US20040203026A1 - Biologically active bactericidal/permeability-increasing protein fragments - Google Patents

Biologically active bactericidal/permeability-increasing protein fragments Download PDF

Info

Publication number
US20040203026A1
US20040203026A1 US10/716,389 US71638903A US2004203026A1 US 20040203026 A1 US20040203026 A1 US 20040203026A1 US 71638903 A US71638903 A US 71638903A US 2004203026 A1 US2004203026 A1 US 2004203026A1
Authority
US
United States
Prior art keywords
bpi
leu
holoprotein
ser
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/716,389
Inventor
Peter Elsbach
Jerrold Weiss
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26770871&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20040203026(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Individual filed Critical Individual
Priority to US10/716,389 priority Critical patent/US20040203026A1/en
Publication of US20040203026A1 publication Critical patent/US20040203026A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4742Bactericidal/Permeability-increasing protein [BPI]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1751Bactericidal/permeability-increasing protein [BPI]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention pertains to biologically active, polypeptide fragments of mammalian bactericidal/permeability-increasing proteins and methods for making and using said fragments.
  • Bactericidal/permeability-increasing protein is a 50 to 60 Kd protein, isolated from the granules of mammalian polymorphonuclear leukocytes (PMN) which are blood cells that are essential in the defense against invading microorganisms in mammals. BPI occurs only in cells of the myeloid series of blood cells, is produced at the promyelocytic/myelocytic stage of differentiation and is located in the primary granules in these cells.
  • PMN mammalian polymorphonuclear leukocytes
  • BPI is a potent bactericidal agent active against a broad range of gram-negative bacterial species. It exhibits a high degree of specificity in its cytotoxic effect, i.e. 10-40 nM (0.5-2.0 micrograms), producing greater than 90% killing of 10 7 sensitive bacteria whereas 100-fold higher concentrations of BPI are non-toxic for other microorganisms and eukaryotic cells. All available evidence suggests that in the intact PMN and in crude leukocyte fractions, BPI is the principal oxygen-independent agent present which is active against BPI-sensitive bacteria.
  • BPI isolated from both human and rabbit PMN has been purified to homogeneity.
  • the molecular weight of human BPI is approximately 58,000 Daltons (58 kDa) and that of rabbit BPI is approximately 50 kDa.
  • the amino acid composition of these two proteins is closely similar as is the amino acid sequence of their first 15 NH 2 -terminal amino acid residues. Both proteins are highly basic, having an isoelectric point greater than 9.6.
  • BPI may be employed as a chemotherapeutic agent and/or as a model for the design of new antibiotic agents.
  • BPI due to its large molecular weight (58 kDa for the human holoprotein), both sequencing and determination of the structural organization of BPI have been hampered (hereinafter the entire BPI molecule is referred to as the holoprotein).
  • the holoprotein the entire BPI molecule is referred to as the holoprotein.
  • BPI has a structural organization where the different functions, namely binding, envelope-altering and killing reside in different domains within the BPI molecule.
  • BPI fragments obtained by digestion of the holoproteins with the proteolytic enzyme elastase, has been disclosed (Weiss. J. et al., Clin. Res 34: 537A, 1986), the fragments tested remained associated under the non-denaturing conditions employed. No biological activity was ascribed to any isolated fragments. Moreover, antibodies directed against the holoprotein did not recognize these fragments under denaturing conditions when analyzed using the well-known Western blotting procedure.
  • Another object of the present invention is to provide biologically active peptide fragments of mammalian BPI with improved antimicrobial effectiveness.
  • Yet another object of the present invention is to provide a process for the production of biologically active peptide fragments of mammalian BPI.
  • Yet another object of the present invention is to provide methods for treating mammals suffering from infections caused by gram-negative bacteria.
  • a further object of the present invention is to provide a method for increasing the permeability of gram-negative bacteria.
  • the present inventors have unexpectedly discovered biologically active fragments of mammalian BPI substantially shorter in length than the native BPI protein. Although these fragments are substantially smaller than the native molecule, they retain at least substantially all of the bactericidal and permeability-increasing properties of the intact protein.
  • the present invention provides a method for treating mammals suffering from infections caused by gram-negative bacteria comprising administering to mammals in need of such treatment a gram-negative bactericidal-effective amount of at least one of the above-mentioned biologically active BPI fragments.
  • the present invention provides pharmaceutical formulations for treating infections in mammals caused by gram negative bacteria comprising a gram-negative bactericidal-effective amount of at least one of the biologically active BPI fragments or pharmaceutically-acceptable salts thereof.
  • the present invention provides a method for increasing the permeability of gram-negative bacteria comprising incubating the bacteria with a gram-negative-bacterial-permeability-increasing-effective amount of a biologically active fragment of BPI.
  • the present invention provides a method for increasing the effectiveness of gram-negative bactericidal agents in mammals in need of such treatments, comprising co-administration of such agents with the biologically active fragments of BPI.
  • a still further aspect of the present invention is directed to a purified, isolated DNA sequence having the sequence set out in FIG. 5 or its complementary strand and DNA sequences hybridizing under stringent hybridization conditions with said DNA sequences.
  • the DNA sequence encodes the human bactericidal/permeability-increasing protein.
  • FIG. 1 is a photograph of a stained SDS-PAGE gel showing the production and purification of the human BPI fragment of a preferred embodiment of the present invention.
  • FIG. 2 is a graph showing the chromatographic behavior of the human BPI holoprotein (a) and human 25 kDa BPI fragment of the present invention (b) on reverse phase HPLC.
  • FIG. 3 is a series of graphs comparing the biological activities of the 25 kDa human BPI fragment of the present invention and the holoprotein toward E. coli J5.
  • A bactericidal activity
  • B effect on bacterial protein synthesis
  • C permeability increasing activity
  • D phospholipase activation.
  • FIG. 4 is a graph comparing the bactericidal effect of the 25 kDa human BPI fragment of the present invention and the holoprotein on E. coli 0111:B4.
  • FIG. 6 is an autoradiogram of a Northern blot analysis of human BPI mRNA.
  • FIG. 7 is an autoradiogram of a Southern blot analysis of human genomic DNA using a BPI CDNA probe.
  • the present inventors have unexpectedly discovered biologically active fragments of BPI isolated from mammalian PMN.
  • NH 2 -terminal amino acid sequence analysis demonstrated that, in the case of human BPI, the fragment represents a portion of the BPI molecule proximal to the NH 2 -terminus, as shown in Example 3 below.
  • the fragment possesses all of the antibacterial and membrane permeability-increasing functions contained in the complete molecule but is substantially smaller (i.e. has a lower molecular weight) than the holoprotein. “Substantially smaller” is defined herein as being up to about half the size of the holoprotein.
  • the BPI fragments of the present invention are as potent as the holoprotein against rough E. coli , more potent than the holoprotein against the generally more resistant, smooth E. coli (on a molar basis), and retain the specificity of the holoprotein towards gram-negative bacteria. This is a particularly important finding because smooth gram-negative bacteria (smoothness being due to the presence of longer LPS chains in the bacterial cell membrane) generally are more pathogenic than their corresponding rough counterparts.
  • Non-limiting examples of the BPI fragments of the present invention are approximately 25 kDa for human and rabbit BPI.
  • the human 25kDa fragment of the preferred embodiment of the present invention was initially isolated after long-term storage (e.g. two months) of the purified holoprotein in a weakly acidic buffer (10 mM ammonium acetate, pH4.6) and can be thus generated.
  • the BPI fragments of the present invention by incubating the holo-proteins in an acceptable buffer i.e., a buffer having sufficient buffering capacity at concentrations between about 10 and about 150 mM at a pH ranging between about 6.0 and about 8.0, such as Tris/HCl, phosphate, and preferably HEPES/NaOH (Sigma Chemicals, St. Louis, Mo.), or mixtures thereof.
  • a buffer having sufficient buffering capacity at concentrations between about 10 and about 150 mM at a pH ranging between about 6.0 and about 8.0, such as Tris/HCl, phosphate, and preferably HEPES/NaOH (Sigma Chemicals, St. Louis, Mo.), or mixtures thereof.
  • the preferred pH is 7.4.
  • the incubations may be performed for a period of time broadly ranging between about 16 and 24 hours and preferably 18 hours, at a temperature ranging between about 20° C. and about 37° C. and preferably 37° C.
  • a particularly preferred condition comprises incubation in 0.1M HEPES/NaOH buffer, pH 7.4 for 18 hours at 37° C. This has led to the conversion of about 50% of the holoprotein into the biologically active fragments of the present invention. Reincubation of the recovered holoprotein, under these conditions again result in formation of the 25 kDa fragment.
  • the BPI holoproteins used as starting materials for the production of the biologically active fragments of the present invention, can be obtained from mammalian cells of the myeloid series of blood cells, such as PMN.
  • the fragments of the present invention are not limited to a particular mammalian species, it is preferable to employ such fragments isolated from a homologous mammalian species when treating bacterial infections caused by gram-negative bacteria.
  • the BPI holoprotein and/or the biologically active fragments of the present invention may be obtained using recombinant DNA techniques employing the sequence information presented below in Example 3 to synthesize DNA probes for the detection of DNA sequences coding for BPI in complementary DNA or genomic libraries using methods well-known in the art.
  • the gene coding for the BPI holoprotein, or a portion of the gene coding for the 25 kDa fragment of the present invention (and possibly smaller biologically active fragments thereof) may be inserted into a suitable expression vector for the production of biologically active polypeptides.
  • human BPI holoprotein can be obtained from PMN isolated from normal blood or from blood from patients with chronic myelocytic leukemia, as detailed in Example 1 below.
  • human BPI can be extracted from the human leukemic cell line HL-60 (available as ATCC CCL 240, American Type Culture Collection, Rockville, Md.). The latter have been found to contain approximately 10 micrograms of BPI holoprotein per 10 8 cells. Mature PMN of either normal or leukemic origin contain approximately 60 micrograms per 10 8 cells of the BPI holoprotein and are therefore the preferred starting material.
  • the mammalian PMN can be fractionated using, for example, the procedures detailed below in Example 1 in order to obtain primary granules (or alternatively by extraction of whole cells with 0.16N sulfuric acid, as described in Elsbach. P. et al., J. Biol. Chem . 254:11000, 1979, incorporated by reference).
  • Such primary granules isolated from PMN or leukemic cell lines contain the bulk of BPI holoprotein activity.
  • the BPI holoprotein can then be extracted and purified using any technique known in the art which yields a biologically active BPI holoprotein.
  • the amounts of starting, purified, BPI holoprotein to be employed in practicing the present invention preferably should be at least 200 micrograms of purified holoprotein. Although it is possible to use smaller amounts of material, this may hamper the recovery of the biologically active fragments due to non-specific losses, as is true with many other biologically-active proteins, such as interferons.
  • the protein cleaving conditions necessary for the production of the biologically active BPI fragments of the present invention are broadly within the pH, temperature and time optima of such serine proteases, i.e. pH6.0-pH 8.0, 20° C.-37° C., 16-24 hours. Such incubation of the BPI holoprotein will produce cleavage at about 25 kDa from the NH 2 -terminus of the holoproteins.
  • the biologically active BPI fragments of the present invention can be utilized for the treatment of mammals suffering from diseases caused by gram-negative bacteria such as, bacteremia or sepsis. Due to its extraordinarivity and lack of cytotoxicity toward cells other than gram-negative bacteria, the BPI fragments of the present invention would be particularly useful as specific therapeutic agents.
  • gram-negative bacterial infections such as those caused by Escherichia coli
  • various species of Salmonella, Klebsiella or Pseudomonas are treated with antibiotics, such as penicillin derivatives, aminoglycosides and chloramphenicol.
  • the BPI fragments of the present invention are preferably administered parenterally, and most preferably intravenously in amounts broadly ranging between about 1 microgram and 1000 micrograms and preferably between 10 and about 250 micrograms per treatment.
  • the duration and number of treatments may vary from individual to individual, depending upon the severity of the illness.
  • a typical treatment regime may comprise intravenous administration of about 100 micrograms of the BPI fragments three times a day.
  • the BPI fragments of the present invention may be coupled with physiologically-acceptable carriers, such as normally occurring serum proteins (e.g. albumin or lysozyme).
  • physiologically-acceptable carriers such as normally occurring serum proteins (e.g. albumin or lysozyme).
  • the BPI fragments of the present invention could also be employed topically to treat mammals suffering from skin infections caused by susceptible gram-negative bacteria which occur on bedridden patients suffering from decubitus ulcers (bed sores) or in burn patients.
  • the BPI fragments may be administered in the same dosages and frequency as described for parenteral administration above.
  • the BPI fragments of the present invention can be incorporated in pharmaceutical formulations to be used to treat mammals suffering from gram-negative bacterial infections.
  • Pharmaceutical formulations comprising the BPI fragments of the present invention (or physiologically-acceptable salts thereof) as at least one of the active ingredients, would in addition comprise pharmaceutically-acceptable carriers, diluents, fillers, salts and other materials well-known in the art depending upon the dosage form utilized.
  • preferred parenteral dosage forms would comprise a sterile isotonic saline solution, and may comprise between about 1 microgram and 1000 micrograms of the BPI fragments of the present invention covalently coupled to suitable physiologically-acceptable carriers, such as normally occurring serum proteins, for example lysozyme or albumin, to prevent their inactivation.
  • suitable physiologically-acceptable carriers such as normally occurring serum proteins, for example lysozyme or albumin
  • suitable physiologically-acceptable carriers such as normally occurring serum proteins, for example lysozyme or albumin
  • suitable physiologically-acceptable carriers such as normally occurring serum proteins, for example lysozyme or albumin
