US20040063656A1

US20040063656A1 - Screening and therapy for lymphatic disorders involving the FLT4 receptor tyrosine kinase (VEGFR-3)

Info

Publication number: US20040063656A1
Application number: US10/661,740
Authority: US
Inventors: Robert Ferrell; Kari Alitalo; David Finegold; Marika Karkkainen
Original assignee: Individual
Current assignee: Individual
Priority date: 1999-03-26
Filing date: 2003-09-12
Publication date: 2004-04-01
Also published as: US20070141609A1; US20030026759A1; US6764820B2

Abstract

The present invention provides materials and methods for screening for and treating hereditary lymphedema in human subjects.

Description

This application is a Continuation-in-Part of International Patent Application No. PCT/US99/06133, filed Mar. 26, 1999, incorporated herein by reference in its entirety.[0001]

ACKNOWLEDGMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with United States and Finnish government support, including support under contract R03-HD35174, awarded by the U.S. National Institutes of Health. The U.S. Government has certain rights in this invention.

FIELD OF THE INVENTION

The present invention relates generally to the fields of molecular biology and medicine; more particularly to the areas of genetic screening and the identification and treatment of hereditary disorders; and more particularly to identification and treatment of hereditary lymphedema.

DESCRIPTION OF RELATED ART

The lymphatic system is a complex structure organized in parallel fashion to the circulatory system. In contrast to the circulatory system, which utilizes the heart to pump blood throughout the body, the lymphatic system pumps lymph fluid using the inherent contractility of the lymphatic vessels. The lymphatic vessels are not interconnected in the same manner as the blood vessels, but rather form a set of coordinated structures including the initial lymphatic sinuses [Jeltsch et al., Science, 276:1423-1425 (1997); and Castenholz, A., in Olszewski, W. L. (ed.), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press: Boca Raton, Fla. (1991), pp.15-42] which drain into the lymphatic capillaries and subsequently to the collecting lymphatics which drain into the lymphatic trunks and the thoracic duct which ultimately drains into the venous circulation. The composition of the channels through which lymph passes is varied [Olszewski, W. L., in Olszewski, W. L. (ed), Lymph Stasis: Pathophysiology, Diagnosis, and Treatment. CRC Press: Boca Raton, Fla. (1991), pp. 235-258; and Kinmonth, J. B., in Kinmonth, J. B. (ed), The Lymphatics: Diseases, Lymphography and Surgery. Edward Arnold Publishers: London, England (1972), pp. 82-86], including the single endothelial layers of the initial lymphatics, the multiple layers of the collecting lymphatics including endothelium, muscular and adventitial layers, and the complex organization of the lymph node. The various organs of the body such as skin, lung, and GI tract have components of the lymphatics with various unique features. [See Ohkuma, M., in Olszewski (1991), supra, at pp. 157-190; Uhley, H. and Leeds, S., in Olszewski (1991), supra, at pp. 191-210; and Barrowman, J. A., in Olszewski (1991), at pp. 221-234).]

Molecular biology has identified at least a few genes and proteins postulated to have roles mediating the growth and/or embryonic development of the lymphatic system. One such gene/protein is the receptor tyrosine kinase designated Flt4 (fms-like lyrosine kinase 4); cloned from human erythroleukaemia cell and placental cDNA libraries. [See U.S. Pat. No. 5,776,755; Aprelikova et al., Cancer Res., 52: 746-748 (1992); Galland et al., Genomics, 13: 475-478 (1992); Galland et al., Oncogene, 8: 1233-1240 (1993); and Pajusola et al., Cancer Res., 52:5738-5743 (1992), all incorporated herein by reference.] Studies showed that, in mouse embryos, a targeted disruption of the Flt4 gene leads to a failure of the remodeling of the primary vascular network, and death after embryonic day 9.5 [Dumont et al., Science, 282: 946-949 (1998)]. These studies suggested that Flt4 has an essential role in the development of the embryonic vasculature, before the emergence of the lymphatic vessels. However, additional studies indicated that, during further development, the expression of Flt4 becomes restricted mainly to lymphatic vessels [Kaipainen, et al., Proc. Natl. Acad. Sci. USA, 92: 3566-3570 (1995)].

In humans, there are two isoforms of the Flt4 protein, designated as Flt4s (short, Genbank Accession No. X68203) and Flt4l (long, Genbank Accession Nos. X68203 and S66407, SEQ ID NO: 1). The sequence of these isoforms is largely identical, except for divergence that occurs at the carboxyl terminus of the receptor as a result of alternative mRNA splicing at the 3′ end. The C-terminus of the long form contains three tyrosyl residues, and one of them (Y 1337 (SEQ ID NO: 2)) serves as an autophosphorylation site in the receptor [Fournier et al., Oncogene., 11: 921-931 (1995); and Pajusola, et al., Oncogene, 8: 2931-2937 (1993)]. Only the long form is detected in human erythroleukaemia (HEL) and in a megakaryoblastic cell line (the DAMI cells), and the mouse Flt4 gene (Genbank Accession No. L07296) only produces one mRNA transcript, corresponding to Flt4l [Galland et al., Oncogene, 8: 1233-1240 (1993); and Pajusola et al., Cancer Res., 52: 5738-5743 (1992)]. These findings suggest that the long form of Flt4 may be responsible for most of the biological properties of this receptor. The Flt4 protein is glycosylated and proteolytically processed in transfected cells [Pajusola et al., Oncogene, 9: 3545-3555 (1994)]. During this process, the 175 kD form of the receptor matures to a 195 kD form, which is subsequently cleaved into a 125 kD C-terminal fragment, and a 75 kD extracellular domain-containing fragment, which are linked by disulphide bonding in the mature receptor.

Two growth factors, named vascular endothelial growth factors C and D (VEGF-C and VEGF-D) due to amino acid sequence similarity to earlier-discovered vascular endothelial growth factor, have been shown to bind and activate the tyrosine phosphorylation of Flt4. [Achen et al., Proc. Natl. Acad. Sci. USA, 95: 548-553 (1998); Joukov et al, EMBOJ., 16: 3898-3911; and Joukov et al., EMBO J., 15: 290-298 (1996)]. Because of Flt4's growth factor binding properties and the fact that Flt4 possesses amino acid sequence similarity to two previously identified VEGF receptors (Flt1/VEGFR-1 and KDR/VEGFR-2), Flt4 has also been designated VEGFR-3, and these terms are used interchangeably herein.

When VEGF-C was intentionally over-expressed under a basal keratin promoter in transgenic mice, a hyperplastic lymphatic vessel network in the skin was observed. [Jeltsch et al., Science, 276: 1423-1425(1997).] The results of this study, when combined with the expression pattern of VEGFR-3 in the lymphatic vasculature, suggest that lymphatic growth may be induced by VEGF-C and mediated via VEGFR-3. Notwithstanding the foregoing insights involving one cell surface receptor and the two apparent ligands therefor, little is known about the developmental regulation of the lymphatic system.

Hereditary or primary lymphedema, first described by Milroy in 1892 [Milroy, N.Y. Med. J., 56:505-508 (1892)], is a developmental disorder of the lymphatic system which leads to a disabling and disfiguring swelling of the extremities. Hereditary lymphedema generally shows an autosomal dominant pattern of inheritance with reduced penetrance, variable expression, and variable age-at-onset [Greenlee et al., Lymphology, 26:156-168 (1993)]. Swelling may appear in one or all limbs, varying in degree and distribution. If untreated, such swelling worsens over time. In rare instances, angiosarcoma may develop in affected tissues [Offori et al., Clin. Exp. Dermatol., 18:174-177 (1993)]. Despite having been described over a century ago, little progress has been made in understanding the mechanisms causing lymphedema. A long-felt need exists for the identification of the presumed genetic variations that underlie hereditary lymphedema, to permit better informed genetic counseling in affected families, earlier diagnosis and treatment, and the development of more targeted and effective lymphedema therapeutic regimens. In addition, identification of genetic markers and high risk members of lymphedema families facilitates the identification and management of environmental factors that influence the expression and severity of a lymphedema phenotype.

SUMMARY OF THE INVENTION

The present invention provides materials and methods that address one or more of the long-felt needs identified above by identifying a genetic-marker that correlates and is posited to have a causative role in the development of hereditary lymphedema. The invention is based in part on the discovery that, in several families with members afflicted with hereditary lymphedema, the lymphedema phenotype correlates with genetic markers localized to chromosome 5q34-q35; and that in at least some such families, a missense mutation in the VEGFR-3 gene (which maps to chromosome 5q34-q35) exists that appears to behave in a loss-of-function dominant negative manner to decrease tyrosine kinase signaling of the receptor. In view of the fact that VEGFR-3 acts as a high affinity receptor for vascular endothelial growth factor C (VEGF-C), a growth factor whose effects include modulation of the growth of the lymphatic vascular network, these linkage and biochemical studies provide an important marker for determining a genetic predisposition for lymphedema in healthy individuals; and for diagnosing hereditary lymphedema in symptomatic individuals. Materials and methods for performing such genetic analyses are considered aspects of the present invention.

Thus, the invention provides genetic screening procedures that entail analyzing a person's genome—in particular their VEGFR-3 alleles—to determine whether the individual possesses a genetic characteristic found in other individuals that are considered to be afflicted with, or at risk for, developing hereditary lymphedema.

For example, in one embodiment, the invention provides a method for determining a hereditary lymphedema development potential in a human subject comprising the steps of analyzing the coding sequence of the VEGFR-3 genes from the human subject; and determining hereditary lymphedema development potential in said human subject from the analyzing step.

In another embodiment, the invention provides a method of screening a human subject for an increased risk of developing a lymphatic disorder, comprising the steps of: (a) assaying nucleic acid of a human subject to determine a presence or an absence of a mutation altering the encoded VEGFR-3 amino acid sequence or expression of at least one VEGFR-3 allele; and (b) screening for an increased risk of developing a lymphatic disorder from the presence or absence of said mutation.

By “human subject” is meant any human being, human embryo, or human fetus. It will be apparent that methods of the present invention will be of particular interest to individuals that have themselves been diagnosed with lymphedema or have relatives that have been diagnosed with lymphedema.

By “screening for an increased risk” is meant determination of whether a genetic variation exists in the human subject that correlates with a greater likelihood of developing lymphedema than exists for the human population as a whole, or for a relevant racial or ethnic human sub-population to which the individual belongs. Both positive and negative determinations (i.e., determinations that a genetic predisposition marker is present or is absent) are intended to fall within the scope of screening methods of the invention. In preferred embodiments, the presence of a mutation altering the sequence or expression of at least one Flt4 receptor tyrosine kinase allele in the nucleic acid is correlated with an increased risk of developing a lymphatic disorder, whereas the absence of such a mutation is reported as a negative determination.

By “lymphatic disorder” is meant any clinical condition affecting the lymphatic system, including but not limited to lymphedemas, lymphangiomas, lymphangiosarcomas, lymphangiomatosis, lymphangiectasis, and cystic hygroma. Preferred embodiments are methods of screening a human subject for an increased risk of developing a lymphedema disorder, i.e., any disorder that physicians would diagnose as lymphedema and that is characterized by swelling associated with lymph accumulation, other than lymphedemas for which non-genetic causes (e.g., parasites, surgery) are known. By way of example, lymphedema disorders include Milroy-Nonne (OMIM 153100) syndrome-early onset lymphedema [Milroy, N.Y. Med. J., 56:505-508 (1892); and Dale, J. Med. Genet., 22: 274-278 (1985)] and lymphedema praecox (Meige syndrome, OMIM 153200)-late onset lymphedema [Lewis et al., J. Ped., 104:641-648 (1984); Holmes et al., Pediatrics 61:575-579 (1978); and Wheeler et al., Plastic Reconstructive Surg., 67:362-364 (1981)] which generally are described as separate entities, both characterized by dominant inheritance. However, there is confusion in the literature about the separation of these disorders. In Milroy's syndrome, the presence of edema, which is usually more severe in the lower extremities, is seen from birth. Lymphedema praecox presents in a similar fashion but the onset of swelling is usually around puberty. Some cases have been reported to develop in the post-pubertal period. In the particular analyses described herein, the lymphedema families showing linkage to 5q34-q35 show an early onset for most affected individuals, but individuals in these pedigrees have presented during or after puberty.

The “assaying” step of the invention may involve any techniques available for analyzing nucleic acid to determine its characteristics, including but not limited to well-known techniques such as single-strand conformation polymorphism analysis (SSCP) [Orita et al., Proc Natl. Acad. Sci. USA, 86: 2766-2770 (1989)]; heteroduplex analysis [White et al., Genomics, 12: 301-306 (1992)]; denaturing gradient gel electrophoresis analysis [Fischer et al., Proc. Natl. Acad. Sci. USA, 80: 1579-1583 (1983); and Riesner et al., Electrophoresis, 10: 377-389 (1989)]; DNA sequencing; RNase cleavage [Myers et al., Science, 230: 1242-1246 (1985)]; chemical cleavage of mismatch techniques [Rowley et al., Genomics, 30: 574-582 (1995); and Roberts et al., Nucl. Acids Res., 25: 3377-3378 (1997)]; restriction fragment length polymorphism analysis; single nucleotide primer extension analysis [Shumaker et al., Hum. Mutat., 7: 346-354 (1996); and Pastinen et al., Genome Res., 7: 606-614 (1997)]; 5′ nuclease assays [Pease et al., Proc. Natl. Acad. Sci. USA, 91:5022-5026 (1994)]; DNA Microchip analysis [Ramsay, G., Nature Biotechnology, 16: 40-48 (1999); and Chee et al., U.S. Pat. No. 5,837,8321; and ligase chain reaction [Whiteley et al., U.S. Pat. No. 5,521,0651. [See generally, Schafer and Hawkins, Nature Biotechnology, 16: 33-39 (1998).] All of the foregoing documents are hereby incorporated by reference in their entirety.

In one preferred embodiment, the assaying involves sequencing of nucleic acid to determine nucleotide sequence thereof, using any available sequencing technique. [See, e.g., Sanger et al., Proc. Natl. Acad. Sci. (USA), 74: 5463-5467 (1977) (dideoxy chain termination method); Mirzabekov, TIBTECH, 12: 27-32 (1994) (sequencing by hybridization); Drmanac et al., Nature Biotechnology, 16: 54-58 (1998); U.S. Pat. No. 5,202,231; and Science, 260: 1649-1652 (1993) (sequencing by hybridization); Kieleczawa et al., Science, 258: 1787-1791 (1992) (sequencing by primer walking); (Douglas et al., Biotechniques, 14: 824-828 (1993) (Direct sequencing of PCR products); and Akane et al., Biotechniques 16: 238-241 (1994); Maxam and Gilbert, Meth. Enzymol., 65: 499-560 (1977) (chemical termination sequencing), all incorporated herein by reference.] The analysis may entail sequencing of the entire VEGFR-3 gene genomic DNA sequence, or portions thereof; or sequencing of the entire VEGFR-3 coding sequence or portions thereof In some circumstances, the analysis may involve a determination of whether an individual possesses a particular VEGFR-3 allelic variant, in which case sequencing of only a small portion of nucleic acid—enough to determine the sequence of a particular codon characterizing the allelic variant—is sufficient. This approach is appropriate, for example, when assaying to determine whether one family member inherited the same allelic variant that has been previously characterized for another family member, or, more generally, whether a person's genome contains an allelic variant that has been previously characterized and correlated with heritable lymphedema. More generally, the sequencing may be focused on those portions of the VEGFR-3 sequence that encode a VEGFR-3 kinase domain, since several different and apparently causative mutations in affected individuals that have been identified correspond to residues within an intracellular VEGFR-3 kinase domain. Referring to SEQ ID NOs: 1 and 2, the two kinase domains of human wild type VEGFR-3 correspond to nucleotides 2546 to 2848 and 3044 to 3514 of SEQ ID NO: 1, which encode residues 843 to 943 and 1009 to 1165 of SEQ ID NO: 2. Such kinase domains are localized to exons 17-20 and 22-26 in the VEGFR-3 gene, so the sequencing/analysis may be focused on those exons in particular. Molecular modeling suggests that, within these domains, residues G852, G854, G857, K879, E896, H1035, D1037, N1042, D1055, F1056, G1057, E1084, D1096, and R1159 are of particular importance in comprising or shaping the catalytic pocket of the VEGFR-3 kinase domains, so the sequencing may focus on these residues (in addition to residues described herein for which mutations have already been identified).

In a related embodiment, the invention provides PCR primers useful for amplifying particular exon sequences of human VEGFR-3 genomic DNA. The Examples below identify preferred primers for amplifying Exon 17, Exon 22, and Exon 24 sequences, where specific missense mutations described herein map. In addition, the Examples below describe the Exon-Intron junctions of human VEGFR-3, which, in combination with the VEGFR-3 cDNA sequence provided herein, permit the manufacture of appropriate oligonucleotide primers for other exons. Any such primers of, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,48, 49, 50, or more nucleotides that are identical or exactly complementary to a human VEGFR-3 genomic sequence and that includes or is within 50 nucleotides of a VEGFR-3 exon-intron splice site is intended to be within the scope of the invention.

In another embodiment, the assaying step comprises performing a hybridization assay to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences. In a preferred embodiment, the hybridization involves a determination of whether nucleic acid derived from the human subject will hybridize with one or more oligonucleotides, wherein the oligonucleotides have nucleotide sequences that correspond identically to a portion of the VEGFR-3 gene sequence, preferably the VEGFR-3 coding sequence set forth in SEQ ID NO: 1, or that correspond identically except for one mismatch. The hybridization conditions are selected to differentiate between perfect sequence complementarity and imperfect matches differing by one or more bases. Such hybridization experiments thereby can provide single nucleotide polymorphism sequence information about the nucleic acid from the human subject, by virtue of knowing the sequences of the oligonucleotides used in the experiments.

Several of the techniques outlined above involve an analysis wherein one performs a polynucleotide migration assay, e.g., on a polyacrylamide electrophoresis gel, under denaturing or non-denaturing conditions. Nucleic acid derived from the human subject is subjected to gel electrophoresis, usually adjacent to one or more reference nucleic acids, such as reference VEGFR-3 sequences having a coding sequence identical to all or a portion of SEQ ID NO: 1, or identical except for one known polymorphism. The nucleic acid from the human subject and the reference sequence(s) are subjected to similar chemical or enzymatic treatments and then electrophoresed under conditions whereby the polynucleotides will show a differential migration pattern, unless they contain identical sequences. [See generally Ausubel et al. (eds.), Current Protocols in Molecular Biology, New York: John Wiley & Sons, Inc. (1987-1999); and Sambrook et al., (eds.), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press (1989), both incorporated herein by reference in their entirety.]

In the context of assaying, the term “nucleic acid of a human subject” is intended to include nucleic acid obtained directly from the human subject (e.g., DNA or RNA obtained from a biological sample such as a blood, tissue, or other cell or fluid sample); and also nucleic acid derived from nucleic acid obtained directly from the human subject. By way of non-limiting examples, well known procedures exist for creating cDNA that is complementary to RNA derived from a biological sample from a human subject, and for amplifying (e.g., via polymerase chain reaction (PCR)) DNA or RNA derived from a biological sample obtained from a human subject. Any such derived polynucleotide which retains relevant nucleotide sequence information of the human subject's own DNA/RNA is intended to fall within the definition of “nucleic acid of a human subject” for the purposes of the present invention.

In the context of assaying, the term “mutation” includes addition, deletion, and/or substitution of one or more nucleotides in the VEGFR-3 gene sequence. The invention is demonstrated by way of non-limiting examples set forth below that identify several mutations in VEGFR-3, including single nucleotide polymorphisms that introduce missense mutations into the VEGFR-3 coding sequence (as compared to the VEGFR-3 cDNA sequence set forth in SEQ ID NO: 1) and other polymorphisms that occur in introns and that are identifiable via sequencing, restriction fragment length polymorphism, or other techniques. Example 2 provides an assay to determine whether a VEGFR-3 mutation inhibits VEGFR-3 signaling. Additional assays to study both ligand binding and signaling activities of VEGFR-3 are disclosed, e.g., in U.S. Pat. No. 5,776,755 and International Patent Publication No. WO 98/33917, published 06 Aug. 1998, both of which are incorporated herein by reference in their entirety. Evidence that a VEGFR-3 mutation inhibits VEGFR-3 signaling is evidence that the mutation may have a causative role in lymphedema phenotype. However, even mutations that have no apparent causative role may serve as useful markers for heritable lymphedema, provided that the appearance of the mutation correlates reliably with the appearance of lymphedema.

In a related embodiment, the invention provides a method of screening for a VEGFR-3 hereditary lymphedema genotype in a human subject, comprising the steps of: (a) providing a biological sample comprising nucleic acid from a human subject; (b) analyzing the nucleic acid for the presence of a mutation or mutations in a VEGFR-3 allele in the nucleic acid of the human subject; (c) determining a VEGFR-3 genotype from said analyzing step; and (d) correlating the presence of a mutation in a VEGFR-3 allele with a hereditary lymphedema genotype. In a preferred embodiment, the biological sample is a cell sample containing human cells that contain genomic DNA of the human subject.

Although more time consuming and expensive than methods involving nucleic acid analysis, the invention also may be practiced by assaying protein of a human subject to determine the presence or absence of an amino acid sequence variation in VEGFR-3 protein from the human subject. Such protein analyses may be performed, e.g., by fragmenting VEGFR-3 protein via chemical or enzymatic methods and sequencing the resultant peptides; or by Western analyses using an antibody having specificity for a particular allelic variant of VEGFR-3.

The invention also provides materials that are useful for performing methods of the invention. For example, the present invention provides oligonucleotides useful as probes in the many analyzing techniques described above. In general, such oligonucleotide probes comprise 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides that have a sequence that is identical, or exactly complementary, to a portion of a human VEGFR-3 gene sequence, or that is identical or exactly complementary except for one nucleotide substitution. In a preferred embodiment, the oligonucleotides have a sequence that corresponds in the foregoing manner to a human VEGFR-3 coding sequence, and in particular, the VEGFR-3 coding sequence set forth in SEQ ID NO: 1. In one variation, an oligonucleotide probe of the invention is purified and isolated. In another variation, the oligonucleotide probe is labeled, e.g., with a radioisotope, chromophore, or fluorophore. In yet another variation, the probe is covalently attached to a solid support. [See generally Ausubel et al And Sambrook el al., supra.]

In preferred embodiments, the invention comprises an oligonucleotide probe useful for detecting one or more of several mutations that have been characterized herein in affected individuals, including:

(1) a missense mutation at nucleotide 3360 of SEQ ID NO: 1, causing a proline to leucine change at residue 1114 in SEQ ID NO: 2;

(2) a missense mutation at nucleotide 2588 of SEQ ID NO: 1, causing a glycine to arginine change at residue 857 in SEQ ID NO: 2;

(3) a missense mutation at nucleotide 3141 of SEQ ID NO: 1, causing an arginine to proline change at residue 1041 in SEQ ID NO: 2;

(4) a missense mutation at nucleotide 3150 in SEQ ID NO: 1, causing a leucine to proline-change at residue 1044 in SEQ ID NO: 2; and

(5) a missense mutation at nucleotide 3164 of SEQ ID NO: 1, causing an aspartic acid to asparagine change at residue 1049 in SEQ ID NO: 2.

For example, the invention provides oligonucleotides comprising anywhere from 6 to 50 nucleotides that have a sequence that is identical to, or exactly complementary to, a portion of the human VEGFR-3 coding sequence set forth in SEQ ID NO: 1, except for a nucleotide substitution corresponding to nucleotide 3360 of SEQ ID NO: 1. Such oligonucleotides may be generically described by the formula X _nYZ_mor its complement; where n and m are integers from 0 to 49; where 5≦(n+m)≦49; where X_nis a stretch of n nucleotides identical to a first portion of SEQ ID NO: 1 and Z_mis a stretch of m nucleotides identical to a second portion of SEQ ID NO: 1, wherein the first and second portions are separated in SEQ ID NO: 1 by one nucleotide; and wherein Y represents a nucleotide other than the nucleotide that separates the first and second portions of SEQ ID NO: 1. For example, where X_nrepresents 0 to 49 nucleotides immediately upstream (5′) of nucleotide 3360 of SEQ ID NO: 1 and Z_mrepresents 0 to 49 nucleotides immediately downstream (3′) of nucleotide 3360 of SEQ ID NO: 1, Y represents a nucleotide other than cytosine, since a cytosine nucleotide is found at position 3360 of SEQ ID NO: 1. In a preferred embodiment, Y is a thymine nucleotide. Similar examples are contemplated for the other specific mutations identified immediately above.

In a related embodiment, the invention provides a kit comprising at least two such oligonucleotide probes. Preferably, the two or more probes are provided in separate containers, or attached to separate solid supports, or attached separately to the same solid support, e.g., on a DNA microchip.

In still another related embodiment, the invention provides an array of oligonucleotide probes immobilized on a solid support, the array having at least 4 probes, preferably at least 100 probes, and preferably up to 100,000, 10,000, or 1000 probes, wherein each probe occupies a separate known site in the array. In a preferred embodiment, the array includes probe sets comprising two to four probes, wherein one probe is exactly identical or exactly complementary to a human VEGFR-3 coding sequence, and the other one to three members of the set are exactly identical to the first member, but for at least one different nucleotide, which different nucleotide is located in the same position in each of the one to three additional set members. In one preferred embodiment, the array comprises several such sets of probes, wherein the sets correspond to different segments of the human VEGFR-3 gene sequence. In a highly preferred embodiment, the array comprises enough sets of oligonucleotides of length N to correspond to every particular N-mer sequence of the VEGFR-3 gene, where N is preferably 6 to 25 and more preferably9 to 20. Materials and methods for making such probes are known in the art and are described, for example, in U.S. Pat. Nos. 5 837,832, 5,202,231, 5;002,867, and 5,143,854.

Moreover, the discoveries which underlie the present invention identify a target for therapeutic intervention in cases of hereditary lymphedema. The causative mutations in the families that have been studied in greatest detail are mutations that appear to result in VEGFR-3 signaling that is reduced in heterozygous affected individuals, but not completely eliminated. This data supports a therapeutic indication for administration of agents, such as VEGFR-3 ligand polypeptides, that will induce VEGFR-3 signaling in the lymphatic endothelia of affected individuals to effect improvement in the structure and function of the lymphatic vasculature of such individuals. In addition, therapeutic gene therapy, to replace defective VEGFR-3 alleles or increase production of VEGFR-3 ligand polypeptides in vivo, is envisioned as an aspect of the invention.

Thus, in yet another aspect, the invention provides a therapeutic or prophylactic method of treatment for lymphedema, comprising the step of administering to a mammalian subject in need of therapeutic or prophylactic treatment for lymphedema a composition comprising a compound effective to induce intracellular signaling of VEGFR-3 in lymphatic endothelial cells that express said receptor. In a preferred embodiment, the compound comprises a polypeptide ligand for VEGFR-3, or a polynucleotide encoding such a ligand, wherein the polynucleotide is administered in a form that results in transcription and translation of the polynucleotide in the mammalian subject to produce the ligand in vivo. In another preferred embodiment, the compound comprises any small molecule that is capable of binding to the VEGFR-3 receptor extracellular or intracellular domain and inducing intracellular signaling.

For example, the invention provides a therapeutic or prophylactic method of treatment for lymphedema, comprising the step of administering to a mammalian subject in need of therapeutic or prophylactic treatment for lymphedema a composition comprising a polynucleotide, the polynucleotide comprising a nucleotide sequence that encodes a vascular endothelial growth factor C (VEGF-C) polypeptide. In a preferred embodiment, the subject is a human subject.

While it is contemplated that the VEGF-C polynucleotide could be administered purely as a prophylactic treatment to prevent lymphedema in subjects at risk for developing lymphedema, it is contemplated in a preferred embodiment that the polynucleotide be administered to subjects afflicted with lymphedema, for the purpose of ameliorating its symptoms (e.g., swelling due to the accumulation of lymph). The polynucleotide is included in the composition in an amount and in a form effective to promote expression of a VEGF-C polypeptide in or near the lymphatic endothelia of the mammalian subject, to stimulate VEGFR-3 signaling in the lymphatic endothelia of the subject.

In a preferred embodiment, the mammalian subject is a human subject. Practice of methods of the invention in other mammalian subjects, especially mammals that are conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., primate, porcine, canine, equine, murine, or rabbit animals), also is contemplated. Several potential animal models for hereditary lymphedema have been described in the literature. [See, e.g., Lyon et al., Mouse News Lett. 71: 26 (1984), Mouse News Lett. 74: 96 (1986), and Genetic variants and strains of the laboratory mouse, 2nd ed., New York: Oxford University Press (1989), p. 70 (Chylous ascites mouse); Dumont et al., Science, 282: 946-949 (1998) (heterozygous VEGFR-3 knockout mouse); Patterson et al., “Hereditary Lymphedema,” Comparative Pathology Bulletin, 3: 2 (1971) (canine hereditary lymphedema model); van der Putte, “Congenital Hereditary Lymphedema in the Pig,” Lympho, 11: 1-9 (1978); and Campbell-Beggs et al., “Chyloabdomen in a neonatal foal,” Veterinary Record, 137: 96-98 (1995).] Those models which are determined to have analogous mutations to the VEGFR-3 gene, such as the Chylous ascetei (Chy) mouse, are preferred. The present inventors have analyzed the VEGFR-3 genes of the Chy mouse and determined that affected mice contain a missense mutation that results in a phenylalanine (rather than an isoleucine) in the VEGFR-3 sequence at a position corresponding to the isoleucine at position 1053 of SEQ ID NO: 2. This mutation maps to the catalytic pocket region of the tyrosine kinase domain of the VEGFR-3 protein, and may represent aviable model for identical mutations in human (if discovered) or other mutations in humans that similarly affect the tyrosine kinase catalytic domain. The Chy mouse has peripheral swelling (oedema) after birth and chyle ascites. In another embodiment, “knock in” homologous recombination genetic engineering strategies are used to create an animal model (e.g., a mouse model) having a VEGFR-3 allelic variation analogous to the human variations described herein. [See, e.g., Partanen et al., Genes & Development, 12: 2332-2344 (1998) (gene targeting to introduce mutations into a receptor protein (FGFR-1) in mice).] Such mice can also be bread to the heterozygous VEGFR-3 knockout mice or Chy mice described above to further modify the phenotypic severity of the lymphedema disease.

For the practice of methods of the invention, the term “VEGF-C polypeptide” is intended to include any polypeptide that has a VEGF-C or VEGF-C analog amino acid sequence (as defined elsewhere herein in greater detail) and that is able to bind the VEGFR-3 extracellular domain and stimulate-VEGFR-3 signaling in vivo. The term “VEGF-C polynucleotide” is intended to include any polynucleotide (e.g., DNA or RNA, single- or double-stranded) comprising a nucleotide sequence that encodes a VEGF-C polypeptide. Due to the well-known degeneracy of the genetic code, multiple VEGF-C polynucleotide sequences exist that encode any selected VEGF-C polypeptide. Preferred VEGF-C polynucleotides, polypeptides, and VEGF-C variants and analogs for use in this invention are disclosed in International Patent Application No. PCT/US98/01973, published as WO 98/33917, incorporated herein by reference in its entirety.

For treatment of humans, VEGF-C polypeptides with an amino acid sequence of a human VEGF-C are highly preferred, and polynucleotides comprising a nucleotide sequence of a human VEGF-C cDNA are highly preferred. By “human, VEGF-C” is meant a polypeptide corresponding to a naturally occurring protein (prepro-protein, partially-processed protein, or fully-processed mature protein) encoded by any allele of the human VEGF-C gene, or a polypeptide comprising a biologically active fragment of a naturally-occurring mature protein. By way of example, a human VEGF-C comprises a continuous portion of the amino acid sequence set forth in SEQ ID NO: 4 sufficient to permit the polypeptide to bind and stimulate VEGFR-3 phosphorylation in cells that express such receptors. A polypeptide comprising amino acids 131-211 of SEQ ID NO: 4 is specifically contemplated. For example, polypeptides having an amino acid sequence comprising a continuous portion of SEQ ID NO: 4, the continuous portion having, as its amino terminus, an amino acid selected from the group consisting of positions 30-131 of SEQ ID NO: 4, and having, as its carboxyl terminus, an amino acid selected from the group consisting of positions 211-419 of SEQ ID NO: 4 are contemplated. An amino terminus selected from the group consisting of positions 102-131 of SEQ ID NO: 4 is preferred, and an amino terminus selected from the group consisting of positions 103-113 of SEQ ID NO: 4 is highly preferred. Likewise, a carboxyl terminus selected from the group consisting of positions 211-227 of SEQ ID NO: 4 is preferred. As stated above, the term “human VEGF-C” also is intended to encompass polypeptides encoded by allelic variants of the human VEGF-C characterized by the sequences set, forth in SEQ ID NOs: 3 & 4.

Moreover, since the therapeutic VEGF-C is to be administered as recombinant VEGF-C or indirectly via somatic gene therapy, it is within the skill in the art to make and use analogs of human VEGF-C (and polynucleotides that encode such analogs) wherein one or more amino acids have been added, deleted, or replaced with other amino acids, especially with conservative replacements, and wherein the VEGFR-3-stimulatory biological activity has been retained. Analogs that retain VEGFR-3-stimulatory VEGF-C biological activity are contemplated as VEGF-C polypeptides for use in the present invention. In a preferred embodiment, analogs having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 such modifications and that retain VEGFR-3-stimulatory VEGF-C biological activity are contemplated as VEGF-C polypeptides for use in the present invention. Analogs having a deletion of or substitution for the cysteine residue at position 156 of SEQ ID NO: 4 and that retain VEGFR-3 stimulatory activity but have reduced activity toward the receptor VEGFR-2, which is expressed in blood vessels, are specifically contemplated. See WO 98/33917. Polynucleotides encoding such analogs are generated using conventional PCR, site-directed mutagenesis, and chemical synthesis techniques.

Also contemplated as VEGF-C polypeptides are non-human mammalian or avian VEGF-C polypeptides and polynucleotides. By “mammalian VEGF-C” is meant a polypeptide corresponding to a naturally occurring protein (prepro-protein, partially-processed protein, or fully-processed mature protein) encoded by any allele of a VEGF-C gene of any mammal, or a polypeptide comprising a biologically active fragment of a mature protein. The term “mammalian VEGF-C polypeptide” is intended to include analogs of mammalian VEGF-C's that possess the in vivo VEGFR-3-stimulatory effects of the mammalian VEGF-C.

Irrespective of which encoded VEGF-C polypeptide is chosen, any VEGF-C polynucleotide gene therapy pharmaceutical encoding it preferably comprises a nucleotide sequence encoding a secretory signal peptide fused in-frame with the VEGF-C polypeptide sequence. The secretory signal peptide directs secretion of the VEGF-C polypeptide by the cells that express the polynucleotide, and is cleaved by the cell from the secreted VEGF-C polypeptide. For example, the VEGF-C polynucleotide could encode the complete prepro-VEGF-C sequence set forth in SEQ ID NO: 4; or could encode the VEGF-C signal peptide fused in-frame to a sequence encoding a fully-processed VEGF-C (e.g., amino acids 103-227 of SEQ ID NO: 4) or VEGF-C analog. Moreover, there is no requirement that the signal peptide be derived from VEGF-C. The signal peptide sequence can be that of another secreted protein, or can be a completely synthetic signal sequence effective to direct secretion in cells of the mammalian subject.

In one embodiment, the VEGF-C polynucleotide of the invention comprises a nucleotide sequence that will hybridize to a polynucleotide that is complementary to the human VEGF-C cDNA sequence specified in SEQ ID NO: 3 under the following exemplary stringent hybridization conditions: hybridization at 42° C. in 50% formamide, 5×SSC, 20 mM Na.PO ₄, pH 6.8; and washing in 1×SSC at 55° C. for 30 minutes; and wherein the nucleotide sequence encodes a polypeptide that binds and stimulates human VEGFR-3. It is understood that variation in these exemplary conditions occur based on the length and GC nucleotide content of the sequences to be hybridized. Formulas standard in the art are appropriate for determining appropriate hybridization conditions. [See Sambrook et al., Molecular Cloning: A Laboratory Manual (Second ed., Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 1989) §§ 9.47-9.51.]

In preferred embodiments, the VEGF-C polynucleotide further comprises additional sequences to facilitate the VEGF-C gene therapy. In one embodiment, a “naked” VEGF-C transgene (i.e., a transgene without a viral, liposomal, or other vector to facilitate transfection) is employed for gene therapy. In this embodiment, the VEGF-C polynucleotide preferably comprises a suitable promoter and/or enhancer sequence (e.g., cytomegalovirus promoter/enhancer [Lehner et al., J. Clin. Microbiol., 29:2494-2502 (1991); Boshart et al., Cell, 41:521-530 (1985)]; Rous sarcoma virus promoter [Davis et al., Hum. Gene Ther., 4:151 (1993)]; Tie promoter [Korhonen et al., Blood, 86(5): 1828-1835 (1995)]; or simian virus 40 promoter) for expression in the target mammalian cells, the promoter being operatively linked upstream (i.e., 5′) of the VEGF-C coding sequence. The VEGF-C polynucleotide also preferably further includes a suitable polyadenylation sequence (e.g., the SV40 or human growth hormone gene polyadenylation sequence) operably linked downstream (i.e., 3′) of the VEGF-C coding sequence. The polynucleotide may further optionally comprise sequences whose only intended function is to facilitate large-scale production of the vector, e.g., in bacteria, such as a bacterial origin of replication and a sequence encoding a selectable marker. However,in a preferred embodiment, such extraneous sequences are at least partially cleaved off prior to administration to humans according to methods of the invention. One can manufacture and administer such polynucleotides to achieve successful gene therapy using procedures that have been described in the literature for other transgenes. See, e.g., Isner et al., Circulation, 91: 2687-2692 (1995); and Isner et al., Human Gene Therapy, 7: 989-1011 (1996); incorporated herein by reference in the entirety.

Any suitable vector may be used to introduce the VEGF-C transgene into the host. Exemplary vectors that have been described in the literature include replication-deficient retroviral vectors, including but not limited to lentivirus vectors [Kim et al., J. Virol., 72(1): 811-816 (1998); Kingsman & Johnson, Scrip Magazine, October, 1998, pp. 43-46]; adeno-associated viral vectors [Gnatenko et al., J. Investig. Med., 45: 87-98 (1997)]; adenoviral vectors [See, e.g., U.S. Pat. No. 5,792,453; Quantin et al., Proc. Natl. Acad. Sci. USA, 89: 2581-2584 (1992); Stratford-Perricadet et al., J. Clin. Invest., 90: 626-630 (1992); and Rosenfeld et al., Cell, 68: 143-155 (1992)]; Lipofectin-mediated gene transfer (BRL); liposomal vectors [See, e.g., U.S. Pat. No. 5,631,237 (Liposomes comprising Sendai virus proteins)]; and combinations thereof All of the foregoing documents are incorporated herein by reference in the entirety. Replication-deficient adenoviral vectors constitute a preferred embodiment.

In embodiments employing a viral vector, preferred polynucleotides still include a suitable promoter and polyadenylation sequence as described above. Moreover, it will be readily apparent that, in these embodiments, the polynucleotide further includes vector polynucleotide sequences (e.g., adenoviral polynucleotide sequences) operably connected to the sequence encoding a VEGF-C polypeptide.

Thus, in one embodiment the composition to be administered comprises a vector, wherein the vector comprises the VEGF-C polynucleotide. In a preferred embodiment, the vector is an adenovirus vector. In a highly preferred embodiment, the adenovirus vector is replication-deficient, i.e., it cannot replicate in the mammalian subject due to deletion of essential viral-replication sequences from the adenoviral genome. For example, the inventors contemplate a method wherein the vector comprises a replication-deficient adenovirus, the adenovirus comprising the VEGF-C polynucleotide operably connected to a promoter and flanked on either end by adenoviral polynucleotide sequences.

The composition to be administered according to methods of the invention preferably comprises (in addition to the polynucleotide or vector) a pharmaceutically-acceptable carrier solution such as water, saline, phosphate-buffered saline, glucose, or other carriers conventionally used to deliver therapeutics intravascularly. Multi-gene therapy is also contemplated, in which case the composition optionally comprises both the VEGF-C polynucleotide/vector and another polynucleotide/vector. As described in greater detail below, a VEGF-D transgene is a preferred candidate for co-administration with the VEGF-C transgene.

The “administering” that is performed according to the present method may be performed using any medically-accepted means for introducing a therapeutic directly or indirectly into a mammalian subject to reach the lymph or the lymphatic system, including but not limited to injections; oral ingestion; intranasal or topical administration; and the like. In a preferred embodiment, administration of the composition comprising the VEGF-C polynucleotide is performed intravascularly, such as by intravenous or intra-arterial injection, or by subcutaneous injection or local depot administration. In a highly preferred embodiment, the composition is administered locally, e.g., to the site of swelling.

In still another variation, endothelial cells or endothelial progenitor cells are transfected ex vivo with a wild type VFGFR-3 transgene, and the transfected cells are administered to the mammalian subject.

In another aspect, the invention provides a therapeutic or prophylactic method of treating for lymphedema, comprising the step of administering to a mammalian subject in need of treatment for lymphedema a composition comprising a VEGF-C polypeptide, in an amount effective to treat or prevent swelling associated with lymphedema. Administration via one or more intravenous or subcutaneous injections is contemplated. Co-administration of VEGF-C polynucleotides and VEGF-C polypeptides is also contemplated.

In yet another embodiment, the invention provides the use of a VEGF-C polynucleotide or VEGF-C polypeptide for the manufacture of a medicament for the treatment or prevention of lymphedema.

In still another embodiment, the invention provides a therapeutic or prophylactic method of treatment for lymphedema, comprising the step of administering to a mammalian subject in need of therapeutic or prophylactic treatment of lymphedema a composition comprising a polynucleotide, the polynucleotide comprising a nucleotide sequence that encodes a vascular endothelial growth factor D (VEGF-D) polypeptide. Such methods are practiced essentially as described herein with respect to VEGF-C-encoding polynucleotides, except that polynucleotides encoding VEGF-D are employed. A detailed description of the human VEGF-D gene and protein are provided in Achen, et al., Proc. Nat'l Acad. Sci. U.S.A., 95(2): 548-553 (1998); International Patent Publication No. WO 98/07832, published 26 Feb. 1998; and in Genbank Accession No. AJ00185, all incorporated herein by reference. A cDNA and deduced amino acid sequence for prepro-VEGF-D is set forth herein in SEQ ID NOs: 5 and 6. Of course, due to the well-known degeneracy of the genetic code, multiple VEGF-D encoding polynucleotide sequence exist, any of which may be employed according to the methods taught herein.

As described herein in detail with respect to VEGF-C, the use of polynucleotides that encode VEGF-D fragments, VEGF-D analogs, VEGF-D allelic and interspecies variants, and the like which possess in vivo stimulatory effects of human VEGF-D are all contemplated as being encompassed by the present invention.

In yet another embodiment, the invention provides a therapeutic or prophylactic method of treatment for lymphedema, comprising the step of administering to a mammalian subject in need of treatment for lymphedema a composition comprising a VEGF-D polypeptide, in an amount effective to treat or prevent swelling associated with lymphederna. Administration via one or more intravenous or subcutaneous injections is contemplated.

The VEGFR-3 allelic variant polynucleotides and polypeptides described, herein that were discovered and characterized by the present inventors are themselves-considered aspects of the invention. Such polynucleotides and polypeptides are useful, for example, in screening assays (e.g., cell-based assays or assays involving transgenic mice that express the polynucleotide in lieu of a native VEGF-3 allele) to study the biological activities of VEGFR-3 variant alleles and identify compounds that are capable of modulating that activity, e.g., to identify therapeutic candidates for treatment of lymphedema. Such screening assays are also considered aspects of the invention.

The polypeptides of the invention are intended to include complete VEGFR-3 polypeptides with signal peptide (e.g., approximately residues 1 to 20 of SEQ ID NO: 2), mature VEGFR-3 polypeptides lacking any signal peptide, and recombinant variants wherein a foreign or synthetic signal peptide has been fused to the mature VEGFR-3 polypeptide. Polynucleotides of the invention include all polynucleotides that encode all such polypeptides. It will be understood that for essentially any polypeptide, many polynucleotides can be constructed that encode the pblypeptide by virtue of the well known degeneracy of the genetic code. All such polynucleotides are intended as aspects of the invention.

Thus, in yet another aspect, the invention provides a purified polynucleotide comprising a nucleotide sequence encoding a human VEGFR-3 protein variant, wherein said polynucleotide is capable of hybridizing to the complement of SEQ ID NO: 1 under stringent hybridization conditions, and wherein the encoded VEGFR-3 protein variant has an amino acid sequence that differs at position 1114, 857, 1041, 1044 or 1049 from the amino acid sequence set forth in SEQ ID NO: 1. Exemplary conditions are as follows: hybridization at 42° C. in 50% formamide, 5×SSC, 20 mM Na.PO4, pH 6.8; and washing in 0.2×SSC at 55° C. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide content of the sequences to be hybridized. Formulas standard in the art are appropriate for determining appropriate hybridization conditions. [See Sambrook et al. (1989), supra, §§ 9.47-9.51.]

In a related embodiment, the invention provides a purified polynucleotide comprising a nucleotide sequence encoding a VEGFR-3 protein of a human that is affected with heritable lymphedema or other lymphatic disorder; wherein the polynucleotide is capable of hybridizing to the complement of SEQ ID NO: 1 under stringent hybridization conditions, and wherein the encoded polynucleotide has an amino acid sequence that differs from SEQ ID NO: 1 at at least one codon. It will be understood that conventional recombinant techniques can be used to isolate such polynucleotides from individuals affected with heritable lymphedema or their relatives. The wildtype VEGFR-3 cDNA sequence set forth in SEQ ID NO: 1 (or its complement, or fragments thereof) is used as a probe to identify and isolate VEGFR-3 sequences from nucleic acid derived from the individuals. Alternatively, PCR amplification primers based on the wildtype VEGFR-3 sequence are generated and used to amplify either VEGFR-3 genomic DNA or VEGFR-3 mRNA from the human subject. The resultant amplified genomic DNA or cDNA is sequenced to determine the variations that characterize the VEGFR-3 lymphedema allele of the individual. Preferred VEGFR-3 lymphedema alleles include, but are not limited to the P114L, G857R, R1041P, L1044P and D1049N alleles described in detail herein.

In addition, the invention provides vectors that comprise the polynucleotides of the invention. Such vectors are useful for amplifying and expressing the VEGFR-3 proteins encoded by the polynucleotides, and for creating recombinant host cells and/or transgenic animals that express the polynucleotides. The invention further provides a host cell transformed or transfected with polynucleotides (including vectors) of the invention. In a preferred embodiment, the host cell expresses the encoded VEGFR-3 protein on its surface. Such host cells are useful in cell-based screening assays for identifying modulators that stimulate or inhibit signaling of the encoded VEGFR-3. Modulators that stimulate VEGFR-3 signaling have utility as therapeutics to treat lymphedemas, whereas modulators that are inhibitory have utility for treating hyperplastic lymphatic conditions mediated by the allelic variant VEGFR-3. In a preferred embodiment, host cells of the invention are co-transfected with both a wildtype and an allelic variant VEGFR-3 polynucleotide, such that the cells express both receptor types on their surface. Such host cells are preferred for simulating a heterozygous VEGFR-3 genotype of many individuals affected with lymphedema.

In yet another aspect, the invention provides a transgenic mammal, e.g., mouse, characterized by a non-native VEGFR-3 allele that has been introduced into the mouse, and the transgenic progeny thereof Preferred allelic variants include allelic variants that correlate with hereditary lymphedema in human subjects, such as an allelic variant wherein a P1114L, G857R, R1041P, L1044P or D1049N missense mutation has been introduced into the murine VEGFR-3 gene, or wherein the human P1114L, G857R, R1041P, L1044P or D1049N allelic variant has been substituted for a murine VEGFR-3 allele. Such mice are produced using standard methods. [See, e.g., Hogan et al. (eds.), Manipulating the Mouse Embryo, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory (1986).] The introduction of the human-like mutations into non-human sequences is readily achieved with standard techniques, such as site-directed mutagenesis. The determination of which residues in a non-human sequence to alter to mimic the foregoing human mutations is routine since the foregoing mutations all occur in regions of the VEGFR-3 sequence that contain residues that are highly conserved between species. See FIGS. 3A-3B.

In yet another aspect, the invention provides assays for identifying modulators of VEGFR-3 signaling, particularly modulators of the signaling of allelic variants of VEGFR-3 that correlate with lymphatic disorders such as heritable lymphedema. For example, the invention provides a method for identifying a modulator of intracellular VEGFR-3 signaling, comprising the steps of: contacting a cell expressing at least one mutant mammalian VEGFR-3 polypeptide in the presence and in the absence of a putative modulator compound; b) detecting VEGFR-3 signaling in the cell; and c) identifying a putative modulator compound in view of decreased or increased signaling in the presence of the putative modulator, as compared to signaling in the absence of the putative modulator.

By “mutant mammalian VEGFR-3 polypeptide” is meant a VEGFR-3 polypeptide that varies from a wildtype mammalian VEGFR-3 polypeptide (e.g., by virtue of one or more amino acid additions, deletions, or substitutions), wherein the variation is reflective of a naturally occurring variation that has been correlated with a lymphatic disorder, such as lymphedema. By way of example, the previously described substitution variations of human VEGFR-3, such as P1114L, have been correlated with heritable lymphedema. Any of the human allelic variants described above, or analogous human allelic variants having a different substitution at the indicated amino acid, positions, or a non-human VEGFR-3 into which a mutation at the position corresponding to any of the described positions has been introduced are all examples of mutant mammalian VEGFR-3 polypeptides.

The detecting step can entail the detection of any parameter indicative of VEGFR-3 signaling. For example, the detecting step can entail a measurement of VEGFR-3 autophosphorylation, or a measurement of VEGFR-3-mediated cell growth, or a measurement of any step in the VEGFR-3 signaling cascade between VEGFR-3 autophosphorylation and cell growth.

In a preferred embodiment, the method is practiced with a cell that expresses the mutant mammalian VEGFR-3 polypeptide and a wildtype mammalian VEGFR-3 polypeptide. Such cells are thought to better mimic the conditions in heterozygous individuals suffering from a VEGFR-3-mediated lymphatic disorder. In a highly preferred embodiment, the mutant and wildtype VEGFR-3 polypeptides are human. In the preferred embodiments, the mutant VEGFR-3 polypeptide comprises a leucine amino acid at the position corresponding to position 1114 of SEQ ID NO: 2; an arginine at the position corresponding to position 857 of SEQ ID NO: 2; a proline amino acid at the position corresponding to position 1041 of SEQ ID NO: 2; a proline amino acid at the position corresponding to position 1044 of SEQ ID NO: 2; or an asparagine at the position corresponding to position 1049 of SEQ ID NO: 2.

Additional features and variations of the invention will be apparent to those skilled in the art from the entirety of this application, including the drawing and detailed description, and all such features are intended as aspects of the invention. Likewise, features of the invention described herein can be re-combined into additional embodiments that are also intended as aspects of the invention, irrespective of whether the combination of features is specifically mentioned above as an aspect or embodiment of the invention. Also, only such limitations which are described herein as critical to the invention should be viewed as such; variations of the invention lacking limitations which have not been described herein as critical are intended as aspects of the invention.

In addition to the foregoing, the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations specifically mentioned above. Although the applicant(s) invented the full scope of the claims appended hereto, the claims appended hereto are not intended to encompass within their scope the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicants by a Patent Office or other entity or individual, the applicant(s) reserve the right to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. [0071] 1A-1F depict pedigrees of six hereditary lymphedema families ( Families 101, 106, 111, 135, 105, and 127, respectively) informative for linkage. Filled symbols represent individuals with clinically documented lymphedema. Crossed symbols represent individuals with an ambiguous phenotype. An ambiguous phenotype is defined as self-reported swelling of the limbs with no known cause, without a clinical diagnosis of lymphedema. Individuals of ambiguous phenotype were coded as disease status unknown for the linkage analysis. The proband in each family is indicated by an arrow.
FIG. 2 is a graph summarizing VITESSE analysis of lymphedema families with markers localized to chromosome 5q34-q35. In the graph, filled circles represent analyses for [0072] Families 101, 105, 106, and 111; open boxes represent analyses for Families 101, 106, and 111; open circles represent the VEGFR-3 gene; and open triangles represent Family 135. The one LOD confidence interval lies completely within the interval flanked by markers D5S1353 and D5S408 and overlaps the most likely location of Flt4 (VEGFR-3). Linkage is excluded for the entire region for family 135.
FIGS. [0073] 3A-3B depict an alignment of portions of the human (top line, SEQ ID NO: 2) and murine (bottom line, GenBank Acc. No. P35917, SEQ ID NO: 19) VEGFR-3 amino acid sequences to demonstrate similarity. Identical residues are marked with a line, and highly conserved and less conserved differences are marked with two dots or a single dot, respectively. The location of various mutations that have been observed to correlate with a heritable lymphedema phenotype are indicated immediately beneath the aligned sequences.

DETAILED DESCRIPTION OF THE INVENTION

Certain therapeutic aspects of the present invention involve the administration of Vascular Endothelial Growth Factor C or D polynucleotides and polypeptides. The growth factor VEGF-C, as well as native human, non-human mammalian, and avian polynucleotide sequences encoding VEGF-C, and VEGF-C variants and analogs, have been described in detail in International Patent Application Number PCT/US98/01973, filed 02 Feb. 1998 and published on 06 Aug. 1998 as International Publication Number WO 98/33917; in Joukov et al, [0074] J. Biol. Chem., 273(12): 6599-6602 (1998); and in Joukov et al., EMBO J., 16(13): 3898-3911 (1997), all of which are incorporated herein by reference in the entirety. As explained therein in detail, human VEGF-C is initially produced in human cells as a prepro-VEGF-C polypeptide of 419 amino acids. A cDNA and deduced amino acid sequence for human prepro-VEGF-C are set forth in SEQ ID NOs: 3 and 4, respectively, and a. cDNA encoding human VEGF-C has been deposited with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Va. 20110-2209 (USA), pursuant to the provisions of the Budapest Treaty (Deposit date of 24 Jul. 1995 and ATCC Accession Number 97231). VEGF-C sequences from other species have also been reported. See Genbank Accession Nos. MMU73620 (Mus musculus); and CCY15837 (Coturnix coturnix) for example, incorporated herein by reference.
The prepro-VEGF-C polypeptide is processed in multiple stages to produce a mature and most active VEGF-C polypeptide of about 21-23 kD (as assessed by SDS-PAGE under reducing conditions). Such processing includes cleavage of a signal peptide (SEQ ID NO: 4, residues 1-31); cleavage of a carboxyl-terminal peptide (corresponding approximately to amino acids 228-419 of SEQ ID NO: 4 and having a pattern of spaced cysteine residues reminiscent of a [0075] Balbiani ring 3 protein (BR3P) sequence [Dignam et al., Gene, 88:133-40 (1990); Paulsson et al., J. Mol. Biol., 211:331-49 (1990)]) to produce a partially-processed form of about 29 kD; and cleavage (apparently extracellularly) of an amino-terminal peptide (corresponding approximately to amino acids 32-103 of SEQ ID NO: 4) to produce a fully-processed mature form of about 21-23 kD. Experimental evidence demonstrates that partially-processed forms of VEGF-C (e.g., the 29 kD form) are able to bind the VEGFR-3 receptor, whereas high affinity binding to VEGFR-2 occurs only with the fully processed forms of VEGF-C.
Moreover, it has been demonstrated that amino acids 103-227 of SEQ ID NO: 4 are not all critical for maintaining VEGF-C functions. A polypeptide consisting of amino acids 113-213 (and lacking residues 103-112 and 214-227) of SEQ ID NO: 2 retains the ability to bind and stimulate VEGFR-3, and it is expected that a polypeptide spanning from about residue 131 to about residue 211 will retain VEGF-C biological activity. The cysteine residue at position 156 has been shown to be important for VEGFR-2 binding ability. However, VEGF-C ΔC[0076] ₁₅₆polypeptides (i.e., analogs that lack this cysteine due to deletion or substitution) remain potent activators of VEGFR-3, and are therefore considered to be among the preferred candidates for treatment of lymphedema. (It has been shown that a VEGF-C C156S serine substitution analog promotes lymphatic growth when over-expressed in the skin of transgenic mice behind the K14 promotee, in a manner analogous to what was described in Jeltsch et al., Science, 276:1423 (1997), incorporated herein by reference.) The cysteine at position 165 of SEQ ID NO: 4 is essential for binding to either receptor, whereas analogs lacking the cysteines at positions 83 or 137 compete with native VEGF-C for binding with both receptors and are able to stimulate both receptors.
An alignment of human VEGF-C with VEGF-C from other species (performed using any generally accepted alignment algorithm) suggests additional residues wherein modifications can be introduced (e.g., insertions, substitutions, and/or deletions) without destroying VEGF-C biological activity. Any position at which aligned VEGF-C polypeptides of two or more species have different amino acids, especially different amino acids with side chains of different chemical character, is a likely position susceptible to modification without concomitant elimination of function. An exemplary alignment of human, murine, and quail VEGF-C is set forth in FIG. 5 of PCT/US98/01973. [0077]
Apart from the foregoing considerations, it will be understood that innumerable conservative amino acid substitutions can be performed to a wildtype VEGF-C sequence which are likely to result in a polypeptide that retains VEGF-C biological activities, especially if the number of such substitutions is small. By “conservative amino acid substitution” is meant substitution of an amino acid with an amino acid having a side chain of a similar chemical character. Similar amino acids for making conservative substitutions include those having an acidic side chain (glutamic acid, aspartic acid); a basic side chain (arginine, lysine, histidine); a polar amide side chain (glutamine, asparagine); a hydrophobic, aliphatic side chain (leucine, isoleucine, valine, alanine, glycine); an aromatic side chain (phenylalanine, tryptophan, tyrosine); a small side chain (glycine, alanine, serine, threonine, methionine); or an aliphatic hydroxyl side chain (serine, threonine). Addition or deletion of one or a few internal amino acids without destroying VEGF-C biological activities also is contemplated. [0078]
Without intending to be limited to a particular theory, the mechanism behind the efficacy of VEGF-C in treating or preventing lymphedema is believed to relate to the ability of VEGF-C to stimulate VEGFR-3 signaling. Administration of VEGF-C in quantities exceeding those usually found in interstitial fluids is expected to stimulate VEGFR-3 in human subjects who, by virtue of a dominant negative heterozygous mutation, have insufficient VEGFR-3 signaling. [0079]
The growth factor named Vascular Endothelial Growth Factor D (VEGF-D), as well as human sequences encoding VEGF-D, and VEGF-D variants and analogs, have been described in detail in International Patent Application Number PCT/US97/14696, filed 21 Aug. 1997 and published on 26 Feb. 1998 as International Publication Number WO 98/07832; and in Achen, et al., [0080] Proc. Nat'l Acad. Sci. U.S.A., 95(2): 548-553 (1998), both incorporated herein by reference in the entirety. As explained therein in detail, human VEGF-D is initially produced in human cells as a prepro-VEGF-D polypeptide of 354 amino acids. A cDNA and deduced amino acid sequence for human prepro-VEGF-D are set forth in SEQ ID Nos: 5 and 6, respectively. VEGF-D sequences from other species also have been reported. See Genbank Accession Nos. D89628 (Mus musculus); and AF014827 (Rattus norvegicus), for example, incorporated herein by reference.
The prepro-VEGF-D polypeptide has a putative signal peptide of 21 amino acids and is apparently proteolytically processed in a manner analogous to the processing of prepro-VEGF-C. A “recombinantly matured” VEGF-D lacking residues 1-92 and 202-354 of SEQ ID NO: 6 retains the ability to activate receptors VEGFR-2 and VEGFR-3, and appears to associate as non-covalently linked dimers. Thus, preferred VEGF-D polynucleotides include those polynucleotides that comprise a nucleotide sequence encoding amino acids 93-201 of SEQ ID NO: 6. [0081]
The subject matter of the invention is further described and demonstrated with reference to the following examples. [0082]

EXAMPLE 1

Demonstration that Hereditary Lymphedema is Linked to the VEGFR-3 Locus

The following experiments, conducted to identify a gene or genes contributing to susceptibility to develop lymphedema, demonstrated that hereditary lymphedema correlates, in at least some families, to the chromosomal locus for the VEGFR-3 -gene. [0083]

OVERVIEW

Families with inherited lymphedema were identified for the purpose of conducting a linkage and positional candidate gene analysis. Thirteen distinct families from the United States and Canada were identified through referrals from lymphedema treatment centers, lymphedema support groups, and from internet correspondence (worldwide web site at www.pitt.edu/˜genetics/lymph/). The study protocol was approved by the Institutional Review Board of the University of Pittsburgh and participants gave written informed consent. All members of the families were of western European ancestry. Forty members of one family (“[0084] Family 101”) were examined during a family reunion by a physiatrist experienced in lymphedema treatment. Family members were considered affected with hereditary lymphedema if they exhibited asymmetry or obvious swelling of one or both legs. Members of the other 12 families were scored as affected if they had received a medical diagnosis of lymphedema, or if there were personal and family reports of extremity swelling or asymmetry. Medical records were obtained to verify status whenever possible. For the purpose of linkage analysis, individuals with very mild or intermittent swelling, heavyset legs, obesity, or a history of leg infections as the only symptom were considered to have indeterminate disease status.
In the 13 families, 105 individuals were classified as affected, with a male:female ratio of 1:2.3. The age of onset of lymphedema symptoms ranged from prenatal (diagnosed by ultrasound) to age 55. When affected by normal matings were analyzed, 76 of 191 children were affected, yielding a penetrance of 80%. First degree relatives of affected individuals were considered at risk. [0085]
Biological samples were obtained from members of the thirteen families to conduct the genetic analyses. DNA was isolated from the EDTA-anticoagulated whole blood by the method of Miller et al., [0086] Nucleic Acids Res., 16: 1215 (1998), and from cytobrush specimens using the Puregene DNA isolation kit (Gentra Systems, Minneapolis, Minn.). Analysis of the markers used in the genome scan were performed by methods recognized in the art. [See Browman et al., Am. J. Hum. Genetic., 63:861-869 (1998); see also the NHLBI Mammalian Genotyping Service world-wide web sites (www.marshmed:org/genetics/methods/pcr.htm; and www.marshmed.org/genetics/methods/gel.htm).
Two-point linkage analysis was conducted using an autosomal dominant model: predicting 80% penetrance in the heterozygous state, 99% penetrance in the homozygous state, and a 1% phenocopy rate. The frequency of the disease allele was set at 1/10,000. Microsatellite marker allele frequencies were calculated by counting founder alleles, with the addition of counts of non-transmitted alleles. Multipoint analysis was carried out using distances obtained from the Location Database (LDB-http:/Hcedar.genetics.soton.ac.uk/public html). Multipoint and 2-point analyses were facilitated using the VITESSE (v1.1) program. [O'Connell, J. R. and Weeks, D. E., (1995), [0087] Nature Genet., 11:402-408].

DETAILED DESCRIPTION OF METHODS AND RESULTS

The first family studied, [0088] Family 101, was a large, multi-generational family demonstrating early onset lymphedema. (See FIG. 1.) Forty individuals of this family were examined and DNA sampled. In addition, blood was obtained from another 11 members from mailing kits. Linkage simulation was performed using SLINK [Weeks et al., Am. J. Hum. Genet. 47:A204 (1990)] and linkage was analyzed using MSIM [Ott, J., Proc. Nat. Acad. Sci. USA, 86:4175-4178 (1989)] to estimate the potential power of two point linkage analysis in the family. Marker genotypes were simulated for a marker with heterozygosity of 0.875 under a linked (θ=0) and unlinked (θ=0.5) model using the 51 available individuals. The simulation showed that the power to detect linkage was greater than 90% for a LOD score threshold of Z(θ) 2.0. The false positive rate was less than 5%.
Shortly thereafter, two additional families (designated Families 106 and 111) segregating for autosomal dominant lymphedema were identified. These three families (FIGS. [0089] 1A-1C, Families 101, 106 and 111) were genotyped for 366 autosomal markers by the NHLBI Mammalian Genotyping Service (www.marshmed.org/genetics). Genotypes were checked for consistency using Pedcheck [O'Connell, J. R. and Weeks, D. E., Am. J. Hum. Genet., 61:A288 (1997)]. Two point linkage analysis was performed using VITESSE [O'Connell, J. R. and Weeks, D. E., Nature Genet., 11:402-408 (1995)]. The model for linkage assumed an autosomal dominant model of inheritance, a disease allele frequency of 0.0001 and a penetrance of 0.80.
The results from the genomic scan can be briefly summarized as follows. A summed LOD score of greater than 4.0 was observed from [0090] distal chromosome 5, markers D5S1456, D5S817 and D5S488. The markers on distal chromosome 5q were the only markers having z>3.0, the criteria established for statistical significance. LOD scores greater than 2.0 (θ=0-0.15) were also detected for chromosome 12 (D12S391 Z=2.03, all families), and chromosome 21 (D21S1440 Z=2.62, all families). The largest two-point LOD (Z=4.3; θ=0) was observed for marker D5S408, localized to chromosome 5q34-q35.

This initial chromosomal mapping was further refined by genotyping the three affected families for eight additional markers localized to region 5q34-q35. Six of these were informative for linkage (D5S653, D5S498, D5S408, D5S2006, D5S1353 and D5S1354). Linkage analysis of these markers using VITESSE yielded a 2-point LOD score of 6.1 at θ=0 for marker DSS1354 (Table 1) and a maximum multipoint LOD score of 8.8 at marker D5S1354 (FIG. 2). These findings supported the localization of a gene within chromosome band 5q34-q35 that is a predisposing factor in hereditary lymphedema.

TABLE 1


LOD scores for individual families estimated over
the interval defined by markers D5S498 and D5S2006.

	Z(θ) 0.0	Z(θ) 0.01	Z(θ) 0.05	Z(θ) 0.1	Z(θ) 0.2

Locus D5S498
Family
101	−3.18	−2.33	−0.45	0.42.	0.88
Family 106	1.08	1.07	1.05	0.99	0.81
Family 111	−0.85	−0.77	−0.53	−0.34	−0.13
Family 105	1.22	1.20	1.11	0.98	0.72
Family 135	−2.48	−1.85	−1.12	−0.75	−0.38
Locus D5S1353
Family
101	−2.99	−2.48	−1.21	−0.63	−0.18
Family 106	0.28	0.29	0.35	0.38	0.38
Family 111	−1.06	−1.02	−0.88	−0.72	−0.42
Family 105	0.72	0.71	0.65	0.56	0.39
Family 135	−8.03	−4.18	−2.09	−1.13	−0.30
Locus D5S1354
Family
101	6.09	6.02	5.69	5.21	4.07
Family 106	1.42	1.40	1.32	1.20	0.96
Family 111	0.21	0.22	0.23	0.24	0.22
Family 105	0.43	0.42	0.40	0.36	0.28
Family 135	−6.88	−4.91	−3.20	−2.16	−1.07
Locus D5S408
Family
101	2.80	2.74	2.50	2.20	1.56
Family 106	0.66	0.68	0.73	0.76	0.71
Family 111	−1.70	−1.40	−0.80	−0.44	−0.10
Family 105	0.42	0.41	0.38	0.35	0.27
Family 135	−5.22	−4.24	−2.58	−1.67	−0.80
Locus D5S2006
Family
101	4.51	4.70	4.85	4.66	3.80
Family 106	1.17	1.16	1.11	1.03	0.83
Family 111	−1.32	−1.18	−0.82	−0.56	−0.25
Family 105	0.43	0.42	0.40	0.36	0.28
Family 135	−3.86	−3.20	−2.11	−1.45	−0.73

During the completion of the genome scan, an additional ten lymphedema families were ascertained. Two of these families (Families 105 and 135, see FIGS. 1E and 1D), were potentially informative for linkage and were genotyped for markers in the linked region. Examination of the two point LOD scores for the five informative families for markers in the linked region (Table 1) shows that four of the families (101, 105, 106 and 111) are consistent with linkage to chromosome 5q while family 135 excluded linkage across the entire region with LOD scores Z=<−2.0 for all markers. Multipoint linkage analysis of [0092] Families 101, 105, 106 and 111 (FIG. 2) yielded a peak LOD score of Z=10 at marker D5S1354. These findings support the existence of at least two loci which predispose to hereditary lymphedema.
The order of markers D5S1353, D5S1354 and D5S408 with respect to each other was uncertain. Multipoint linkage analysis using alternative orders for these markers gave similar results. Marker D5S498 is a framework marker and marker D5S408 is mapped 11.2 centimorgans distal to D5S498, based oh the [0093] CHLC chromosome 5 sex averaged, recombination minimized map, version 3 (www.chlc.org). The physical distance between D5S498 and D5S408 is estimated as 1.45 megabases based on the Genetic Location Database (LDB) chromosome 5 summary map (cedar.genetics.soton.ac.uk/public_html/).
Database analysis identified sixteen genes within this region. Two of these genes have been identified as having roles in development (MSX2 and VEGFR-3). MSX2 was considered an unlikely candidate gene for lymphedema because of its known involvement in craniofacial development [Jabs et al., [0094] Cell, 75: 443-450 (1993)]. VEGFR-3, the gene encoding a receptor for VEGF-C, was selected as a better candidate gene for initial further study for the following reasons.
(1) VEGFR-3 is expressed in developing lymphatic endothelium in the mouse [Kukk et al., [0095] Development, 122: 3829-3837 (1996); and Kaipainen et al., Proc. Nat. Acad. Sci. USA, 92: 3566-3570 (1995)];
(2) expression of VEGFR-3 is induced in differentiating avian chorioallantoic membrane [Oh et al., [0096] Dev. Biol., 188:96-109 (1997)]; and
(3) overexpression of VEGF-C, a ligand of VEGFR-3, leads to hyperplasia of the lymphatic vessels in transgenic mice [Jeltsch et al., [0097] Science, 276: 1423-1425 (1997)].

To explore the potential role of VEGFR-3 in lymphedema, probands from the thirteen lymphedema families were screened for variation by direct sequencing of portions of the VEGFR-3 gene. The sequencing strategy used amplification primers generated based upon the VEGFR-3 cDNA sequence (SEQ ID NO: 1) and information on the genomic organization of the related vascular endothelial growth factor receptor-2 (VEGFR-2/KDR/flk-1) [Yin et al., Mammalian Genome, 9: 408-410.(1998)]. Variable positions (single nucleotide polymorphisms), the unique sequence primers used to amplify sequences flanking each variable site, and the method of detecting each variant are summarized in Table 2.

TABLE 2


Location, amplification primer sequences, amplification conditions, and
detection methods for five intragenic single nucleotide polymorphisms
in the human VEGFR-3 gene

Position			Ann.		Base	Detection
in VEGFR-3 gene	Primer	1 sequence	Primer	2 sequence	temp.	[MgCl₂]	change	Method

Exon
12, amino	tcaccatcgatccaagc	agttctgcgtgagccgag	56° C.	1.0 mM	C→T	Sequencing
acid 641	(SEQ ID NO: 7)	(SEQ ID NO: 8)
Exon 24,amino	caggacggggtgacttga	gcccaggcctgtctactg	56° C.	1.0 mM	C→T	Sequencing
acid 1114	(SEQ ID NO: 9)	(SEQ ID NO: 10)
Exon 3, amino	ccagctcctacgtgttcg	ggcaacagctggatgtca	56° C.	1.0 mM	C→T	HhaI
acid 175	(SEQ ID NO: 11)	(SEQ ID NO: 12)
65bp 3′ to Exon 6	ctgtgagggcgtgggagt	gtcctttgagccactgga	54° C.	1.5 mM	G→A	StyI
	(SEQ ID NO: 13)	(SEQ ID NO: 14)
55bp 3′ to Exon 2	cacacgtcatcgacaccggtg	ggcaacagctggatgtca	56° C.	1.5 mM	C→T	ApaI
	(SEQ ID NO: 15)	(SEQ ID NO: 16)

All amplifications were done for 35 cycles with denaturation at 94° for 30 seconds, annealing as above for 30 seconds, and extension at 72° for 30 seconds. [0099]
Amplification and sequencing primers were synthesized by the DNA Synthesis Facility, University of Pittsburgh. Amplification primers were tagged at the 5′, end with the forward or reverse M13 universal sequence to facilitate direct sequencing. Amplimers were subjected to cycle sequencing using the dRhodamine terminator ready reaction kit or the Dye Primer ready reaction kit for −M13 and M13 Rev primers (Perkin Elmer) and analyzed on the Prismi ABI 377 fluorescent sequencer. Sequences were aligned for further analysis using SEQUENCHER 3.0 (Gene Codes). [0100]
Genomic sequence from approximately 50% of the VEGFR-3 gene was determined in this manner, and five single nucleotide variants were observed. Two of the variants occurred in introns, and a third was a silent substitution in predicted [0101] exon 3. These intragenic polymorphisms were used to map the VEGFR-3 gene. As shown in FIG. 2, VEGFR-3 maps within the region of chromosome 5q linked to the lymphedema phenotype, consistent with it being selected as a candidate gene. In two families, (Family 127, pedigree not shown, and Family 135), a C→T transition was identified at nucleotide position 1940 of the VEGFR-3 cDNA (SEQ ID NO: 1). This nucleotide substitution is predicted to lead to a non-conservative substitution of serine (codon TCC) for proline (codon CCC) at residue 641 (putative exon 12, within the sixth immunoglobulin-like region of the receptor's extracellular domain) of the amino acid sequence of the receptor (SEQ ID NO: 2). However, this sequence change was observed in 2 of 120 randomly selected individuals from the general population (240 alleles) Also, in one of the two families in which this variant was initially detected, family 135, linkage between lymphedema and chromosome 5q markers was excluded (Table 1 and FIG. 2). In probands from the other ten families, wild type sequence was observed at nucleotide position 1940. Collectively, these results suggest that this P641S variant is not causative.
In one nuclear family (Family 127, pedigree shown in FIG. 1F) a C→T transition was observed at nucleotide position 3360 (SEQ ID NO: 1) of the VEGFR-3 cDNA. This nucleotide substitution is predicted to lead to a non-conservative substitution of leucine (codon CTG) for proline (codon CCG) at residue 1114 of the amino acid sequence of the receptor (SEQ ID NO: 2). This P114L mutation is predicted to lie in the intracellular tyrosine kinase domain II involved in intracellular signaling [Pajusola et al., [0102] Cancer Res., 52:5738-5743 (1992)]. Direct sequencing of predicted exon 24 of the VEGFR-3 gene alleles from members of this family identified this substitution only in affected and at-risk family members. This sequence change was not observed in 120 randomly selected individuals of mixed European ancestry from the general population (240 alleles). In probands from the other 11 families, wild type sequence was observed at nucleotide position 3360.
Collectively, this data demonstrates that a missense mutation that causes a non-conservative substitution in a kinase domain of the VEGFR-3 protein correlates strongly with a heritable lymphedema in one family, and suggests that other mutations in the same gene may exist that correlate with heritable lymphedema in other families. As explained above, only a portion of the VEGFR-3 gene sequence was analyzed to identify this first mutant of interest. Additional sequencing, using standard techniques and using the known VEGFR-3 gene sequence for guidance, is expected to identify additional mutations of interest that are observed in affected and at-risk members of other families studied. [0103]

EXAMPLE

Demonstration that a C→T Missense Mutation at Position 3360 in the VEGFR-3 Coding Sequence Results in a Tyrosine Kinase Negative Mutant

The results set forth in Example 1 identified two missense mutations in the VEGFR-3 coding sequence, one of which (C→T at position 3360) appeared to correlate with heritable lymphedema and one of which (C→T transition at position 1940) did not. The following experiments were conducted to determine the biochemical significance of these mutations on VEGFR-3 biological activity. [0104]
To analyze how the two single amino acid substitutions affect the VEGFR-3-mediated signaling, the corresponding mutant receptor expression vectors were generated using site-directed mutagenesis procedures and expressed in 293T cells by transient transfection. The long form of human VEGFR-3 cDNA (SEQ ID NO: 1) was cloned as a Hind III-Bam HI fragment from the LTR-FLT41 plasmid [Pajusola et al., [0105] Oncogene 8: 2931-2937 (1993)] into pcDNA3.1/Z(+) (Invitrogen). The P641 S and P1114L mutants of VEGFR-3 were generated from this construct with the GeneEditor™ in vitro Site-Directed Mutagenesis. System (Promega) using the following oligonucleotides (the C→T mutations are indicated with bold letters):

(SEQ ID NO: 17)

5′-CCTGAGTATCTCCCGCGTCGC-3′ for P6415 mutation;

and

(SEQ ID NO: 18)

5′-GGTGCCTCCCTGTACCCTGGG-3′ for P1114L mutation.
For the transient expression studies, 293T cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (GIBCO BRL, Life Technologies, Gaithersburg, Md.), glutamine, and antibiotics. Cells were transfected with 20 μg of plasmid encoding the wild type or mutant VEGFR-3 forms using the calcium phosphate method, and harvested 36 hours after transfection for immunoprecipitation and Western blotting. Under these conditions, RTK overexpression results in ligand-independent activation, thus allowing the receptor phosphorylation to be studied. An empty vector was used for mock (control) transfections. (It will be appreciated that ligand stimulation assays of VEGFR-3 forms also can be employed, e.g., as described in U.S. Pat. No. 5,776,755, incorporated herein by reference, using VEGF-C or VEGF-D ligands.) In order to investigate the effect of the two VEGFR-3 mutants on the tyrosine phosphorylation of the VEGFR-3, Western blotting analysis was performed using anti-phosphotyrosine antibodies. The cell monolayers were washed three times with cold phosphate-buffered saline (PBS, containing 2 mM vanadate and 2 mM PMSF) and scraped into RIPA buffer (150 mM NaCl, 1% Nonidet P40, 0.5% deoxycholic acid sodium salt, 0.1% SDS, 50 mM Tris-HCl, pH 8.0) containing 2 mM Vanadate, 2 mM PMSF, and 0.07 U/ml Aprotinin. [0106]
The cell lysates were sonicated and centrifuged for 10 minutes at 19,000×g, and the supernatants were incubated for 2 hours on ice with 2 μg/ml of monoclonal anti-VEGFR-3 antibodies (9D9f9) [Jussila et al., [0107] Cancer Res., 58: 1599-604 (1998)]. Thereafter, Protein A sepharose (Pharmacia) beads were added and incubation was continued for 45 minutes with rotation at +4° C. The sepharose beads were then washed three times with ice-cold RIPA buffer and twice with PBS (both containing 2 mM vanadate, 2 mM PMSF), analyzed by 7.5% SDS-PAGE and transferred to a nitrocellulose filter (Protran Nitrocellulose, Schleicher & Schuell, No. 401196) using semi-dry transfer apparatus. After blocking the filter with 5% BSA in TBS-T buffer (10 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Tween 20), the filters were incubated with the phosphotyrosine-specific primary antibodies (Upstate Biotechnology, #05-321), followed by biotinylated goat-anti-mouse immunoglobulins (Dako, E0433) and Biotin-Streptavidin HRP complex (Amersham, RPN1051). The bands were visualized by the enhanced chemiluminescence (ECL) method.
After analysis for phosphotyrine-containing proteins, the filters were stripped by washing for 30 minutes at +50° C. in 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7, with occasional agitation. The filters were washed with TBS-T, blocked again with BSA as described above, and analyzed for the presence of VEGFR-3 using the 9D9f9 antibodies and HRP-conjugated rabbit-anti-mouse immunoglobulins (Dako, P0161). [0108]
The Western analyses revealed that the P641 S mutant receptor was phosphorylated normally, i.e., in a manner similar to the wild type control. However, the proteolytic processing of the P641S receptor protein may be affected, as the 175 kD and 125 kD polypeptides seemed to have a higher relative density when compared to the 195 kD form. [0109]
In contrast, no phosphorylated P1114L mutant protein was detected using the phosphotyrosine antibodies. The expression of similar amounts of the VEGFR-3 protein (normal and both mutants) was confirmed using the monoclonal 9D9f9 antibody, which is directed towards the extracellular domain of the VEGFR-3. Both the P641 S and the P 1114L mutant VEGFR-3 migrated slightly faster than the wild type VEGFR-3 in the gel electrophoresis. [0110]
In order to analyze the possible dominant negative effect of the P1114L mutant on the wild-type receptor, a second, similar set of experiments were performed wherein the 293T cells were transfected with an increasing amount of the P1114L expression vector in combination with decreasing amounts of the wild type vector. Wild type to mutant ratios of 1:0, 3:1, 1:1, 1:3 and 0:1 were used. The cells were lysed 48 hours after transfection and the lysates were analyzed by immunoprecipitation and Western blotting as described above. These experiments permitted evaluation of whether the mutant protein interferes with wild type protein phosphorylation and estimation of the minimal amount of the WT protein needed for observable tyrosyl autophosphorylation. Immunoprecipitates from cells transfected with only the WT plasmid revealed WT protein that was strongly phosphorylated in this experiment (lane 2), whereas immunoprecipitates from cells transfected with only the mutant plasmid were again inactive (unphosphorylated). [0111]
Interestingly, when transfection was made using 75% of WT and 25% of mutant plasmid, the phosphorylation of the receptors was decreased by about 90%. This result strongly suggests that the P1114L mutant receptor forms heterodimers with the WT receptor, but cannot phosphorylate the WT receptor, thus failing to activate it. Under this theory, the WT receptor monomers in the heterodimers would also remain inactive, causing a disproportionate decrease of the total amount of activated receptor, when co-transfected with the mutant. Wildtype-wildtype homodimers would remainactive and be responsible for the observed signaling. When the wild type and mutant receptor expression vectors were transfected at a 1:1 ratio, the VEGFR-3 phosphorylation was about 4% of the wild type alone, whereas at a 1:3 ratio, no 30- tyrosine phosphorylation of VEGFR-3 was observed. [0112]
The foregoing results are consistent with the linkage analyses in Example 1: the mutation at position 641 that did not appear to correlate with lymphedema also did not appear to be disfunctional, whereas the mutation at position 1114 appeared to cause a dominant negative mutation that shows no tyrosine phosphorylation alone and that drastically reduces VEGFR-3 signaling in cells expressing both the mutant and wild type VEGFR-3 genes. [0113]
Collectively, these data indicate that the P1114L VEGFR-3 mutant is unable to act as a part of the signaling cascade, and also acts in a dominant negative manner, thus possibly interfering partially with the activation of the wild type VEGFR-3. Such effects of the mutation may eventually lead to lymphedema. [0114]

EXAMPLE 3

Treatment of Lymphedema with a VEGFR-3 Ligand

The data from Examples 1 and 2 collectively indicate a causative role in heritable lymphedema for a mutation in the VEGFR-3 gene that interferes with VEGFR-3 signaling. Such a mutation behaves in an autosomal dominant pattern, due to the apparent necessity for receptor dimerization in the signaling process. However, the data from Example 2 suggests that some residual signaling may still occur in heterozygous affected individuals, presumably through pairing of VEGFR-3 Proteins expressed from the wild type allele. The following experiments are designed to demonstrate the efficacy of VEGFR-3 ligand treatment in such affected individuals, to raise VEGFR-3 signaling to levels approaching normal and thereby ameliorate/palliate the symptoms of hereditary lymphedema. [0115]
Initially, an appropriate animal model is selected. Several potential animal models have been described in the literature. [See, e.g., Lyon et al, [0116] Mouse News Lett 71: 26(1984), Mouse News Lett. 74: 96 (1986), and Genetic variants and strains of the laboratory mouse, 2nd ed., New York: Oxford University Press (1989), p. 70 (Chylous ascites mouse); Dumont et al, Science, 282: 946-949.(1998) (heterozygous VEGFR-3 knockout mouse); Patterson et al, “Hereditary Lymphedema,” Comparative Pathology Bulletin, 3: 2 (1971) (canine hereditary lymphedema model); van der Putte, “Congenital Hereditary Lymphedema in the Pig,” Lympho, 11: 1-9 (1978); and Campbell-Beggs et al., “Chyloabdomen in a neonatal foal,” Veterinary Record, 137: 96-98 (1995).] Those models which are determined to have analogous mutations to the VEGFR-3 gene are preferred. Analogous mutations would include mutations affecting corresponding residues and also mutations affecting different residues but causing similar functional alterations. The Chylous ascites mouse VEGFR-3 gene contains a missense mutation at a position corresponding to residue 1053 of SEQ ID No. 2, which maps to the catalytic pocket region of the tyrosine kinase catalytic domain. Thus, the “Chy” mouse is expected to display similar functional alterations to human mutations affecting tyrosine kinase activity, a prediction which can be confirmed by functional assays such as those described in Example 2. In a preferred embodiment, “knock in” homologous recombination genetic engineering strategies are used to create an animal model (e.g., a mouse model) having a VEGFR-3 allelic variation analogous to the human variations described herein. [See, e.g., Partanen et al., Genes & Development, 12: 2332-2344 (1998) (gene targeting to introduce mutations into another receptor protein (FGFR-1) in mice).] For example, the P1114L mutation in human VEGFR-3 occurs in a VEGFR-3 region having highly conserved amino acid identity with murine VEGFR-3 (Genbank Accession No. L07296). Thus, a corresponding P1114L can be introduced into the murine VEGFR-3 by “knock-in” homologous recombination. Optionally, such mice can be bred to the heterozygous VEGFR-3 knockout mice or Chy mice described above to further modify the phenotypic severity of the lymphedema disease.
The mice as described above are treated with a candidate therapeutic,. e.g., a recombinant mature form of VEGF-C, at various dosing schedules, e.g., once daily by intravenous (IV) or intramuscular (IM) injection at a dose of 1-1000 ng/g body weight, preferably 10-100 ng/g, which should result in a peak level saturating VEGFR-3 (K[0117] _dabout 150 pM) but not VEGFR-2 (K_daround 400 pM). For VEGFR3-specific forms, such as VEGF-CΔC₁₅₆, even higher dosing is contemplated, to sustain VEGFR-3-saturating physiological concentrations for longer periods. Direct IM injection at multiple sites in the muscles of affected extremities is a preferred route of administration. The dosing is adjusted according to the efficacy of the treatment and the presence of possible side effects due to the lowering of blood pressure, which has been observed in response to VEGF administration IV. The efficacy of treatment is measured via NMRI imaging of the water content and volume of swelling of the abdomen and the extremities of the animals. The amount of fluid in the abdominal cavity is estimated and the animals are weighed during the follow-up.
In studies using VEGFR-3±×Chy mice progeny, the animals will also have the β-galactosidase marker in their lymphatic endothelium. After a successful treatment, the treated and non-treated experimental animals and VEGFR-3 ±controls are killed and their lymphatic vessels are visualized by β-gal and antibody staining. The staining patterns of experimental and control animals are compared for vessel diameter, numbers of endothelial cells, density of blood and lymphatic vessels, and nuclear density/section surface area for the estimation of tissue oedema. [0118]
Such experiments are repeated with various candidate therapeutics (e.g., VEGF-C or VEGF-D recombinant polypeptides; VEGF-C and VEGF-D gene therapy vectors; and combinations thereof) at various dosing schedules to determine an optimum treatment regimen. [0119]

EXAMPLE 4

Chromosomal Structure of the Human VEGFR-3 Gene

Sequencing and mapping of human DNA corresponding to the VEGFR-3 locus has indicated that this gene consists of thirty exons separated by twenty-nine introns of varying size. The exon intron organization is summarized as follows:



EXON	Bp of SEQ ID NO: 1
NUMBER	size (bp)	INTRON SIZE

1	20-77	unknown
	58 bp
2	78-174	>1 kb
	97 bp
3	175-419	218 bp
	245 bp
4	420-532	120 bp
	113 bp
5	533-695	107 bp
	163 bp
6	696-835	269 bp
	140 bp
7	836-1004	261 bp
	169 bp
8	1005-1122	>1 kb
	118 bp
9	1123-1277	unknown
	155 bp
10	1278-1440	>1 kb
	163 bp
11	1441-1567	unknown
	127 bp
12	1568-1676	unknown
	109 bp
13	1677-2039	293 bp
	363 bp
14	2040-2186	99 bp
	147 bp
15	2187-2318	approx.
	132 bp	160 bp
16	2319-2425	301 bp
	107 bp
17	2426-2561	>464 bp
	139 bp
18	2562-2666	unknown
	105 bp
19	2667-2780	143 bp
	114 bp
20	2781-2869	>1 kb
	89 bp
21	2870-3020	unknown
	151 bp
22	3021-3115	unknown
	95 bp
23	3116-3238	unknown
	123 bp
24	3239-3350	974 bp
	112 bp
25	3351-3450	400 bp
	100 bp
26	3451-3557	unknown
	107 bp
27	3558-3705	>1 kb
	148 bp
28	3706-3826	unknown
	121 bp
29	3827-3912	unknown
	86 bp
30a	3913-4111	3.7 kb
(Flt4 short)	199 bp
30b	3913-4416	(CDS
(Flt4 long)	>504 bp	504 bp)

The foregoing information permits rapid design of oligonucleotides for amplifying select portions of the VEGFR-3 gene from genomic DNA, or RNA, or cDNA, to facilitate rapid analysis of an individual's VEGFR-3 coding sequence, to determine whether the individual possesses a mutation that correlates with a lymphedema phenotype. [0121]

EXAMPLE 5

Identification of Additional Non-Conservative Missense Mutants

Using procedures essentially as described in Example 1, the VEGFR-3 coding sequences from additional affected and unaffected individuals from families having members suffering from heritable lymphedema were studied. The analysis focused on families with statistical linkage to chromosome 5q as described in Example 1. The additional analysis included the PCR amplification and sequencing of Exon 17, Exon 22, and Exon 23 sequences with the following PCR primers:


Exon 17-1	5′-CATCAAGACGGGCTACCT-3′	(SEQ ID NO: 23)

Exon 17-2	5′-CCGCTGACCCCACACCTT-3′	(SEQ ID NO: 24)

Exon 22-1	5′-GAGTTGACCTCCCAAGGT-3′	(SEQ ID NO: 25)

Exon 22-2	5′-TCTCCTGGACAGGCAGTC-3′	(SEQ ID NO: 26)

Exon 23-1	5′-GAGTTGACCTCCCAAGGT-3′	(SEQ ID NO. 27)

Exon 23-2	5′-TCTCCTGGACAGGCAGTC-3′	(SEQ ID NO. 28)

These additional studies identified four additional non-conservative missense mutations in evolutionarily conserved amino acids in kinase domains I and II of human VEGFR-3. Each mutation, shown in Table 3 below, was observed in a single independently ascertained family, and in each family, the mutation co-segregates with individuals suffering from, or considered at risk for developing, lymphedema. None of these mutations were observed in the VEGFR-3 genes in a random sample of more than 300 chromosomes from individuals from families unafflicted with heritable lymphedema.

TABLE 3


Mutations in VEGFR-3 causing Hereditary Lymphedema*

	Nucleotide	Amino Acid	Functional
Exon	Substitution**	Substitution	Domain

24	C3360T	P1114L	Kinase	2
17	G2588A	G857R	Kinase	1
23	G3141C	R1041P	Kinase	2
23	T3150C	L1044P	Kinase	2
23	G3164A	D1049N	Kinase	2

Referring to SEQ ID NO: 2, the kinase domains of VEGFR-3 comprise approximately residues 843-943 and residues 1009-1165. Within these domains, molecular modeling suggests that residues G852, G854, G857, K879, E896, H1035, D1037, N1042, D1055, F1056, G1057, E1084, D1096 and R1159 are of particular importance in comprising or shaping the catalytic pocket within the kinase domains. See van Der Geer and Hunter, [0124] Ann. Rev. Cell. Biol., 10: 251-337 (1994); and Mohammadi et al., Cell 86: 577-587 (1996). Thus, this data identifying additional mutations implicate missense mutations within a kinase domain of the VEGFR-3 protein as correlating strongly with a risk for developing a heritable lymphedema phenotype. Mutations which affect residues in and around the catalytic pocket appear particularly likely to correlate with lymphedema. The P1114L mutation, though not situated within the catalytic pocket, is postulated to cause a conformational alteration that affects the catalytic pocket. The G857R mutation is postulated to block the catalytic pocket and/or the ATP binding site of the kinase domain.

EXAMPLE 6

Functional Analysis of Additional VEGFR-3 Missense Mutations

Using procedures essentially as described above in Example 2, the functional state of the G857R, L1044P, and D1049N mutations were analyzed. (PLCLB buffer, comprising 150 mm NaCl, 5% glycerol, 1% Triton X-100, 1.5M MgCl[0125] ₂, 50 mm HEPES, pH 7.5, was substituted for RIPA buffer described in Example 2 for immunoprecipitation and Western blotting protocols.) A VEGFR-3-encoding construct comprising the G857R mutation was generated from the long form of human VEGFR-3 cDNA using the oligonucleotide:
5′-CGG CGC CTT CAG GAA GGT GGT-3′ (SEQ ID NO: 20) [0126]
A construct comprising the L1044P mutation was generated from the long form of human VEGFR-3 cDNA using the oligonucleotide: [0127]
5′-CGG AAC ATT CCG CTG TCG GAA-3′ (SEQ ID NO: 21) [0128]
A construct comprising the D 1049N mutation was generated from the long form of human VEGFR-3 cDNA using the oligonucleotide: [0129]
5′-GTC GGA AAG CAA CGT GGT GAA-3′ (SEQ ID NO: 22). [0130]
The constructs were transiently transfected into 293T cells and harvested for Western blotting essentially as described in Example 2, except for the buffer substitution described above. In contrast to wild type VEGFR-3 and VEGFR-3 containing the P641S mutation, no phosphorylated G857R or L1044P mutant protein was detected using the phosphotyrosine antibodies, consistent with the results that had been observed for P1114L. The expression of similar amounts of the VEGFR-3 protein was confirmed using the monoclonal 9D9f9 antibody, which is directed towards the extracellular domain of the VEGFR-3 in the Western blotting. This data suggested that these observed mutations did indeed affect VEGFR-3 kinase function. The D1049N mutant appeared to retain at least some tyrosine kinase activity. It is also noteworthy that VEGFR-1 and VEGFR-2 contain an asparagine residue at the position in their tyrosine kinase domains which corresponds to position 1049 of VEGFR-3. Together, these data suggest that the D1049N variation may only be an alielic variant that correlates with hereditary lymphedema, rather than a causative mutation. [0131]
To determine whether the VEGFR-3 mutants function in a dominant negative manner, each construct was co-transfected at varying ratios with wild type receptor into 293T cells essentially as described in Example 2. Unlike the results observed for P1114L and described in Example 2, neither the G857R mutant nor the L1044P mutant seemed to interfere with phosphorylation of the co-transfected wild type receptor. [0132]
The absence of a dominant negative effect in these experiments does not foreclose a conclusion that the mutations described above are causative. It has been found that a significant fraction of ligand-activated receptor tyrosine kinases traffic to the lysosotnal compartment after internalization, where they are degraded, However, receptors which are not ligand-activated preferentially recycle back to the cell surface after internalization. Thus, it is possible that the turnover time of the weakly phosphorylated mutant receptor is significantly longer than that of the wild type receptor protein. If this were true, the amount of the mutant receptor on the endothelial cell surface could be considerably higher than the amount of the phosphorylated and rapidly internalized wild type receptor, and any available ligand would thus bind a disproportionally high number of mutant receptors. Both a possible dominant negative effect of the mutant receptor and an abnormally long half-life of the tyrosine kinase negative mutant receptor could eventually lead to lymphedema. Alternatively; a mutation that merely decreases.(but does not eliminate) VFGFR-3 tyrosine kinase activity may display a constitutive low level of internalization and degradation that is insufficient to trigger sufficient downstream signalling, but decreases the effective concentration of VEGFR-3 on cell surfaces for ligand binding and effective activation, leading eventually to lymphedema. [0133]
While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those in the art, all of which are intended as aspects of the present invention. Accordingly, only such limitations as appear in the claims should be placed on the invention. [0134]
1 28 1 4111 DNA Homo sapiens CDS (20)..(4111) Human Flt4 (VEGFR-3) long form cDNA 1 ccacgcgcag cggccggag atg cag cgg ggc gcc gcg ctg tgc ctg cga ctg 52 Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu 1 5 10 tgg ctc tgc ctg gga ctc ctg gac ggc ctg gtg agt ggc tac tcc atg 100 Trp Leu Cys Leu Gly Leu Leu Asp Gly Leu Val Ser Gly Tyr Ser Met 15 20 25 acc ccc ccg acc ttg aac atc acg gag gag tca cac gtc atc gac acc 148 Thr Pro Pro Thr Leu Asn Ile Thr Glu Glu Ser His Val Ile Asp Thr 30 35 40 ggt gac agc ctg tcc atc tcc tgc agg gga cag cac ccc ctc gag tgg 196 Gly Asp Ser Leu Ser Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp 45 50 55 gct tgg cca gga gct cag gag gcg cca gcc acc gga gac aag gac agc 244 Ala Trp Pro Gly Ala Gln Glu Ala Pro Ala Thr Gly Asp Lys Asp Ser 60 65 70 75 gag gac acg ggg gtg gtg cga gac tgc gag ggc aca gac gcc agg ccc 292 Glu Asp Thr Gly Val Val Arg Asp Cys Glu Gly Thr Asp Ala Arg Pro 80 85 90 tac tgc aag gtg ttg ctg ctg cac gag gta cat gcc aac gac aca ggc 340 Tyr Cys Lys Val Leu Leu Leu His Glu Val His Ala Asn Asp Thr Gly 95 100 105 agc tac gtc tgc tac tac aag tac atc aag gca cgc atc gag ggc acc 388 Ser Tyr Val Cys Tyr Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr 110 115 120 acg gcc gcc agc tcc tac gtg ttc gtg aga gac ttt gag cag cca ttc 436 Thr Ala Ala Ser Ser Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe 125 130 135 atc aac aag cct gac acg ctc ttg gtc aac agg aag gac gcc atg tgg 484 Ile Asn Lys Pro Asp Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp 140 145 150 155 gtg ccc tgt ctg gtg tcc atc ccc ggc ctc aat gtc acg ctg cgc tcg 532 Val Pro Cys Leu Val Ser Ile Pro Gly Leu Asn Val Thr Leu Arg Ser 160 165 170 caa agc tcg gtg ctg tgg cca gac ggg cag gag gtg gtg tgg gat gac 580 Gln Ser Ser Val Leu Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp 175 180 185 cgg cgg ggc atg ctc gtg tcc acg cca ctg ctg cac gat gcc ctg tac 628 Arg Arg Gly Met Leu Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr 190 195 200 ctg cag tgc gag acc acc tgg gga gac cag gac ttc ctt tcc aac ccc 676 Leu Gln Cys Glu Thr Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro 205 210 215 ttc ctg gtg cac atc aca ggc aac gag ctc tat gac atc cag ctg ttg 724 Phe Leu Val His Ile Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Leu 220 225 230 235 ccc agg aag tcg ctg gag ctg ctg gta ggg gag aag ctg gtc ctg aac 772 Pro Arg Lys Ser Leu Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn 240 245 250 tgc acc gtg tgg gct gag ttt aac tca ggt gtc acc ttt gac tgg gac 820 Cys Thr Val Trp Ala Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp 255 260 265 tac cca ggg aag cag gca gag cgg ggt aag tgg gtg ccc gag cga cgc 868 Tyr Pro Gly Lys Gln Ala Glu Arg Gly Lys Trp Val Pro Glu Arg Arg 270 275 280 tcc cag cag acc cac aca gaa ctc tcc agc atc ctg acc atc cac aac 916 Ser Gln Gln Thr His Thr Glu Leu Ser Ser Ile Leu Thr Ile His Asn 285 290 295 gtc agc cag cac gac ctg ggc tcg tat gtg tgc aag gcc aac aac ggc 964 Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys Ala Asn Asn Gly 300 305 310 315 atc cag cga ttt cgg gag agc acc gag gtc att gtg cat gaa aat ccc 1012 Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val His Glu Asn Pro 320 325 330 ttc atc agc gtc gag tgg ctc aaa gga ccc atc ctg gag gcc acg gca 1060 Phe Ile Ser Val Glu Trp Leu Lys Gly Pro Ile Leu Glu Ala Thr Ala 335 340 345 gga gac gag ctg gtg aag ctg ccc gtg aag ctg gca gcg tac ccc ccg 1108 Gly Asp Glu Leu Val Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro 350 355 360 ccc gag ttc cag tgg tac aag gat gga aag gca ctg tcc ggg cgc cac 1156 Pro Glu Phe Gln Trp Tyr Lys Asp Gly Lys Ala Leu Ser Gly Arg His 365 370 375 agt cca cat gcc ctg gtg ctc aag gag gtg aca gag gcc agc aca ggc 1204 Ser Pro His Ala Leu Val Leu Lys Glu Val Thr Glu Ala Ser Thr Gly 380 385 390 395 acc tac acc ctc gcc ctg tgg aac tcc gct gct ggc ctg agg cgc aac 1252 Thr Tyr Thr Leu Ala Leu Trp Asn Ser Ala Ala Gly Leu Arg Arg Asn 400 405 410 atc agc ctg gag ctg gtg gtg aat gtg ccc ccc cag ata cat gag aag 1300 Ile Ser Leu Glu Leu Val Val Asn Val Pro Pro Gln Ile His Glu Lys 415 420 425 gag gcc tcc tcc ccc agc atc tac tcg cgt cac agc cgc cag gcc ctc 1348 Glu Ala Ser Ser Pro Ser Ile Tyr Ser Arg His Ser Arg Gln Ala Leu 430 435 440 acc tgc acg gcc tac ggg gtg ccc ctg cct ctc agc atc cag tgg cac 1396 Thr Cys Thr Ala Tyr Gly Val Pro Leu Pro Leu Ser Ile Gln Trp His 445 450 455 tgg cgg ccc tgg aca ccc tgc aag atg ttt gcc cag cgt agt ctc cgg 1444 Trp Arg Pro Trp Thr Pro Cys Lys Met Phe Ala Gln Arg Ser Leu Arg 460 465 470 475 cgg cgg cag cag caa gac ctc atg cca cag tgc cgt gac tgg agg gcg 1492 Arg Arg Gln Gln Gln Asp Leu Met Pro Gln Cys Arg Asp Trp Arg Ala 480 485 490 gtg acc acg cag gat gcc gtg aac ccc atc gag agc ctg gac acc tgg 1540 Val Thr Thr Gln Asp Ala Val Asn Pro Ile Glu Ser Leu Asp Thr Trp 495 500 505 acc gag ttt gtg gag gga aag aat aag act gtg agc aag ctg gtg atc 1588 Thr Glu Phe Val Glu Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile 510 515 520 cag aat gcc aac gtg tct gcc atg tac aag tgt gtg gtc tcc aac aag 1636 Gln Asn Ala Asn Val Ser Ala Met Tyr Lys Cys Val Val Ser Asn Lys 525 530 535 gtg ggc cag gat gag cgg ctc atc tac ttc tat gtg acc acc atc ccc 1684 Val Gly Gln Asp Glu Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro 540 545 550 555 gac ggc ttc acc atc gaa tcc aag cca tcc gag gag cta cta gag ggc 1732 Asp Gly Phe Thr Ile Glu Ser Lys Pro Ser Glu Glu Leu Leu Glu Gly 560 565 570 cag ccg gtg ctc ctg agc tgc caa gcc gac agc tac aag tac gag cat 1780 Gln Pro Val Leu Leu Ser Cys Gln Ala Asp Ser Tyr Lys Tyr Glu His 575 580 585 ctg cgc tgg tac cgc ctc aac ctg tcc acg ctg cac gat gcg cac ggg 1828 Leu Arg Trp Tyr Arg Leu Asn Leu Ser Thr Leu His Asp Ala His Gly 590 595 600 aac ccg ctt ctg ctc gac tgc aag aac gtg cat ctg ttc gcc acc cct 1876 Asn Pro Leu Leu Leu Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro 605 610 615 ctg gcc gcc agc ctg gag gag gtg gca cct ggg gcg cgc cac gcc acg 1924 Leu Ala Ala Ser Leu Glu Glu Val Ala Pro Gly Ala Arg His Ala Thr 620 625 630 635 ctc agc ctg agt atc ccc cgc gtc gcg ccc gag cac gag ggc cac tat 1972 Leu Ser Leu Ser Ile Pro Arg Val Ala Pro Glu His Glu Gly His Tyr 640 645 650 gtg tgc gaa gtg caa gac cgg cgc agc cat gac aag cac tgc cac aag 2020 Val Cys Glu Val Gln Asp Arg Arg Ser His Asp Lys His Cys His Lys 655 660 665 aag tac ctg tcg gtg cag gcc ctg gaa gcc cct cgg ctc acg cag aac 2068 Lys Tyr Leu Ser Val Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn 670 675 680 ttg acc gac ctc ctg gtg aac gtg agc gac tcg ctg gag atg cag tgc 2116 Leu Thr Asp Leu Leu Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys 685 690 695 ttg gtg gcc gga gcg cac gcg ccc agc atc gtg tgg tac aaa gac gag 2164 Leu Val Ala Gly Ala His Ala Pro Ser Ile Val Trp Tyr Lys Asp Glu 700 705 710 715 agg ctg ctg gag gaa aag tct gga gtc gac ttg gcg gac tcc aac cag 2212 Arg Leu Leu Glu Glu Lys Ser Gly Val Asp Leu Ala Asp Ser Asn Gln 720 725 730 aag ctg agc atc cag cgc gtg cgc gag gag gat gcg gga cgc tat ctg 2260 Lys Leu Ser Ile Gln Arg Val Arg Glu Glu Asp Ala Gly Arg Tyr Leu 735 740 745 tgc agc gtg tgc aac gcc aag ggc tgc gtc aac tcc tcc gcc agc gtg 2308 Cys Ser Val Cys Asn Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val 750 755 760 gcc gtg gaa ggc tcc gag gat aag ggc agc atg gag atc gtg atc ctt 2356 Ala Val Glu Gly Ser Glu Asp Lys Gly Ser Met Glu Ile Val Ile Leu 765 770 775 gtc ggt acc ggc gtc atc gct gtc ttc ttc tgg gtc ctc ctc ctc ctc 2404 Val Gly Thr Gly Val Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu 780 785 790 795 atc ttc tgt aac atg agg agg ccg gcc cac gca gac atc aag acg ggc 2452 Ile Phe Cys Asn Met Arg Arg Pro Ala His Ala Asp Ile Lys Thr Gly 800 805 810 tac ctg tcc atc atc atg gac ccc ggg gag gtg cct ctg gag gag caa 2500 Tyr Leu Ser Ile Ile Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln 815 820 825 tgc gaa tac ctg tcc tac gat gcc agc cag tgg gaa ttc ccc cga gag 2548 Cys Glu Tyr Leu Ser Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu 830 835 840 cgg ctg cac ctg ggg aga gtg ctc ggc tac ggc gcc ttc ggg aag gtg 2596 Arg Leu His Leu Gly Arg Val Leu Gly Tyr Gly Ala Phe Gly Lys Val 845 850 855 gtg gaa gcc tcc gct ttc ggc atc cac aag ggc agc agc tgt gac acc 2644 Val Glu Ala Ser Ala Phe Gly Ile His Lys Gly Ser Ser Cys Asp Thr 860 865 870 875 gtg gcc gtg aaa atg ctg aaa gag ggc gcc acg gcc agc gag cac cgc 2692 Val Ala Val Lys Met Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg 880 885 890 gcg ctg atg tcg gag ctc aag atc ctc att cac atc ggc aac cac ctc 2740 Ala Leu Met Ser Glu Leu Lys Ile Leu Ile His Ile Gly Asn His Leu 895 900 905 aac gtg gtc aac ctc ctc ggg gcg tgc acc aag ccg cag ggc ccc ctc 2788 Asn Val Val Asn Leu Leu Gly Ala Cys Thr Lys Pro Gln Gly Pro Leu 910 915 920 atg gtg atc gtg gag ttc tgc aag tac ggc aac ctc tcc aac ttc ctg 2836 Met Val Ile Val Glu Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu 925 930 935 cgc gcc aag cgg gac gcc ttc agc ccc tgc gcg gag aag tct ccc gag 2884 Arg Ala Lys Arg Asp Ala Phe Ser Pro Cys Ala Glu Lys Ser Pro Glu 940 945 950 955 cag cgc gga cgc ttc cgc gcc atg gtg gag ctc gcc agg ctg gat cgg 2932 Gln Arg Gly Arg Phe Arg Ala Met Val Glu Leu Ala Arg Leu Asp Arg 960 965 970 agg cgg ccg ggg agc agc gac agg gtc ctc ttc gcg cgg ttc tcg aag 2980 Arg Arg Pro Gly Ser Ser Asp Arg Val Leu Phe Ala Arg Phe Ser Lys 975 980 985 acc gag ggc gga gcg agg cgg gct tct cca gac caa gaa gct gag gac 3028 Thr Glu Gly Gly Ala Arg Arg Ala Ser Pro Asp Gln Glu Ala Glu Asp 990 995 1000 ctg tgg ctg agc ccg ctg acc atg gaa gat ctt gtc tgc tac agc ttc 3076 Leu Trp Leu Ser Pro Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe 1005 1010 1015 cag gtg gcc aga ggg atg gag ttc ctg gct tcc cga aag tgc atc cac 3124 Gln Val Ala Arg Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His 1020 1025 1030 1035 aga gac ctg gct gct cgg aac att ctg ctg tcg gaa agc gac gtg gtg 3172 Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Ser Asp Val Val 1040 1045 1050 aag atc tgt gac ttt ggc ctt gcc cgg gac atc tac aaa gac cct gac 3220 Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp 1055 1060 1065 tac gtc cgc aag ggc agt gcc cgg ctg ccc ctg aag tgg atg gcc cct 3268 Tyr Val Arg Lys Gly Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro 1070 1075 1080 gaa agc atc ttc gac aag gtg tac acc acg cag agt gac gtg tgg tcc 3316 Glu Ser Ile Phe Asp Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser 1085 1090 1095 ttt ggg gtg ctt ctc tgg gag atc ttc tct ctg ggg gcc tcc ccg tac 3364 Phe Gly Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr 1100 1105 1110 1115 cct ggg gtg cag atc aat gag gag ttc tgc cag cgg ctg aga gac ggc 3412 Pro Gly Val Gln Ile Asn Glu Glu Phe Cys Gln Arg Leu Arg Asp Gly 1120 1125 1130 aca agg atg agg gcc ccg gag ctg gcc act ccc gcc ata cgc cgc atc 3460 Thr Arg Met Arg Ala Pro Glu Leu Ala Thr Pro Ala Ile Arg Arg Ile 1135 1140 1145 atg ctg aac tgc tgg tcc gga gac ccc aag gcg aga cct gca ttc tcg 3508 Met Leu Asn Cys Trp Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser 1150 1155 1160 gag ctg gtg gag atc ctg ggg gac ctg ctc cag ggc agg ggc ctg caa 3556 Glu Leu Val Glu Ile Leu Gly Asp Leu Leu Gln Gly Arg Gly Leu Gln 1165 1170 1175 gag gaa gag gag gtc tgc atg gcc ccg cgc agc tct cag agc tca gaa 3604 Glu Glu Glu Glu Val Cys Met Ala Pro Arg Ser Ser Gln Ser Ser Glu 1180 1185 1190 1195 gag ggc agc ttc tcg cag gtg tcc acc atg gcc cta cac atc gcc cag 3652 Glu Gly Ser Phe Ser Gln Val Ser Thr Met Ala Leu His Ile Ala Gln 1200 1205 1210 gct gac gct gag gac agc ccg cca agc ctg cag cgc cac agc ctg gcc 3700 Ala Asp Ala Glu Asp Ser Pro Pro Ser Leu Gln Arg His Ser Leu Ala 1215 1220 1225 gcc agg tat tac aac tgg gtg tcc ttt ccc ggg tgc ctg gcc aga ggg 3748 Ala Arg Tyr Tyr Asn Trp Val Ser Phe Pro Gly Cys Leu Ala Arg Gly 1230 1235 1240 gct gag acc cgt ggt tcc tcc agg atg aag aca ttt gag gaa ttc ccc 3796 Ala Glu Thr Arg Gly Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro 1245 1250 1255 atg acc cca acg acc tac aaa ggc tct gtg gac aac cag aca gac agt 3844 Met Thr Pro Thr Thr Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser 1260 1265 1270 1275 ggg atg gtg ctg gcc tcg gag gag ttt gag cag ata gag agc agg cat 3892 Gly Met Val Leu Ala Ser Glu Glu Phe Glu Gln Ile Glu Ser Arg His 1280 1285 1290 aga caa gaa agc ggc ttc agc tgt aaa gga cct ggc cag aat gtg gct 3940 Arg Gln Glu Ser Gly Phe Ser Cys Lys Gly Pro Gly Gln Asn Val Ala 1295 1300 1305 gtg acc agg gca cac cct gac tcc caa ggg agg cgg cgg cgg cct gag 3988 Val Thr Arg Ala His Pro Asp Ser Gln Gly Arg Arg Arg Arg Pro Glu 1310 1315 1320 cgg ggg gcc cga gga ggc cag gtg ttt tac aac agc gag tat ggg gag 4036 Arg Gly Ala Arg Gly Gly Gln Val Phe Tyr Asn Ser Glu Tyr Gly Glu 1325 1330 1335 ctg tcg gag cca agc gag gag gac cac tgc tcc ccg tct gcc cgc gtg 4084 Leu Ser Glu Pro Ser Glu Glu Asp His Cys Ser Pro Ser Ala Arg Val 1340 1345 1350 1355 act ttc ttc aca gac aac agc tac taa 4111 Thr Phe Phe Thr Asp Asn Ser Tyr 1360 2 1363 PRT Homo sapiens 2 Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu Trp Leu Cys Leu Gly 1 5 10 15 Leu Leu Asp Gly Leu Val Ser Gly Tyr Ser Met Thr Pro Pro Thr Leu 20 25 30 Asn Ile Thr Glu Glu Ser His Val Ile Asp Thr Gly Asp Ser Leu Ser 35 40 45 Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp Ala Trp Pro Gly Ala 50 55 60 Gln Glu Ala Pro Ala Thr Gly Asp Lys Asp Ser Glu Asp Thr Gly Val 65 70 75 80 Val Arg Asp Cys Glu Gly Thr Asp Ala Arg Pro Tyr Cys Lys Val Leu 85 90 95 Leu Leu His Glu Val His Ala Asn Asp Thr Gly Ser Tyr Val Cys Tyr 100 105 110 Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr Thr Ala Ala Ser Ser 115 120 125 Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe Ile Asn Lys Pro Asp 130 135 140 Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp Val Pro Cys Leu Val 145 150 155 160 Ser Ile Pro Gly Leu Asn Val Thr Leu Arg Ser Gln Ser Ser Val Leu 165 170 175 Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp Arg Arg Gly Met Leu 180 185 190 Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr Leu Gln Cys Glu Thr 195 200 205 Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro Phe Leu Val His Ile 210 215 220 Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Leu Pro Arg Lys Ser Leu 225 230 235 240 Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn Cys Thr Val Trp Ala 245 250 255 Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp Tyr Pro Gly Lys Gln 260 265 270 Ala Glu Arg Gly Lys Trp Val Pro Glu Arg Arg Ser Gln Gln Thr His 275 280 285 Thr Glu Leu Ser Ser Ile Leu Thr Ile His Asn Val Ser Gln His Asp 290 295 300 Leu Gly Ser Tyr Val Cys Lys Ala Asn Asn Gly Ile Gln Arg Phe Arg 305 310 315 320 Glu Ser Thr Glu Val Ile Val His Glu Asn Pro Phe Ile Ser Val Glu 325 330 335 Trp Leu Lys Gly Pro Ile Leu Glu Ala Thr Ala Gly Asp Glu Leu Val 340 345 350 Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro Pro Glu Phe Gln Trp 355 360 365 Tyr Lys Asp Gly Lys Ala Leu Ser Gly Arg His Ser Pro His Ala Leu 370 375 380 Val Leu Lys Glu Val Thr Glu Ala Ser Thr Gly Thr Tyr Thr Leu Ala 385 390 395 400 Leu Trp Asn Ser Ala Ala Gly Leu Arg Arg Asn Ile Ser Leu Glu Leu 405 410 415 Val Val Asn Val Pro Pro Gln Ile His Glu Lys Glu Ala Ser Ser Pro 420 425 430 Ser Ile Tyr Ser Arg His Ser Arg Gln Ala Leu Thr Cys Thr Ala Tyr 435 440 445 Gly Val Pro Leu Pro Leu Ser Ile Gln Trp His Trp Arg Pro Trp Thr 450 455 460 Pro Cys Lys Met Phe Ala Gln Arg Ser Leu Arg Arg Arg Gln Gln Gln 465 470 475 480 Asp Leu Met Pro Gln Cys Arg Asp Trp Arg Ala Val Thr Thr Gln Asp 485 490 495 Ala Val Asn Pro Ile Glu Ser Leu Asp Thr Trp Thr Glu Phe Val Glu 500 505 510 Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile Gln Asn Ala Asn Val 515 520 525 Ser Ala Met Tyr Lys Cys Val Val Ser Asn Lys Val Gly Gln Asp Glu 530 535 540 Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro Asp Gly Phe Thr Ile 545 550 555 560 Glu Ser Lys Pro Ser Glu Glu Leu Leu Glu Gly Gln Pro Val Leu Leu 565 570 575 Ser Cys Gln Ala Asp Ser Tyr Lys Tyr Glu His Leu Arg Trp Tyr Arg 580 585 590 Leu Asn Leu Ser Thr Leu His Asp Ala His Gly Asn Pro Leu Leu Leu 595 600 605 Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro Leu Ala Ala Ser Leu 610 615 620 Glu Glu Val Ala Pro Gly Ala Arg His Ala Thr Leu Ser Leu Ser Ile 625 630 635 640 Pro Arg Val Ala Pro Glu His Glu Gly His Tyr Val Cys Glu Val Gln 645 650 655 Asp Arg Arg Ser His Asp Lys His Cys His Lys Lys Tyr Leu Ser Val 660 665 670 Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn Leu Thr Asp Leu Leu 675 680 685 Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys Leu Val Ala Gly Ala 690 695 700 His Ala Pro Ser Ile Val Trp Tyr Lys Asp Glu Arg Leu Leu Glu Glu 705 710 715 720 Lys Ser Gly Val Asp Leu Ala Asp Ser Asn Gln Lys Leu Ser Ile Gln 725 730 735 Arg Val Arg Glu Glu Asp Ala Gly Arg Tyr Leu Cys Ser Val Cys Asn 740 745 750 Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val Ala Val Glu Gly Ser 755 760 765 Glu Asp Lys Gly Ser Met Glu Ile Val Ile Leu Val Gly Thr Gly Val 770 775 780 Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu Ile Phe Cys Asn Met 785 790 795 800 Arg Arg Pro Ala His Ala Asp Ile Lys Thr Gly Tyr Leu Ser Ile Ile 805 810 815 Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln Cys Glu Tyr Leu Ser 820 825 830 Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu Arg Leu His Leu Gly 835 840 845 Arg Val Leu Gly Tyr Gly Ala Phe Gly Lys Val Val Glu Ala Ser Ala 850 855 860 Phe Gly Ile His Lys Gly Ser Ser Cys Asp Thr Val Ala Val Lys Met 865 870 875 880 Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg Ala Leu Met Ser Glu 885 890 895 Leu Lys Ile Leu Ile His Ile Gly Asn His Leu Asn Val Val Asn Leu 900 905 910 Leu Gly Ala Cys Thr Lys Pro Gln Gly Pro Leu Met Val Ile Val Glu 915 920 925 Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu Arg Ala Lys Arg Asp 930 935 940 Ala Phe Ser Pro Cys Ala Glu Lys Ser Pro Glu Gln Arg Gly Arg Phe 945 950 955 960 Arg Ala Met Val Glu Leu Ala Arg Leu Asp Arg Arg Arg Pro Gly Ser 965 970 975 Ser Asp Arg Val Leu Phe Ala Arg Phe Ser Lys Thr Glu Gly Gly Ala 980 985 990 Arg Arg Ala Ser Pro Asp Gln Glu Ala Glu Asp Leu Trp Leu Ser Pro 995 1000 1005 Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe Gln Val Ala Arg Gly 1010 1015 1020 Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His Arg Asp Leu Ala Ala 1025 1030 1035 1040 Arg Asn Ile Leu Leu Ser Glu Ser Asp Val Val Lys Ile Cys Asp Phe 1045 1050 1055 Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp Tyr Val Arg Lys Gly 1060 1065 1070 Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser Ile Phe Asp 1075 1080 1085 Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu 1090 1095 1100 Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr Pro Gly Val Gln Ile 1105 1110 1115 1120 Asn Glu Glu Phe Cys Gln Arg Leu Arg Asp Gly Thr Arg Met Arg Ala 1125 1130 1135 Pro Glu Leu Ala Thr Pro Ala Ile Arg Arg Ile Met Leu Asn Cys Trp 1140 1145 1150 Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser Glu Leu Val Glu Ile 1155 1160 1165 Leu Gly Asp Leu Leu Gln Gly Arg Gly Leu Gln Glu Glu Glu Glu Val 1170 1175 1180 Cys Met Ala Pro Arg Ser Ser Gln Ser Ser Glu Glu Gly Ser Phe Ser 1185 1190 1195 1200 Gln Val Ser Thr Met Ala Leu His Ile Ala Gln Ala Asp Ala Glu Asp 1205 1210 1215 Ser Pro Pro Ser Leu Gln Arg His Ser Leu Ala Ala Arg Tyr Tyr Asn 1220 1225 1230 Trp Val Ser Phe Pro Gly Cys Leu Ala Arg Gly Ala Glu Thr Arg Gly 1235 1240 1245 Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro Met Thr Pro Thr Thr 1250 1255 1260 Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser Gly Met Val Leu Ala 1265 1270 1275 1280 Ser Glu Glu Phe Glu Gln Ile Glu Ser Arg His Arg Gln Glu Ser Gly 1285 1290 1295 Phe Ser Cys Lys Gly Pro Gly Gln Asn Val Ala Val Thr Arg Ala His 1300 1305 1310 Pro Asp Ser Gln Gly Arg Arg Arg Arg Pro Glu Arg Gly Ala Arg Gly 1315 1320 1325 Gly Gln Val Phe Tyr Asn Ser Glu Tyr Gly Glu Leu Ser Glu Pro Ser 1330 1335 1340 Glu Glu Asp His Cys Ser Pro Ser Ala Arg Val Thr Phe Phe Thr Asp 1345 1350 1355 1360 Asn Ser Tyr 3 1997 DNA Homo sapiens CDS (352)..(1611) Human cDNA for prepro-VEGF-C 3 cccgccccgc ctctccaaaa agctacaccg acgcggaccg cggcggcgtc ctccctcgcc 60 ctcgcttcac ctcgcgggct ccgaatgcgg ggagctcgga tgtccggttt cctgtgaggc 120 ttttacctga cacccgccgc ctttccccgg cactggctgg gagggcgccc tgcaaagttg 180 ggaacgcgga gccccggacc cgctcccgcc gcctccggct cgcccagggg gggtcgccgg 240 gaggagcccg ggggagaggg accaggaggg gcccgcggcc tcgcaggggc gcccgcgccc 300 ccacccctgc ccccgccagc ggaccggtcc cccacccccg gtccttccac c atg cac 357 Met His 1 ttg ctg ggc ttc ttc tct gtg gcg tgt tct ctg ctc gcc gct gcg ctg 405 Leu Leu Gly Phe Phe Ser Val Ala Cys Ser Leu Leu Ala Ala Ala Leu 5 10 15 ctc ccg ggt cct cgc gag gcg ccc gcc gcc gcc gcc gcc ttc gag tcc 453 Leu Pro Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Phe Glu Ser 20 25 30 gga ctc gac ctc tcg gac gcg gag ccc gac gcg ggc gag gcc acg gct 501 Gly Leu Asp Leu Ser Asp Ala Glu Pro Asp Ala Gly Glu Ala Thr Ala 35 40 45 50 tat gca agc aaa gat ctg gag gag cag tta cgg tct gtg tcc agt gta 549 Tyr Ala Ser Lys Asp Leu Glu Glu Gln Leu Arg Ser Val Ser Ser Val 55 60 65 gat gaa ctc atg act gta ctc tac cca gaa tat tgg aaa atg tac aag 597 Asp Glu Leu Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met Tyr Lys 70 75 80 tgt cag cta agg aaa gga ggc tgg caa cat aac aga gaa cag gcc aac 645 Cys Gln Leu Arg Lys Gly Gly Trp Gln His Asn Arg Glu Gln Ala Asn 85 90 95 ctc aac tca agg aca gaa gag act ata aaa ttt gct gca gca cat tat 693 Leu Asn Ser Arg Thr Glu Glu Thr Ile Lys Phe Ala Ala Ala His Tyr 100 105 110 aat aca gag atc ttg aaa agt att gat aat gag tgg aga aag act caa 741 Asn Thr Glu Ile Leu Lys Ser Ile Asp Asn Glu Trp Arg Lys Thr Gln 115 120 125 130 tgc atg cca cgg gag gtg tgt ata gat gtg ggg aag gag ttt gga gtc 789 Cys Met Pro Arg Glu Val Cys Ile Asp Val Gly Lys Glu Phe Gly Val 135 140 145 gcg aca aac acc ttc ttt aaa cct cca tgt gtg tcc gtc tac aga tgt 837 Ala Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr Arg Cys 150 155 160 ggg ggt tgc tgc aat agt gag ggg ctg cag tgc atg aac acc agc acg 885 Gly Gly Cys Cys Asn Ser Glu Gly Leu Gln Cys Met Asn Thr Ser Thr 165 170 175 agc tac ctc agc aag acg tta ttt gaa att aca gtg cct ctc tct caa 933 Ser Tyr Leu Ser Lys Thr Leu Phe Glu Ile Thr Val Pro Leu Ser Gln 180 185 190 ggc ccc aaa cca gta aca atc agt ttt gcc aat cac act tcc tgc cga 981 Gly Pro Lys Pro Val Thr Ile Ser Phe Ala Asn His Thr Ser Cys Arg 195 200 205 210 tgc atg tct aaa ctg gat gtt tac aga caa gtt cat tcc att att aga 1029 Cys Met Ser Lys Leu Asp Val Tyr Arg Gln Val His Ser Ile Ile Arg 215 220 225 cgt tcc ctg cca gca aca cta cca cag tgt cag gca gcg aac aag acc 1077 Arg Ser Leu Pro Ala Thr Leu Pro Gln Cys Gln Ala Ala Asn Lys Thr 230 235 240 tgc ccc acc aat tac atg tgg aat aat cac atc tgc aga tgc ctg gct 1125 Cys Pro Thr Asn Tyr Met Trp Asn Asn His Ile Cys Arg Cys Leu Ala 245 250 255 cag gaa gat ttt atg ttt tcc tcg gat gct gga gat gac tca aca gat 1173 Gln Glu Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser Thr Asp 260 265 270 gga ttc cat gac atc tgt gga cca aac aag gag ctg gat gaa gag acc 1221 Gly Phe His Asp Ile Cys Gly Pro Asn Lys Glu Leu Asp Glu Glu Thr 275 280 285 290 tgt cag tgt gtc tgc aga gcg ggg ctt cgg cct gcc agc tgt gga ccc 1269 Cys Gln Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys Gly Pro 295 300 305 cac aaa gaa cta gac aga aac tca tgc cag tgt gtc tgt aaa aac aaa 1317 His Lys Glu Leu Asp Arg Asn Ser Cys Gln Cys Val Cys Lys Asn Lys 310 315 320 ctc ttc ccc agc caa tgt ggg gcc aac cga gaa ttt gat gaa aac aca 1365 Leu Phe Pro Ser Gln Cys Gly Ala Asn Arg Glu Phe Asp Glu Asn Thr 325 330 335 tgc cag tgt gta tgt aaa aga acc tgc ccc aga aat caa ccc cta aat 1413 Cys Gln Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gln Pro Leu Asn 340 345 350 cct gga aaa tgt gcc tgt gaa tgt aca gaa agt cca cag aaa tgc ttg 1461 Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gln Lys Cys Leu 355 360 365 370 tta aaa gga aag aag ttc cac cac caa aca tgc agc tgt tac aga cgg 1509 Leu Lys Gly Lys Lys Phe His His Gln Thr Cys Ser Cys Tyr Arg Arg 375 380 385 cca tgt acg aac cgc cag aag gct tgt gag cca gga ttt tca tat agt 1557 Pro Cys Thr Asn Arg Gln Lys Ala Cys Glu Pro Gly Phe Ser Tyr Ser 390 395 400 gaa gaa gtg tgt cgt tgt gtc cct tca tat tgg aaa aga cca caa atg 1605 Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro Gln Met 405 410 415 agc taa gattgtactg ttttccagtt catcgatttt ctattatgga aaactgtgtt 1661 Ser 420 gccacagtag aactgtctgt gaacagagag acccttgtgg gtccatgcta acaaagacaa 1721 aagtctgtct ttcctgaacc atgtggataa ctttacagaa atggactgga gctcatctgc 1781 aaaaggcctc ttgtaaagac tggttttctg ccaatgacca aacagccaag attttcctct 1841 tgtgatttct ttaaaagaat gactatataa tttatttcca ctaaaaatat tgtttctgca 1901 ttcattttta tagcaacaac aattggtaaa actcactgtg atcaatattt ttatatcatg 1961 caaaatatgt ttaaaataaa atgaaaattg tattat 1997 4 419 PRT Homo sapiens 4 Met His Leu Leu Gly Phe Phe Ser Val Ala Cys Ser Leu Leu Ala Ala 1 5 10 15 Ala Leu Leu Pro Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Phe 20 25 30 Glu Ser Gly Leu Asp Leu Ser Asp Ala Glu Pro Asp Ala Gly Glu Ala 35 40 45 Thr Ala Tyr Ala Ser Lys Asp Leu Glu Glu Gln Leu Arg Ser Val Ser 50 55 60 Ser Val Asp Glu Leu Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met 65 70 75 80 Tyr Lys Cys Gln Leu Arg Lys Gly Gly Trp Gln His Asn Arg Glu Gln 85 90 95 Ala Asn Leu Asn Ser Arg Thr Glu Glu Thr Ile Lys Phe Ala Ala Ala 100 105 110 His Tyr Asn Thr Glu Ile Leu Lys Ser Ile Asp Asn Glu Trp Arg Lys 115 120 125 Thr Gln Cys Met Pro Arg Glu Val Cys Ile Asp Val Gly Lys Glu Phe 130 135 140 Gly Val Ala Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr 145 150 155 160 Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly Leu Gln Cys Met Asn Thr 165 170 175 Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe Glu Ile Thr Val Pro Leu 180 185 190 Ser Gln Gly Pro Lys Pro Val Thr Ile Ser Phe Ala Asn His Thr Ser 195 200 205 Cys Arg Cys Met Ser Lys Leu Asp Val Tyr Arg Gln Val His Ser Ile 210 215 220 Ile Arg Arg Ser Leu Pro Ala Thr Leu Pro Gln Cys Gln Ala Ala Asn 225 230 235 240 Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn Asn His Ile Cys Arg Cys 245 250 255 Leu Ala Gln Glu Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser 260 265 270 Thr Asp Gly Phe His Asp Ile Cys Gly Pro Asn Lys Glu Leu Asp Glu 275 280 285 Glu Thr Cys Gln Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys 290 295 300 Gly Pro His Lys Glu Leu Asp Arg Asn Ser Cys Gln Cys Val Cys Lys 305 310 315 320 Asn Lys Leu Phe Pro Ser Gln Cys Gly Ala Asn Arg Glu Phe Asp Glu 325 330 335 Asn Thr Cys Gln Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gln Pro 340 345 350 Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gln Lys 355 360 365 Cys Leu Leu Lys Gly Lys Lys Phe His His Gln Thr Cys Ser Cys Tyr 370 375 380 Arg Arg Pro Cys Thr Asn Arg Gln Lys Ala Cys Glu Pro Gly Phe Ser 385 390 395 400 Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro 405 410 415 Gln Met Ser 5 2029 DNA Homo sapiens CDS (411)..(1475) Human prepro-VEGF-D cDNA 5 gttgggttcc agctttctgt agctgtaagc attggtggcc acaccacctc cttacaaagc 60 aactagaacc tgcggcatac attggagaga tttttttaat tttctggaca tgaagtaaat 120 ttagagtgct ttctaatttc aggtagaaga catgtccacc ttctgattat ttttggagaa 180 cattttgatt tttttcatct ctctctcccc acccctaaga ttgtgcaaaa aaagcgtacc 240 ttgcctaatt gaaataattt cattggattt tgatcagaac tgattatttg gttttctgtg 300 tgaagttttg aggtttcaaa ctttccttct ggagaatgcc ttttgaaaca attttctcta 360 gctgcctgat gtcaactgct tagtaatcag tggatattga aatattcaaa atg tac 416 Met Tyr 1 aga gag tgg gta gtg gtg aat gtt ttc atg atg ttg tac gtc cag ctg 464 Arg Glu Trp Val Val Val Asn Val Phe Met Met Leu Tyr Val Gln Leu 5 10 15 gtg cag ggc tcc agt aat gaa cat gga cca gtg aag cga tca tct cag 512 Val Gln Gly Ser Ser Asn Glu His Gly Pro Val Lys Arg Ser Ser Gln 20 25 30 tcc aca ttg gaa cga tct gaa cag cag atc agg gct gct tct agt ttg 560 Ser Thr Leu Glu Arg Ser Glu Gln Gln Ile Arg Ala Ala Ser Ser Leu 35 40 45 50 gag gaa cta ctt cga att act cac tct gag gac tgg aag ctg tgg aga 608 Glu Glu Leu Leu Arg Ile Thr His Ser Glu Asp Trp Lys Leu Trp Arg 55 60 65 tgc agg ctg agg ctc aaa agt ttt acc agt atg gac tct cgc tca gca 656 Cys Arg Leu Arg Leu Lys Ser Phe Thr Ser Met Asp Ser Arg Ser Ala 70 75 80 tcc cat cgg tcc act agg ttt gcg gca act ttc tat gac att gaa aca 704 Ser His Arg Ser Thr Arg Phe Ala Ala Thr Phe Tyr Asp Ile Glu Thr 85 90 95 cta aaa gtt ata gat gaa gaa tgg caa aga act cag tgc agc cct aga 752 Leu Lys Val Ile Asp Glu Glu Trp Gln Arg Thr Gln Cys Ser Pro Arg 100 105 110 gaa acg tgc gtg gag gtg gcc agt gag ctg ggg aag agt acc aac aca 800 Glu Thr Cys Val Glu Val Ala Ser Glu Leu Gly Lys Ser Thr Asn Thr 115 120 125 130 ttc ttc aag ccc cct tgt gtg aac gtg ttc cga tgt ggt ggc tgt tgc 848 Phe Phe Lys Pro Pro Cys Val Asn Val Phe Arg Cys Gly Gly Cys Cys 135 140 145 aat gaa gag agc ctt atc tgt atg aac acc agc acc tcg tac att tcc 896 Asn Glu Glu Ser Leu Ile Cys Met Asn Thr Ser Thr Ser Tyr Ile Ser 150 155 160 aaa cag ctc ttt gag ata tca gtg cct ttg aca tca gta cct gaa tta 944 Lys Gln Leu Phe Glu Ile Ser Val Pro Leu Thr Ser Val Pro Glu Leu 165 170 175 gtg cct gtt aaa gtt gcc aat cat aca ggt tgt aag tgc ttg cca aca 992 Val Pro Val Lys Val Ala Asn His Thr Gly Cys Lys Cys Leu Pro Thr 180 185 190 gcc ccc cgc cat cca tac tca att atc aga aga tcc atc cag atc cct 1040 Ala Pro Arg His Pro Tyr Ser Ile Ile Arg Arg Ser Ile Gln Ile Pro 195 200 205 210 gaa gaa gat cgc tgt tcc cat tcc aag aaa ctc tgt cct att gac atg 1088 Glu Glu Asp Arg Cys Ser His Ser Lys Lys Leu Cys Pro Ile Asp Met 215 220 225 cta tgg gat agc aac aaa tgt aaa tgt gtt ttg cag gag gaa aat cca 1136 Leu Trp Asp Ser Asn Lys Cys Lys Cys Val Leu Gln Glu Glu Asn Pro 230 235 240 ctt gct gga aca gaa gac cac tct cat ctc cag gaa cca gct ctc tgt 1184 Leu Ala Gly Thr Glu Asp His Ser His Leu Gln Glu Pro Ala Leu Cys 245 250 255 ggg cca cac atg atg ttt gac gaa gat cgt tgc gag tgt gtc tgt aaa 1232 Gly Pro His Met Met Phe Asp Glu Asp Arg Cys Glu Cys Val Cys Lys 260 265 270 aca cca tgt ccc aaa gat cta atc cag cac ccc aaa aac tgc agt tgc 1280 Thr Pro Cys Pro Lys Asp Leu Ile Gln His Pro Lys Asn Cys Ser Cys 275 280 285 290 ttt gag tgc aaa gaa agt ctg gag acc tgc tgc cag aag cac aag cta 1328 Phe Glu Cys Lys Glu Ser Leu Glu Thr Cys Cys Gln Lys His Lys Leu 295 300 305 ttt cac cca gac acc tgc agc tgt gag gac aga tgc ccc ttt cat acc 1376 Phe His Pro Asp Thr Cys Ser Cys Glu Asp Arg Cys Pro Phe His Thr 310 315 320 aga cca tgt gca agt ggc aaa aca gca tgt gca aag cat tgc cgc ttt 1424 Arg Pro Cys Ala Ser Gly Lys Thr Ala Cys Ala Lys His Cys Arg Phe 325 330 335 cca aag gag aaa agg gct gcc cag ggg ccc cac agc cga aag aat cct 1472 Pro Lys Glu Lys Arg Ala Ala Gln Gly Pro His Ser Arg Lys Asn Pro 340 345 350 tga ttcagcgttc caagttcccc atccctgtca tttttaacag catgctgctt 1525 tgccaagttg ctgtcactgt ttttttccca ggtgttaaaa aaaaaatcca ttttacacag 1585 caccacagtg aatccagacc aaccttccat tcacaccagc taaggagtcc ctggttcatt 1645 gatggatgtc ttctagctgc agatgcctct gcgcaccaag gaatggagag gaggggaccc 1705 atgtaatcct tttgtttagt tttgtttttg ttttttggtg aatgagaaag gtgtgctggt 1765 catggaatgg caggtgtcat atgactgatt actcagagca gatgaggaaa actgtagtct 1825 ctgagtcctt tgctaatcgc aactcttgtg aattattctg attctttttt atgcagaatt 1885 tgattcgtat gatcagtact gactttctga ttactgtcca gcttatagtc ttccagttta 1945 atgaactacc atctgatgtt tcatatttaa gtgtatttaa agaaaataaa caccattatt 2005 caagccaaaa aaaaaaaaaa aaaa 2029 6 354 PRT Homo sapiens 6 Met Tyr Arg Glu Trp Val Val Val Asn Val Phe Met Met Leu Tyr Val 1 5 10 15 Gln Leu Val Gln Gly Ser Ser Asn Glu His Gly Pro Val Lys Arg Ser 20 25 30 Ser Gln Ser Thr Leu Glu Arg Ser Glu Gln Gln Ile Arg Ala Ala Ser 35 40 45 Ser Leu Glu Glu Leu Leu Arg Ile Thr His Ser Glu Asp Trp Lys Leu 50 55 60 Trp Arg Cys Arg Leu Arg Leu Lys Ser Phe Thr Ser Met Asp Ser Arg 65 70 75 80 Ser Ala Ser His Arg Ser Thr Arg Phe Ala Ala Thr Phe Tyr Asp Ile 85 90 95 Glu Thr Leu Lys Val Ile Asp Glu Glu Trp Gln Arg Thr Gln Cys Ser 100 105 110 Pro Arg Glu Thr Cys Val Glu Val Ala Ser Glu Leu Gly Lys Ser Thr 115 120 125 Asn Thr Phe Phe Lys Pro Pro Cys Val Asn Val Phe Arg Cys Gly Gly 130 135 140 Cys Cys Asn Glu Glu Ser Leu Ile Cys Met Asn Thr Ser Thr Ser Tyr 145 150 155 160 Ile Ser Lys Gln Leu Phe Glu Ile Ser Val Pro Leu Thr Ser Val Pro 165 170 175 Glu Leu Val Pro Val Lys Val Ala Asn His Thr Gly Cys Lys Cys Leu 180 185 190 Pro Thr Ala Pro Arg His Pro Tyr Ser Ile Ile Arg Arg Ser Ile Gln 195 200 205 Ile Pro Glu Glu Asp Arg Cys Ser His Ser Lys Lys Leu Cys Pro Ile 210 215 220 Asp Met Leu Trp Asp Ser Asn Lys Cys Lys Cys Val Leu Gln Glu Glu 225 230 235 240 Asn Pro Leu Ala Gly Thr Glu Asp His Ser His Leu Gln Glu Pro Ala 245 250 255 Leu Cys Gly Pro His Met Met Phe Asp Glu Asp Arg Cys Glu Cys Val 260 265 270 Cys Lys Thr Pro Cys Pro Lys Asp Leu Ile Gln His Pro Lys Asn Cys 275 280 285 Ser Cys Phe Glu Cys Lys Glu Ser Leu Glu Thr Cys Cys Gln Lys His 290 295 300 Lys Leu Phe His Pro Asp Thr Cys Ser Cys Glu Asp Arg Cys Pro Phe 305 310 315 320 His Thr Arg Pro Cys Ala Ser Gly Lys Thr Ala Cys Ala Lys His Cys 325 330 335 Arg Phe Pro Lys Glu Lys Arg Ala Ala Gln Gly Pro His Ser Arg Lys 340 345 350 Asn Pro 7 17 DNA Artificial Sequence Description of Artificial Sequence primer 7 tcaccatcga tccaagc 17 8 18 DNA Artificial Sequence Description of Artificial Sequence primer 8 agttctgcgt gagccgag 18 9 18 DNA Artificial Sequence Description of Artificial Sequence primer 9 caggacgggg tgacttga 18 10 18 DNA Artificial Sequence Description of Artificial Sequence primer 10 gcccaggcct gtctactg 18 11 18 DNA Artificial Sequence Description of Artificial Sequence primer 11 ccagctccta cgtgttcg 18 12 18 DNA Artificial Sequence Description of Artificial Sequence primer 12 ggcaacagct ggatgtca 18 13 18 DNA Artificial Sequence Description of Artificial Sequence primer 13 ctgtgagggc gtgggagt 18 14 18 DNA Artificial Sequence Description of Artificial Sequence primer 14 gtcctttgag ccactgga 18 15 21 DNA Artificial Sequence Description of Artificial Sequence primer 15 cacacgtcat cgacaccggt g 21 16 18 DNA Artificial Sequence Description of Artificial Sequence primer 16 ggcaacagct ggatgtca 18 17 21 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide 17 cctgagtatc tcccgcgtcg c 21 18 21 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide 18 ggtgcctccc tgtaccctgg g 21 19 1363 PRT Mus musculus 19 Met Gln Pro Gly Ala Ala Leu Asn Leu Arg Leu Trp Leu Cys Leu Gly 1 5 10 15 Leu Leu Gln Gly Leu Ala Asn Gly Tyr Ser Met Thr Pro Pro Thr Leu 20 25 30 Asn Ile Thr Glu Asp Ser Tyr Val Ile Asp Thr Gly Asp Ser Leu Ser 35 40 45 Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp Thr Trp Pro Gly Ala 50 55 60 Gln Glu Val Leu Thr Thr Gly Gly Lys Asp Ser Glu Asp Thr Arg Val 65 70 75 80 Val His Asp Cys Glu Gly Thr Glu Ala Arg Pro Tyr Cys Lys Val Leu 85 90 95 Leu Leu Ala Gln Thr His Ala Asn Asn Thr Gly Ser Tyr His Cys Tyr 100 105 110 Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr Thr Ala Ala Ser Thr 115 120 125 Tyr Val Phe Val Arg Asp Phe Lys His Pro Phe Ile Asn Lys Pro Asp 130 135 140 Thr Leu Leu Val Asn Arg Lys Asp Ser Met Trp Val Pro Cys Leu Val 145 150 155 160 Ser Ile Pro Gly Leu Asn Ile Thr Leu Arg Ser Gln Ser Ser Ala Leu 165 170 175 His Pro Asp Gly Gln Glu Val Leu Trp Asp Asp Arg Arg Gly Met Arg 180 185 190 Val Pro Thr Gln Leu Leu Arg Asp Ala Leu Tyr Leu Gln Cys Glu Thr 195 200 205 Thr Trp Gly Asp Gln Asn Phe Leu Ser Asn Leu Phe Val Val His Ile 210 215 220 Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Tyr Pro Lys Lys Ser Met 225 230 235 240 Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn Cys Thr Val Trp Ala 245 250 255 Glu Phe Asp Ser Gly Val Thr Phe Asp Trp Asp Tyr Pro Gly Lys Gln 260 265 270 Ala Glu Arg Ala Lys Trp Val Pro Glu Arg Arg Ser Gln Gln Thr His 275 280 285 Thr Glu Leu Ser Ser Ile Leu Thr Ile His Asn Val Ser Gln Asn Asp 290 295 300 Leu Gly Pro Tyr Val Cys Glu Ala Asn Asn Gly Ile Gln Arg Phe Arg 305 310 315 320 Glu Ser Thr Glu Val Ile Val His Glu Lys Pro Phe Ile Ser Val Glu 325 330 335 Trp Leu Lys Gly Pro Val Leu Glu Ala Thr Ala Gly Asp Glu Leu Val 340 345 350 Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro Pro Glu Phe Gln Trp 355 360 365 Tyr Lys Asp Arg Lys Ala Val Thr Gly Arg His Asn Pro His Ala Leu 370 375 380 Val Leu Lys Glu Val Thr Glu Ala Ser Ala Gly Val Tyr Thr Leu Ala 385 390 395 400 Leu Trp Asn Ser Ala Ala Gly Leu Arg Gln Asn Ile Ser Leu Glu Leu 405 410 415 Val Val Asn Val Pro Pro His Ile His Glu Lys Glu Ala Ser Ser Pro 420 425 430 Ser Ile Tyr Ser Arg His Ser Arg Gln Thr Leu Thr Cys Thr Ala Tyr 435 440 445 Gly Val Pro Gln Pro Leu Ser Val Gln Trp His Trp Arg Pro Trp Thr 450 455 460 Pro Cys Lys Thr Phe Ala Gln Arg Ser Leu Arg Arg Arg Gln Gln Arg 465 470 475 480 Asp Gly Met Pro Gln Cys Arg Asp Trp Lys Glu Val Thr Thr Gln Asp 485 490 495 Ala Val Asn Pro Ile Glu Ser Leu Asp Ser Trp Thr Glu Phe Val Glu 500 505 510 Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile Gln Asp Ala Asn Val 515 520 525 Ser Ala Met Tyr Lys Cys Val Val Val Asn Lys Val Gly Gln Asp Glu 530 535 540 Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro Asp Gly Phe Ser Ile 545 550 555 560 Glu Ser Glu Pro Ser Glu Asp Pro Leu Glu Gly Gln Ser Val Arg Leu 565 570 575 Ser Cys Arg Ala Asp Asn Tyr Thr Tyr Glu His Leu Arg Trp Tyr Arg 580 585 590 Leu Asn Leu Ser Thr Leu His Asp Ala Gln Gly Asn Pro Leu Leu Leu 595 600 605 Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro Leu Glu Ala Asn Leu 610 615 620 Glu Glu Ala Glu Pro Gly Ala Arg His Ala Thr Leu Ser Leu Asn Ile 625 630 635 640 Pro Arg Val Ala Pro Glu Asp Glu Gly Asp Tyr Val Cys Glu Val Gln 645 650 655 Asp Arg Arg Ser Gln Asp Lys His Cys His Lys Lys Tyr Leu Ser Val 660 665 670 Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn Leu Thr Asp Leu Leu 675 680 685 Val Asn Val Ser Asp Ser Leu Glu Met Arg Cys Pro Val Ala Gly Ala 690 695 700 His Val Pro Ser Ile Val Trp Tyr Lys Asp Glu Arg Leu Leu Glu Lys 705 710 715 720 Glu Ser Gly Ile Asp Leu Ala Asp Ser Asn Gln Arg Leu Ser Ile Gln 725 730 735 Arg Val Arg Glu Glu Asp Ala Gly Arg Tyr Leu Cys Ser Val Cys Asn 740 745 750 Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val Ala Val Glu Gly Ser 755 760 765 Glu Asp Lys Gly Ser Met Glu Ile Val Ile Leu Ile Gly Thr Gly Val 770 775 780 Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu Ile Phe Cys Asn Met 785 790 795 800 Lys Arg Pro Ala His Ala Asp Ile Lys Thr Gly Tyr Leu Ser Ile Ile 805 810 815 Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln Cys Glu Tyr Leu Ser 820 825 830 Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu Arg Leu His Leu Gly 835 840 845 Arg Val Leu Gly His Gly Ala Phe Gly Lys Val Val Glu Ala Ser Ala 850 855 860 Phe Gly Ile Asn Lys Gly Ser Ser Cys Asp Thr Val Ala Val Lys Met 865 870 875 880 Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg Ala Leu Met Ser Glu 885 890 895 Leu Lys Ile Leu Ile His Ile Gly Asn His Leu Asn Val Val Asn Leu 900 905 910 Leu Gly Ala Cys Thr Lys Pro Asn Gly Pro Leu Met Val Ile Val Glu 915 920 925 Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu Arg Val Lys Arg Asp 930 935 940 Thr Phe Asn Pro Tyr Ala Glu Lys Ser Pro Glu Gln Arg Arg Arg Phe 945 950 955 960 Arg Ala Met Val Glu Gly Ala Lys Ala Asp Arg Arg Arg Pro Gly Ser 965 970 975 Ser Asp Arg Ala Leu Phe Thr Arg Phe Leu Met Gly Lys Gly Ser Ala 980 985 990 Arg Arg Ala Pro Leu Val Gln Glu Ala Glu Asp Leu Trp Leu Ser Pro 995 1000 1005 Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe Gln Val Ala Arg Gly 1010 1015 1020 Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His Arg Asp Leu Ala Ala 1025 1030 1035 1040 Arg Asn Ile Leu Leu Ser Glu Ser Asp Ile Val Lys Ile Cys Asp Phe 1045 1050 1055 Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp Tyr Val Arg Lys Gly 1060 1065 1070 Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser Ile Phe Asp 1075 1080 1085 Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu 1090 1095 1100 Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr Pro Gly Val Gln Ile 1105 1110 1115 1120 Asn Glu Glu Phe Cys Gln Arg Leu Lys Asp Gly Thr Arg Met Arg Ala 1125 1130 1135 Pro Glu Leu Ala Thr Pro Ala Ile Arg His Ile Met Gln Ser Cys Trp 1140 1145 1150 Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser Asp Leu Val Glu Ile 1155 1160 1165 Leu Gly Asp Leu Leu Gln Gly Gly Gly Trp Gln Glu Glu Glu Glu Glu 1170 1175 1180 Arg Met Ala Leu His Ser Ser Gln Ser Ser Glu Glu Asp Gly Phe Met 1185 1190 1195 1200 Gln Ala Ser Thr Thr Ala Leu His Ile Thr Glu Ala Asp Ala Asp Asp 1205 1210 1215 Ser Pro Pro Ser Met His Cys His Ser Leu Ala Ala Arg Tyr Tyr Asn 1220 1225 1230 Cys Val Ser Phe Pro Gly Arg Leu Ala Arg Gly Thr Lys Thr Pro Gly 1235 1240 1245 Ser Ser Arg Met Lys Thr Phe Glu Glu Leu Pro Met Thr Pro Thr Thr 1250 1255 1260 Tyr Lys Ala Ser Met Asp Asn Gln Thr Asp Ser Gly Met Val Leu Ala 1265 1270 1275 1280 Ser Glu Glu Phe Glu Glu Leu Glu Ser Arg His Arg Pro Glu Gly Ser 1285 1290 1295 Phe Ser Cys Lys Gly Pro Gly Gln His Met Asp Ile Pro Arg Gly His 1300 1305 1310 Pro Asp Pro Gln Gly Arg Arg Arg Arg Pro Thr Gln Gly Ala Gln Gly 1315 1320 1325 Gly Lys Val Phe Tyr Asn Asn Glu Tyr Gly Glu Val Ser Gln Pro Cys 1330 1335 1340 Thr Glu Gly Asp Cys Cys Pro Ser Ala Gly Ser Thr Phe Phe Ala Asp 1345 1350 1355 1360 Ser Ser Tyr 20 21 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide 20 cggcgccttc aggaaggtgg t 21 21 21 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide 21 cggaacattc cgctgtcgga a 21 22 21 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide 22 gtcggaaagc aacgtggtga a 21 23 18 DNA Artificial Sequence Description of Artificial Sequence primer 23 catcaagacg ggctacct 18 24 18 DNA Artificial Sequence Description of Artificial Sequence primer 24 ccgctgaccc cacacctt 18 25 18 DNA Artificial Sequence Description of Artificial Sequence primer 25 gagttgacct cccaaggt 18 26 18 DNA Artificial Sequence Description of Artificial Sequence primer 26 tctcctggac aggcagtc 18 27 18 DNA Artificial Sequence Description of Artificial Sequence primer 27 gagttgacct cccaaggt 18 28 18 DNA Artificial Sequence Description of Artificial Sequence primer 28 tctcctggac aggcagtc 18

Claims

What is claimed is:

1. A method of screening a human subject for an increased risk of developing a lymphatic disorder, comprising the steps of:

(a) assaying nucleic acid of a human subject to determine a presence or an absence of a mutation altering the sequence or expression of at least one VEGFR-3 allele; and

(b) screening for an increased risk of developing a lymphatic disorder from the presence or absence of said mutation, wherein the presence of a mutation altering the encoded amino acid sequence or expression of at least one VEGFR-3 allele in the nucleic acid correlates with an increased risk of developing a lymphatic disorder.

2. A method according to claim 1 wherein the assaying step comprises determining the presence or absence of a mutation altering a tyrosine kinase domain amino acid sequence of the protein encoded by the VEGFR-3 allele:

3. A method according to claim 1 wherein the assaying step comprises determining the presence or absence of a missense mutation in a VEGFR-3 allele at a position corresponding to one of codons 857, 1041, 1044 and 1049 of the VEGFR-3-encoding sequence set forth in SEQ ID NO: 1.

4. A method according to claim 1 wherein the assaying step comprises determining the presence or absence of a missense mutation in the VEGFR-3 allele at a position corresponding to codon 1114 of the VEGFR-3-encoding sequence set forth in SEQ ID NO: 1.

5. A method according to claim 1 wherein the assaying step comprises at least one procedure selected from the group consisting of:

(a) determining a nucleotide sequence of at least one codon of at least one VEGFR-3 allele of the human subject;

(b) performing a hybridization assay to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences;

(c) performing a polynucleotide migration assay to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences; and

(d) performing a restriction endonuclease digestion to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences.

6. A method according to claim 1 wherein the assaying step comprises: performing a polymerase chain reaction (PCR) to amplify nucleic acid comprising VEGFR-3 coding sequence, and determining nucleotide sequence of the amplified nucleic acid.

7. A method of screening for a VEGFR-3 hereditary lymphedema genotype in a human patient, comprising the steps of:

(a) providing a biological sample comprising nucleic acid from said patient, said nucleic acid including sequences corresponding to said patient's VEGFR-3 alleles;

(b) analyzing said nucleic acid for the presence of a mutation or mutations;

(c) determining a VEGFR-3 genotype from said analyzing step and

(d) correlating the presence of a mutation in a VEGFR-3 allele with a hereditary lymphedema genotype.

8. The method according to claim 7 wherein said biological sample is a cell sample.

9. The method according to claim 7 wherein said analyzing comprises sequencing a portion of said nucleic acid, said portion comprising at least one codon of said VEGFR-3 alleles.

10. The method according to claim 7 wherein said nucleic acid is DNA.

11. The method according to claim 7 wherein said nucleic acid is RNA.

12. A method of treatment for hereditary lymphedema, comprising the step of administering to a patient with hereditary lymphedema a therapeutically effective amount of a growth factor product selected from the group consisting of vascular endothelial growth factor C (VEGF-C) protein products, vascular endothelial growth factor D (VEGF-D) protein products, VEGF-C gene therapy products, and VEGF-D gene therapy protein products.

13. A therapeutic or prophylactic method of treating lymphedema, comprising the steps of:

providing isolated lymphatic endothelial cells or lymphatic endothelial progenitor cells;

transforming or transfecting the cells ex vivo with a polynucleotide comprising a nucleotide sequence that encodes a wild type VEGFR-3;

and administering the transformed or transfected cells to the mammalian subject.

14. An oligonucleotide useful as a probe for identifying polymorphisms in a human Flt4 receptor tyrosine kinase gene, the oligonucleotide comprising 6-50 nucleotides that have a sequence that is identical or exactly complementary to a portion of a wild type human VEGFR-3 gene sequence or VEGFR-3 coding sequence, except for one sequence difference selected from the group consisting of a nucleotide addition, a nucleotide deletion, or nucleotide substitution.

15. An oligonucleotide according to claim 14 wherein the nucleotide sequence is exactly identical or exactly complementary to a portion of the human VEGFR-3 coding sequence set forth in SEQ ID NO: 1, except for a nucleotide substitution at a position corresponding to a nucleotide selected from the group consisting of bases 2546 through 2848 and bases 3044 through 3514.

16. An oligonucleotide according to claim 14 wherein the nucleotide sequence is exactly identical or exactly complementary to a portion of the human VEGFR-3 coding sequence set forth in SEQ ID NO: 1, except for a nucleotide substitution at a position corresponding to nucleotide 3360 of SEQ ID NO: 1.

17. An oligonucleotide according to claim 14 wherein the nucleotide sequence is exactly identical or exactly complementary to a portion of the human VEGFR-3 coding sequence set forth in SEQ ID NO: 1, except for a nucleotide substitution at a position corresponding to a nucleotide selected from the group consisting of position 2588, position 3141, position 3150 and position 3164 of SEQ ID NO: 1.

18. A kit comprising at least two oligonucleotides of the formula X_nYZ_mor its complement;

where n and m are integers from 0 to 49;

where 5≦(n+m)≦49;

where X_nis a stretch of n nucleotides identical to a first portion of SEQ ID NO: 1, said first portion ending immediately upstream (5′) of position 3360 of SEQ ID NO: 1; and

where Z_mis a stretch of m nucleotides identical to a second portion of SEQ ID NO: 1, said second portion beginning immediately downstream (3′) of position 3360 of SEQ ID NO: 1; and

wherein Y represents a nucleotide selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil nucleotides.

19. A kit comprising at least two oligonucleotides of the formula X_nYZ_mor its complement;

where n and m are integers from 0 to 49;

where 5≦(n+m)≦49;

where X_nis a stretch of n nucleotides identical to a first portion of SEQ ID NO: 1, said first portion ending immediately upstream (5′) of position W of SEQ ID NO: 1; and

where Z_mis a stretch of m nucleotides identical to a second portion of SEQ ID NO: 1, said second portion beginning immediately downstream (3′) of position W of SEQ ID NO: 1;

wherein position W of SEQ ID NO: 1 is selected from the group consisting of nucleotides 2588, 3141, 3150, and 3164 of SEQ ID NO: 1; and

20. An array of oligonucleotide probes immobilized on a solid support, wherein each probe occupies a separate known site in the array; and wherein the array includes at-least one probe set comprising two to four probes, wherein one probe is exactly identical or exactly complementary to a wild type human VEGFR-3 coding sequence, and the other one to three members of the set are exactly identical to the first member, but for at least one different nucleotide, which different nucleotide is located in the same position in each of the one to three additional set members.

21. An array of oligonucleotide probes immobilized on a solid support according to claim 20, wherein each probe occupies a separate known site in the array; and wherein the array includes at least one probe set comprising two to four probes, wherein one probe is exactly identical or exactly complementary to a portion of a human VEGFR-3 coding sequence set forth in SEQ ID NO: 1, and the other one to three members of the set are exactly identical to the first member, but for at least one different nucleotide, which different nucleotide is located in the same position in each of the one to three additional set members, said position corresponding to a position selected from the group consisting of bases 2546 through 2848 and bases 3044 through 3514 of SEQ ID NO: 1.

22. A purified polynucleotide comprising a nucleotide sequence encoding a human VEGFR-3 protein variant, wherein said polynucleotide is capable of hybridizing to the complement of SEQ ID NO: 1 under the following hybridization conditions:

hybridization at 42° C. in 50% formamide, 5×SSC, 20 mM Na.PO₄, pH 6.8; and

washing in 0.2×SSC at 55° C.;

and wherein the encoded VEGFR-3 protein variant has an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO: 2 at one or more positions selected from the group consisting of amino acids 843 to 943 of SEQ ID NO: 2 and amino acids 1009 to 1165 of SEQ ID NO: 2.

23. A purified polynucleotide according to claim 22, wherein the encoded VEGFR-3 protein variant has an amino acid sequence that differs at position 1114 from the amino acid sequence set forth in SEQ ID NO: 2.

24. A purified polynucleotide according to claim 22 wherein the encoded VEGFR-3 protein variant has an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO: 2 at position selected from the group consisting of residues 857, 1041, 1044 and 1049 of SEQ ID NO: 2.

25. A purified polynucleotide comprising a nucleotide sequence encoding a VEGFR-3 protein of a human that is affected with heritable lymphedema;

wherein said polynucleotide is capable of hybridizing to the complement of SEQ ID NO: 1 under the following hybridization conditions: hybridization at 42° C. in 50% formamide, 5×SSC, 20 mM Na.PO₄, pH 6.8; and washing in 0.2×SSC at 55° C.;

and wherein the polynucleotide encodes a VEGFR-3 amino acid sequence that differs from SEQ ID NO: 2 at at least one residue.

26. A purified polynucleotide according to claim 25 wherein the polynucleotide encodes an amino acid sequence that differs from SEQ ID NO: 2 at at least one residue selected from the group consisting of residues 843 to 943 and 1009 to 1165 of SEQ ID NO: 2.

27. A vector comprising a polynucleotide according to claim 25.

28. A host cell that has been transformed or transfected with a polynucleotide according to claim 25 and that expresses the VEGFR-3 protein encoded by the polynucleotide.

29. A host cell according to claim 28 that has been co-transfected with a polynucleotide encoding the VEGFR-3 amino acid sequence set forth in SEQ ID NO: 2 and that expresses the VEGFR-3 protein having the amino acid sequence set forth in SEQ ID NO: 2.

30. A method for identifying a modulator of intracellular VEGFR-3 signaling, comprising the steps of:

a) contacting a cell expressing at least one mutant mammalian VEGFR-3 polypeptide in the presence and in the absence of a putative modulator compound;

b) detecting VEGFR-3 signaling in the cell; and

c) identifying a putative modulator compound in view of decreased or increased signaling in the presence of the putative modulator, as compared to signaling in the absence of the putative modulator.

31. A method according to claim 30 wherein the cell expresses the mutant mammalian VEGFR-3 polypeptide and a wildtype mammalian VEGFR-3 polypeptide.

32. A method according to claim 31 wherein the mutant and wildtype VEGFR-3 polypeptides are human.

33. A method according to claim 32 wherein said mutant VEGFR-3 polypeptide is characterized by a substitution or deletion mutation in a kinase domain of the VEGFR-3 polypeptide.

34. A method according to claim 32 wherein said mutant VEGFR-3 polypeptide is characterized by at least one substitution or deletion of the wild type VEGFR-3 amino acid sequence set forth in SEQ ID NO: 2, said at least one substitution or deletion occurring at a position corresponding to a residue selected from positions 843 to 943 and positions 1009 to 1165 of SEQ ID NO: 2.

35. A method according to claim 32 wherein the mutant VEGFR-3 polypeptide comprises, a leucine amino acid at the position corresponding to position 1114 of SEQ ID NO: 2.

36. A method according to claim 32 wherein said mutant VEGFR-3 polypeptide is characterized by at least one substitution or deletion of the wild type VEGFR-3 amino acid sequence set forth in SEQ ID NO: 2, said at least one substitution or deletion occurring at a position corresponding to a residue selected from positions 857, 1041, 1044 and 1049, and 1114 of SEQ ID NO: 2.