US20040192607A1 - Transcriptional regulation of the human beta3-adrenergic receptor gene - Google Patents

Transcriptional regulation of the human beta3-adrenergic receptor gene Download PDF

Info

Publication number
US20040192607A1
US20040192607A1 US10/830,283 US83028304A US2004192607A1 US 20040192607 A1 US20040192607 A1 US 20040192607A1 US 83028304 A US83028304 A US 83028304A US 2004192607 A1 US2004192607 A1 US 2004192607A1
Authority
US
United States
Prior art keywords
segment
dna
cells
nucleic acid
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/830,283
Inventor
Vedrana Susulic
Emir Duzic
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wyeth LLC
Original Assignee
Wyeth LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wyeth LLC filed Critical Wyeth LLC
Priority to US10/830,283 priority Critical patent/US20040192607A1/en
Publication of US20040192607A1 publication Critical patent/US20040192607A1/en
Priority to US11/624,841 priority patent/US20070134735A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to a positive cis-regulatory (enhancer) element of human ⁇ 3 -adrenergic receptor responsible for its transcription in SK-N-MC cells.
  • Such element is composed of three DNA binding sites that act synergistically and is located 6.5 kb upstream from the translation start site of the ⁇ 3 -adrenergic receptor.
  • the invention further relates to use of this enhancer element for regulated gene expression and for drug screening.
  • the ⁇ 3 -adrenergic receptor ( ⁇ 3 -AR) is an important regulator of metabolic activity in brown and white adipose tissue, two major sites for regulation of energy balance.
  • the ⁇ 3 -AR belongs to a family of G-protein coupled receptors. Its binding to endogenous ligand or specific synthetic agonist leads to activation of adenylate cyclase, an increased concentration of cAMP, and an increased activity of PKA, resulting in increased thermogenic activity and heat production in brown adipose tissue (BAT) and lipolysis in white adipose tissue (WAT).
  • ⁇ 3 -AR stimulation causes an increase in thermogenic activity and a less efficient utilization of metabolic fuels, its sustained activation should be of benefit in the treatment of obesity, and improvement of glycemic control in type II diabetes. Indeed, numerous reports have shown that stimulation of ⁇ 3 -ARs cause weight loss and improvement in glycemic control in rodent models of these diseases (Carroll et al., Diabetes 34:1198-1204, 1984; Umekawa et al., European Journal of Endo.136:429-437, 1997; Yoshida et al., J. Nutr. Sci.
  • NIDDM non-insulin dependent diabetes mellitus
  • mouse ⁇ 3 -AR shows a high affinity and selectivity for certain ⁇ 3 -AR specific agonists, while the human receptor has little or no affinity for the same agonists when tested in CHO cells stably transfected with human ⁇ 3 AR (Liggett et al., Molecular Pharmacology, 42:634-637, 1992).
  • agonists that show high affinity and selectivity in ⁇ 3 -AR transfected CHO cells that express a high level of human ⁇ 3 -ARs have little or no activity in vivo (when tested in non human primates and clinical trials). Their lack of robust activity may be due to pharmacokinetic or metabolic issues, but another reason for this discrepancy may be the low level of ⁇ 3 -AR expression in target tissues (Wilson et al., The Journal of Pharmacology and Experimental Therapeutics 279:214-221, 1996).
  • the present invention provides an isolated nucleic acid comprising a nucleotide sequence that is greater than 80% identical to the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1). This sequence is specifically recognized by a transcription factor, and is responsible for tissue specific expression of ⁇ 3 -AR.
  • the invention further provides this nucleic acid further comprising a nucleotide sequence that binds an Sp-1 transcription factor protein, or contains an S1 nuclease sensitive site, or both.
  • a combination of these sequences in proximity to each other in a nucleic acid, termed herein a ⁇ 3 -AR enhancer element permits positive regulation of expression of a gene operably associated with the sequences.
  • Host cells containing vectors, with genes operably associated with the enhancer element, and both transient and stable expression of such genes are also provided.
  • the invention further provides a specific ⁇ 3 -AR trans-activating factor polypeptide having the following characteristics: (a) it binds specifically to the nucleic acid having the sequence GCCTCTGGGGAG (SEQ ID NO:1); (b) it is expressed by mouse brown adipose tissue cells; (c) it is expressed at very low levels by human white adipocytes isolated from the perirenal depot; (d) an AP-2 binding oligonucleotide does not compete with a nucleic acid having the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1) for binding the polypeptide; and (e) when complexed to a nucleic acid comprising SEQ ID NO:1, it is not recognized by an antibody to AP-2, e.g., as detected in a super shift assay.
  • a specific ⁇ 3 -AR trans-activating factor polypeptide having the following characteristics: (a) it binds specifically to the nucleic acid having the sequence GCCTCT
  • the invention provides a method of isolating a polypeptide that binds specifically to a nucleic acid having a nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1).
  • the method comprises contacting a composition suspected of containing the polypeptide with the nucleic acid under conditions that permit detection of binding of the polypeptide to the nucleic acid; and isolating the bound polypeptide.
  • the invention provides a method of screening for a compound that increases activity of a ⁇ 3 -AR trans-activating factor in human cells. This method comprises contacting cells with a test compound; and detecting an increase in a level of activity of the ⁇ 3 -AR trans-activating factor.
  • a related method of the invention provides for screening for a compound that inhibits activity of a ⁇ 3-AR trans-activating factor in human cells. Such a method comprises contacting cells with a test compound; and detecting a decrease in a level of activity of the ⁇ 3 -AR trans-activating factor.
  • test cells are capable of producing, i.e., expressing, one or more components of the ⁇ 3 -AR trans-activating factor.
  • FIG. 1 Partial restriction enzymes map of 7A human ⁇ 3 -AR clone.
  • a human lung genomic library was screened with a probe that corresponds to the full cDNA region except the last 6 amino acids. The probe was made by ligation of 4 PCR products that overlap partial cDNA for the h ⁇ 3 -AR gene.
  • the map shows restriction enzymes sites and their corresponding position within the genomic DNA from the translation start site (PsI-Pst I, Avr-AvII, EV-EcoRV, E1- EcoRI, BE-BstEII, SI-SalI).
  • FIG. 2 Determination of transcription start site of h ⁇ 3 -AR gene using 5′ RACE.
  • 5′ RACE was performed on poly A RNA isolated from SK-N-MC cells using the Marathon cDNA amplification kit (Clontech). Twenty subcloned RACE-PCR products were subcloned and sequenced. Capital letters in the Figure represent translation start sites. The underlined sequence represents the primer used in 5′ RACE; determined transcription start sites are indicated with asterisks.
  • FIG. 3 Partial restriction enzymes map of constructs used in transient transfection experiments. All promoter regions were cloned in a pGL3 basic vector. The positions of the restriction enzyme sites are based on assigning the translation start site as +1.
  • FIG. 4 Constructs to evaluate the effect of far upstream region on transcription activity. Transfection constructs were made by keeping region between ⁇ 7 to ⁇ 5.6 and deleting regions between Avr II and EcorV, EcoRI and BstEII to make dEVh ⁇ 3AR/luc, dEIh ⁇ 3AR/luc and dBh ⁇ 3AR/luc respectively.
  • FIG. 5 Further analysis of 1.5 kb of distal promoter. A series of PCR products were made and ligated to a TK minimal promoter within pGL3 basic.
  • FIGS. 6A, B, C and D EMSA experiments with oligonucleotides generated from sequence between ⁇ 6.508 and ⁇ 6.308 kp from 5′ flanking region of h ⁇ 3 -AR gene.
  • A Sequence of 200 bp between primers “6” ( ⁇ 6.508 kb) and “8” ( ⁇ 6.308 kb).
  • EMSA were done using underlined sequences as oligonucleotides, which are marked as 1, 2, 3, 4, and 1A to cover the 200 bp region, and 2A, 3A, 4A, and 1B representing overlaps between oligonucleotides 1 and 2, 2 and 3, 3 and 4, and 1A and 4, respectively.
  • B and C Nuclear extracts from SK-N-MC, CV-1 and HeLa cells were incubated with radiolabeled oligonucleotides described above. The Figure shows only oligonucleotides that show binding.
  • B Oligonucleotides 2, 2A, 3A, and C: 1B and 4A.
  • D Also, EMSAs were done in a presence of excess of indicated cold oligonucleotides. The amount of cold oligos was a 50x molar excess of labeled oligonucleotides unless otherwise indicated. Arrows indicate the position of major DNA-protein complexes.
  • FIGS. 7 A and 7 B Mutational analysis of regions “A” and “B”.
  • the present invention is based, in part, on the discovery of a new regulatory region that appears to be an enhancer element for the human ⁇ 3 -AR gene.
  • Mechanisms of transcriptional regulation of the human ⁇ 3 -adrenergic receptor were studied using SK-N-MC cells, a human neuroblastoma cell line that expresses ⁇ 3 - and ⁇ 1 -adrenergic receptors endogenously.
  • a genomic 7 kilobase (kb) region of the human ⁇ 3 -adrenergic receptor 5′ flanking region was isolated.
  • Transfection constructs that contain deletions within this 7 kb region linked to a luciferase reporter gene were made and transfected in SK-N-MC, CV1 and HeLa cells.
  • Segment A represents a novel DNA binding site that binds a protein present in nuclear extracts from SK-N-MC cells and brown adipose tissue, but which was not detectable in other cells, notably white adipose tissue by methods used in the Examples, infra. These data support the brown adipose tissue-specific expression of the ⁇ 3 -adrenergic receptor.
  • Segment C binds protein present in SK-N-MC and HeLa cells; it also exhibits an S1 nuclease hypersensitive site. These data taken together indicate the existence of cell specific positive cis-regulatory elements located 6.5 kb upstream from the translation start site that play a pivotal role in transcriptional regulation of the human ⁇ 3 -adrenergic receptor.
  • the nucleotide sequence of a nucleic acid (DNA) that binds a tissue-specific trans-activating factor has been identified in segment B of the ⁇ 3 -AR regulatory region.
  • the sequence is greater than 80% identical (at least 10 of 12 bases are the same) to the core nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1).
  • the sequence of this segment is GCCTCTGGGGAG (SEQ ID NO:1).
  • the sequence is 78% similar to an ERF AP-2 consensus binding site.
  • an oligonucleotide comprising the segment B core sequence cannot displace binding of an AP-2 oligonucleotide by an AP-2 protein, even at a 100-fold molar excess.
  • Segment B can be further characterized by its specificity for binding with a trans-activating factor found at detectable levels in brown adipose tissue (BAT) and in a human neuroblastoma cell line, but which is not detectably present in HeLa cells, or in white adipose tissue (WAT) (murine, and probably human as well).
  • BAT brown adipose tissue
  • WAT white adipose tissue
  • an isolated nucleic acid comprising a nucleotide sequence of the invention can be identified by its specificity for the particular trans-activating factor.
  • the new trans-activating factor is termed herein the “B segment-binding trans-activating factor.”
  • This B segment-binding trans-activating factor polypeptide appears to be an AP-2-like protein. This conclusion is based on the similarity of the B segment sequence, specifically SEQ ID NO:1, to an ERF consensus binding site that belongs to a family of AP-2 transcription factors.
  • the B segment-binding trans-activating factor binds a nucleic acid comprising the sequence GCCTCTGGGGAG (SEQ ID NO:1) with high enough affinity that an AP-2 oligonucleotide competitor failed to displace it, even at a 200-fold molar excess.
  • the B segment-binding trans-activating factor does not bind an antibody that recognizes AP-2.
  • segment A A second protein-binding segment that operates synergistically with segment B in the regulatory region has also been identified. Because in a specific embodiment this segment is upstream (5′) to segment B, it has been termed segment A. Segment A binds an Sp1-like transcription factor. In specific embodiments, segment A is displaced from binding a protein from cellular nuclear extracts by an Sp1 oligonucleotide. In another embodiment, a protein that binds to segment A is recognized by an anti-Sp1 antibody. Thus, in a specific embodiment, segment A is an Sp1 binding site. In a further specific embodiment, exemplified infra, the nucleotide sequence of the binding site is AGGTGGGACT (SEQ ID NO:2). This binding site sequence differs from known Sp1 sequences. It contains a “GGTG” motif, whereas known Sp1 sequences have a “GGCG” motif.
  • segment C is an S1 nuclease-sensitive site. In a specific embodiment, it comprises at least 12 bases, and preferably about 80 bases, of a homopurine-homopyrimidine rich region. In a more specific embodiment, segment C comprises at least 3, and preferably about 20, repeats of the sequence CCTT.
  • segment C is found to be essential for transcriptional activity of segments A and B.
  • tissue-specific trans-activating factor binding sequence that has been termed herein segment B, along with the Sp1 transcription activation factor binding sequence termed herein segment A and the S1 nuclease-sensitive segment that is a protein binding site termed herein segment C (collectively, regulatory segments), can be combined to create a regulatory region that positively regulates gene expression in a tissue-specific manner.
  • the regulatory region of the invention comprising all three segments has the attributes of an enhancer element, and the term “ ⁇ 3 -AR enhancer element” or “enhancer element” may be used herein for the regulatory region of the invention comprising all three segments.
  • the enhancer element is a 200 base-pair sequence as depicted in FIG. 6A (SEQ ID NO:3).
  • a “ ⁇ 3 -AR trans-activating factor” refers to a polypeptide or polypeptide complex that recognizes the enhancer element. This complex includes the AP-2 like B segment trans-activating factor polypeptide, Sp1, and the C segment-specific polypeptide. It also includes other binding factors that may interact with genomic DNA sequences present on the approximately 7 kb DNA upstream of the ⁇ 3 -AR start site.
  • a nucleic acid vector such as a plasmid, containing these sites, or combinations of A and C or B and C, in proximity to each other and upstream a distance of about 0 to about 10 kb from a promoter region operatively associated with a gene on an expression vector can increase the level of expression of the gene.
  • Inclusion of the B segment confers tissue specificity: expression of the gene under control of the enhancer element only occurs in cells that have a transcription factor that binds to the core binding sequence of segment B. All three segments together (the enhancer element) synergistically increase expression levels of a gene operably associated with the enhancer element under appropriate expression conditions (i.e., when the B segment binding protein is present in the cell).
  • the three segments can be oriented in either orientation in the 5′ flanking region of a gene.
  • the segments are arranged in A-B-C order on the coding strand relative to the translation start site.
  • the segments are arranged in A-B-C order on the non-coding strand (and thus in [-C]-[-B]-[-A] order on the coding strand, where [-C] is the complement of the C segment, [-B] is the complement of the B segment, and [-A] is the complement of the A segment).
  • the three segments are arranged in A-B-C order, with the relative spacing between each segment found, e.g., in SEQ ID NO:3.
  • proximity when applied to the protein binding segments of the enhancer element means that the sites are located in a range from 1 to about 100 nucleotides from each other, and preferably, from about 10 to about 30 nucleotides from each other.
  • segment A is located about 14 nucleotides upstream of segment B
  • segment B is located about 31 nucleotides upstream of segment C.
  • the enhancer element is found in a nucleic acid (genomic DNA) isolated from a region about 7 kb upstream ( ⁇ 7 kb) of the ⁇ 3 -adrenergic receptor ( ⁇ 3 -AR) transcription initiation (start) site. More specifically, the enhancer element can be located between ⁇ 6.5 kb and ⁇ 6.3 kb of the translation start site of the gene. In particular, a 200 bp region of the 5′ flanking region of ⁇ 3 -AR demonstrates the enhancer activity.
  • the enhancer element operates with a heterologous promoter.
  • the enhancer element regulates gene expression from a herpes simplex virus (HSV) thymidine kinase (tk) minimal promoter.
  • HSV herpes simplex virus
  • tk thymidine kinase
  • the enhancer element operates more efficiently in conjunction with a ⁇ 3 -AR promoter (found ⁇ 0.5 kb from translation start site).
  • the term “about” or “approximately” means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.
  • an isolated nucleic acid includes a PCR product, an isolated MRNA, a cDNA, or a restriction fragment.