  • the BPI fragments of the present invention in amounts ranging between 1 microgram and 1000 micrograms per dose, may be mixed with antibiotics and may be formulated in the same type of preparations used in antibiotic creams (such as Silvadene, Marion Laboratories, Kansas City, Mo., Terramycin, Pfipharmecs, New York, N.Y. or Achromycin, Lederle Laboratories, Pearle River, N.Y.) well-known in the art for topical administration.
  • antibiotic creams such as Silvadene, Marion Laboratories, Kansas City, Mo., Terramycin, Pfipharmecs, New York, N.Y. or Achromycin, Lederle Laboratories, Pearle River, N.Y.
  • pharmaceutical formulations for treating mammals suffering from gram-negative bacterial infections may contain the BPI fragments of the present invention in addition to standard amounts (well-known in the art) of antibiotics such as Penicillin-G (available from E.R. Squibb and Sons, Inc., Princeton, N.J.) or cephalosporins (available from Eli Lily & Co., Indianapolis, Ind.).
  • antibiotics such as Penicillin-G (available from E.R. Squibb and Sons, Inc., Princeton, N.J.) or cephalosporins (available from Eli Lily & Co., Indianapolis, Ind.).
  • the BPI fragments of the present invention may be mixed with hydrophobic antibiotics, such as rifampicin (available as RIFAMPIN, CIBA Pharmaceutical CO., Summit, N.J.), and hydrophobic penicillins such as Penicillin-V Benzathine (Lederle Labs, Pearl River, N.Y.).
  • hydrophobic antibiotics such as rifampicin (available as RIFAMPIN, CIBA Pharmaceutical CO., Summit, N.J.)
  • hydrophobic penicillins such as Penicillin-V Benzathine (Lederle Labs, Pearl River, N.Y.).
  • the BPI fragments of the present invention are expected to be ideally-suited for co-treatment using any antibiotic, immune system cells or factors such as T-cells or interleukin-2, cytotoxic agents or the like, effective against gram-negative bacteria. Because of the increased sensitivity to the fragments of the present invention of the more pathogenic, smooth, gram-negative bacteria, the BPI fragments of the present invention are expected to decrease resistance of such bacteria to such factors. Substantially simultaneous administration of the fragments of the present invention and the antibiotic of choice is preferred.
  • Example 4 An example of the above-mentioned embodiment is demonstrated in Example 4 below, wherein actinomycin D (which normally cannot enter and affect gram-negative bacteria due to its hydrophobic properties) significantly inhibited RNA and protein synthesis only in BPI-treated E. coli.
  • the present inventors have isolated the gene encoding the human BPI holoprotein and have identified and sequenced BPI cDNA isolated from human promyelocytic leukemia cells (HL-60). The nucleotide sequence of the cDNA and the corresponding amino acid sequence of the holoprotein are set out in FIG. 5.
  • sequence information contained in FIG. 5 can be employed to synthesize the 25 kDa, biologically active fragment of BPI.
  • a vector can be generated comprising DNA residues 123 to about 759-780 (or amino acid residues 1 to about 210-220) of FIG. 5 using techniques well-known in the art.
  • smaller sub-fragments of the cDNA of FIG. 5 can be generated using, for example, limited Ba131 nuclease digestion of the entire cDNA, to probe for the minimum sequences necessary for BPI biological activities mentioned above.
  • the BPI holoprotein can be obtained after synthesis by suitably transfected or transformed eukaryotic (mammalian or yeast) or prokaryotic cells and the biologically-active 25 kDa fragments mentioned above can be obtained using the techniques described in Example 2 below.
  • Human leukocytes were obtained from heparin-treated (100-200 U.S.P. units/10 ml) peripheral blood collected by venipuncture from healthy donors and patients with chronic myelocytic leukemia.
  • PMN's were isolated by the dextran-sedimentation procedure, followed by centrifugation in an Isopaque-Ficoll gradient (Pharmacia Fine Chemicals, Piscataway, N.J.) as described (Boyum, A. J., J. Clin. Lab . Invest. Suppl. 97: 77-89, 1968, incorporated by reference).
  • the leukocyte-rich plasma from healthy donors was first diluted with isotonic Krebs-ringer phosphate buffer (pH7.4) to a concentration of 10,000 to 20,000 cells/-microliter before layering on the Isopaque-Ficoll mixture. The cells were washed twice in Krebs-ringer phosphate before use.
  • leukocyte-rich plasma obtained by leukopheresis (using procedures well-known in the art) of 400 ml of venous blood, from a patient with chronic myelocytic leukemia, was sedimented directly at 1000 ⁇ g for five minutes yielding 3.5 ⁇ 10 10 leukocytes, essentially all of which were PMN. These cells were washed twice with Krebs-ringer phosphate before homogenization.
  • the PMN were first disrupted in one of two ways: 1) Granule-rich fractions, containing the bulk of the BPI activity, were obtained by homogenization at 0° C. of PMN suspended in 0.34 M sucrose (2 ⁇ 10 8 cells/ml), as described in Weiss, J. et al., J. Biol. Chem . 253: 2664-2672, 1978, incorporated by reference, followed by centrifugation at 400 ⁇ g for 10 and 20,000 ⁇ g for 30 minutes at 4° C. The granule-rich pellet was extracted with approximately 10 volumes of 0.2 M sodium acetate (pH 4.0), overnight at 4° C. with continuous stirring. The extract was collected as a supernatant by centrifugation of the extract at 20,000 ⁇ g for 30 minutes.
  • the BPI in these extracts was purified by gel filtration chromatography on a molecular sieving column (SEPHADEX G-75, superfine, Pharmacia Fine Chemicals, Piscataway, N.J.) at 4° C.
  • the beads were prepared according to the manufacturer's instructions and equilibrated in the 0.2M sodium acetate (pH 4.0). Using this technique, substantially all of the BPI holoprotein activity was eluted as a single peak (fractions 35-39) corresponding to a discrete protein peak (5-6% of the total protein applied) just after the void volume.
  • the chromatographic fraction containing the human BPI holoprotein was subjected to further chromatography on an ion exchange resin (SP-SEPHADEX, Pharmacia Fine Chemicals, Piscataway, N.J.). Protein was applied to the column, equilibrated in 0.1N NaCl-0.2M sodium acetate/acetic acid buffer (pH4.6) and eluted with a stepwise gradient of buffered NaCl (0.3, 0.5 and 0.75M). Human BPI holoprotein eluted in the last step.
  • SP-SEPHADEX Pharmacia Fine Chemicals, Piscataway, N.J.
  • Reverse phase HPLC of this incubated mixture performed as described above for the holoprotein, yielded two major protein peaks, one co-eluting with native human BPI holoprotein and the other eluting slightly earlier (FIG. 2).
  • Protein from the later peak migrated on SDS-PAGE as a single 60 kDa species and protein from the earlier peak migrated as a single 25 kDa species (FIG. 1, lanes D and E respectively). Fragmentation of the human BPI holoprotein and isolation of the 25 kDa fragment could be repeated with the recovered human holoprotein upon repetition of this procedure, confirming that the 25 kDa fragment was human BPI-derived.
  • rabbit BPI holoprotein purified as in Example 1 above (500ng, FIG. 1, lane F) was fragmented after incubation for 18 hours at 37° C. in 0.1M HEPES-NaOH (pH7.4) into a 25 kDa species (FIG. 1, lane G).
  • the human 25 kDa BPI fragment of the present invention was subjected to amino acid analysis, and the results wet compared with the amino acid analysis of purified 60 kDa human holoprotein.
  • Amino acid compositions were determined using a Waters Pico-Tag amino acid analyzer (Waters Associates, Milford, NA) as described (Bidlingmyer, B. A. et al., J. Chrom . 336: 93-104 1984 incorporated, by reference). Samples were pretreated in vacuo for 24 hours at 110° C. with 5.7N HCl containing 0.05% phenol. The results are shown in Table 1.
  • NH 2 -terminal sequence analysis of the human BPI fragment of the present invention and of the holoprotein were performed using the well-known sequential Edman degradation technique (Edman, P. Eur. J. Biochem . 1:80-91, 1967, incorporated by reference) using an amino acid sequencer (Beckman, Model 890C, Beckman Instruments Inc., Fullerton, Calif.) for the holoprotein or a gas phase sequencer (Applied Biosystems, Model 470A, Applied Biosystems, Inc., Foster City, Calif.) for the fragment.
  • an amino acid sequencer Beckman, Model 890C, Beckman Instruments Inc., Fullerton, Calif.
  • a gas phase sequencer Applied Biosystems, Model 470A, Applied Biosystems, Inc., Foster City, Calif.
  • Phenylthiohydantoin derivatives of amino acids released sequentially by the Edman degradation process were analyzed by reverse-phase HPLC using an 150 mm C-18 column for human BPI (IBM Instruments Inc., Willingford, Conn.) or an ODS column for the fragment of the present invention (Dupont Zorbax ODS column, E.I. Dupont de Nemours, Wilmington, Del.). The results are shown in Table 2 below. TABLE 2 Holoprotein V N P G V V V V R I S Q K G L D Y A S Q Q 25 Kd Frag- V N P G V V V R I S Q K G L D Y A S Q Q ment
  • E. coli J5 obtained from Dr. L. Leive, NIH Bethesda, Md.
  • LPS short-chain lipo-polysaccharides
  • coli J5 were incubated in a volume of 250 microliters with increasing amounts of either the human holoprotein or the human 25 kDa fragment of the present invention.
  • the effects on bacterial viability were determined either by (1) diluting an aliquot (5 ⁇ 10 5 bacteria) of the incubation mixture into 2 ml of nutrient broth (Difco Laboratories, Detroit, Mich.) and measuring bacterial growth (absorbance at 550nM using a standard spectrophotometer after approximately 4 hours at 37° C.); or (2) plating diluted samples on nutrient agar and counting bacterial colonies after overnight incubation at 37° C.
  • FIG. 3 open circles represent BPI holoprotein-treated bacteria and closed circles represent bacteria treated with the human 25 kDa fragment of the present invention.
  • FIG. 3A shows that the isolated 25 kDa fragment of the present invention killed E. coli J5, a strain of bacteria highly sensitive to the holoprotein, in a dose-dependent manner.
  • a linear regression analysis of the data presented in FIG. 3A further showed that the fragment was about twice as potent as the holoprotein on a mass basis, meaning that it is about equally potent on a molar basis because the fragment is about half the size of the holoprotein (FIG. 3A).
  • FIG. 3B shows that even at almost fully lethal doses, both the human holoprotein and the human 25 kDa fragment of the present invention caused little inhibition of bacterial protein synthesis. In contrast, both the fragment and the holoprotein caused nearly a complete inhibition of E. coli J5 protein synthesis when administered in the presence of 50 micrograms/ml of the antibiotic actinomycin D (Merck, Sharp and Dohme, St. Louis, Mo., FIG. 3C).
  • actinomycin D reflects increased permeability of the outer membrane of the bacteria permitting the entry of the normally impermeant actinomycin D into the cell where it inhibited RNA and, consequently, protein synthesis.
  • the dose-dependence of the permeability-increasing effect of the fragment of the present invention and the holoprotein was the same as that shown for the bactericidal activity above, and demonstrated that in this respect also the fragment was twice as active as the holoprotein, on a mass basis.
  • the dose-dependent activation of bacterial phospholipid degrading enzymes by the holoprotein was also produced by the 25 kDa fragment of the present invention, again requiring only half the mass of protein for a comparable effect.
  • E. coli 0111:B4 is a smooth strain bearing longer polysaccharide chains than E. coli J5.
  • Bacteria (1 ⁇ 10 6 ) were incubated in 125 microliter mixtures with increasing amounts of the BPI holoprotein or the 25 kDa fragment of the present invention. Bacterial viability was measured as above and is expressed as percent of viability of bacteria incubated alone (without any additions). The results are shown in FIG. 4.
  • the 25 kDa fragment of the present invention (closed circles) was about five times more potent than the holoprotein (open circles) towards E. coli 0111:B4.
  • the five fold enhancement in activity of the 25 kDa fragment of the present invention with respect to the holoprotein suggests that the smaller size of the fragment of the present invention is a factor in facilitating access of the fragment to binding sites at the base of the LPS polysaccharide chain.
  • BPI-1 GTCAATCCTGGTGTTGTGGTCAGGATCTCTCAGAAGGGCCTGGATTATGCCTCCCA
  • BPI-2 GCAAGGCACAGCTGCCCTGCAGAAGGAGCTGAAGAGGATCAAGATTCCTGACTAT
  • the probes were kinase labeled with 32 p using standard techniques well-known in the art and used to independently screen a human genomic liver library as disclosed in Lawn. R. M. et al. ( Cell 15: 1157-1174, 1978).
  • six clones were identified among 500,000 plaques which hybridized independently with each probe.
  • the hybridizing region of one of these clones was sequenced and clearly encoded the amino terminal end of human BPI. This sequence was interrupted by an intron or intervening sequence but nevertheless predicted an additional 22 amino acid residues which preceded the next intron.
  • the sequence predicts a 31 amino acid signal peptide, followed by a 456 residue mature protein.
  • the amino terminal sequence determined by protein sequencing of human BPI matches the encoded cDNA exactly.
  • the deduced amino acid composition of the encoded protein corresponds closely to the amino acid composition determined for purified human BPI as disclosed in Ooi. C. E. et al., supra.
  • the encoded sequence predicts a protein of 50.6 kD; the estimated molecular size of purified human BPI is approximately 58 kD. This difference in the apparent size may reflect the presence of two potential N-linked glycosylation sites at positions 122 and 249 of the protein (indicated by overlines in FIG. 5).
  • the BPI cDNA probe hybridized well with mRNA prepared from the spleen of a patient with chronic myelocytic leukemia.
  • the spleen was heavily infiltrated with immature myeloid cells.
  • the size of the hybridizing signal was approximately 2,000 bases in length, suggesting that the cDNA sequence presented in FIG. 5 was full length.
  • the BPI probe did not hybridize with mRNA from normal spleen, mature peripheral blood leukocytes, liver, kidney, or brain (FIG. 6). This result is in agreement with previous observations on the location of BPI in various cell types and tissues; the presence of BPI has been previously shown to be restricted to cells of the myeloid series.
  • the BPI cDNA was also used as a probe in Southern hybridizations of human genomic DNA.
  • DNA was isolated from human peripheral blood leukocytes, as described in Blin. N. et al. ( Nuc. Acids Res . 3: 2303-2308, 1976), digested with restriction en-donucleases Eco RI, BamHI and HindIII, and fractionated on a 1% agarose gel. The DNA was transferred to nitrocellulose (as described in Southern, E. M., J. Molec. Biol .
  • the primary structure of the human BPI protein sequence reveals several features which may be critical for its function.
  • an amino terminal 25 kD fragment contains all of the bactericidal activity of the holoprotein.
  • a clear charge asymmetry can be observed when the amino terminal 25 kD fragment is compared with the holoprotein.
  • the amino terminal end contains 16 more basic than acidic residues (28 lysine/argine vs. 12 aspartate/glutamate), while the carboxy terminal end is slightly acidic (20 basic vs. 22 acidic residues).
  • the very basic nature of the amino terminal domain may promote an electrostatic interaction of BPI with the negatively charged LPS on the bacterial envelope.
  • the human BPI fragment of the present invention will be used to test the effectiveness of compositions containing the fragments and Penicillin-G or a hydrophobic derivative, Penicillin-V. Both smooth ( E. coli 0111:B4) and rough ( E. coli J5) gram-negative bacteria will be seeded and incubated as in Example 3 above with serial two-fold dilutions containing: the human 25 kDa BPI fragment of the present invention (1 microgram-1000 micrograms) alone, Penicillin-G (3000-300,000 units) alone, Penicillin-V Benzathine (3000-3.00,000 units) alone and compositions containing the same concentrations of the above as mixtures, e.g. the BPI fragment plus Penicillin-G and the BPI fragment plus Penicillin-V. Bacterial viability will be monitored as above in Example 3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A purified, isolated DNA sequence encoding human bactericidal/permeability-increasing protein and biologically-active fragments thereof is provided.

