US20030186906A1 - Mixture comprising an inhibitor or suppresor of a gene and a molecule binding to an expression product of that gene - Google Patents

Mixture comprising an inhibitor or suppresor of a gene and a molecule binding to an expression product of that gene Download PDF

Info

Publication number
US20030186906A1
US20030186906A1 US10/220,033 US22003302A US2003186906A1 US 20030186906 A1 US20030186906 A1 US 20030186906A1 US 22003302 A US22003302 A US 22003302A US 2003186906 A1 US2003186906 A1 US 2003186906A1
Authority
US
United States
Prior art keywords
gene
mixture
molecule
expression
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/220,033
Inventor
Karl-Hermann Schlingensiepen
Reimar Schlingensiepen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biognostik Gesellschaft fuer Biomolekulare Diagnostik mbH
Original Assignee
Biognostik Gesellschaft fuer Biomolekulare Diagnostik mbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biognostik Gesellschaft fuer Biomolekulare Diagnostik mbH filed Critical Biognostik Gesellschaft fuer Biomolekulare Diagnostik mbH
Assigned to BIOGNOSTIK GESELLSCHAFT FUR BIOMOLEKULARE DIAGNOSTIK MBH reassignment BIOGNOSTIK GESELLSCHAFT FUR BIOMOLEKULARE DIAGNOSTIK MBH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SCHLINGENSIEPEN, KARL-HERMANN, SCHLINGENSIEPEN, REIMAR
Publication of US20030186906A1 publication Critical patent/US20030186906A1/en
Priority to US12/382,415 priority Critical patent/US8703729B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates

Definitions

  • Binding can also be achieved by nucleic acid derivatives like aptamers and spiegelmers.
  • the invention pertains to a mixture comprising at least one inhibitor or suppressor of the expression of a gene and at least one molecule binding to an expression product of said gene.
  • the at least one molecule preferably inhibits the functional activity of the expression product.
  • U.S. Pat. No. 5,891,858 discloses antisense polynucleotides to human transforming growth factor alpha (TGF- ⁇ ) and the receptor for human epidermal growth factor (rEGF). It discloses the combination of an antisense polynucleotide for rEGF with antibodies to rEGF (anti-rEGF) but the anti-rEGF is not able to inhibit the activity of the EGF-receptor. In contrast anti-rEGF is a stimulator of the receptor.
  • the at least one inhibitor or suppressor is an nucleic acid molecule or derivative thereof.
  • the at least one nucleic acid molecule is preferably an oligonucleotide, an antisense oligonucleotide and/or a ribozyme inhibiting or interfering with the expression of a gene which plays a role in a patho-physiological event.
  • the DNA delivery system comprises viral or non-viral vectors or both and additionally anionic lipids, cationic lipids, non-cationic lipids or mixtures thereof.
  • the antisense and/or ribozyme molecule can also be modified by coupling it to an enhancer of uptake and/or inhibitory activity.
  • the nucleic acid molecules are coupled to or mixed with folic acid, hormones, steroid hormones such as oestrogene, progesterone, corticosteroids, mineral corticoids, peptides, proteoglycans, glycolipids, phospholipids and derivatives thereof.
  • hormones such as oestrogene, progesterone, corticosteroids, mineral corticoids, peptides, proteoglycans, glycolipids, phospholipids and derivatives thereof.
  • nucleic acid sequences are known to those skilled in the art. More sequences and methods for selecting such sequences can be found for example in WO 94/25588 or WO 98/33904.
  • the inhibitor or supressor is a peptide, protein and/or low molecular weight substance, which is able to bind to DNA or RNA coding for the gene, thus inhibiting or suppressing expression of the gene.
  • Suitable proteins also comprise antibodies and antibody fragments.
  • the mixture of the invention comprises preferably as the at least one molecule binding to the expression product of the gene an antibody, antibody fragment, such as a F ab fragment, single chain antibody or combinations thereof.
  • the antibody, antibody fragment, such as a F ab fragment, single chain antibody or combinations thereof are e.g. obtainable by screening of antibody libraries and testing the expression products for binding to an expression product of the gene.
  • the at least one molecule binding to an expression product of the gene is preferably a peptide and/or protein.
  • the peptide and/or protein is e.g. obtainable by screening an expression library and testing the expression products for binding to an expression product of the gene.
  • the synthetic peptide and/or protein may also be obtained by screening randomly synthesised peptides and/or polypeptides for binding to an expression product of the gene. Peptides binding to expression products are for example disclosed in EMBO J. 20(2001) 340-349. The peptides bind to MIA (Melanoma Inhibitory Activity), thus inhibiting the functional activity of MIA. Suitable peptides (SEQ ID No. 18-41) are for example
  • the mixture of the invention comprises a low molecular weight molecule binding to an expression product of the gene.
  • the low molecular weight molecule is obtainable by using combinatorial chemistry and testing the products for binding to an expression product of the gene.
  • Low molecular weight molecules as used herein are molecules having up to 100 carbon atoms in combination with further atoms such as N, S, O, P and the like. Suitable compounds binding to an expression product can be found in FIG. 2, all binding to MIA.
  • the molecule or factor binding to an expression product of the gene may also be DNA or RNA molecule or a derivative thereof including aptamers and/or aptamers and/or aptamers that bind to the expression product to the gene.
  • the gene is selected from the group consisting of TGF- ⁇ , erbB-2, MIA, c-jun, junB, c-fos, VCAM, NF-kappaB p65, NF-kappa B p50, ICAM, VEGF and NF-kB 2.
  • the invention pertains as well to oligonucleotides having the sequences Seq. ID. No 1 to 17.
  • a medicament comprising the mixture of the invention is also subject matter of the present invention.
  • the invention further concerns a method of using a mixture comprising at least one suppressor or inhibitor of the expression of a gene and at least one molecule or factor binding to an expression product of said gene for treating tumors, immune disorders, or improving organ or cell transplantation, including transplantation of hematoietic stem cells and their derivatives including erythrocytes, white blood cells, platelets, thrombocytes and their precursor cells.
  • Organ transplantation includes transplantation of liver, kidney, heart, lung, gastrointestinal organs, bone, pancreas, cartilage, neurones, islet cells and stem cells from which these organs can be derived or reconstructed.
  • the mixture of the present invention is also useful in Drug Target Validation, i.e. to identify genes that are relevant for a certain pathological state by testing the effect of the mixture of the present invention on a cell system or organism.
  • the invention is directed to a method for reducing a functional activity of a gene product in a biological system comprising treatment of the biological system simultaneously or successively with at least one inhibitor or suppressor of the expression of a gene and at least one molecule inhibiting functional activity of an expression product of said gene.
  • the biological system may be a cell, a cell culture, an organ or an organism.
  • FIG. 1 shows a strongly supra-additive effect of a combination of both the blocking of a gene with an antisense molecule combined with a neutralising antibody.
  • PBMC Peripheral blood mononuclear cells
  • glioma tumor cells were harvested, washed twice in 5% FCS/PBS solution and resuspended at 10 Mio cells/ml in 5% FCS/PBS. Calcein-AM (Molecular Probes, USA) was added to a final concentration of 25 ⁇ M. The cells were labelled for 30 min at 37° C. then washed twice in 5% FCS/PBS, adjusted to 1 Mio cells/ml and loaded into 96-well U-shaped microtiter plates at the final concentration of 0.1 Mio/100 ⁇ L/1 well (Nunc, Denmark).
  • antisense phosphorothioate TGF- ⁇ 2 oligonucleotides (f.c. 2-5 ⁇ M)
  • Hematopoietic Stem cells were collected by apheresis after mobilisation from bone marrow with a daily dose of 10 ⁇ g/kg/day of rhG-CSF for 5 days or from cord blood (cord blood stem cells) and enrichment of CD34+ cells achieved with immunopurification.
  • the multipotent progenitor fraction of both, bone marrow derived and cord blood derived stem cells are of critical relevance for clinical application.
  • a problem of current stem cell transplantation is the low number of stem cells generated by optimised cytokine cocktails.
  • a critical problem for long term success is the quiescence and maturation of multipotent progenitor fraction by current treatment with cytokine cocktails.
  • Both the number of cells and the proliferative capacity of bone marrow stem cells can be improved by treatment with TGF- ⁇ 1 inactivating antibodies or with TGF- ⁇ 1 antisense oligonucleotides.
  • TGF- ⁇ 1 inactivating antibodies had a strongly supra-additive effect.
  • Bone marrow derived and cord blood derived stem cells were treated with either
  • the number of multipotent proliferating progenitor cells was increased by 85% through treatment with TGF- ⁇ 1 antisense oligonucleotides compared to controls.
  • the number of multipotent proliferating progenitor cells was increased by more than 350% through treatment with a combination of both, TGF- ⁇ 1 inactivating antibodies and TGF- ⁇ 1 antisense oligonucleotides compared to controls.
  • TGF- ⁇ 1 binding peptide and TGF- ⁇ 1 antisense oligonucleotides had a similarly strongly supra-additive effect on the proliferation of multipotent proliferating hematopoietic progenitor cells.
  • the number of multipotent proliferating progenitor cells was increased by 85% through treatment with TGF- ⁇ 1 antisense oligonucleotides compared to controls.
  • the number of multipotent proliferating progenitor cells was increased by more than 3-fold through treatment with a combination of both, TGF- ⁇ 1 binding peptide and TGF- ⁇ 1 antisense oligonucleotides compared to controls.
  • Inhibition of tumor cell proliferation was between 18% and 31% with antisense c-erbB-2 oligonucleotides, between 13 and 34% with antibodies, but by more than 85% with a combination of the two.
  • MIA-secreting melanoma reduced their migration activity, as well as increasing their adhesion to matrices, both suggesting a strong inhibitory effect of MIA inhibitors and tumor invasion and metastasis.
  • Supra-additive inhibition can also be achieved by combining a transcription factor or its binding domain, binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins genes with a molecule of small molecular weight, e.g. derived by combinatorial chemistry, binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • a regulatory sequence of receptors such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • Supra-additive inhibition can also be achieved by combining a peptide or a protein, binding to the mRNAs transcribed from receptors, enzymes, transcription factors, cell adhesion molecules, cytokines, or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrin genes with a small molecule binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines, or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • Supra-additive inhibition can also be achieved by combining peptide, a protein e.g. a transcription factor or its binding domain, binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrin genes with a Spiegelmer binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • a protein e.g. a transcription factor or its binding domain
  • cytokines growth factors such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • Supra-additive inhibition can also be achieved by combining a transcription factor or its binding domain, binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrin genes with peptides binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • a transcription factor or its binding domain binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF- ⁇ , MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins.
  • Supra-additive effects can also be achieved by combining an inbibitor of c-jun expression with a molecule binding the c-jun gene product or derivative thereof. Such mixtures are useful for the protection of neurones to ischaemia, hypoxia, degeneration or overstimulation.
  • the HPP-Q-assay compares cells cultivated in a control medium induding cytokines (IL-3, IL-6, IL-11, G-CSF, GM-CSF, SCF and Epo) with cells cultured in the same cytokine-containing medium in the presence of anti-TGF- ⁇ 1-blocking antibody.
  • the control reveals cytokine-responsive progenitors, while the addition of blocking TGF- ⁇ -antibody induces quiescent progenitors.
  • Table 1 shows that antisense TGF- ⁇ 1 increases the effect of the anti-TGF- ⁇ 1 antibody (TGF- ⁇ 1 AB) on CD34-positive cells from a lymphoma patient more than twofold, i.e. in the presence of antisense TGF- ⁇ 1 the cell number more than doubles compared to antibody alone.
  • Table 2 shows that also antibody amplifies the effect of antisense TGF- ⁇ 1 on CD34-positive cells from two lymphoma and one myeloma patient: The cell number gained with antisense-TGF- ⁇ 1 alone increases almost threefold if TGF- ⁇ 1 antibody is added as well.
  • Antisense-TGF- ⁇ 1 Antisense-TGF- ⁇ 1+TGF- ⁇ 1 AB Lymphoma 1 19,00 ⁇ 1,41 37,00 ⁇ 6,48 Lymphoma 2 24,00 ⁇ 2,34 63,33 ⁇ 5,31 Myeloma 23,33 ⁇ 5,13 60,00 + 3.45

Abstract

A mixture comprising at least one inhibitor or suppressor of the expression of a gene and at least one molecule binding to an expression product of said gene.

Description

  • Classically, molecules including drugs, used to modulate biological functions through gene products and their derivatives—like e.g. glycosylated, phosphorylated or otherwise modified gene products, have either stimulated or inhibited gene products and/or their derivatives. Stimulation or inhibition was achieved e.g. by use of agonists or antagonists, including small molecular weight molecules, peptides, antibodies etc. Well known examples are H2-antagonists, and β-blockers or antibodies binding to HER2 protein or to immunomodulating receptors as well as hormone receptor binding molecules. [0001]
  • Binding can also be achieved by nucleic acid derivatives like aptamers and spiegelmers. [0002]
  • More recently the inhibition of gene products was also used by inhibiting their expression through antisense, ribozymes, triple helix binders etc. Examples are the inhibition of expression of neurotransmitter receptors in brain or inhibition of cell growth regulating proteins, cytokines and growth factors. [0003]
  • Both approaches, either inhibition of gene products by binding of molecules to the gene products and their derivatives or alternatively inhibition of expression have been used for a large variety of gene products and their derivatives. [0004]
  • The invention pertains to a mixture comprising at least one inhibitor or suppressor of the expression of a gene and at least one molecule binding to an expression product of said gene. The at least one molecule preferably inhibits the functional activity of the expression product. [0005]
  • Surprisingly, this combination shows a supra-additive effect. “Supra-additive” is defined as an effectiveness of a mixture that is at least 20%, preferably more than 50%, more preferably more than 100% better than the sum of the effects of the single compounds of the mixture. This can be tested in any in vitro or in vivo system, which a) expresses the respective gene and b) the expression of the gene has a measurable effect in the system. [0006]
  • Advantages are lower doses and/or higher efficiency compared to each individual approach. [0007]
  • U.S. Pat. No. 5,891,858 (Rubenstein) discloses antisense polynucleotides to human transforming growth factor alpha (TGF-α) and the receptor for human epidermal growth factor (rEGF). It discloses the combination of an antisense polynucleotide for rEGF with antibodies to rEGF (anti-rEGF) but the anti-rEGF is not able to inhibit the activity of the EGF-receptor. In contrast anti-rEGF is a stimulator of the receptor. [0008]
  • Preferably, the at least one inhibitor or suppressor is an nucleic acid molecule or derivative thereof. The at least one nucleic acid molecule is preferably an oligonucleotide, an antisense oligonucleotide and/or a ribozyme inhibiting or interfering with the expression of a gene which plays a role in a patho-physiological event. [0009]
  • Derivatives of gene products are e.g. posttranscritptionally or postranslationally modified gene products e.g. RNA or proteins which have undergone editing or chemical modification e.g. by methylation, phosphorylation, glycosylation etc. [0010]
  • According to the invention it may be useful to integrate the antisense and/or ribozyme molecule into a DNA delivery system. The DNA delivery system comprises viral or non-viral vectors or both and additionally anionic lipids, cationic lipids, non-cationic lipids or mixtures thereof. [0011]
  • Preferably, the antisense and/or ribozyme molecule is modified at one or more of the sugar moieties, the bases and/or the internucleotide linkages, e.g. the phosphate bonds. For example, the modification of the oligonucleotides, ribozymes and/or nucleic acids comprises modifications such as phosphorothioate (S-ODN) internucleotide linkages, methylphosphonate internucleotide linkages, phosphoramidate linkages, peptide linkages, 2′-O-alkyl modifications of the sugar, in particular methyl, ethyl, propyl, butyl and the like, 2′-methoxyethoxy modifications of the sugar and/or modifications of the bases. The various modifications may be combined in an oligo- or polynucleotid. [0012]
  • The antisense and/or ribozyme molecule can also be modified by coupling it to an enhancer of uptake and/or inhibitory activity. [0013]
  • In a further preferred embodiment of the invention, the nucleic acid molecules are coupled to or mixed with folic acid, hormones, steroid hormones such as oestrogene, progesterone, corticosteroids, mineral corticoids, peptides, proteoglycans, glycolipids, phospholipids and derivatives thereof. [0014]
  • In a very preferred embodiment, the nucleic acid molecule is selected from nucleic acid molecules comprising one or more of the following nucleotide sequences: [0015]
    GTA GTA CAC GAT GG (Seq. ID. No. 1)
    CTG ATG TGT TGA AGA ACA (Seq. ID. No. 2)
    CTC TGA TGT GTT GAA G (Seq. ID. No. 3)
    CGG CAT GTC TAT TTT GTA (Seq. ID. No. 4)
    GCT TTC ACC AAA TTG GAA GC (Seq. ID. No. 5)
    CTG GCT TTT GGG TT (Seq. ID. No. 6)
    GCT GTT GAC TGC CC (Seq. ID. No. 7)
    CCC AGT ATT ACT GC (Seq. ID. No. 8)
    GGT TGA AGC CAT TG (Seq. ID. No. 9)
    GCC GCT CAA TCT TCA TC (Seq. ID. No. 10)
    GAA CAG TTC GTC CAT G (Seq. ID. No. 11)
    CCA GAG TTT CGG TTC (Seq. ID. No. 12)
    CTA GGA CTG GGA CAG (Seq. ID. No. 13)
    CAT CTT CTG CCA TTC (Seq. ID. No. 14)
    CGT AGG TGG TGC TG (Seq. ID. No. 15)
    GTG TTT TCC CAC CAG (Seq. ID. No. 16)
    GGT TTT GGT TCA CTA G (Seq. ID. No. 17)
  • Further suitable nucleic acid sequences are known to those skilled in the art. More sequences and methods for selecting such sequences can be found for example in WO 94/25588 or WO 98/33904. [0016]
  • In a further embodiment, the inhibitor or supressor is a peptide, protein and/or low molecular weight substance, which is able to bind to DNA or RNA coding for the gene, thus inhibiting or suppressing expression of the gene. Suitable proteins also comprise antibodies and antibody fragments. [0017]
  • The mixture of the invention comprises preferably as the at least one molecule binding to the expression product of the gene an antibody, antibody fragment, such as a F[0018] ab fragment, single chain antibody or combinations thereof. The antibody, antibody fragment, such as a Fab fragment, single chain antibody or combinations thereof are e.g. obtainable by screening of antibody libraries and testing the expression products for binding to an expression product of the gene.
  • In a further embodiment the at least one molecule binding to an expression product of the gene is preferably a peptide and/or protein. The peptide and/or protein is e.g. obtainable by screening an expression library and testing the expression products for binding to an expression product of the gene. [0019]
  • The synthetic peptide and/or protein may also be obtained by screening randomly synthesised peptides and/or polypeptides for binding to an expression product of the gene. Peptides binding to expression products are for example disclosed in EMBO J. 20(2001) 340-349. The peptides bind to MIA (Melanoma Inhibitory Activity), thus inhibiting the functional activity of MIA. Suitable peptides (SEQ ID No. 18-41) are for example [0020]