  • an isolated nucleic acid is preferably excised from the chromosome in which it may be found, and more preferably is no longer joined to non-regulatory, non-coding regions, or to other genes, located upstream or downstream of the gene contained by the isolated nucleic acid molecule when found in the chromosome.
  • the isolated nucleic acid lacks one or more introns.
  • Isolated nucleic acid molecules can be inserted into plasmids, cosmids, artificial chromosomes, and the like.
  • a recombinant nucleic acid is an isolated nucleic acid.
  • An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein.
  • An isolated organelle, cell, or tissue is removed from the anatomical site in which it is found in an organism.
  • An isolated material may be, but need not be, purified.
  • purified refers to material that has been isolated under conditions that reduce or eliminate unrelated materials, i.e., contaminants.
  • a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell; a purified nucleic acid molecule is preferably substantially free of proteins or other unrelated nucleic acid molecules with which it can be found within a cell.
  • substantially free is used operationally, in the context of analytical testing of the material.
  • purified material substantially free of contaminants is at least 50% pure; more preferably, at least 90% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
  • the protein binding segments identified herein can be used in recombinant construction of expression vectors with positive regulation of gene expression.
  • the A and C or B and C segments can be used together to achieve positive regulation of gene expression.
  • use of all three segments synergistically enhances gene expression. Accordingly, as used herein, use of a regulatory element of the present invention in a recombinant expression vector relates to any of the foregoing combinations, unless a specific combination is explicitly stated.
  • a “vector” is a recombinant nucleic acid construct, such as plasmid, phage genome, virus genome, cosmid, or artificial chromosome to which another DNA segment may be attached.
  • the vector may bring about the replication of the attached segment, e.g., in the case of a cloning vector.
  • a “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., it is capable of replication under its own control.
  • a “cassette” refers to a segment of DNA that can be inserted into a vector at specific restriction sites.
  • the segment of DNA that can be inserted encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation.
  • a cell has been “transfected” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • a cell has been “transformed” by exogenous or heterologous DNA when transfected DNA is expressed.
  • heterologous refers to a combination of elements not naturally occurring.
  • heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell.
  • the heterologous DNA includes a gene foreign to the cell.
  • a heterologous expression regulatory element is such an element operatively associated with a different gene than the one it is operatively associated with in nature.
  • a regulatory element of the invention is operatively associated with a heterologous gene when the gene is not a gene encoding human ⁇ 3 -AR.
  • a “nucleic acid molecule” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA:DNA, DNA:RNA and RNA:RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • a “recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • a “gene” is used herein to refer to a portion of a DNA molecule that includes a polypeptide coding sequence operatively associated with expression control sequences.
  • a gene can be a genomic or partial genomic sequence, in that it contains one or more introns.
  • the term gene refers to a cDNA molecule (i.e., the coding sequence lacking any introns).
  • a DNA “coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus.
  • a coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic niRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding sequence.
  • “Expression control sequences”, e.g., transcriptional and translational control sequences, are regulatory sequences that flank a coding sequence, such as promoters, enhancers, suppressors, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • polyadenylation signals are control sequences.
  • a ribosome binding site is an expression control sequence.
  • a coding sequence is “operatively associated with” or “under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into MRNA, which is then trans-RNA spliced and translated into the protein encoded by the coding sequence.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence.
  • the promoter sequence is bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • the ⁇ 3 -AR promoter extends about 0.5 Kb 5′ to the translation start site.
  • a nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., supra). The conditions of temperature and ionic strength determine the “stringency” of the hybridization.
  • low stringency hybridization conditions corresponding to a T m of 55° C.
  • 5 ⁇ SSC 0.1% SDS, 0.25% milk, and no formamide
  • 30% formamide 5 ⁇ SSC, 0.5% SDS.
  • Moderate stringency hybridization conditions correspond to a higher T m , e.g., 40% formamide, with 5 ⁇ or 6 ⁇ SSC.
  • High stringency hybridization conditions correspond to the highest T m , e.g., 50% formamide, 0.1 ⁇ SSC.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences.
  • the relative stability (corresponding to higher T m ) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
  • equations for calculating T m have been derived (see Sambrook et al., supra, 9.50-0.51).
  • a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.
  • the term “standard hybridization conditions” refers to a T m of 55 ° C., and utilizes conditions as set forth above.
  • the T m is 60° C.; in a more preferred embodiment, the T m is 65 ° C.
  • “high stringency” refers to hybridization and/or washing conditions at 68° C. in 0.2 ⁇ SSC, at 42° C. in 50% formamide, 4 ⁇ SSC, or under conditions that afford levels of hybridization equivalent to those observed under either of these two conditions.
  • oligonucleotide refers to a nucleic acid, generally of at least 10, preferably at least about 15, and more preferably at least about 20 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a regulatory or protein binding segment, a gene, mRNA, cDNA, or other nucleic acid of interest. Oligonucleotides can be labeled, e.g., with 32 P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated.
  • a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid.
  • oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of the enhancer element, or to detect the presence of nucleic acids encoding the enhancer element.
  • an oligonucleotide of the invention can form a triple helix with a DNA molecule containing one or more of the segments found in the enhancer element, e.g., to suppress positive regulation of the enhancer.
  • oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.
  • “Homologous recombination” refers to the insertion of a foreign DNA sequence of a vector in a chromosome.
  • the vector targets a specific chromosomal site for homologous recombination.
  • the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination.
  • homologous in all its grammatical forms and spelling variations refers to the relationship between proteins that possess a “common evolutionary origin,” including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc.) (Reeck et al., Cell 50:667, 1987). Such proteins (and their encoding genes) have sequence homology, as reflected by their high degree of sequence similarity.
  • sequence similarity in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., supra).
  • sequence similarity particularly when modified with an adverb such as “highly,” may refer to sequence similarity, which may or may not relate to a common evolutionary origin.
  • two DNA sequences are “substantially homologous” or “substantially similar” when at least about 80% (preferably at least about 90%) of the nucleotides match over the defined length of the DNA sequences.
  • Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
  • corresponding to is used herein to refer to similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured.
  • a nucleic acid or amino acid sequence alignment may include spaces.
  • corresponding to refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases.
  • a nucleic acid comprising one or more of segments A, B, and C, including an enhancer element (comprising all three segments in proximity), can be isolated from any source, particularly from a human genomic library. Methods for obtaining such nucleic acids are well known in the art, as described above (see, e.g., Sambrook et al., 1989, supra). Accordingly, any human cell potentially can serve as the nucleic acid source for the molecular cloning of a regulatory element.
  • the DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA “library”).
  • identification of the specific DNA fragment containing the desired regulatory activity may be accomplished in a number of ways. For example, as shown in the Examples, regulation of expression of a reporter gene, such as luciferase, can establish that the regulatory element or elements have been obtained. Alternatively, oligonucleotide probes or primers can be used to detect the presence of a nucleic acid encoding the regulatory region. As noted above, the greater the degree of sequence similarity, the more stringent hybridization conditions can be used.
  • the present invention also relates to cloning or using recombinant means to prepare vectors containing genes encoding analogs and derivatives of the regulatory segments of the invention, that have the same or homologous functional activity as the segments, and homologs thereof from other species. Also contemplated, and specifically exemplified herein, are derivatives or analogs of the regulatory segments that do not bind to the specific proteins. Such “non-functional” derivatives or analogs can be used to evaluate the characteristics of the DNA binding proteins that recognize the regulatory segments of the invention. The production and use of derivatives and analogs are within the scope of the present invention.
  • Nucleic acids encoding derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level.
  • the cloned regulatory segment can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro.
  • the regulatory segment can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification.
  • Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C., et al., J. Biol. Chem. 253:6551, 1978 ; Zoller and Smith, DNA 3:479-488, 1984; Oliphant et al., Gene 44:177, 1986; Hutchinson et al., Proc. Natl. Acad. Sci.
  • a regulatory element of the invention can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of a protein-coding sequence.
  • the regulatory element of the invention is operatively associated with a gene in an expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under control of such regulatory sequences.
  • An expression vector also preferably includes a replication origin.
  • Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • virus e.g., vaccinia virus, adenovirus, etc.
  • insect cell systems infected with virus e.g., baculovirus
  • microorganisms such as yeast containing yeast vectors
  • bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA e.g., bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used.
  • a recombinant gene may be expressed chromosomally under control of a regulatory element of the invention after integration of the coding sequence by recombination.
  • any of a number of amplification systems may be used to achieve high levels of stable gene expression (See Sambrook et al., 1989, supra).
  • Any of the methods for the insertion of DNA fragments into a cloning vector may be used to construct expression vectors. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombination (genetic recombination).
  • Expression of a protein under control of a regulatory element of the invention may be controlled by any promoter known in the art, so long as the promoter is functional in the host selected for expression.
  • Promoters which may be used to control gene expression include, but are not limited to, the cytomegalovirus immediate early (CMV) promoter, the SV40 early promoter region (Benoist and Chambon, Nature 290:304-310, 1981), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto, et al., Cell 22:787-797, 1980), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci.
  • the regulatory element of the invention is operably associated with an HSVtk promoter and with a ⁇ 3 -AR promoter.
  • a heterologous gene is expressed under control of a ⁇ 3 -AR promoter.
  • Vectors are introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (liposome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990).
  • a vector is any means for the transfer of a nucleic acid according to the invention into a host cell.
  • the regulatory elements of the present invention which permit positive, tissue-specific expression control, are useful in conjunction with delivery of a therapeutic gene in vivo or ex vivo, e.g., gene therapy.
  • Such vectors can be viral vectors, such as retroviruses, herpes viruses, adenoviruses and adeno-associated viruses, or non-viral vectors.
  • Viral vectors commonly used for in vivo or ex vivo targeting and therapy procedures are DNA-based vectors and retroviral vectors. Methods for constructing and using viral vectors are known in the art (see, e.g., Miller and Rosman, BioTechniques 7:980-990, 1992).
  • the viral vectors are replication defective, that is, they are unable to replicate autonomously in the target cell.
  • the genome of the replication defective viral vectors used within the scope of the present invention lack at least one region which is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), be rendered non-functional by any technique known to a person skilled in the art.
  • These techniques include the total removal, substitution (by other sequences, in particular by the inserted nucleic acid), partial deletion, or addition of one or more bases to an essential (for replication) region.
  • Such techniques may be performed in vitro (on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents.
  • the replication defective virus retains the sequences of its genome which are necessary for encapsidating the viral particles.
  • DNA viral vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
  • HSV herpes simplex virus
  • EBV Epstein Barr virus
  • AAV adeno-associated virus
  • Defective viruses which entirely or almost entirely lack viral genes, are preferred. Defective virus is not infective after introduction into a cell. Thus, a specific tissue can be specifically targeted.
  • particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
  • Adenovirus vectors are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid of the invention to a variety of cell types.
  • adenoviruses of animal origin which can be used within the scope of the present invention include adenoviruses of canine, bovine, murine (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine, avian, and simian (example: SAV) origin.
  • the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus (e.g. Manhattan or A26/61 strain (ATCC VR-800), for example).
  • the replication defective adenoviral vectors of the invention comprise the inverted terminal repeats (ITRs), an encapsidation sequence and the nucleic acid of interest. Still more preferably, at least the E1 region of the adenoviral vector is non-functional. The deletion in the E1 region preferably extends from nucleotides 455 to 3329 in the sequence of the Ad5 adenovirus (PvuII-BgIII fragment) or 382 to 3446 (HinfII-Sau3A fragment).
  • E3 region WO95/02697
  • E2 region WO94/28938
  • E4 region WO94/28152, WO94/12649, WO95/02697 and WO96/22378
  • the replication defective recombinant adenoviruses according to the invention can be prepared by any technique known to the person skilled in the art (Levrero et al., Gene 101 (1991) 195, EP 185 573; Graham, EMBO J. 3 (1984) 2917). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid which carries, inter alia, the DNA sequence of interest. The homologous recombination is effected following cotransfection of the adenovirus and plasmid into an appropriate cell line.
  • the cell line which is employed should preferably (i) be transformable by the elements, and (ii) contain the sequences which are able to complement the part of the genome of the replication defective adenovirus, preferably in integrated form in order to avoid the risks of recombination.
  • Examples of cell lines which may be used are the human embryonic kidney cell line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which contains the left-hand portion of the genome of an Ad5 adenovirus (12%) integrated into its genome, and cell lines which are able to complement the E1 and E4 functions, as described in applications WO94/26914 and WO95/02697.
  • Recombinant adenoviruses are recovered and purified using standard molecular biological techniques, which are well known to one of ordinary skill in the art.
  • Adeno-associated viruses are DNA viruses of relatively small size which can integrate, in a stable and site-specific manner, into the genome of the cells which they infect. They are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies.
  • the AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus.
  • ITR inverted terminal repeat
  • the remainder of the genome is divided into two essential regions which carry the encapsidation functions: the left-hand part of the genome, which contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, which contains the cap gene encoding the capsid proteins of the virus.
  • the use of vectors derived from the AAVs for transferring genes in vitro and in vivo has been described (see WO 91/18088; WO 93/09239; U.S. Pat. Nos. 4,797,368, 5,139,941, EP 488 528).
  • Retrovirus vectors In another embodiment the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Pat. No. 5,399,346; Mann et al., 1983, Cell 33:153; Temin et al., U.S. Pat. No. 4,650,764; Temin et al., U.S. Pat. No. 4,980,289; Markowitz et al., 1988, J. Virol. 62:1120; Temin et al., U.S. Pat. No. 5,124,263; EP 453242, EP178220; Bernstein et al. Genet. Eng.
  • WO 95/07358 published Mar. 16, 1995, by Dougherty et al.; and Kuo et al., 1993, Blood 82:845.
  • retrovirus such as, HIV, MoMuLV (“murine Moloney leukaemia virus” MSV (“murine Moloney sarcoma virus”), HaSV (“Harvey sarcoma virus”); SNV (“spleen necrosis virus”); RSV (“Rous sarcoma virus”) and Friend virus.
  • HIV HIV
  • MoMuLV murine Moloney leukaemia virus
  • MSV murine Moloney sarcoma virus
  • HaSV Harmonic sarcoma virus
  • SNV spleen necrosis virus
  • RSV Ra sarcoma virus
  • Friend virus Friend virus.
  • Defective retroviral vectors are disclosed in WO95/02697.
  • Retroviral vectors for preparation of retroviral vectors have been described in the prior art, in particular the cell line PA317 (U.S. Pat. No. 4,861,719); the PsiCRIP cell line (WO90/02806) and the GP+envAm-12 cell line (WO89/07150).
  • the recombinant retroviral vectors can contain modifications within the long terminal repeats (LTRs) for suppressing transcriptional activity as well as extensive encapsidation sequences which may include a part of the gag gene (Bender et al., J. Virol. 61:1639, 1987).
  • LTRs long terminal repeats
  • Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art.
  • Non-viral vectors can be introduced in vivo as naked DNA, or with a DNA transfer facilitating agent, such as a lipid.
  • one method for transfer of a nucleic acid vector is by lipofection.
  • Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Felgner, et. al., Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417, 1987; see Mackey, et al., Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031, 1988; Ulmer et al., Science 259:1745-1748, 1993).
  • cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Felgner and Ringold, Science 337:387-388, 1989).
  • Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO95/18863 and WO96/17823, and in U.S. Pat. No. 5,459,127.
  • the use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain.
  • Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey, et. al., supra).
  • Targeted peptides e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.
  • a nucleic acid in vivo, is also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., International Patent Publication WO95/21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO96/25508), or a cationic polymer (e.g., International Patent Publication WO95/2193 1).
  • a cationic oligopeptide e.g., International Patent Publication WO95/21931
  • peptides derived from DNA binding proteins e.g., International Patent Publication WO96/25508
  • a cationic polymer e.g., International Patent Publication WO95/2193
  • DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wu et al., J. Biol. Chem. 267:963-967, 1992; Wu and Wu, J. Biol. Chem. 263:14621-14624, 1988; Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar.
  • Identification and isolation of the regulatory elements of the invention provides for development of screening assays, particularly for high throughput screening of molecules that up- or down-regulate the activity of the regulatory element of the invention.
  • control of the regulatory element can be effected by increasing or decreasing the activity of a trans-acting factor (preferably the B-segment-binding trans-acting factor) of the invention.
  • the factor can act directly by interacting with the sequences of the regulatory segments or region.
  • Molecules that increase the activity of the regulatory element of the invention, and thus increase the level of expression of endogenous ⁇ 3 -AR would be useful in combination with a ⁇ 3 -AR-specific agonist for the treatment of obesity and diabetes, particularly non-insulin dependent diabetes mellitus (NIDDM).
  • NIDDM non-insulin dependent diabetes mellitus
  • an agent that induces expression of the B-segment-specific trans-acting factor discovered herein would be useful for inducing ⁇ 3 -AR expression in a desired tissue, such as a WAT cell or an undifferentiated adipocyte (so as to push it to differentiation into a BAT cell), so as to render it sensitive to a ⁇ 3 -AR agonist.
  • such agents may be useful in combination with a ⁇ 3 -AR agonist for treating urinary incontinence and to suppress ureteral colic; in the facilitation of stone discharge in urolithiasis patients; and in the treatment of depression (at least one ⁇ 3 -AR agonist having been shown to have anti-depressant activity).
  • Any mammalian cell can be used to screen for molecules that increase or decrease the activity of a ⁇ 3 -AR trans-activating factor.
  • the cells express or have the potential to express the ⁇ 3 -AR trans-activating factor, such as BAT (including HIB) or SK-N-MC cells.
  • BAT and SK-N-MC cells have been discussed.
  • the HIB 1B cell line was derived from brown adipose tissue (BAT) tumor isolated from transgenic mice (Ross et al., PNAS, 89:7561-7565, 1992). This cell line represents the first established brown adipocytes cell line capable of expressing uncoupling protein 1 (UCP-1).
  • UCP-1 is a mitochondrial protein expressed exclusively in BAT.
  • UCP-1 mRNA is detectable after stimulation of ⁇ -adrenergic receptor system that is present in these cells ( ⁇ 1 -and ⁇ 2 -AR, 60-70%, and ⁇ 3 -AR, 30-40%) (Klaus et al., J. Cell. Sci., 107:313-319, 1994).
  • the HIB 1B cells are maintained in DMEM:F12 (1:1) in the presence of 10% FCS. When they reach confluency, cells are induced to differentiate (i.e., to show UCP-1 expression and accumulation of lipid droplets). Differentiation is achieved by adding 5% FBS in addition to T 3 and insulin, to the medium. Seven days after confluency in the presence of T 3 and insulin, 90-95% of the cells are differentiated.
  • any screening technique known in the art can be used to screen for compounds that up- or down-regulate the activity of the regulatory region of the invention.
  • the term “compound” refers to any molecule or complex of more than one molecule that affects the regulatory region.
  • the present invention contemplates screens for synthetic small molecule agents, chemical compounds, chemical complexes, and salts thereof as well as screens for natural products, such as plant extracts or materials obtained from fermentation broths.
  • molecules that can be identified using the screens of the invention include proteins and peptide fragments, peptides, nucleic acids and oligonucleotides (particularly triple-helix-forming oligonucleotides), carbohydrates, phospholipids and other lipid derivatives, steroids and steroid derivatives, prostaglandins and related arachadonic acid derivatives, etc.
  • the screening can be performed with recombinant cells that express a reporter gene under control of the regulatory region of the invention, particularly the enhancer region.
  • a reporter gene under control of the regulatory region of the invention, particularly the enhancer region.
  • luciferase a reporter gene
  • a reporter gene assay can be used to detect increased expression of a gene under control of the ⁇ 3 -AR enhancer element in a cell that does not normally express or expresses at very low levels ⁇ 3 -AR relative to ⁇ 3 -AR-expressing cells.
  • Such cells include WAT cells (including perirenal cells), muscle cells, liver cells and HeLa and CV-1 cells.
  • WAT cells including perirenal cells
  • muscle cells including perirenal cells
  • liver cells did not express the B segment trans-activating factor.
  • These cells recombinantly engineered with a reporter gene under control of the enhancer region, can be used to screen for molecules that induce trans-activating factor activity.
  • increased levels of expression of the B segment binding trans-activating factor can be detected in cells that express ⁇ 3 -AR, including but not limited to BAT cells (including HIB cells, which is a BAT-derived cell line), and human neuroblastoma cells.
  • BAT cells including HIB cells, which is a BAT-derived cell line
  • human neuroblastoma cells in both cases, an increase in the level of expression of the reporter gene, relative to the level of expression in the absence of a test compound, indicates that the test compound has a positive influence on regulation of expression under control of the regulatory element of the invention.
  • a reporter gene assay can be used to test inhibitors of the regulatory region.
  • Such reporter gene assays are most conveniently performed on cells that constitutively express high levels of a reporter gene operatively associated with the regulatory element. A reduction in the level of expression of the reporter gene in the presence of a test compound, relative to the level of expression in the absence of the test compound, indicates that the test compound inhibits expression control by the regulatory element.
  • Reporter genes for use in the invention encode detectable proteins, including, but are by no means limited to, chloramphenicol transferase (CAT), ⁇ -galactosidase ( ⁇ -gal), luciferase, green fluorescent protein, alkaline phosphatase, and other genes that can be detected, e.g., immunologically (by antibody assay).
  • CAT chloramphenicol transferase
  • ⁇ -gal ⁇ -galactosidase
  • luciferase green fluorescent protein
  • alkaline phosphatase alkaline phosphatase
  • the present invention permits directly assessing the level of expression of the B segment binding trans-activating protein by detecting the amount of this protein associated with a nucleic acid containing the B segment core binding sequence.
  • assays include gel shift assays, solid phase binding assays, and the like.
  • the nucleic acid such as an oligonucleotide
  • the B segment sequence preferably either the nucleic acid (such as an oligonucleotide) containing the B segment sequence, or the protein, or both, are detectably labeled so that any binding of the two can be detected.
  • labels include enzymes, such as alkaline phosphatase and horseradish peroxidase; colored latex beads; magnetic beads; fluorescent labels, e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated lanthanide series salts, especially Eu 3+ , to name a few fluorophores; fluorescence transfer pairs; chemiluminescent molecules; radioisotopes; or magnetic resonance imaging labels.
  • the oligonucleotide is radiolabeled.
  • a significant and unexpected discovery of the present invention is the identification and characterization of a novel AP-2-like transcription factor, the B-segment binding trans-activating factor.
  • This factor binds to DNA having the sequence GCCTCTGGGGAG (SEQ ID NO:1), and is expressed, inter alia, by mouse brown adipose tissue cells and the human neuroblastoma cell line SK-N-MC; it is also expressed at very low levels in perirenal white adipose tissue (and perhaps not at all in pure white adipose tissue cells), and an AP-2 oligonucleotide does not compete with the B segment sequence for binding to this factor.
  • the factor is not recognized by an anti-AP-2 antibody.
  • the transcription factor AP-2 was first isolated from HeLa cells by affinity chromatography and subsequently cloned by screening a HeLa genomic library.
  • AP-2 is a 52 kDa protein which gene was mapped to a region on chromosome 6.
  • the DNA binding domain within AP-2 transcription factor is located in C-terminal half of protein and consists of two putative amphipathic alpha helices separated by a large spanning region.
  • the N-terminal domain of AP-2 protein contains a trans-activation domain with a proline-rich region.
  • AP-2 transcription factor binds to a consensus binding site ⁇ 5′-GCCNNNGGC-3′ (SEQ ID NO:4) that is found in numerous viral and cellular promoters.
  • Phorbol-ester and agents that lead to an increase of cAMP induces AP-2 activity independently of protein synthesis (Buttner et al., Mol. Cell. Biology, 13:4174-4185, 1993; Bauer et al., Nucleic Acid Research, 22:1413-1420, 1994.)
  • Various means can be used to isolate the B segment binding factor protein or gene, including a yeast one-hybrid assay in a system recombinantly engineered to express polypeptides from cells that express the ⁇ 3 -AR.
  • Such cells include BAT cells (including HIB cells), and human neuroblastoma cells, such as SK-N-MC cells.
  • the yeast one hybrid system was described by Fields and Song (Nature, 340:245-247, 1989). Numerous laboratories have used this system to successfully clone unknown transcription factors that bind for identified DNA binding sites (e.g., Wu et al., EMBO J., 13:4823-4830, 1994).
  • the yeast-one hybrid system provides the tool for isolation of novel genes that encode the proteins that bind to a target: cis-acting regulatory DNA elements.
  • the one-hybrid assay is based on the interaction between a target-specific DNA-binding domain and a target-independent activation domain (AD).
  • the binding domain for target DNA is provided in a construct with the AD. If the binding protein that recognizes the target DNA is present in the cDNA library, its expression will allow binding to target DNA. Binding to the target DNA results in expression and binding of AD to transcriptional machinery of another vector to induce expression of a reporter gene.
  • oligonucleotides that correspond to region B are synthesized, annealed and cloned into the Eco RI and the Mlu I sites of pHISi, pHISI-1 and pLacZi vectors (Clontech). B/pHISi and B/pHISi-1 clones are then stably transfected into the genome of yeast strain YM4271. The yeast cells are transformed according to established protocol using LiAc method and colonies selected by growth on SD-His plates.
  • B/pHISi/YM4271 stably integrated yeast cells are transformed with a mouse brown adipose tissue (BAT) library constructed into a pGAD10 vector (custom-made library by Clontech). Colonies are selected by growth on SD/-his/-leu plates supplemented with 30 mM 3-AT (3-amino-1,2,4-triazole).
  • BAT mouse brown adipose tissue
  • Screening of an expression library generated from SK-N-MC poly-A RNA with a radiolabeled segment “B” oligonucleotide is another strategy for cloning and isolation of the transcription factor that binds for “B” sequence.
  • a nucleic acid, and particularly a DNA oligonucleotide, comprising the B segment core binding sequence GCCTCTGGGGAG (SEQ ID NO:1) can be used to isolate the protein, e.g., by an affinity chromatography technique.
  • a DNA oligonucleotide can be used to capture polysomes expressing the B segment binding factor, permitting isolation and reverse cloning of the B segment binding factor mRNA.
  • This example presents data that show the existence of h ⁇ 3 -AR cis-acting positive regulatory elements between ⁇ 6.5 kb to ⁇ 6.3 kb of the 5′-flanking region.
  • These positive regulatory elements consist of three DNA binding sequences: A, B, and C that act synergistically.
  • Region A binds Sp1 binding factor
  • region B is recognized by proteins (as yet unidentified) present in nuclear extracts from SK-N-MC cells as well as mouse BAT
  • region C is represented by 20 repeats of a CCTT motif that is necessary to achieve full transcriptional activity of h ⁇ 3 -AR enhancer.
  • cDNA was constructed by ligating four polymerase chain reaction (PCR) products using the following primers: an ATG-NarI fragment, sense primer 5′ CTTTCCCTACCGCCCCACGCGCGATC 3′ (SEQ ID NO:5) and anti-sense primer 5′ GTGGCGCCCAACGGCCAGTGGCCAGTC 3′ (SEQ ID NO:6); a NarI-AccI fragment, 5′ TTGGCGCTGACTGGCCACTGGCCGTTG 3′ (SEQ ID NO:7) as sense and 5′ GCGCGTAGACGAAGAGCATCACGAG 3′ (SEQ ID NO:8) as anti-sense primer; an AccI-Styl fragment, sense primer 5′ CTCGTGATGCTCTTCGTCTSCGCGC 3′ (SEQ ID NO:9) and anti-sense primer 5′ GTGAAGGTGCCCATGATGAGACCCAAGG 3′ (SEQ ID NO:10) and a Styl-TAG fragment, with sense primer 5′ CCCTGTGCACCTTGGGTCTCAT
  • 5′ RACE To identifythe transcription start site ofthe h ⁇ 3 -AR gene, 5′ RACE was performed using SK-N-MC cell total RNA purified using RNAzol B (Tel-Test, Inc., Friendswood, Tex.). Poly A RNA was then purified using an Ambion Micropo(A) pure kit. The 5′ RACE was done using the Marathon cDNA amplification kit (Clonetech, Palo Alto, Calif.) according to the protocol provided with the kit.
  • the PCR products were then cloned into a pCRII vector using the TA cloning kit (Invitrogen, Carlsbad, Calif.). The clones were sequenced using the ABI 373 Automated Sequencer.
  • the deletion constructs labeled as ⁇ 5.5h ⁇ 3/Luc, ⁇ 3h ⁇ 3/Luc and 0.5h ⁇ 3/Luc were made by digestion with AvrII, EcoRV and BstEII, respectively and KpnI, blunt ended and re-ligated.
  • the construct ⁇ .3h ⁇ 3/Luc was made by ligating a PCR product corresponding to a 1.3 kb region of the h ⁇ 3 -AR gene promoter that has been previously published (Liggett and Schwina, supra).
  • the PCR product was obtained using HeLa cell genomic DNA and the 5′ ggtaccTCTAGGTGGAAAGGTGCATG 3′ (SEQ ID NO:15) as sense and 5′ aagcttAGTCCCCTCCCTGTCGT 3′ (SEQ ID NO:16) as anti-sense primers (GenBank sequence with accession #M62473) was used when choosing the primers.

Abstract

Regulatory elements responsible for tissue-specific transcriptional regulation of the human β3-adrenergic receptor (β3-AR) were identified. A region localized between −6.50 and −6.30 kb of the proximal promoter contained three sequences that act synergistically to achieve full transcriptional activity. One segment, termed segment A, contains an Sp1 binding site. Another of the sequences, termed segment B, is a binding site for a trans-acting factor present in cells that constitutively express β3-AR. In a specific embodiment, the trans-acting factor is expressed in neuroblastoma (SK-N-MC) and brown adipose tissue cells, but little or not at all in CV-1, HeLa, or white adipose tissue cells. The third segment, C, is an S1 nuclease-sensitive site having CCTT repeats. Recombinant vectors under control of this transcriptional regulation region, particularly containing the B and C segments, provide a substrate for high throughput assays, such as reporter gene assays, to identify compounds that can increase the level of expression of β3-AR. The B segment nucleic acids also provide for isolation and cloning of the trans-acting factor. Mechanisms of transcriptional regulation and identification of other adjacent proteins involved in the regulation of the hβ3-AR gene expression are provided.

Description

  • This is a division of application Ser. No. 09/761,116, filed Jan. 16, 2001, which is a division of U.S. Pat. No. 6,197,580, issued on Mar, 6, 2001, each of which is herein incorporated by reference in their entirety.[0001]
  • FIELD OF THE INVENTION
  • The present invention relates to a positive cis-regulatory (enhancer) element of human β[0002] 3-adrenergic receptor responsible for its transcription in SK-N-MC cells. Such element is composed of three DNA binding sites that act synergistically and is located 6.5 kb upstream from the translation start site of the β3-adrenergic receptor. The invention further relates to use of this enhancer element for regulated gene expression and for drug screening.
  • BACKGROUND OF THE INVENTION
  • The β[0003] 3-adrenergic receptor (β3-AR) is an important regulator of metabolic activity in brown and white adipose tissue, two major sites for regulation of energy balance. The β3-AR belongs to a family of G-protein coupled receptors. Its binding to endogenous ligand or specific synthetic agonist leads to activation of adenylate cyclase, an increased concentration of cAMP, and an increased activity of PKA, resulting in increased thermogenic activity and heat production in brown adipose tissue (BAT) and lipolysis in white adipose tissue (WAT). Since β3-AR stimulation causes an increase in thermogenic activity and a less efficient utilization of metabolic fuels, its sustained activation should be of benefit in the treatment of obesity, and improvement of glycemic control in type II diabetes. Indeed, numerous reports have shown that stimulation of β3-ARs cause weight loss and improvement in glycemic control in rodent models of these diseases (Carroll et al., Diabetes 34:1198-1204, 1984; Umekawa et al., European Journal of Endo.136:429-437, 1997; Yoshida et al., J. Nutr. Sci. Vitaminol (Tokyo) 36:75-80, 1990; Yoshida et al., Endocrinol Japon 38:397-403, 1991; Smith et al., New Antidiabetic Drugs, Ed.: Bailey, C. J., and Flatt, P. R., London, 1990; Largis et al., Drug Dev. Res. 32:69-76, 1994; Bloom et al., Journal of Medicinal Chemistry 35:3081-3084, 1992; Cawthorne et al., American Journal of Clinical Nutrition 55:252S-257S, 1992).
  • Despite the well characterized role of β[0004] 3-ARs in rodents, its role in the regulation of energy balance in man is still not clear. Observations by several groups of investigators (Walston et al., New Engl. J. Med. 333:343-347, 1995; Kadowaki et al., Biochem. Biophys. Res. Commun. 215:555-560, 1995; Yoshioka et al., Diabetologia 39: 1410-1411, 1996; Fujisawa et al., Diabetologia 39:349-352, 1996; Kurabayashi et al., Diabetes 45:1358-1363, 1996; Zhang et al., Diabetologia 39:1505-1511, 1996; Widen et al., New Engl. J. Med. 333:348-351, 1995; Clement et al., New Engl. J. Med. 333:352-354, 1995) describing the existence of a positive correlation between an Arg to Trp mutation at position 64 in the human β3-AR (hβ3-AR ) gene and the early onset of non-insulin dependent diabetes mellitus (NIDDM) (Walston et al., supra; Yoshioka et al., supra; Fujisawa et al., supra; Kurabayashi et al., supra; Widen et al., supra), insulin resistance (Walston et al., supra), increased weight gain (Kadowaki et al., supra; Yoshioka et al. supra; Fujisawa et al. supra; Zhang et al, supra; Clement et al., supra) and abdominal obesity (Walston et al., supra) seemed to validate the role of the β3-AR in the development of obesity and diabetes. However, other investigators have failed to observe any correlation between the prevalences of the Trp64Arg mutation and obesity or diabetes in the patient populations they have studied (Li, et al., Diabetologia 39:857-860, 1996; Elbein et al., J. Clin. Endocrinol. Metab. 81:4422-4427, 1996; Ueda et al., Metabolism 46:199-202, 1997; Awata et al. Diabetes Care 19:271-272, 1996). Further, the pharmacology and biology of the wild type and mutated receptors did not differ when compared in cell based systems (Candelore et al., Endocrinology 137:2638-2641, 1996; Pietri-Rouxel et al., Eur.J. Biochem. 247:1174-11791 1997), although it does appear that the mutations cause less accumulation of cAMP, indicating diminished signal transduction efficiency in the cells that contained mutated hβ3-AR. The physiological significance of this observation is not yet clear. The success achieved in the treatment of obesity and diabetes in rodent models with selective β3-AR agonists supported a role for this receptor as a therapeutic target and has prompted a great effort to develop compounds with a high affinity and selectivity towards the human β3-AR.
  • Despite the approximately 80% homology in amino acid sequences and similar adipose tissue expression pattern, human and mouse β[0005] 3-ARs differ in two very important ways. First, the mouse β3-AR shows a high affinity and selectivity for certain β3-AR specific agonists, while the human receptor has little or no affinity for the same agonists when tested in CHO cells stably transfected with human β3AR (Liggett et al., Molecular Pharmacology, 42:634-637, 1992). On the other hand, agonists that show high affinity and selectivity in β3-AR transfected CHO cells that express a high level of human β3-ARs have little or no activity in vivo (when tested in non human primates and clinical trials). Their lack of robust activity may be due to pharmacokinetic or metabolic issues, but another reason for this discrepancy may be the low level of β3-AR expression in target tissues (Wilson et al., The Journal of Pharmacology and Experimental Therapeutics 279:214-221, 1996).
  • Second, in rodents β[0006] 3-AR mRNA is predominantly detected in brown and white adipose tissue (Granneman et al., Mol. Pharmacol. 40:895-899, 1991; Muzzin et al, J. Biol Chem. 266:24053-24058, 1991), while in man β3-ARs are expressed in BAT but appear to have little or no expression in WAT (Krief et al., J. Clin. Invest. 91:344-349, 1993; Thomas and Liggett, Mol. Pharmacol., 43:343-343, 1991). However, other studies support the existence of functionally active β3-ARs in human WAT, showing an increase in lipolysis and glycerol formation after treatment with CGP-12177 (a selective agonist for the human β3-AR) both in vivo (Lonnqvist, Br. J. Pharmacol., 1993) and in vitro (Enocksson et al., J. Clin. Invest. 95:2239-2245, 1995). The significance of these studies in terms of the importance of β3-ARs in the regulation of WAT physiology remains to be proven, since CGP-12177 might interact with other as yet undescribed adrenergic receptors (Kaumann, A. J., Trends in Pharmacological Sciences 18:70-76, 1997).
  • The low affinity for synthetic agonists together with a low level of expression of hβ[0007] 3-ARs in WAT and the relatively small amount of BAT in humans may explain why agonists developed so far have been inactive in man.
  • Although the beneficial effects of an increased presence of β[0008] 3-ARs in man can be envisioned, research leading to a better understanding of the factors that regulate the hβ3-AR gene expression has been limited. Given the possibility that increased expression of β3-AR in humans will lead to an increased accessibility of receptors in WAT and BAT, as well as to the recruitment of more brown adipocytes, there is a need in the art to better understand mechanisms and factors that regulate transcription of hβ3-ARs.
  • This problem is rendered more complex due to the lack of human brown and white adipose tissue cell lines. Although the genes for mouse (Nahmias et al., EMBO J. 10:3721-3727, 1991), rat (Granneman et al., Mol. Pharmacol. 40:895-899, 1991), and human β[0009] 3-ARs (Granneman et al., Mol. Pharmacol. 44:264-270, 1993); Granneman et al., Mol. Pharmacol. 42:964-970, 1992; Emorine et al., Science 245:1118-1121) have been cloned, little additional data is available about the structure of regulatory regions and possible transcription factors close to the proximal promoter that may play a role in β3-AR transcriptional regulation (Liggett et al., J. DNA Sequencing and Mapping 2:61-63, 1991). Thus, there is a need in the art to provide the endogenous regulatory sequences of β3-AR.
  • SUMMARY OF THE INVENTION
  • In one aspect, the present invention provides an isolated nucleic acid comprising a nucleotide sequence that is greater than 80% identical to the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1). This sequence is specifically recognized by a transcription factor, and is responsible for tissue specific expression of β[0010] 3-AR. The invention further provides this nucleic acid further comprising a nucleotide sequence that binds an Sp-1 transcription factor protein, or contains an S1 nuclease sensitive site, or both. A combination of these sequences in proximity to each other in a nucleic acid, termed herein a β3-AR enhancer element, permits positive regulation of expression of a gene operably associated with the sequences. Host cells containing vectors, with genes operably associated with the enhancer element, and both transient and stable expression of such genes, are also provided.
  • The invention further provides a specific β[0011] 3-AR trans-activating factor polypeptide having the following characteristics: (a) it binds specifically to the nucleic acid having the sequence GCCTCTGGGGAG (SEQ ID NO:1); (b) it is expressed by mouse brown adipose tissue cells; (c) it is expressed at very low levels by human white adipocytes isolated from the perirenal depot; (d) an AP-2 binding oligonucleotide does not compete with a nucleic acid having the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1) for binding the polypeptide; and (e) when complexed to a nucleic acid comprising SEQ ID NO:1, it is not recognized by an antibody to AP-2, e.g., as detected in a super shift assay.
  • In another aspect, the invention provides a method of isolating a polypeptide that binds specifically to a nucleic acid having a nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1). The method comprises contacting a composition suspected of containing the polypeptide with the nucleic acid under conditions that permit detection of binding of the polypeptide to the nucleic acid; and isolating the bound polypeptide. [0012]
  • In still another embodiment, the invention provides a method of screening for a compound that increases activity of a β[0013] 3-AR trans-activating factor in human cells. This method comprises contacting cells with a test compound; and detecting an increase in a level of activity of the β3-AR trans-activating factor.
  • A related method of the invention provides for screening for a compound that inhibits activity of a β3-AR trans-activating factor in human cells. Such a method comprises contacting cells with a test compound; and detecting a decrease in a level of activity of the β[0014] 3-AR trans-activating factor.
  • In both screening methods, the test cells are capable of producing, i.e., expressing, one or more components of the β[0015] 3-AR trans-activating factor.
  • These and other aspects of the present invention are further elaborated in the drawings and detailed description that follow.[0016]
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1: Partial restriction enzymes map of 7A human β[0017] 3-AR clone. A human lung genomic library was screened with a probe that corresponds to the full cDNA region except the last 6 amino acids. The probe was made by ligation of 4 PCR products that overlap partial cDNA for the hβ3-AR gene. The map shows restriction enzymes sites and their corresponding position within the genomic DNA from the translation start site (PsI-Pst I, Avr-AvII, EV-EcoRV, E1- EcoRI, BE-BstEII, SI-SalI).
  • FIG. 2: Determination of transcription start site of hβ[0018] 3-AR gene using 5′ RACE. 5′ RACE was performed on poly A RNA isolated from SK-N-MC cells using the Marathon cDNA amplification kit (Clontech). Twenty subcloned RACE-PCR products were subcloned and sequenced. Capital letters in the Figure represent translation start sites. The underlined sequence represents the primer used in 5′ RACE; determined transcription start sites are indicated with asterisks.
  • FIG. 3: Partial restriction enzymes map of constructs used in transient transfection experiments. All promoter regions were cloned in a pGL3 basic vector. The positions of the restriction enzyme sites are based on assigning the translation start site as +1. [0019]
  • FIG. 4: Constructs to evaluate the effect of far upstream region on transcription activity. Transfection constructs were made by keeping region between −7 to −5.6 and deleting regions between Avr II and EcorV, EcoRI and BstEII to make dEVhβ3AR/luc, dEIhβ3AR/luc and dBhβ3AR/luc respectively. [0020]
  • FIG. 5: Further analysis of 1.5 kb of distal promoter. A series of PCR products were made and ligated to a TK minimal promoter within pGL3 basic. [0021]
  • FIGS. 6A, B, C and D: EMSA experiments with oligonucleotides generated from sequence between −6.508 and −6.308 kp from 5′ flanking region of hβ[0022] 3-AR gene. A: Sequence of 200 bp between primers “6” (−6.508 kb) and “8” (−6.308 kb). EMSA were done using underlined sequences as oligonucleotides, which are marked as 1, 2, 3, 4, and 1A to cover the 200 bp region, and 2A, 3A, 4A, and 1B representing overlaps between oligonucleotides 1 and 2, 2 and 3, 3 and 4, and 1A and 4, respectively. Experiments were done with doublestranded labeled oligonucleotides under the conditions described in experimental procedures. B and C: Nuclear extracts from SK-N-MC, CV-1 and HeLa cells were incubated with radiolabeled oligonucleotides described above. The Figure shows only oligonucleotides that show binding. B: Oligonucleotides 2, 2A, 3A, and C: 1B and 4A. D: Also, EMSAs were done in a presence of excess of indicated cold oligonucleotides. The amount of cold oligos was a 50x molar excess of labeled oligonucleotides unless otherwise indicated. Arrows indicate the position of major DNA-protein complexes.
  • FIGS. [0023] 7A and 7B: Mutational analysis of regions “A” and “B”. A: Segment “A” oligonucleotides (SEQ ID NOS:33-40) representing the overlap between oligonucleotides 1 and 2. B: Segment “B” oligonucleotides (SEQ ID NOS:41-48) representing the overlap between oligonucleotides 2 and 3A. Mutated oligonucleotides are shown, with mutated bases underlined. Small letters correspond to restriction enzymes sites for easier cloning and purification of doublestranded oligonucleotides.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention is based, in part, on the discovery of a new regulatory region that appears to be an enhancer element for the human β[0024] 3-AR gene. Mechanisms of transcriptional regulation of the human β3-adrenergic receptor were studied using SK-N-MC cells, a human neuroblastoma cell line that expresses β3- and β1-adrenergic receptors endogenously. A genomic 7 kilobase (kb) region of the human β3-adrenergic receptor 5′ flanking region was isolated. Transfection constructs that contain deletions within this 7 kb region linked to a luciferase reporter gene were made and transfected in SK-N-MC, CV1 and HeLa cells. Maximal luciferase activity was observed only with the presence of a 200 basepair (bp) region located far upstream (between −6.5 kb and −6.3 kb) from the translation start site. This region was also shown to determine cell-specific expression in SK-N-MC cells, but not CV1 or HeLa cells. Electrophoretic mobility shifts assays using nuclear extracts from SK-N-MC, CV-1 and HeLa cells with oligonucleotides that cover this 200 bp promoter region revealed the existence of three cis-regulatory elements (segments A, B, and C), or protein binding segments, that act synergistically to achieve full transcriptional activity. Mutational analysis, along with antibody-supershift studies and competition experiments, implicated an Sp1 transcription factor as a part of the positive regulatory element (segment A). Segment B represents a novel DNA binding site that binds a protein present in nuclear extracts from SK-N-MC cells and brown adipose tissue, but which was not detectable in other cells, notably white adipose tissue by methods used in the Examples, infra. These data support the brown adipose tissue-specific expression of the β3-adrenergic receptor. Segment C binds protein present in SK-N-MC and HeLa cells; it also exhibits an S1 nuclease hypersensitive site. These data taken together indicate the existence of cell specific positive cis-regulatory elements located 6.5 kb upstream from the translation start site that play a pivotal role in transcriptional regulation of the human β3-adrenergic receptor.
  • The nucleotide sequence of a nucleic acid (DNA) that binds a tissue-specific trans-activating factor has been identified in segment B of the β[0025] 3-AR regulatory region. The sequence is greater than 80% identical (at least 10 of 12 bases are the same) to the core nucleotide sequence GCCTCTGGGGAG (SEQ ID NO:1). In a specific embodiment, the sequence of this segment is GCCTCTGGGGAG (SEQ ID NO:1). In another specific embodiment, the sequence is 78% similar to an ERF AP-2 consensus binding site. However, an oligonucleotide comprising the segment B core sequence cannot displace binding of an AP-2 oligonucleotide by an AP-2 protein, even at a 100-fold molar excess. Segment B can be further characterized by its specificity for binding with a trans-activating factor found at detectable levels in brown adipose tissue (BAT) and in a human neuroblastoma cell line, but which is not detectably present in HeLa cells, or in white adipose tissue (WAT) (murine, and probably human as well). Thus, in a specific embodiment, an isolated nucleic acid comprising a nucleotide sequence of the invention can be identified by its specificity for the particular trans-activating factor.
  • The new trans-activating factor is termed herein the “B segment-binding trans-activating factor.” This B segment-binding trans-activating factor polypeptide appears to be an AP-2-like protein. This conclusion is based on the similarity of the B segment sequence, specifically SEQ ID NO:1, to an ERF consensus binding site that belongs to a family of AP-2 transcription factors. In a specific embodiment, infra, the B segment-binding trans-activating factor binds a nucleic acid comprising the sequence GCCTCTGGGGAG (SEQ ID NO:1) with high enough affinity that an AP-2 oligonucleotide competitor failed to displace it, even at a 200-fold molar excess. In a further embodiment, the B segment-binding trans-activating factor does not bind an antibody that recognizes AP-2. [0026]
  • A second protein-binding segment that operates synergistically with segment B in the regulatory region has also been identified. Because in a specific embodiment this segment is upstream (5′) to segment B, it has been termed segment A. Segment A binds an Sp1-like transcription factor. In specific embodiments, segment A is displaced from binding a protein from cellular nuclear extracts by an Sp1 oligonucleotide. In another embodiment, a protein that binds to segment A is recognized by an anti-Sp1 antibody. Thus, in a specific embodiment, segment A is an Sp1 binding site. In a further specific embodiment, exemplified infra, the nucleotide sequence of the binding site is AGGTGGGACT (SEQ ID NO:2). This binding site sequence differs from known Sp1 sequences. It contains a “GGTG” motif, whereas known Sp1 sequences have a “GGCG” motif. [0027]
  • A third protein-binding segment that is necessary for the positive regulatory effects of segment A and segment B, alone and in combination, has also been identified. Because in a specific embodiment exemplified infra this segment is 3′ to segment B, it has been termed segment C. Segment C is an S1 nuclease-sensitive site. In a specific embodiment, it comprises at least 12 bases, and preferably about 80 bases, of a homopurine-homopyrimidine rich region. In a more specific embodiment, segment C comprises at least 3, and preferably about 20, repeats of the sequence CCTT. In a specific embodiment exemplified infra, there are 19 repeats of CCTT and one repeat, in the 19[0028] th position, with the sequence TCTT (for a total of 20 repeats). Segment C is found to be essential for transcriptional activity of segments A and B.
  • The tissue-specific trans-activating factor binding sequence that has been termed herein segment B, along with the Sp1 transcription activation factor binding sequence termed herein segment A and the S1 nuclease-sensitive segment that is a protein binding site termed herein segment C (collectively, regulatory segments), can be combined to create a regulatory region that positively regulates gene expression in a tissue-specific manner. The regulatory region of the invention comprising all three segments has the attributes of an enhancer element, and the term “β[0029] 3-AR enhancer element” or “enhancer element” may be used herein for the regulatory region of the invention comprising all three segments. In a specific embodiment, the enhancer element is a 200 base-pair sequence as depicted in FIG. 6A (SEQ ID NO:3).
  • As used herein, a “β[0030] 3-AR trans-activating factor” refers to a polypeptide or polypeptide complex that recognizes the enhancer element. This complex includes the AP-2 like B segment trans-activating factor polypeptide, Sp1, and the C segment-specific polypeptide. It also includes other binding factors that may interact with genomic DNA sequences present on the approximately 7 kb DNA upstream of the β3-AR start site.
  • A nucleic acid vector, such as a plasmid, containing these sites, or combinations of A and C or B and C, in proximity to each other and upstream a distance of about 0 to about 10 kb from a promoter region operatively associated with a gene on an expression vector can increase the level of expression of the gene. Inclusion of the B segment confers tissue specificity: expression of the gene under control of the enhancer element only occurs in cells that have a transcription factor that binds to the core binding sequence of segment B. All three segments together (the enhancer element) synergistically increase expression levels of a gene operably associated with the enhancer element under appropriate expression conditions (i.e., when the B segment binding protein is present in the cell). The three segments can be oriented in either orientation in the 5′ flanking region of a gene. Thus, in one embodiment, the segments are arranged in A-B-C order on the coding strand relative to the translation start site. In another embodiment, the segments are arranged in A-B-C order on the non-coding strand (and thus in [-C]-[-B]-[-A] order on the coding strand, where [-C] is the complement of the C segment, [-B] is the complement of the B segment, and [-A] is the complement of the A segment). Preferably, to ensure proper positioning to allow interaction between binding factors, and to reveal, to the extent possible, activation and binding domains after conformational changes, the three segments are arranged in A-B-C order, with the relative spacing between each segment found, e.g., in SEQ ID NO:3. [0031]
  • As used herein, the term “proximity” when applied to the protein binding segments of the enhancer element means that the sites are located in a range from 1 to about 100 nucleotides from each other, and preferably, from about 10 to about 30 nucleotides from each other. In specific embodiments, segment A is located about 14 nucleotides upstream of segment B, and segment B is located about 31 nucleotides upstream of segment C. [0032]
  • In a specific embodiment, exemplified infra, the enhancer element is found in a nucleic acid (genomic DNA) isolated from a region about 7 kb upstream (−7 kb) of the β[0033] 3-adrenergic receptor (β3-AR) transcription initiation (start) site. More specifically, the enhancer element can be located between −6.5 kb and −6.3 kb of the translation start site of the gene. In particular, a 200 bp region of the 5′ flanking region of β3-AR demonstrates the enhancer activity. In other embodiments, exemplified infra, location of the enhancer adjacent to 500 bp of the translation start site of the gene, and in locations between −7 kb and −0.5 kb, results in positive regulation of gene expression. The enhancer element operates with a heterologous promoter. In a specific embodiment, the enhancer element regulates gene expression from a herpes simplex virus (HSV) thymidine kinase (tk) minimal promoter. In another embodiment, the enhancer element operates more efficiently in conjunction with a β3-AR promoter (found −0.5 kb from translation start site).
  • As used herein, the term “about” or “approximately” means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. [0034]
  • As used herein, the term “isolated” means that the referenced material is free of components found in the natural environment in which the material is normally found. In particular, isolated biological material is free of cellular components. In the case of nucleic acid molecules, an isolated nucleic acid includes a PCR product, an isolated MRNA, a cDNA, or a restriction fragment. In another embodiment, an isolated nucleic acid is preferably excised from the chromosome in which it may be found, and more preferably is no longer joined to non-regulatory, non-coding regions, or to other genes, located upstream or downstream of the gene contained by the isolated nucleic acid molecule when found in the chromosome. In yet another embodiment, the isolated nucleic acid lacks one or more introns. Isolated nucleic acid molecules can be inserted into plasmids, cosmids, artificial chromosomes, and the like. Thus, in a specific embodiment, a recombinant nucleic acid is an isolated nucleic acid. An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein. An isolated organelle, cell, or tissue is removed from the anatomical site in which it is found in an organism. An isolated material may be, but need not be, purified. [0035]
  • The term “purified” as used herein refers to material that has been isolated under conditions that reduce or eliminate unrelated materials, i.e., contaminants. For example, a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell; a purified nucleic acid molecule is preferably substantially free of proteins or other unrelated nucleic acid molecules with which it can be found within a cell. As used herein, the term “substantially free” is used operationally, in the context of analytical testing of the material. Preferably, purified material substantially free of contaminants is at least 50% pure; more preferably, at least 90% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art. [0036]
  • Vector Constructs
  • The protein binding segments identified herein can be used in recombinant construction of expression vectors with positive regulation of gene expression. As noted above, the A and C or B and C segments can be used together to achieve positive regulation of gene expression. Furthermore, use of all three segments synergistically enhances gene expression. Accordingly, as used herein, use of a regulatory element of the present invention in a recombinant expression vector relates to any of the foregoing combinations, unless a specific combination is explicitly stated. [0037]
  • In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, [0038] Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (herein “Sambrook et al., 1989”); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization [B. D. Hames & S. J. Higgins eds. (1985)]; Transcription And Translation [B. D. Hames & S. J. Higgins, eds. (1984)]; Animal Cell Culture [R. I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F. M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
  • Therefore, if appearing herein, the following terms shall have the definitions set out below. [0039]
  • A “vector” is a recombinant nucleic acid construct, such as plasmid, phage genome, virus genome, cosmid, or artificial chromosome to which another DNA segment may be attached. In a specific embodiment, the vector may bring about the replication of the attached segment, e.g., in the case of a cloning vector. A “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., it is capable of replication under its own control. [0040]
  • A “cassette” refers to a segment of DNA that can be inserted into a vector at specific restriction sites. The segment of DNA that can be inserted encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation. [0041]
  • A cell has been “transfected” by exogenous or heterologous DNA when such DNA has been introduced inside the cell. A cell has been “transformed” by exogenous or heterologous DNA when transfected DNA is expressed. [0042]
  • The term “heterologous” refers to a combination of elements not naturally occurring. For example, heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell. Preferably, the heterologous DNA includes a gene foreign to the cell. A heterologous expression regulatory element is such an element operatively associated with a different gene than the one it is operatively associated with in nature. For example, a regulatory element of the invention is operatively associated with a heterologous gene when the gene is not a gene encoding human β[0043] 3-AR.
  • A “nucleic acid molecule” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA:DNA, DNA:RNA and RNA:RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A “recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation. [0044]
  • A “gene” is used herein to refer to a portion of a DNA molecule that includes a polypeptide coding sequence operatively associated with expression control sequences. In one embodiment, a gene can be a genomic or partial genomic sequence, in that it contains one or more introns. In another embodiment, the term gene refers to a cDNA molecule (i.e., the coding sequence lacking any introns). [0045]
  • A DNA “coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic niRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding sequence. [0046]
  • “Expression control sequences”, e.g., transcriptional and translational control sequences, are regulatory sequences that flank a coding sequence, such as promoters, enhancers, suppressors, terminators, and the like, that provide for the expression of a coding sequence in a host cell. In eukaryotic cells, polyadenylation signals are control sequences. On mRNA, a ribosome binding site is an expression control sequence. [0047]
  • A coding sequence is “operatively associated with” or “under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into MRNA, which is then trans-RNA spliced and translated into the protein encoded by the coding sequence. [0048]
  • A “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In a specific embodiment, the β[0049] 3-AR promoter extends about 0.5 Kb 5′ to the translation start site.
  • A nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., supra). The conditions of temperature and ionic strength determine the “stringency” of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a T[0050] m of 55° C., can be used, e.g., 5×SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5×SSC, 0.5% SDS. Moderate stringency hybridization conditions correspond to a higher Tm, e.g., 40% formamide, with 5× or 6×SSC. High stringency hybridization conditions correspond to the highest Tm, e.g., 50% formamide, 0.1×SSC. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-0.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8). A minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.
  • In a specific embodiment, the term “standard hybridization conditions” refers to a T[0051] m of 55 ° C., and utilizes conditions as set forth above. In a preferred embodiment, the Tm is 60° C.; in a more preferred embodiment, the Tm is 65 ° C. In a specific embodiment, “high stringency” refers to hybridization and/or washing conditions at 68° C. in 0.2×SSC, at 42° C. in 50% formamide, 4×SSC, or under conditions that afford levels of hybridization equivalent to those observed under either of these two conditions.
  • As used herein, the term “oligonucleotide” refers to a nucleic acid, generally of at least 10, preferably at least about 15, and more preferably at least about 20 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a regulatory or protein binding segment, a gene, mRNA, cDNA, or other nucleic acid of interest. Oligonucleotides can be labeled, e.g., with [0052] 32P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. In one embodiment, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid. In another embodiment, oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of the enhancer element, or to detect the presence of nucleic acids encoding the enhancer element. In a further embodiment, an oligonucleotide of the invention can form a triple helix with a DNA molecule containing one or more of the segments found in the enhancer element, e.g., to suppress positive regulation of the enhancer. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.
  • “Homologous recombination” refers to the insertion of a foreign DNA sequence of a vector in a chromosome. Preferably, the vector targets a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination. [0053]
  • As used herein, the term “homologous” in all its grammatical forms and spelling variations refers to the relationship between proteins that possess a “common evolutionary origin,” including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc.) (Reeck et al., Cell 50:667, 1987). Such proteins (and their encoding genes) have sequence homology, as reflected by their high degree of sequence similarity. [0054]
  • Accordingly, the term “sequence similarity” in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., supra). However, in common usage and in the instant application, the term “homologous,” particularly when modified with an adverb such as “highly,” may refer to sequence similarity, which may or may not relate to a common evolutionary origin. [0055]
  • In a specific embodiment, two DNA sequences are “substantially homologous” or “substantially similar” when at least about 80% (preferably at least about 90%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra. [0056]
  • The term “corresponding to” is used herein to refer to similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured. A nucleic acid or amino acid sequence alignment may include spaces. Thus, the term “corresponding to” refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases. [0057]
  • A nucleic acid comprising one or more of segments A, B, and C, including an enhancer element (comprising all three segments in proximity), can be isolated from any source, particularly from a human genomic library. Methods for obtaining such nucleic acids are well known in the art, as described above (see, e.g., Sambrook et al., 1989, supra). Accordingly, any human cell potentially can serve as the nucleic acid source for the molecular cloning of a regulatory element. The DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA “library”). [0058]
  • Once the DNA fragments are generated, identification of the specific DNA fragment containing the desired regulatory activity may be accomplished in a number of ways. For example, as shown in the Examples, regulation of expression of a reporter gene, such as luciferase, can establish that the regulatory element or elements have been obtained. Alternatively, oligonucleotide probes or primers can be used to detect the presence of a nucleic acid encoding the regulatory region. As noted above, the greater the degree of sequence similarity, the more stringent hybridization conditions can be used. [0059]
  • The present invention also relates to cloning or using recombinant means to prepare vectors containing genes encoding analogs and derivatives of the regulatory segments of the invention, that have the same or homologous functional activity as the segments, and homologs thereof from other species. Also contemplated, and specifically exemplified herein, are derivatives or analogs of the regulatory segments that do not bind to the specific proteins. Such “non-functional” derivatives or analogs can be used to evaluate the characteristics of the DNA binding proteins that recognize the regulatory segments of the invention. The production and use of derivatives and analogs are within the scope of the present invention. [0060]
  • Nucleic acids encoding derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level. For example, the cloned regulatory segment can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. Additionally, the regulatory segment can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C., et al., J. Biol. Chem. 253:6551, 1978 ; Zoller and Smith, DNA 3:479-488, 1984; Oliphant et al., Gene 44:177, 1986; Hutchinson et al., Proc. Natl. Acad. Sci. U.S.A. 83:710, 1986), use of TAB™ linkers (Pharmacia), etc. PCR techniques are preferred for site directed mutagenesis (see Higuchi, “Using PCR to Engineer DNA”, in [0061] PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, 1989, Chapter 6, pp. 61-70).
  • A regulatory element of the invention can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of a protein-coding sequence. Thus, the regulatory element of the invention is operatively associated with a gene in an expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under control of such regulatory sequences. An expression vector also preferably includes a replication origin. [0062]
  • Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. [0063]
  • A recombinant gene may be expressed chromosomally under control of a regulatory element of the invention after integration of the coding sequence by recombination. In this regard, any of a number of amplification systems may be used to achieve high levels of stable gene expression (See Sambrook et al., 1989, supra). [0064]
  • Any of the methods for the insertion of DNA fragments into a cloning vector may be used to construct expression vectors. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombination (genetic recombination). [0065]
  • Expression of a protein under control of a regulatory element of the invention may be controlled by any promoter known in the art, so long as the promoter is functional in the host selected for expression. Promoters which may be used to control gene expression include, but are not limited to, the cytomegalovirus immediate early (CMV) promoter, the SV40 early promoter region (Benoist and Chambon, Nature 290:304-310, 1981), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto, et al., Cell 22:787-797, 1980), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445, 1981), and the regulatory sequences of the metallothionein gene (Brinster et al., Nature 296:39-42, 1982). In specific embodiments, the regulatory element of the invention is operably associated with an HSVtk promoter and with a β[0066] 3-AR promoter. In a preferred embodiment, a heterologous gene is expressed under control of a β3-AR promoter.
  • Vectors are introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (liposome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990). [0067]
  • Gene Therapy and Transgenic Vectors
  • As discussed above, a vector is any means for the transfer of a nucleic acid according to the invention into a host cell. The regulatory elements of the present invention, which permit positive, tissue-specific expression control, are useful in conjunction with delivery of a therapeutic gene in vivo or ex vivo, e.g., gene therapy. Such vectors can be viral vectors, such as retroviruses, herpes viruses, adenoviruses and adeno-associated viruses, or non-viral vectors. [0068]
  • Viral vectors commonly used for in vivo or ex vivo targeting and therapy procedures are DNA-based vectors and retroviral vectors. Methods for constructing and using viral vectors are known in the art (see, e.g., Miller and Rosman, [0069] BioTechniques 7:980-990, 1992). Preferably, the viral vectors are replication defective, that is, they are unable to replicate autonomously in the target cell. In general, the genome of the replication defective viral vectors used within the scope of the present invention lack at least one region which is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution (by other sequences, in particular by the inserted nucleic acid), partial deletion, or addition of one or more bases to an essential (for replication) region. Such techniques may be performed in vitro (on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents. Preferably, the replication defective virus retains the sequences of its genome which are necessary for encapsidating the viral particles.
  • DNA viral vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses, which entirely or almost entirely lack viral genes, are preferred. Defective virus is not infective after introduction into a cell. Thus, a specific tissue can be specifically targeted. Examples of particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci. 2:320-330, 1991), defective herpes virus vector lacking a glyco-protein L gene (Patent Publication RD 371005 A), or other defective herpes virus vectors (International Patent Publication No. WO 94/21807, published Sep. 29, 1994; International Patent Publication No. WO 92/05263, published Apr. 2, 1994); an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. (J. Clin. Invest. 90:626-630, 1992; see also La Salle et al., Science 259:988-990, 1993); and a defective adeno-associated virus vector (Samulski et al., J. Virol. 61:3096-3101, 1987; Samulski et al., J. Virol. 63:3822-3828, 1989; Lebkowski et al., Mol. Cell. Biol. 8:3988-3996, 1988). [0070]
  • Adenovirus vectors. Adenoviruses are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid of the invention to a variety of cell types. Various serotypes of adenovirus exist. Of these serotypes, [0071] type 2 or type 5 human adenoviruses (Ad 2 or Ad 5) or adenoviruses of animal origin (see WO94/26914) are most commonly used. Those adenoviruses of animal origin which can be used within the scope of the present invention include adenoviruses of canine, bovine, murine (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine, avian, and simian (example: SAV) origin. Preferably, the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus (e.g. Manhattan or A26/61 strain (ATCC VR-800), for example).
  • Preferably, the replication defective adenoviral vectors of the invention comprise the inverted terminal repeats (ITRs), an encapsidation sequence and the nucleic acid of interest. Still more preferably, at least the E1 region of the adenoviral vector is non-functional. The deletion in the E1 region preferably extends from nucleotides 455 to 3329 in the sequence of the Ad5 adenovirus (PvuII-BgIII fragment) or 382 to 3446 (HinfII-Sau3A fragment). Other regions may also be modified, in particular the E3 region (WO95/02697), the E2 region (WO94/28938), the E4 region (WO94/28152, WO94/12649, WO95/02697 and WO96/22378), or in any of the late genes L1-L5. [0072]
  • The replication defective recombinant adenoviruses according to the invention can be prepared by any technique known to the person skilled in the art (Levrero et al., Gene 101 (1991) 195, EP 185 573; Graham, EMBO J. 3 (1984) 2917). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid which carries, inter alia, the DNA sequence of interest. The homologous recombination is effected following cotransfection of the adenovirus and plasmid into an appropriate cell line. The cell line which is employed should preferably (i) be transformable by the elements, and (ii) contain the sequences which are able to complement the part of the genome of the replication defective adenovirus, preferably in integrated form in order to avoid the risks of recombination. Examples of cell lines which may be used are the human embryonic kidney cell line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which contains the left-hand portion of the genome of an Ad5 adenovirus (12%) integrated into its genome, and cell lines which are able to complement the E1 and E4 functions, as described in applications WO94/26914 and WO95/02697. Recombinant adenoviruses are recovered and purified using standard molecular biological techniques, which are well known to one of ordinary skill in the art. [0073]
  • Adeno-associated viruses. The adeno-associated viruses (AAV) are DNA viruses of relatively small size which can integrate, in a stable and site-specific manner, into the genome of the cells which they infect. They are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies. The AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus. The remainder of the genome is divided into two essential regions which carry the encapsidation functions: the left-hand part of the genome, which contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, which contains the cap gene encoding the capsid proteins of the virus. The use of vectors derived from the AAVs for transferring genes in vitro and in vivo has been described (see WO 91/18088; WO 93/09239; U.S. Pat. Nos. 4,797,368, 5,139,941, EP 488 528). [0074]
  • Retrovirus vectors. In another embodiment the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Pat. No. 5,399,346; Mann et al., 1983, Cell 33:153; Temin et al., U.S. Pat. No. 4,650,764; Temin et al., U.S. Pat. No. 4,980,289; Markowitz et al., 1988, J. Virol. 62:1120; Temin et al., U.S. Pat. No. 5,124,263; EP 453242, EP178220; Bernstein et al. Genet. Eng. 7:235, 1985; McCormick, BioTechnology 3:689, 1985; International Patent Publication No. WO 95/07358, published Mar. 16, 1995, by Dougherty et al.; and Kuo et al., 1993, Blood 82:845. These vectors can be constructed from different types of retrovirus, such as, HIV, MoMuLV (“murine Moloney leukaemia virus” MSV (“murine Moloney sarcoma virus”), HaSV (“Harvey sarcoma virus”); SNV (“spleen necrosis virus”); RSV (“Rous sarcoma virus”) and Friend virus. Defective retroviral vectors are disclosed in WO95/02697. Packaging cell lines for preparation of retroviral vectors have been described in the prior art, in particular the cell line PA317 (U.S. Pat. No. 4,861,719); the PsiCRIP cell line (WO90/02806) and the GP+envAm-12 cell line (WO89/07150). In addition, the recombinant retroviral vectors can contain modifications within the long terminal repeats (LTRs) for suppressing transcriptional activity as well as extensive encapsidation sequences which may include a part of the gag gene (Bender et al., J. Virol. 61:1639, 1987). Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art. [0075]
  • Non-viral vectors. Alternatively, the vector can be introduced in vivo as naked DNA, or with a DNA transfer facilitating agent, such as a lipid. [0076]
  • For example, one method for transfer of a nucleic acid vector is by lipofection. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Felgner, et. al., Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417, 1987; see Mackey, et al., Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031, 1988; Ulmer et al., Science 259:1745-1748, 1993). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Felgner and Ringold, Science 337:387-388, 1989). Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO95/18863 and WO96/17823, and in U.S. Pat. No. 5,459,127. The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey, et. al., supra). Targeted peptides, e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically. [0077]
  • Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., International Patent Publication WO95/21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO96/25508), or a cationic polymer (e.g., International Patent Publication WO95/2193 1). [0078]
  • It is also possible to introduce the vector in vivo as a naked DNA plasmid. Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wu et al., J. Biol. Chem. 267:963-967, 1992; Wu and Wu, J. Biol. Chem. 263:14621-14624, 1988; Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990; Williams et al., Proc. Natl. Acad. Sci. USA 88:2726-2730, 1991). Receptor-mediated DNA delivery approaches can also be used (Curiel et al., Hum. Gene Ther. 3:147-154, 1992; Wu and Wu, J. Biol. Chem. 262:4429-4432, 1987). [0079]
  • Screening Assays
  • Identification and isolation of the regulatory elements of the invention provides for development of screening assays, particularly for high throughput screening of molecules that up- or down-regulate the activity of the regulatory element of the invention. In one embodiment, control of the regulatory element can be effected by increasing or decreasing the activity of a trans-acting factor (preferably the B-segment-binding trans-acting factor) of the invention. Alternatively, the factor can act directly by interacting with the sequences of the regulatory segments or region. [0080]
  • Molecules that increase the activity of the regulatory element of the invention, and thus increase the level of expression of endogenous β[0081] 3-AR, would be useful in combination with a β3-AR-specific agonist for the treatment of obesity and diabetes, particularly non-insulin dependent diabetes mellitus (NIDDM). In particular, an agent that induces expression of the B-segment-specific trans-acting factor discovered herein would be useful for inducing β3-AR expression in a desired tissue, such as a WAT cell or an undifferentiated adipocyte (so as to push it to differentiation into a BAT cell), so as to render it sensitive to a β3-AR agonist. In addition, such agents may be useful in combination with a β3-AR agonist for treating urinary incontinence and to suppress ureteral colic; in the facilitation of stone discharge in urolithiasis patients; and in the treatment of depression (at least one β3-AR agonist having been shown to have anti-depressant activity).
  • Any mammalian cell can be used to screen for molecules that increase or decrease the activity of a β[0082] 3-AR trans-activating factor. Preferably the cells express or have the potential to express the β3-AR trans-activating factor, such as BAT (including HIB) or SK-N-MC cells. BAT and SK-N-MC cells have been discussed. The HIB 1B cell line was derived from brown adipose tissue (BAT) tumor isolated from transgenic mice (Ross et al., PNAS, 89:7561-7565, 1992). This cell line represents the first established brown adipocytes cell line capable of expressing uncoupling protein 1 (UCP-1). UCP-1 is a mitochondrial protein expressed exclusively in BAT. UCP-1 mRNA is detectable after stimulation of β-adrenergic receptor system that is present in these cells (β1-and β2-AR, 60-70%, and β3-AR, 30-40%) (Klaus et al., J. Cell. Sci., 107:313-319, 1994). The HIB 1B cells are maintained in DMEM:F12 (1:1) in the presence of 10% FCS. When they reach confluency, cells are induced to differentiate (i.e., to show UCP-1 expression and accumulation of lipid droplets). Differentiation is achieved by adding 5% FBS in addition to T3 and insulin, to the medium. Seven days after confluency in the presence of T3 and insulin, 90-95% of the cells are differentiated.
  • Any screening technique known in the art can be used to screen for compounds that up- or down-regulate the activity of the regulatory region of the invention. As used herein, the term “compound” refers to any molecule or complex of more than one molecule that affects the regulatory region. The present invention contemplates screens for synthetic small molecule agents, chemical compounds, chemical complexes, and salts thereof as well as screens for natural products, such as plant extracts or materials obtained from fermentation broths. Other molecules that can be identified using the screens of the invention include proteins and peptide fragments, peptides, nucleic acids and oligonucleotides (particularly triple-helix-forming oligonucleotides), carbohydrates, phospholipids and other lipid derivatives, steroids and steroid derivatives, prostaglandins and related arachadonic acid derivatives, etc. [0083]
  • Knowledge of the primary sequence of the regulatory region, and particularly the regulatory segments, permits development of DNA binding molecules, including triple-helix forming oligonucleotides, that can be used to interfere with transcription factor binding to the regulatory region, and thus inhibit or block positive gene regulation mediated by the region. [0084]
  • Various approaches can be used to identify small molecules for testing. One approach uses primarily chemical methods, of which the Geysen method (Geysen et al., Molecular Immunology 23:709-715, 1986; Geysen et al., J. Immunologic Method 102:259-274, 1987) and the method of Fodor et al. Science 251:767-773, 1991) are examples. Furka et al. (14th International Congress of Biochemistry, [0085] Volume 5, Abstract FR:013, 1988; Furka, Int. J. Peptide Protein Res. 37:487-493, 1991), Houghton (U.S. Pat. No. 4,631,211, issued Dec. 1986) and Rutter et al. (U.S. Pat. No. 5,010,175, issued Apr. 23, 1991) describe methods to produce a mixture of peptides that can be tested as agonists or antagonists.
  • In another aspect, synthetic libraries (Needels et al., Proc. Natl. Acad. Sci. USA 90:10700-4, 1993); Ohlmeyer et al., Proc. Natl. Acad. Sci. USA 90:10922-10926, 1993); Lam et al., International Patent Publication No. WO 92/00252; Kocis et al., International Patent Publication No. WO 9428028) and the like can be used to screen for agents according to the present invention. [0086]
  • Reporter Gene Assays
  • The screening can be performed with recombinant cells that express a reporter gene under control of the regulatory region of the invention, particularly the enhancer region. For example, in an example, infra, luciferase (a reporter gene) is placed under control of the enhancer region for detecting enhancement of reporter gene expression. [0087]
  • In one embodiment, a reporter gene assay can be used to detect increased expression of a gene under control of the β[0088] 3-AR enhancer element in a cell that does not normally express or expresses at very low levels β3-AR relative to β3-AR-expressing cells. Such cells include WAT cells (including perirenal cells), muscle cells, liver cells and HeLa and CV-1 cells. In a specific embodiment, mouse WAT, muscle, and liver cells did not express the B segment trans-activating factor. These cells, recombinantly engineered with a reporter gene under control of the enhancer region, can be used to screen for molecules that induce trans-activating factor activity.
  • In another embodiment, increased levels of expression of the B segment binding trans-activating factor can be detected in cells that express β[0089] 3-AR, including but not limited to BAT cells (including HIB cells, which is a BAT-derived cell line), and human neuroblastoma cells. In both cases, an increase in the level of expression of the reporter gene, relative to the level of expression in the absence of a test compound, indicates that the test compound has a positive influence on regulation of expression under control of the regulatory element of the invention.
  • Alternatively, a reporter gene assay can be used to test inhibitors of the regulatory region. Such reporter gene assays are most conveniently performed on cells that constitutively express high levels of a reporter gene operatively associated with the regulatory element. A reduction in the level of expression of the reporter gene in the presence of a test compound, relative to the level of expression in the absence of the test compound, indicates that the test compound inhibits expression control by the regulatory element. [0090]
  • Reporter genes for use in the invention encode detectable proteins, including, but are by no means limited to, chloramphenicol transferase (CAT), β-galactosidase (β-gal), luciferase, green fluorescent protein, alkaline phosphatase, and other genes that can be detected, e.g., immunologically (by antibody assay). [0091]
  • Direct Assays for B Segment Binding Trans-Activating Factor Activity
  • As an alternative or an adjunct to the reporter gene assays described above, the present invention permits directly assessing the level of expression of the B segment binding trans-activating protein by detecting the amount of this protein associated with a nucleic acid containing the B segment core binding sequence. Such assays include gel shift assays, solid phase binding assays, and the like. [0092]
  • For such assays, preferably either the nucleic acid (such as an oligonucleotide) containing the B segment sequence, or the protein, or both, are detectably labeled so that any binding of the two can be detected. Such labels include enzymes, such as alkaline phosphatase and horseradish peroxidase; colored latex beads; magnetic beads; fluorescent labels, e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated lanthanide series salts, especially Eu[0093] 3+, to name a few fluorophores; fluorescence transfer pairs; chemiluminescent molecules; radioisotopes; or magnetic resonance imaging labels. In a specific embodiment, the oligonucleotide is radiolabeled.
  • Isolation and Characterization of the B Segment Trans-Activating Factor
  • A significant and unexpected discovery of the present invention is the identification and characterization of a novel AP-2-like transcription factor, the B-segment binding trans-activating factor. This factor binds to DNA having the sequence GCCTCTGGGGAG (SEQ ID NO:1), and is expressed, inter alia, by mouse brown adipose tissue cells and the human neuroblastoma cell line SK-N-MC; it is also expressed at very low levels in perirenal white adipose tissue (and perhaps not at all in pure white adipose tissue cells), and an AP-2 oligonucleotide does not compete with the B segment sequence for binding to this factor. Furthermore, the factor is not recognized by an anti-AP-2 antibody. Although the presence and characteristics that permit unambiguous identification of this factor are set forth herein, the invention advantageously permits further evaluation and characterization, including elucidation of the sequence of the gene encoding the factor, and accordingly deduction of the complete amino acid sequence. [0094]
  • The transcription factor AP-2 was first isolated from HeLa cells by affinity chromatography and subsequently cloned by screening a HeLa genomic library. AP-2 is a 52 kDa protein which gene was mapped to a region on [0095] chromosome 6. The DNA binding domain within AP-2 transcription factor is located in C-terminal half of protein and consists of two putative amphipathic alpha helices separated by a large spanning region. The N-terminal domain of AP-2 protein contains a trans-activation domain with a proline-rich region. AP-2 transcription factor binds to a consensus binding site −5′-GCCNNNGGC-3′ (SEQ ID NO:4) that is found in numerous viral and cellular promoters. Activity of AP-2 is regulated by different agents. Phorbol-ester and agents that lead to an increase of cAMP induces AP-2 activity independently of protein synthesis (Buttner et al., Mol. Cell. Biology, 13:4174-4185, 1993; Bauer et al., Nucleic Acid Research, 22:1413-1420, 1994.)
  • Various means can be used to isolate the B segment binding factor protein or gene, including a yeast one-hybrid assay in a system recombinantly engineered to express polypeptides from cells that express the β[0096] 3-AR. Such cells include BAT cells (including HIB cells), and human neuroblastoma cells, such as SK-N-MC cells. The yeast one hybrid system was described by Fields and Song (Nature, 340:245-247, 1989). Numerous laboratories have used this system to successfully clone unknown transcription factors that bind for identified DNA binding sites (e.g., Wu et al., EMBO J., 13:4823-4830, 1994). The yeast-one hybrid system provides the tool for isolation of novel genes that encode the proteins that bind to a target: cis-acting regulatory DNA elements. The one-hybrid assay is based on the interaction between a target-specific DNA-binding domain and a target-independent activation domain (AD). The binding domain for target DNA is provided in a construct with the AD. If the binding protein that recognizes the target DNA is present in the cDNA library, its expression will allow binding to target DNA. Binding to the target DNA results in expression and binding of AD to transcriptional machinery of another vector to induce expression of a reporter gene.
  • Three copies of oligonucleotides that correspond to region B are synthesized, annealed and cloned into the Eco RI and the Mlu I sites of pHISi, pHISI-1 and pLacZi vectors (Clontech). B/pHISi and B/pHISi-1 clones are then stably transfected into the genome of yeast strain YM4271. The yeast cells are transformed according to established protocol using LiAc method and colonies selected by growth on SD-His plates. To confirm that the clones have stably integrated B/pHISi or B/pHISi-1 plasmids, colonies are picked and lysed, and PCR is performed using primers on each side of the insert flanking the NcoI site. PCR products that contain the proper size insert are considered positive. The B/pHISi/YM4271 stably integrated yeast cells are transformed with a mouse brown adipose tissue (BAT) library constructed into a pGAD10 vector (custom-made library by Clontech). Colonies are selected by growth on SD/-his/-leu plates supplemented with 30 mM 3-AT (3-amino-1,2,4-triazole). Larger colonies which grow up are streaked onto grid plates and a β-galactosidase assay is performed by colony lifts according to the manufacturer's protocol. PCR is performed on lysed yeast colonies using primers flanking the insert region of the pGAD10 vector. PCR products containing inserts are ligated using T-A cloning system into pCRII vector. Colonies that contain inserts are sequenced and subjected to BLAST search. [0097]
  • Screening of an expression library generated from SK-N-MC poly-A RNA with a radiolabeled segment “B” oligonucleotide is another strategy for cloning and isolation of the transcription factor that binds for “B” sequence. [0098]
  • Alternatively, a nucleic acid, and particularly a DNA oligonucleotide, comprising the B segment core binding sequence GCCTCTGGGGAG (SEQ ID NO:1) can be used to isolate the protein, e.g., by an affinity chromatography technique. Alternatively, such an oligonucleotide can be used to capture polysomes expressing the B segment binding factor, permitting isolation and reverse cloning of the B segment binding factor mRNA. [0099]
  • The present invention will be better understood by reference to the following Example. [0100]
  • DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • The Examples in this application are intended to be exemplary thereof, and are not intended to be limiting. [0101]
  • EXAMPLE 1 Isolation and Characterization of a β3-AR Enhancer
  • This example presents data that show the existence of hβ[0102] 3-AR cis-acting positive regulatory elements between −6.5 kb to−6.3 kb of the 5′-flanking region. These positive regulatory elements consist of three DNA binding sequences: A, B, and C that act synergistically. Region A binds Sp1 binding factor, region B is recognized by proteins (as yet unidentified) present in nuclear extracts from SK-N-MC cells as well as mouse BAT, and region C is represented by 20 repeats of a CCTT motif that is necessary to achieve full transcriptional activity of hβ3-AR enhancer.
  • Materials and Methods
  • Cloning of human β[0103] 3-AR genomic DNA. In order to isolate a 5′-flanking region of the hβ3-AR gene, a Human Fibroblast Genomic Library (Stratagene, LaJolla, Calif.) was screened using a 1.2 kb insert from cDNA for the hβ3-AR gene. cDNA was constructed by ligating four polymerase chain reaction (PCR) products using the following primers: an ATG-NarI fragment, sense primer 5′ CTTTCCCTACCGCCCCACGCGCGATC 3′ (SEQ ID NO:5) and anti-sense primer 5′ GTGGCGCCCAACGGCCAGTGGCCAGTC 3′ (SEQ ID NO:6); a NarI-AccI fragment, 5′ TTGGCGCTGACTGGCCACTGGCCGTTG 3′ (SEQ ID NO:7) as sense and 5′ GCGCGTAGACGAAGAGCATCACGAG 3′ (SEQ ID NO:8) as anti-sense primer; an AccI-Styl fragment, sense primer 5′ CTCGTGATGCTCTTCGTCTSCGCGC 3′ (SEQ ID NO:9) and anti-sense primer 5′ GTGAAGGTGCCCATGATGAGACCCAAGG 3′ (SEQ ID NO:10) and a Styl-TAG fragment, with sense primer 5′ CCCTGTGCACCTTGGGTCTCATCATGG 3′ (SEQ ID NO:11) and anti-sense primer 5′ CCTCTGCCCCGGTTACCTACCC 3′ (SEQ ID NO:12). The corresponding primer sequences were taken according to Emorine et al. (Science 245:1118-21).
  • The four fragments were ligated into a pUC 18 plasmid (Gibco-BRL) and sequenced. Using cDNA as a probe two genomic clones were isolated. In addition a PCR product representing a 1.3 kb hβ[0104] 3-AR promoter that was previously published (Liggett et al., J. DNA Sequencing and Mapping 2:61-63, 1991) was used to identify and map 7 kb of the hβ3-AR gene 5′-flanking region. This 7 kb promoter region was subcloned into pSP 72 (Promega, Madison, Wis.) between PstI and HindIII restriction enzyme sites and mapped extensively. The full length of the promoter was sequenced in both directions using automated sequencing with primers designed to “walk” along the sequence as further sequences were obtained.
  • 5′ RACE. To identifythe transcription start site ofthe hβ[0105] 3-AR gene, 5′ RACE was performed using SK-N-MC cell total RNA purified using RNAzol B (Tel-Test, Inc., Friendswood, Tex.). Poly A RNA was then purified using an Ambion Micropo(A) pure kit. The 5′ RACE was done using the Marathon cDNA amplification kit (Clonetech, Palo Alto, Calif.) according to the protocol provided with the kit. The primers used included: the sense adapter primer AP2 (Clonetech) 5′ ACTCACTATAGGGCTCGAGCGGC 3′ (SEQ ID NO:13) and antisense primer 5′ GGCAGCCCACTGGTGTTGGCGGTAT 3′ (SEQ ID NO:14) that corresponded to the hβ3-AR gene sequence at positions 729-703 as per the sequence from GenBank with accession # X72861 (positioned 81 base pairs in the 5′-3′ direction from the translation start site). The PCR products were then cloned into a pCRII vector using the TA cloning kit (Invitrogen, Carlsbad, Calif.). The clones were sequenced using the ABI 373 Automated Sequencer.
  • Human β[0106] 3-AR gene promoter deletion constructs. Serial deletions of the hβ3-AR gene 5′-flanking region were designed in order to identify the region(s) responsible for transcriptional regulation. A 7 kb sequence was subcloned into the KpnI/HindIII sites of a pGL3 basic vector (Promega) to obtain the full length promoter to drive expression of the reporter gene luciferase labeled here as −7 hβ3/Luc (KpnI is a part of a multiple cloning site from pSP72) pGL3 basic contains luciferase cDNA as a reporter gene and an upstream synthetic poly-A signal to reduce background. The deletion constructs labeled as −5.5hβ3/Luc, −3hβ3/Luc and 0.5hβ3/Luc were made by digestion with AvrII, EcoRV and BstEII, respectively and KpnI, blunt ended and re-ligated. The construct −.3hβ3/Luc was made by ligating a PCR product corresponding to a 1.3 kb region of the hβ3-AR gene promoter that has been previously published (Liggett and Schwina, supra). The PCR product was obtained using HeLa cell genomic DNA and the 5′ ggtaccTCTAGGTGGAAAGGTGCATG 3′ (SEQ ID NO:15) as sense and 5′ aagcttAGTCCCCTCCCTGTCGT 3′ (SEQ ID NO:16) as anti-sense primers (GenBank sequence with accession #M62473) was used when choosing the primers.
  • Constructs with deletions in the promoter region were made as follows: for the dEVhβ3AR/Luc parental vector −7hβ3AR/Luc was digested with Avr II (−5.6 kb) and EcoRV (−3.1 kb), blunt ended and re-ligated; for dEIhβ3AR/Luc, a deletion between Avr II and EcoRI (−2.3 kb) was made, and dBhβ3AR/Luc was made by digestion of the parental vector with Avr II and BstEII (−0.5 kb); sites of digestion were blunt ended and re-ligated. [0107]
  • To further analyze and more precisely identify the sequence located between −7 kb and −5.6 kb of the hβ[0108] 3-AR promoter that contains cis-regulatory elements, expression plasmids were generated containing PCR products made using a series of primers shown in Table 1.

Claims (3)

What is claimed is:
1. An isolated β3-AR trans-activating factor polypeptide, wherein said polypeptide has the following characteristics:
(a) it binds specifically to a nucleic acid having the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO: 1);
(b) it is expressed by brown adipose tissue cells;
(c) it is expressed at very low levels by cells isolated from the perirenal depot;
(d) an AP-2 binding nucleic acid does not compete with a nucleic acid comprising a nucleotide sequence GCCTCTGGGGAG (SEQ ID NO: 1) for binding the polypeptide; and,
(e) when complexed to a nucleic acid comprising SEQ ID NO: 1, it is not recognized by an antibody to AP-2.
2. A composition comprising an isolated β3-AR trans-activating factor polypeptide, wherein said polypeptide has the following characteristics:
(a) it binds specifically to a nucleic acid having the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO: 1);
(b) it is expressed by brown adipose tissue cells;
(c) it is expressed at very low levels by cells isolated from the perirenal depot;
(d) an AP-2 binding nucleic acid does not compete with a nucleic acid comprising a nucleotide sequence GCCTCTGGGGAG (SEQ ID NO: 1) for binding the polypeptide; and,
(e) when complexed to a nucleic acid comprising SEQ ID NO: 1, it is not recognized by an antibody to AP-2.
3. The composition of claim 2 further comprising an isolated nucleic acid having the nucleotide sequence GCCTCTGGGGAG (SEQ ID NO: 1).
US10/830,283 1999-02-01 2004-04-21 Transcriptional regulation of the human beta3-adrenergic receptor gene Abandoned US20040192607A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/830,283 US20040192607A1 (en) 1999-02-01 2004-04-21 Transcriptional regulation of the human beta3-adrenergic receptor gene
US11/624,841 US20070134735A1 (en) 1999-02-01 2007-01-19 Transcriptional regulation of the human beta3-adrenergic receptor gene

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US09/243,335 US6197580B1 (en) 1999-02-01 1999-02-01 Transcriptional regulation of the human β3-adrenergic receptor gene
US09/761,116 US6753140B2 (en) 1999-02-01 2001-01-16 Transcriptional regulation of the human β3-adrenergic receptor gene
US10/830,283 US20040192607A1 (en) 1999-02-01 2004-04-21 Transcriptional regulation of the human beta3-adrenergic receptor gene

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/761,116 Division US6753140B2 (en) 1999-02-01 2001-01-16 Transcriptional regulation of the human β3-adrenergic receptor gene

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/624,841 Continuation US20070134735A1 (en) 1999-02-01 2007-01-19 Transcriptional regulation of the human beta3-adrenergic receptor gene

Publications (1)

Publication Number Publication Date
US20040192607A1 true US20040192607A1 (en) 2004-09-30

Family

ID=22918347

Family Applications (4)

Application Number Title Priority Date Filing Date
US09/243,335 Expired - Fee Related US6197580B1 (en) 1999-02-01 1999-02-01 Transcriptional regulation of the human β3-adrenergic receptor gene
US09/761,116 Expired - Fee Related US6753140B2 (en) 1999-02-01 2001-01-16 Transcriptional regulation of the human β3-adrenergic receptor gene
US10/830,283 Abandoned US20040192607A1 (en) 1999-02-01 2004-04-21 Transcriptional regulation of the human beta3-adrenergic receptor gene
US11/624,841 Abandoned US20070134735A1 (en) 1999-02-01 2007-01-19 Transcriptional regulation of the human beta3-adrenergic receptor gene

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US09/243,335 Expired - Fee Related US6197580B1 (en) 1999-02-01 1999-02-01 Transcriptional regulation of the human β3-adrenergic receptor gene
US09/761,116 Expired - Fee Related US6753140B2 (en) 1999-02-01 2001-01-16 Transcriptional regulation of the human β3-adrenergic receptor gene

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/624,841 Abandoned US20070134735A1 (en) 1999-02-01 2007-01-19 Transcriptional regulation of the human beta3-adrenergic receptor gene

Country Status (8)

Country Link
US (4) US6197580B1 (en)
EP (1) EP1147191A1 (en)
JP (1) JP2002535005A (en)
AU (1) AU769132B2 (en)
CA (1) CA2360064A1 (en)
IL (1) IL144546A0 (en)
NZ (1) NZ513142A (en)
WO (1) WO2000044901A1 (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7981842B2 (en) 2001-06-08 2011-07-19 Panomics, Inc. Method for detecting transcription factor-protein interactions
US6924113B2 (en) 2001-06-08 2005-08-02 Panomics, Inc. Method and kit for isolating DNA probes that bind to activated transcription factors
US6821737B2 (en) 2001-06-08 2004-11-23 Panomics, Inc. Method for screening for drug candidates for modulating transcription factor activity
US20040214166A1 (en) * 2001-06-08 2004-10-28 Xianqiang Li Method for identifying a disease state based on a detected mixture of activated transcription factors
US6696256B1 (en) 2001-06-08 2004-02-24 Pandmics, Inc. Method, array and kit for detecting activated transcription factors by hybridization array
US8476227B2 (en) 2010-01-22 2013-07-02 Ethicon Endo-Surgery, Inc. Methods of activating a melanocortin-4 receptor pathway in obese subjects
US9044606B2 (en) 2010-01-22 2015-06-02 Ethicon Endo-Surgery, Inc. Methods and devices for activating brown adipose tissue using electrical energy
US10080884B2 (en) 2014-12-29 2018-09-25 Ethicon Llc Methods and devices for activating brown adipose tissue using electrical energy
US10092738B2 (en) 2014-12-29 2018-10-09 Ethicon Llc Methods and devices for inhibiting nerves when activating brown adipose tissue

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5364772A (en) * 1992-07-20 1994-11-15 Wayne State University DNA molecule encoding the β3 -adrenergic receptor
US5683912A (en) * 1994-07-21 1997-11-04 The Salk Institute For Biological Studies Cloning and expression of a novel acetylcholine-gated ion channel receptor subunit
US5789654A (en) * 1996-05-09 1998-08-04 Beth Israel Hospital Association Transgenic animals deficient in endogenous β3 -adrenergic receptor and uses thereof
US6414220B1 (en) * 1997-12-17 2002-07-02 The University Of Manitoba Galanin transgenic mice

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5364772A (en) * 1992-07-20 1994-11-15 Wayne State University DNA molecule encoding the β3 -adrenergic receptor
US5683912A (en) * 1994-07-21 1997-11-04 The Salk Institute For Biological Studies Cloning and expression of a novel acetylcholine-gated ion channel receptor subunit
US5789654A (en) * 1996-05-09 1998-08-04 Beth Israel Hospital Association Transgenic animals deficient in endogenous β3 -adrenergic receptor and uses thereof
US6414220B1 (en) * 1997-12-17 2002-07-02 The University Of Manitoba Galanin transgenic mice

Also Published As

Publication number Publication date
EP1147191A1 (en) 2001-10-24
IL144546A0 (en) 2002-05-23
US20020102552A1 (en) 2002-08-01
US20070134735A1 (en) 2007-06-14
US6197580B1 (en) 2001-03-06
CA2360064A1 (en) 2000-08-03
AU2750700A (en) 2000-08-18
US6753140B2 (en) 2004-06-22
AU769132B2 (en) 2004-01-15
JP2002535005A (en) 2002-10-22
NZ513142A (en) 2004-01-30
WO2000044901A1 (en) 2000-08-03

Similar Documents

Publication Publication Date Title
US20070134735A1 (en) Transcriptional regulation of the human beta3-adrenergic receptor gene
AU745296B2 (en) A tumor suppressor designated TS10Q23.3
US6075123A (en) Cyclin-C variants, and diagnostic and therapeutic uses thereof
Skerjanc et al. The E box is essential for activity of the cardiac actin promoter in skeletal but not in cardiac muscle
AU767010B2 (en) Isoforms of human calcium sensing receptor
US5972609A (en) Utrophin gene promotor
Fernández et al. The gene encoding human annexin V has a TATA-less promoter with a high G+ C content
US6586581B1 (en) Prolactin regulatory element binding protein and uses thereof
EP1332372B1 (en) Net, a transcription factor of the tcf family, as regulator of angiogenic factor expression
Bachman et al. The 5′ region of the COX4 gene contains a novel overlapping gene, NOC4
Aho et al. Human periplakin: genomic organization in a clonally unstable region of chromosome 16p with an abundance of repetitive sequence elements
US8642739B2 (en) Nuclear factor κB inducing factor
JP2004531241A (en) Human ABCC11 gene nucleic acids, vectors containing such nucleic acids, and uses thereof
JP4548938B2 (en) MEKK1 (serine threonine kinase) interacting FHA (forkhead binding domain) protein 1 (MIF1)
US6197947B1 (en) Translation initiation factor 4AIII and methods of use thereof
JP2002542826A (en) Variants of TRAF2 that act as inhibitors of tumor necrosis factor α (TNF-α) signaling pathway
US20030152963A1 (en) Human chromosome 15 and 16 bardet-biedl syndrome polynucleotides and polypeptides and methods of use
Li et al. Molecular cloning and characterization of AAAS-V2, a novel splice variant of human AAAS
US7332593B2 (en) Variants of TRAF2 which act as an inhibitor of TNF-alpha (TNFα) signaling pathway
JP2001510464A (en) "Basic helix loop helix" bHLH family polypeptides, corresponding nucleic acid sequences
EP1279733A1 (en) Nucleic acids and polypeptides involved in the predisposition to infection to human papilloma virus, to epidermodysplasia verruciformis and/or to psoriasis
Grossman et al. The 5′ region of the COX4 gene contains a novel overlapping gene, NOC4
NZ521786A (en) NFIF-14b and NFIF-7a (nuclear factor kappa B inducing factor) polypeptides and nulciec acids and their use in compositions for inhibiting inflammation
JP2000175684A (en) Gene encoding new acylitransferase
WO2000075670A1 (en) Interaction of b3-1 with adp-ribosylation factor gtp exchange factors

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION