Búsqueda Imágenes Maps Play YouTube Noticias Gmail Drive Más »
Búsqueda avanzada de patentes | Historial web | Iniciar sesión

Patentes

Número de publicaciónUS6468743 B1
Tipo de publicaciónConcesión
Número de solicitud09/313,221
Fecha de publicación22 Oct 2002
Fecha de presentación17 May 1999
Fecha de prioridad
18 May 1998
También publicado como
Inventores
Cesionario original
Clasificación de EE.UU.
Clasificación internacional
Clasificación cooperativa
Clasificación europea
C12Q1/68M10B
Referencias
Enlaces externos
PCR techniques for detecting microbial contaminants in foodstuffs
US 6468743 B1
Resumen

A method or detecting the presence of living or dead microorganisms and viruses in a sample comprises adding to a pre-determined volume of a sample comprising nucleic acid-containing microbe (s) and/or virus (es), known amounts of a pair of primers binding to sequences up-stream and down-stream to a universal or specific microbial and/or viral nucleic acid sequence and polymerase chain reaction (PCR) reagents, cycling the mixture to amplify the universal or specific microbial and/or viral nucleic acid sequence; adding a polynucleotide comprising a DNA internal segment that is hybridizably complementary to at least a portion of the universal or specific nucleic acid sequence; and a first and a second DNA arm segment adjoining the DNA internal segment, the first DNA arm segment ending in a 5′ terminus and the second DNA arm segment ending in a 3′ terminus, the arms segments comprising nucleotide sequences such that they are hybridizably complementary to one another. Optionally, the terminus of one arm segment is operatively connected to a fluorogen and the terminus of the other arm segment is operatively connected to a quencher, such that the polynucleotide comprises a “fluorescent beacon.”

Reclamaciones
What is claimed as novel & unobvious in U.S. Letters Patent is:

1. An in vitro method of detecting the presence of a microbe in a food sample, comprising:

(a) forming a polymerase chain reaction mixture by combining (1) a predetermined volume of a food sample to be tested for the presence of a universal bacteria nucleic acid sequence comprising 5′-CCACCGAATCTTCGTCGGTGG-3′ (SEQ. ID. NO.: 144) and sequences upstream and downstream of the universal bacteria nucleic acid sequence (2) known amounts of a first nucleic acid primer and a second nucleic acid primer for binding to the upstream sequence and the downstream sequence, respectively, wherein a fluorogen is connected to one end of the first or second primer, and a (3) polynucleotide containing a single-stranded DNA probe that specifically hybridizes to SEQ. ID. NO.: 144 and wherein the polynucleotide assumes a stem-loop structure in the absence of the universal or bacterial nucleic acid sequence wherein the polynucleotide comprises a DNA internal segment being complementary to at least a portion of the universal bacterial nucleic acid sequence and a first and a second DNA arm segment adjoining the DNA internal segment, each of the arm segments comprising nucleotide sequences such that the arm segments are complementary to one another and (4) polymerase chain reaction reagents;

(b) forming a polymerase chain reaction product by cycling the polymerase chain reaction mixture under conditions whereby the universal bacterial nucleic acid sequence is replicated to from about 0.25 to about 10,000 μg nucleotide product/μl mixture;

(c) quenching any primer not bound to the upstream or the downstream sequences in the polymerase chain reaction product;

(d) hybridizing the DNA probe to the universal bacterial nucleic acid sequence, if present, and change the conformation of the stem-loop structure, the presence of a microbe in the sample is determined by detecting the conformational change in the stem-loop structure of the polynucleotide; and

(e) determining whether or not the universal bacterial nucleic acid sequence is present in the polymerase chain reaction product, the presence of the universal bacterial nucleic acid sequence detecting the presence of a microbe in the food sample.

2. The method in accordance with claim 1, wherein the internal DNA segment and the arm segments comprise a sequence complementary to at least a portion of a contiguous universal bacterial nucleic acid sequence.

3. An in vitro method of detecting the presence of a microbe in a food sample, comprising the steps of:

(a) forming a polymerase chain reaction mixture by combining (1) a predetermined volume of a food sample to be tested for the presence of a nucleic acid sequence comprising a universal bacteria nucleic acid sequence comprising 5′-CCACCGAATCTTCGTCGGTGG-3′ (SEQ. ID. NO.: 144) of a microbe and sequences upstream and downstream of the universal bacterial nucleic acid sequence (2) known amounts of a first nucleic acid primer and a second nucleic acid primer for binding to the upstream sequence and the downstream sequence, respectively, wherein a fluorogen is connected to one end of the first or second primer and (3) polymerase chain reaction reagents;

(b) forming a polymerase chain reaction product by cycling the polymerase chain reaction mixture under conditions whereby the universal bacterial nucleic acid sequence is replicated to from about 0.25 to about 10,000 μg nucleotide product/μl mixture;

(c) adding to the polymerase chain reaction product a polynucleotide containing a single-stranded DNA probe that specifically hybridizes to SEQ ID NO: 144 and wherein the polynucleotide assumes a stem-loop structure in the absence of the universal bacterial nucleic acid sequence wherein the polynucleotide comprises a DNA internal segment being complementary to at least a portion of the universal bacterial nucleic acid sequence and a first and a second DNA arm segment adjoining the DNA internal segment, each of the arm segments comprising nucleotide sequences such that the arm segments are complementary to one another;

(d) quenching any primer not bound to the upstream or the downstream sequences in the polymerase chain reaction product;

(e) determining whether or not the universal bacterial nucleic acid sequence is present in the polymerase chain reaction product, the presence of the universal bacterial nucleic acid sequence detecting the presence of a microbe in the food sample; and

(f) hybridizing the DNA probe to the universal bacterial nucleic acid sequence, if present, and change the conformation of the stem-loop structure, the presence of a microbe in the sample is determined by detecting the conformational change in the stem-loop structure of the polynucleotide.

4. The method in accordance to claim 3, wherein the internal DNA segment and the arm segments comprise a sequence complementary to at least a portion of a contiguous universal nucleic acid sequence.

5. An in vitro method of detecting the presence of a bacterium in a food sample, comprising the steps of:

forming a polymerase chain reaction mixture by combining (1) a predetermined volume of a food sample to be tested for the presence of a nucleic acid sequence comprising a universal nucleic acid sequence comprising 5′-CCACCGAATCTTCGTCGGTGG-3′ (SEQ. ID. NO: 144) and sequences upstream and downstream of the universal or specific nucleic acid sequence, (2) known amounts of a first nucleic acid primer and a second nucleic acid primer for binding to the upstream sequence and the downstream sequence, respectively, wherein a fluorogen is connected to one end of the first or second primer, and (3) polymerase chain reaction reagents;

forming a polymerase chain reaction product by cycling the polymerase chain reaction mixture under conditions whereby the universal or specific nucleic acid sequence is replicated to from about 0.25 to about 10,000 μg nucleotide product/μl mixture;

adding to the polymerase chain reaction mixture or to the polymerase chain reaction product a polynucleotide comprising a DNA internal segment specifically hybridizes to SEQ ID NO: 144 and a first and a second DNA arm segment adjoining the DNA internal segment, each of the arm segments comprises nucleotide sequences such that the arm segments are complementary to one another, the polynucleotide assuming a stem-loop structure in the absence of the universal or specific nucleic acid sequence;

hybridizing the DNA probe to at the universal nucleic acid sequence, if present, and changing the conformation of the stem-loop structure;

quenching any primer not bound to the upstream or the downstream sequences in the polymerase chain reaction product; and

detecting the presence of a bacterium in the food sample by determining whether or not the universal or specific nucleic acid sequence is present in the polymerase chain reaction product by detecting whether there was a conformational change in the stem-loop structure of the polynucleotide.

6. The method in accordance with claim 5, wherein a change in conformation of the stem-loop structure is detected by a fluorescent detection system.

7. The method in accordance with claim 6, wherein a change in conformation of the stem-loop structure results in fluorescence from the polynucleotide.

8. The method in accordance with claim 5, wherein the polynucleotide is added to the polymerization reaction mixture.

9. The method in accordance with claim 5, wherein the polynucleotide is added to the polymerization reaction product.

10. The method in accordance with claim 5, wherein any primer not bound to the upstream or the downstream sequences in the polymerase chain reaction product is quenched by adding to the polymerase chain reaction product an oligonucleotide that is complimentary to the primer and has a quencher attached to said oligonucleotide.

11. The method in accordance with claim 5, wherein the fluorogen is connected to the 5′ end of the first primer or the second primer and any primer that is not bound to the upstream or the down stream sequences in the polymerase chain reaction product is quenched by adding to the polymerase chain reaction product an oligonucleotide that is complimentary to the primer and has a quencher attached to the 3′ end of said oligonucleotide.

12. The method in accordance with claim 5, wherein the fluorogen is fluorescein and the quencher is dabcyl.

13. The method in accordance with claim 5, wherein the cycling is conducted about 1 to 30 times at alternative temperatures of about 95° C. to about 58° C., about 58° C. to a 74° C. or 74° C. to 95° C.

14. The method in accordance to claim 5, wherein the internal DNA segment and the arm segments comprise a sequence complementary to at least a portion of a contiguous universal nucleic acid sequence.

15. The method in accordance with claim 5, wherein the ratio of polynucleotide and primer concentrations is about 0.6 to 1 to about 1.6 to 1.

16. The method in accordance with claim 5, further comprising adding to the polymerase chain reaction product single-stranded DNA that is complementary to at least a portion of the universal nucleic acid sequence and hybridizing the DNA to at least a portion of the universal nucleic acid sequence, if present, to form double stranded nucleic acid; and detecting the presence of the universal nucleic acid sequence in the polymerase chain reaction product by detecting any double stranded DNA.

17. The method in accordance with claim 16, wherein the formation of double stranded nucleic acid is detected by a fluorescent detection system and wherein when no universal nucleic acid is present and replicated by the polymerase chain reaction in the sample the internal DNA segment remains single stranded and flourescence is detected, and when there is nucleic acid present and replicated by the polymerase chain reaction, its bacterial nucleic acid sequence is double stranded and operatively bound to the fluoregenic agent fluoresces.

18. The method of claim 17, wherein the internal DNA segment and the universal nucleic acid sequence, if present in the polymerase reaction product, are separated prior to the fluorescence detection.

19. The method of claim 18, wherein the internal DNA segment and the universal nucleic acid sequence, if present in the polymerase reaction product, are separated by electrophoresis.

20. The method of claim 19, further comprising staining the internal DNA segment and the universal nucleic acid sequence, if present in the polymerase reaction product, with a DNA stain that operatively binds to double stranded nucleic acid, but not to single stranded nucleic acid.

21. The method in accordance with claim 20, wherein the DNA stain is ethidium bromide and fluorescence is detected under ultraviolet light.

Descripción

This invention claims priority based on Ser. No. 60/086,025, filed May 18, 1998.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a novel technology provided in the form of novel primers, probes, and beacons, and their use in a rapid and accurate assay and kit for assaying for the presence of a microorganism or virus, particularly a bacterium, in a sample. More specifically, this invention relates to an accurate method for assessing microbial, e. g. bacterial or viral, contamination of sterile substances, such as sterile foods, by microorganisms and/or viruses relying on PCR and fluorescent beacon technologies.

2. Description of the Background

Beacons are fluorescent probes which contain short complementary sequences of nucleotide, (arms) attached to the 5′ and 3′ ends of a probe of a sequence complementary to a target nucleic acid. In addition, the beacon comprises a fluor, fluorophore or fluorogen (fluorogenic agent) and a quencher attached, e. g. via linkers, to the ends of the stem or arms. In the absence of a target, the fluor and the quencher remain close to one another held in place by a hairpin loop stem formed by hybridization of the arms. In this conformation, the beacon does not fluoresce because of quenching. However, when the segment encompassed by the loop hybridizes to a complementary sequence, the hybridization of the arms is prevented, the fluor, fluorophore or fluorogenic agent and the quencher are held apart and fluorescence appears. Thus, the appearance of fluorescence is an indication of hybridization of the probe (DNA internal segment of the beacon) to a complementary nucleic acid sequence of a target. The annealing of a strand of nucleic acid to its complement, thus, may now be measured by following changes in the physical properties of the nucleic acids which occur upon hybridization.

Prior technology utilized, and immobilized the hybridized strands onto, a solid surface, removed unhybridized probes and then determined the number of probes attached to the solid phase. The need for removal of unhybridized probes precluded the application of solid phase hybridization to real time studies involving hybridization of nucleic acids. In addition, solid phase technology also has sensitivity limitations because the probes also bind non-specifically to the solid phase.

In the past the detection of microorganisms was made, generally, by phenotypic observation. Upon the realization that all living cells contain DNA and that DNA is responsible for the expression of phenotypic traits, novel detection methods relying on genetic parameters have been implemented. The polymerase chain reaction (PCR), a relatively recent technological development for amplification of DNA, provides significantly higher sensitivity and, thus, permits the detection of smaller quantities of nucleic acid by amplification and subsequent visualization, for instance, after electrophoretic separation and staining. Fluorescent dyes are also utilized by, for example, attachment to complementary oligomers (hybridization) that bind PCR-amplified DNA. These and other detection technologies eliminate the need for naked eye visualization of PCR products and, therefore, eliminate the need to electrophorese the nucleic acids, except for determining their molecular weight.

As is known in the art, the fidelity of specific DNA sequences produced by PCR is controlled by the primer DNA sequences used and by reaction conditions, such as thermocycling parameters, and the composition of the reaction mixture. DNA primers are generally designed to target specific sites vicinal to a desired sequence and applied to obtain DNA products of complementary sequences by the PCR, along with specifically tailored fluorescent molecular beacons designed to detect only the PCR product.

The detection of pathogens in edible products, cosmetics, medical fluids such as blood and IV solutions, and other products involved in commerce, is of great importance to avoid costly contamination, which may lead to outbreaks of disease and/or the need to discard large batches even after distribution. In most cases, even the etiological agent remains unidentified because of the sparcity of adequate testing technology to do this. Traditional technologies for recovering microorganisms from, for example, a foodstuff might include homogenization of the product in a buffered solution, inoculation of the homogenate in a selective enrichment medium, long hours of incubation at controlled temperatures, streaking of the broth onto a selective and/or differential agar medium, another incubation, isolation of colonies and finally a multiplicity of tests for biochemical or immunological characteristics and microscopic examination. Virulence is mostly tested on pure cultures which require several days of incubation. In addition, for sterility testing, the mere detection of biologically active DNA is critical.

Accordingly, there is a need for a rapid, simple, inexpensive and sensitive method for the general detection of microorganisms and/or viruses in commercial products as well as in pure cultures of microorganisms and viruses.

SUMMARY OF THE INVENTION

This invention relates to an in vitro method of detecting the presence of a microbe or a virus in a food sample, comprising the steps of:

(a) forming a polymerase chain reaction mixture by combining (1) a predetermined volume of a food sample to be tested for the presence of a nucleic acid sequence comprising a universal or specific nucleic acid sequence indicative of a microbe or a virus and sequences upstream and downstream of the universal or specific nucleic acid sequence, (2) known amounts of a first nucleic acid primer and a second nucleic acid primer for binding to the upstream sequence and the downstream sequence, respectively, and (3) polymerase chain reaction reagents;

(b) forming a polymerase chain reaction product by cycling the polymerase chain reaction mixture under conditions effective to amplify the universal or specific nucleic sequence, if present, to replicate and attain about 0.25 to about 10,000 μg nucleotide product/μl mixture; and

(c) determining whether or not the universal or specific nucleic acid sequence is present in the polymerase chain reaction product, the presence of the universal or specific nucleic acid sequence being indicative of the presence of a microbe or a virus in the food sample.

Any suitable method is used to determine the presence of the universal or specific nucleic acid sequence is present in the polymerase chain reaction product. Fluorescent intercalating reagents, such as ethidium bromide, can be used in conjunction with a fluorescence detection system. Alternatively, suitable oligonucleotide primers(s) that are hybridizably complementary to at least a portion of the reaction product, and bearing a fluorescent label and/or quencher can also be used in conjunction with the PCR amplification and/or fluorescence detection system as known in the art.

This invention also relates to an in vitro method of detecting the presence of a microbe or a virus in a food sample, comprising:

adding to a pre-determined volume of a sample suspected of comprising nucleic acid-containing microbe(s), known amounts of a pair of primers binding to sequences up-stream and down-stream to a universal or specific microbial and/or viral nucleic acid sequence and polymerase chain reaction (PCR) reagents to form a mixture;

cycling the mixture about under conditions effective to amplify the universal or specific microbial and/or viral nucleic acid sequence to attain about 0.25 to about 10,000 μg universal microbial nucleic acid/μl mixture;

adding a polynucleotide comprising a DNA internal segment that is hybridizably complementary to at least a portion of the universal or specific nucleic acid sequence; and a first and a second DNA arm segment adjoining the DNA internal segment, the first DNA arm segment ending in a 5′ terminus and the second DNA arm segment ending in a 3′ terminus, the arms segments comprising nucleotide sequences such that they are hybridizably complementary to one another. Optionally, the terminus of one arm segment is operatively connected to a fluorogen and the terminus of the other arm segment is operatively connected to a quencher, such that the polynucleotide comprises a “fluorescent beacon.” The polynucleotide can form a stem-loop structure when there is no universal or specific microbial and/or viral nucleic acid present in the sample. A change in conformation of the stem-loop structure is detected by a fluorescent detection system; and detecting fluorescence emitted by the sample. Any suitable reagent containing a fluorogen or fluorogenic agent, such as fluoroscein, or an intercalating agent, such as ethidium bromide, can be used in detecting a conformational change in the polynucleotide. The reagent can also be a suitable oligonucleotide bearing a fluorescent label.

Alternatively, the polynucleotide is a “fluorescent beacon.” When no universal or specific microbial and/or viral nucleic acid is present and replicated by PCR in the sample, the DNA internal segment of the fluorescent beacon is single stranded, the complementary sequences of the arms are hybridized to one another and the fluorogenic agent is quenched by the quencher; when there is microbial and/or viral DNA in the sample, a portion of the universal or specific microbial and/or viral nucleic acid is hybridized to the internal segment of the beacon, and the fluorogenic agent fluoresces.

This invention also relates to a kit for detecting a microbe or virus. The detection kit comprises primers binding to sequences up-stream and down-stream to universal of specific microbial and/or viral nucleic acid sequence (s) and polymerase chain reaction (PCR) reagents; a polynucleotide comprising a DNA internal segment that is hybridizably complementary to at least a portion of the universal or specific nucleic acid sequence; and a first and a second DNA arm segment adjoining the DNA internal segment, the first DNA arm segment ending in a 5′ terminus and the second DNA arm segment ending in a 3′ terminus, the arms segments comprising nucleotide sequences such that they are hybridizably complementary to one another. Optionally, the terminus of one arm segment is operatively connected to a fluorogen and the terminus of the other arm segment is operatively connected to a quencher, such that the polynucleotide comprises a “fluorescent beacon.” The polynucleotide can form a stem-loop structure when there is no universal or specific microbial and/or viral nucleic acid present in the sample. A change in conformation of the stem-loop structure is detected by a fluorescent detection system. The kit also contains instructions for use of the kit to detect the presence of a microbe (s) and/or virus (es), in particular bacteria, and the kit optionally contains PCR reagents.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

This invention arose from the desire by the inventors to improve on prior art technology for assessing in a short time whether a sample is contaminated with microorganisms or viruses in an accurate and simple manner. This invention provides an assay and detection kit combining the benefits of nucleic acid amplification by PCR, the specificity of DNA hybridization probes and the signal amplification capability of fluorescent molecular beacon technologies to detect the presence of microorganisms and/or viruses in a product without needing to separate unbound beacon molecules.

This invention relates to an in vitro method of detecting the presence of a microbe or a virus in a food sample, comprising the steps of:

(a) forming a polymerase chain reaction mixture by combining (1) a predetermined volume of a food sample to be tested for the presence of a nucleic acid sequence comprising a universal or specific nucleic acid sequence indicative of a microbe or a virus and sequences upstream and downstream of the universal or specific nucleic acid sequence, (2) known amounts of a first nucleic acid primer and a second nucleic acid primer for binding to the upstream sequence and the downstream sequence, respectively, and (3) polymerase chain reaction reagents;

(b) forming a polymerase chain reaction product by cycling the polymerase chain reaction mixture under conditions effective to amplify the universal or specific nucleic sequence, if present, to replicate and attain about 0.25 to about 10,000 μg nucleotide product/μl mixture;. and

(c) determining whether or not the universal or specific nucleic acid sequence is present in the polymerase chain reaction product, the presence of the universal or specific nucleic acid sequence being indicative of the presence of a microbe or a virus in the food sample.

Any suitable method is used to determine the presence of the universal or specific nucleic acid sequence is present in the polymerase chain reaction product. Fluorescent intercalating agents, such as ethidium bromide, can be used in conjunction with a fluorescence detection system. Alternatively, a suitable oligonucleotide primer(s) that is hybridizably complementary to at least a portion of the reaction product, and bears a fluorescent label and/or quencher can also be used in conjunction with the PCR amplification or the fluorescence detection system. For example, when the universal or specific nucleic acid sequence is 5′-TAGAAGC-3′ (SEQ. ID NO: 138), suitable oligonucleotide primers(s) for purposes of amplification and/or detection of amplification reaction products include 5′-GCTAAGGTCCCAAAGT-3′ (SEQ. ID NO. 120), which is usefully labeled with a fluorogen, such as fluoroscein, at its 5′-end, and/or 5′-ACTTTGGGACCTTAGC-3′ (SEQ. ID NO. 134), which can also be usefully labeled at its 3′-end with a quencher, such as dabcyl, to quench unhybridized fluorogen-labeled primer in the reaction mix.

The present method also provides a broadly applicable in vitro method of detecting the presence of one or more microbe (s) and/or virus (es) in a sample, which comprises adding to a pre-determined volume of a sample suspected of comprising nucleic acid-containing microbe(s) known amounts of a pair of primers binding to sequences up-stream and down-stream to a universal microbial and viral nucleic acid sequence and polymerase chain reaction (PCR) reagents to form a mixture;

cycling the mixture under conditions effective to amplify the universal microbial and/or viral nucleic acid sequence to attain about 0.25 to about 10,000 μg universal microbial nucleic acid/μl mixture;

adding a polynucleotide comprising a DNA internal segment that is hybridizably complementary to at least a portion of the universal or specific nucleic acid sequence; and a first and a second DNA arm segment adjoining the DNA internal segment, the first DNA arm segment ending in a 5′ terminus and the second DNA arm segment ending in a 3′ terminus, the arms segments comprising nucleotide sequences such that they are hybridizably complementary to one another. Optionally, the terminus of one arm segment is operatively connected to a fluorogen and the terminus of the other arm segment is operatively connected to a quencher, such that the polynucleotide comprises a “fluorescent beacon.” The polynucleotide can form a stem-loop structure when there is no universal or specific microbial and/or viral nucleic acid present in the sample. A change in conformation of the stem-loop structure is detected by a fluorescent detection system and detecting any fluorescence emitted by the sample, wherein when no universal microbial and/or viral nucleic acid is present and replicated by PCR in the sample the internal DNA segment remains single stranded. Any suitable reagent containing a fluorogen or fluorogenic agent, such as fluoroscein, or ethidium bromide can be used in detecting a conformational change in the polynucleotide. The reagent can also be a suitable oligonucleotide primer, bearing a fluorescent label or quencher, as described above.

If the polynucleotide is a “fluorescent beacon,” the complementary sequences of the extension arms are hybridized to one another and the fluorophore or fluorogenic agent is quenched by the quencher, and when there is microbial and/or viral DNA in the sample, its universal microbial and/or viral nucleic acid sequence is hybridized to the internal segment of the beacon and the fluorogenic agent fluoresces.

As already described above, the polynucleotide (or beacon) is a single stranded nucleic acid molecule possessing a stem and loop structure, where the loop is a probe with a sequence which is complementary to a pre-determined sequence in a target nucleic acid. The stem, on the other hand, is formed by the annealing of two complementary arm segment sequences placed on both sides of the probe segment (DNA internal segment of the polynucleotide) and which DNA arm segment sequences are unrelated to the target sequence to avoid hybridization. Typically, the 5′ and 3′ ends of the arms are attached, respectively, to a fluorescent moiety and to a non-fluorescent quenching moiety to form a “fluorescent beacon” structure. Thus, the stem portion of the stem and loop structure keeps these two moieties in close proximity and, thereby, quenches any fluorescence by the fluor, fluorophore or fluorogenic agent. When the probe segment encounters a target molecule and hybridizes to it to form a more stable, double stranded structure than the stem and loop structure. The existence of the two structures is precluded by the relative rigidity of nucleic acid structures. Thus, when the probe encounters a complementary sequence, it undergoes a spontaneous conformational change that opens up the stem and forces the arms apart from one another, and, thereby, causes the separation of the fluorophore or fluorogen (or fluorogenic agent) and the quencher and permits, upon incidence of ultraviolet light, the fluorophore to fluoresce. Moreover, because unhybridized beacons are quenched, it is not necessary to remove them from the medium to detect by fluorescence the presence of specific nucleic acids in homogeneous phase and in living cells.

In one preferred embodiment, the DNA internal segment and the two DNA arm segments are complementary to a contiguous universal microbial nucleic acid sequence, and more preferably the DNA internal segment is about 7 to 19 nucleotides long, more preferably about 9 to 15, and still more preferably about 11 to 13 nucleotides long, each DNA arm segment is preferably about 5 to 9 nucleotides long, more preferably about 6 to 8 nucleotides long, and still more preferably 7 nucleotides long, and each primer is preferably about 10 to 20 nucleotides long, more preferably about 12 to 18, and still more preferably about 14 to 16 nucleotides long. In one of the most preferred embodiments the polynucleotide comprises one arm segment with at least one C or G nucleotide(s) at the 5′ terminus and the other arm segment with a similar number of complementary nucleotide(s) of the 3′ terminus. In this manner, the arm segments strongly hybridize by formation of at least one G:C pair to, thereby, prevent sliding of the DNA segment. The DNA arm segments comprise any possible combination of C, A, T and G nucleotides, and preferably about I to 8 C or G at the 5′ terminus and a similar number of complementary nucleotides at the 3′ terminus, more preferably about 1 to 3 C or G nucleotide at the 5′ terminus and I to 3 complementary nucleotides at the 3′ terminus, still more preferably 2 to 6 C or G nucleotides at the 5′ terminus and 2 to 6 complementary nucleotide at the 3′ terminus. In addition, the polynucleotide's arm segments may further comprise at least one A or T nucleotide(s) vicinal to the C or G nucleotide(s) located at the 5′ terminus in a similar number of complementary nucleotide(s) vicinal to the G or C nucleotide(s) at the 3′ terminus. In this manner, the hybridization of the arm segments is further reinforced by formation of one or more A:T pairs next to the one or more terminal G:C pairs, preferably the polynucleotide's arm segments comprise 1 to 4 A or T nucleotide vicinal to the C or G nucleotide at the 5′ terminus and I to 4 complementary nucleotide(s) thereto which are vicinal to the G or C nucleotide at the 3′ terminus, and still more preferably about 2 to 3 A or T nucleotides and 2 to 3 complementary nucleotides.

In another preferred embodiment of the invention, the DNA arm segments are complementary to one another, but at least one of them is not hybridizably complementary the universal microbial or viral nucleic acid sequence. Such non-complementary arm segments are known as “false arms.” In this embodiment, the DNA internal segment is preferably about 7 to 19 nucleotides long, more preferably 10 to 15 nucleotides long, and still more preferably 12 to 14 nucleotides long, each DNA arm segment is preferably 5 to 9 nucleotides long, and more preferably 6 to 8 nucleotides long, and each primer is about 10 to 20 nucleotides long, and more preferably 12 to 18 nucleotides long. However, in some instances, longer or shorter sequences are also suitable. In this case, the polynucleotide's DNA arm segments may comprise one or more C or G nucleotide(s) at the 5′ terminus and a similar number of complementary nucleotide at the 3′ terminus. The pairing of these nucleotide(s) provides strong hybridization and prevents the sliding of the DNA segments with respect to one another. A preferred number of C or G nucleotides at the 5′ terminus of the polynucleotide's (or fluorescent beacon's) arm segments is about 1 to 8, and more preferably about 3 to 5 C or G nucleotides, and a similar number of complementary nucleotide at the 3′ terminus of the extension arms. In addition, the arm segments can further comprise one or more A or T nucleotide vicinal to the one or more C or G nucleotide(s) at the 5′ terminus in a similar number of complementary nucleotides vicinal or next to the one or more G or C nucleotide(s) at the 3′ terminus. As may be surmised, the addition of A:T pairs next to the G:C pairs further reinforces the strength of the hybridization exhibited by the extension arms. The number of A or T nucleotides vicinal to the C or G nucleotides at the 5′ terminus of the extension arms is preferably 1 to 4, and more preferably 2 to 3. Consequently, the number of complementary nucleotides next to the G or C nucleotides at the 3′ terminus is also 1 to 4, and more preferably 2 to 3.