Description

  • This application is a continuation-in-part of copending, commonly assigned U.S. patent application Ser. No. 084,335, filed Aug. 6, 1987 of Peter Elsbach and Jerrold Weiss.[0001]
  • [0002] The United States government has rights to this invention by virtue of research grant Nos. DK-05472 and AI-18571 from the National Institute of Health.
  • BACKGROUND OF THE INVENTION
  • The present invention pertains to biologically active, polypeptide fragments of mammalian bactericidal/permeability-increasing proteins and methods for making and using said fragments. [0003]
  • Bactericidal/permeability-increasing protein (BPI) is a 50 to 60 Kd protein, isolated from the granules of mammalian polymorphonuclear leukocytes (PMN) which are blood cells that are essential in the defense against invading microorganisms in mammals. BPI occurs only in cells of the myeloid series of blood cells, is produced at the promyelocytic/myelocytic stage of differentiation and is located in the primary granules in these cells. [0004]
  • BPI is a potent bactericidal agent active against a broad range of gram-negative bacterial species. It exhibits a high degree of specificity in its cytotoxic effect, i.e. 10-40 nM (0.5-2.0 micrograms), producing greater than 90% killing of 10[0005] 7 sensitive bacteria whereas 100-fold higher concentrations of BPI are non-toxic for other microorganisms and eukaryotic cells. All available evidence suggests that in the intact PMN and in crude leukocyte fractions, BPI is the principal oxygen-independent agent present which is active against BPI-sensitive bacteria.
  • BPI isolated from both human and rabbit PMN has been purified to homogeneity. The molecular weight of human BPI is approximately 58,000 Daltons (58 kDa) and that of rabbit BPI is approximately 50 kDa. The amino acid composition of these two proteins is closely similar as is the amino acid sequence of their first 15 NH[0006] 2-terminal amino acid residues. Both proteins are highly basic, having an isoelectric point greater than 9.6.
  • The biological effects of BPI require attachment of the protein to the surface of the susceptible gram-negative bacteria. Initial binding of BPI to target cells involves electrostatic interactions between the basic protein and the negatively charged sites on the lipopolysaccharides (LPS) on the bacterial outer membrane and leads to an activation of bacterial enzymes that degrade phospholipids and peptidoglycans. The final stage of action is the actual killing of the bacteria by an as yet unknown mechanism. The closely similar amino acid composition and nearly identical bactericidal and membrane-perturbing properties of BPI purified from human and rabbit PMN suggest that this protein has been highly conserved during evolution and is an important member of the anti-bacterial arsenal of the mammalian PMN. [0007]
  • Due to its potent bactericidal action against gram-negative bacteria and lack of cytotoxicity towards other microorganisms and eukaryotic cells, it is envisioned what BPI may be employed as a chemotherapeutic agent and/or as a model for the design of new antibiotic agents. However, due to its large molecular weight (58 kDa for the human holoprotein), both sequencing and determination of the structural organization of BPI have been hampered (hereinafter the entire BPI molecule is referred to as the holoprotein). The possibility has been raised that, as in the case with other cytotoxic proteins, BPI has a structural organization where the different functions, namely binding, envelope-altering and killing reside in different domains within the BPI molecule. Although BPI fragments, obtained by digestion of the holoproteins with the proteolytic enzyme elastase, has been disclosed (Weiss. J. et al., Clin. Res 34: 537A, 1986), the fragments tested remained associated under the non-denaturing conditions employed. No biological activity was ascribed to any isolated fragments. Moreover, antibodies directed against the holoprotein did not recognize these fragments under denaturing conditions when analyzed using the well-known Western blotting procedure. [0008]
  • Therefore, in light of the above, there is a need in the art for biologically active peptide fragments of BPI for use as bactericidal/permeability increasing agents as well as therapeutic agents. Such fragments are also needed to provide sequence information on BPI to direct the design of future generations of antimicrobial agents specific for gram-negative bacteria and to be used as probes into the molecular organization of the holoproteins. [0009]
  • OBJECTS OF THE INVENTION
  • It is an object of the present invention to provide biologically active peptide fragments of mammalian BPI. [0010]
  • Another object of the present invention is to provide biologically active peptide fragments of mammalian BPI with improved antimicrobial effectiveness. [0011]
  • Yet another object of the present invention is to provide a process for the production of biologically active peptide fragments of mammalian BPI. [0012]
  • Yet another object of the present invention is to provide methods for treating mammals suffering from infections caused by gram-negative bacteria. [0013]
  • A further object of the present invention is to provide a method for increasing the permeability of gram-negative bacteria. [0014]
  • A still further object of the present invention is to increase the effectiveness of gram-negative bactericidal agents. [0015]
  • These and other objects of the present invention will be apparent to those of ordinary skill in the art in light of the present description, accompanying claims and appended drawings. [0016]
  • SUMMARY OF THE INVENTION
  • The present inventors have unexpectedly discovered biologically active fragments of mammalian BPI substantially shorter in length than the native BPI protein. Although these fragments are substantially smaller than the native molecule, they retain at least substantially all of the bactericidal and permeability-increasing properties of the intact protein. [0017]
  • The biologically active BPI fragments of the present invention can be produced by incubating a sample comprising the BPI holoprotein under BPI cleaving conditions and recovering biologically active fragments of the BPI holoprotein. The preferred BPI cleaving conditions include heating of the BPI holoprotein in an acceptable buffer for a time ranging between about 16 and 24 hours at a temperature between about 20° C. and about 37° C. [0018]
  • In another aspect, the present invention provides a method for treating mammals suffering from infections caused by gram-negative bacteria comprising administering to mammals in need of such treatment a gram-negative bactericidal-effective amount of at least one of the above-mentioned biologically active BPI fragments. [0019]
  • In another aspect, the present invention provides pharmaceutical formulations for treating infections in mammals caused by gram negative bacteria comprising a gram-negative bactericidal-effective amount of at least one of the biologically active BPI fragments or pharmaceutically-acceptable salts thereof. [0020]
  • In yet another aspect, the present invention provides a method for increasing the permeability of gram-negative bacteria comprising incubating the bacteria with a gram-negative-bacterial-permeability-increasing-effective amount of a biologically active fragment of BPI. [0021]
  • In still another aspect, the present invention provides a method for increasing the effectiveness of gram-negative bactericidal agents in mammals in need of such treatments, comprising co-administration of such agents with the biologically active fragments of BPI. [0022]
  • A still further aspect of the present invention is directed to a purified, isolated DNA sequence having the sequence set out in FIG. 5 or its complementary strand and DNA sequences hybridizing under stringent hybridization conditions with said DNA sequences. The DNA sequence encodes the human bactericidal/permeability-increasing protein.[0023]
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 is a photograph of a stained SDS-PAGE gel showing the production and purification of the human BPI fragment of a preferred embodiment of the present invention. [0024]
  • FIG. 2 is a graph showing the chromatographic behavior of the human BPI holoprotein (a) and human 25 kDa BPI fragment of the present invention (b) on reverse phase HPLC. [0025]
  • FIG. 3 is a series of graphs comparing the biological activities of the 25 kDa human BPI fragment of the present invention and the holoprotein toward [0026] E. coli J5. (A) bactericidal activity; (B) effect on bacterial protein synthesis; (C) permeability increasing activity; and (D) phospholipase activation.
  • FIG. 4 is a graph comparing the bactericidal effect of the 25 kDa human BPI fragment of the present invention and the holoprotein on [0027] E. coli 0111:B4.
  • FIG. 5, bottom line, shows the sequence of the cDNA encoding human BPI whereas printed above is the corresponding amino acid sequence. The two potential glycosylation sites are overlined. [0028]
  • FIG. 6 is an autoradiogram of a Northern blot analysis of human BPI mRNA. [0029]
  • FIG. 7 is an autoradiogram of a Southern blot analysis of human genomic DNA using a BPI CDNA probe.[0030]
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present inventors have unexpectedly discovered biologically active fragments of BPI isolated from mammalian PMN. NH[0031] 2-terminal amino acid sequence analysis demonstrated that, in the case of human BPI, the fragment represents a portion of the BPI molecule proximal to the NH2-terminus, as shown in Example 3 below. The fragment possesses all of the antibacterial and membrane permeability-increasing functions contained in the complete molecule but is substantially smaller (i.e. has a lower molecular weight) than the holoprotein. “Substantially smaller” is defined herein as being up to about half the size of the holoprotein. This is a most surprising finding because, in the case of other cellular toxins and proteins, the entire molecule is necessary for the full manifestation of their biological effects. For example, studies on a wide variety of bacterial and plant cytotoxins, such as diphtheria toxin, cholera toxin and ricin (toxins which do not demonstrate the unique specificity of the BPI holo-protein) have revealed that individual functions, such as binding or catalytic activity, can be expressed by isolated fragments, but that cytotoxicity (comprising both binding to a cell membrane and intracellular toxic activity) requires essentially the entire molecule.
  • The BPI fragments of the present invention are as potent as the holoprotein against rough [0032] E. coli, more potent than the holoprotein against the generally more resistant, smooth E. coli (on a molar basis), and retain the specificity of the holoprotein towards gram-negative bacteria. This is a particularly important finding because smooth gram-negative bacteria (smoothness being due to the presence of longer LPS chains in the bacterial cell membrane) generally are more pathogenic than their corresponding rough counterparts.
  • The distinctive size, chromatographic behavior (FIGS. 1 and 2 below) amino acid content. (Table 1 below) and potency (see Example 4 below) firmly establish that the BPI fragment of the present invention is a molecular entity distinct from the holoprotein. [0033]
  • Non-limiting examples of the BPI fragments of the present invention are approximately 25 kDa for human and rabbit BPI. The human 25kDa fragment of the preferred embodiment of the present invention was initially isolated after long-term storage (e.g. two months) of the purified holoprotein in a weakly acidic buffer (10 mM ammonium acetate, pH4.6) and can be thus generated. However, it is preferable to produce the BPI fragments of the present invention by incubating the holo-proteins in an acceptable buffer i.e., a buffer having sufficient buffering capacity at concentrations between about 10 and about 150 mM at a pH ranging between about 6.0 and about 8.0, such as Tris/HCl, phosphate, and preferably HEPES/NaOH (Sigma Chemicals, St. Louis, Mo.), or mixtures thereof. The preferred pH is 7.4. The incubations may be performed for a period of time broadly ranging between about 16 and 24 hours and preferably 18 hours, at a temperature ranging between about 20° C. and about 37° C. and preferably 37° C. A particularly preferred condition comprises incubation in 0.1M HEPES/NaOH buffer, pH 7.4 for 18 hours at 37° C. This has led to the conversion of about 50% of the holoprotein into the biologically active fragments of the present invention. Reincubation of the recovered holoprotein, under these conditions again result in formation of the 25 kDa fragment. [0034]
  • The BPI holoproteins, used as starting materials for the production of the biologically active fragments of the present invention, can be obtained from mammalian cells of the myeloid series of blood cells, such as PMN. Although the fragments of the present invention are not limited to a particular mammalian species, it is preferable to employ such fragments isolated from a homologous mammalian species when treating bacterial infections caused by gram-negative bacteria. [0035]
  • In addition, the BPI holoprotein and/or the biologically active fragments of the present invention may be obtained using recombinant DNA techniques employing the sequence information presented below in Example 3 to synthesize DNA probes for the detection of DNA sequences coding for BPI in complementary DNA or genomic libraries using methods well-known in the art. The gene coding for the BPI holoprotein, or a portion of the gene coding for the 25 kDa fragment of the present invention (and possibly smaller biologically active fragments thereof) may be inserted into a suitable expression vector for the production of biologically active polypeptides. [0036]
  • In one embodiment, human BPI holoprotein can be obtained from PMN isolated from normal blood or from blood from patients with chronic myelocytic leukemia, as detailed in Example 1 below. Alternatively, human BPI can be extracted from the human leukemic cell line HL-60 (available as [0037] ATCC CCL 240, American Type Culture Collection, Rockville, Md.). The latter have been found to contain approximately 10 micrograms of BPI holoprotein per 108 cells. Mature PMN of either normal or leukemic origin contain approximately 60 micrograms per 108 cells of the BPI holoprotein and are therefore the preferred starting material.
  • Once obtained, the mammalian PMN can be fractionated using, for example, the procedures detailed below in Example 1 in order to obtain primary granules (or alternatively by extraction of whole cells with 0.16N sulfuric acid, as described in Elsbach. P. et al., [0038] J. Biol. Chem. 254:11000, 1979, incorporated by reference). Such primary granules isolated from PMN or leukemic cell lines contain the bulk of BPI holoprotein activity. The BPI holoprotein can then be extracted and purified using any technique known in the art which yields a biologically active BPI holoprotein. Although crude extracts obtained from such primary granules can be employed as starting materials for the production of the BPI fragments of the present invention, it is preferable to purify the holo-protein before generating the fragments. Preferred extraction and purification techniques for human and rabbit BPI holo-proteins are described in Example 1 below.
  • The amounts of starting, purified, BPI holoprotein to be employed in practicing the present invention preferably should be at least 200 micrograms of purified holoprotein. Although it is possible to use smaller amounts of material, this may hamper the recovery of the biologically active fragments due to non-specific losses, as is true with many other biologically-active proteins, such as interferons. [0039]
  • Although not wishing to be bound by any theory of operation of the present invention, it is believed that the cleavage of the holoprotein to generate the biologically active fragments of the present invention is due to the presence of serine proteases. [0040]
  • The protein cleaving conditions necessary for the production of the biologically active BPI fragments of the present invention are broadly within the pH, temperature and time optima of such serine proteases, i.e. pH6.0-pH 8.0, 20° C.-37° C., 16-24 hours. Such incubation of the BPI holoprotein will produce cleavage at about 25 kDa from the NH[0041] 2-terminus of the holoproteins.
  • The biologically active BPI fragments of the present invention can be utilized for the treatment of mammals suffering from diseases caused by gram-negative bacteria such as, bacteremia or sepsis. Due to its exquisite selectivity and lack of cytotoxicity toward cells other than gram-negative bacteria, the BPI fragments of the present invention would be particularly useful as specific therapeutic agents. Currently gram-negative bacterial infections, such as those caused by [0042] Escherichia coli, various species of Salmonella, Klebsiella or Pseudomonas are treated with antibiotics, such as penicillin derivatives, aminoglycosides and chloramphenicol. The effectiveness of antibiotics is limited due to the fact that gram-negative bacilli tend to display significant intrinsic resistance to many currently available antibiotics and to readily develop further resistance due to the acquisition of resistance factor plasmids. Under appropriate selective conditions, rapid dissemination of multiple antibiotic resistance among a wide variety of gram-negative pathogens is known to occur.
  • When employed to treat bacteremia (i.e. the presence of bacteria in the blood stream) or sepsis (bacterial contamination of bodily fluids) caused by gram-negative bacteria, the BPI fragments of the present invention are preferably administered parenterally, and most preferably intravenously in amounts broadly ranging between about 1 microgram and 1000 micrograms and preferably between 10 and about 250 micrograms per treatment. The duration and number of treatments may vary from individual to individual, depending upon the severity of the illness. A typical treatment regime may comprise intravenous administration of about 100 micrograms of the BPI fragments three times a day. To help avoid rapid inactivation of the BPI fragments of the present invention (and indeed the holoproteins) which has been observed in vitro after incubation with serum, the BPI fragments may be coupled with physiologically-acceptable carriers, such as normally occurring serum proteins (e.g. albumin or lysozyme). The BPI fragments of the present invention could also be employed topically to treat mammals suffering from skin infections caused by susceptible gram-negative bacteria which occur on bedridden patients suffering from decubitus ulcers (bed sores) or in burn patients. When employed as a topical antibacterial agent, the BPI fragments may be administered in the same dosages and frequency as described for parenteral administration above. [0043]
  • The BPI fragments of the present invention can be incorporated in pharmaceutical formulations to be used to treat mammals suffering from gram-negative bacterial infections. Pharmaceutical formulations comprising the BPI fragments of the present invention (or physiologically-acceptable salts thereof) as at least one of the active ingredients, would in addition comprise pharmaceutically-acceptable carriers, diluents, fillers, salts and other materials well-known in the art depending upon the dosage form utilized. For example, preferred parenteral dosage forms would comprise a sterile isotonic saline solution, and may comprise between about 1 microgram and 1000 micrograms of the BPI fragments of the present invention covalently coupled to suitable physiologically-acceptable carriers, such as normally occurring serum proteins, for example lysozyme or albumin, to prevent their inactivation. For use in treating mammals with gram-negative bacterial infections in body fluids largely devoid of (lipo) proteins, such as urine, pharmaceutical formulations, may comprise the above amounts of BPI fragments of the present invention and sterile, isotonic saline solutions for irrigation of the urinary tract. [0044]
  • In another preferred embodiment, the BPI fragments of the present invention in amounts ranging between 1 microgram and 1000 micrograms per dose, may be mixed with antibiotics and may be formulated in the same type of preparations used in antibiotic creams (such as Silvadene, Marion Laboratories, Kansas City, Mo., Terramycin, Pfipharmecs, New York, N.Y. or Achromycin, Lederle Laboratories, Pearle River, N.Y.) well-known in the art for topical administration. [0045]
  • In another preferred embodiment of the present invention, pharmaceutical formulations for treating mammals suffering from gram-negative bacterial infections may contain the BPI fragments of the present invention in addition to standard amounts (well-known in the art) of antibiotics such as Penicillin-G (available from E.R. Squibb and Sons, Inc., Princeton, N.J.) or cephalosporins (available from Eli Lily & Co., Indianapolis, Ind.). In a particularly preferred embodiment, the BPI fragments of the present invention may be mixed with hydrophobic antibiotics, such as rifampicin (available as RIFAMPIN, CIBA Pharmaceutical CO., Summit, N.J.), and hydrophobic penicillins such as Penicillin-V Benzathine (Lederle Labs, Pearl River, N.Y.). The increased permeability of gram-negative bacteria after BPI treatment is expected to enhance the effectiveness of such antibiotics which cannot easily enter non-permeabilized bacteria. [0046]
  • The BPI fragments of the present invention are expected to be ideally-suited for co-treatment using any antibiotic, immune system cells or factors such as T-cells or interleukin-2, cytotoxic agents or the like, effective against gram-negative bacteria. Because of the increased sensitivity to the fragments of the present invention of the more pathogenic, smooth, gram-negative bacteria, the BPI fragments of the present invention are expected to decrease resistance of such bacteria to such factors. Substantially simultaneous administration of the fragments of the present invention and the antibiotic of choice is preferred. [0047]
  • An example of the above-mentioned embodiment is demonstrated in Example 4 below, wherein actinomycin D (which normally cannot enter and affect gram-negative bacteria due to its hydrophobic properties) significantly inhibited RNA and protein synthesis only in BPI-treated [0048] E. coli.
  • In addition, the present inventors have isolated the gene encoding the human BPI holoprotein and have identified and sequenced BPI cDNA isolated from human promyelocytic leukemia cells (HL-60). The nucleotide sequence of the cDNA and the corresponding amino acid sequence of the holoprotein are set out in FIG. 5. [0049]
  • The sequence information contained in FIG. 5 can be employed to synthesize the 25 kDa, biologically active fragment of BPI. In this case, a vector can be generated comprising DNA residues 123 to about 759-780 (or [0050] amino acid residues 1 to about 210-220) of FIG. 5 using techniques well-known in the art. In addition, smaller sub-fragments of the cDNA of FIG. 5 can be generated using, for example, limited Ba131 nuclease digestion of the entire cDNA, to probe for the minimum sequences necessary for BPI biological activities mentioned above.
  • Alternatively, the BPI holoprotein can be obtained after synthesis by suitably transfected or transformed eukaryotic (mammalian or yeast) or prokaryotic cells and the biologically-active 25 kDa fragments mentioned above can be obtained using the techniques described in Example 2 below. [0051]
  • The present invention is described further below in specific examples which are intended to illustrate it without limiting its scope. [0052]
  • EXAMPLE 1 Isolation and Purification of Human BPI
  • Human leukocytes were obtained from heparin-treated (100-200 U.S.P. units/10 ml) peripheral blood collected by venipuncture from healthy donors and patients with chronic myelocytic leukemia. [0053]
  • Populations of human PMS were obtained in two ways. (1) PMN's were isolated by the dextran-sedimentation procedure, followed by centrifugation in an Isopaque-Ficoll gradient (Pharmacia Fine Chemicals, Piscataway, N.J.) as described (Boyum, A. J., [0054] J. Clin. Lab. Invest. Suppl. 97: 77-89, 1968, incorporated by reference). The leukocyte-rich plasma from healthy donors was first diluted with isotonic Krebs-ringer phosphate buffer (pH7.4) to a concentration of 10,000 to 20,000 cells/-microliter before layering on the Isopaque-Ficoll mixture. The cells were washed twice in Krebs-ringer phosphate before use.
  • (2) Alternatively, leukocyte-rich plasma obtained by leukopheresis (using procedures well-known in the art) of 400 ml of venous blood, from a patient with chronic myelocytic leukemia, was sedimented directly at 1000×g for five minutes yielding 3.5×10[0055] 10 leukocytes, essentially all of which were PMN. These cells were washed twice with Krebs-ringer phosphate before homogenization.
  • For extraction of the human BPI holoprotein, the PMN were first disrupted in one of two ways: 1) Granule-rich fractions, containing the bulk of the BPI activity, were obtained by homogenization at 0° C. of PMN suspended in 0.34 M sucrose (2×10[0056] 8 cells/ml), as described in Weiss, J. et al., J. Biol. Chem. 253: 2664-2672, 1978, incorporated by reference, followed by centrifugation at 400×g for 10 and 20,000 ×g for 30 minutes at 4° C. The granule-rich pellet was extracted with approximately 10 volumes of 0.2 M sodium acetate (pH 4.0), overnight at 4° C. with continuous stirring. The extract was collected as a supernatant by centrifugation of the extract at 20,000×g for 30 minutes.
  • 2) Alternatively, PMN (2-3×10[0057] 8 cells/ml) were disrupted in distilled water at 0° C. with a Potter-Elvejhem glass homogenizer and a motor-driven teflon pestle (Kontes; subsidiary of Kimble Div. of Owens, Ill.) and extracted at 0° C. for 30 minutes with 0.16N sulfuric acid to solubilize the BPI holoprotein. After centrifugation at 23,000×g for 20 minutes at 4° C. to sediment insoluble material, the extract was dialyzed against 200 mM sodium acetate/acetic acid buffer (pH 4.0). The BPI in these extracts was purified by gel filtration chromatography on a molecular sieving column (SEPHADEX G-75, superfine, Pharmacia Fine Chemicals, Piscataway, N.J.) at 4° C. The beads were prepared according to the manufacturer's instructions and equilibrated in the 0.2M sodium acetate (pH 4.0). Using this technique, substantially all of the BPI holoprotein activity was eluted as a single peak (fractions 35-39) corresponding to a discrete protein peak (5-6% of the total protein applied) just after the void volume.
  • The chromatographic fraction containing the human BPI holoprotein was subjected to further chromatography on an ion exchange resin (SP-SEPHADEX, Pharmacia Fine Chemicals, Piscataway, N.J.). Protein was applied to the column, equilibrated in 0.1N NaCl-0.2M sodium acetate/acetic acid buffer (pH4.6) and eluted with a stepwise gradient of buffered NaCl (0.3, 0.5 and 0.75M). Human BPI holoprotein eluted in the last step. [0058]
  • Purified human BPI holoprotein was then isolated by high performance liquid chromatography (HPLC) on a reverse phase C-4 (Vydac) column (Sota Chromatography, Crompand, N.Y.) using an HPLC system (Model 332, Beckman Instruments, Fullerton, Calif.). The column used a linear gradient of acetonitrile (0-95% volume/volume, J. T. Baker Chemical Co., Philipsburg, N.J.) in 0.1% trifluoroacetic acid (TFA, Pierce Chemical Co., Rockford, Ill.). Human BPI eluted at about 70% acetonitrile and was dialyzed against approximately 50 volumes of 10 mM ammonium acetate/acetic acid buffer (pH4.6). Purified BPI was stored either in 0.2M sodium acetate/acetic acid buffer (pH 4.0) or in 10 mM ammonium acetate/acetic acid buffer (pH4.0) at 4° C. [0059]
  • EXAMPLE 2 Production of Human BPI Fragments
  • Purified human BPI holoprotein was incubates. in 0.1M HEPES-NaOH buffer, pH7.4 for 18 hours, and then analyzed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) in 12% polyacrylamide gels using the buffer system containing 0.375M Tris/HCl and 0.1%. SDS of Laemmli, U.K., [0060] Nature 227: 680-6851970 incorporated by reference. The results are shown in FIG. 1. In FIG. 1, lanes A-E were stained using the well-known Coomassie blue technique and lanes F and G were silver stained using a commercial kit (Bio-Rad, Bio-Rad Labs, Richmond, Calif.).
  • Upon incubation in 10 mM ammonium acetate buffer (pH 4.6) at 4° C. for two months, 10 micrograms of the purified human protein (FIG. 1, lane A) fragmented into two species of approximately 35 and 25 kDa (FIG. 1, lane B). Incubation of purified human BPI holoprotein (10 micrograms) for 24 hours at 37° C. in 0.1M HEPES/NaoH buffer, pH 0.7.4, enhanced the accumulation of the two species, particularly the 25 kDa species with the concomitant loss of the holoprotein (FIG. 1, lane C). Reverse phase HPLC of this incubated mixture, performed as described above for the holoprotein, yielded two major protein peaks, one co-eluting with native human BPI holoprotein and the other eluting slightly earlier (FIG. 2). Protein from the later peak migrated on SDS-PAGE as a single 60 kDa species and protein from the earlier peak migrated as a single 25 kDa species (FIG. 1, lanes D and E respectively). Fragmentation of the human BPI holoprotein and isolation of the 25 kDa fragment could be repeated with the recovered human holoprotein upon repetition of this procedure, confirming that the 25 kDa fragment was human BPI-derived. [0061]
  • In like manner, rabbit BPI holoprotein, purified as in Example 1 above (500ng, FIG. 1, lane F) was fragmented after incubation for 18 hours at 37° C. in 0.1M HEPES-NaOH (pH7.4) into a 25 kDa species (FIG. 1, lane G). [0062]
  • EXAMPLE 3 NH2-Terminal Amino Acid Composition and Sequence Analysis of BPI Fragments
  • The human 25 kDa BPI fragment of the present invention was subjected to amino acid analysis, and the results wet compared with the amino acid analysis of purified 60 kDa human holoprotein. Amino acid compositions were determined using a Waters Pico-Tag amino acid analyzer (Waters Associates, Milford, NA) as described (Bidlingmyer, B. A. et al., [0063] J. Chrom. 336: 93-104 1984 incorporated, by reference). Samples were pretreated in vacuo for 24 hours at 110° C. with 5.7N HCl containing 0.05% phenol. The results are shown in Table 1.
    TABLE 1
    Amino Acid Composition of the 25 kDa Frag-
    ment and of the Human BPI Holoprotein
    (% of total)
    25 kDa Fragment Human BPI Holoprotein
    Asx 8.7 9.1
    Glx 8.8 8.9
    Ser 15.2 8.8
    Gly 7.1 6.4
    His 2.9 2.8
    Arg 3.6 3.7
    Thr 3.5 4.6
    Ala 4.1 6.0
    Pro 5.0 8.1
    Tyr 2.6 2.7
    Val 5.8 7.3
    Met 2.3 2.4
    Ile 7.3 5.0
    Leu 7.7 10.3
    Phe 4.2 6.1
    Lys 11.4 7.6
  • The values shown above represent the mole-fraction (%) of each amino acid and are the mean of three independent determinations. “Asx” stands for asparagine and/or aspartic acid and “Glx” stands for glutamine or glutamic acid. [0064]
  • Amino acid analysis showed that the human 25 kDa fragment was enriched in lysine and serine and contained less non-polar residues when compared with the holoprotein (Table 1). [0065]
  • NH[0066] 2-terminal sequence analysis of the human BPI fragment of the present invention and of the holoprotein were performed using the well-known sequential Edman degradation technique (Edman, P. Eur. J. Biochem. 1:80-91, 1967, incorporated by reference) using an amino acid sequencer (Beckman, Model 890C, Beckman Instruments Inc., Fullerton, Calif.) for the holoprotein or a gas phase sequencer (Applied Biosystems, Model 470A, Applied Biosystems, Inc., Foster City, Calif.) for the fragment. Phenylthiohydantoin derivatives of amino acids released sequentially by the Edman degradation process were analyzed by reverse-phase HPLC using an 150 mm C-18 column for human BPI (IBM Instruments Inc., Willingford, Conn.) or an ODS column for the fragment of the present invention (Dupont Zorbax ODS column, E.I. Dupont de Nemours, Wilmington, Del.). The results are shown in Table 2 below.
    TABLE 2
    Holoprotein V N P G V V V R I S Q K G L D Y A S Q Q
    25 Kd Frag- V N P G V V V R I S Q K G L D Y A S Q Q
    ment
  • As can be seen from the data in Table 2, the NH[0067] 2-terminal amino acid sequence of the human 25 kDa fragment of the present invention and the holoprotein derived from human PMN were identical in the first 20 amino acid residues, indicating that the fragment was the NH2-terminal portion of the human holoprotein.
  • EXAMPLE 4 Biological Properties of the BPI Fragment of the Present Invention
  • The antibacterial effects of the 25 kDa human BPI fragment of the present invention were compared with the known activities of the holoprotein. [0068] E. coli J5 (obtained from Dr. L. Leive, NIH Bethesda, Md.) which produces short-chain lipo-polysaccharides (LPS) in galactose-free culture medium, were grown overnight and then subcultured at 37° C. in triethanol-amine-buffered media as described in Simon. E. G. et al., (Proc. Nat. Acad. Sci. U.S.A. 51:877, 1964, incorporated by reference). 5×106 E. coli J5 were incubated in a volume of 250 microliters with increasing amounts of either the human holoprotein or the human 25 kDa fragment of the present invention. The effects on bacterial viability were determined either by (1) diluting an aliquot (5×105 bacteria) of the incubation mixture into 2 ml of nutrient broth (Difco Laboratories, Detroit, Mich.) and measuring bacterial growth (absorbance at 550nM using a standard spectrophotometer after approximately 4 hours at 37° C.); or (2) plating diluted samples on nutrient agar and counting bacterial colonies after overnight incubation at 37° C. The results are presented in FIG. 3. In FIG. 3, open circles represent BPI holoprotein-treated bacteria and closed circles represent bacteria treated with the human 25 kDa fragment of the present invention.
  • FIG. 3A shows that the isolated 25 kDa fragment of the present invention killed [0069] E. coli J5, a strain of bacteria highly sensitive to the holoprotein, in a dose-dependent manner. A linear regression analysis of the data presented in FIG. 3A further showed that the fragment was about twice as potent as the holoprotein on a mass basis, meaning that it is about equally potent on a molar basis because the fragment is about half the size of the holoprotein (FIG. 3A).
  • Killing of [0070] E. coli by mammalian BPI is initially accompanied by discrete alterations of the outer envelope without causing any apparent damage to the bacterial biosynthetic machinery. FIG. 3B shows that even at almost fully lethal doses, both the human holoprotein and the human 25 kDa fragment of the present invention caused little inhibition of bacterial protein synthesis. In contrast, both the fragment and the holoprotein caused nearly a complete inhibition of E. coli J5 protein synthesis when administered in the presence of 50 micrograms/ml of the antibiotic actinomycin D (Merck, Sharp and Dohme, St. Louis, Mo., FIG. 3C). This effect of actinomycin D reflects increased permeability of the outer membrane of the bacteria permitting the entry of the normally impermeant actinomycin D into the cell where it inhibited RNA and, consequently, protein synthesis. The dose-dependence of the permeability-increasing effect of the fragment of the present invention and the holoprotein was the same as that shown for the bactericidal activity above, and demonstrated that in this respect also the fragment was twice as active as the holoprotein, on a mass basis.
  • In order to compare the effects of the fragment of the present invention with the holoprotein on bacterial phospholipids, bacteria were prelabeled during growth with (1-[0071] 14C)-oleic acid (New England Nuclear, Boston, Mass.) as described in Elsbach. P. et al., J. Biol Chem. 254: 11000-11009, 1979 incorporated by reference. Incubation mixtures were supplemented with 0.4% bovine serum albumin (W/V) to capture phospholipid breakdown products (14C-free fatty acids and 14C-lysocom-pounds) permitting their separation from unhydrolyzed bacterial 14C-phospholipids by filtration through a membrane filter (Millipore HAWP, Millipore Corp. Bedford, Mass.) to measure phospholipid degradation. The results are shown in FIG. 3D.
  • As shown in FIG. 3D, the dose-dependent activation of bacterial phospholipid degrading enzymes by the holoprotein was also produced by the 25 kDa fragment of the present invention, again requiring only half the mass of protein for a comparable effect. [0072]
  • The action of the BPI holoprotein on [0073] E. coli is hindered by the presence in the bacterial outer membrane of lipopolysaccharides with long polysaccharide chains (“smooth strains”). The effectiveness of the 25 kDa fragment of the present invention towards a smooth E. coli strain (0111:B4) was compared with that of the holoprotein. E. coli 0111:B4 is a smooth strain bearing longer polysaccharide chains than E. coli J5. Bacteria (1×106) were incubated in 125 microliter mixtures with increasing amounts of the BPI holoprotein or the 25 kDa fragment of the present invention. Bacterial viability was measured as above and is expressed as percent of viability of bacteria incubated alone (without any additions). The results are shown in FIG. 4.
  • As can be seen in FIG. 4, the 25 kDa fragment of the present invention (closed circles) was about five times more potent than the holoprotein (open circles) towards [0074] E. coli 0111:B4. The five fold enhancement in activity of the 25 kDa fragment of the present invention with respect to the holoprotein, suggests that the smaller size of the fragment of the present invention is a factor in facilitating access of the fragment to binding sites at the base of the LPS polysaccharide chain.
  • In order to determine if the human 25 kDa fragment of the present invention retained the same cytotoxic specificity towards gram-negative bacteria as the holoprotein, the activities of the 25 kDa fragment and the holoprotein toward a gram-positive bacterium, [0075] Micrococcus lysodeikticus (obtained from Dr. M. Salton, New York University, New York, N.Y.) were compared. The bacteria were grown in brain heart infusion broth (Difco Laboratories, Detroit, Mich.) at 37° C. Bacterial viability was measured as above for E. coli.
  • Neither the human 25 kDa fragment of the present invention (5-10 micrograms) nor the holoprotein (10-20 micrograms) produced any effect on the viability of [0076] Micrococcus lvsodeikticus, even at doses twenty times greater than those that are fully lethal towards gram-negative E. coli J5.
  • The data presented above demonstrate that the spectrum and potency of the antibacterial activities of the human 25 kDa BPI fragment of the present invention are at least equal to and sometimes substantially greater than those of the holoprotein. The data indicate that all of the molecular determinants required for BPI cytotoxicity reside within the portion of the BPI molecule included in the fragment of the present invention. [0077]
  • EXAMPLE 5 Cloning of the cDNA of Human BPI and Identification of the Amino Acid Sequence
  • Two synthetic oligonucleotides were designed to encode the 33 amino terminal residues of human BPI. The probes BPI-1 (GTCAATCCTGGTGTTGTGGTCAGGATCTCTCAGAAGGGCCTGGATTATGCCTCCCA) and BPI-2 (GCAAGGCACAGCTGCCCTGCAGAAGGAGCTGAAGAGGATCAAGATTCCTGACTAT) were each designed to encode half of the partially known human BPI sequence as previously disclosed in Ooi. C. E. et al., ([0078] J. Biol. Chem. 262: 14891-14894, 1987). The probes were kinase labeled with 32p using standard techniques well-known in the art and used to independently screen a human genomic liver library as disclosed in Lawn. R. M. et al. (Cell 15: 1157-1174, 1978). six clones were identified among 500,000 plaques which hybridized independently with each probe. The hybridizing region of one of these clones was sequenced and clearly encoded the amino terminal end of human BPI. This sequence was interrupted by an intron or intervening sequence but nevertheless predicted an additional 22 amino acid residues which preceded the next intron.
  • Based on the gene sequence, a new DNA probe was then synthesized which corresponded exactly to the encoded 55 amino terminal amino acid residues. This probe was used to screen a small CDNA library prepared from human HL-60 cells (available as [0079] ATCC CCL 240, American Type Culture Collection, Rockville, Md.) induced with dimethylsulfoxide, DMSO. In the library of the 300,000 plaques, 4 clones were isolated which hybridized with the exact probe. DNA from the clones was isolated and the hybridizing regions were sequenced by the dideoxy chain termination technique of Smith. A. J. H. (Meth. Enzym. 65: 560-580, 1980). The sequence of the longest clone is presented in FIG. 5.
  • As shown in FIG. 5, the sequence predicts a 31 amino acid signal peptide, followed by a 456 residue mature protein. The amino terminal sequence determined by protein sequencing of human BPI matches the encoded cDNA exactly. Furthermore, the deduced amino acid composition of the encoded protein corresponds closely to the amino acid composition determined for purified human BPI as disclosed in Ooi. C. E. et al., supra. The encoded sequence predicts a protein of 50.6 kD; the estimated molecular size of purified human BPI is approximately 58 kD. This difference in the apparent size may reflect the presence of two potential N-linked glycosylation sites at positions 122 and 249 of the protein (indicated by overlines in FIG. 5). [0080]
  • To further demonstrate that this CDNA encoded human BPI, its expression was engineered in mammalian cells. The entire cDNA was subcloned in a mammalian cell expression vector (Wood, W. I. et al., [0081] Nature 312: 330-337, 1984), and then transfected into a human kidney cell line. Small amounts of recombinant BPI were transiently produced and characterized by Western Blotting techniques, showing an immunoreactive band with a mobility identical to that of native human BPI (results no. shown).
  • The natural expression of BPI in various human tissues was then analyzed by Northern Blot hybridization. RNA was prepared from various tissues (Chirgwin. J. M. et al., [0082] Biochem. 24: 5294-5299, 1979), passed over oligo-dT-cellulose and electrophoresed through a formaldehyde agarose gel (Dobner. P. R. et al., Proc. Nat. Acad. Sci. U.S.A. 78: 2230-2234, 1981). The gel was transferred to nitrocellulose as described (Thomas. P. S., Proc. Nat. Acad. Sci. U.S.A. 77: 5201-5205, 1980) and hybridized under stringent conditions with BPI cDNA.
  • As shown in FIG. 6, the BPI cDNA probe hybridized well with mRNA prepared from the spleen of a patient with chronic myelocytic leukemia. The spleen was heavily infiltrated with immature myeloid cells. The size of the hybridizing signal was approximately 2,000 bases in length, suggesting that the cDNA sequence presented in FIG. 5 was full length. The BPI probe did not hybridize with mRNA from normal spleen, mature peripheral blood leukocytes, liver, kidney, or brain (FIG. 6). This result is in agreement with previous observations on the location of BPI in various cell types and tissues; the presence of BPI has been previously shown to be restricted to cells of the myeloid series. The BPI cDNA was also used as a probe in Southern hybridizations of human genomic DNA. DNA was isolated from human peripheral blood leukocytes, as described in Blin. N. et al. ([0083] Nuc. Acids Res. 3: 2303-2308, 1976), digested with restriction en-donucleases Eco RI, BamHI and HindIII, and fractionated on a 1% agarose gel. The DNA was transferred to nitrocellulose (as described in Southern, E. M., J. Molec. Biol. 98: 503-517, 1975) and hybridized with a 5′ end fragment of the BPI CDNA probe under stringent conditions (as described in Maniatis et al., Molecular Cloning, a laboratory Manual, pp. 387-389, Cold Spring Harbor Laboratories, NY, 1982, incorporated by reference).
  • As shown in FIG. 7, a single hybridizing band was observed in restriction digests using Eco RI and BamHI when the 5′ end of the BPI cDNA was utilized as a probe. This suggested that BPI was encoded by a single gene. [0084]
  • The primary structure of the human BPI protein sequence reveals several features which may be critical for its function. As mentioned above, an amino terminal 25 kD fragment contains all of the bactericidal activity of the holoprotein. A clear charge asymmetry can be observed when the amino terminal 25 kD fragment is compared with the holoprotein. The amino terminal end contains 16 more basic than acidic residues (28 lysine/argine vs. 12 aspartate/glutamate), while the carboxy terminal end is slightly acidic (20 basic vs. 22 acidic residues). The very basic nature of the amino terminal domain may promote an electrostatic interaction of BPI with the negatively charged LPS on the bacterial envelope. [0085]
  • PAPER EXAMPLE I Co-Treatment of Gram-negative Bacteria with the Human BPI Fragment and Penicillins
  • The human BPI fragment of the present invention will be used to test the effectiveness of compositions containing the fragments and Penicillin-G or a hydrophobic derivative, Penicillin-V. Both smooth ([0086] E. coli 0111:B4) and rough (E. coli J5) gram-negative bacteria will be seeded and incubated as in Example 3 above with serial two-fold dilutions containing: the human 25 kDa BPI fragment of the present invention (1 microgram-1000 micrograms) alone, Penicillin-G (3000-300,000 units) alone, Penicillin-V Benzathine (3000-3.00,000 units) alone and compositions containing the same concentrations of the above as mixtures, e.g. the BPI fragment plus Penicillin-G and the BPI fragment plus Penicillin-V. Bacterial viability will be monitored as above in Example 3.
  • It is expected that lower amounts of both of the penicillins will be effective in killing both smooth and rough [0087] E. coli strains in the presence of the human 25 kDa BPI fragments showing the efficacy of this embodiment of the present invention.
  • 1 6 1 1813 DNA Homo sapiens CDS (31)..(1491) mat_peptide (124)..(1491) 1 caggccttga ggttttggca gctctggagg atg aga gag aac atg gcc agg ggc 54 Met Arg Glu Asn Met Ala Arg Gly -30 -25 cct tgc aac gcg ccg aga tgg gtg tcc ctg atg gtg ctc gtc gcc ata 102 Pro Cys Asn Ala Pro Arg Trp Val Ser Leu Met Val Leu Val Ala Ile -20 -15 -10 ggc acc gcc gtg aca gcg gcc gtc aac cct ggc gtc gtg gtc agg atc 150 Gly Thr Ala Val Thr Ala Ala Val Asn Pro Gly Val Val Val Arg Ile -5 -1 1 5 tcc cag aag ggc ctg gac tac gcc agc cag cag ggg acg gcc gct ctg 198 Ser Gln Lys Gly Leu Asp Tyr Ala Ser Gln Gln Gly Thr Ala Ala Leu 10 15 20 25 cag aag gag ctg aag agg atc aag att cct gac tac tca gac agc ttt 246 Gln Lys Glu Leu Lys Arg Ile Lys Ile Pro Asp Tyr Ser Asp Ser Phe 30 35 40 aag atc aag cat ctt ggg aag ggg cat tat agc ttc tac agc atg gac 294 Lys Ile Lys His Leu Gly Lys Gly His Tyr Ser Phe Tyr Ser Met Asp 45 50 55 atc cgt gaa ttc cag ctt ccc agt tcc cag ata agc atg gtg ccc aat 342 Ile Arg Glu Phe Gln Leu Pro Ser Ser Gln Ile Ser Met Val Pro Asn 60 65 70 gtg ggc ctt aag ttc tcc atc agc aac gcc aat atc aag atc agc ggg 390 Val Gly Leu Lys Phe Ser Ile Ser Asn Ala Asn Ile Lys Ile Ser Gly 75 80 85 aaa tgg aag gca caa aag aga ttc tta aaa atg agc ggc aat ttt gac 438 Lys Trp Lys Ala Gln Lys Arg Phe Leu Lys Met Ser Gly Asn Phe Asp 90 95 100 105 ctg agc ata gaa ggc atg tcc att tcg gct gat ctg aag ctg ggc agt 486 Leu Ser Ile Glu Gly Met Ser Ile Ser Ala Asp Leu Lys Leu Gly Ser 110 115 120 aac ccc acg tca ggc aag ccc acc atc acc tgc tcc agc tgc agc agc 534 Asn Pro Thr Ser Gly Lys Pro Thr Ile Thr Cys Ser Ser Cys Ser Ser 125 130 135 cac atc aac agt gtc cac gtg cac atc tca aag agc aaa gtc ggg tgg 582 His Ile Asn Ser Val His Val His Ile Ser Lys Ser Lys Val Gly Trp 140 145 150 ctg atc caa ctc ttc cac aaa aaa att gag tct gcg ctt cga aac aag 630 Leu Ile Gln Leu Phe His Lys Lys Ile Glu Ser Ala Leu Arg Asn Lys 155 160 165 atg aac agc cag gtc tgc gag aaa gtg acc aat tct gta tcc tcc aag 678 Met Asn Ser Gln Val Cys Glu Lys Val Thr Asn Ser Val Ser Ser Lys 170 175 180 185 ctg caa cct tat ttc cag act ctg cca gta atg acc aaa ata gat tct 726 Leu Gln Pro Tyr Phe Gln Thr Leu Pro Val Met Thr Lys Ile Asp Ser 190 195 200 gtg gct gga atc aac tat ggt ctg gtg gca cct cca gca acc acg gct 774 Val Ala Gly Ile Asn Tyr Gly Leu Val Ala Pro Pro Ala Thr Thr Ala 205 210 215 gag acc ctg gat gta cag atg aag ggg gag ttt tac agt gag aac cac 822 Glu Thr Leu Asp Val Gln Met Lys Gly Glu Phe Tyr Ser Glu Asn His 220 225 230 cac aat cca cct ccc ttt gct cca cca gtg atg gag ttt ccc gct gcc 870 His Asn Pro Pro Pro Phe Ala Pro Pro Val Met Glu Phe Pro Ala Ala 235 240 245 cat gac cgc atg gta tac ctg ggc ctc tca gac tac ttc ttc aac aca 918 His Asp Arg Met Val Tyr Leu Gly Leu Ser Asp Tyr Phe Phe Asn Thr 250 255 260 265 gcc ggg ctt gta tac caa gag gct ggg gtc ttg aag atg acc ctt aga 966 Ala Gly Leu Val Tyr Gln Glu Ala Gly Val Leu Lys Met Thr Leu Arg 270 275 280 gat gac atg att cca aag gag tcc aaa ttt cga ctg aca acc aag ttc 1014 Asp Asp Met Ile Pro Lys Glu Ser Lys Phe Arg Leu Thr Thr Lys Phe 285 290 295 ttt gga acc ttc cta cct gag gtg gcc aag aag ttt ccc aac atg aag 1062 Phe Gly Thr Phe Leu Pro Glu Val Ala Lys Lys Phe Pro Asn Met Lys 300 305 310 ata cag atc cat gtc tca gcc tcc acc ccg cca cac ctg tct gtg cag 1110 Ile Gln Ile His Val Ser Ala Ser Thr Pro Pro His Leu Ser Val Gln 315 320 325 ccc acc ggc ctt acc ttc tac cct gcc gtg gat gtc cag gcc ttt gcc 1158 Pro Thr Gly Leu Thr Phe Tyr Pro Ala Val Asp Val Gln Ala Phe Ala 330 335 340 345 gtc ctc ccc aac tcc tcc ctg gct tcc ctc ttc ctg att ggc atg cac 1206 Val Leu Pro Asn Ser Ser Leu Ala Ser Leu Phe Leu Ile Gly Met His 350 355 360 aca act ggt tcc atg gag gtc agc gcc gag tcc aac agg ctt gtt gga 1254 Thr Thr Gly Ser Met Glu Val Ser Ala Glu Ser Asn Arg Leu Val Gly 365 370 375 gag ctc aag ctg gat agg ctg ctc ctg gaa ctg aag cac tca aat att 1302 Glu Leu Lys Leu Asp Arg Leu Leu Leu Glu Leu Lys His Ser Asn Ile 380 385 390 ggc ccc ttc ccg gtt gaa ttg ctg cag gat atc atg aac tac att gta 1350 Gly Pro Phe Pro Val Glu Leu Leu Gln Asp Ile Met Asn Tyr Ile Val 395 400 405 ccc att ctt gtg ctg ccc agg gtt aac gag aaa cta cag aaa ggc ttc 1398 Pro Ile Leu Val Leu Pro Arg Val Asn Glu Lys Leu Gln Lys Gly Phe 410 415 420 425 cct ctc ccg acg ccg gcc aga gtc cag ctc tac aac gta gtg ctt cag 1446 Pro Leu Pro Thr Pro Ala Arg Val Gln Leu Tyr Asn Val Val Leu Gln 430 435 440 cct cac cag aac ttc ctg ctg ttc ggt gca gac gtt gtc tat aaa 1491 Pro His Gln Asn Phe Leu Leu Phe Gly Ala Asp Val Val Tyr Lys 445 450 455 tgaaggcacc aggggtgccg ggggctgtca gccgcacctg ttcctgatgg gctgtggggc 1551 accggctgcc tttccccagg gaatcctctc cagatcttaa ccaagagccc cttgcaaact 1611 tcttcgactc agattcagaa atgatctaaa cacgaggaaa cattattcat tggaaaagtg 1671 catggtgtgt attttaggga ttatgagctt ctttcaaggg ctaaggctgc agagatattt 1731 cctccaggaa tcgtgtttca attgtaacca agaaatttcc atttgtgctt catgaaaaaa 1791 aacttctggt ttttttcatg tg 1813 2 487 PRT Homo sapiens 2 Met Arg Glu Asn Met Ala Arg Gly Pro Cys Asn Ala Pro Arg Trp Val -30 -25 -20 Ser Leu Met Val Leu Val Ala Ile Gly Thr Ala Val Thr Ala Ala Val -15 -10 -5 -1 1 Asn Pro Gly Val Val Val Arg Ile Ser Gln Lys Gly Leu Asp Tyr Ala 5 10 15 Ser Gln Gln Gly Thr Ala Ala Leu Gln Lys Glu Leu Lys Arg Ile Lys 20 25 30 Ile Pro Asp Tyr Ser Asp Ser Phe Lys Ile Lys His Leu Gly Lys Gly 35 40 45 His Tyr Ser Phe Tyr Ser Met Asp Ile Arg Glu Phe Gln Leu Pro Ser 50 55 60 65 Ser Gln Ile Ser Met Val Pro Asn Val Gly Leu Lys Phe Ser Ile Ser 70 75 80 Asn Ala Asn Ile Lys Ile Ser Gly Lys Trp Lys Ala Gln Lys Arg Phe 85 90 95 Leu Lys Met Ser Gly Asn Phe Asp Leu Ser Ile Glu Gly Met Ser Ile 100 105 110 Ser Ala Asp Leu Lys Leu Gly Ser Asn Pro Thr Ser Gly Lys Pro Thr 115 120 125 Ile Thr Cys Ser Ser Cys Ser Ser His Ile Asn Ser Val His Val His 130 135 140 145 Ile Ser Lys Ser Lys Val Gly Trp Leu Ile Gln Leu Phe His Lys Lys 150 155 160 Ile Glu Ser Ala Leu Arg Asn Lys Met Asn Ser Gln Val Cys Glu Lys 165 170 175 Val Thr Asn Ser Val Ser Ser Lys Leu Gln Pro Tyr Phe Gln Thr Leu 180 185 190 Pro Val Met Thr Lys Ile Asp Ser Val Ala Gly Ile Asn Tyr Gly Leu 195 200 205 Val Ala Pro Pro Ala Thr Thr Ala Glu Thr Leu Asp Val Gln Met Lys 210 215 220 225 Gly Glu Phe Tyr Ser Glu Asn His His Asn Pro Pro Pro Phe Ala Pro 230 235 240 Pro Val Met Glu Phe Pro Ala Ala His Asp Arg Met Val Tyr Leu Gly 245 250 255 Leu Ser Asp Tyr Phe Phe Asn Thr Ala Gly Leu Val Tyr Gln Glu Ala 260 265 270 Gly Val Leu Lys Met Thr Leu Arg Asp Asp Met Ile Pro Lys Glu Ser 275 280 285 Lys Phe Arg Leu Thr Thr Lys Phe Phe Gly Thr Phe Leu Pro Glu Val 290 295 300 305 Ala Lys Lys Phe Pro Asn Met Lys Ile Gln Ile His Val Ser Ala Ser 310 315 320 Thr Pro Pro His Leu Ser Val Gln Pro Thr Gly Leu Thr Phe Tyr Pro 325 330 335 Ala Val Asp Val Gln Ala Phe Ala Val Leu Pro Asn Ser Ser Leu Ala 340 345 350 Ser Leu Phe Leu Ile Gly Met His Thr Thr Gly Ser Met Glu Val Ser 355 360 365 Ala Glu Ser Asn Arg Leu Val Gly Glu Leu Lys Leu Asp Arg Leu Leu 370 375 380 385 Leu Glu Leu Lys His Ser Asn Ile Gly Pro Phe Pro Val Glu Leu Leu 390 395 400 Gln Asp Ile Met Asn Tyr Ile Val Pro Ile Leu Val Leu Pro Arg Val 405 410 415 Asn Glu Lys Leu Gln Lys Gly Phe Pro Leu Pro Thr Pro Ala Arg Val 420 425 430 Gln Leu Tyr Asn Val Val Leu Gln Pro His Gln Asn Phe Leu Leu Phe 435 440 445 Gly Ala Asp Val Val Tyr Lys 450 455 3 20 PRT Homo sapiens 3 Val Asn Pro Gly Val Val Val Arg Ile Ser Gln Lys Gly Leu Asp Tyr 1 5 10 15 Ala Ser Gln Gln 20 4 20 PRT Homo sapiens 4 Val Asn Pro Gly Val Val Val Arg Ile Ser Gln Lys Gly Leu Asp Tyr 1 5 10 15 Ala Ser Gln Gln 20 5 56 DNA Artificial sequence Synthetic primer 5 gtcaatcctg gtgttgtggt caggatctct cagaagggcc tggattatgc ctccca 56 6 55 DNA Artificial sequence Synthetic primer 6 gcaaggcaca gctgccctgc agaaggagct gaagaggatc aagattcctg actat 55

Claims (11)

What is claimed is:
1. A purified, isolated DNA sequence comprising the sequence as set out in FIG. 5 or its complementary strand and DNA sequences which hybridize under stringent hybridization conditions with said DNA sequences.
2. A purified, isolated DNA sequence consisting essentially of a DNA sequence encoding a polypeptide having an amino acid sequence sufficiently duplicative of human bactericidal/permeability-increasing protein to allow possession of the biological property of increasing the permeability and killing of susceptible gram negative bacteria.
3. A purified, isolated DNA sequence which hybridizes under stringent hybridization conditions with DNA sequences that encode natural bactericidal/permeability increasing holoprotein.
4. A purified, isolated DNA sequence having the sequence of from nucleotide 123 to about nucleotide 780 as set out in FIG. 5.
5. The DNA sequence of claim 4 comprising a biologically-active fragment of bactericidal/permeability-increasing protein.
6. A purified, isolated protein having the properties of naturally occurring human bactericidal/permeability-increasing protein.
7. The purified, isolated protein of claim 7 comprising the amino acid sequence as set out in FIG. 5.
8. The purified, isolated protein comprising the amino acid sequence from amino acid residue 1 to about amino acid residue 220 as set out in FIG. 5.
9. A purified, isolated gene encoding human bactericidal/permeability-increasing protein.
10. A DNA plasmid vector consisting essentially of the DNA sequence of claim 1 in the proper reading frame.
11. A prokaryotic or eukaryotic cell stably transformed or transfected with the DNA vector of claim 10.
US10/716,389 1987-08-11 2003-11-18 Biologically active bactericidal/permeability-increasing protein fragments Abandoned US20040203026A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/716,389 US20040203026A1 (en) 1987-08-11 2003-11-18 Biologically active bactericidal/permeability-increasing protein fragments

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US8433587A 1987-08-11 1987-08-11
US22803588A 1988-08-05 1988-08-05
US76273091A 1991-09-17 1991-09-17
US07/805,031 US5198541A (en) 1987-08-11 1991-12-11 Dna encoding bactericidal/permeability-increasing proteins
US08/007,837 US5641874A (en) 1987-08-11 1993-01-22 DNA encoding bactericidal/permeability increasing proteins
US08/361,299 US5948408A (en) 1987-08-11 1995-01-23 DNA encoding bactericidal/permeability-increasing proteins
US09/309,217 US6287811B1 (en) 1987-08-11 1999-05-10 Biologically active bactericidal/permeability-increasing protein fragments
US09/866,514 US6652862B2 (en) 1987-08-11 2001-05-25 Biologically active bactericidal/permeability-increasing protein fragments
US10/716,389 US20040203026A1 (en) 1987-08-11 2003-11-18 Biologically active bactericidal/permeability-increasing protein fragments

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/866,514 Continuation US6652862B2 (en) 1987-08-11 2001-05-25 Biologically active bactericidal/permeability-increasing protein fragments

Publications (1)

Publication Number Publication Date
US20040203026A1 true US20040203026A1 (en) 2004-10-14

Family

ID=26770871

Family Applications (6)

Application Number Title Priority Date Filing Date
US07/805,031 Expired - Lifetime US5198541A (en) 1987-08-11 1991-12-11 Dna encoding bactericidal/permeability-increasing proteins
US08/007,837 Expired - Lifetime US5641874A (en) 1987-08-11 1993-01-22 DNA encoding bactericidal/permeability increasing proteins
US08/361,299 Expired - Lifetime US5948408A (en) 1987-08-11 1995-01-23 DNA encoding bactericidal/permeability-increasing proteins
US09/309,217 Expired - Fee Related US6287811B1 (en) 1987-08-11 1999-05-10 Biologically active bactericidal/permeability-increasing protein fragments
US09/866,514 Expired - Fee Related US6652862B2 (en) 1987-08-11 2001-05-25 Biologically active bactericidal/permeability-increasing protein fragments
US10/716,389 Abandoned US20040203026A1 (en) 1987-08-11 2003-11-18 Biologically active bactericidal/permeability-increasing protein fragments

Family Applications Before (5)

Application Number Title Priority Date Filing Date
US07/805,031 Expired - Lifetime US5198541A (en) 1987-08-11 1991-12-11 Dna encoding bactericidal/permeability-increasing proteins
US08/007,837 Expired - Lifetime US5641874A (en) 1987-08-11 1993-01-22 DNA encoding bactericidal/permeability increasing proteins
US08/361,299 Expired - Lifetime US5948408A (en) 1987-08-11 1995-01-23 DNA encoding bactericidal/permeability-increasing proteins
US09/309,217 Expired - Fee Related US6287811B1 (en) 1987-08-11 1999-05-10 Biologically active bactericidal/permeability-increasing protein fragments
US09/866,514 Expired - Fee Related US6652862B2 (en) 1987-08-11 2001-05-25 Biologically active bactericidal/permeability-increasing protein fragments

Country Status (1)

Country Link
US (6) US5198541A (en)

Families Citing this family (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5576292A (en) * 1987-08-11 1996-11-19 New York University Biologically active bactericidal/permeability-increasing protein fragments
ATE312844T1 (en) * 1987-08-11 2005-12-15 Univ New York BIOLOGICALLY ACTIVE BACTERICIDES/PERMEABILITY-INCREASING PROTEIN BREAKS
US5198541A (en) * 1987-08-11 1993-03-30 New York University Dna encoding bactericidal/permeability-increasing proteins
US6274348B1 (en) 1992-05-19 2001-08-14 Xoma Corporation Methods for the preparation of positively charged proteins
WO1993023540A2 (en) * 1992-05-19 1993-11-25 Xoma Corporation Improved methods for the preparation of endotoxin-binding proteins
US6024090A (en) * 1993-01-29 2000-02-15 Aradigm Corporation Method of treating a diabetic patient by aerosolized administration of insulin lispro
US6131567A (en) * 1993-01-29 2000-10-17 Aradigm Corporation Method of use of monomeric insulin as a means for improving the reproducibility of inhaled insulin
US5888477A (en) * 1993-01-29 1999-03-30 Aradigm Corporation Use of monomeric insulin as a means for improving the bioavailability of inhaled insulin
US5743250A (en) 1993-01-29 1998-04-28 Aradigm Corporation Insulin delivery enhanced by coached breathing
US5915378A (en) * 1993-01-29 1999-06-29 Aradigm Corporation Creating an aerosolized formulation of insulin
US5970973A (en) * 1993-01-29 1999-10-26 Aradigm Corporation Method of delivering insulin lispro
US5873358A (en) * 1993-01-29 1999-02-23 Aradigm Corporation Method of maintaining a diabetic patient's blood glucose level in a desired range
US5420019A (en) * 1993-02-02 1995-05-30 Xoma Corporation Stable bactericidal/permeability-increasing protein muteins
CN1163264C (en) * 1993-02-02 2004-08-25 爱克索马技术有限公司 Pharmaceutical compositions containing bactericidal permeability increasing protein and a surfactant
US5652332A (en) * 1993-03-12 1997-07-29 Xoma Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6214789B1 (en) * 1993-03-12 2001-04-10 Xoma Corporation Treatment of mycobacterial diseases by administration of bactericidal/permeability-increasing protein products
AU7175694A (en) 1993-06-17 1995-01-17 Xoma Corporation Lipopolysaccharide binding protein derivatives
AU7330994A (en) * 1993-07-14 1995-02-13 Xoma Corporation Method for potentiating bpi protein product bactericidal activity by administration of lbp protein products
US5770561A (en) * 1993-07-14 1998-06-23 Xoma Corporation Method for potentiating BPI protein product bactericidal activity by administration of LBP protein products
CA2172245C (en) * 1993-09-22 2003-04-08 Jonathan Cohen Method of treating gram-negative bacterial infection by administration of bactericidal/permeability-increasing (bpi) protein
CN1133634A (en) * 1993-09-22 1996-10-16 爱克斯欧玛公司 Method for quantifying BPI in body fluids
US6759203B1 (en) 1993-09-22 2004-07-06 Xoma Corporation Method for quantifying BPI in body fluids
JPH09508357A (en) * 1994-01-14 1997-08-26 ゾーマ コーポレイション Antifungal methods and materials
EP0754050B1 (en) * 1994-01-14 2002-06-26 XOMA Technology Ltd. Anti gram positive bacterial methods and materials
US5643875A (en) * 1994-01-24 1997-07-01 Friedmann; Nadav Human therapeutic uses of bactericidal/permeability increasing (BPI) protein products
US5447913A (en) * 1994-03-11 1995-09-05 Xoma Corporation Therapeutic uses of bactericidal/permeability-increasing protein dimer products
US5786324A (en) * 1994-03-24 1998-07-28 Regents Of The University Of Minnesota Synthetic peptides with bactericidal activity and endotoxin neutralizing activity for gram negative bacteria and methods for their use
US5830860A (en) * 1994-03-24 1998-11-03 Regents Of The University Of Minnesota Peptides with bactericidal activity and endotoxin neutralizing activity for gram negative bacteria and methods for their use
US5578568A (en) * 1994-04-22 1996-11-26 Xoma Corporation Method of treating conditions associated with intestinal ischemia/reperfusion
US5932544A (en) * 1994-05-31 1999-08-03 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) compositions
US5646114A (en) * 1994-07-11 1997-07-08 Xoma Corporation Anti-protozoan methods
US6271203B1 (en) 1994-07-07 2001-08-07 Xoma Corporation Anti-protozoan methods and materials
US5494896A (en) * 1995-03-31 1996-02-27 Xoma Corporation Method of treating conditions associated with burn injuries
CA2227292A1 (en) * 1995-07-20 1997-02-06 Xoma Corporation Anti-fungal peptides
ATE198050T1 (en) 1996-05-10 2000-12-15 Xoma Technology Ltd THERAPEUTIC USES OF BPI PROTEIN PRODUCTS FOR THE TREATMENT OF HUMAN MENINGOCOCCEMIA
US5741779A (en) * 1996-05-10 1998-04-21 Xoma Corporation Antithrombotic materials and methods
EP0907372B1 (en) * 1996-05-23 2003-03-12 XOMA Technology Ltd. Therapeutic uses of bpi protein products in humans with hemorrhage due to trauma
US6486125B1 (en) * 1996-05-24 2002-11-26 Regents Of The University Of Minnesota Synthesis of soluble β-sheet forming peptides
US5888973A (en) * 1996-08-09 1999-03-30 Xoma Corporation Anti-chlamydial uses of BPI protein products
US6482796B2 (en) 1996-11-01 2002-11-19 Xoma Corporation Therapeutic uses of N-terminal BPI protein products in ANCA-positive patients
US6093573A (en) * 1997-06-20 2000-07-25 Xoma Three-dimensional structure of bactericidal/permeability-increasing protein (BPI)
US6013631A (en) 1998-06-19 2000-01-11 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
WO2000023101A1 (en) 1998-10-22 2000-04-27 Eli Lilly And Company Methods for treating sepsis
BR9804648A (en) * 1998-11-23 2000-05-30 Fundacao Oswaldo Cruz Monitoring of patient compliance with treatment and bioavailability of drugs by deproteinization of body fluids.
JP2003500363A (en) 1999-05-24 2003-01-07 ゾーマ(ユーエス) エルエルシー Therapeutic use of BPI protein products in humans with otitis media with effusion
AU2005202199B2 (en) * 1999-05-24 2007-08-09 Xoma Technology Ltd Therapeutic uses of BPI protein products in humans with otitis media with effusion
WO2001003724A1 (en) * 1999-07-12 2001-01-18 Xoma Technology Ltd. Therapeutic uses of bpi protein products for inhibiting h+/k+ atpase activity
AU1751801A (en) * 1999-11-19 2001-05-30 Eli Lilly And Company Protein c derivatives
CA2430588A1 (en) * 2000-12-01 2002-07-18 Xoma Technology Ltd. Modulation of pericyte proliferation using bpi protein products or bpi inhibitors
JP2005536453A (en) 2002-02-20 2005-12-02 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Partial peptide mimetics and methods
WO2004033693A1 (en) 2002-03-29 2004-04-22 Xoma Technology Ltd. Methods vectors plasmids and methods for increasing expression of recombinant polypeptides
EP1741440A1 (en) 2005-07-08 2007-01-10 Mellitus S.L. Use of BPI protein for the treatment of disorders of the metabolism and cardiovascular disorders
EP3839572B1 (en) 2010-05-06 2023-10-18 Immunolight, Llc. Adhesive bonding composition and method of use
US20140166202A1 (en) 2012-12-11 2014-06-19 Immunolight, Llc. Bonding of substrates induced by ionizing radiation
GB201319621D0 (en) 2013-11-06 2013-12-18 Norwegian University Of Science And Technology Antimicrobial agents and their use in therapy
GB201319620D0 (en) 2013-11-06 2013-12-18 Norwegian University Of Science And Technology Immunosuppressive agents and their use in therapy
ES2948676T3 (en) 2014-03-18 2023-09-15 Immunolight Llc Improved adhesive bond composition and method of use
EP3160734B1 (en) 2014-06-30 2023-09-06 Immunolight, Llc. Improved adhesive bonding composition and method of use
ES2556262B1 (en) * 2014-07-11 2016-12-27 Torres Servicios Técnicos, Sl. Method for firefighting and projectile for firefighting

Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5087569A (en) * 1986-11-26 1992-02-11 Cornell Research Foundation, Inc. And The Rockefeller University Antimicrobial proteins, compositions containing same and uses thereof
US5089274A (en) * 1989-02-14 1992-02-18 Incyte Pharmaceuticals, Inc. Use of bactericidal/permeability increasing protein or biologically active analogs thereof to treat endotoxin-related disorders
US5126257A (en) * 1986-11-26 1992-06-30 Cornell Research Foundation Antimicrobial proteins, compositions containing same and uses thereof
US5171739A (en) * 1989-02-14 1992-12-15 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and preventation thereof using a BPI protein
US5308834A (en) * 1989-02-14 1994-05-03 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and prevention thereof using a BPI protein
US5334584A (en) * 1989-02-14 1994-08-02 Incyte Pharamaceuticals, Inc. Recombinant, non-glycosylated bpi protein and uses thereof
US5489676A (en) * 1990-03-30 1996-02-06 Elsbach; Peter Polypeptides that potentiate bactericidal/permeability-increasing protein and methods for treating bacterial infections
US5652332A (en) * 1993-03-12 1997-07-29 Xoma Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US5674834A (en) * 1993-02-02 1997-10-07 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5686414A (en) * 1995-11-14 1997-11-11 Xoma Corporation Methods of treating conditions associated with corneal transplantation
US5703038A (en) * 1994-03-11 1997-12-30 Xoma Corporation Therapeutic uses of bactericidal-permeability-increasing protein dimer products
US5733872A (en) * 1993-03-12 1998-03-31 Xoma Corporation Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US5756464A (en) * 1996-05-23 1998-05-26 Xoma Corporation Therapeutic uses of BPI protein products in humans with hemmorhage due to trauma
US5807818A (en) * 1993-03-12 1998-09-15 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein (BPI) protein products
US5837678A (en) * 1993-03-12 1998-11-17 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein products
US5980897A (en) * 1987-08-11 1999-11-09 New York University Biologically active bactericidal/permeability-increasing protein fragments
US6132775A (en) * 1987-08-11 2000-10-17 New York University Therapeutic uses of biologically active bactericidal/permeability-increasing protein fragments
US6162788A (en) * 1996-08-09 2000-12-19 Xoma Corporation Uses of BPI protein products
US6376465B1 (en) * 1999-04-01 2002-04-23 Xoma Technology Ltd., Therapeutic uses of BPI protein products in BPI-deficient humans
US20030027762A1 (en) * 1999-04-01 2003-02-06 Xoma Technology Ltd. Therapeutic uses of BPI protein products in BPI-deficient humans
US6586400B2 (en) * 1994-01-24 2003-07-01 Xoma Corporation Human therapeutic uses of BPI protein products
US6596691B2 (en) * 1996-05-10 2003-07-22 Xoma Corporation Therapeutic uses of BPI protein products for human meningococcemia
US6599880B1 (en) * 1998-06-19 2003-07-29 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
US20030144195A1 (en) * 1999-06-25 2003-07-31 Little Roger G. Therapeutic peptide-based constructs
US6620785B2 (en) * 1993-03-12 2003-09-16 Xoma Corporation Treatment of Mycobacterial diseases by administration of bactericidal/permeability-increasing protein products
US6652862B2 (en) * 1987-08-11 2003-11-25 New York University Biologically active bactericidal/permeability-increasing protein fragments
US6670327B1 (en) * 1999-05-24 2003-12-30 Xoma (Us) Llc Therapeutic uses of BPI protein products in humans with otitis media with effusion
US20040014153A1 (en) * 1997-06-20 2004-01-22 Beamer Lesa J. Bactericidal/permeability-increasing protein: crystallization, x-ray diffraction, three-dimensional structure determination, rational drug design and molecular modeling of related proteins
US6686332B1 (en) * 1993-10-15 2004-02-03 Xoma Corporation Method of treating depressed reticuloendothelial system function
US20040023884A1 (en) * 1993-03-12 2004-02-05 Xoma Corporation Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6824818B2 (en) * 2001-12-27 2004-11-30 Soliant Llc Wet on wet process for producing films
US20050080008A1 (en) * 1996-05-10 2005-04-14 White Mark L. Antithrombotic materials and methods
US20050209837A1 (en) * 1998-06-22 2005-09-22 Beamer Lesa J Bactericidal/permeability-increasing protein: crystallization, x-ray diffraction, three-dimensional structure determination, rational drug design and molecular modeling or related proteins

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3923492A1 (en) * 1989-05-20 1991-02-07 Hoechst Ag New phosphonous acid aryl ester(s)

Patent Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5126257A (en) * 1986-11-26 1992-06-30 Cornell Research Foundation Antimicrobial proteins, compositions containing same and uses thereof
US5087569A (en) * 1986-11-26 1992-02-11 Cornell Research Foundation, Inc. And The Rockefeller University Antimicrobial proteins, compositions containing same and uses thereof
US6652862B2 (en) * 1987-08-11 2003-11-25 New York University Biologically active bactericidal/permeability-increasing protein fragments
US5980897A (en) * 1987-08-11 1999-11-09 New York University Biologically active bactericidal/permeability-increasing protein fragments
US6132775A (en) * 1987-08-11 2000-10-17 New York University Therapeutic uses of biologically active bactericidal/permeability-increasing protein fragments
US5171739A (en) * 1989-02-14 1992-12-15 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and preventation thereof using a BPI protein
US5334584A (en) * 1989-02-14 1994-08-02 Incyte Pharamaceuticals, Inc. Recombinant, non-glycosylated bpi protein and uses thereof
US5308834A (en) * 1989-02-14 1994-05-03 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and prevention thereof using a BPI protein
US5089274A (en) * 1989-02-14 1992-02-18 Incyte Pharmaceuticals, Inc. Use of bactericidal/permeability increasing protein or biologically active analogs thereof to treat endotoxin-related disorders
US5489676A (en) * 1990-03-30 1996-02-06 Elsbach; Peter Polypeptides that potentiate bactericidal/permeability-increasing protein and methods for treating bacterial infections
US6433140B1 (en) * 1993-02-02 2002-08-13 Xoma Corporation Stable bactericidal permeability-increasing protein products and pharmaceutical compositions containing the same
US5674834A (en) * 1993-02-02 1997-10-07 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5827816A (en) * 1993-02-02 1998-10-27 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US20040024179A1 (en) * 1993-03-12 2004-02-05 Xoma Technology Ltd. Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US20050118112A1 (en) * 1993-03-12 2005-06-02 Xoma Corporation Treatment of Mycobacterial diseases by administration of bacterial/permeability-increasing protein products
US5763567A (en) * 1993-03-12 1998-06-09 Xoma Corporation Biologically active peptides from funcional domains of bactericidal/permeability-increasing protein and uses thereof
US5837678A (en) * 1993-03-12 1998-11-17 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein products
US5854214A (en) * 1993-03-12 1998-12-29 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein products
US20040023884A1 (en) * 1993-03-12 2004-02-05 Xoma Corporation Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US5856438A (en) * 1993-03-12 1999-01-05 Xoma Corporation Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6620785B2 (en) * 1993-03-12 2003-09-16 Xoma Corporation Treatment of Mycobacterial diseases by administration of bactericidal/permeability-increasing protein products
US5733872A (en) * 1993-03-12 1998-03-31 Xoma Corporation Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6495516B1 (en) * 1993-03-12 2002-12-17 Xoma Technology Ltd. Method for killing gram-negative bacteria with biologically active peptides from functional domains of bacterial/permeability-increasing protein
US5807818A (en) * 1993-03-12 1998-09-15 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein (BPI) protein products
US5652332A (en) * 1993-03-12 1997-07-29 Xoma Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6686332B1 (en) * 1993-10-15 2004-02-03 Xoma Corporation Method of treating depressed reticuloendothelial system function
US6586400B2 (en) * 1994-01-24 2003-07-01 Xoma Corporation Human therapeutic uses of BPI protein products
US5703038A (en) * 1994-03-11 1997-12-30 Xoma Corporation Therapeutic uses of bactericidal-permeability-increasing protein dimer products
US5856302A (en) * 1994-03-11 1999-01-05 Xoma Corporation Therapeutic uses of bactericidal/permeability-increasing protein dimer products
US5686414A (en) * 1995-11-14 1997-11-11 Xoma Corporation Methods of treating conditions associated with corneal transplantation
US6596691B2 (en) * 1996-05-10 2003-07-22 Xoma Corporation Therapeutic uses of BPI protein products for human meningococcemia
US20050080008A1 (en) * 1996-05-10 2005-04-14 White Mark L. Antithrombotic materials and methods
US5756464A (en) * 1996-05-23 1998-05-26 Xoma Corporation Therapeutic uses of BPI protein products in humans with hemmorhage due to trauma
US6162788A (en) * 1996-08-09 2000-12-19 Xoma Corporation Uses of BPI protein products
US20040014153A1 (en) * 1997-06-20 2004-01-22 Beamer Lesa J. Bactericidal/permeability-increasing protein: crystallization, x-ray diffraction, three-dimensional structure determination, rational drug design and molecular modeling of related proteins
US6599880B1 (en) * 1998-06-19 2003-07-29 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
US20050209837A1 (en) * 1998-06-22 2005-09-22 Beamer Lesa J Bactericidal/permeability-increasing protein: crystallization, x-ray diffraction, three-dimensional structure determination, rational drug design and molecular modeling or related proteins
US6376465B1 (en) * 1999-04-01 2002-04-23 Xoma Technology Ltd., Therapeutic uses of BPI protein products in BPI-deficient humans
US20030027762A1 (en) * 1999-04-01 2003-02-06 Xoma Technology Ltd. Therapeutic uses of BPI protein products in BPI-deficient humans
US6670327B1 (en) * 1999-05-24 2003-12-30 Xoma (Us) Llc Therapeutic uses of BPI protein products in humans with otitis media with effusion
US20030144195A1 (en) * 1999-06-25 2003-07-31 Little Roger G. Therapeutic peptide-based constructs
US6964948B2 (en) * 1999-06-25 2005-11-15 Xoma Technology Ltd. Therapeutic peptide-based constructs derived from Domain II of bactericidal/permeability-increasing protein
US6824818B2 (en) * 2001-12-27 2004-11-30 Soliant Llc Wet on wet process for producing films

Also Published As

Publication number Publication date
US5948408A (en) 1999-09-07
US20020137050A1 (en) 2002-09-26
US6652862B2 (en) 2003-11-25
US5641874A (en) 1997-06-24
US5198541A (en) 1993-03-30
US6287811B1 (en) 2001-09-11

Similar Documents

Publication Publication Date Title
US6652862B2 (en) Biologically active bactericidal/permeability-increasing protein fragments
US5980897A (en) Biologically active bactericidal/permeability-increasing protein fragments
EP0563222B1 (en) Biologically active bactericidal/permeability-increasing protein fragments
US6054431A (en) Anti-gram-positive bacterial methods and materials
US6228834B1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6153730A (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
AU695814B2 (en) Method of treating gram-negative bacterial infection by administration of bactericidal/permeability-increasing (bpi) protein product and antibiotic
WO1994020532A1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6274344B1 (en) Methods for recombinant microbial production of fusion proteins and BPI-derived peptides
WO1995002414A1 (en) Method for potentiating bpi protein product bactericidal activity by administration of lbp protein products
AU755624B2 (en) Bactericidal/permeability-increasing protein (BPI) deletion analogs
US5576292A (en) Biologically active bactericidal/permeability-increasing protein fragments
US6132775A (en) Therapeutic uses of biologically active bactericidal/permeability-increasing protein fragments
US20040023884A1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
JP3040781B2 (en) Biologically active bactericidal / permeability enhancing protein fragments
US20020119918A1 (en) Therapeutic uses of n-terminal bpi protein products in anca-positive patients
AU681453C (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION