EP0751827A1 - Verfahren zur bearbeitung von nukleinsäuren - Google Patents
Verfahren zur bearbeitung von nukleinsäurenInfo
- Publication number
- EP0751827A1 EP0751827A1 EP95913132A EP95913132A EP0751827A1 EP 0751827 A1 EP0751827 A1 EP 0751827A1 EP 95913132 A EP95913132 A EP 95913132A EP 95913132 A EP95913132 A EP 95913132A EP 0751827 A1 EP0751827 A1 EP 0751827A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- temperature
- nucleic acids
- processing
- reaction mixture
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L7/00—Heating or cooling apparatus; Heat insulating devices
- B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
Definitions
- the invention relates to methods for processing nucleic acids using a temperature regulating element and devices and devices for carrying out these methods.
- nucleic acids are known as e.g. B. very specific detection agent for organisms for the diagnosis of diseases well suited.
- Various processing steps, such as denaturation, hybridization, synthesis and immobilization of nucleic acids, and their enzymatic treatment are common during these detection methods. For a long time, a problem with such methods was the small amount of nucleic acids in the samples.
- a solution to this problem which makes a large number of analytes available for detection, brought the amplification of nucleic acids.
- Such a method is described in EP-A-0200362, namely the polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- a large number of copies of the original nucleic acid are produced by repeatedly extending primers in a reaction solution. These can be detected for example by hybridization with a labeled nucleic acid probe according to EP-A-0201 184.
- the reaction solutions used for this purpose are heated to specific temperatures or cooled again at intervals to separate double strands and for the extension reaction. Because the volumes are relatively large, the times for temperature regulation require a relatively long time for carrying out the entire amplification process.
- capillary PCR tries to remedy this.
- the reaction mixture is in glass capillaries with a small diameter.
- the time for carrying out an amplification sequence can be reduced to approximately 30 minutes.
- a problem with capillary PCR is the vulnerability of the glass of the capillary to be heated and the difficult to handle sample application.
- More and more amplification methods have recently been described, in which the amplification reactions can be carried out in a closed system, ie without the addition of reagents during the cycles.
- WO 92/07089 describes a system in which the amplification mixture is kept in a circulatory system for as long as necessary by repeatedly heating and cooling the reaction mixture.
- the residence time of the mixture in the individual zones of the system can be influenced by the choice of the diameter.
- EP 0511712A1 describes an amplification process in which the amplification mixture is cyclically brought to very specific temperatures in order to achieve relatively short cycle times. Sample handling is also difficult here.
- One of the objects of the present invention was to improve the existing nucleic acid processing methods and in particular to provide methods in which the amplification can be completed in a particularly short time.
- the invention therefore relates to a method for processing and, in particular, multiplying nucleic acids in a reaction mixture, characterized in that the temperature of a surface adjacent to the reaction mixture and its immediate surroundings is regulated, but the main space of the reaction mixture remains essentially isothermal.
- the invention also relates to a device for processing and multiplying nucleic acids with a temperature regulating element and a device which contains this device.
- Nucleic acids in the sense of the invention are all types of nucleic acids, modified or unmodified. Unmodified nucleic acids are, for example, the naturally occurring nucleic acids. Modified nucleic acids can be created by exchanging groups of the natural nucleic acids for other chemical residues. Examples are nucleic acid phosphonates or phosphothioates and nucleic acids modified on the sugar residues or the bases by chemical groups, which can also be detectable.
- the processing of nucleic acids according to the present invention preferably contains at least one reaction step which takes place at an elevated temperature, but at least at a temperature which deviates from the ambient temperature.
- reaction steps are, for example, the thermal denaturation of partially or completely double-stranded nucleic acids. It is used to manufacture single strands or to Melt secondary structures that heat nucleic acids to temperatures above the corresponding melting point.
- a further processing step of nucleic acids is the hybridization of mutually complementary nucleic acids in single-stranded areas to form a double-stranded nucleic acid (hybrid). This takes place at temperatures below the melting point of the hybrid. In order to achieve hybridization, the reaction mixture often has to be cooled.
- a further processing step is carried out, namely the extension of a primer hybridized to a so-called template nucleic acid (template) with the aid of further mono- or oligonucleotides.
- template nucleic acid template nucleic acid
- the temperature at which the corresponding enzyme used has its optimum activity or competitive reactions are reduced is preferably set here. This temperature can also be identical to the hybridization temperature (2-stage PCR).
- a special case of processing nucleic acids is the multiplication of nucleic acids.
- practically all amplification methods eg. B. target sequence-dependent amplifications (in particular non-isothermal amplifications such as the polymerase chain reaction, ligase chain reaction or similar) are carried out.
- At least one of the temperature-sensitive processing steps mentioned above also takes place during these propagation processes.
- a central feature of the present invention is the fact that the change in temperature does not take place in the entire reaction mixture, but only in a very small part of the reaction mixture. The consequence of this is that the heating up or cooling down of this relatively small area can take place very quickly and thus the processing of the nucleic acids is greatly accelerated.
- the reaction mixture is therefore brought into contact with a temperature-controllable surface. By changing the temperature of the surface, the immediate surroundings of this surface are heated, adjusted or cooled, depending on the processing step and the temperature of the reaction mixture. There are several cases here.
- the surface can be cooled in order to achieve hybridization of the nucleic acids in the surrounding area.
- the surface and thus the immediate surroundings can first be heated to a temperature where the primer can be extended. The temperature can then be raised above the melting point of the nucleic acids, as a result of which denaturation and strand separation of the double-stranded nucleic acids formed can take place. This can be followed by cooling to a temperature at which the single strands can hybridize with new primers. This cycle can be run through several times.
- the temperature on the surface is first increased in order to separate double strands. The temperature is then reduced to a temperature at which the individual strands hybridize with primers. The optimum temperature for the extension is then set and, if desired, the cycle is repeated.
- the desired temperature can be maintained for a set period of time, e.g. B. until the desired reactions have occurred on the surface.
- the temperature of the surface can also be kept constant by known control measures and connected control measures (reheating, cooling).
- the time periods depend on the length of the nucleic acids to be processed and their homology, as well as the special hybridization conditions.
- the person skilled in the art can determine the optimal periods of time by simple experiments. Depending on the processing step, the periods are between fractions of a second and a few seconds.
- the main space of the reaction mixture remains essentially isothermal, while the reaction mixture located in the immediate vicinity of the surface adapts to the temperatures set on the surface.
- the surface of a device which consists of a heating element and a cooling element.
- the heating element preferably has a relatively large surface area with a comparatively low heat capacity.
- Metal foils for example, have proven to be suitable, which can be heated in a suitable manner, e.g. B. by electrical Electricity. Materials for the metal foil are good heat-conducting materials, e.g. B. gold, preferred.
- the cooling element should have a comparatively high heat capacity.
- Solid, liquid or gaseous substances are suitable as cooling medium.
- Liquid cooling media e.g. B. water.
- Good thermal conductivity is an advantage.
- the arrangement of the heating element and the cooling element can be changed in accordance with the temperature of the reaction medium, depending on whether the device is to be used more for heating or for cooling the surface and its immediate surroundings. In general, however, the heating element will be located in close proximity to the surface. The surface of the heating element can also directly adjoin the reaction mixture. However, it is also possible to separate the heating element from the reaction mixture by means of a thin, thermally conductive layer.
- the cooling element can in principle be positioned at any point with which the surface and the immediate surroundings can be cooled. However, it has proven to be preferred to position the cooling element on the side of the heating element remote from the reaction mixture. In the event that the heating element has a low heat capacity, the fact that the heating element also has to be cooled is not a decisive disadvantage.
- the heating element is used for heating until the surface and its immediate surroundings are heated to the desired temperature.
- a strong temperature gradient will form near the surface, while the rest of the reaction mixture remains isothermal. This applies in particular if no remarkable liquid exchange is realized during the heating process, but also if a liquid exchange takes place.
- the heating process can be completed within fractions of a second, in favorable cases even milliseconds. The same applies to cooling.
- the reaction space, which is heated to the desired temperature can be very small, preferably it is less than 0.2 mm, particularly preferably less than 0.5 ⁇ m deep.
- the surface of the heating element which is directed onto the reaction mixture influences the depth of the temperature gradient and its rate of build-up. A preferred size of the surface can result from the desired applications of the method.
- the surface is ⁇ 2 cm ⁇ , particularly preferably between 0.2 cm ⁇ and 0.2 mm ⁇ .
- the surface can be smooth or rough.
- the volume of the reaction mixture is practically not of great importance for the invention. This can be a drop with a volume of 20 ⁇ l, but it can also be any volume. It is an advantage of the method according to the invention that the device containing the heating and cooling element can, for example, also be introduced into a large vessel with reaction mixture, the essential reactions taking place only in a very small boundary region of the surface, while the rest of the reaction space has practically no influence on the reaction. On the other hand, the available samples and reagent quantities represent a practical limit for the size of the reaction mixture.
- the reaction volumes will therefore usually be in a range between 1 ml and 30 ⁇ l, preferably between 100 ⁇ l and 50 ⁇ l, but can be applied, for example of the reaction mixture on the temperature-regulating surface also work with much smaller volumes.
- nucleic acids For processing the nucleic acids, they are brought to the temperature-regulatable surface or its immediate surroundings. This can be done in various ways, for example mechanically or by diffusion.
- the nucleic acids are preferably bound to the surface. This binding again can be of different types. A chemical bond is preferred, either via adsorption or biospecific interactions.
- the surface can be coated with a nucleic acid-binding reagent. Biospecific interactions can be interactions between nucleic acids and the nucleic acids to be processed (hybridization, complementary part of these nucleic acids), but also interactions between antigens or haptens with antibodies directed against them and receptor-ligand interactions.
- a preferred way of binding the nucleic acids to be processed to the surface is via oligonucleotides which are covalently bound to the surface and which are complementary to at least part of the nucleic acid to be processed.
- these oligonucleotides can also have biospecific interactions, e.g. B. biotin streptavidin, bound to the surface.
- the binding of the nucleic acids to be processed is preferably reversible.
- the nucleic acids can be heated by heating the surface and its immediate exercise can be released again. Any steps can be carried out between binding and releasing the nucleic acid, e.g. B. Implementation of chemical reactions, but also separation of the bound nucleic acids from the original reaction mixture and transfer to a new reaction mixture.
- the oligonucleotides bound to the surface can be used as primers for the elongarion or extension using the nucleic acid to be processed as a template.
- the nucleic acid used as a template can be detached from the extension product by increasing the temperature and can act as a template for a new immobilized primer which has not yet been extended in the next temperature cycle. In this way it is possible to extend a large amount of primers immobilized on the surface and thus to produce copies of parts of the nucleic acid to be processed.
- the extended (extended) surface-primers serve in turn by means of complementary primers to multiply the molecules serving as the template.
- the reagents required for the reactions to be carried out must be kept in stock in the entire reaction mixture or added as required.
- the deoxyribonucleotides, a DNA polymerase and another primer and suitable buffer reagents must therefore be kept in the reaction mixture.
- other reagents e.g. B. ribonucleotides or RNA-dependent polymerases are provided. This step of the process can take particular account of the working temperature of the processing enzyme.
- the nucleic acids to be processed can also be bound to the surface by physical methods, e.g. B. by means of a magnet. To do this, however, the nucleic acids must be bound to a magnetizable particle.
- the binding of magnetic particles loaded with nucleic acid can be made reversible in that a magnet is located behind the surface or is induced.
- the magnetic parts can be bound to or removed from the surface by applying an alternating field.
- the efficiency can be increased by increasing the diffusion of the nucleic acids in the reaction mixture by convection. It can also be partial to use higher concentrations of the reactants compared to the reaction mixtures usually used.
- the nucleic acid to be processed can be concentrated on the surface by prehybridization at the start of the reaction.
- thermostable polymerase is therefore not absolutely necessary for a multiplication reaction and nevertheless new enzyme does not have to be pipetted into the reaction mixture in every amplification cycle.
- nucleic acids can either be examined in the state bound to the surface or in the released state again, or processed with further reagents.
- a method for the detection of nucleic acids in a sample can thus be formed in a simple manner.
- the surface to which the oligonucleotides functioning as primers are bound is brought into contact with the sample liquid.
- the temperature of the surface and its immediate surroundings is then brought to a temperature which is above the melting point of the double-stranded nucleic acid contained in the sample.
- the nucleic acid to be detected will hybridize with the oligonucleotide.
- the nucleic acid to be detected is used to produce a large number of copies which can remain bound to the surface at the end of the multiplication reaction.
- the amount of nucleic acids on the surface can be determined by hybridization with labeled nucleic acid probes and their detection with the aid of the label. For methods that allow the direct detection of nucleic acid hybrids without labeling or of extended single strands (primers) (e.g. based on the principle of surface plasmon resonance) direct evidence is also possible. If labeled primers or mononucleotides are used for the multiplication reaction, the hybridization with a detectably labeled nucleic acid probe is omitted. An approach is also conceivable in which a higher temperature is maintained in the approach and the surface, which assumes lower temperatures necessary for further steps.
- the invention also relates to a device which can be used for use in the machining method mentioned above.
- the subject of the invention is a device for processing nucleic acids by means of a temperature regulating element, this element being suitable for regulating the temperature of the surface and the immediately adjacent surroundings and wherein means for processing the nucleic acids can be bound to this.
- These agents can be oligonucleotides and serve, for example, as primers.
- This device preferably contains a cooling element and a heating element, the arrangement preferably being as in the processing method described above.
- This device is preferably very small. For example, it can have a thickness of ⁇ 5 mm and an area of ⁇ 10 cm 2 .
- the elements therein, such as the cooling element or the heating element are simple components.
- this device is excellently suitable for single use (disposable), which can reduce the inherent contamination risk for reusable. If the device is to be suitable for multiple use, it is also possible to separate the heating element from the space containing the reaction mixture by means of a very thin component and to make this component separable from the device. A new component can then be used for a further processing stage.
- the invention also relates to a device for processing nucleic acids which contains a control element for time-dependent temperature regulation and a device according to the invention.
- the control element of a so-called thermal cycler according to EP-A-0236 069 can be used as the control element, but control based on the principle of inkjet printers is preferred, since they have a higher control speed.
- the control element must be able to heat the heating element at predetermined intervals until the surroundings of the surface have a sufficient temperature.
- it must be able to the cooling element to provide cooling on the surface at predetermined intervals.
- a cooling liquid can be passed through the device. If the heat capacity of the heating element is low, but the heat output is relatively high, continuous cooling is also possible.
- the surface to be tempered is located on a preferably black base, preferably a plastic film, which is heated from the distal surface to be tempered by a laser beam, preferably an infrared laser.
- a laser beam preferably an infrared laser.
- Both the surface to be tempered and the heat-absorbing and heat-conducting material can be attached to a support surface, preferably infrared-transparent glass.
- the device according to the invention can have a wide variety of embodiments. For example, it can be designed for immersion in a vessel. However, it can also be designed such that the liquid containing the nucleic acid to be processed can be dripped onto the surface or filled into a vessel formed by the surface. This reaction space can also be closed after the liquid has been poured in, so that contamination problems can be reduced.
- One embodiment of the invention is a method for increasing nucleic acids.
- Another embodiment of the method according to the invention is a method for enriching nucleic acids e.g. B. by hybridization.
- a hybridization temperature can be specified such that a specific binding of the nucleic acid to be analyzed is specified to the primers used for hybridization which are covalently bound to the surface. This method can be used for this
- This method can also be used to transfer nucleic acids from one solution to another. Then hybridization takes place in the first vessel (low temperature) and denaturation (higher temperature) takes place in the second vessel.
- Another embodiment of the present invention is a method for sequencing nucleic acids.
- One possible application of the invention in connection with sequence analyzes is the so-called mini-sequence analysis.
- the exact sequence determination of the nucleic acid nucleotide adjacent to the primer can be carried out by adding only dideoxynucleotides and no deoxynucleotides for sequencing in the solution provided for sequencing.
- the four possible dideoxynucleotides ddATP, ddCTP, ddGTP and ddTTP are labeled with different fluorescent markers.
- the incorporation of the next nucleotide leads to the termination of the sequence reaction and after the extended primer located on the surface has been agreed, the sequence of the nucleotide on the primer can be determined by analyzing the specific fluorescence.
- a special case of the possibilities of using the present invention is a method for sequencing nucleic acids which have previously been amplified in a PCR reaction. After amplification, the amplified product is covalently bound to the reactive surface in double-stranded form via the primer. By briefly going through a high-temperature phase, this amplificate is present in single-stranded form through denaturation, can be cleaned by transferring it into a washing solution, and can then be used again by transferring it to a sequencing reaction for subsequent sequencing. This sequencing is particularly efficient since only single-stranded matrix material is now available, to which a pair of sequencers will bind particularly efficiently.
- FIG. 1 shows the construction diagram of a device (1) according to the invention, which is immersed in a reaction vessel (3) filled with reaction mixture (2).
- the device contains a cooling element (4) and a heating element (5) which can be heated by means of electricity.
- Oligonucleotides (6) are covalently bound to the surface of the heating element. Both the cooling and the heating element can be regulated via connections (7; 8) on control units.
- FIG. 2 shows an exemplary temperature profile for an amplification reaction according to the type of PCR.
- a first phase the nucleic acids are denatured at a temperature slightly below 100 ° C.
- a phase the hybridization of the nucleic acids to be amplified with the immobilized oligonucleotides takes place on the solid phase at about 50 ° C.
- the primers are extended at about 70 ° C using the nucleic acid as a template.
- FIG. 3 shows the reactions taking place in the immediate vicinity of the surface (phases A to C).
- phase (A) three isotherms are shown in their schematic course, for phase (B) and (C) only one isotherm each.
- phase (A) the nucleic acids are denatured and diffuse single-stranded over a certain time, in phase (B) templates and primers hybridize and in phase (C) primers are extended along the matrices.
- FIG. 4 shows a possible prototype of a surface temperature control suitable for the application according to the invention.
- the heating unit which contains the exchangeable heated gold surfaces as well as the physical requirements for cooling or heating (coolant connection, power connection), is connected to the actual measuring units (1) by means of plug connections (7; 8) with the brackets also attached to them Reaction vessels (11) are attached, in which the matrix molecules, buffer components and primers necessary for carrying out the reaction are in solution and the polymerase is present.
- the sensors (9), here in the form of a test strip, contain, for example, gold surfaces (5) in FIG. 4, which do not have to be coated with the same primers (6).
- a cross section through this measuring unit is shown in the lower part of the figure, on which the cooling circuit (4) used for cooling with stirring mechanism (12) and cooling liquid (13) as well as the reaction surfaces (5, 6) with electronic connection can recognize.
- the cooling circuit (4) used for cooling with stirring mechanism (12) and cooling liquid (13) as well as the reaction surfaces (5, 6) with electronic connection can recognize.
- the cathode connection of the gold membrane (5) with a support and separation filter (14) and an adhesive layer for the oligonucleotides (6) can be seen.
- FIG. 6 consists of a schematic drawing of the temperature gradient which forms in the immediate vicinity of the adhesive layer with oligonucleotides and the temperature profile to be expected, here using the example of a 3-stage PCR in which the temperatures are 96 ° for 0.1 seconds, 54 ° for 0.5 seconds and 72 ° are also shown for 0.5 seconds.
- An exemplary cyclically temperable gold surface can be obtained by milling two approximately 1 mm wide and 3 mm long elongated holes parallel to one another at a distance of 3 mm in a thin circuit board.
- these elongated holes are conductively connected to one another by vapor deposition with gold.
- one of these elongated holes is connected to the anode via the printed circuit board traces, and the other is also connected to the cathode via the printed circuit board runs.
- the gold layer on the proximal side is applied by applying a mask of the desired size, in this case 3 x 3 mm flush, over the two longitudinal surfaces.
- the inside of the longitudinal surface is galvanically coated with copper up to the surface.
- the two electrically conductive longitudinal holes are now coated with a gold layer a few ⁇ m thick. The coating process is described below:
- the layer thickness of the gold is 300 nm.
- the multi-gold sports plate was coated with "thinned" biotinthiol binding layers to form a hydrophobic SAM layer.
- biotin thiol compound H-C12-DADOO-biotin; N, N "- (12-mercaptodc ⁇ ecylyl-biotmylyl ⁇ jT-diaminoethyl-glycol diether; 2.94 mg; 5x10-5 m
- the diluent (12-mercaptoundecanol, 9.2 mg, 4.5x10 " ⁇ m) were dissolved in 100 ml of ethanol pa.
- the freshly coated polycarbonate foils were immersed in this solution. After 4 hours the plates were removed, washed twice with ethanol pa and immediately coated with streptavidin.
- the very thin thickness of the gold layer results in a very small conductive gold cross section (3 mm x 3 ⁇ m over a distance of 3 mm). This gold layer therefore represents a relatively high resistance compared to the conductor tracks.
- the conductor tracks are now connected to a power supplier which, with the aid of a computer, allows the ohmic induced temperature of the gold surface to be checked.
- the cover layer which isolates the measuring meander from platinum
- a platinum temperature sensor PT 100
- PT 100 platinum temperature sensor
- this sensor can also be used as a thermal source for the evaporated gold layer. To do this, it is necessary to forward the current and voltage at the platinum sensor to a controller via an analog divider.
- the controlled variable of the controller is the resistance of the heated platinum element, which permits exact temperature control when the gold surface temperature has been normalized with the temperature of the platinum meander.
- An exemplary device for measuring the surface temperature of the gold foil (variant a).
- a gold foil according to Example 1, variant a is covered with a mask which allows the gold foil to be vapor-deposited with an approximately 1 mm wide gold thread which extends beyond this gold surface and can be connected to a measuring point.
- the metal thread lies at the same point on the gold surface as the gold thread at (200 nm thick), but separates in its course when it leaves the gold surface to be tempered and leads as a separate metal thread (300 nm thick) to a second measuring point.
- This arrangement of the measuring probes made of gold and a further metal or alloy suitable for temperature measurement allows the measurement of the thermal voltage (2.2 mV / 100 ° Kalvin) in the area of the gold foil where the two Probe thread overlap.
- the temperature at the cold junction is measured with a thermal precision PT 1000 element (accuracy> 1%) and standardized to 10 V (0 V corresponds to 0 °, 10 V corresponds to 100 °), only amplified and also to 10 V standardized.
- the sum of both temperatures is formed in a sum amplifier and used for the electronic control of the respective surface temperature.
- An exemplary device for measuring the surface temperature of the gold surface from example 1, variant b.
- the surface temperature of the gold layer there is the possibility of pressing the surfaces of two gold-vaporized PT 100 measuring sensors as described in example 1, variant b, in such a way that half of the gold-vaporized surfaces of the heating sensor and the Measuring sensor cover each other and the remaining area is in the surrounding medium. If only one sensor is used for measurement and the other for heating, then the temperature of the gold surfaces can be calculated exactly.
- the temperature at the surface of the sensors corresponds exactly to the mean value of the temperature of the heated and of the unheated sensor, both of which can be precisely defined via resistance measurements. In this way, using a temperature sensor used for the measurement, a whole series of temperable surfaces can be calibrated and prepared for carrying out PCR reactions.
- the temperature gradient of two surfaces arranged in this way is approximately 3 ° C. between the heated and unheated surface.
- An exemplary implementation of a polymerase chain reaction uses a surface-fixed, biotin-labeled primer (5 -GAAGGGAGGAAGGAGGGAGCGGAC-3 '). This primer is coupled via its biotin group located at the 5 'end to a surface streptavidin or gold streptavidin surface. The molar amount of streptavidin or biotin / square millimeter is approximately 0.2 pmol / mm 2 .
- nanogram amounts or less of the following double or single-stranded template molecule in solution (only one strand cited: 5'-GAAGGGAGGAAGGAGGGAGCGGACGTCCACCACCACCCAACCACCCCACCC -3 ') and a counterprimer in the concentration of between 0.5 ⁇ M to 2 ⁇ M.
- the reaction takes place in commercially available PCR buffer (Boehringer Mannheim, package insert for the enzyme, 8th edition, ID number 1146165) at 1.5 mMMg 2+ .
- a commercially available Taq DNA polymerase (Boehringer Mannheim, ID number 1146165) was used as the polymerase in a concentration of 20 nM.
- the counterprimer present in solution (5 3GGTGGGGTGGTTGGGTGGTGGTG-3 ') was digoxigenin-labeled at its 5' end (patent EP 0324474).
- the PCR reaction took place at a constant solution temperature of 68 ° and a primer-coated surface which varied cyclically between 96 and 68 °.
- the cyclical duration of the higher temperature varied in our example between 0.1 seconds, 10 seconds and 1 minute, that of the lower temperature between 0.5 seconds, 20 seconds and 1 minute.
- the solution was cooled to room temperature, only the complementary elongated biotin and elongated digoxigenin-labeled primers hybridizing with one another and forming double-stranded DNA fragments.
- the surfaces were reacted with anti-Dig-POD, incubated for 30 minutes, washed again and treated with ABTS (staining protocol according to package insert item 3 for the Boehringer Mannheim reverse transcriptase assay, non-radioactive, ID number 1468120).
- ABTS staining protocol according to package insert item 3 for the Boehringer Mannheim reverse transcriptase assay, non-radioactive, ID number 1468120.
- the resulting colored product was quantified in an ELISA photometer at a wavelength of 405/490 nanometers.
- An exemplary device according to this invention consists of three structural units. These three structural units are:
- the element surface described in this example consists of a thin gold foil with a thickness of less than half a millimeter, which is firmly connected to a streptavidin layer.
- the biotin-labeled oligonucleotides necessary for the further processing steps can in turn be attached to this dextran layer by affinity coupling. These oligonucleotides are then covalently coupled to the surface via their 5'-phosphate end and thus have a reactive 3 'end which is accessible to enzymes.
- This gold foil which can be structurally stabilized by a supporting plastic net, and which has a reactive surface of about 5 x 5 mm, also serves as a heating element, since it is connected to an electrical power source which, when current flows, spontaneously heats this gold foil leads.
- the cooling element is located distal to the reaction batch, behind the gold foil.
- the cooling element consists of a plastic channel with a 7 mm wide surface bordering the gold foil. The channel is 2 mm deep and extends over the entire length of the part of the device referred to here as the sensor, which in this case comprises the heating and cooling elements and the reactive surface.
- This channel extends from one end of the sensor to the other end of the sensor to which the reactive surface is attached and back by enclosing a web separating the two channels.
- a suitable cooling liquid for. B. water circulated.
- the entire unit is cast in hard plastic and recyclable, i. H. both the gold foil and the plastic are recyclable.
- the control of both the heating of the reactive surface, as well as the circulation speed and pre-cooling temperature of the cooling liquid is carried out via an electronic third component, which is attached outside the sensor, made.
- This third unit also includes the storage container and the connection connections for the cooling liquid.
- this third unit there is also a micropump, which is responsible for circulating the coolant.
- the example of an application of the device according to the invention here is an amplification reaction, referred to as a polymerase chain reaction, from a predetermined nucleic acid sequence.
- a polymerase chain reaction For this nucleic acid sequence, two primers with a length of 16 bases each, which code at a distance of 4 nucleotides to one another, have been selected.
- One primer is identical in its sequence, the other complementary to the analyzing sequence.
- the primer referred to here as identical is coupled to the reactive surface via its biotin residue present at the 5 'end.
- the other, complementary primer and all other reagents that are usually used in a so-called PCR reaction are added to the reaction mixture.
- the reaction is started by entering the corresponding reaction temperatures which should prevail in the immediate vicinity of the reactive surface and by immersing the reactive surface or the sensor (see Example 4) in the reaction mixture.
- the temperature changes in the reactive surface are programmed so that 50 heating and cooling cycles can be carried out in about 1 minute.
- the surface is cleaned of all non-covalently bound reaction partners.
- the surface cleaned in this way which now only contains primer molecules and extended primer molecules, is introduced for analysis, together with the sensor, into a device which, according to the principle of plasmon resonance, allows a direct determination of the amount of the extended product.
- measuring unit 1. Device according to the invention, measuring unit
Description
Claims
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE4409436A DE4409436A1 (de) | 1994-03-19 | 1994-03-19 | Verfahren zur Bearbeitung von Nukleinsäuren |
DE4409436 | 1994-03-19 | ||
PCT/EP1995/000975 WO1995025592A1 (de) | 1994-03-19 | 1995-03-16 | Verfahren zur bearbeitung von nukleinsaüren |
Publications (2)
Publication Number | Publication Date |
---|---|
EP0751827A1 true EP0751827A1 (de) | 1997-01-08 |
EP0751827B1 EP0751827B1 (de) | 1998-08-19 |
Family
ID=6513253
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP95913132A Expired - Lifetime EP0751827B1 (de) | 1994-03-19 | 1995-03-16 | Verfahren zur bearbeitung von nukleinsäuren |
Country Status (7)
Country | Link |
---|---|
US (1) | US5985555A (de) |
EP (1) | EP0751827B1 (de) |
JP (1) | JP3591653B2 (de) |
AT (1) | ATE169844T1 (de) |
DE (2) | DE4409436A1 (de) |
ES (1) | ES2123239T3 (de) |
WO (1) | WO1995025592A1 (de) |
Families Citing this family (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2226776C (en) * | 1995-07-31 | 2007-11-27 | Hideji Tajima | Multi-vessel container for testing fluids |
DE19610146C1 (de) * | 1996-03-15 | 1997-06-12 | Wolf Prof Dr Bertling | Vorrichtung zur Untersuchung von biologischen und medizinischen Proben |
US5912129A (en) * | 1998-03-05 | 1999-06-15 | Vinayagamoorthy; Thuraiayah | Multi-zone polymerase/ligase chain reaction |
US6171850B1 (en) | 1999-03-08 | 2001-01-09 | Caliper Technologies Corp. | Integrated devices and systems for performing temperature controlled reactions and analyses |
US6403317B1 (en) * | 1999-03-26 | 2002-06-11 | Affymetrix, Inc. | Electronic detection of hybridization on nucleic acid arrays |
US6544477B1 (en) | 2000-08-01 | 2003-04-08 | Regents Of The University Of Minnesota | Apparatus for generating a temperature gradient |
DE10315074A1 (de) * | 2003-04-02 | 2004-10-14 | Clondiag Chip Technologies Gmbh | Vorrichtung zur Vervielfältigung und zum Nachweis von Nukleinsäuren |
US20060258021A1 (en) * | 2003-08-12 | 2006-11-16 | Arizona Board Of Regents, A Body Corporate, Acting For And On Behalf Of Arizona State University | Biocompatible linkers for surface plasmon resonance biosensors |
US7622296B2 (en) | 2004-05-28 | 2009-11-24 | Wafergen, Inc. | Apparatus and method for multiplex analysis |
US7939312B2 (en) * | 2006-08-30 | 2011-05-10 | Dxna Llc | Rapid thermocycler with movable cooling assembly |
WO2008091626A1 (en) | 2007-01-22 | 2008-07-31 | Wafergen, Inc. | Apparatus for high throughput chemical reactions |
US10641772B2 (en) | 2015-02-20 | 2020-05-05 | Takara Bio Usa, Inc. | Method for rapid accurate dispensing, visualization and analysis of single cells |
EP3487616B1 (de) | 2016-07-21 | 2023-08-09 | Takara Bio USA, Inc. | Multi-z-bildgebung von wells von multi-well-geräten und flüssigkeitsabgabe in die wells |
DE102018103215B3 (de) * | 2018-02-13 | 2019-08-14 | Gna Biosolutions Gmbh | Verfahren und Vorrichtung zur Extraktion einer Nukleinsäure aus einer Probenflüssigkeit |
DE102019114011B3 (de) * | 2019-05-07 | 2020-07-30 | Gna Biosolutions Gmbh | Verfahren und Vorrichtung zum Extrahieren und/oder Vervielfältigen einer Target-Nukleinsäure |
DE102020118516A1 (de) | 2020-06-26 | 2021-12-30 | Gna Biosolutions Gmbh | Verfahren und Vorrichtung zur Extraktion und Amplifikation einer Target-Nukleinsäure |
Family Cites Families (35)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5261545A (en) * | 1978-06-29 | 1993-11-16 | Yoshino Kogyosho Co., Ltd. | Polyester container |
US4256945A (en) * | 1979-08-31 | 1981-03-17 | Iris Associates | Alternating current electrically resistive heating element having intrinsic temperature control |
JPS60241884A (ja) * | 1984-05-15 | 1985-11-30 | Tokyo Daigaku | 自動サイクリング反応装置およびこれを用いる自動分析装置 |
US5038852A (en) * | 1986-02-25 | 1991-08-13 | Cetus Corporation | Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps |
US4965188A (en) * | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
US5089406A (en) * | 1987-01-07 | 1992-02-18 | Allied-Signal Inc. | Method of producing a gene cassette coding for polypeptides with repeating amino acid sequences |
DE3853678T2 (de) * | 1987-02-26 | 1995-08-31 | Univ Sydney | Verfahren zum nachweis des karzinogenen menschlichen papillomavirus. |
US4902624A (en) * | 1987-11-23 | 1990-02-20 | Eastman Kodak Company | Temperature cycling cuvette |
FI79342C (fi) * | 1987-12-23 | 1989-12-11 | Orion Yhtymae Oy | Apparat, del av en apparat och foerfarande foer maongfaldigande av nukleinsyror. |
JP2939485B2 (ja) * | 1988-09-08 | 1999-08-25 | ザ・ソーク・インスチュート・フォーバイオロジカル・スタディーズ | 複製rnaに基づく増幅/検出系 |
US4865986A (en) * | 1988-10-06 | 1989-09-12 | Coy Corporation | Temperature control apparatus |
US4950608A (en) * | 1989-04-25 | 1990-08-21 | Scinics Co., Ltd. | Temperature regulating container |
CA2016981C (en) * | 1989-06-12 | 1994-09-27 | Mark Joseph Devaney, Jr. | Temperature control device and reaction vessel |
WO1991004340A1 (en) * | 1989-09-20 | 1991-04-04 | Cambridge Biotech Corporation | In vitro, isothermal nucleic acid amplification |
US5346672A (en) * | 1989-11-17 | 1994-09-13 | Gene Tec Corporation | Devices for containing biological specimens for thermal processing |
WO1991007504A1 (en) * | 1989-11-21 | 1991-05-30 | Kindconi Pty. Ltd. | Improved dna polymerisation device |
US5427930A (en) * | 1990-01-26 | 1995-06-27 | Abbott Laboratories | Amplification of target nucleic acids using gap filling ligase chain reaction |
ES2116977T3 (es) * | 1990-05-11 | 1998-08-01 | Microprobe Corp | Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente. |
US5187084A (en) * | 1990-06-22 | 1993-02-16 | The Dow Chemical Company | Automatic air temperature cycler and method of use in polymerose chain reaction |
DE4029004C1 (de) * | 1990-09-13 | 1992-04-02 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften Ev, 3400 Goettingen, De | |
RU2017821C1 (ru) * | 1990-10-10 | 1994-08-15 | Анатолий Михайлович Онищенко | Способ амплификации днк и устройство для его осуществления |
DE4034036C2 (de) * | 1990-10-26 | 1994-03-03 | Diagen Inst Molekularbio | Vorrichtung und Verfahren zur Isolierung von Nukleinsäuren aus Zellsuspensionen |
KR100236506B1 (ko) * | 1990-11-29 | 2000-01-15 | 퍼킨-엘머시터스인스트루먼츠 | 폴리머라제 연쇄 반응 수행 장치 |
US5270183A (en) * | 1991-02-08 | 1993-12-14 | Beckman Research Institute Of The City Of Hope | Device and method for the automated cycling of solutions between two or more temperatures |
CA2065719A1 (en) * | 1991-04-30 | 1992-10-31 | John B. Findlay | Nucleic acid amplification and detection methods using rapid polymerase chain reaction cycle |
WO1992020778A1 (en) * | 1991-05-24 | 1992-11-26 | Kindconi Pty Limited | Biochemical reaction control |
CA2218875C (en) * | 1991-07-23 | 2000-11-07 | The Research Foundation Of State University Of New York | Improvements in the in situ pcr |
DE4213029A1 (de) * | 1991-09-26 | 1993-04-01 | Boehringer Mannheim Gmbh | Verfahren zur spezifischen vervielfaeltigung von nukleins aeuresequenzen |
ATE192503T1 (de) * | 1991-12-24 | 2000-05-15 | Tepnel Medical Ltd | Manipulation von nukleinsäuresequenzen |
JPH05236997A (ja) * | 1992-02-28 | 1993-09-17 | Hitachi Ltd | ポリヌクレオチド捕捉用チップ |
US5587128A (en) * | 1992-05-01 | 1996-12-24 | The Trustees Of The University Of Pennsylvania | Mesoscale polynucleotide amplification devices |
US5498392A (en) * | 1992-05-01 | 1996-03-12 | Trustees Of The University Of Pennsylvania | Mesoscale polynucleotide amplification device and method |
GB9212164D0 (en) * | 1992-06-09 | 1992-07-22 | Medical Res Council | Preparation of nucleic acids |
WO1994001529A1 (en) * | 1992-07-01 | 1994-01-20 | Keiichi Katoh | Ceramic heating/cooling device |
DE4301693A1 (de) * | 1993-01-22 | 1994-07-28 | Cytech Biomedical Inc | Verfahren zur Amplifikation und Verfahren zum Nachweis von Polynucleotidsequenzen an fester Phase |
-
1994
- 1994-03-19 DE DE4409436A patent/DE4409436A1/de not_active Withdrawn
-
1995
- 1995-03-16 DE DE59503269T patent/DE59503269D1/de not_active Expired - Fee Related
- 1995-03-16 JP JP52436495A patent/JP3591653B2/ja not_active Expired - Fee Related
- 1995-03-16 ES ES95913132T patent/ES2123239T3/es not_active Expired - Lifetime
- 1995-03-16 AT AT95913132T patent/ATE169844T1/de not_active IP Right Cessation
- 1995-03-16 WO PCT/EP1995/000975 patent/WO1995025592A1/de active IP Right Grant
- 1995-03-16 US US08/704,682 patent/US5985555A/en not_active Expired - Fee Related
- 1995-03-16 EP EP95913132A patent/EP0751827B1/de not_active Expired - Lifetime
Non-Patent Citations (1)
Title |
---|
See references of WO9525592A1 * |
Also Published As
Publication number | Publication date |
---|---|
JP3591653B2 (ja) | 2004-11-24 |
DE4409436A1 (de) | 1995-09-21 |
WO1995025592A1 (de) | 1995-09-28 |
ES2123239T3 (es) | 1999-01-01 |
ATE169844T1 (de) | 1998-09-15 |
EP0751827B1 (de) | 1998-08-19 |
JPH09510353A (ja) | 1997-10-21 |
US5985555A (en) | 1999-11-16 |
DE59503269D1 (de) | 1998-09-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0751827B1 (de) | Verfahren zur bearbeitung von nukleinsäuren | |
EP1054735B1 (de) | Miniaturisierter temperaturzonen flussreaktor | |
EP0764468A2 (de) | System zur Temperaturwechselbehandlung von Probenflüssigkeiten | |
DE69634175T2 (de) | Auf silikon basierende mantelvorrichtungen für chemische reaktionen | |
EP2256478B1 (de) | Vorrichtung und verfahren zum nachweis von molekularen wechselwirkungen | |
DE60217375T2 (de) | Verfahren und vorrichtung zur amplifikation von nukleinsäuresequenzen mittels thermischer konvektion | |
EP0539369B1 (de) | Platte mit einer mehrzahl von mulden zur aufnahme von chemischen und/oder biochemischen und/oder mikrobiologischen substanzen | |
DE60018733T2 (de) | Vorrichtung und verfahren zur probenanalyse | |
EP1629116B1 (de) | Verfahren zur detektion von dna-punktmutationen (snp-analyse) sowie zugehörige anordnung | |
DE19643921A1 (de) | Integriertes Nukleinsäureanalysesystem für eine Matrix-unterstützte Laser-Desorption/Ionisation-Laufzeit-Massenspektroskopie | |
EP1022059A2 (de) | Miniaturisierter Fluss-Thermocycler | |
WO2009080817A2 (de) | Mobiles schnelltestsystem für die nukleinsäureanalytik | |
DE102016120124B4 (de) | Verfahren zum Durchführen einer Polymerase-Kettenreaktion und Vorrichtung zum Ausführen des Verfahrens | |
DE102006027675B4 (de) | Verfahren zur Bestimmung der Konzentration von Nukleinsäuren | |
DE60201257T2 (de) | Verfahren und vorrichtung zur kontinuerlichen durchführung einer biologischen, chemischen oder biochemischen reaktion | |
DE10233212B4 (de) | Messvorrichtung mit einer Biochip-Anordnung und Verwendung der Vorrichtung für ein Hochdurchsatzanalyseverfahren | |
EP1732692A1 (de) | Temperierverfahren und-vorrichtung für die temperaturbehandlung kleiner flüssigkeitsmengen | |
EP2337633B1 (de) | Vorrichtung zur durchführung einer pcr | |
AT507376B1 (de) | Vorrichtung zum temperieren eines rotationssymetrischen behältnisses | |
EP0673679A1 (de) | Vorrichtung zur Bearbeitung von Nukleinsäuren in Präparationen | |
DE10006188A1 (de) | Chemische Testverfahren | |
WO1994010564A1 (de) | Verfahren zur trennung von substanzen aus verdünnten lösungen oder suspensionen | |
DE10361137A1 (de) | Mikroarray, Kit und Verfahren zum Validieren und/oder Kalibrieren eines Systems von Hybridisierungsexperimenten | |
DE4305651A1 (de) | Verfahren zur Trennung von Substanzen aus verdünnten Lösungen oder Suspensionen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 19961021 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT CH DE ES FR GB IT LI |
|
17Q | First examination report despatched |
Effective date: 19970324 |
|
GRAG | Despatch of communication of intention to grant |
Free format text: ORIGINAL CODE: EPIDOS AGRA |
|
GRAG | Despatch of communication of intention to grant |
Free format text: ORIGINAL CODE: EPIDOS AGRA |
|
GRAH | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOS IGRA |
|
GRAH | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOS IGRA |
|
GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AT CH DE ES FR GB IT LI |
|
REF | Corresponds to: |
Ref document number: 169844 Country of ref document: AT Date of ref document: 19980915 Kind code of ref document: T |
|
REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP |
|
REF | Corresponds to: |
Ref document number: 59503269 Country of ref document: DE Date of ref document: 19980924 |
|
REG | Reference to a national code |
Ref country code: CH Ref legal event code: NV Representative=s name: A. BRAUN, BRAUN, HERITIER, ESCHMANN AG PATENTANWAE |
|
GBT | Gb: translation of ep patent filed (gb section 77(6)(a)/1977) |
Effective date: 19981103 |
|
ET | Fr: translation filed | ||
REG | Reference to a national code |
Ref country code: ES Ref legal event code: FG2A Ref document number: 2123239 Country of ref document: ES Kind code of ref document: T3 |
|
RAP4 | Party data changed (patent owner data changed or rights of a patent transferred) |
Owner name: ROCHE DIAGNOSTICS GMBH |
|
PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
26N | No opposition filed | ||
REG | Reference to a national code |
Ref country code: CH Ref legal event code: PUE Owner name: BOEHRINGER MANNHEIM GMBH TRANSFER- NOVEMBER AG NOV |
|
REG | Reference to a national code |
Ref country code: GB Ref legal event code: IF02 |
|
REG | Reference to a national code |
Ref country code: ES Ref legal event code: PC2A |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: ES Payment date: 20020325 Year of fee payment: 8 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: ES Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20030317 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: AT Payment date: 20040322 Year of fee payment: 10 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: CH Payment date: 20040323 Year of fee payment: 10 |
|
REG | Reference to a national code |
Ref country code: ES Ref legal event code: FD2A Effective date: 20030317 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: AT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20050316 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LI Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20050331 Ref country code: CH Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20050331 |
|
REG | Reference to a national code |
Ref country code: CH Ref legal event code: PL |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: IT Payment date: 20060331 Year of fee payment: 12 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: GB Payment date: 20070202 Year of fee payment: 13 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DE Payment date: 20070330 Year of fee payment: 13 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FR Payment date: 20070301 Year of fee payment: 13 |
|
GBPC | Gb: european patent ceased through non-payment of renewal fee |
Effective date: 20080316 |
|
REG | Reference to a national code |
Ref country code: FR Ref legal event code: ST Effective date: 20081125 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: DE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20081001 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: FR Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080331 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: GB Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20080316 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20070316 |