  • VPHIPPN [0021]
  • MPPTQVS [0022]
  • QMHPWPP [0023]
  • QPPFWQF [0024]
  • TPPQGLA [0025]
  • IPPYNTL [0026]
  • AVRPAPL [0027]
  • GAKPHPQ [0028]
  • QQLSPLP [0029]
  • GPPPSPV [0030]
  • LPLTPLP [0031]
  • QLNVNHQARADQ [0032]
  • TSASTRPELHYP [0033]
  • TFLPHQMHPWPP [0034]
  • VPHIPPNSMALT [0035]
  • RLTLLVLIMPAP [0036]
  • RKLPPRPRR [0037]
  • VLASQIATTPSP [0038]
  • TPLTKLPSVNHP [0039]
  • PPNSFSSAGGQRT [0040]
  • EQDSRQGQELTKKGL [0041]
  • ETTIVITWTPAPR [0042]
  • TSLLISWDAPAVT [0043]
  • NSLLVSWQPPPAR [0044]
  • In another embodiment, the mixture of the invention comprises a low molecular weight molecule binding to an expression product of the gene. In particular, the low molecular weight molecule is obtainable by using combinatorial chemistry and testing the products for binding to an expression product of the gene. [0045]
  • Low molecular weight molecules (small molecules) as used herein are molecules having up to 100 carbon atoms in combination with further atoms such as N, S, O, P and the like. Suitable compounds binding to an expression product can be found in FIG. 2, all binding to MIA. [0046]
  • The molecule or factor binding to an expression product of the gene may also be DNA or RNA molecule or a derivative thereof including aptamers and/or spiegelmers that bind to the expression product to the gene. [0047]
  • In a preferred embodiment of the invention, the gene is selected from the group consisting of TGF-β, erbB-2, MIA, c-jun, junB, c-fos, VCAM, NF-kappaB p65, NF-kappa B p50, ICAM, VEGF and NF-kB 2. [0048]
  • The invention pertains as well to oligonucleotides having the sequences Seq. ID. No 1 to 17. [0049]
  • A medicament comprising the mixture of the invention is also subject matter of the present invention. [0050]
  • The invention further concerns a method of using a mixture comprising at least one suppressor or inhibitor of the expression of a gene and at least one molecule or factor binding to an expression product of said gene for treating tumors, immune disorders, or improving organ or cell transplantation, including transplantation of hematoietic stem cells and their derivatives including erythrocytes, white blood cells, platelets, thrombocytes and their precursor cells. Organ transplantation includes transplantation of liver, kidney, heart, lung, gastrointestinal organs, bone, pancreas, cartilage, neurones, islet cells and stem cells from which these organs can be derived or reconstructed. [0051]
  • The invention furthermore pertains to a method of treating tumors, immune disorders, or improving organ or cell transplantation by administration of an effective amount of a combination of at least one molecule or factor suppressing or inhibiting an expression of a gene and at least one factor binding to an expression product of said gene whereby inhibition of tumor growth, improvement of organ or cell transplantation, enhancement or inhibition of immune response is enhanced in a supra-additive manner, including transplantation of hematoietic stem cells and their derivatives including erythrocytes, white blood cells, platelets, thrombocytes and their precursor cells. Organ transplantation includes transplantation of liver, kidney, heart, lung, gastrointestinal organs, bone, pancreas, cartilage, neurones, islet cells and stem cells from which these organs can be derived or reconstructed. [0052]
  • The mixture of the present invention is also useful in Drug Target Validation, i.e. to identify genes that are relevant for a certain pathological state by testing the effect of the mixture of the present invention on a cell system or organism. [0053]
  • In a further embodiment the invention is directed to a method for reducing a functional activity of a gene product in a biological system comprising treatment of the biological system simultaneously or successively with at least one inhibitor or suppressor of the expression of a gene and at least one molecule inhibiting functional activity of an expression product of said gene. The biological system may be a cell, a cell culture, an organ or an organism.[0054]
  • FIG. 1 shows a strongly supra-additive effect of a combination of both the blocking of a gene with an antisense molecule combined with a neutralising antibody. [0055]
  • FIG. 2 discloses small molecules able to inhibit the gene product MIA.[0056]
    • EXAMPLES Example 1
  • To study the effects of neutralising antibody against TGF-β2 as an inhibitor of the gene product, antisense oligonucleotides against TGF-β2 as an inhibitor of gene expression and a combination of the two, upon immune response activity of cytotoxic T-lymphocytes (CTL) and Lymphokine activated killer cells (LAK cells) on tumor cells, a CARE-LASS assay has been employed (Lichtenfels, R., Biddison, W. E.1 Schulz, H.1 Voyt, A. B. and R. Martin. CARE-LASS (calcein-release assay), an improved fluorescence based test system to measure cytotoxic lymphocyte activity. J. Immunol. Meth., 172: 227-239, 1994). [0057]
  • Generation of LAK Cells and CTLs [0058]
  • Peripheral blood mononuclear cells (PBMC) were isolated from venous blood of healthy donors by standard Ficoll-Hypaque gradient centrifugation, as described previously. Briefly, heparinized blood was mixed with equal volumes of complete medium (RMPI 1640 medium supplemented with 10% (v/v) fetal calf serum and 1 mM L-Glutamine) and layered onto Ficoll-Hypaque (Pharmacia, Uppsala, Sweden) gradients. After centrifugation at 400 g for 30 min at room temperature, PBMCs banded at the plasma-Ficoll interface were removed, washed tree times and resuspended in complete medium. Cell viability, as determined by Trypan blue exclusion, was >97%. Lymphocytes were activated by treatment with 10 U/ml IL-1 alpha and 100 U/ml IL-2. [0059]
  • At the day of the assay, glioma tumor cells were harvested, washed twice in 5% FCS/PBS solution and resuspended at 10 Mio cells/ml in 5% FCS/PBS. Calcein-AM (Molecular Probes, USA) was added to a final concentration of 25 μM. The cells were labelled for 30 min at 37° C. then washed twice in 5% FCS/PBS, adjusted to 1 Mio cells/ml and loaded into 96-well U-shaped microtiter plates at the final concentration of 0.1 Mio/100 μL/1 well (Nunc, Denmark). [0060]
  • Either [0061]
  • antisense phosphorothioate TGF-β2 oligonucleotides (f.c. 2-5 μM), [0062]
  • or [0063]
  • neutralising antibody against TGF-β2 (f.c. 100 mg/ml) [0064]
  • or [0065]
  • a combination of the two [0066]
  • or [0067]
  • neither of the two [0068]
  • were added as indicated in the Figure. [0069]
  • Measure of cytotoxic activity of effector cells (E) on the target cells (T): [0070]
  • To measure cytotoxic activity of effector cells, wells were loaded with 100 μM of CTL and LAK cells (E) to produce the desired E:T ratios of 1:20. [0071]
  • Spontaneous Release of Calcein [0072]
  • To measure spontaneous release and total release of calcein, wells were preloaded with 100 μl 5% FCS/PBS or 100 μL lysis buffer (50 nM sodium borate, 0.1% Triton×100, pH 9.0) respectively. After incubating the plate for 4 h at 37° C. the supernatants (50 μL) were transferred into new wells and measured using an automated fluorescence scanner(Titertek Fluoroskan II, Germany). The cytotoxicity was determined from the following equation: [0073] F / CTL   assay - F   spontaneous   release F   total   lysis - F   spontanous   release × 100 = %   cytotoxicity
    Figure US20030186906A1-20031002-M00001
    • Example 2
  • Hematopoietic Stem cells were collected by apheresis after mobilisation from bone marrow with a daily dose of 10 μg/kg/day of rhG-CSF for 5 days or from cord blood (cord blood stem cells) and enrichment of CD34+ cells achieved with immunopurification. [0074]
  • The multipotent progenitor fraction of both, bone marrow derived and cord blood derived stem cells, are of critical relevance for clinical application. A problem of current stem cell transplantation is the low number of stem cells generated by optimised cytokine cocktails. Furthermore a critical problem for long term success is the quiescence and maturation of multipotent progenitor fraction by current treatment with cytokine cocktails. [0075]
  • Both the number of cells and the proliferative capacity of bone marrow stem cells can be improved by treatment with TGF-β1 inactivating antibodies or with TGF-β1 antisense oligonucleotides. [0076]
  • Surprisingly a combination of both, TGF-β1 inactivating antibodies and TGF-β1 antisense oligonucleotides had a strongly supra-additive effect. [0077]
  • Bone marrow derived and cord blood derived stem cells were treated with either [0078]
  • antisense TGF-β1 oligonucleotides, [0079]
  • or [0080]
  • neutralising antibody against TGF-β1 [0081]
  • or [0082]
  • a combination of the two [0083]
  • or [0084]
  • neither of the two (controls). [0085]
  • The number of multipotent proliferating progenitor cells was increased by 85% through treatment with TGF-β1 antisense oligonucleotides compared to controls. [0086]
  • The number of multipotent proliferating progenitor cells was increased by 63% through treatment with TGF-β1 neutralising antibody compared to controls. [0087]
  • The number of multipotent proliferating progenitor cells was increased by more than 350% through treatment with a combination of both, TGF-β1 inactivating antibodies and TGF-β1 antisense oligonucleotides compared to controls. [0088]
    • Example 3
  • A combination of both, TGF-β1 binding peptide and TGF-β1 antisense oligonucleotides had a similarly strongly supra-additive effect on the proliferation of multipotent proliferating hematopoietic progenitor cells. [0089]
  • The number of multipotent proliferating progenitor cells was increased by 85% through treatment with TGF-β1 antisense oligonucleotides compared to controls. [0090]
  • The number of multipotent proliferating progenitor cells was increased by 57% through treatment with TGF-β1 binding peptide compared to controls. [0091]
  • The number of multipotent proliferating progenitor cells was increased by more than 3-fold through treatment with a combination of both, TGF-β1 binding peptide and TGF-β1 antisense oligonucleotides compared to controls. [0092]
    • Example 4
  • The c-erbB-2 gene (also called p185, HER-2 or neu) is amplified and/or overexpressed in 30-45% of human mammary carcinomas, and in up to 50% in pancreas carcinomas, ovarian cancer, gastric carcinomas, non-small-cell lung cancer, oral squamous cell carcinomas. [0093]
  • An inactivating antibody for cerbB-2 or HER2 with the trade name Herceptin® has been used for treatment of breast cancer patients. Clinical studies initially showed good therapeutic potential, while current clinical studies give controversial results. We found that a combination of an inhibitor of cerbB-2 gene expression with a molecule binding to the cerbB-2 gene product strongly enhanced the effect of each molecule alone. [0094]
  • Ovarian carcinoma cells and pancreas carcinoma cells were treated either with either [0095]
  • antisense c-erbB-2 oligonucleotides, [0096]
  • or [0097]
  • neutralising antibody against c-erbB-2 [0098]
  • or [0099]
  • a combination of the two [0100]
  • or [0101]
  • neither of the two. [0102]
  • Inhibition of tumor cell proliferation was between 18% and 31% with antisense c-erbB-2 oligonucleotides, between 13 and 34% with antibodies, but by more than 85% with a combination of the two. [0103]
    • Example 5
  • Inhibition of endogenous MIA synthesis by a transfecting vector expressing the antisense sequence: [0104]
    GGCAGGGCCAGCGGTAGGCTGAGCTCACTGGCAGTAGAAATCCCATTTGT
    CTGTCTTCACATCGACTTTGCCAGGTTTCAGGGTCTGGTCCTCTCGGACA
    ATGCTACTGGGGAAATAGCCCAGGCGAGCAGCCAGATCTCCATAGTAATC
    TCCCTGAACGCTGCCTCCCCAGAAGAGCCGCCCACGGCCCTTCAGCTTGG
    AGAAGACATACACCACTTGGCCCCGGTGAATGGTCAGGAATCGGCAGTCG
    GGGGCCATGTAGTCCTGAAGGGCCACAGCCATGGAGATAGGGTGGCTGCA
    CTCCTGGTCCGCACACAGCTTCCGGTCAGCCAGCTTGGGCATAGGACCAC
    CCCTGACACCAGGTCCGGAGAAGGCAGACAGCAAGATGATGACACCAAGG
    CACACCAGGGACCGGGCCATCGTGGACTGTGAGCAAGAGAGTGAGCAAGG
    GGGTGCTGG
  • or parts of this sequence in human, MIA-secreting melanoma as well as breast cancer cell lines reduced their migration activity, as well as increasing their adhesion to matrices, both suggesting a strong inhibitory effect of MIA inhibitors and tumor invasion and metastasis. [0105]
  • Supra-additive effects were achieved with a combination of a MIA binding peptide with a transfecting vector expressing the above antisense sequence on reduction of their migration activity, as well as increasing their adhesion to matrices. [0106]
    • Example 6
  • Supra-additive inhibition can also be achieved by combining a transcription factor or its binding domain, binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins genes with a molecule of small molecular weight, e.g. derived by combinatorial chemistry, binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins. [0107]
    • Example 7
  • Supra-additive inhibition can also be achieved by combining a peptide or a protein, binding to the mRNAs transcribed from receptors, enzymes, transcription factors, cell adhesion molecules, cytokines, or growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrin genes with a small molecule binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines, or growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins. [0108]
    • Example 8
  • Supra-additive inhibition can also be achieved by combining peptide, a protein e.g. a transcription factor or its binding domain, binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrin genes with a Spiegelmer binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins. [0109]
    • Example 9
  • Supra-additive inhibition can also be achieved by combining a transcription factor or its binding domain, binding to a regulatory sequence of receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrin genes with peptides binding to receptors, enzymes, transcription factors, cell adhesion molecules, cytokines or growth factors, such as TGF-β, MIA, VCAM, ICAM, c-jun, junB, NF-kappaB, VEGF or integrins. [0110]
  • The mixtures of examples 6 to 9 are especially useful for neuronal stem cell expansion. [0111]
    • Example 10
  • Supra-additive effects can also be achieved by combining an inbibitor of c-jun expression with a molecule binding the c-jun gene product or derivative thereof. Such mixtures are useful for the protection of neurones to ischaemia, hypoxia, degeneration or overstimulation. [0112]
    • Example 11
  • HPP-Q-Assay [0113]
  • The effect of the combination of antisense-TGF-β1-oligonucleotide and anti-TGF-β1-antibody on human hematopoietic Stern cells was investigated. For this reason, purified human CD34-positive cells from peripheral blood were first cultured for 72 h in medium containing cytokines (IL-3, IL-6, GM-CSF, G-CSF, SCF) without oligonudeotides or in the presence of antisense TGF-β1 oligonudeotides or a missense control. Subsequently, in an HPP-Q-assay (high proliferative potential quiescent cell-assay) the cells were further cultivated with or without anti-TGF-β1 antibody. [0114]
  • The HPP-Q-assay compares cells cultivated in a control medium induding cytokines (IL-3, IL-6, IL-11, G-CSF, GM-CSF, SCF and Epo) with cells cultured in the same cytokine-containing medium in the presence of anti-TGF-β1-blocking antibody. The control reveals cytokine-responsive progenitors, while the addition of blocking TGF-β-antibody induces quiescent progenitors. [0115]
  • The HPP-Q-assay was performed as described by the manufacturer (StemBio Research, Villejuif, France). Briefly 1,6×10[0116] 4 cultured cells were plated in triplicate for each medium in 1 ml aliquots into 35-mm tissue dishes. After 18 days the number of colonies (CFU=most immature cells gained) was counted.
  • Table 1 shows that antisense TGF-β1 increases the effect of the anti-TGF-β1 antibody (TGF-β1 AB) on CD34-positive cells from a lymphoma patient more than twofold, i.e. in the presence of antisense TGF-β1 the cell number more than doubles compared to antibody alone. [0117]
  • CFU colony number [0118]
  • Control+TGF-[0119] 62 1 AB 17,66±2,49
  • Antisense TGF-β1+TGF-β1 AB 41,33±2,49 [0120]
  • Table 2 shows that also antibody amplifies the effect of antisense TGF-β1 on CD34-positive cells from two lymphoma and one myeloma patient: The cell number gained with antisense-TGF-β1 alone increases almost threefold if TGF-β1 antibody is added as well. [0121]
  • CFU colony number [0122]
  • Antisense-TGF-β1 Antisense-TGF-β1+TGF-β1 AB [0123]
    Lymphoma 1 19,00 ± 1,41 37,00 ± 6,48
    Lymphoma 2 24,00 ± 2,34 63,33 ± 5,31
    Myeloma 23,33 ± 5,13 60,00 + 3.45
  • Thus, the combination of antisense TGF-β1 and anti-TGF-β1 antibody results in a more than twofold increase in cell number compared to antisense or antibody alone. [0124]
  • 1 42 1 14 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 1 gtagtacacg atgg 14 2 18 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 2 ctgatgtgtt gaagaaca 18 3 16 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 3 ctctgatgtg ttgaag 16 4 18 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 4 cggcatgtct attttgta 18 5 20 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 5 gctttcacca aattggaagc 20 6 14 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 6 ctggcttttg ggtt 14 7 14 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 7 gctgttgact gccc 14 8 14 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 8 cccagtatta ctgc 14 9 14 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 9 ggttgaagcc attg 14 10 17 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 10 gccgctcaat cttcatc 17 11 16 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 11 gaacagttcg tccatg 16 12 15 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 12 ccagagtttc ggttc 15 13 15 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 13 ctaggactgg gacag 15 14 15 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 14 catcttctgc cattc 15 15 14 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 15 cgtaggtggt gctg 14 16 16 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 16 gtgttttccc caccag 16 17 16 DNA Artificial Sequence Description of Artificial Sequence antisense oligonucleotide 17 ggttttggtt cactag 16 18 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 18 Val Pro His Ile Pro Pro Asn 1 5 19 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 19 Met Pro Pro Thr Gln Val Ser 1 5 20 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 20 Gln Met His Pro Trp Pro Pro 1 5 21 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 21 Gln Pro Pro Phe Trp Gln Phe 1 5 22 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 22 Thr Pro Pro Gln Gly Leu Ala 1 5 23 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 23 Ile Pro Pro Tyr Asn Thr Leu 1 5 24 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 24 Ala Val Arg Pro Ala Pro Leu 1 5 25 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 25 Gly Ala Lys Pro His Pro Gln 1 5 26 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 26 Gln Gln Leu Ser Pro Leu Pro 1 5 27 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 27 Gly Pro Pro Pro Ser Pro Val 1 5 28 7 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 28 Leu Pro Leu Thr Pro Leu Pro 1 5 29 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 29 Gln Leu Asn Val Asn His Gln Ala Arg Ala Asp Gln 1 5 10 30 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 30 Thr Ser Ala Ser Thr Arg Pro Glu Leu His Tyr Pro 1 5 10 31 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 31 Thr Phe Leu Pro His Gln Met His Pro Trp Pro Pro 1 5 10 32 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 32 Val Pro His Ile Pro Pro Asn Ser Met Ala Leu Thr 1 5 10 33 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 33 Arg Leu Thr Leu Leu Val Leu Ile Met Pro Ala Pro 1 5 10 34 9 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 34 Arg Lys Leu Pro Pro Arg Pro Arg Arg 1 5 35 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 35 Val Leu Ala Ser Gln Ile Ala Thr Thr Pro Ser Pro 1 5 10 36 12 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 36 Thr Pro Leu Thr Lys Leu Pro Ser Val Asn His Pro 1 5 10 37 13 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 37 Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr 1 5 10 38 15 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 38 Glu Gln Asp Ser Arg Gln Gly Gln Glu Leu Thr Lys Lys Gly Leu 1 5 10 15 39 13 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 39 Glu Thr Thr Ile Val Ile Thr Trp Thr Pro Ala Pro Arg 1 5 10 40 13 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 40 Thr Ser Leu Leu Ile Ser Trp Asp Ala Pro Ala Val Thr 1 5 10 41 13 PRT Artificial Sequence Description of Artificial Sequence peptide obtained by screening randomly synthesized peptides 41 Asn Ser Leu Leu Val Ser Trp Gln Pro Pro Arg Ala Arg 1 5 10 42 459 DNA Artificial Sequence Description of Artificial Sequence antisense sequence for inhibition of MIA synthesis 42 ggcagggcca gcggtaggct gagctcactg gcagtagaaa tcccatttgt ctgtcttcac 60 atcgactttg ccaggtttca gggtctggtc ctctcggaca atgctactgg ggaaatagcc 120 caggcgagca gccagatctc catagtaatc tccctgaacg ctgcctcccc agaagagccg 180 cccacggccc ttcagcttgg agaagacata caccacttgg ccccggtgaa tggtcaggaa 240 tcggcagtcg ggggccatgt agtcctgaag ggccacagcc atggagatag ggtggctgca 300 ctcctggtcc gcacacagct tccggtcagc cagcttgggc ataggaccac ccctgacacc 360 aggtccggag aaggcagaca gcaagatgat gacaccaagg cacaccaggg accgggccat 420 cgtggactgt gagcaagaga gtgagcaagg gggtgctgg 459

Claims (23)

1. A mixture comprising at least one inhibitor or suppressor of the expression of a gene and at least one molecule inhibiting functional activity of an expression product of said gene.
2. The mixture of claim 1 wherein the at least one inhibitor or suppressor is a nucleic acid molecule or a derivative thereof.
3. The mixture of claim 2 wherein the nucleic acid molecule is an oligonucleotide, an antisense oligonucleotide and/or a ribozyme molecule.
4. The mixture of claim 3 wherein the oligonucleotide, the antisense oligonucleotide and/or the ribozyme molecule is integrated into a DNA delivery system comprising viral and/or non-viral vectors together with lipids selected from the group of anionic lipids, cationic lipids, non-cationic lipids and mixtures thereof.
5. The mixture of claim 3 wherein the antisense oligonucleotide and/or ribozyme molecule is modified at one or more of the sugar moieties, the bases and/or the internucleotide linkages and/or by coupling the antisense and/or ribozyme molecule to an enhancer of uptake and/or inhibitory activity.
6. The mixture of claim 2 wherein the oligonucleotide has any one of the nucleotide sequences Seq. Id. No 1 to 17.
7. The mixture of claim 1, wherein the at least one inhibitor or supressor is a peptide and/or a protein.
8. The mixture of any one of claims 1 to 7 wherein the at least one molecule binding to the expression product of the gene is an antibody, antibody fragment, such as a Fab fragment, single chain antibody or combinations thereof.
9. The mixture according to claim 8 wherein the antibody, antibody fragment, such as a Fab fragment, single chain antibody or combinations thereof is derived by screening antibody libraries and testing the expression products for binding to an expression product of the gene.
10. The mixture of any one of claims 1 to 7 wherein the at least one molecule binding to an expression product of the gene is a peptide and/or protein.
11. The mixture according to claim 10 wherein the peptide and/or protein is derived by screening an expression library and testing the expression products for binding to an expression product of the gene or is derived by screening randomly synthesised peptides and/or proteins for binding to an expression product of the gene.
12. The mixture according to claim 1, wherein the molecule or factor binding to an expression product of the gene is a low molecular weight molecule.
13. The mixture according to claim 12 wherein the low molecular weight molecule inhibitor is derived using combinatorial chemistry and testing the products for binding to an expression product of the gene.
14. The mixture according to claim 1, wherein the molecule binding to an expression product of the gene is a DNA or RNA molecule or a derivative thereof including aptamers and/or spiegelmers.
15. The mixture according to claims 3 and 8 wherein the at least one inhibitor or suppressor of the expression of a gene is an antisense oligonucleotide and the at least one molecule inhibiting functional activity of an expression product of said gene as an antibody.
16. The mixture of any one of claims 1 to 15 wherein the gene is a gene selected from the group consisting of TGF-β, erbB-2, MIA, c-jun, junB, c-fos, VCAM, NF-kappaB p65, NF-kappa B p50, ICAM, VEGF and NF-kB 2.
17. Oligonucleotides having the sequences Seq. ID. No 1 to 17.
18. A medicament comprising the mixture of any one of claims 1 to 16.
19. Use of the mixture according to claims 1 to 16 for the preparation of a medicament for treating tumors, immune disorders, or improving organ or cell transplantation or cell expansion.
20. Use according to claim 18 wherein inhibition of tumor growth, improvement of organ or cell transplantation, cell expansion, enhancement or inhibition of immune response is enhanced in a supra-additive manner.
21. A method for reducing a functional activity of a gene product in a biological system comprising treatment of the biological system simultaneously or successively with at least one inhibitor or suppressor of the expression of a gene and at least one molecule inhibiting functional activity of an expression product of said gene.
22. The method of claim 21, wherein the biological system is a cell, a cell culture, an organ or an organism.
23. The method of claim 21, wherein the biological system is a patient suffering from the functional activity of a gene product.
US10/220,033 2000-03-11 2001-03-10 Mixture comprising an inhibitor or suppresor of a gene and a molecule binding to an expression product of that gene Abandoned US20030186906A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/382,415 US8703729B2 (en) 2000-03-11 2009-03-16 Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP00105190A EP1133988A1 (en) 2000-03-11 2000-03-11 Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene
PCT/EP2001/002694 WO2001068146A2 (en) 2000-03-11 2001-03-10 Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/382,415 Division US8703729B2 (en) 2000-03-11 2009-03-16 Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene

Publications (1)

Publication Number Publication Date
US20030186906A1 true US20030186906A1 (en) 2003-10-02

Family

ID=8168078

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/220,033 Abandoned US20030186906A1 (en) 2000-03-11 2001-03-10 Mixture comprising an inhibitor or suppresor of a gene and a molecule binding to an expression product of that gene
US12/382,415 Expired - Fee Related US8703729B2 (en) 2000-03-11 2009-03-16 Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12/382,415 Expired - Fee Related US8703729B2 (en) 2000-03-11 2009-03-16 Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene

Country Status (9)

Country Link
US (2) US20030186906A1 (en)
EP (2) EP1133988A1 (en)
JP (1) JP4843177B2 (en)
AT (1) ATE304858T1 (en)
AU (1) AU2001260109A1 (en)
DE (1) DE60113511T2 (en)
ES (1) ES2245364T3 (en)
HK (1) HK1049796B (en)
WO (1) WO2001068146A2 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030162190A1 (en) * 2001-11-15 2003-08-28 Gorenstein David G. Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
US20040242521A1 (en) * 1999-10-25 2004-12-02 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20040265912A1 (en) * 2003-05-23 2004-12-30 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20050118611A1 (en) * 2003-07-24 2005-06-02 Board Of Regents, The University Of Texas System Thioaptamers enable discovery of physiological pathways and new therapeutic strategies
US20050123939A1 (en) * 2002-10-16 2005-06-09 Board Of Regents, The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
US20050214772A1 (en) * 1998-10-26 2005-09-29 Board Of Regents, The University Of Texas System Thio modified aptamer synthetic methods and compositions
US20050239134A1 (en) * 2004-04-21 2005-10-27 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate single-stranded DNA aptamers for TGF-beta-1 protein
US20060121489A1 (en) * 2003-05-23 2006-06-08 Board Of Regents, The University Of Texas System High throughput screening of aptamer libraries for specific binding to proteins on viruses and other pathogens
US20060172925A1 (en) * 1998-10-26 2006-08-03 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20080268423A1 (en) * 2002-08-16 2008-10-30 Alan Barrett Compositions and Methods Related to Flavivirus Envelope Protein Domain III Antigens
US20110223127A1 (en) * 2007-08-06 2011-09-15 Noxxon Pharma Ag SDF-1 Binding Nucleic Acids And The Use Thereof
US9035038B2 (en) 2006-07-18 2015-05-19 Noxxon Pharma Ag SDF-1 binding nucleic acids
US9758786B2 (en) 2016-02-09 2017-09-12 Autotelic, Llc Compositions and methods for treating pancreatic cancer

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2248895B8 (en) 2003-12-19 2016-09-21 Autotelic LLC Combination therapy associating a TGF-beta antagonist with a chemotherapeutic agent
US20070196269A1 (en) * 2003-12-19 2007-08-23 Karl-Hermann Schlingensiepen Pharmaceutical composition
KR100880371B1 (en) * 2004-02-09 2009-01-30 레게니온 게엠베하 Inhibitors of TGF-R signaling for treatment of CNS disorders
EP1568383A3 (en) * 2004-02-27 2005-11-16 Antisense Pharma GmbH Use of an oligonucleotide or its active derivative for the preparation of a pharmaceutical composition for inhibiting the formation of metastases in cancer treatment
US20070155685A1 (en) * 2004-02-27 2007-07-05 Karl-Hermann Schlingensiepen Pharmaceutical composition
US8097597B2 (en) 2005-05-05 2012-01-17 Antisense Pharma Gmbh Use of low doses of oligonucleotides antisense to TGF-β genes in the treatment of brain tumors
DE102007056488A1 (en) * 2007-11-22 2009-07-23 Biontex Laboratories Gmbh Composition, useful e.g. transfection comprises a non-viral gene delivery system containing e.g. cationic lipid, and an agent for partial suppression and/or activation of innate intracellular and/or intercellular immune defense
CN103068983A (en) 2010-06-11 2013-04-24 安提森斯制药有限公司 Method for selective oligonucleotide modification
US9427458B2 (en) 2010-07-22 2016-08-30 Consejo Nacional De Investigaciones Cientificas Y Tecnicas, Conicet Methods for inhibiting cancer cell proliferation
CN104800858B (en) * 2015-04-27 2017-11-21 中国医学科学院基础医学研究所 HSP90 suppresses peptide conjugate and its application in oncotherapy
KR20180103816A (en) 2016-02-09 2018-09-19 오토텔릭 엘엘씨 Compositions and methods for treating pancreatic cancer

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5571714A (en) * 1988-12-22 1996-11-05 Celtrix Pharmaceuticals, Inc. Monoclonal antibodies which bind both transforming growth factors β1 and β2 and methods of use
US5683902A (en) * 1994-05-13 1997-11-04 Northern Illinois University Human papilloma virus inhibition by a hairpin ribozyme
US5733523A (en) * 1990-12-10 1998-03-31 Akzo Nobel N.V. Targeted delivery of a therapeutic entity using complementary oligonucleotides
US5891858A (en) * 1993-01-27 1999-04-06 Hektoen Institute For Medical Research Antisense polynucleotide inhibition of human growth factor-sensitive cancer cells
US5958769A (en) * 1996-01-18 1999-09-28 Fred Hutchinson Cancer Research Center Compositions and methods for mediating cell cycle progression
US6248723B1 (en) * 1997-06-10 2001-06-19 National Jewish Medical And Research Center Method for treatment of inflammatory disease
US20020165174A1 (en) * 1997-01-31 2002-11-07 Gill Parkash S. Methods and compositions for antisense VEGF oligonucleotides
US6900299B1 (en) * 1999-03-11 2005-05-31 University Of South Florida Interrupting the interaction of intercellular adhesion molecule-1 and respiratory syncytial virus for prevention and treatment of infection

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE235549T1 (en) 1993-04-30 2003-04-15 Biognostik Ges ANTISENSE OLIGONUCLEOTIDES FOR TREATING IMMUNOSUPPRESSIVE EFFECTS OF TGF-BETA2
EP0945507A1 (en) * 1998-03-27 1999-09-29 Boehringer Mannheim Gmbh Tumor specific expression controll region and its use
WO2000001410A1 (en) * 1998-07-06 2000-01-13 Beth Israel Deaconess Medical Center Methods of inhibiting proliferative diseases by inhibiting tgf-beta mediated angiogenesis

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5571714A (en) * 1988-12-22 1996-11-05 Celtrix Pharmaceuticals, Inc. Monoclonal antibodies which bind both transforming growth factors β1 and β2 and methods of use
US5733523A (en) * 1990-12-10 1998-03-31 Akzo Nobel N.V. Targeted delivery of a therapeutic entity using complementary oligonucleotides
US5891858A (en) * 1993-01-27 1999-04-06 Hektoen Institute For Medical Research Antisense polynucleotide inhibition of human growth factor-sensitive cancer cells
US5683902A (en) * 1994-05-13 1997-11-04 Northern Illinois University Human papilloma virus inhibition by a hairpin ribozyme
US5958769A (en) * 1996-01-18 1999-09-28 Fred Hutchinson Cancer Research Center Compositions and methods for mediating cell cycle progression
US20020165174A1 (en) * 1997-01-31 2002-11-07 Gill Parkash S. Methods and compositions for antisense VEGF oligonucleotides
US6248723B1 (en) * 1997-06-10 2001-06-19 National Jewish Medical And Research Center Method for treatment of inflammatory disease
US6900299B1 (en) * 1999-03-11 2005-05-31 University Of South Florida Interrupting the interaction of intercellular adhesion molecule-1 and respiratory syncytial virus for prevention and treatment of infection

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050214772A1 (en) * 1998-10-26 2005-09-29 Board Of Regents, The University Of Texas System Thio modified aptamer synthetic methods and compositions
US20060172925A1 (en) * 1998-10-26 2006-08-03 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20040242521A1 (en) * 1999-10-25 2004-12-02 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20030162190A1 (en) * 2001-11-15 2003-08-28 Gorenstein David G. Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
US20080255005A1 (en) * 2001-11-15 2008-10-16 Board Of Regents, The University Of Texas System Bead Bound Combinatorial Oligonucleoside Phosphorothioate And Phosphorodithioate Aptamer Libraries
US20080200340A1 (en) * 2001-11-15 2008-08-21 Board Of Regents, The University Of Texas System Bead Bound Combinatorial Oligonucleoside Phosphorothioate And Phosphorodithioate Aptamer Libraries
US7785799B2 (en) 2002-08-16 2010-08-31 The Board Of Regents Of The University Of Texas System Compositions and methods related to flavivirus envelope protein domain III antigens
US20080268423A1 (en) * 2002-08-16 2008-10-30 Alan Barrett Compositions and Methods Related to Flavivirus Envelope Protein Domain III Antigens
US7338762B2 (en) 2002-10-16 2008-03-04 Board Of Regents, The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
US20050123939A1 (en) * 2002-10-16 2005-06-09 Board Of Regents, The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
US20090123922A1 (en) * 2002-10-16 2009-05-14 Board Of Regents, The University Of Texas System Bead Bound Combinatorial Oligonucleoside Phosphorothioate And Phosphorodithioate Aptamer Libraries
US20110212843A1 (en) * 2003-05-23 2011-09-01 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting ap-1 transcription factors
US7910523B2 (en) 2003-05-23 2011-03-22 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20060121489A1 (en) * 2003-05-23 2006-06-08 Board Of Regents, The University Of Texas System High throughput screening of aptamer libraries for specific binding to proteins on viruses and other pathogens
US9567579B2 (en) 2003-05-23 2017-02-14 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20040265912A1 (en) * 2003-05-23 2004-12-30 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20050118611A1 (en) * 2003-07-24 2005-06-02 Board Of Regents, The University Of Texas System Thioaptamers enable discovery of physiological pathways and new therapeutic strategies
US20050239134A1 (en) * 2004-04-21 2005-10-27 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate single-stranded DNA aptamers for TGF-beta-1 protein
WO2005113811A3 (en) * 2004-04-21 2006-11-30 Univ Texas Combinatorial selection of phosphorothioate aptamers for tgf-beta
WO2005113811A2 (en) * 2004-04-21 2005-12-01 Board Of Regents The University Of Texas System Combinatorial selection of phosphorothioate aptamers for tgf-beta
US9035038B2 (en) 2006-07-18 2015-05-19 Noxxon Pharma Ag SDF-1 binding nucleic acids
US9822369B2 (en) 2006-07-18 2017-11-21 Noxxon Pharma Ag SDF-1 binding nucleic acids
US20110223127A1 (en) * 2007-08-06 2011-09-15 Noxxon Pharma Ag SDF-1 Binding Nucleic Acids And The Use Thereof
US8772257B2 (en) 2007-08-06 2014-07-08 Noxxon Pharma Ag SDF-1 binding nucleic acids and the use thereof
US9988636B2 (en) 2007-08-06 2018-06-05 Noxxon Pharma Ag SDF-1 binding nucleic acids and the use thereof
US9758786B2 (en) 2016-02-09 2017-09-12 Autotelic, Llc Compositions and methods for treating pancreatic cancer
US9963703B2 (en) 2016-02-09 2018-05-08 Autotelic Llc Compositions and methods for treating pancreatic cancer

Also Published As

Publication number Publication date
EP1263446B1 (en) 2005-09-21
US20090285817A1 (en) 2009-11-19
WO2001068146A2 (en) 2001-09-20
HK1049796A1 (en) 2003-05-30
DE60113511T2 (en) 2006-06-22
HK1049796B (en) 2006-01-20
DE60113511D1 (en) 2006-02-02
AU2001260109A1 (en) 2001-09-24
EP1133988A1 (en) 2001-09-19
EP1263446A2 (en) 2002-12-11
US8703729B2 (en) 2014-04-22
JP2003526684A (en) 2003-09-09
WO2001068146A3 (en) 2002-01-31
JP4843177B2 (en) 2011-12-21
ES2245364T3 (en) 2006-01-01
ATE304858T1 (en) 2005-10-15

Similar Documents

Publication Publication Date Title
US8703729B2 (en) Mixture comprising an inhibitor or suppressor of a gene and a molecule binding to an expression product of that gene
AU708096B2 (en) Inhibition of tumor growth by antisense oligonucleotides for IL-8 and IL-8 receptor
AU635002B2 (en) Methods and compositions for treatment of cancer using oligonucleotides
EP1089764B1 (en) Stimulating the immune system
JP2004024264A (en) ANTISENSE-OLIGONUCLEOTIDES FOR TREATMENT OF IMMUNOSUPPRESSIVE EFFECTS OF TRANSFORMING GROWTH FACTOR-beta (TGF-beta)
Gerosa et al. Overexpression of N-ras oncogene and epidermal growth factor receptor gene in human glioblastomas
WO1993020200A1 (en) Modified cells and method of treatment
KR20190077390A (en) An immunosuppressive-repair oligonucleotide that inhibits the expression of CD73
US6312684B1 (en) Method of inducing resistance to tumor growth
CN115516095A (en) PD-1 specific antisense oligonucleotides and their use in therapy
Allam et al. Inhibition of GM-CSF/IL-3/IL-5 signaling by antisense oligodeoxynucleotides targeting the common beta chain of their receptors
AU2001246501B2 (en) A method for reversing the immunosuppressive effects of the melanoma inhibitory activity "mia"
JP2024502055A (en) Oligonucleotides that reduce the amount of CD73 mRNA and CD73 protein expression
KR20190076978A (en) Immunosuppressive-repair oligonucleotides that inhibit the expression of CD39
AU2001246501A1 (en) A method for reversing the immunosuppressive effects of the melanoma inhibitory activity "mia"
Geiger et al. antisense oligonucleotides, mdm2, p53, apoptosis
US6268350B1 (en) Polynucleotides for inhibiting metastasis and tumor cell growth
AU2335192A (en) Antisense oligonucleotides to c-kit proto-oncogene and uses thereof
JP3150609B2 (en) Antisense oligonucleotides for cancer treatment
JPWO2020027217A1 (en) Medicines for the treatment and / or prevention of cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: BIOGNOSTIK GESELLSCHAFT FUR BIOMOLEKULARE DIAGNOST

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SCHLINGENSIEPEN, KARL-HERMANN;SCHLINGENSIEPEN, REIMAR;REEL/FRAME:013449/0442

Effective date: 20020927

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION