acids, starch or proteins.

Verfahren zum Erhöhen der Expression von Nukleinsäuresequenzen oder Genen, oder Genprodukten, sind in der Fachwelt gut beschrieben, und Beispiele finden sich im Abschnitt „Definitionen”.Methods of increasing the expression of nucleic acid sequences or genes, or gene products, are well described in the art, and examples are provided in the "Definitions" section.

Wie oben erwähnt besteht ein bevorzugtes Verfahren für das Erhöhen der Expression (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert und (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, darin, dass man (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert und (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, in eine(r) Pflanze einführt und exprimiert; die Auswirkungen der Durchführung des Verfahrens, d. h. des Erhöhens der Ertragsmerkmale, können auch unter Verwendung von anderen gut bekannten Techniken erzielt werden, darunter, jedoch nicht einschränkend, T-DNA-Aktivierungs-Tagging, TILLING, homologe Rekombination. Eine Beschreibung dieser Techniken findet sich im Abschnit „Definitionen”. As mentioned above, a preferred method for increasing the expression of (i) a nucleic acid sequence encoding a GRF polypeptide and (ii) a nucleic acid sequence encoding a SYT polypeptide is by (i) preparing a nucleic acid sequence, which encodes a GRF polypeptide and (ii) introduces and expresses a nucleic acid sequence encoding a SYT polypeptide into a plant; the effects of performing the method, ie, enhancing the yield-related traits, can also be achieved using other well-known techniques, including, but not limited to, T-DNA activation tagging, TILLING, homologous recombination. A description of these techniques can be found in the section "Definitions".

Die vorliegende Erfindung umfasst auch die Verwendung von (i) Nukleinsäuresequenzen, die für wie im vorliegenden Text beschriebene GRF-Polypeptide kodieren und Nukleinsäuresequenzen, die für wie im vorliegenden Text beschriebene SYT-Polypeptide kodierten, und die Verwendung dieser GRF-Polypeptide und SYT-Polypeptide bei der Erhöhung von einem der oben genannten Ertragsmerkmale in Pflanzen, unter normalen Wachstumsbedingungen, unter abiotischen Stresswachstumsbedingungen (vorzugsweise osmotischen Stresswachstumsbedingungen) und unter Wachstumsbedingungen mit reduzierter Nährstoffverfügbarkeit, vorzugsweise unter reduzierten Stickstoffverfügbarkeitsbedingungen.The present invention also encompasses the use of (i) nucleic acid sequences encoding GRF polypeptides as described herein and nucleic acid sequences encoding the SYT polypeptides as described herein and the use of these GRF polypeptides and SYT polypeptides in increasing one of the above-mentioned yield-related traits in plants, under normal growth conditions, under abiotic stress-growth conditions (preferably osmotic stress-growth conditions) and under growth conditions with reduced nutrient availability, preferably under reduced nitrogen-availability conditions.

Nukleinsäuresequenzen, die für wie im vorliegenden Text beschriebene GRF-Polypeptide und SYT-Polypeptide kodieren, bzw. die GRF-Polypeptide selbst, können in Zuchtprogrammen eingesetzt werden, in denen ein DNA-Marker, der genetisch mit einem für ein GRF-Polypeptid kodierenden Gen verbunden sein kann, identifiziert wird. Die Gene/Nukleinsäuresequenzen bzw. die GRF-Polypeptide und SYT-Polypeptide selbst können dazu verwendet werden, um einen molekularen Marker zu definieren. Dieser DNA- oder Proteinmarker kann dann in Zuchtprogrammen eingesetzt werden, um Pflanzen zu selektieren, die wie oben in den erfindungsgemäßen Verfahren definierte, erhöhte Ertragsmerkmale aufweisen.Nucleic acid sequences encoding GRF polypeptides and SYT polypeptides as described herein, or the GRF polypeptides themselves, can be used in breeding programs in which a DNA marker genetically linked to a gene encoding a GRF polypeptide can be connected is identified. The genes / nucleic acid sequences or the GRF polypeptides and SYT polypeptides themselves can be used to define a molecular marker. This DNA or protein marker can then be used in breeding programs to select plants having increased yield-related traits as defined above in the methods of the invention.

Allelvarianten eines Gens/einer Nukleinsäuresequenz, die/das für ein GRF-Polypeptid und SYT-Polypeptid kodieren, können ebenfalls in Marker gestützten Zuchtprogrammen Verwendung finden. Für solche Zuchtprogramme ist es manchmal erforderlich, dass mittels mutagener Behandlung von Pflanzen, zum Beispiel mittels EMS-Mutagenese, eine Allelvariation eingeführt wird; alternativ dazu kann dem Programm eine Kollektion von Allelvarianten so genannten „natürlichen” Ursprungs, die unabsichtlich erzeugt wurden, als Ausgangsmaterial dienen. Anschließend findet die Identifikation von Allelvarianten statt, zum Beispiel mittels PCR. Danach schließt sich ein Schritt für die Selektion von überlegenen Allelvarianten der jeweiligen Sequenz, die erhöhte Ertragsmerkmale geben, an. Typischerweise wird die Selektion dadurch durchgeführt, dass man die Wachstumsleistung von Pflanzen, die unterschiedliche Allelvarianten der jeweiligen Sequenz enthalten, verfolgt. Die Wachstumsleistung kann in einem Gewächshaus oder auf dem Feld verfolgt werden. Zu weiteren optionalen Schritten zählt das Kreuzen von Pflanzen, in denen die überlegene Allelvariante identifiziert wurde, mit einer anderen Pflanze. Damit könnte man zum Beispiel eine Kombination von interessanten phänotypischen Merkmalen erzeugen.Allelic variants of a gene / nucleic acid sequence encoding a GRF polypeptide and SYT polypeptide may also find use in marker-assisted breeding programs. For such breeding programs, it is sometimes necessary to introduce allelic variation by mutagenic treatment of plants, for example by EMS mutagenesis; Alternatively, the program may use a collection of allelic variants of so-called "natural" origin that have been unintentionally generated as source material. Subsequently, the identification of allelic variants takes place, for example by means of PCR. This is followed by a step for the selection of superior allelic variants of the respective sequence which give increased yield-related traits. Typically, the selection is performed by following the growth performance of plants containing different allelic variants of the particular sequence. The growth performance can be tracked in a greenhouse or in the field. Other optional steps include crossing plants in which the superior allelic variant has been identified with another plant. This could, for example, produce a combination of interesting phenotypic features.

Nukleinsäuresequenzen, die für GRF-Polypeptide und SYT-Polypeptide kodieren, können auch als Sonden für die genetische und physikalische Kartierung der Gene, von denen sie ein Teil sind, und als Marker für Merkmale, die mit diesen Genen verbunden sind, eingesetzt werden. Solche Informationen können in der Pflanzenzüchtung nützlich sein, um Linien mit erwünschten Phänotypen zu entwickeln. Für solch eine Verwendung von Nukleinsäuresequenzen, die für ein GRF-Polypeptid und/oder ein SYT-Polypeptid kodieren, ist nur eine Nukleinsäuresequenz mit einer Länge von mindestens 15 Nukleotiden erforderlich. Die Nukleinsäuresequenzen, die für ein GRF-Polypeptid und/oder ein SYT-Polypeptid kodieren, können als Marker für den Restriktionsfragmentlängen-Polymorphismus (RFLP) verwendet werden. Southern-Blots ( Sambrook J, Fritsch EF und Maniatis T (1989), Molecular Cloning, A Laborstory Manual ) von pflanzlicher genomischer DNA, mit der ein Restriktionsverdau durchgeführt wurde, können mit den Nukleinsäuresequenzen, die für ein GRF-Polypeptid kodieren, als Sonde behandelt werden. Mit den erhaltenen Bandierungsmustern kann man anschließend mit Hilfe von Computerprogrammen wie MapMaker ( Lander et al, (1987), Genomics 1: 174–181 ) genetische Analysen durchführen, um eine Genkarte zu konstruieren. Weiterhin kann man mit den Nukleinsäuresequenzen als Sonde Southern-Blots behandeln, die mit Restriktionsendonuklease behandelte genomische DNAs eines Satzes von Einzelorganismen, die Elter und Nachkommenschaft einer definierten genetischen Kreuzung darstellen, enthalten. Die Aufspaltung der DNA-Polymorphismen wird notiert und für die Berechnung der Position der Nukleinsäuresequenz, die für ein spezifisches Polypeptid kodiert, in der zuvor unter Verwendung dieser Population erhaltenen Genkarte verwendet ( Botstein et al, (1980), Am. J. Hum. Genet. 32: 314–331 ).Nucleic acid sequences encoding GRF polypeptides and SYT polypeptides may also be used as probes for the genetic and physical mapping of the genes of which they are a part and as markers for traits associated with these genes. Such information may be useful in plant breeding to develop lines of desirable phenotypes. For such use of nucleic acid sequences encoding a GRF polypeptide and / or a SYT polypeptide, only one nucleic acid sequence of at least 15 nucleotides in length is required. The nucleic acid sequences encoding a GRF polypeptide and / or a SYT polypeptide may be used as restriction fragment length polymorphism (RFLP) markers. Southern blots ( Sambrook J, Fritsch EF and Maniatis T (1989), Molecular Cloning, A Laboratory Manual ) of genomic genomic DNA which has been subjected to restriction digestion can be probed with the nucleic acid sequences encoding a GRF polypeptide. With the obtained banding patterns you can then with the help of computer programs such as MapMaker ( Lander et al, (1987), Genomics 1: 174-181 ) perform genetic analyzes to construct a gene map. Further, one may treat with the nucleic acid sequences as a probe Southern blots containing restriction endonuclease treated genomic DNAs of a set of single organisms representing parent and progeny of a defined genetic cross. The cleavage of the DNA polymorphisms is noted and used to calculate the position of the nucleic acid sequence encoding a specific polypeptide in the gene map previously obtained using this population ( Botstein et al, (1980), Am. J. Hum. Genet. 32: 314-331 ).

Die Herstellung und die Verwendung von Sonden, die von pflanzlichen Genen abstammen, für die Verwendung in der genetischen Kartierung ist bei Bernatzky und Tanksley (1986), Plant Mol. Biol. Reporter 4: 37–41 beschrieben. Die genkartierung von spezifischen cDNA-Klonen unter Verwendung der oben beschriebenen Methodik bzw. Variationen davon ist in zahlreichen Publikationen beschrieben. So können für die Kartierung zum Beispiel F2-Heterozygotenkreuzungspopulationen, Rückkreuzungspopulationen, Populationen mit zufälliger Paarung, nahezu isogene Linien und andere Sätze von Einzelorganismen verwendet werden. Diese Methodiken sind dem Fachmann gut bekannt.The preparation and use of probes derived from plant genes for use in genetic mapping is included Bernatzky and Tanksley (1986), Plant Mol. Biol. Reporter 4: 37- 41 described. Gene mapping of specific cDNA clones using the methodology or variations thereof described above is described in numerous publications. For example, for mapping, F2 heterozygotic crossover populations, backcross populations, random mating populations, near isogenic lines, and other sets of single organisms may be used. These methodologies are well known to those skilled in the art.

Die Nukleinsäuresequenzsonden können auch für eine physikalische Kartierung verwendet werden (d. h. die Platzierung von Sequenzen auf physikalische Karten; siehe Hoheisel et al, In: Non-mammalian Genomic Analysis: A Practical Guide, Academic press 1996,. S. 319–346 , und darin genannte Literaturhinweise).The nucleic acid sequence probes can also be used for physical mapping (ie, the placement of sequences on physical maps; Hoheisel et al, In: Non-mammalian Genomic Analysis: A Practical Guide, Academic Press 1996 ,. Pp. 319-346 , and references cited therein).

In einer anderen Ausführungsform können die Nukleinsäuresequenzsonden für ein direktes „fluorescence in situ hybridisation mapping” (FISH) verwendet werden ( Trask (1991), Trends Genet. 7: 149–154 ). Obwohl man bei den derzeitigen FISH-Kartierungsmethoden lieber größere Klone verwendet (mehrere kB bis mehrere Hundert kB; siehe Laan et al, (1995), Genome Res. 5: 13–20 ), können es Verbesserungen bezüglich der Empfindlichkeit ermöglichen, ein FISH-Mapping mit kürzeren Sonden durchzuführen.In another embodiment, the nucleic acid sequence probes may be used for direct fluorescence in situ hybridization mapping (FISH) ( Trask (1991), Trends Genet. 7: 149-154 ). Although the current FISH mapping method prefers to use larger clones (several kb to several hundred kb, see Laan et al, (1995), Genome Res. 5: 13-20 ), improvements in sensitivity may allow for FISH mapping with shorter probes.

Mit den Nukleinsäuresequenzen können verschiedene Verfahren für die genetische und physikalische Kartierung, die auf der Amplifikation von Nukleinsäuresequenzen beruhen, durchgeführt werden. Zu Beispielen zählen die allelspezifische Amplifikation ( Kazazian (1989), J. Lab. Clin. Med 11: 95–96 ), der Polymorphismus von PCR-amplifizierten Fragmenten (CAPS; Sheffield et al, (1993), Genomics 16: 325–332 ), die allelspezifische Ligation ( Landegren et al, (1988), Science 241: 1077–1080 ), Nukleotidextensionsreaktionen ( Sokolov (1990), Nucleic Acid Sequence Res. 18: 3671 ), „Radiation Hybrid Mapping” ( Walter et al, (1997), Nat. Genet. 7: 22–28 ) und „Happy Mapping” (Dear und Cook (1989) Nucleic Acid Sequence Res. 17: 6795–6807) . Bei diesen Verfahren verwendet man die Sequenz einer Nukleinsäuresequenz, um Primer-Paare für die Verwendung in der Amplifikationsreaktion oder in Primer-Extensionsreaktionen zu entwickeln und herzustellen. Die Entwicklung von solchen Primern ist dem Fachmann gut bekannt. Bei Verfahren, bei denen eine Genkartierung auf PCR-Basis verwendet wird, kann es erforderlich sein, Unterschiede bezüglich der DNA-Sequenz zwischen den Eltern der Kartierungskreuzung in der Region, die der vorliegenden Nukleinsäuresequenz entspricht, zu identifizieren. Dies ist jedoch allgemein für Kartierungsmethoden nicht erforderlich.Various methods for genetic and physical mapping based on the amplification of nucleic acid sequences can be performed with the nucleic acid sequences. Examples include allele specific amplification ( Kazazian (1989) J. Lab. Clin. Med. 11: 95-96 ), the polymorphism of PCR-amplified fragments (CAPS; Sheffield et al, (1993), Genomics 16: 325-332 ), the allele-specific ligation ( Landegren et al, (1988), Science 241: 1077-1080 ), Nucleotide extension reactions ( Sokolov (1990), Nucleic Acid Sequence Res. 18: 3671 ), "Radiation Hybrid Mapping" ( Walter et al, (1997), Nat. Genet. 7: 22-28 ) and "Happy Mapping" (Dear and Cook (1989) Nucleic Acid Sequence Res. 17: 6795-6807) , In these methods, one uses the sequence of a nucleic acid sequence to design and produce primer pairs for use in the amplification reaction or in primer extension reactions. The development of such primers is well known to those skilled in the art. In methods where PCR-based gene mapping is used, it may be necessary to identify differences in DNA sequence between the parents of the mapping cross in the region corresponding to the subject nucleic acid sequence. However, this is generally not required for mapping methods.

Die Verfahren gemäß der vorliegenden Erfindung führen zu Pflanzen mit erhöhten Ertragsmerkmalen, wie oben beschrieben. Diese Merkmale können auch mit anderen wirtschaftlich vorteilhaften Merkmalen, wie weiteren ertragserhöhenden Merkmalen, Toleranz für abiotische und biotische Stressfaktoren, Toleranz für Herbizide, Insektizide, Merkmalen, die verschiedene Architekturaspekte und/oder biochemische und/oder physiologische Aspekte modifizieren, kombiniert werden.The methods of the present invention result in plants having enhanced yield-related traits as described above. These features may also be combined with other economically advantageous features, such as other yield-enhancing traits, tolerance for abiotic and biotic stressors, tolerance for herbicides, insecticides, features that modify various architectural aspects and / or biochemical and / or physiological aspects.

Beschreibung der AbbildungenDescription of the pictures

Die vorliegende Erfindung soll nun anhand der folgenden Abbildungen beschrieben werden, in denen Folgendes dargestellt wird.The present invention will now be described with reference to the following figures, in which the following is shown.

ist eine Darstellung eines GRF-Polypeptids gemäß SEQ ID NO: 2, das die folgenden Merkmale umfasst: (i) eine QLQ-Domäne mit einem InterPro-Eintrag IPR014978 (PFAM-Eintrag PF08880); (ii) eine WRC-Domäne mit einem InterPro-Eintrag IPR014977 (PFAM-Eintrag PF08879); und (iii) eine Transkriptionseffektordomäne (Effector of Transcription, ET-Domäne), die drei Cys- und einen His-Reste in konservierter Beabstandung (CX₉CX₁₀CX₂H) umfasst und die innerhalb der WRC-Domäne liegt. is a representation of a GRF polypeptide of SEQ ID NO: 2 comprising the following features: (i) a QLQ domain with an InterPro entry IPR014978 (PFAM entry PF08880); (ii) a WRC domain with an InterPro entry IPR014977 (PFAM entry PF08879); and (iii) an effector of transcription (ET) domain comprising three conserved-spaced Cys and His residues (CX ₉ CX ₁₀ CX ₂ H) and located within the WRC domain.

zeigt ein AlignX (von Vector NTI 10.3, Invitrogen Corporation) multiples Sequenz-Alignment der QLQ-Domäne von GRF-Polypeptiden von Tabelle A.1 (gemäß SEQ ID NO: 115 für SEQ ID NO: 2). Die konservierten QLQ-Aminosäurereste befinden sich oben in dem multiplen Alignment. Zwei weitere sehr stark konservierte Reste (schwarz hinterlegt) sind E (Glu) und P (Pro). Figure 9 shows an AlignX (from Vector NTI 10.3, Invitrogen Corporation) multiple sequence alignment of the QLQ domain of GRF polypeptides of Table A.1 (according to SEQ ID NO: 115 for SEQ ID NO: 2). The conserved QLQ amino acid residues are at the top of the multiple alignment. Two other highly conserved residues (highlighted in black) are E (Glu) and P (Pro).

zeigt ein AlignX (von Vector NTI 10.3, Invitrogen Corporation) multiples Sequenz-Alignment der WRC-Domäne von GRF-Polypeptiden von Tabelle A.1 (gemäß SEQ ID NO: 116 für SEQ ID NO: 2). Die konservierten WRC-Aminosäurereste sind in der Konsensus-Sequenz fett gedruckt. Die drei Cys-Reste und der eine His-Rest in einer konservierten Beabstandung (CX₉CX₁₀CX₂H), als „Effector of Transcription” (ET) bezeichnete Domäne, sind senkrecht über das Alignment hinweg eingerahmt und auch im Alignment unten angegeben. Das mutmaßliche Kernlokalisierungssignal (NLS), das in der WRC-Domäne vorliegt, ist doppelt unterstrichen. Figure 9 shows an AlignX (from Vector NTI 10.3, Invitrogen Corporation) multiple sequence alignment of the WRC domain of GRF polypeptides of Table A.1 (according to SEQ ID NO: 116 for SEQ ID NO: 2). The conserved WRC amino acid residues are shown in bold in the consensus sequence. The three Cys residues and one His residue in a conserved spacing (CX "_9" CX "_10" CX "_2" H), called the "Effector of Transcription" (ET), are boxed vertically across the alignment and also indicated in the alignment below , The putative nuclear localization signal (NLS) present in the WRC domain is underlined twice.

zeigt die typische Domänenstruktur von SYT-Polypeptiden aus Pflanzen und Säugetieren. Die konservierte SNH-Domäne befindet sich am N-terminalen Ende des Polypeptids. Der C-terminale Rest des Polypeptids besteht aus einer QG-reichen Domäne mit pflanzlichen SYT-Polypeptiden und einer QPGY-reichen Domäne in Säugetier-SYT-Polypeptiden. Eine Met-reiche Domäne liegt in Pflanzen oder in QPGY-reichen Säugetieren typischerweise innerhalb der ersten Hälfte der QG-reichen vor (vom N-terminalen Ende Richtung C-terminales Ende). Bei pflanzlichen SYT-Polypeptiden kann eine zweite Met-reiche Domäne der SNH-Domäne vorangehen. shows the typical domain structure of SYT polypeptides from plants and mammals. The conserved SNH domain is located at the N-terminal end of the polypeptide. The C-terminal residue of the polypeptide consists of a QG-rich domain with plant SYT polypeptides and a QPGY-rich domain in mammalian SYT polypeptides. A Met-rich domain is present in plants or in QPGY-rich mammals, typically within the first half of the QG-rich (from the N-terminal end toward the C-terminal end). In plant SYT polypeptides, a second Met-rich domain may precede the SNH domain.

zeigt ein multiples Alignment des N-terminalen Endes von verschiedenen SYT-Polypeptiden unter Verwendung des multiplen Alignment-Programms VNTI AlignX, das auf einem modifizierten ClustalW-Algorithmus basiert (InforMax, Bethesda, MD, http://www.informaxinc.com ), und zwar mit den Default-Einstellungen „Gap Opening Penalty” 10 und „Gap Extension” 0,05. Die SNH-Domäne ist über die pflanzlichen und humanen SYT-Polypeptide eingerahmt. Die letzte Linie in dem Alignment besteht aus einer Konsensus-Sequenz, die von den Sequenzen im Alignment abgeleitet ist. Figure 10 shows a multiple alignment of the N-terminal end of various SYT polypeptides using the multiple alignment program VNTI AlignX based on a modified ClustalW algorithm (InforMax, Bethesda, MD, http://www.informaxinc.com ), with the default settings "Gap Opening Penalty" 10 and "Gap Extension" 0.05. The SNH domain is framed by the plant and human SYT polypeptides. The last line in the alignment consists of a consensus sequence derived from the sequences in alignment.

zeigt ein multiples Alignment von verschiedenen pflanzlichen SYT-Polypeptiden unter Verwendung des multiplen Alignment-Programms VNTI AlignX, das auf einem modifizierten ClustalW-Algorithmus basiert (InforMax, Bethesda, MD, http://www.informaxinc.com ), und zwar mit den Default-Einstellungen „Gap Opening Penalty” 10 und „Gap Extension” 0,05. Die zwei Hauptdomänen vom N-Terminus in Richtung C-Terminus sind eingerahmt und als SNH-Domäne und Met-reiche/QG-reiche Domäne identifiziert. Zusätzlich ist auch die N-terminale Met-reiche Domäne eingerahmt, und die Positionen von SEQ ID NO: 90 und SEQ ID NO: 91 sind fett unterstrichen. Figure 3 shows a multiple alignment of various plant SYT polypeptides using the multiple alignment program VNTI AlignX based on a modified ClustalW algorithm (InforMax, Bethesda, MD, http://www.informaxinc.com ), with the default settings "Gap Opening Penalty" 10 and "Gap Extension" 0.05. The two major domains from the N-terminus towards the C-terminus are boxed and identified as SNH domain and Met rich / QG rich domain. In addition, the N-terminal Met-rich domain is also boxed, and the positions of SEQ ID NO: 90 and SEQ ID NO: 91 are underlined in bold.

zeigt links eine Rispe einer Reispflanze (Oryza sativa spp. Japonica cv. Nipponbare), die mit einem Kontrollvektor transformiert ist, und rechts eine Rispe von einer Reispflanze (Oryza sativa spp. Japonica cv. Nipponbare), die mit zwei Konstrukten transformiert ist: (1) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert; sowie (2) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert; on the left shows a panicle of a rice plant (Oryza sativa spp., Japonica cv., Nipponbare) transformed with a control vector and, on the right, a panicle of a rice plant (Oryza sativa spp., Japonica cv., Nipponbare) transformed with two constructs: ( 1) a nucleic acid sequence encoding a GRF polypeptide under the control of a rice GOS2 promoter (pGOS2); and (2) a nucleic acid sequence encoding a SYT polypeptide under the control of a rice GOS2 promoter (pGOS2);

zeigt in der oberen Reihe von links nach rechts 30 reife Reissamen (Oryza sativa spp. Japonica cv. Nipponbare) von:

• a. Pflanzen, die mit einem Konstrukt umfassend eine Nukleinsäuresequenz, die für ein SYT-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert, transformiert wurden;
• b. Pflanzen, die mit zwei Konstrukten transformiert wurden: (1) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert; sowie (2) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert;
• c. Pflanzen, die mit einem Konstrukt umfassend eine Nukleinsäuresequenz, die für ein GRF-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert, transformiert wurden;
• d. nullizygote Pflanzen (Kontrollpflanzen) von a;
• e. nullizygote Pflanzen (Kontrollpflanzen) von c.

• a. Plants transformed with a construct comprising a nucleic acid sequence encoding a SYT polypeptide under the control of a rice GOS2 promoter (pGOS2);
• b. Plants transformed with two constructs: (1) a nucleic acid sequence encoding a GRF polypeptide from the rice under the control of a GOS2 promoter (pGOS2); and (2) a nucleic acid sequence encoding a SYT polypeptide under the control of a rice GOS2 promoter (pGOS2);
• c. Plants transformed with a construct comprising a nucleic acid sequence encoding a GRF polypeptide under the control of a rice GOS2 promoter (pGOS2);
• d. zero-zygote plants (control plants) of a;
• e. zero-zygote plants (control plants) of c.

zeigt den binären Vektor für die erhöhte Expression einer Nukleinsäuresequenz, die für ein GRF-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert, in Oryza sativa bzw. für die erhöhte Expression einer Nukleinsäuresequenz, die für ein SYT-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert, in Oryza sativa. Figure 4 shows the binary vector for increased expression of a nucleic acid sequence encoding a GRF polypeptide under the control of a rice GOS2 promoter (pGOS2) in Oryza sativa or for increased expression of a nucleic acid sequence encoding a SYT polypeptide encoded in rice under the control of a GOS2 promoter (pGOS2), in Oryza sativa.

In sind Einzelheiten von Sequenzbeispielen dargestellt, die bei der Durchführung der Verfahren gemäß der vorliegenden Erfindung nützlich sind.In For example, details of sequence examples useful in carrying out the methods of the present invention are shown.

BeispieleExamples

Die vorliegende Erfindung wird nun anhand der folgenden Beispiele, die lediglich der Erläuterung dienen, beschrieben. Die folgenden Beispiele sollen den Umfang der Erfindung nicht vollständig definieren oder auf andere Weise begrenzen.The present invention will now be described by way of the following examples, which are given by way of illustration only. The following examples are not intended to fully define or otherwise limit the scope of the invention.

DNA-Manipulation: Falls nicht anders erwähnt werden die DNA-Rekombinationstechniken nach den Standardprotokollen durchgeführt, die in den folgenden Veröffentlichungen beschrieben sind: ( Sambrook (2001), Molecular Cloning: a laboratory manual, 3. Ausgabe, Cold Spring Harbor Laboratory Press, CSH, New York ) oder in Band 1 und 2 von Ausubel et al, (1994) , Current Protocols in Molecular Biology, Current Protocols. Standardmaterial und -verfahren für molekularbiologische Arbeiten an Pflanzen sind beschrieben in Plant Molecular Biology Labfax (1993), von R. D. D. Croy, verlegt bei BIOS Scientific Publications Ltd (UK) und Blackwell Scientific Publications (UK) .DNA Manipulation: Unless otherwise stated, recombinant DNA techniques are performed according to the standard protocols described in the following publications: ( Sambrook (2001), Molecular Cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory Press, CSH, New York ) or in Volumes 1 and 2 of Ausubel et al, (1994) , Current Protocols in Molecular Biology, Current Protocols. Standard material and methods for molecular biology work on plants are described in Plant Molecular Biology Labfax (1993) by RDD Croy, published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK) ,

Beispiel 1: Identifikation von Sequenzen, die mit der Nukleinsäuresequenz, die bei den erfindungsgemäßen Verfahren verwendet wird, verwandt sindExample 1: Identification of sequences related to the nucleic acid sequence used in the methods of the invention

Unter den Sequenzen in der Entrez Nucleotides Datenbank am National Center for Biotechnology Information (NCBI) wurden unter Verwendung von Datenbanksequenzabfragewerkzeugen, wie dem Basic Local Alignment Tool (BLAST) ( Altschul et al, (1990), J. Mol. Biol. 215: 403–410 ; und Altschul et al, (1997), Nucleic Acids Res. 25: 3389–3402 ), (Volllängen-cDNA, ESTs oder genomische) Sequenzen, die mit der Nukleinsäuresequenz, die bei den erfindungsgemäßen Verfahren verwendet wird, verwandt sind, identifiziert. Das Programm wird dazu verwendet, um Regionen mit lokaler Ähnlichkeit zwischen Sequenzen aufzufinden, und zwar dadurch, dass man Nukleinsäuresequenz oder Polypeptidsequenzen mit Sequenzdatenbanken verglich und die statistische Signifikanz der „Matches” berechnete. Beispielsweise wurde das Polypeptid, das von der Nukleinsäuresequenz der vorliegenden Erfindung kodiert wird, für den TBLASTN-Algorithmus verwendet, und zwar unter Ausschaltung der Default-Einstellungen und des Filters für die Nichtmiteinbeziehung von Sequenzen mit niedriger Komplexität. Der Output der Analyse wurde mittels paarweisem Vergleich betrachtet und gemäß der Wahrscheinlichkeits-Wertung (E-Wert) gereiht, wobei die Wertung die Wahrscheinlichkeit, dass ein bestimmtes Alignment zufallsmäßig vorkommt, widerspiegeln (je niedriger der E-Wert, desto signifikanter der Hit). Zusätzlich zu den E-Werten wurden die Vergleiche auch durch Prozentsatz der Identität gewertet. Der Prozentsatz der Identität bezieht sich auf die Anzahl identischer Nukleotide (oder Aminosäuren) zwischen den zwei verglichenen Nukleinsäuresequenz(oder Polypeptid)-Sequenzen über eine bestimmte Länge. In manchen Fällen können die Default-Parameter verändert werden, um die Stringenz der Suche zu modifizieren. So kann zum Beispiel der E-Wert erhöht werden, um Matches mit niedrigerer Stringenz aufzuzeigen. Auf diese Weise können kurze, beinahe exakte Matches identifiziert werden.Among the sequences in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI), using database sequence query tools such as the Basic Local Alignment Tool (BLAST) ( Altschul et al, (1990), J. Mol. Biol. 215: 403-410 ; and Altschul et al, (1997), Nucleic Acids Res. 25: 3389-3402 ), (Full-length cDNA, ESTs or genomic) sequences related to the nucleic acid sequence used in the methods of the invention. The program is used to find regions of local similarity between sequences by comparing nucleic acid sequence or polypeptide sequences with sequence databases and calculating the statistical significance of the "matches". For example, the polypeptide encoded by the nucleic acid sequence of the present invention has been used for the TBLASTN algorithm, bypassing the default settings and the filter for not involving low complexity sequences. The output of the analysis was considered by pairwise comparison and ranked according to the probability score (E value), the score reflecting the probability that a particular alignment will occur randomly (the lower the E value, the more significant the hit). In addition to the E-values, the comparisons were also evaluated by percentage of identity. Percent identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid sequence (or polypeptide) sequences over a given length. In some cases, the default parameters can be changed to modify the stringency of the search. For example, the E value can be increased to show matches with lower stringency. In this way, short, almost exact matches can be identified.

Tabelle A.1 stellt eine Aufzählung von verwandten Nukleinsäuresequenzen bereit, die für GRF-Polypeptide kodieren, welche bei der Durchfürhung der erfindungsgemäßen Verfahren nützlich sind. Tabelle A.2 stellt eine Aufzählung von verwandten Nukleinsäuresequenzen bereit, die für SYT-Polypeptide kodieren, welche bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind. Tabelle A.1: Beispiele für GRF-Polypeptidsequenzen sowie kodierende Nukleinsäuresequenzen: Bezeichnung Herkunftsorganismus Nukleinsäure SEQ ID NO: Polypeptid SEQ ID NO: Datenbank-Eintragsnummer Arath_GRF_At3G13960.1 Arabidopsis thaliana 1 2 AT3G13960.1 Arath_GRFAt2G06200.1 Arabidopsis thaliana 3 4 At2G06200.1 Arath_GRF_At2G22840.1 Arabidopsis thaliana 5 6 At2G22840.1 Arath_GRF_At36400.1 Arabidopsis thaliana 7 8 At2G36400.1 Arath_GRF_At2G45480.1 Arabidopsis thaliana 9 10 At2G45480.1 Arath_GRF_At3G52910.1 Arabidopsis thaliana 11 12 At3G52910.1 Arath_GRF_At4G24150.1 Arabidopsis thaliana 13 14 At4G24150.1 Arath_GRF_At4G37740.1 Arabidopsis thaliana 15 16 At4G37740.1 Arath_GRF_At5G53660.1 Arabidopsis thaliana 17 18 At5G53660.1 Aqufo_GRF Aquilegia formosa x Aquilegia pubescens 19 20 DT756681.1 DR946716.1 Brana_GRF Brassica napus 21 22 CN730217.1 Horvu_GRF Hordeum vulgare 23 24 AK250947.1 Lyces_GRF Lycopersicon esculentum 25 26 BT013977.1 Medtr_GRF Medicago truncatula 27 28 AC144645.17 Medtr_GRF like Medicago truncatula 29 30 AC174350.4 Orysa_GRF_Os02g47280.2 Oryza sativa 31 32 Os02g47280.2 Orysa_GRF_Os02g53690.1 Oryza sativa 33 34 Os02g53690.1 Orysa_GRF_Os03g51970.1 Oryza sativa 35 36 Os03g51970.1 Orysa_GRF_Os04g48510.1 Oryza sativa 37 38 Os04g48510.1 Orysa_GRF_Os04g51190.1 Oryza sativa 39 40 Os04g51190.1 Orysa_GRF_Os06g02560.1 Oryza sativa 41 42 Os06g02560.1 Orysa_GRF_Os11 g35030.1 Oryza sativa 43 44 Os11g35030.1 Orysa_GRF_Os12g29980.1 Oryza sativa 45 46 Os12g29980.1 Orysa_GRF_Os03g47140.1 Oryza sativa 47 48 Os03g47140.1 Orysa_GRF-gi_115447910_ref_NM001054270.1 Oryza sativa 49 50 NM_001054270.1 Orysa_GRF-gi_115460325_ref_NM_001060298.1 Oryza sativa 51 52 NM_001060298.1 Orysa_GRF_gi_115471984_ref NM_001066126.1 Oryza sativa 53 54 NM_001066126.1 Poptr_GRF_lcl_scaffXIV.399 Populus tremuloides 55 56 lcl_scaff_XIV.39 Poptr_GRF_lcl_scaffII.1070 Populus tremuloides 57 58 lcl_scaff _II.1070 Poptr_GRF_lcl_scaffI.1018 Populus tremuloides 59 60 lcl_scaff_I.1018 Poptr_GRF_lcl_scaff28.10 Populus tremuloides 61 62 lcl_scaff_28.10 Poptr_GRF_lcl_scaff_I.995 Populus tremuloides 63 64 lcl_scaff_I.995 Poptr_GRF_lcl_scaffIII.741 Populus tremuloides 65 66 lcl_scaff_III.741 Poptr_GRF_lcl_scaffVII.1274 Populus tremuloides 67 68 lcl_scaff_VII.1274 Poptr_GRF_lcl_scaffXII.277 Populus tremuloides 69 70 lcl_scaff_XII.277 Poptr_GRF_lcl_scaff_XIII.769 Populus tremuloides 71 72 lcl_scafXIII.769 Poptr_GRF_lcl_scaffXIV.174 Populus tremuloides 73 74 lcl_scaff_XIV.174 Poptr_GRF_lcl_scaffXIV.51 Populus tremuloides 75 76 lcl_scaff_XIV.51 Poptr_GRF_lcl_scaffXIX.480 Populus tremuloides 77 78 lcl_scaff_XIX.480 Poptr_GRF_lcl_scaff28.309 Populus tremuloides 79 80 lcl_scaff_28.309 Poptr_GRF_lcl_scaffI.688 Populus tremuloides 81 82 lcl_scaff_I.688 Sacof_GRF Saccharum officinarum 83 84 CA084837.1 CA238919.1 CA122516.1 Vitvi_GRF Vitis vinifera 85 86 AM468035 Zeama_GRF10_gi_146008494_gb_RF515849.1 Zea mays 87 88 EF515849.1 Zeama_GRF11_gi_146008515_gb_EF515850.1 Zea mays 89 90 EF515850.1 Zeama_GRF12_gi_146008534_gb_EF515851.1 Zea mays 91 92 EF515851.1 Zeama_GRF13_gi_146008539_gb_EF515852.1 Zea mays 93 94 EF515852.1 Zeama_GRF14_gi_146008560_gb_EF515853.1 Zea mays 95 96 EF515853.1 Zeama_GRF1_gi_146008330_gb_EF515840.1 Zea mays 97 98 EF515840.1 Zeama_GRF2_gi_146008352_gb_EF515841.1 Zea mays 99 100 EF515841.1 Zeama_GRF3_gi_146008368_gb_EF515842.1 Zea mays 101 102 EF515842.1 Zeama_GRF4_gi_146008393_gb_EF515843.1 Zea mays 103 104 EF515843.1 Zeama_GRF5_gi_146008412_gb_EF515844.1 Zea mays 105 106 EF515844.1 Zeama_GRF_gi_146008429_gb_EF515845.1 Zea mays 107 108 EF515845.1 Zeama_GRF7_gi_146008440_gb_EF515846.1 Zea mays 109 110 EF515846.1 Zeama_GRF8_gi_146008461_gb_EF515847.1 Zea mays 111 112 EF515847.1 Zeama_GRF9_gi_146008475_gb_EF515848.1 Zea mays 113 114 EF515848.1 Tabelle A.2: Beispiele für SYT-Polypeptidsequenzen sowie kodierende Nukleinsäuresequenzen: Bezeichnung Herkunftsorganismus Nukleinsäure SEQ ID NO: Translatierte Polypeptid SEQ ID NO: Datenbank-Eintragsnummer Arath_SYT1 Arabidopsis thaliana 120 121 AY102639.1 Arath_SYT2 Arabidopsis thaliana 122 123 AY102640.1 Arath_SYT3 Arabidopsis thaliana 124 125 AY102641.1 Allce_SYT2 Allium cepa 126 127 CF437485 Aqufo_SYT1 Aquilegia formosa x Aquilegia pubescens 128 129 DT758802.1 Aqufo_SYT2 Aquilegia Formosa x Aquilegia pubescens 130 131 TA15831_33861 8 T25K16.15 Aspof_SYT1 Aspergillus officinalis 132 133 CV287542 Betvu_SYT2 Beta vulgaris 134 135 BQ594749.1 BQ594658.1 Bradi_SYT3 Brachypodium distachyon 136 137 DV480064.1 Brana_SYT1 Brassica napus 138 139 CD823592 Brana_SYT2 Brassica napa 140 141 CN732814 Chlre_SYT Chlamydomonas reinhardtii 142 143 BQ814858, jgi_Chlre3_194013_estExt_fgenesh2_pg.C_510025 Citsi_SYT1 Citrus sinensis 144 145 CB290588 Citsi_SYT2 Citrus sinensis 146 147 CV717501 Cryja_SYT1 Cryptomeria japonica 148 149 TA3001_3369_2 Curlo_SYT2 Curcuma longa 150 151 TA2676_136217 Eupes_SYT Euphorbia esula 152 153 DV144834 Frave_SYT2 Fragaria vesca 154 155 DY668312 Glyma_SYT1.1 Glycine max 156 157 TA55102_3847 Glyma_SYT1.2 Glycine max 158 159 TA51451_3847 Glyma_SYT2.1 Glycine max 160 161 BQ612648 Glyma_SYT2.2 Glycine max 162 163 TA48452_3847 Glyso_SYT2 Glycine soya 164 165 CA799921 Gosar SYT1 Gossypium arboretum 166 167 BM359324 Goshi_SYT1 Gissypium hirsutum 168 169 DT558852 Goshi_SYT2 Gossypium hirsutum 170 171 DT563805 Helan_SYT1 Helianthus annuus 172 173 TA12738_4232 Horvu_SYT2 Hordeum vulgare 174 175 CA032350 Lacse_SYT2 Lactuca serriola 176 177 DW110765 Lyces_SYT1 Lycopersicon esculentum 178 179 AW934450.1 BP893155.1 Maldo_SYT2 Malus domestica 180 181 CV084230 DR997566 Medtr_SYT1 Medicago trunculata 182 183 CA858507.1 Medtr_SYT2 Medicago trunculata 184 185 CA858743 B1310799.1 AL382135.1 Orysa_SYT1 Oryza sativa 186 187 AK058575 Orysa_SYT2 Oryza sativa 188 189 AK105366 Orysa_SYT3 Oryza sativa 190 191 BP185008 Panvi_SYT3 Panicum virgatum 192 193 DN152517 Phypa_SYT1.1 Physcomitrella patens 194 195 TA28566_3218 Phypa_SYT1.2 Physcomitrella patens 196 197 TA21282_3218 Phypa_SYT1.3 Physcomitrella patens 198 199 TA20922_3218 Phypa_SYT1.4 Physcomitrella patens 200 201 TA29452_3218 Picsi_SYT1 Picea sitchensis 202 203 DR484100 DR478464.1 Pinta_SYT1 Pinus taeda 204 205 DT625916 Poptr_SYT1 Populus trichocarpa 206 207 DT476906 Poptr_SYT2 Populus trichocarpa 208 209 scaff_XIV.493 Poptr_SYT1.2 Populus trichocarpa 210 211 CV257942.1 Prupe_SYT2 Prunus persica 212 213 DT454880.1 Sacof_SYT1 Saccharum officinarum 214 215 Ca078249.1 CA078630 CA082679 CA234526 CA239244 CA083312 Sacof_SYT2 Saccharum officinarum 216 217 CA110367 Sacof_SYT3 Saccharum officinarum 218 219 CA161933.1 CA265085 Soltu_SYT1.1 Solanum tuberosum 220 221 CK265597 Soltu_SYT1.2 Solanum tuberosum 222 223 BG590990 Soltu SYT3 Solanum tuberosum 224 225 CK272804 Sorbi_SYT1 Sorghum bicolor 226 227 TA40712_4558 Sorbi_SYT2 Sorghum bicolor 228 229 CF482417 CW376917 Sorbi_SYT3 Sorghum bicolor 230 231 CX611128 Taxof_SYT2 Taraxacum officinale 232 233 TA1299_50225 Taxof_SYT3 Taraxacum officinale 234 235 TA5000_50225 Triae_SYT1 Triticumaestivum 236 237 TA105893_4565 Triae_SYT2 Triticur aestivum 238 239 CD901951 Triae_SYT3 Triticum aestivum 240 241 BJ246754 BJ252709 Vitvi_SYT1.1 Vitis vinifera 242 243 DV219834 Vitvi_SYT1.2 Vitis vinifera 244 245 EE108079 Vitvi_SYT2.1 Vitis vinifera 246 247 EC939550 Vitvi_SYT2.2 Vitis vinifera 248 249 EE094148.1 EC964169.1 Volca_SYT Volvox carteri 250 251 JGI_CBHO11121.fwdjGI_CBHO11121.rev Welmi_SYT Welwitschia mirabilis 252 253 DT598761 Zeama_SYT1 Zea mays 254 255 BG874129.1 CA409022.1 Zeama_SYT2 Zea mays 256 257 AY106697 Zeama_SYT3 Zea mays 258 259 CO468901 Homsa_SYT Homo sapiens 260 261 CR542103 Table A.1 provides an enumeration of related nucleic acid sequences encoding GRF polypeptides useful in carrying out the methods of the invention. Table A.2 provides an enumeration of related nucleic acid sequences encoding SYT polypeptides which are useful in practicing the methods of the invention. Table A.1: Examples of GRF Polypeptide Sequences and Coding Nucleic Acid Sequences: description source organism Nucleic acid SEQ ID NO: Polypeptide SEQ ID NO: Database record number Arath_GRF_At3G13960.1 Arabidopsis thaliana 1 2 AT3G13960.1 Arath_GRFAt2G06200.1 Arabidopsis thaliana 3 4 At2G06200.1 Arath_GRF_At2G22840.1 Arabidopsis thaliana 5 6 At2G22840.1 Arath_GRF_At36400.1 Arabidopsis thaliana 7 8th At2G36400.1 Arath_GRF_At2G45480.1 Arabidopsis thaliana 9 10 At2G45480.1 Arath_GRF_At3G52910.1 Arabidopsis thaliana 11 12 At3G52910.1 Arath_GRF_At4G24150.1 Arabidopsis thaliana 13 14 At4G24150.1 Arath_GRF_At4G37740.1 Arabidopsis thaliana 15 16 At4G37740.1 Arath_GRF_At5G53660.1 Arabidopsis thaliana 17 18 At5G53660.1 Aqufo_GRF Aquilegia formosa x Aquilegia pubescens 19 20 DT756681.1 DR946716.1 Brana_GRF Brassica napus 21 22 CN730217.1 Horvu_GRF Hordeum vulgare 23 24 AK250947.1 Lyces_GRF Lycopersicon esculentum 25 26 BT013977.1 Medtr_GRF Medicago truncatula 27 28 AC144645.17 Medtr_GRF like Medicago truncatula 29 30 AC174350.4 Orysa_GRF_Os02g47280.2 Oryza sativa 31 32 Os02g47280.2 Orysa_GRF_Os02g53690.1 Oryza sativa 33 34 Os02g53690.1 Orysa_GRF_Os03g51970.1 Oryza sativa 35 36 Os03g51970.1 Orysa_GRF_Os04g48510.1 Oryza sativa 37 38 Os04g48510.1 Orysa_GRF_Os04g51190.1 Oryza sativa 39 40 Os04g51190.1 Orysa_GRF_Os06g02560.1 Oryza sativa 41 42 Os06g02560.1 Orysa_GRF_Os11 g35030.1 Oryza sativa 43 44 Os11g35030.1 Orysa_GRF_Os12g29980.1 Oryza sativa 45 46 Os12g29980.1 Orysa_GRF_Os03g47140.1 Oryza sativa 47 48 Os03g47140.1 Orysa_GRF-gi_115447910_ref_NM001054270.1 Oryza sativa 49 50 NM_001054270.1 Orysa_GRF-gi_115460325_ref_NM_001060298.1 Oryza sativa 51 52 NM_001060298.1 Orysa_GRF_gi_115471984_ref NM_001066126.1 Oryza sativa 53 54 NM_001066126.1 Poptr_GRF_lcl_scaffXIV.399 Populus tremuloides 55 56 lcl_scaff_XIV.39 Poptr_GRF_lcl_scaffII.1070 Populus tremuloides 57 58 lcl_scaff _II.1070 Poptr_GRF_lcl_scaffI.1018 Populus tremuloides 59 60 lcl_scaff_I.1018 Poptr_GRF_lcl_scaff28.10 Populus tremuloides 61 62 lcl_scaff_28.10 Poptr_GRF_lcl_scaff_I.995 Populus tremuloides 63 64 lcl_scaff_I.995 Poptr_GRF_lcl_scaffIII.741 Populus tremuloides 65 66 lcl_scaff_III.741 Poptr_GRF_lcl_scaffVII.1274 Populus tremuloides 67 68 lcl_scaff_VII.1274 Poptr_GRF_lcl_scaffXII.277 Populus tremuloides 69 70 lcl_scaff_XII.277 Poptr_GRF_lcl_scaff_XIII.769 Populus tremuloides 71 72 lcl_scafXIII.769 Poptr_GRF_lcl_scaffXIV.174 Populus tremuloides 73 74 lcl_scaff_XIV.174 Poptr_GRF_lcl_scaffXIV.51 Populus tremuloides 75 76 lcl_scaff_XIV.51 Poptr_GRF_lcl_scaffXIX.480 Populus tremuloides 77 78 lcl_scaff_XIX.480 Poptr_GRF_lcl_scaff28.309 Populus tremuloides 79 80 lcl_scaff_28.309 Poptr_GRF_lcl_scaffI.688 Populus tremuloides 81 82 lcl_scaff_I.688 Sacof_GRF Saccharum officinarum 83 84 CA084837.1 CA238919.1 CA122516.1 Vitvi_GRF Vitis vinifera 85 86 AM468035 Zeama_GRF10_gi_146008494_gb_RF515849.1 Zea mays 87 88 EF515849.1 Zeama_GRF11_gi_146008515_gb_EF515850.1 Zea mays 89 90 EF515850.1 Zeama_GRF12_gi_146008534_gb_EF515851.1 Zea mays 91 92 EF515851.1 Zeama_GRF13_gi_146008539_gb_EF515852.1 Zea mays 93 94 EF515852.1 Zeama_GRF14_gi_146008560_gb_EF515853.1 Zea mays 95 96 EF515853.1 Zeama_GRF1_gi_146008330_gb_EF515840.1 Zea mays 97 98 EF515840.1 Zeama_GRF2_gi_146008352_gb_EF515841.1 Zea mays 99 100 EF515841.1 Zeama_GRF3_gi_146008368_gb_EF515842.1 Zea mays 101 102 EF515842.1 Zeama_GRF4_gi_146008393_gb_EF515843.1 Zea mays 103 104 EF515843.1 Zeama_GRF5_gi_146008412_gb_EF515844.1 Zea mays 105 106 EF515844.1 Zeama_GRF_gi_146008429_gb_EF515845.1 Zea mays 107 108 EF515845.1 Zeama_GRF7_gi_146008440_gb_EF515846.1 Zea mays 109 110 EF515846.1 Zeama_GRF8_gi_146008461_gb_EF515847.1 Zea mays 111 112 EF515847.1 Zeama_GRF9_gi_146008475_gb_EF515848.1 Zea mays 113 114 EF515848.1 Table A.2: Examples of SYT polypeptide sequences and coding nucleic acid sequences: description source organism Nucleic acid SEQ ID NO: Translated Polypeptide SEQ ID NO: Database record number Arath_SYT1 Arabidopsis thaliana 120 121 AY102639.1 Arath_SYT2 Arabidopsis thaliana 122 123 AY102640.1 Arath_SYT3 Arabidopsis thaliana 124 125 AY102641.1 Allce_SYT2 Allium cepa 126 127 CF437485 Aqufo_SYT1 Aquilegia formosa x Aquilegia pubescens 128 129 DT758802.1 Aqufo_SYT2 Aquilegia Formosa x Aquilegia pubescens 130 131 TA15831_33861 8 T25K16.15 Aspof_SYT1 Aspergillus officinalis 132 133 CV287542 Betvu_SYT2 Beta vulgaris 134 135 BQ594749.1 BQ594658.1 Bradi_SYT3 Brachypodium distachyon 136 137 DV480064.1 Brana_SYT1 Brassica napus 138 139 CD823592 Brana_SYT2 Brassica napa 140 141 CN732814 Chlre_SYT Chlamydomonas reinhardtii 142 143 BQ814858, jgi_Chlre3_194013_estExt_fgenesh2_pg.C_510025 Citsi_SYT1 Citrus sinensis 144 145 CB290588 Citsi_SYT2 Citrus sinensis 146 147 CV717501 Cryja_SYT1 Cryptomeria japonica 148 149 TA3001_3369_2 Curlo_SYT2 Curcuma longa 150 151 TA2676_136217 Eupes_SYT Euphorbia esula 152 153 DV144834 Frave_SYT2 Fragaria vesca 154 155 DY668312 Glyma_SYT1.1 Glycine max 156 157 TA55102_3847 Glyma_SYT1.2 Glycine max 158 159 TA51451_3847 Glyma_SYT2.1 Glycine max 160 161 BQ612648 Glyma_SYT2.2 Glycine max 162 163 TA48452_3847 Glyso_SYT2 Glycine soya 164 165 CA799921 Gosar SYT1 Gossypium arboretum 166 167 BM359324 Goshi_SYT1 Gissypium hirsutum 168 169 DT558852 Goshi_SYT2 Gossypium hirsutum 170 171 DT563805 Helan_SYT1 Helianthus annuus 172 173 TA12738_4232 Horvu_SYT2 Hordeum vulgare 174 175 CA032350 Lacse_SYT2 Lactuca serriola 176 177 DW110765 Lyces_SYT1 Lycopersicon esculentum 178 179 AW934450.1 BP893155.1 Maldo_SYT2 Malus domestica 180 181 CV084230 DR997566 Medtr_SYT1 Medicago trunculata 182 183 CA858507.1 Medtr_SYT2 Medicago trunculata 184 185 CA858743 B1310799.1 AL382135.1 Orysa_SYT1 Oryza sativa 186 187 AK058575 Orysa_SYT2 Oryza sativa 188 189 AK105366 Orysa_SYT3 Oryza sativa 190 191 BP185008 Panvi_SYT3 Panicum virgatum 192 193 DN152517 Phypa_SYT1.1 Physcomitrella patens 194 195 TA28566_3218 Phypa_SYT1.2 Physcomitrella patens 196 197 TA21282_3218 Phypa_SYT1.3 Physcomitrella patens 198 199 TA20922_3218 Phypa_SYT1.4 Physcomitrella patens 200 201 TA29452_3218 Picsi_SYT1 Picea sitchensis 202 203 DR484100 DR478464.1 Pinta_SYT1 Pinus taeda 204 205 DT625916 Poptr_SYT1 Populus trichocarpa 206 207 DT476906 Poptr_SYT2 Populus trichocarpa 208 209 scaff_XIV.493 Poptr_SYT1.2 Populus trichocarpa 210 211 CV257942.1 Prupe_SYT2 Prunus persica 212 213 DT454880.1 Sacof_SYT1 Saccharum officinarum 214 215 Ca078249.1 CA078630 CA082679 CA234526 CA239244 CA083312 Sacof_SYT2 Saccharum officinarum 216 217 CA110367 Sacof_SYT3 Saccharum officinarum 218 219 CA161933.1 CA265085 Soltu_SYT1.1 Solanum tuberosum 220 221 CK265597 Soltu_SYT1.2 Solanum tuberosum 222 223 BG590990 Soltu SYT3 Solanum tuberosum 224 225 CK272804 Sorbi_SYT1 Sorghum bicolor 226 227 TA40712_4558 Sorbi_SYT2 Sorghum bicolor 228 229 CF482417 CW376917 Sorbi_SYT3 Sorghum bicolor 230 231 CX611128 Taxof_SYT2 Taraxacum officinale 232 233 TA1299_50225 Taxof_SYT3 Taraxacum officinale 234 235 TA5000_50225 Triae_SYT1 Triticumaestivum 236 237 TA105893_4565 Triae_SYT2 Triticur aestivum 238 239 CD901951 Triae_SYT3 Triticum aestivum 240 241 BJ246754 BJ252709 Vitvi_SYT1.1 Vitis vinifera 242 243 DV219834 Vitvi_SYT1.2 Vitis vinifera 244 245 EE108079 Vitvi_SYT2.1 Vitis vinifera 246 247 EC939550 Vitvi_SYT2.2 Vitis vinifera 248 249 EE094148.1 EC964169.1 Volca_SYT Volvox carteri 250 251 JGI_CBHO11121.fwdjGI_CBHO11121.rev Welmi_SYT Welwitschia mirabilis 252 253 DT598761 Zeama_SYT1 Zea mays 254 255 BG874129.1 CA409022.1 Zeama_SYT2 Zea mays 256 257 AY106697 Zeama_SYT3 Zea mays 258 259 CO468901 Homsa_SYT homo sapiens 260 261 CR542103

In manchen Fällen wurden verwandte Sequenzen vorläufig assembliert und von Forschungsinstituten, wie The Institute for Genomic Research (TIGR) der Öffentlichkeit bekannt gemacht. Um solche verwandten Sequenzen zu identifzieren, kann man sich der Eukaryotic Gene Orthologs (EGO) Datenbank bedienen, und zwar entweder durch Schlagwortsuche oder unter Verwendung des BLAST-Algorithmus mit der interessierenden Nukleinsäuresequenz- oder Polypeptidsequenz. In anderen Fällen wurden spezielle Nukleinsäuresequenz-Datenbanken für bestimmte Organismen geschaffen, wie zum Beispiel von Joint Genome Institute zum Beispiel für die Pappel und für Ostreococcus tauri.In some cases, related sequences have been preliminarily assembled and made public by research institutes such as The Institute for Genomic Research (TIGR). In order to identify such related sequences, one may use the Eukaryotic Gene Orthologs (EGO) database, either by keyword search or using the BLAST algorithm with the nucleic acid sequence or polypeptide sequence of interest. In other cases, specific nucleic acid sequence databases have been created for particular organisms, such as Joint Genome Institute for example for the poplar and for Ostreococcus tauri.

Bespiel 2: Alignment von Polypeptidsequenzen, die für die Durchführung der erfindungsgemäßen Verfahren nützlich sindExample 2: Alignment of polypeptide sequences useful for performing the methods of the invention

Alignment von GRF-PolypeptidsequenzenAlignment of GRF polypeptide sequences

Unter Verwendung des AlignX-Algorithmus (von Vector NTI 10.3, Invitrogen Corporation) wurde ein multiples Sequenz-Alignment von allen GRF-Polypeptidsequenzen in Tabelle A.1 durchgeführt. Die Ergebnisse des Alignment für die QLQ-Domäne der GRF-Polypeptide aus Tabelle A.1 (gemäß SEQ ID NO: 115 für SEQ ID NO: 2) sind in der vorliegenden Anmeldung dargestellt. Die konservierten QLQ-Aminosäurereste befinden sich oben in dem multiplen Alignment. Zwei weitere sehr stark konservierte Reste (schwarz hinterlegt) sind E (Glu) und P (Pro). Die Ergebnisse des Alignment für die WRC-Domäne der GRF-Polypeptide aus Tabelle A.1 (gemäß SEQ ID NO: 116 für SEQ ID NO: 2) sind in der vorliegenden Anmeldung dargestellt. Die konservierten WRC-Aminosäurereste sind in der Konsensus-Sequenz fett gedruckt. Die drei Cys-Reste und einen His-Rest in einer konservierten Beabstandung (CX₉CX₁₀CX₂H) umfassende „Effector of Transcription”(ET)-Domäne ist im Alignment unten identifiziert.Using the AlignX algorithm (from Vector NTI 10.3, Invitrogen Corporation), a multiple sequence alignment of all GRF polypeptide sequences was performed in Table A.1. The results of the alignment for the QLQ domain of the GRF polypeptides from Table A.1 (according to SEQ ID NO: 115 for SEQ ID NO: 2) are in represented in the present application. The conserved QLQ amino acid residues are at the top of the multiple alignment. Two other highly conserved residues (highlighted in black) are E (Glu) and P (Pro). The results of the alignment for the WRC domain of the GRF polypeptides from Table A.1 (according to SEQ ID NO: 116 for SEQ ID NO: 2) are in represented in the present application. The conserved WRC amino acid residues are shown in bold in the consensus sequence. The three Cys residues and a His residue in a conserved spacing (CX ₉ CX ₁₀ CX ₂ H) "Effector of Transcription" (ET) domain are identified below.

Alignment von SYT-PolypeptidsequenzenAlignment of SYT polypeptide sequences

Ein multiples Sequenz-Alignment von allen SYT-Polypeptidsequenzen in Tabelle A.2 wurde unter Verwendung des AlignX-Algorithmus (der auf einem modifizierten ClustalW-Algorithmus beruht; von Vector NTI 10.3, Invitrogen Corporation) durchgeführt, und zwar mit den Default-Einstellungen „Gap Opening Penalty” 10 und „Gap Extension” 0,05 und ist in dargestellt. Die zwei Hauptdomänen vom N-terminalen Ende Richtung C-terminales Ende sind eingerahmt und als SNH-Domäne und Met-reiche/QG-reiche Domäne identifiziert. Außerdem ist die N-terminale Met-reiche Domäne ebenfalls eingerahmt.A multiple sequence alignment of all SYT polypeptide sequences in Table A.2 was performed using the AlignX algorithm (based on a modified ClustalW algorithm, from Vector NTI 10.3, Invitrogen Corporation) with the default settings. " Gap Opening Penalty "10 and" Gap Extension "0.05 and is in shown. The two main domains from the N-terminal end towards the C-terminal end are boxed and identified as SNH domain and Met rich / QG rich domain. In addition, the N-terminal Met-rich domain is also boxed.

Die Ergebnisse des Alignment für die SNH-Domäne der SYT-Polypeptide aus der Tabelle A.2 (gemäß SEQ ID NO: 115 für SEQ ID NO: 2) sind in der vorliegenden Anmeldung dargestellt. Die am stärksten konservierten Aminosäurereste innerhalb der SNH-Domäne gemäß SEQ ID NO: 263 sind schwarz hinterlegt. The results of the alignment for the SNH domain of the SYT polypeptides from Table A.2 (according to SEQ ID NO: 115 for SEQ ID NO: 2) are in represented in the present application. The most conserved amino acid residues within the SNH domain according to SEQ ID NO: 263 are highlighted in black.

Beispiel 3: Berechnung des Gesamtidentitätsprozentsatzes zwischen Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sindExample 3: Calculation of the total identity percentage between polypeptide sequences useful in performing the methods of the invention

Die Prozentsätze für Gesamtähnlichkeit und -identität zwischen Volllängenpolypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, wurden unter Verwendung von einer der in der Fachwelt verfügbaren Techniken, nämlich der MatGAT (Matrix Global Alignment Tool) Software ( BMC Bioinformatics. 2003, 4: 29. MatGAT: an application that generstes similarity/identity matrices using Protein or DNA sequences. Campanella JJ, Bitincka L, Smalley J ; die Software wird von Ledion Bitincka gehustet) bestimmt. Die MatGAT-Software erzeugt Ähnlichkeits-/Identitätsmatrices für DNA- oder Proteinsequenzen, ohne dass ein vorheriges Alignment der Daten erforderlich ist. Das Programm führt eine Reihe von paarweisen Alignments unter Verwendung des globalen Alignment-Algorithmus von Myers und Miller durch (gap opening Penalty 12, gap extension Penalty 2), berechnet die Ähnlichkeit und Identität unter Verwendung von z. B. Blosum 62 (für Polypeptide) und platziert dann die Ergebnisse in einer Abstandsmatrix. Die Sequenzähnlichkeit ist in der unteren Hälfte der Trennlinie und die Sequenzidentität in der oberen Hälfte der diagonalen Trennlinie dargestellt.The percentages of overall similarity and identity between full length polypeptide sequences useful in practicing the methods of the present invention were determined using any of the techniques available in the art, namely, MatGAT (Matrix Global Alignment Tool) software (US Pat. BMC Bioinformatics. 2003, 4: 29. MatGAT: an application that generates the most similarity / identity matrices using protein or DNA sequences. Campanella JJ, Bitincka L, Smalley J ; the software is coughed by Ledion Bitincka). The MatGAT software generates similarity / identity matrices for DNA or protein sequences without requiring prior alignment of the data. The program performs a series of pair alignments using the global alignment algorithm of Myers and Miller (gap opening penalty 12, gap extension penalty 2), calculates the similarity and identity using e.g. B. Blosum 62 (for polypeptides) and then place the results in a distance matrix. The sequence similarity is shown in the lower half of the dividing line and the sequence identity in the upper half of the diagonal dividing line.

Bei den in dem Vergleich eingesetzten Parametern handelte es sich um:
Scoring matrix: Blosum62
First Gap: 12
Extending gap: 2The parameters used in the comparison were:
Scoring matrix: Blosum62
First Gap: 12
Extending gap: 2

Die Ergebnisse der Software-Analyse sind in Tabelle B.1 für die globale Ähnlichkeit und Identität über die volle Länge der GRF-Polypeptidsequenzen (ausschließlich der Polypeptid-Partialsequenzen) und in Tabelle B.2 für die globale Ähnlichkeit und Identität über die volle Länge der SYT-Polypeptidsequenzen dargestellt.The results of the software analysis are shown in Table B.1 for the global similarity and identity over the full length of the GRF polypeptide sequences (excluding the polypeptide partial sequences) and in Table B.2 for the full length global similarity and identity SYT polypeptide sequences shown.

Der Prozentsatz der Identität zwischen den Volllängen-GRF-Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, kann nur 15% Aminosäureidentität im Vergleich zu SEQ ID NO: 2 betragen.The percentage of identity between the full-length GRF polypeptide sequences useful in practicing the methods of the invention may be only 15% amino acid identity compared to SEQ ID NO: 2.

Der Prozentsatz der Identität kann wesentlich gesteigert werden, wenn die Identitätsberechnung zwischen der QLQ-Domäne SEQ ID NO: 2 (gemäß SEQ ID NO: 115 innerhalb SEQ ID NO: 2; QLQ-Domäne der GRF-Polypeptide von Tabelle A.1 gemäß ) und den QLQ-Domänen der Polypeptide, die bei der Durchführung der Erfindung nützlich sind, durchgeführt wird. Auf ähnliche Art und Weise kann der Prozentsatz der Identität wesentlich gesteigert werden, wenn die Identitätsberechnung zwischen der WRC-Domäne SEQ ID NO: 2 (gemäß SEQ ID NO: 116 innerhalb SEQ ID NO: 2; WRC-Domäne der GRF-Polypeptide von Tabelle A.1 gemäß ) und den WRC-Domänen der Polypeptide, die bei der Durchführung der Erfindung nützlich sind, durchgeführt wird. Der Prozentsatz der Identität über die QLQ-Domäne liegt bei den Polypeptidsequenzen, die für die Durchführung der erfindungsgemäßen Verfahren nützlich sind, zwischen 25% und 99% Aminosäureidentität, und der Prozentsatz der Identität über die WRC-Domäne beträgt bei den Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, zwischen 60% und 99% Aminosäureidentität. Auch ist, wie aus hervorgeht, die WRC-Domäne bei den unterschiedlichen GRF-Polypeptiden besser konserviert als die QLQ-Domäne, siehe .The percentage of identity can be significantly increased if the identity calculation between the QLQ domain SEQ ID NO: 2 (according to SEQ ID NO: 115 within SEQ ID NO: 2; QLQ domain of the GRF polypeptides of Table A.1 according to ) and the QLQ domains of the polypeptides useful in the practice of the invention. Similarly, if the identity computation between the WRC domain SEQ ID NO: 2 (SEQ ID NO: 116 within SEQ ID NO: 2; WRC domain of GRF polypeptides of Table A.1 according to ) and the WRC domains of the polypeptides useful in the practice of the invention. The percentage of identity across the QLQ domain is between 25% and 99% amino acid identity for the polypeptide sequences useful in practicing the methods of the invention, and the percentage of identity across the WRC domain for the polypeptide sequences used in the Implementation of the methods of the invention are useful, between 60% and 99% amino acid identity. Also, how is out shows that the WRC domain is more conserved among the different GRF polypeptides than the QLQ domain, see ,

Die Prozentsätze der Aminosäureidentität zwischen den QLQ-Domänen und der Prozentsatz der Identität zwischen den WRC-Domänen sind signifikant höher als der berechnete Prozentsatz Aminosäureidentität zwischen den Volllängen-GRF-Polypeptidsequenzen.The percentages of amino acid identity between the QLQ domains and the percent identity between the WRC domains are significantly higher than the calculated percent amino acid identity between the full-length GRF polypeptide sequences.

Die prozentuale Identität zwischen den bei der Durchführung der erfindungsgemäßen Verfahren geeigneten Volllängen-SYT-Polypeptidsequenzen kann so wenig wie 25% Aminosäureidentität im Vergleich zu der Polypeptidsequenz der SEQ ID NO: 121 betragen (siehe Tabelle B.2 und ).The percent identity between the full length SYT polypeptide sequences useful in performing the methods of the invention may be as little as 25% amino acid identity as compared to the polypeptide sequence of SEQ ID NO: 121 (see Table B.2 and FIG ).

Die prozentuale Identität kann wesentlich höher liegen, wenn die Identitätsberechnung zwischen der SNH-Domäne, wie sie durch die SEQ ID NO: 262 (enthalten in SEQ ID NO: 121) repräsentiert ist, und den SNH-Domänen der bei der Durchführung der Erfindung geeigneten Polypeptide vorgenommen wird. Die prozentuale Identität über die SNH-Domäne liegt unter den bei der Durchführung der erfindungsgemäßen Verfahren geeigneten Polypeptidsequenzen zwischen 30% und 99% Aminosäureidentität. The percent identity may be significantly higher if the identity calculation between the SNH domain as represented by SEQ ID NO: 262 (contained in SEQ ID NO: 121) and the SNH domains of those useful in the practice of the invention Polypeptides is made. Percent identity across the SNH domain is between 30% and 99% amino acid identity among the polypeptide sequences useful in performing the methods of the invention.

Die Prozentwerte der Aminosäureidentität zwischen der SNH-Domäne der Polypeptide von Tabelle A.2 liegen deutlich höher als die zwischen den Volllängen-SYT-Polypeptidsequenzen berechnete Aminosäureidentität.The percent amino acid identity between the SNH domain of the polypeptides of Table A.2 are significantly higher than the amino acid identity calculated between the full length SYT polypeptide sequences.

Beispiel 4: Identifikation von Domänen in Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sindExample 4: Identification of domains in polypeptide sequences useful in performing the methods of the invention

Bei der Integrated Resource of Protein Families, Domains and Sites (InterPro) Datenbank handelt es sich um eine integrierte Plattform für die häufig verwendeten Signatur-Datenbanken für Suchen auf Text- und Sequenzbasis. Die InterPro-Datenbank kombiniert diese Datenbanken, die unterschiedliche Methodiken und verschiedene Mengen an biologischer Information über gut charakterisierte Proteine verwenden, um Proteinsignaturen abzuleiten. Zu den angeschlossenen Datenbanken zählen SWISS-PROT, PROSITS, TrEMBL, PRINTS, ProDom und Pfam, Smart und TIGRFAMs. InterPro wird von dem European Bioinformatics Institute in Großbritannien gehostet.The Integrated Resource of Families, Domains and Sites (InterPro) database is an integrated platform for the commonly used signature databases for text- and sequence-based searches. The InterPro database combines these databases, which use different methodologies and different amounts of biological information about well-characterized proteins to derive protein signatures. The databases include SWISS-PROT, PROSITS, TrEMBL, PRINTS, ProDom and Pfam, Smart and TIGRFAMs. InterPro is hosted by the European Bioinformatics Institute in the UK.

Die Ergebnisse des InterPro-Scanning der Polypeptidsequenz gemäß SEQ ID NO: 2 sind in Tabelle C.1 dargestellt. Tabelle C.1: InterPro-Scanning-Ergebnisse der Polypeptidsequenz gemäß SEQ ID NO: 2 InterPro-Eintragsnummer und -Bezeichnung Bezeichnung in der integrierten Datenbank Eintragsnummer in der integrierten Datenbank Eintragsnummer in der integrierten Datenbank IPR014977 WRC-Domäne PFAM PF08879 WRC IPR014978 QLQ-Domäne PFAM PF08880 QLQ The results of the InterPro scanning of the polypeptide sequence according to SEQ ID NO: 2 are shown in Table C.1. Table C.1: InterPro scanning results of the polypeptide sequence according to SEQ ID NO: 2 InterPro entry number and designation Name in the integrated database Entry number in the integrated database Entry number in the integrated database IPR014977 WRC domain PFAM PF08879 WRC IPR014978 QLQ domain PFAM PF08880 QLQ

Die Ergebnisse des InterPro-Scanning der Polypeptidsequenz gemäß SEQ ID NO: 121 sind in Tabelle C.2 dargestellt. Tabelle C.2: InterPro-Scanning-Ergebnisse der Polypeptidsequenz gemäß SEQ ID NO: 2 InterPro-Eintragsnummer und -Bezeichnung Bezeichnung in der integrierten Datenbank Eintragsnummer in der integrierten Datenbank Eintragsnummer in der integrierten Datenbank IPR007726 SSXT-Domäne/Familie PFAM PF05030 SSXT-Protein (N-terminale Region) IPR007726 SSXT-Domäne/-Familie Panther PTHR23107 SYNOVIAL-SARCOMA-ASSOCIATED-SS18-PROTEIN The results of the InterPro scanning of the polypeptide sequence according to SEQ ID NO: 121 are shown in Table C.2. Table C.2: InterPro scanning results of the polypeptide sequence according to SEQ ID NO: 2 InterPro entry number and designation Name in the integrated database Entry number in the integrated database Entry number in the integrated database IPR007726 SSXT domain / family PFAM PF05030 SSXT protein (N-terminal region) IPR007726 SSXT domain / family panther PTHR23107 Synovial sarcoma ASSOCIATED-SS18 PROTEIN

Außerdem kann das Vorliegen einer Met-reichen Domäne oder einer QG-reichen Domäne in den SYT-Polypeptidsequenzen ebenfalls leicht nachgewiesen werden. Wie in dargestellt folgt die Met-reiche Domäne und die QG-reiche Domäne auf die SNH-Domäne. Die QG-reiche Domäne kann im Wesentlichen als der C-terminale Rest des Polypeptids (minus der SHN-Domäne) bezeichnet werden; die Met-reiche Domäne liegt typischerweise innerhalb der ersten Hälfte der QG-reichen Domäne (vom N-Terminus in Richtung C-Terminus). Die primäre Aminosäurezusammensetzung (in %) für die Bestimmung, ob eine Polypeptiddomäne reich an spezifischen Aminosäuren ist, kann unter Verwendung von Software-Programmen des ExPASy-Servers ( Gasteiger E et al. (2003) ExPASy: the proteomics server for in-depth Protein knowledge and analysis. Nucleic Acids Res. 31: 3784–3788 ), insbesondere des ProtParam-Programms, berechnet werden. Die Zusammensetzung des interessierenden Polypeptids kann dann mit der durchschnittlichen Aminosäurezusammensetzung (in %) in der Datenbank Swiss-Prot Protein Sequence verglichen werden (Tabelle C.3). Innerhalb dieser Datenbank ist der durchschnittliche Met(M)-Gehalt 2,37%, der durchschnittliche Gln(Q)-Gehalt 3,93% und der durchschnittliche Gly(G)-Gehalt 6,93% (Tabelle C.3). Im vorliegenden Zusammenhang wird eine Met-reiche Domäne oder eine QG-reiche Domäne als eine Domäne mit einem Met-Gehalt (in %) bzw. einem Gln- und Gly-Gehalt (in %) oberhalb der durchschnittlichen Aminosäurezusammensetzung (in %) der Datenbank Swiss-Prot Protein Sequence definiert. So weist zum Beispiel in SEQ ID NO: 121 die Met-reiche Domäne am N-terminalen Ende vor der SNH-Domäne (von Aminosäureposition 1 bis Aminosäureposition 24) einen Met-Gehalt von 20,8% auf, und eine QG-reiche Domäne (von Aminosäureposition 71 bis Aminosäureposition 200) weist einen Gln(Q)-Gehalt von 18,6% und einen Gly(G)-Gehalt von 21,4% auf. Vorzugsweise weist die Met-Domäne wie im vorliegenden Zusammenhang definiert einen Met-Gehalt (in %) auf, der mindestens 1,25, 1,5, 1,75, 2,0, 2,25, 2,5, 2,75, 3,0, 3,25, 3,5, 3,75, 4,0, 4,25, 4,5, 4,75, 5,0, 5,25, 5,0, 5,75, 6,0, 6,25, 6,5, 6,75, 7,0, 7,25, 7,5, 7,75, 8,0, 8,25, 8,5, 8,75, 9,0, 9,25, 9,5, 9,75, 10 oder mehr wie die durchschnittliche Aminosäurezusammensetzung (in %) dieser Art von Proteinsequenzen, die in der Datenbank Swiss-Prot Protein Sequence vorliegen, beträgt. Vorzugsweise weist die QG-reiche Domäne wie im vorliegenden Zusammenhang definiert einen Gln(Q)-Gehalt und/oder einen Gly(G)-Gehalt auf, der mindestens 1,25, 1,5, 1,75, 2,0, 2,25, 2,5, 2,75, 3,0, 3,25, 3,5, 3,75, 4,0, 4,25, 4,5, 4,75, 5,0, 5,25, 5,0, 5,75, 6,0, 6,25, 6,5, 6,75, 7,0, 7,25, 7,5, 7,75, 8,0, 8,25, 8,5, 8,75, 9,0, 9,25, 9,5, 9,75, 10 oder mehr wie die durchschnittliche Aminosäurezusammensetzung (in %) dieser Art von Proteinsequenzen, die in der Datenbank Swiss-Prot Protein Sequence vorliegen, beträgt. Tabelle C.3: Mittlere Aminosäurezusammensetzung (%) der Proteine in der Datenbank SWISS PROT Protein Sequence (Juli 2004): Rest % Rest % A = Ala 7,80 M = Met 2,37 C = Cys 1,57 N = Asn 4,22 D = Asp 5,30 P = Pro 4,85 E = Glu 6,59 Q = Gin 3,93 F = Phe 4,02 R = Arg 5,29 G = Gly 6,93 S = Ser 6,89 H = His 2,27 T = Thr 5,46 I = Ile 5,91 V = Val 6,69 K = Lys 5,93 W = Trp 1,16 L = Leu 9,62 Y = Tyr 3,09 In addition, the presence of a Met-rich domain or a QG-rich domain in the SYT polypeptide sequences can also be easily detected. As in As shown, the Met-rich domain and the QG-rich domain follow the SNH domain. The QG-rich domain may be referred to essentially as the C-terminal residue of the polypeptide (minus the SHN domain); the Met-rich domain is typically within the first half of the QG-rich domain (from the N-terminus toward the C-terminus). The primary amino acid composition (in%) for determining whether a polypeptide domain is rich in specific amino acids can be determined using software programs of the ExPASy server ( Gasteiger E et al. (2003) ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 31: 3784-3788 ), in particular the ProtParam program. The composition of the polypeptide of interest can then be compared with the average amino acid composition (in%) in the Swiss-Prot Protein Sequence database (Table C.3). Within this database the average Met (M) content is 2.37%, the average Gln (Q) content 3.93% and the average Gly (G) content 6.93% (Table C.3). As used herein, a Met-rich domain or a QG-rich domain is defined as a domain having a Met content (in%) and a Gln and Gly content (in%), respectively, above the average amino acid composition (%) of the database Swiss-Prot protein sequence defined. For example, in SEQ ID NO: 121, the Met-rich domain at the N-terminal end in front of the SNH domain (from amino acid position 1 to amino acid position 24) has a Met content of 20.8%, and a QG-rich domain (from amino acid position 71 to amino acid position 200) has a Gln (Q) content of 18.6% and a Gly (G) content of 21.4%. Preferably, as defined herein, the Met domain has a Met content (in%) that is at least 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 , 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, 5.0, 5.25, 5.0, 5.75, 6 , 0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8.5, 8.75, 9.0 , 9.25, 9.5, 9.75, 10 or more, such as the average amino acid composition (in%) of this type of protein sequences present in the Swiss-Prot Protein Sequence database. Preferably, as defined herein, the QG-rich domain has a Gln (Q) content and / or a Gly (G) content of at least 1.25, 1.5, 1.75, 2.0, 2 , 25, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, 5.0, 5.25 , 5.0, 5.75, 6.0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8 , 5, 8.75, 9.0, 9.25, 9.5, 9.75, 10 or more such as the average amino acid composition (in%) of this type of protein sequences present in the Swiss-Prot Protein Sequence database, is. Table C.3: Mean amino acid composition (%) of the proteins in the database SWISS PROT Protein Sequence (July 2004): rest % rest % A = Ala 7.80 M = Met 2.37 C = Cys 1.57 N = Asn 4.22 D = Asp 5.30 P = Pro 4.85 E = Glu 6.59 Q = Gin 3.93 F = Phe 4.02 R = Arg 5.29 G = Gly 6.93 S = Ser 6.89 H = His 2.27 T = Thr 5.46 I = Ile 5.91 V = Val 6.69 K = Lys 5.93 W = Trp 1.16 L = Leu 9.62 Y = Tyr 3.09

Beispiel 5: Vorhersage der Lokalisierung der GRF-Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind, innerhalb der ZelleExample 5: Prediction of Localization of GRF Polypeptide Sequences Useful in Performing the Methods of the Invention Within the Cell

Experimentelle Methoden für die Lokalisierung von Proteinen reichen von der Immunlokalisierung bis zum Tagging von Proteinen mit Green Fluorescent Protein (GFP) oder beta-Glucuronidase (GUS). So wurde zum Beispiel ein GRF-Polypeptid in Fusion mit einem GUS-Reportergen eingesetzt, um Zwiebelepidermiszellen transient zu transformieren ( van der Knapp et al. (2000) Plant Phys. 122: 695–704 ). Als Kompartiment des GRF-Polypeptids innerhalb der Zelle wurde der Zellkern identifiziert. Solche Verfahren zum Identifizieren der Kompartimentalisierung von GRF-Polypeptiden innerhalb der Zelle sind in der Fachwelt gut bekannt.Experimental methods for the localization of proteins range from immunolocalization to tagging of proteins with Green Fluorescent Protein (GFP) or beta-glucuronidase (GUS). For example, a GRF polypeptide has been used in fusion with a GUS reporter gene to transiently transform onion epidermal cells ( van der Knapp et al. (2000) Plant Phys. 122: 695-704 ). As a compartment of the GRF polypeptide within the cell, the nucleus was identified. Such methods for identifying the compartmentalization of GRF polypeptides within the cell are well known in the art.

Durch multiples Sequenz-Alignment und anschließende visuelle Betrachtung wurde ein vorhergesagtes Kernlokalisierungssignal (NLS) in der WRC-Domäne (CRRTDGKKWRC) des GRF-Polypeptids von Tabelle A gefunden. Bei einem NLS handelt es sich um eine oder mehrere kurze Sequenz(en) von positiv geladenen Lysin- oder Argininresten.By multiple sequence alignment and subsequent visual inspection, a predicted nuclear localization signal (NLS) was found in the WRC domain (C RR TDG KK WRC) of the GRF polypeptide of Table A. An NLS is one or more short sequence (s) of positively charged lysine or arginine residues.

Es wurde eine computergestützte Vorhersage der Lokalisierung von Proteinen aus Sequenzdaten durchgeführt. Zu den Algorithmen, mit denen der Fachmann gut vertraut ist und die am ExPASy Proteomics-Server, das vom Swiss Institute for Bioinformatics gehostet wird, verfügbar sind, zählen zum Beispiel PSort, TargetP, ChloroP, LocTree, Predotar, LipoP, MITOPROT, PATS, PTS1, Signale sowie andere.A computerized prediction of the localization of proteins from sequence data was performed. Algorithms that are well known to those skilled in the art and are available on the ExPASy Proteomics server hosted by the Swiss Institute for Bioinformatics include, for example, PSort, TargetP, ChloroP, LocTree, Predotar, LipoP, MITOPROT, PATS, PTS1, signals and others.

Bei LOCtree handelt es sich um einen Algorithmus, mit dem die Lokalisierung und DNA-Bindungsneigung von Nichtmembranproteinen in nichtpflanzlichen und pflanzlichen Eukaryonten sowie in Prokaryonten innerhalb der Zelle vorhergesagt werden kann. LOCtree teilt eukaryontische tierische Proteine in eine von fünf subzellulären Klassen ein, während pflanzliche Proteine in eine von sechs Klassen und prokaryontische Proteine in eine von drei Klassen eingeteilt werden. In Tabelle D unten wird der Output von LOCtree unter Verwendung der Polypeptidsequenzinformation gemäß SEQ ID NO: 2 dargestellt. Vorhersagen mit hoher Konfidenz weisen einen Verlässlichkeitsindex von mehr als 5 auf. Tabelle D: Output von LOCtree unter Verwendung der Polypeptidsequenzinformation von SEQ ID NO: 2 Vorhergesagte Lokalisierung Verlässlichkeitsindex Lokalisierungszwischenvorhersage (Output von unterschiedlichen SVM in hierarchischen Baumstrukturen) Verlässlichkeitsindex DNA-Bindung 6 Nicht sezerniert, Zellkern, DNA-Bindung 8, 6, 9 LOCtree is an algorithm that can be used to predict the localization and DNA binding propensity of non-membrane proteins in non-plant and plant eukaryotes as well as in prokaryotes within the cell. LOCtree divides eukaryotic animal proteins into one out of five subcellular classes, while plant proteins fall into one of six classes and prokaryotic proteins into one of three classes. In Table D below, the output of LOCtree is shown using the polypeptide sequence information shown in SEQ ID NO: 2. High confidence forecasts have a reliability index of more than 5. Table D: Output of LOCtree using the polypeptide sequence information of SEQ ID NO: 2 Predicted localization reliability Index Localization intermediate prediction (output of different SVM in hierarchical tree structures) reliability Index DNA binding 6 Not secreted, nucleus, DNA binding 8, 6, 9

Das vorhergesagte subzelluläre Kompartiment des GRF-Polypeptids gemäß SEQ ID NO: 2 unter Verwendung des LOCtree-Algorithmus ist der Zellkern.The predicted subcellular compartment of the GRF polypeptide of SEQ ID NO: 2 using the LOCtree algorithm is the nucleus.

Beispiel 6: Assay der Polypeptidsequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sindExample 6: Assay of polypeptide sequences useful in performing the methods of the invention

Die GRF-Polypeptide und SYT-Polypeptide, die bei den erfindungsgemäßen Verfahren nützlich sind (zumindest in ihrer nativen Form) weisen typischerweise, jedoch nicht zwingend, Transkriptionsregulationsaktivität sowie die Fähigkeit, mit anderen Proteinen zu interagieren, auf. Die DNA-Bindungsaktivität und die Protein-Protein-Interaktionen können leicht in vitro oder in vivo unter Verwendung von fachbekannten Techniken bestimmt werden (zum Beispiel in Current Protocols in Molecular Biology, Band 1 und 2, Ausubel et al. (1994), Current Protocols ). Die GRF-Polypeptide sind zur transkriptionellen Aktivierung von Reportergenen in Hefezellen befähigt ( Kim & Kende (2004) Proc. Natl. Acad. Sci. 101(36): 13374–13379 ). Die GRF-Polypeptide sind auch zur in-vivo-Interaktion mit SYT-Polypeptiden (auch GRF Interacting Factor oder GIF genannt) in Hefezellen befähigt, und zwar unter Verwendung eines Hefe-zwei-Hybrid-Protein-Protein-Interaktions-Assays (Kim & Kende, oben). In-vitro-Bindungsassays werden auch verwendet, um nachzuweisen, dass es sich bei den GRF-Polypeptiden und SYT-Polypeptiden um interagierende Partner handelt (Kim & Kende, oben). Die in dieser Veröffentlichung beschriebenen Versuche eignen sich für die Charakterisierung von GRF-Polypeptiden und SYT-Polypeptiden und sind in der Fachwelt gut bekannt.The GRF polypeptides and SYT polypeptides useful in the methods of the invention (at least in their native form) typically, but not necessarily, have transcriptional regulatory activity as well as the ability to interact with other proteins. DNA binding activity and protein-protein interactions can be readily determined in vitro or in vivo using art-known techniques (for example, in U.S. Pat Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel et al. (1994), Current Protocols ). The GRF polypeptides are capable of transcriptional activation of reporter genes in yeast cells ( Kim & Kende (2004) Proc. Natl. Acad. Sci. 101 (36): 13374-13379 ). The GRF polypeptides are also capable of interacting in vivo with SYT polypeptides (also called GRF Interacting Factor or GIF) in yeast cells using a yeast two-hybrid protein-protein interaction assay (Kim & Kende, above). In vitro binding assays are also used to demonstrate that the GRF polypeptides and SYT polypeptides are interacting partners (Kim & Kende, supra). The experiments described in this publication are useful for the characterization of GRF polypeptides and SYT polypeptides and are well known in the art.

Beispiel 7: Klonierung von Nukleinsäuresequenzen, die bei der Durchführung der erfindungsgemäßen Verfahren nützlich sind:Example 7 Cloning of Nucleic Acid Sequences Useful in Carrying Out the Methods of the Invention

Falls nicht anders erwähnt werden die DNA-Rekombinationstechniken nach Standardprotokollen durchgeführt, die bei Sambrook (2001) Molecular Cloning: a laboratory manual, 3. Ausgabe Cold Spring Harbor Laborstory Press, CSH, New York oder in Band 1 und 2 von Ausubel et al. (1994), Current Protocols in Molecular Biology , Current Protocols beschrieben sind. Standardmäßige Materialien und Methoden für pflanzenmolekulare Arbeiten sind in Plant Molecular Biology Labfax (1993) von R. D. D. Croy, herausgegeben von BIOS Scientific Publications Ltd (GB) und Blackwell Scientific Publications (GB) beschrieben.Unless otherwise stated, recombinant DNA techniques are performed according to standard protocols used in Sambrook (2001) Molecular Cloning: a laboratory manual, 3rd Edition Cold Spring Harbor Laboratory Press, CSH, New York or in Volumes 1 and 2 of Ausubel et al. (1994), Current Protocols in Molecular Biology , Current Protocols are described. Standard materials and methods for plant molecular work are in Plant Molecular Biology Labfax (1993) by RDD Croy, published by BIOS Scientific Publications Ltd (GB) and Blackwell Scientific Publications (GB) described.

Klonieren einer Nukleinsäuresequenz gemäß SEQ ID NO: 1Cloning of a nucleic acid sequence according to SEQ ID NO: 1

Die Arabidopsis-thaliana-cDNA, die für die GRF-Polypeptidsequenz gemäß SEQ ID NO: 2 kodiert, wurde mittels PCR amplifiziert, und zwar unter Verwendung einer Arabidopsis-cDNA-Bibliothek, welche aus mRNA, die aus einer Pflanzengewebemischung extrahiert worden war, synthetisiert wurde. Primer prm08136 SEQ ID NO: 42;;: 5'-ggggaccactttgtacaagaaagctgggttaaaaaccattttaacgcacg). Für die PCR-Amplifizierung wurden die folgenden Primer verwendet, die die AttB-Stellen für die Gateway-Rekombination beinhalten:

• 1) Prm 10010 (SEQ ID NO: 118, sense):
  
• 2) Prm 10011 (SEQ ID NO: 119, reverse, komplementär):
  

• 1) Prm 10010 (SEQ ID NO: 118, sense):
  
• 2) Prm 10011 (SEQ ID NO: 119, reverse, complementary):
  

Klonieren einer Nukleinsäuresequenz gemäß SEQ ID NO: 120 Cloning of a nucleic acid sequence according to SEQ ID NO: 120

Die Arabidopsis-thaliana-cDNA, die für die SYT-Polypeptidsequenz gemäß SEQ ID NO: 121 kodiert, wurde mittels PCR amplifiziert, und zwar unter Verwendung einer Arabidopsis-cDNA-Bibliothek, welche aus mRNA, die aus einer Pflanzengewebemischung extrahiert worden war, synthetisiert wurde. Für die PCR-Amplifizierung wurden die folgenden Primer verwendet, die die AttB-Stellen für die Gateway-Rekombination beinhalten:

• 1) Prm06681 (SEQ ID NO: 265, sense):
  
• 2) Prm 06682 (SEQ ID NO: 266, reverse, komplementär):
  

• 1) Prm06681 (SEQ ID NO: 265, sense):
  
• 2) Prm 06682 (SEQ ID NO: 266, reverse, complementary):
  

Für SEQ ID NO: 1 und SEQ ID NO: 120 wurden unabhängig PCR-Reaktionen durchgeführt, und zwar unter Verwendung der Hifi-Tag-DNA-Polymerase unter Standardbedingungen. Ein PCR-Fragment mit der erwarteten Länge (einschließlich der attB-Stellen) wurde amplifiziert und aufgereinigt, ebenfalls unter Verwendung von Standardmethoden. Anschließend wurde der erste Schritt der Gateway-Vorgehensweise, die Bp-Reaktion, durchgeführt, während der das PCR-Fragment in vivo mit dem Plasmid pDONR201 unter Bildung – gemäß Gateway-Terminologie – eines „entry clone, rekombinierte. Das Plasmid pDONR201 wurde käuflich von Invitrogen als Bestandteil der Gateway^® Technik erworben.For SEQ ID NO: 1 and SEQ ID NO: 120, independent PCR reactions were performed using hi-fi tag DNA polymerase under standard conditions. A PCR fragment of the expected length (including the attB sites) was amplified and purified, also using standard methods. Subsequently, the first step of the Gateway procedure, the Bp reaction, was performed while recombining the PCR fragment in vivo with the plasmid pDONR201 to form - according to Gateway terminology - an "entry clone". Plasmid pDONR201 was purchased from Invitrogen, as part of the Gateway ^® technology.

Beispiel 8: Expressionsvektorkonstruktion unter Verwendung der Nukleinsäuresequenzen gemäß SEQ ID NO: 1 und SEQ ID NO: 120Example 8: Expression Vector Construction Using the Nucleic Acid Sequences of SEQ ID NO: 1 and SEQ ID NO: 120

Die „entry clones” unabhängig umfassend SEQ ID NO: 1 und SEQ ID NO: 120 wurden unabhängig anschließend in einer LR-Reaktion mit einem Zielvektor für die Transformation von Oryza sativa eingesetzt. Dieser Vektor enthielt als funktionale Elemente innerhalb der T-DNA-Borders Folgendes: einen pflanzlichen Selektionsmarker; eine visuelle Markerexpressionskassette; sowie eine Gateway-Kassette für die LR-in-vivo-Rekombination, wobei die interessierende Nukleinsäuresequenz bereits in den „entry clone” kloniert war. Ein Reis-GOS2-Promoter (SEQ ID NO: 117) für die konstitutive Expression befand sich stromaufwärts von dieser Gateway-Kassette.The entry clones independently comprising SEQ ID NO: 1 and SEQ ID NO: 120 were independently used subsequently in an LR reaction with a target vector for the transformation of Oryza sativa. This vector contained as functional elements within the T-DNA Borders: a plant selection marker; a visual marker expression cassette; and a Gateway cassette for LR in vivo recombination, wherein the nucleic acid sequence of interest was already cloned in the entry clone. A rice GOS2 promoter (SEQ ID NO: 117) for constitutive expression was upstream of this Gateway cassette.

Nach dem LR-Rekombinationsschritt wurden die erhaltenen Expressionsvektoren pGOS2::GRF und pGOS2::SYT ( ) nach fachbekannten Techniken unabhängig in den Agrobacterium-Stamm LBA4404 transformiert.After the LR recombination step, the resulting expression vectors pGOS2 :: GRF and pGOS2 :: SYT ( ) transformed independently into the Agrobacterium strain LBA4404 according to art-known techniques.

Beispiel 9: PflanzentransformationExample 9: Plant transformation

Reistransformationrice transformation

Mit dem Agrobacterium, das den Expressionsvektor pGOS2:: SYT enthielt, wurden Oryza-sativa-Pflanzen transformiert. Reife trockene Samen der japonica-Reissorte Nipponbare wurden entspelzt. Die Sterilisation erfolgte durch einminütiges Inkubieren in 70%igem Ethanol und anschließend 30 Minuten in 0,2% HgCl₂, wonach 6 mal je 15 Minuten mit sterilem destilliertem Wasser gewaschen wurde. Anschließend wurden die sterilen Samen auf einem Medium, das 2,4-D enthielt (Kallusinduktionsmedium) keimen gelassen. Nach vierwöchigem Inkubieren im Dunkeln wurden embryogene, von Scutellum stammende Kalli herauspräpariert und auf demselben Medium vermehrt. Nach zwei Wochen wurden die Kalli vervielfacht oder vermehrt, und zwar durch Subkultur auf demselben Medium für weitere 2 Wochen. Embryogene Kallusstückchen wurden auf frischem Medium 3 Tage vor der Cokultivierung subkultiviert (um die Zellteilungsaktivität zu fördern).The Agrobacterium containing the expression vector pGOS2 :: SYT was used to transform Oryza sativa plants. Mature dry seeds of the japonica rice variety Nipponbare were dehusked. Sterilization was carried out by incubation in 70% ethanol for 1 minute, then in 0.2% HgCl ₂ for 30 minutes, followed by washing 6 times 15 minutes each with sterile distilled water. Subsequently, the sterile seeds were germinated on a medium containing 2,4-D (callus induction medium). After incubation in the dark for four weeks, embryogenic scutellum-derived calli were excised and propagated on the same medium. After two weeks the calli were multiplied or increased by subculture on the same medium for another 2 weeks. Embryogenic callus pieces were subcultured on fresh medium 3 days before cocultivation (to promote cell division activity).

Für die Cokultivierung verwendete man den Agrobacterium–Stamm LBA4404, der jeden einzelnen Expressionsvektor enthielt. Agrobacterium wurde auf AB-Medium mit den entsprechenden Antibiotika inokuliert und 3 Tage bei 28°C kultiviert. Anschließend wurden die Bakterien gewonnen und bis zum Erreichen einer Dichte (OD₆₀₀) von ungefähr 1 in flüssigem Cokultivierungsmedium suspendiert. Anschließend wurde die Suspension in eine Petrischale gegeben und die Kalli wurden 15 Minuten in der Suspension eingetaucht. Dann wurden die Kallusgewebe auf einem Papierfilter trocken getupft und auf ein verfestigtes Cokultivierungsmedium umgesetzt und 3 Tage im Dunkeln bei 25°C inkubiert. Die cokultivierten Kalli wurden 4 Wochen im Dunkeln bei 28°C in Gegenwart eines Selektionsmittels auf 2,4-D-haltigem Medium herangezogen. Während dieses Zeitraums entwickelten sich rasch wachsende resistente Kallusinseln. Nach dem Umsetzen dieses Materials auf ein Regenerationsmedium und Inkubation in Licht wurde das embryogene Potential freigesetzt, und in den nächsten 4 bis 5 Wochen entwickelten sich Sprosse. Die Sprosse wurden von den Kalli herauspräpariert und 2 bis 3 Wochen lang auf auxinhaltigem Medium inkubiert, von dem sie in Erde umgesetzt wurden.For cocultivation, Agrobacterium strain LBA4404 was used which contained each individual expression vector. Agrobacterium was inoculated on AB medium with the appropriate antibiotics and cultured for 3 days at 28 ° C. Subsequently, the bacteria were harvested and suspended in a liquid co-cultivation medium until reaching a density (OD ₆₀₀ ) of approximately 1. Subsequently, the suspension was placed in a Petri dish and the calli were immersed in the suspension for 15 minutes. The callus tissues were then blotted dry on a paper filter and transferred to solidified co-cultivation medium and incubated for 3 days in the dark at 25 ° C. The cultured calli were grown for 4 weeks in the dark at 28 ° C. in the presence of a selection agent on 2,4-D-containing medium. During this period, rapidly growing resistant callus islands developed. After reacting this material on a regeneration medium and incubated in light, the embryogenic potential was released, and shoots developed in the next 4 to 5 weeks. The shoots were dissected out from the calli and incubated for 2 to 3 weeks on auxin containing medium, from which they were transferred to soil.

Abgehärtete Sprosse wurden im Gewächshaus unter hoher Feuchtigkeit und im Kurztag herangezogen.Hardened shoots were grown in the greenhouse under high humidity and during short day.

Für jedes Konstrukt wurden ungefähr 35 unabhängige T0-Reistransformanten erzeugt. Die Primärtransformanten wurden von einer Gewebekulturkammer in ein Gewächshaus umgesetzt. Nach einer quantitativen PCR-Analyse zur Überprüfung der Kopienzahl des T-DNA-Inserts wurden nur transgene Ein-Kopien-Pflanzen mit Toleranz für die Selektionsmittel zurückbehalten, um T1-Samen zu ernten. Die Samen wurden dann 3 bis 5 Monate nach dem Umsetzen geerntet. Das Verfahren ergab Ein-Locus-Transformanten mit einer Rate von über 50% ( Aldemita und Hodges 1996, Chan et al, 1993, Hiei et al, 1994 ).For each construct, approximately 35 independent T0 rice transformants were generated. The primary transformants were transferred from a tissue culture chamber to a greenhouse. Following a quantitative PCR analysis to verify the copy number of the T-DNA insert, only one-copy transgenic plants with tolerance to the selection agents were retained to harvest T1 seeds. The seeds were then harvested 3 to 5 months after the reaction. The procedure yielded one-locus transformants at a rate of over 50% ( Aldemita and Hodges 1996, Chan et al, 1993, Hiei et al, 1994 ).

Retransformation von ReisRetransformation of rice

Unter „Retransformation von Reis” versteht man im vorliegenden Zusammenhang die Transformation von Reispflanzen, die bereits für ein anderes Konstrukt transgen sind.In this context, "rice transformation" is understood to mean the transformation of rice plants which are already transgenic for another construct.

Insbesondere wurden Samen, die von transgenen homozygoten Pflanzen, die die Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, exprimieren, mit dem Expressionsvektor von Beispiel 7 retransformiert. Abgesehen von diesem Unterschied bezüglich des ursprünglichen Pflanzenausgangsmaterials unter Verwendung eines unterschiedlichen Selektionsmarkers für die Retransformation im Vergleich zu dem Selektionsmarker für die ursprüngliche Transformation ging man ansonsten wie oben beschrieben vor.In particular, seeds transcribed from transgenic homozygous plants expressing the nucleic acid sequence encoding a SYT polypeptide were retransformed with the expression vector of Example 7. Apart from this difference in the original plant starting material using a different selection marker for the retransformation compared to the selection marker for the original transformation, one otherwise proceeded as described above.

Beispiel 10: Vorgehen bei der phänotypischen AuswertungExample 10: Procedure in the Phenotypic Evaluation

10.1 Aufbau der Auswertung10.1 Structure of the evaluation

Es wurden ungefähr 35 unabhängige T0-Reisretransformanten erzeugt. Diese Pflanzen wurden weiterhin für das Heranziehen und Ernten von T1-Samen von einer Gewebekulturkammer in ein Gewächshaus umgestellt. Die Gewächshausbedingungen waren kurze Tage (12 Stunden Licht), 28°C im Licht und 22°C in der Dunkelheit, und eine relative Feuchtigkeit von 70%.About 35 independent T0 rice transformants were generated. These plants were further switched from a tissue culture chamber to a greenhouse for the collection and harvesting of T1 seeds. The greenhouse conditions were short days (12 hours light), 28 ° C in the light and 22 ° C in the dark, and a relative humidity of 70%.

Für die Überprüfung des Vorliegens von (i) des isolierten Nukleinsäuretransgens, das für ein GRF-Polypeptid gemäß SEQ ID NO: 2 kodiert; sowie von (ii) des isolierten Nukleinsäuretransgens, das für ein SYT-Polypeptid gemäß SEQ ID NO: 121 kodiert, wurden PCR-Tests durchgeführt. PCR-Tests wurden auch bezüglich des Vorliegens und der Kopienzahl von Promotern, Terminatoren und pflanzlichen Selektionsmarkern durchgeführt. Die selektierten transgenen Pflanzen wurden weiter herangezogen, bis sie für beide Transgen-Loci homozygot waren.For the verification of the presence of (i) the isolated nucleic acid transgene encoding a GRF polypeptide of SEQ ID NO: 2; and of (ii) the isolated nucleic acid transgene encoding a SYT polypeptide of SEQ ID NO: 121, PCR assays were performed. PCR assays were also performed for the presence and copy number of promoters, terminators and plant selection markers. The selected transgenic plants were further grown until homozygous for both transgene loci.

10.2 Statistische Analyse: F-Test10.2 Statistical Analysis: F-Test

Als statistisches Modell für die Gesamtauswertung der phänotypischen Eigenschaften der Pflanze wurde eine zweifaktorielle ANOVA (Varianzanalyse) verwendet. Mit allen Parametern, die bei allen Pflanzen von allen Events, die mit dem erfindungsgemäßen Gen transformiert wurden, bestimmt wurden, wurde ein F-Test durchgeführt. Der F-Test erfolgte als Überprüfung auf einen Effekt des Gens über alle Transformations-Events und zur Feststellung eines Gesamteffekts des Gens, auch unter der Bezeichnung globaler Geneffekt bekannt. Die Signifikanzschwelle für einen echten globalen Geneffekt wurde bei dem F-Test auf dem 5%-Wahrscheinlichkeitsniveau festgelegt. Ein signifikanter F-Test-Wert weist auf einen Geneffekt hin, was bedeutet, dass mehr als nur das einfache Vorhandensein oder die Lage des Gens die Unterschiede im Phänotyp verursacht.As a statistical model for the overall evaluation of the phenotypic properties of the plant, a two-factorial ANOVA (variance analysis) was used. With all parameters that were determined in all plants of all events that were transformed with the gene of the invention, an F-test was performed. The F-test was performed to check for an effect of the gene on all transformation events and to establish a total effect of the gene, also known as the global gene effect. The significance threshold for a true global gene effect was set at the 5% probability level in the F-test. A significant F-test score indicates a gene effect, which means that more than just the simple presence or location of the gene causes the differences in the phenotype.

10.3 Messparameter10.3 Measurement parameters

Samenparameter-MesswerteSeed-related parameter measurements

Die einzelnen Samenparameter (darunter Breite, Länge, Fläche) wurden mit einem speziell angefertigten Gerät gemessen, das aus zwei Hauptkomponenten, nämlich einem Wäge- und einem Imaging-Gerät bestand, die mit Software für die Image-Analyse verbunden waren.The individual seed parameters (including breadth, length, area) were measured on a custom device consisting of two major components, a weighing and imaging device, associated with software for image analysis.

Beispiel 11: Ergebnisse der Samengrößenmessungen von von retransformierten Reispflanzen geernteten Samen Example 11: Results of semen size measurements of seeds harvested from retransformed rice plants

Homozygote transgene Reispflanzen, die die Nukleinsäuresequenz, die für ein SYT-Polypeptid gemäß SEQ ID NO: 121 unter der Kontrolle eines konstitutiven Promoters exprimieren, wurden mit dem Expressionsvektor von Beispiel 7 oben, der die Nukleinsäuresequenz, die für das GRF-Polypeptid gemäß SEQ ID NO: 2, ebenfalls unter der Kontrolle eines konstitutiven Promoters, umfasst, retransformiert. Die retransformierten Reispflanzen wurden weiter herangezogen, bis sie für beide Loci homozygot waren.Homozygous transgenic rice plants expressing the nucleic acid sequence encoding a SYT polypeptide of SEQ ID NO: 121 under the control of a constitutive promoter were amplified with the expression vector of Example 7 above containing the nucleic acid sequence encoding the GRF polypeptide of SEQ ID NO: 2, also under the control of a constitutive promoter, retransformed. The retransformed rice plants were further grown until homozygous for both loci.

zeigt links eine Rispe einer Reispflanze (Oryza sativa spp. Japonica cv. Nipponbare), die mit einem Kontrollvektor transformiert ist, und rechts eine Rispe von einer Reispflanze (Oryza sativa spp. Japonica cv. Nipponbare), die mit zwei Konstrukten transformiert ist: (1) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert; sowie (2) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert. Die mit beiden Konstrukten transformierten Reispflanzen sind für beide Loci homozygot. In dem retransformierten Reis sind Pflanzenbiomasse, Anzahl Rispen, Rispengröße, Anzahl Samen und Samengröße im Vergleich zu denselben Parametern bei mit einem Kontrollvektor transformiertem Reis eindeutig erhöht. on the left shows a panicle of a rice plant (Oryza sativa spp., Japonica cv., Nipponbare) transformed with a control vector and, on the right, a panicle of a rice plant (Oryza sativa spp., Japonica cv., Nipponbare) transformed with two constructs: ( 1) a nucleic acid sequence encoding a GRF polypeptide under the control of a rice GOS2 promoter (pGOS2); and (2) a nucleic acid sequence encoding a SYT polypeptide under the control of a rice GOS2 promoter (pGOS2). The rice plants transformed with both constructs are homozygous for both loci. In the retransformed rice, plant biomass, number of panicles, panicle size, number of seeds and seed size are clearly increased in rice transformed with a control vector compared to the same parameters.

Samen, die von den retransformierten Reispflanzen geerntet worden waren und die für beide Loci homozygot waren, wurden geernet, und Stichproben von 30 Samen wurden fotografiert. zeigt in der oberen Reihe von links nach rechts 30 reife Samen (Oryza sativa spp. Japonica cv. Nipponbare) von:

• (a) Pflanzen, die mit einem Konstrukt umfassend eine Nukleinsäuresequenz, die für ein SYT-Polypeptid gemäß SEQ ID NO: 120 unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert, transformiert wurden;
• (b) Pflanzen, die mit zwei Konstrukten transformiert wurden: (1) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid gemäß SEQ ID NO: 2 unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert; sowie (2) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid gemäß SEQ ID NO: 120 unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert;
• (c) Pflanzen, die mit einem Konstrukt umfassend eine Nukleinsäuresequenz, die für ein GRF-Polypeptid gemäß SEQ ID NO: 2 unter der Kontrolle eines GOS2-Promoters (pGOS2) aus dem Reis kodiert, transformiert wurden;
• (d) nullizygote Pflanzen (Kontrollpflanzen) von a;
• (e) nullizygote Pflanzen (Kontrollpflanzen) von c.

• (a) plants transformed with a construct comprising a nucleic acid sequence encoding a SYT polypeptide of SEQ ID NO: 120 under the control of a rice GOS2 promoter (pGOS2);
• (b) plants transformed with two constructs: (1) a nucleic acid sequence encoding a GRF polypeptide of SEQ ID NO: 2 under the control of a rice GOS2 promoter (pGOS2); and (2) a nucleic acid sequence encoding a SYT polypeptide of SEQ ID NO: 120 under the control of a rice GOS2 promoter (pGOS2);
• (c) plants transformed with a construct comprising a nucleic acid sequence encoding a GRF polypeptide of SEQ ID NO: 2 under the control of a rice GOS2 promoter (pGOS2);
• (d) zero-zygote plants (control plants) of a;
• (e) zero-zygote plants (control plants) of c.

Anschließend wurde mit den homozygoten Samen von 6 transgenen Events ein Imaging durchgeführt, um die durchschnittliche Samenfläche, die durchschnittliche Samenlänge und die durchschnittliche Samenbreite abzuschätzen, und die Werte wurden anschließend mit denselben Parametern, die an (i) homozygoten Samen von Pflanzen, die mit einem Konstrukt umfassend eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, transformiert worden waren, sowie (ii) Samen von Kontrollpflanzen (Nullizygoten) von (i) gemessen worden waren, verglichen. Die Ergebnisse sind in Tabelle E unten angeben. Tabelle E: Ergebnisse der Samenflächen-, Samenlängen- und Samenbreitenmessungen von Samen, die von homozygoten retransformierten Reispflanzen geernet worden waren, im Vergleich zu entsprechenden Kontrollsamen. Im Vergleich zu homozygoten Samen von Pflanzen, die mit einem Konstrukt umfassend eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, transformiert worden waren Im Vergleich zu Samen von Kontrollpflanzen (Nullizygoten) Samenfläche mindestens 11% Erhöhung mindestens 26% Erhöhung Samenlänge mindestens 8% Erhöhung mindestens 21% Erhöhung Samenbreite mindestens 3% Erhöhung mindestens 6% Erhöhung Subsequently, with the homozygous seeds of 6 transgenic events, imaging was performed to estimate the average seed area, the average seed length and the average seed width, and the values were then analyzed with the same parameters as (i) homozygous seeds of plants treated with a Construct comprising a nucleic acid sequence coding for a SYT polypeptide, transformed, and (ii) seeds of control plants (nullizygotes) of (i) were measured compared. The results are given in Table E below. Table E: Seed area, seed length and seed width measurements of seeds harvested from homozygous retransformed rice plants compared to corresponding control seeds. In comparison to homozygous seeds of plants transformed with a construct comprising a nucleic acid sequence encoding a SYT polypeptide Compared to seeds of control plants (nullizygotes) seed area at least 11% increase at least 26% increase seed length at least 8% increase at least 21% increase seed width at least 3% increase at least 6% increase

Beispiel 12: Beispiele für die Transformation von anderen Kulturen Example 12: Examples of the transformation of other cultures

Maistransformationcorn transformation

Die Transformation von Mais (Zea mays) erfolgt unter Abwandlung der von Ishida et al, (1996) Nature Biotech. 14(6): 745–50 beschriebenen Methode. Die Transformation beim Mais ist genotypabhängig, und nur bestimmte Genotypen eignen sich für die Transformation und Regeneration. Gute Herkünfte von Donormaterial für die Transformation sind die Inzuchtlinie A188 (University of Minnesota) oder Hybride mit A188 als Elter, es können jedoch auch andere Genotypen erfolgreich verwendet werden. Ungefähr 11 Tage nach der Bestäubung (DAP), wenn die Länge des unreifen Embryos ungefähr 1 bis 1,2 mm beträgt, werden die Kolben von den Maispflanzen geerntet. Die unreifen Embryonen werden mit Agrobacterium tumefaciens, der den Expressionsvektor enthält, cokultiviert, und transgene Pflanzen werden mittels Organogenese gewonnen. Die herauspräparierten Embryonen werden auf Kallusinduktionsmedium und anschließend Maisregenerationsmedium, das das Selektionsmittel enthält (zum Beispiel Imidazolidinon, es können jedoch verschiedene Selektionsmarker verwendet werden) herangezogen. Die Petrischalen werden 2 bis 3 Wochen lang oder bis sich Sprosse entwickeln in Licht bei 25°C inkubiert. Die grünen Sprosse werden von jedem Embryo auf Maisbewurzelungsmedium umgesetzt und 2 bis 3 Wochen lang, bis sich Wurzeln entwickeln, bei 25°C inkubiert. Die bewurzelten Sprosse werden im Gewächshaus in Erde umgesetzt. T1-Samen werden von Pflanzen gebildet, die eine Toleranz für das Selektionsmittel aufweisen und die eine einzelne Kopie des T-DNA-Inserts enthalten.The transformation of maize (Zea mays) is carried out under modification of Ishida et al, (1996) Nature Biotech. 14 (6): 745-50 described method. The transformation in maize is genotype-dependent and only certain genotypes are suitable for transformation and regeneration. Good sources of donor material for transformation are the inbred line A188 (University of Minnesota) or hybrids with A188 as parent, but other genotypes can be used successfully. About 11 days after pollination (DAP), when the length of the immature embryo is about 1 to 1.2 mm, the flasks are harvested from the corn plants. The immature embryos are co-cultivated with Agrobacterium tumefaciens containing the expression vector and transgenic plants are recovered by organogenesis. The prepared embryos are grown on callus induction medium and then maize regeneration medium containing the selection agent (for example, imidazolidinone but various selection markers can be used). The Petri dishes are incubated for 2 to 3 weeks or until shoots develop in light at 25 ° C. The green shoots are transferred from each embryo to corn rooting medium and incubated at 25 ° C for 2-3 weeks until roots develop. The rooted shoots are turned into soil in the greenhouse. T1 seeds are produced by plants that have tolerance for the selection agent and that contain a single copy of the T-DNA insert.

Weizentransformationwheat transformation

Die Transformation von Weizen erfolgt mit der von Ishida et al, (1996) Nature Biotech. 14(6): 745–50 beschriebenen Methode. Die Sorte Bobwhite (vom CIMMYT, Mexico, erhältlich) wird häufig für Transformationszwecke verwendet. Die unreifen Embryonen werden mit Agrobacterium tumefaciens, der den Expressionsvektor enthält, cokultiviert, und transgene Pflanzen werden mittels Organogenese gewonnen. Nach Inkubation mit Agrobacterium werden die Embryonen in vitro auf Kallusinduktionsmedium und anschließend Regenerationsmedium, das das Selektionsmittel enthält (zum Beispiel Imidazolidinon, es können jedoch verschiedene Selektionsmarker verwendet werden) herangezogen. Die Petrischalen werden 2 bis 3 Wochen lang oder bis sich Sprosse entwickeln in Licht bei 25°C inkubiert. Die grünen Sprosse werden von jedem Embryo auf Bewurzelungsmedium umgesetzt und 2 bis 3 Wochen lang, bis sich Wurzeln entwickeln, bei 25°C inkubiert. Die bewurzelten Sprosse werden im Gewächshaus in Erde umgesetzt. T1-Samen werden von Pflanzen gebildet, die eine Toleranz für das Selektionsmittel aufweisen und die eine einzelne Kopie des T-DNA-Inserts enthalten.The transformation of wheat takes place with that of Ishida et al, (1996) Nature Biotech. 14 (6): 745-50 described method. The Bobwhite variety (available from CIMMYT, Mexico) is often used for transformation purposes. The immature embryos are co-cultivated with Agrobacterium tumefaciens containing the expression vector and transgenic plants are recovered by organogenesis. After incubation with Agrobacterium, the embryos are grown in vitro on callus induction medium and then regeneration medium containing the selection agent (for example imidazolidinone, but different selection markers can be used). The Petri dishes are incubated for 2 to 3 weeks or until shoots develop in light at 25 ° C. The green shoots are transferred from each embryo to rooting medium and incubated at 25 ° C for 2 to 3 weeks until roots develop. The rooted shoots are turned into soil in the greenhouse. T1 seeds are produced by plants that have tolerance for the selection agent and that contain a single copy of the T-DNA insert.

Sojabohnentransformationsoybean transformation

Die Transformation von Sojabohne erfolgt unter Abwandlung der im Texas A&M Patent US 5,164,310 beschriebenen Methode. Für die Transformation nach dieser Methode eignen sich mehrere im Handel erhältliche Sojabohnensorten. Die Sorte Jack (erhältlich von der Illinois Seed Foundation) wird häufig für Transformationszwecke verwendet. Sojabohnensamen werden sterilisiert, um in vitro ausgesät zu werden. Hypokotyl, Keimwurzel und ein Keimblatt werden von sieben-Tage-alten Jungkeimpflanzen herauspräpariert. Das Epikotyl und das verbleibende Keimblatt werden weiter herangezogen, um Achselnodien zu entwickeln. Diese Achselnodien werden herauspräpariert und mit Agrobacterium tumefaciens, das den Expressionsvektor enthält, inkubiert. Nach der Cokultivierungsbehandlung werden die Explantate gewaschen und in Selektionsmedium umgesetzt. Regenerierte Sprosse werden herauspräpariert und auf Sprosselongationsmedium gesetzt. Sprosse mit einer Länge von nicht mehr als 1 cm werden auf Bewurzelungsmedium gesetzt, bis sich Wurzeln entwickeln. Die bewurzelten Sprosse werden im Gewächshaus in Erde umgesetzt. T1-Samen werden von Pflanzen gebildet, die eine Toleranz für das Selektionsmittel aufweisen und die eine einzelne Kopie des T-DNA-Inserts enthalten.The transformation of soybean is carried out in a modification of the Texas A & M patent US 5,164,310 described method. For the transformation by this method, several commercially available soybean varieties are suitable. The variety Jack (available from the Illinois Seed Foundation) is often used for transformation purposes. Soybean seeds are sterilized to be seeded in vitro. Hypocotyl, radicle and a cotyledon are dissected out of seven-day old seedlings. The epicotyl and the remaining cotyledon are further used to develop axillary odors. These axillary modes are dissected out and incubated with Agrobacterium tumefaciens containing the expression vector. After cocultivation treatment, the explants are washed and transferred to selection medium. Regenerated shoots are dissected out and placed on shoot elongation medium. Shoots no more than 1 cm in length are placed on rooting medium until roots develop. The rooted shoots are turned into soil in the greenhouse. T1 seeds are produced by plants that have tolerance for the selection agent and that contain a single copy of the T-DNA insert.

Raps/Canola-TransformationRapeseed / canola transformation

Als Explantate für die Gewebekultur werden Keimblattpetiolen und Hypokotyle von 5-6-Tage alten Jungkeimpflanzen verwendet und nach dem Verfahren von Babic et al, (1998, Plant Cell Rep. 17: 183–188) transformiert. Die im Handel erhältliche Sorte Westar (Agriculture Canada) ist die für Transformationszwecke verwendete Standardsorte, es können jedoch auch andere Sorten verwendet werden. Die Canola-Samen werden oberflächensterilisiert, um in vitro ausgesät zu werden. Die Keimblattpetiolenexplantate mit dem daran haftenden Keimblatt werden aus den in-vitro-Keimpflanzen herauspräpariert und dadurch mit Agrobacterium (das den Expressionsvektor enthält) inokuliert, dass man das Schnittende des Petiolenexplantats in die Bakteriensuspension eintaucht. Die Explantate werden anschließend bei 23°C und 16 Stunden Licht 2 Tage lang auf MSBAP-3-Medium mit 3 mg/l BAP, 3% Saccharose, 0.7% Phytagar kultiviert. Nach zweitägiger Cokultur mit Agrobacterum werden die Petiolenexplantate 7 Tage lang auf MSBAP-3-Medium mit 3 mg/l BAP, Cefotaxime, Carbenicillin, oder Timentin (300 mg/l) umgesetzt und dann auf MSBAP-3-Medium mit Cefotaxime, Carbenicillin, oder Timentin und Selektionsmittel bis zur Sprossregeneration kultiviert. Sobald die Sprosse 5–10 mm lang sind, werden sie abgeschnitten und auf Sprosselongationsmedium (MSBAP-0.5, mit 0.5 mg/l BAP) umgesetzt. Sprosse mit einer Länge von ungefähr 2 cm werden zur Induktion von Wurzeln auf Bewurzelungsmedium (MS0) umgesetzt. Die bewurzelten Sprosse werden im Gewächshaus in Erde umgesetzt. T1-Samen werden von Pflanzen gebildet, die eine Toleranz für das Selektionsmittel aufweisen und die eine einzelne Kopie des T-DNA-Inserts enthalten.As explants for tissue culture cotyledonetiols and hypocotyls of 5-6-day old seedlings are used and according to the method of Babic et al, (1998, Plant Cell Rep. 17: 183-188) transformed. The commercially available variety Westar (Agriculture Canada) is the standard variety used for transformation purposes, but other varieties may be used. The canola seeds are surface sterilized to be seeded in vitro. The cotyledonous petiole explants with the cotyledon sticking thereto are prepared from the in vitro seedlings and inoculated with Agrobacterium (containing the expression vector) by dipping the cut end of the petiole explant into the bacterial suspension. The explants then emerge at 23 ° C and 16 hours of light for 2 days MSBAP-3 medium cultured with 3 mg / l BAP, 3% sucrose, 0.7% Phytagar. After two days coculture with Agrobacterum, the petiole explants are transplanted for 7 days on MSBAP-3 medium with 3 mg / L BAP, cefotaxime, carbenicillin, or timentin (300 mg / l) and then on MSBAP-3 medium with cefotaxime, carbenicillin, or Timentin and selection agent cultivated until shoot regeneration. Once the shoots are 5-10 mm long, they are cut off and transferred to shoot elongation medium (MSBAP-0.5, with 0.5 mg / L BAP). Sprouts about 2 cm in length are transplanted to rooting rooting medium (MS0) for induction. The rooted shoots are turned into soil in the greenhouse. T1 seeds are produced by plants that have tolerance for the selection agent and that contain a single copy of the T-DNA insert.

LuzernetransformationAlfalfa

Ein regenerierender Klon von Luzerne (Medicago sativa) wird nach dem Verfahren von ( McKersie et al, 1999, Plant Physiol. 119: 839–847 ) transformiert. Die Regeneration und Transformation von Luzerne ist genotypabhängig und es ist daher eine regenerierende Pflanze erforderlich. Verfahren zur Gewinnung von regenerierenden Pflanzen sind beschrieben worden. Diese können zum Beispiel wie von Brown DCW und A Atanassov (1985. Plant Cell Tissue Organ Culture 4: 111–112) aus der Sorte Rangelander (Agriculture Canada) oder einer beliebigen sonstigen im Handel erhältlichen Luzernesorte selektiert werden. Alternativ dazu wurde die Sorte RA3 (University of Wisconsin) für die Verwendung in der Gewebekultur selektiert ( Walker et al, 1978, Am. J. Bot. 65: 654–659 ). Es werden Petiolenexplantate mit einer Obernachtkultur von Agrobacterium tumefaciens C58C1 pMP90 ( McKersie et al, 1999, Plant Physiol. 119: 839–847 ) oder LBA4404, die den Expressionsvektor enthält, cokultiviert. Die Pflanzen werden 3 Tage im Dunkeln auf SH-Induktionsmedium mit 288 mg/l Pro, 53 mg/l Thioprolin, 4.35 g/l K₂SO₄ und 100 μm Acetosyringinon cokultiviert. Die Explantate werden mit halbkonzentriertem Murashige-Skoog-Medium (Murashige und Skoog, 1962) gewaschen und auf dasselbe SH-Induktionsmedium ohne Acetosyringinon, jedoch mit einem geeigneten Selektionsmittel und einem geeigneten Antibiotikum für die Hemmung des Agrobacterium-Wachstums ausplattiert. Nach mehreren Wochen werden die somatischen Embryonen auf BOi2Y-Entwicklungsmedium ohne Wachstumsregulatoren, ohne Antibiotika, jedoch mit 50 g/l Saccharose umgesetzt. Somatische Embryonen keimten anschließend auf halbkonzentriertem Murashige-Skoog-Medium aus. Bewurzelte Keimlingspflanzen wurden in Töpfe umgesetzt und im Gewächshaus herangezogen. T1-Samen werden von Pflanzen gebildet, die eine Toleranz für das Selektionsmittel aufweisen und die eine einzelne Kopie des T-DNA-Inserts enthalten.A regenerating clone of alfalfa (Medicago sativa) is obtained by the method of ( McKersie et al, 1999, Plant Physiol. 119: 839-847 ). The regeneration and transformation of alfalfa is genotype dependent and therefore a regenerating plant is required. Methods of recovering regenerating plants have been described. These can be like for example Brown DCW and A Atanassov (1985. Plant Cell Tissue Organ Culture 4: 111-112) from the variety Rangelander (Agriculture Canada) or any other commercially available alfalfa. Alternatively, the variety RA3 (University of Wisconsin) was selected for use in tissue culture ( Walker et al, 1978, Am. J. Bot. 65: 654-659 ). Petiolene explants containing an overnight culture of Agrobacterium tumefaciens C58C1 pMP90 ( McKersie et al, 1999, Plant Physiol. 119: 839-847 ) or LBA4404 containing the expression vector. The plants are cocultured for 3 days in the dark on SH induction medium with 288 mg / l Pro, 53 mg / l thioproline, 4.35 g / l K ₂ SO ₄ and 100 microns acetosyringinone. The explants are washed with half-concentrated Murashige-Skoog medium (Murashige and Skoog, 1962) and plated on the same SH induction medium without acetosyringinone but with a suitable selection agent and a suitable antibiotic for the inhibition of Agrobacterium growth. After several weeks, the somatic embryos are transferred to BOi2Y development medium without growth regulators, without antibiotics but with 50 g / l sucrose. Somatic embryos were then germinated on half-concentrated Murashige-Skoog medium. Rooted seedling plants were transferred to pots and grown in the greenhouse. T1 seeds are produced by plants that have tolerance for the selection agent and that contain a single copy of the T-DNA insert.

Transformation von BaumwolleTransformation of cotton

Baumwolle (Gossypium hirsutum L.) wird unter Verwendung von Agrobacterium tumefaciens an Hypocotylexplantaten transformiert. Bei den im Handel erhältlichen Kultivaren wie Coker 130 oder Coker 312 (SeedCo, Lubbock, TX) handelt es sich um Standardsorten, die für die Transformation verwendet werden, es können jedoch auch andere Sorten verwendet werden. Die Samen werden oberflächensterilisiert und im Dunkeln keimen gelassen. Von den gekeimten Keimpflanzen werden Hypocotylexplantate in Längen von ungefähr 1–1,5 cm geschnitten. Das Hypocotylexplantat wird in dem Agrobacterium-tumefaciens-Inoculum, das den Expressionsvektor enthält, 5 Minuten lang eingetaucht, und dann ungefähr 48 Stunden lang auf MS + 1,8 mg/l KNO₃ +2% Glucose bei 24°C im Dunkeln cokultiviert. Die Explantate werden auf dasselbe Medium, das entsprechende Bakterien- und Pflanzenselektionsmarker enthält (und das mehrmals erneuert wird) umgesetzt, bis embryogene Kalli beobachtet werden können. Die Kalli werden abgetrennt und subkultiviert, bis somatische Embryonen erscheinen. Die Pflänzchen, die aus den somatischen Embryonen entstehen, werden auf Bewurzelungsmedium reifen gelassen, bis sich Wurzeln entwickeln. Die bewurzelten Sprosse werden in Blumenerde im Gewächshaus umgesetzt. T1-Samen werden von den Pflanzen, die eine Toleranz gegenüber dem Selektionsmittel aufweisen und die eine einzige Kopie des T-DNA-Inserts enthalten, produziert.Cotton (Gossypium hirsutum L.) is transformed to hypocotylsmiths using Agrobacterium tumefaciens. Commercially available cultivars such as Coker 130 or Coker 312 (SeedCo, Lubbock, TX) are standard varieties used for transformation, but other varieties may be used. The seeds are surface sterilized and germinated in the dark. Of the germinated seedlings, hypocotyl implants are cut into lengths of about 1-1.5 cm. The hypocotyl explant is submerged in the Agrobacterium tumefaciens inoculum containing the expression vector for 5 minutes and then cocultivated for approximately 48 hours on MS + 1.8 mg / L KNO ₃ + 2% glucose at 24 ° C in the dark. The explants are transferred to the same medium containing appropriate bacterial and plant selection markers (and renewed several times) until embryogenic calli can be observed. The calli are separated and subcultured until somatic embryos appear. The plantlets originating from the somatic embryos are ripened on rooting medium until roots develop. The rooted shoots are transferred to potting soil in the greenhouse. T1 seeds are produced by the plants that have tolerance to the selection agent and that contain a single copy of the T-DNA insert.

ZusammenfassungSummary

Pflanzen mit erhöhten Ertragsmerkmalen und Verfahren zu ihrer HerstellungPlants with enhanced yield-related traits and methods for their production

Die vorliegende Erfindung betrifft allgemein das Gebiet der Molekularbiologie und befasst sich mit einem Verfahren zur Erhöhung verschiedener Ertragsmerkmalen in Pflanzen durch Erhöhung der Expression von Folgendem in einer Pflanze: (i) einer Nukleinsäuresequenz, die für ein Growth-Regulating Factor(GRF)-Polypeptid kodiert; und (ii) einer Nukleinsäuresequenz, die für ein ”synovial sarcoma translocation”(SYT)-Polypeptid kodiert, wobei die Ertragsmerkmale im Vergleich zu Pflanzen mit einer erhöhten Expression einer der folgenden erhöht sind: (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert, oder (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert. Die vorliegende Erfindung betrifft auch Pflanzen mit einer erhöhten Expression von (i) einer Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; und von (ii) einer Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, wobei die Pflanzen im Vergleich zu Pflanzen mit einer erhöhten Expression von einer der folgenden: (i) eine Nukleinsäuresequenz, die für ein GRF-Polypeptid kodiert; oder (ii) eine Nukleinsäuresequenz, die für ein SYT-Polypeptid kodiert, erhöhte Ertragsmerkmale aufweisen. Die Erfindung stellt auch Konstrukte bereit, die sich für die erfindungsgemäßen Verfahren eignen.The present invention relates generally to the field of molecular biology and is directed to a method for increasing various yield-related traits in plants by increasing the expression of the following in a plant: (i) a nucleic acid sequence encoding a Growth Regulating Factor (GRF) polypeptide ; and (ii) a nucleic acid sequence encoding a "synovial sarcoma translocation" (SYT) polypeptide, wherein the yield-related traits are increased as compared to plants having increased expression of any of the following: (i) a nucleic acid sequence encoding a GRF Polypeptide, or (ii) a nucleic acid sequence encoding a SYT polypeptide. The present invention also relates to plants having a increased expression of (i) a nucleic acid sequence encoding a GRF polypeptide; and (ii) a nucleic acid sequence encoding a SYT polypeptide, said plants comprising, in comparison to plants having increased expression, any of the following: (i) a nucleic acid sequence encoding a GRF polypeptide; or (ii) a nucleic acid sequence encoding a SYT polypeptide has increased yield-related traits. The invention also provides constructs useful in the methods of the invention.

ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDE IN THE DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Zitierte PatentliteraturCited patent literature

• JP 2004-350553 [0025] JP 2004-350553 [0025]
• US 5811238 [0049] US 5811238 [0049]
• US 6395547 [0049] US 6395547 [0049]
• WO 2004/070039 [0054, 0060, 0060, 0060, 0060, 0060, 0062] WO 2004/070039 [0054, 0060, 0060, 0060, 0060, 0060, 0062]
• WO 2004/065596 [0054] WO 2004/065596 [0054]
• US 4962028 [0054] US 4962028 [0054]
• WO 01/14572 [0054] WO 01/14572 [0054]
• WO 95/14098 [0054] WO 95/14098 [0054]
• WO 94/12015 [0054] WO 94/12015 [0054]
• EP 99106056 [0060] EP 99106056 [0060]
• US 5565350 [0067, 0079] US 5565350 [0067, 0079]
• WO 9322443 [0067] WO 9322443 [0067]
• WO 98/36083 [0073] WO 98/36083 [0073]
• WO 99/15682 [0073] WO 99/15682 [0073]
• WO 00/15815 [0079] WO 00/15815 [0079]
• EP 1198985 A1 [0082] EP 1198985 A1 [0082]
• US 5164310 [0287] US 5164310 [0287]

Zitierte Nicht-PatentliteraturCited non-patent literature

• Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 [0005] Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 [0005]
• Fasoula & Tollenaar 2005 Maydica 50: 39 [0005] Fasoula & Tollenaar 2005 Maydica 50: 39 [0005]
• ter Steege et al. 2005 Plant Physiology 139: 1078 [0005] Steege et al. 2005 Plant Physiology 139: 1078 [0005]
• Hittalmani et al. 2003 Theoretical Applied Genetics 107: 679 [0005] Hittalmani et al. 2003 Theoretical Applied Genetics 107: 679 [0005]
• Rebetzke et al. 2002 Crop Science 42: 739 [0007] Rebetzke et al. 2002 Crop Science 42: 739 [0007]
• Gardener et al. 1985 Physiology of Crop Plants. Iowa State University Press, S. 68–73 [0007] Gardener et al. 1985 Physiology of Crop Plants. Iowa State University Press, pp. 68-73 [0007]
• Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 [0007] Tittonell et al. 2005 Agric. Ecosys. & Environ. 105: 213 [0007]
• Wang et al. (2003) Planta 218: 1–14 [0008] Wang et al. (2003) Planta 218: 1-14 [0008]
• Riechmann et al. (2000) Science 290: 2105–2109 [0014] Riechmann et al. (2000) Science 290: 2105-2109 [0014]
• Gao et al. (2006) Bioinformatics 2006, 22(10): 1286–7 [0014] Gao et al. (2006) Bioinformatics 2006, 22 (10): 1286-7 [0014]
• Kim et al. (2003) Plant J. 36: 94–104 [0015] Kim et al. (2003) Plant J. 36: 94-104 [0015]
• Choi et al. (2004) Plant Cell Physiol. 45(7): 897–904 [0015] Choi et al. (2004) Plant Cell Physiol. 45 (7): 897-904 [0015]
• Ellerstrom et al. (2005) Plant Molec. Biol. 59: 663-681 [0015] Ellerstrom et al. (2005) Plant Molec. Biol. 59: 663-681 [0015]
• Kim & Kende (2004) Proc. Natl. Acad. Sci. 101: 13374–13379 [0016] Kim & Kende (2004) Proc. Natl. Acad. Sci. 101: 13374-13379 [0016]
• de Vetten & Ferl (1994) Plant Physiol. 106: 1593–1604 [0017] de Vetten & Ferl (1994) Plant Physiol. 106: 1593-1604 [0017]
• van der Knapp et al. (2000) Plant Physiol. 122: 695–704 [0018] van der Knapp et al. (2000) Plant Physiol. 122: 695-704 [0018]
• Kim et al. (2003) Plant J. 36: 94–104 [0018] Kim et al. (2003) Plant J. 36: 94-104 [0018]
• Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374–9 [0020] Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374-9 [0020]
• Horiguchi et al. (2005) Plant J. 43: 68–78 [0020] Horiguchi et al. (2005) Plant J. 43: 68-78 [0020]
• van der Knaap E et al., (2000) Plant Phys. 122: 695–704 [0020] van der Knaap E et al., (2000) Plant Phys. 122: 695-704 [0020]
• Näär AM et al., (2001) Annu. Rev. Biochem. 70: 475–501 [0020] Näär AM et al., (2001) Annu. Rev. Biochem. 70: 475-501 [0020]
• Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374–9 [0020] Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374-9 [0020]
• Thaete et al. (1999) Hum. Molec. Genet. 8: 585–591 [0021] Thaete et al. (1999) Hum. Molec. Genet. 8: 585-591 [0021]
• Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374–9 [0023] Kim HJ, Kende H (2004) Proc. Nat. Acad. Sc. 101: 13374-9 [0023]
• Horiguchi et al. (2005) Plant J. 43: 68–78 [0024] Horiguchi et al. (2005) Plant J. 43: 68-78 [0024]
• Creighton (1984), Proteins. W. H. Freeman and Company (Hrsg.) [0034] Creighton (1984), Proteins. WH Freeman and Company (ed.) [0034]
• Meinkoth und Wahl, Anal. Biochem., 138: 267–284, 1984 [0042] Meinkoth and Wahl, anal. Biochem., 138: 267-284, 1984 [0042]
• Sambrook et al, (2001), Molecular Cloning: a laboratory manual, 3. Ausgabe, Cold Spring Harbor Laboratory Press, CSH, New York [0046] Sambrook et al, (2001), Molecular Cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory Press, CSH, New York [0046]
• Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989 und jährliche Neufassungen) [0046] Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989 and Annual Review) [0046]
• Foissac und Schiex (2005), BMC Bioinformatics 6: 25 [0047] Foissac and Schiex (2005), BMC Bioinformatics 6: 25 [0047]
• Castle et al, (2004), Science 304(5674): 1151–4 [0049] Castle et al, (2004), Science 304 (5674): 1151-4 [0049]
• Neid et al, 1996, Genome Methods 6: 986–994 [0052] Neid et al, 1996, Genome Methods 6: 986-994 [0052]
• McElroy et al, Plant Cell, 2: 163–171, 1990 [0054] McElroy et al, Plant Cell, 2: 163-171, 1990 [0054]
• de Pater et al, Plant J. Nov.; 2(6): 837–44, 1992 [0054] de Pater et al, Plant J. Nov .; 2 (6): 837-44, 1992 [0054]
• Christensen et al, Plant Mol. Biol. 18: 675–689, 1992 [0054] Christensen et al, Plant Mol. Biol. 18: 675-689, 1992 [0054]
• Buchholz et al, Plant Mol. Biol. 25(5): 837–43, 1994 [0054] Buchholz et al, Plant Mol. Biol. 25 (5): 837-43, 1994 [0054]
• Lepetit et al, Mol. Gen. Genet. 231: 276–285, 1992 [0054] Lepetit et al, Mol. Gen. Genet. 231: 276-285, 1992 [0054]
• Wu et al, Plant Mol. Biol. 11: 641–649, 1988 [0054] Wu et al, Plant Mol. Biol. 11: 641-649, 1988 [0054]
• An et al, Plant J. 10(1); 107–121, 1996 [0054] An et al, Plant J. 10 (1); 107-121, 1996 [0054]
• Sanger et al, Plant. Mol. Biol., 14, 1990: 433–443 [0054] Sanger et al, Plant. Biol., 14, 1990: 433-443 [0054]
• Leisner (1988), Proc. Natl. Acad. Sci. USA 85(5): 2553 [0054] Leisner (1988), Proc. Natl. Acad. Sci. USA 85 (5): 2553 [0054]
• Jain et al, Crop Science, 39 (6), 1999: 1696 [0054] Jain et al, Crop Science, 39 (6), 1999: 1696 [0054]
• Jain et al, Crop Science, 39 (6), 1999: 1696 [0054] Jain et al, Crop Science, 39 (6), 1999: 1696 [0054]
• Shaw et al, (1984), Nucleic Acids Res. 12(20): 7831–7846 [0054] Shaw et al, (1984), Nucleic Acids Res. 12 (20): 7831-7846 [0054]
• Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48: 89–108 [0057] Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48: 89-108 [0057]
• Xu et al. (1995) Plant Mol. Biol. 27(2): 237– 48 [0059] Xu et al. (1995) Plant Mol. Biol. 27 (2): 237-48 [0059]
• Kovama et al., 2005 [0059] Kovama et al., 2005 [0059]
• Xiao et al., 2006 [0059] Xiao et al., 2006 [0059]
• Nitz et al. (2001) Plant Sci. 161(2): 337–346 [0059] Nitz et al. (2001) Plant Sci. 161 (2): 337-346 [0059]
• Conkling et at. (1990) Plant Phys. 93(3): 1203–1211 [0059] Conkling et al. (1990) Plant Phys. 93 (3): 1203-1211 [0059]
• Lerner & Raikhel (1989) Plant Phys. 91: 124–129 [0059] Lerner & Raikhel (1989) Plant Phys. 91: 124-129 [0059]
• Keller & Lamb (1989) Genes & Dev. 3: 1639–1646 [0059] Keller & Lamb (1989) Genes & Dev. 3: 1639-1646 [0059]
• Blilou et al. (2002) Genes & Dev. 16: 2566–2575 [0059] Blilou et al. (2002) Genes & Dev. 16: 2566-2575 [0059]
• Qing Qu und Takaiwa (Plant Biotechnol. J. 2, 113–125, 2004 [0060] Qing Qu and Takaiwa (Plant Biotechnol. J. 2, 113-125, 2004 [0060]
• Simon et al, Plant Mol. Biol. 5: 191, 1985 [0060] Simon et al, Plant Mol. Biol. 5: 191, 1985 [0060]
• Scofield et al, J. Biol. Chem. 262: 12202, 1987 [0060] Scofield et al, J. Biol. Chem. 262: 12202, 1987 [0060]
• Baszczynski et al, Plant Mol. Biol. 14: 633, 1990 [0060] Baszczynski et al., Plant Mol. Biol. 14: 633, 1990 [0060]
• Pearson et al, Plant Mol. Biol. 18: 235–245, 1992 [0060] Pearson et al, Plant Mol. Biol. 18: 235-245, 1992 [0060]
• Ellis et al, Plant Mol. Biol. 10: 203–214, 1988 [0060] Biol. 10: 203-214, 1988 [0060] Ellis et al., Plant Mol.
• Takaiwa et al, Mol. Gen. Genet. 208: 15–22, 1986 [0060] Takaiwa et al, Mol. Gen. Genet. 208: 15-22, 1986 [0060]
• Takaiwa et al, FEBS Letts. 221: 43–47, 1987 [0060] Takaiwa et al, FEBS Letts. 221: 43-47, 1987 [0060]
• Matzke et al, Plant Mol. Biol., 14(3): 323–32, 1990 [0060] Matzke et al, Plant Mol. Biol., 14 (3): 323-32, 1990 [0060]
• Stalberg et al, Planta 199: 515–519, 1996 [0060] Stalberg et al, Planta 199: 515-519, 1996 [0060]
• Mol. Gen. Genet. 216: 81–90, 1989; NAR 17:4 61–2, 1989 [0060] Mol. Gen. Genet. 216: 81-90, 1989; NAR 17: 4 61-2, 1989 [0060]
• Albani et al, Plant Cell, 9: 171–184, 1997 [0060] Albani et al, Plant Cell, 9: 171-184, 1997 [0060]
• EMBO J. 3: 1409–15, 1984 [0060] EMBO J. 3: 1409-15, 1984 [0060]
• Diaz et al, (1995), Mol. Gen. Genet. 248(5): 592–8 [0060] Diaz et al, (1995), Mol. Genet. 248 (5): 592-8 [0060]
• Theor. Appl. Gen. 98: 125362, 1999; Plant J. 4: 34355, 1993 [0060] Theor. Appl. Gene. 98: 125362, 1999; Plant J. 4: 34355, 1993 [0060]
• Mol. Gen. Genet. 250: 75060, 1996 [0060] Mol. Gen. Genet. 250: 75060, 1996 [0060]
• Mena et al, The Plant Journal, 116(1): 53–62, 1998 [0060] Mena et al, The Plant Journal, 116 (1): 53-62, 1998 [0060]
• Vicente-Carbajosa et al, Plant J. 13: 629–640, 1998 [0060] Vicente-Carbajosa et al, Plant J. 13: 629-640, 1998 [0060]
• Wu et al, Plant Cell Physiology 39(8) 885–889, 1998 [0060] Wu et al, Plant Cell Physiology 39 (8) 885-889, 1998 [0060]
• Wu et al, Plant Cell Physiology 39(8) 885–889, 1998 [0060] Wu et al, Plant Cell Physiology 39 (8) 885-889, 1998 [0060]
• Sato et al, Proc. Natl. Acad. Sci. USA, 93: 8117–8122, 1996 [0060] Sato et al, Proc. Natl. Acad. Sci. USA, 93: 8117-8122, 1996 [0060]
• Nakase et al, Plant Mol. Biol. 33: 513–522, 1997 [0060] Nakase et al, Plant Mol. Biol. 33: 513-522, 1997 [0060]
• Trans. Res. 6: 15768, 1997 [0060] Trans. Res. 6: 15768, 1997 [0060]
• Plant J. 12: 23546, 1997 [0060] Plant J. 12: 23546, 1997 [0060]
• DeRose et al, Plant Mol. Biol. 32: 1029–35, 1996 [0060] DeRose et al, Plant Mol. Biol. 32: 1029-35, 1996 [0060]
• Postma-Haarsma et al, Plant Mol. Biol. 39: 25771, 1999 [0060] Postma-Haarsma et al, Plant Mol. Biol. 39: 25771, 1999 [0060]
• Wu et al, J. Biochem. 123: 386, 1998 [0060] Wu et al, J. Biochem. 123: 386, 1998 [0060]
• Cummins et al, Plant Mol. Biol. 19: 873–876, 1992 [0060] Cummins et al, Plant Mol. Biol. 19: 873-876, 1992 [0060]
• Lanahan et al, Plant Cell 4: 203–211, 1992 [0060] Lanahan et al, Plant Cell 4: 203-211, 1992 [0060]
• Skriver et al, Proc. Natl. Acad. Sci., USA 88: 7266–7270, 1991 [0060] Skriver et al, Proc. Natl. Acad. Sci., USA 88: 7266-7270, 1991 [0060]
• Cejudo et al, Plant Mol. Biol. 20: 849856, 1992 [0060] Cejito et al, Plant Mol. Biol. 20: 849856, 1992 [0060]
• Kalla et al, Plant J. 6: 849–60, 1994 [0060] Kalla et al, Plant J. 6: 849-60, 1994 [0060]
• Leah et al, Plant J. 4: 579–89, 1994 [0060] Leah et al, Plant J. 4: 579-89, 1994 [0060]
• Selinger et al, Genetics 149; 1125–38, 1998 [0060] Selinger et al, Genetics 149; 1125-38, 1998 [0060]
• Fukavama et al., 2001 [0062] Fukavama et al., 2001 [0062]
• Kausch et al., 2001 [0062] Kausch et al., 2001 [0062]
• Liu et al., 2003 [0062] Liu et al., 2003 [0062]
• Nomura et al., 2000 [0062] Nomura et al., 2000 [0062]
• Panguluri et al., 2005 [0062] Panguluri et al., 2005 [0062]
• Sato et al. (1996) Proc. Natl. Acad. Sci. USA, 93: 8117–8122 [0063] Sato et al. (1996) Proc. Natl. Acad. Sci. USA, 93: 8117-8122 [0063]
• Wagner & Kohorn (2001) Plant Cell 13(2): 303–318 [0063] Wagner & Kohorn (2001) Plant Cell 13 (2): 303-318 [0063]
• Buchman und Berg (1988), Mol. Cell biol. 8: 4395–4405 [0069] Buchman and Berg (1988), Mol. Cell biol. 8: 4395-4405 [0069]
• Callis et al, (1987), Genes Dev. 1: 1183–1200 [0069] Callis et al, (1987), Genes Dev. 1: 1183-1200 [0069]
• The Maize Handbook, Kapitel 116, Freeling und Walbot, Hrsg., Springer, N. Y. (1994) [0069] The Maize Handbook, Chapter 116, Freeling and Walbot, eds., Springer, NY (1994) [0069]
• Angell und Baulcombe ((1999), Plant J. 20(3): 357–62 [0073] Angell and Baulcombe ((1999), Plant J. 20 (3): 357-62 [0073]
• Schwab et al., (2005) Dev. Cell 8(4): 517–27 [0073] Schwab et al., (2005) Dev. Cell 8 (4): 517-27 [0073]
• Schwab et al., (2006) Plant Cell 18(5): 1121–33 [0073] Schwab et al., (2006) Plant Cell 18 (5): 1121-33 [0073]
• Tribble et al, J. Biol. Chem., 275, 2000: 22255–22267 [0078] Tribble et al, J. Biol. Chem., 275, 2000: 22255-22267 [0078]
• Velmurugan et al, J. Cell Biol., 149, 2000: 553–566 [0078] Velmurugan et al, J. Cell Biol., 149, 2000: 553-566 [0078]
• Krens, F. A. et al, (1982), Nature 296, 72–74 [0082] Krens, FA et al, (1982), Nature 296, 72-74 [0082]
• Negrutiu I et al, (1987), Plant Mol. Biol. 8: 363–373 [0082] Negrutiu I et al, (1987), Plant Mol. Biol. 8: 363-373 [0082]
• Shillito R. D. et al, (1985), Bio/Technol. 3, 1099–1102 [0082] Shillito RD et al, (1985), Bio / Technol. 3, 1099-1102 [0082]
• Crossway A et al, (1986), Mol. Gen. Genet. 202: 179–185 [0082] Crossway A et al, (1986), Mol. Genet. 202: 179-185 [0082]
• Klein TM et al, (1987), Nature 327: 70 [0082] Klein TM et al, (1987), Nature 327: 70 [0082]
• Clough und Bent, Plant J. (1998), 16, 735–743 [0082] Clough and Bent, Plant J. (1998), 16, 735-743 [0082]
• Aldemita und Hodges (Planta 199: 612–617, 1996) [0082] Aldemita and Hodges (Planta 199: 612-617, 1996) [0082]
• Chan et al, (Plant Mol. Biol. 22 (3): 491–506, 1993) [0082] Chan et al, (Plant Mol. Biol. 22 (3): 491-506, 1993) [0082]
• Hiei et al, (Plant J. 6 (2): 271–282, 1994) [0082] Hiei et al, (Plant J. 6 (2): 271-282, 1994) [0082]
• Ishida et al, (Nat. Biotechnol. 14(6): 745–50, 1996) [0082] Ishida et al, (Nat. Biotechnol., 14 (6): 745-50, 1996) [0082]
• Frame et al, (Plant Physiol. 129(1): 13–22, 2002) [0082] Frame et al, (Plant Physiol. 129 (1): 13-22, 2002) [0082]
• B. Jenes et al, Techniques for Gene Transfer, in: Transgenic Plants, Band 1, Engineering and Utilization, Hrsg. S. D. Kung und R. Wu, Academic Press (1993), 128–143 [0082] Genes Transfer, Transgenic Plants, Vol. 1, Engineering and Utilization, eds. SD Kung and R. Wu, Academic Press (1993), 128-143 [0082]
• Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205–225 [0082] Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205-225 [0082]
• Bevan et al, Nucl. Acids Res. 12 (1984) 8711 [0082] Bevan et al, Nucl. Acids Res. 12 (1984) 8711 [0082]
• Höfgen und Willmitzer in Nucl. Acid Res. (1988), 16, 9877 [0082] Hofgen and Willmitzer in Nucl. Acid Res. (1988), 16, 9877 [0082]
• F. F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Band 1, Engineering and Utilization, Hrsg. S. D. Kung und R. Wu, Academic Press, 1993, S. 15–38 [0082] FF White, Vectors for Gene Transfer to Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, Ed. SD Kung and R. Wu, Academic Press, 1993, pp. 15-38 [0082]
• Feldman, KA und Marks MD (1987). Mol. Gen. Genet. 208: 274–289 [0083] Feldman, KA and Marks MD (1987). Mol. Gen. Genet. 208: 274-289 [0083]
• Feldmann K (1992). In: C Koncz, N-H Chua und J Shell, Hrsg., Methods in Arabidopsis Research. Word Scientific, Singapur, S. 274–289 [0083] Feldmann K (1992). In: C Koncz, NH Chua and J Shell, eds., Methods in Arabidopsis Research. Word Scientific, Singapore, pp. 274-289 [0083]
• Chang (1994). Plant J. 5: 551–558; Katavic (1994). Mol. Gen. Genet., 245: 363–370 [0083] Chang (1994). Plant J. 5: 551-558; Katavic (1994). Mol. Gen. Genet., 245: 363-370 [0083]
• Bechthold, N (1993). C. R. Acad. Sci. Paris Life Sci., 316: 1194–1199 [0083] Bechthold, N (1993). CR Acad. Sci. Paris Life Sci., 316: 1194-1199 [0083]
• Clough, SJ und Bent AF (1998), The Plant J. 16, 735–743 [0083] Clow, SJ and Bent AF (1998), The Plant J. 16, 735-743 [0083]
• Klaus et al, 2004, [Nature Biotechnology 22 (2), 225–229 [0083] Klaus et al, 2004, [Nature Biotechnology 22 (2), 225-229 [0083]
• Bock (2001) Transgenic plastids in basic research and plant biotechnology. J. Mol. Biol. 2001 Sept. 21; 312 (3): 425–38 [0083] Bock (2001) Transgenic plastids in basic research and plant biotechnology. J. Mol. Biol. 2001 Sept. 21; 312 (3): 425-38 [0083]
• Maliga, P (2003), Progress towards commercialization of plastid transformation technology. Trends Biotechnol. 21, 20–28 [0083] Maliga, P (2003), Progress towards commercialization of plastid transformation technology. Trends Biotechnol. 21, 20-28 [0083]
• Klaus et al, 2004, Nature Biotechnology 22(2), 225–229 [0083] Klaus et al, 2004, Nature Biotechnology 22 (2), 225-229 [0083]
• Hayashi et al, Science (1992), 1350–1353 [0084] Hayashi et al, Science (1992), 1350-1353 [0084]
• Redei GP und Koncz C (1992), In Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, Hrsg. Singapur, World Scientific Publishing Co, S. 16–82 [0085] Redei GP and Koncz C (1992), In Methods in Arabidopsis Research, Koncz C, Chua NH, Schell J, eds. Singapore, World Scientific Publishing Co, pp. 16-82 [0085]
• Feldmann et al, (1994) In Meyerowitz EM, Somerville CR, Hrsg, Arabidopsis. Cold Spring Harbor Laborstory Press, Cold Spring Harbor, NY, S. 137–172 [0085] Feldmann et al, (1994) In Meyerowitz EM, Somerville CR, Eds, Arabidopsis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 137-172 [0085]
• Lightner J und Caspar T (1998), In J Martinez-Zapater, J Salinas, Hrsg., Methods an Molecular Biology, Band 82. Humana Press, Totowa, NJ, S. 91–104 [0085] Lightner J and Caspar T (1998), In J Martinez-Zapater, J Salinas, eds., Methods on Molecular Biology, Vol. 82. Humana Press, Totowa, NJ, pp. 91-104 [0085]
• McCallum et al, (2000), Nat. Biotechnol. 18: 455–457 [0085] McCallum et al, (2000), Nat. Biotechnol. 18: 455-457 [0085]
• Stemple (2004), Nat. Rev. Genet. 5(2): 145–50 [0085] Stemple (2004), Nat. Rev. Genet. 5 (2): 145-50 [0085]
• Offringa et al, (1990), EMBO J. 9(10): 3077–84 [0086] Offringa et al, (1990), EMBO J. 9 (10): 3077-84 [0086]
• Terada et al, (2002), Nat. Biotech. 20(10): 1030–4 [0086] Terada et al, (2002), Nat. Biotech. 20 (10): 1030-4 [0086]
• Iida und Terada (2004), Curr. Opin. Biotech. 15(2): 132–8 [0086] Iida and Terada (2004), Curr. Opin. Biotech. 15 (2): 132-8 [0086]
• Schultz et al, (1998), Proc. Natl. Acad. Sci. USA 95, 5857–5864 [0104] Schultz et al, (1998), Proc. Natl. Acad. Sci. USA 95, 5857-5864 [0104]
• Letunic et al, (2002), Nucleic Acids Res. 30, 242–244 [0104] Letunic et al, (2002), Nucleic Acids Res. 30, 242-244 [0104]
• Mulder et al, (2003), Nucl. Acids Res. 31, 315-318 [0104] Mulder et al, (2003), Nucl. Acids Res. 31, 315-318 [0104]
• Sucher und Bairoch (1994) [0104] Seeker and Bairoch (1994) [0104]
• Proceedings 2nd International Conference an Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Hrsg., S. 53-61 [0104] Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., eds, pp. 53-61 [0104]
• Hulo et al, Nucl. Acids Res. 32: D134–D137, (2004) [0104] Hulo et al, Nucl. Acids Res. 32: D134-D137, (2004) [0104]
• Bateman et al, Nucleic Acids Research 30(1): 276280 (2002) [0104] Bateman et al, Nucleic Acids Research 30 (1): 276280 (2002) [0104]
• Gasteiger et al, ExPASy: the proteomics server for in-depth Protein knowledge and analysis, Nucleic Acids Res. 31: 3784–3788 (2003) [0104] Gasteiger et al, ExPASy: the proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res. 31: 3784-3788 (2003) [0104]
• Needleman und Wunsch ((1970), J. Mol. Biol. 48: 443–453 [0106] Needleman and Wunsch ((1970), J. Mol. Biol. 48: 443-453 [0106]
• Altschul et al., (1990), J. Mol. Biol. 215: 403–10 [0107] Altschul et al., (1990), J. Mol. Biol. 215: 403-10 [0107]
• Campanella et al., (2003) BMC Bioinformatics, 10: 29 [0107] Campanella et al., (2003) BMC Bioinformatics, 10: 29 [0107]
• Current Protocols in Molecular Biology, Band 1 und 2, Ausubel et al. (1994), Current Protocols [0109] Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel et al. (1994), Current Protocols [0109]
• Kim & Kende (2004) Proc. Natl. Acad. Sci. 101(36): 13374–13379 [0109] Kim & Kende (2004) Proc. Natl. Acad. Sci. 101 (36): 13374-13379 [0109]
• Current Protocols in Molecular Biology. Verlegt bei Wiley [0130] Current Protocols in Molecular Biology. Published by Wiley [0130]
• Current Protocols in Molecular Biology, Band 1 und 2, Ausubel et al. (1994), Current Protocols [0140] Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel et al. (1994), Current Protocols [0140]
• Current Protocols in Molecular Biology. Verlegt bei Wiley [0160] Current Protocols in Molecular Biology. Published by Wiley [0160]
• Wang et al, (Planta (2003), 218: 1–14) [0171] Wang et al, (Planta (2003), 218: 1-14) [0171]
• Rabbani et al, (Plant Physiol. (2003), 133: 1755–1767) [0171] Rabbani et al, (Plant Physiol. (2003), 133: 1755-1767) [0171]
• Frink et al. (1999) Proc. Natl. Acad. Sci. USA 96(4): 1175–1180 [0174] Frink et al. (1999) Proc. Natl. Acad. Sci. USA 96 (4): 1175-1180 [0174]
• Halpin (2005) Plant Biotech. J. (3): 141–155 [0178] Halpin (2005) Plant Biotech. J. (3): 141-155 [0178]
• Sambrook J, Fritsch EF und Maniatis T (1989), Molecular Cloning, A Laborstory Manual [0221] Sambrook J, Fritsch EF and Maniatis T (1989), Molecular Cloning, A Laboratory Manual [0221]
• Lander et al, (1987), Genomics 1: 174–181 [0221] Lander et al, (1987), Genomics 1: 174-181 [0221]
• Botstein et al, (1980), Am. J. Hum. Genet. 32: 314–331 [0221] Botstein et al, (1980), Am. J. Hum. Genet. 32: 314-331 [0221]
• Bernatzky und Tanksley (1986), Plant Mol. Biol. Reporter 4: 37–41 [0222] Bernatzky and Tanksley (1986), Plant Mol. Biol. Reporter 4: 37-41 [0222]
• Hoheisel et al, In: Non-mammalian Genomic Analysis: A Practical Guide, Academic press 1996,. S. 319–346 [0223] Hoheisel et al, In: Non-mammalian Genomic Analysis: A Practical Guide, Academic Press 1996 ,. Pp. 319-346 [0223]
• Trask (1991), Trends Genet. 7: 149–154 [0224] Trask (1991), Trends Genet. 7: 149-154 [0224]
• Laan et al, (1995), Genome Res. 5: 13–20 [0224] Laan et al, (1995), Genome Res. 5: 13-20 [0224]
• Kazazian (1989), J. Lab. Clin. Med 11: 95–96 [0225] Kazazian (1989) J. Lab. Clin. Med. 11: 95-96 [0225]
• Sheffield et al, (1993), Genomics 16: 325–332 [0225] Sheffield et al, (1993), Genomics 16: 325-332 [0225]
• Landegren et al, (1988), Science 241: 1077–1080 [0225] Landegren et al, (1988), Science 241: 1077-1080 [0225]
• Sokolov (1990), Nucleic Acid Sequence Res. 18: 3671 [0225] Sokolov (1990), Nucleic Acid Sequence Res. 18: 3671 [0225]
• Walter et al, (1997), Nat. Genet. 7: 22–28 [0225] Walter et al, (1997), Nat. Genet. 7: 22-28 [0225]
• „Happy Mapping” (Dear und Cook (1989) Nucleic Acid Sequence Res. 17: 6795–6807) [0225] "Happy Mapping" (Dear and Cook (1989) Nucleic Acid Sequence Res. 17: 6795-6807) [0225]
• http://www.informaxinc.com [0232] http://www.informaxinc.com [0232]
• http://www.informaxinc.com [0233] http://www.informaxinc.com [0233]
• Sambrook (2001), Molecular Cloning: a laboratory manual, 3. Ausgabe, Cold Spring Harbor Laboratory Press, CSH, New York [0239] Sambrook (2001), Molecular Cloning: a laboratory manual, 3rd Edition, Cold Spring Harbor Laboratory Press, CSH, New York [0239]
• Band 1 und 2 von Ausubel et al, (1994) [0239] Volumes 1 and 2 of Ausubel et al, (1994) [0239]
• Plant Molecular Biology Labfax (1993), von R. D. D. Croy, verlegt bei BIOS Scientific Publications Ltd (UK) und Blackwell Scientific Publications (UK) [0239] Plant Molecular Biology Labfax (1993) by RDD Croy, published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK) [0239]
• Altschul et al, (1990), J. Mol. Biol. 215: 403–410 [0240] Altschul et al, (1990), J. Mol. Biol. 215: 403-410 [0240]
• Altschul et al, (1997), Nucleic Acids Res. 25: 3389–3402 [0240] Altschul et al, (1997), Nucleic Acids Res. 25: 3389-3402 [0240]
• BMC Bioinformatics. 2003, 4: 29. MatGAT: an application that generstes similarity/identity matrices using Protein or DNA sequences. Campanella JJ, Bitincka L, Smalley J [0246] BMC Bioinformatics. 2003, 4: 29. MatGAT: an application that generates the most similarity / identity matrices using protein or DNA sequences. Campanella JJ, Bitincka L, Smalley J [0246]
• Gasteiger E et al. (2003) ExPASy: the proteomics server for in-depth Protein knowledge and analysis. Nucleic Acids Res. 31: 3784–3788 [0258] Gasteiger E et al. (2003) ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 31: 3784-3788 [0258]
• van der Knapp et al. (2000) Plant Phys. 122: 695–704 [0259] van der Knapp et al. (2000) Plant Phys. 122: 695-704 [0259]
• Current Protocols in Molecular Biology, Band 1 und 2, Ausubel et al. (1994), Current Protocols [0264] Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel et al. (1994), Current Protocols [0264]
• Kim & Kende (2004) Proc. Natl. Acad. Sci. 101(36): 13374–13379 [0264] Kim & Kende (2004) Proc. Natl. Acad. Sci. 101 (36): 13374-13379 [0264]
• Sambrook (2001) Molecular Cloning: a laboratory manual, 3. Ausgabe Cold Spring Harbor Laborstory Press, CSH, New York [0265] Sambrook (2001) Molecular Cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, CSH, New York [0265]
• Band 1 und 2 von Ausubel et al. (1994), Current Protocols in Molecular Biology [0265] Volumes 1 and 2 of Ausubel et al. (1994), Current Protocols in Molecular Biology [0265]
• Plant Molecular Biology Labfax (1993) von R. D. D. Croy, herausgegeben von BIOS Scientific Publications Ltd (GB) und Blackwell Scientific Publications (GB) [0265] Plant Molecular Biology Labfax (1993) by RDD Croy, published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (GB) [0265]
• Aldemita und Hodges 1996, Chan et al, 1993, Hiei et al, 1994 [0274] Aldemita and Hodges 1996, Chan et al, 1993, Hiei et al., 1994 [0274]
• Ishida et al, (1996) Nature Biotech. 14(6): 745–50 [0285] Ishida et al, (1996) Nature Biotech. 14 (6): 745-50 [0285]
• Ishida et al, (1996) Nature Biotech. 14(6): 745–50 [0286] Ishida et al, (1996) Nature Biotech. 14 (6): 745-50 [0286]
• Babic et al, (1998, Plant Cell Rep. 17: 183–188) [0288] Babic et al, (1998, Plant Cell Rep. 17: 183-188) [0288]
• McKersie et al, 1999, Plant Physiol. 119: 839–847 [0289] McKersie et al, 1999, Plant Physiol. 119: 839-847 [0289]
• Brown DCW und A Atanassov (1985. Plant Cell Tissue Organ Culture 4: 111–112) [0289] Brown DCW and A Atanassov (1985. Plant Cell Tissue Organ Culture 4: 111-112) [0289]
• Walker et al, 1978, Am. J. Bot. 65: 654–659 [0289] Walker et al, 1978, Am. J. Bot. 65: 654-659 [0289]
• McKersie et al, 1999, Plant Physiol. 119: 839–847 [0289] McKersie et al, 1999, Plant Physiol. 119: 839-847 [0289]