The reagents, including enzymes, which may be utilized in the polymerized chain reaction (PCR) are known in the art. See, for example, U.S. Pat. Nos. 5,210,015; 4,683,195; 4,683,202; 4,965,188; 4,800,159; and 4,889,818, the relevant portions of which are incorporated by reference. However, preferred cycling conditions for this reaction are about 1 to 30 cycles, more preferably 5 to 20 cycles, and still more preferably 10 to 15 cycles, at alternating between temperatures of about (1) 58 to about 95° C.: to (2) about 58 to about 95° C. Some of the more preferred temperature combinations being about 95: about 58° C., about 58: about 74° C. and about 74: about 95° C. However, other combinations are also suitable. A preferred amount of beacon DNA is approximately the same as or about the concentration of both primer DNAs used. However, other proportions may also be utilized as an artisan would know. See, for example, the US Patents listed above.

In another preferred embodiment, the DNA internal segment of the polynucleotide binds to universal or conserved nucleic acid sequences of a large number of viruses and microorganisms, including bacteria, yeast, molds and protista. In still a more preferred embodiment, the internal DNA segment comprises a sequence which hybridizes to, and may be complementary to a contiguous specific universal bacterial nucleic acid sequence and, therefore, it hybridizes to all classes of bacteria. By means of example, a bacteria-specific nucleic acid sequence comprises 5′-ATCTTCG-3′ (SEQ. ID NO: 115), and the internal DNA segment comprises a complementary sequence thereto, i.e. 5′-CGAAGAT-3′ (SEQ. ID NO: 116). Other sequences, however, may also be utilized. In one preferred embodiment, both the internal DNA segment and the extension arms are formed by a sequence which is complementary to a contiguous bacteria-specific bacterial nucleic acid sequence. By means of example, the nucleic acid sequence of the polynucleotide (or beacon) may comprise 5′-CCACCGACGAAGATTCGGTGG-3′ (SEQ. ID NO: 117). Others, however, are also suitable.

In yet another embodiment, the polynucleotide (or fluorescent beacon) may be a specific probe for a class of microorganisms, for a specific species or for a group of species, depending on the DNA internal segment chosen. Examples of all of the above are provided in the Tables below.

The present method is similarly applicable to the detection of viruses by implementing the method described above. Similarly, nucleic acid sequences which are specific for yeast may be utilized to design primers which will bind upstream and downstream from the sequences to amplify the yeast nucleic acid sequence, and to manufacture a polynucleotide (or fluorescent beacon) by selecting a complementary DNA sequence which includes the DNA internal segment and the DNA arm segments and may additionally have the A:T and C:G termini. Alternatively, the DNA internal segment may comprise a sequence complementary to the yeast nucleic acid and the arm segments may be “false arms” constituted by complementary strings of A, T, C and G for form A:T and C:G pairs. This may also be attained with specific sequences for molds and/or protista in the same manner.

Various universal and specific microbial and viral nucleic acid sequences, primers, and DNA sequences suitable for use in the polynucleotide (or fluorescent beacon) in accordance with the present invention are provided below. However, the practice of this invention is not limited to the sequences described herein but, in addition, may be practiced with other universal nucleic acid sequences or sequences specific for either a species or a class of microorganism or virus. In another embodiment of the invention, whether or not a sample is sterile or has microbial and/or viral contamination may be determined by using a “pre-mix” of reagents with which a sample is mixed, and a specialized instrument for detecting fluorescence. This embodiment may be performed in a period of time as short as about 10 minutes. In this embodiment, the reagent “pre-mix” may comprise two primers and a fluorescent molecular probe or beacon, to which are added the sample and the PCR reagents, e.g. enzyme.

The necessary elements for implementing this technology are provided as a kit for detecting a microbe and/or virus. The detection kit comprises in separate containers primers binding to sequences up-stream and down-stream to a universal or specific microbial and/or viral nucleic acid sequence; and optionally, a polynucleotide comprising a DNA internal segment that is hybridizably complementary to at least a portion of the universal or specific nucleic acid sequence; and a first and a second DNA arm segment adjoining the DNA internal segment, the first DNA arm segment ending in a 5′ terminus and the second DNA arm segment ending in a 3′ terminus, the arms segments comprising nucleotide sequences such that they are hybridizably complementary to one another. Optionally, the terminus of one arm segment is operatively connected to a fluorogen and the terminus of the other arm segment is operatively connected to a quencher, such that the polynucleotide comprises a “fluorescent beacon.”

Also included in the kit are instructions for use of the kit to detect the presence of a microbe(s) or virus(es).

As described above, in one preferred embodiment the DNA internal segment and the two arm segments of the polynucleotide (or fluorescent beacon) are fully complementary to a contiguous universal microbial nucleic acid sequence. Preferably, the internal DNA segment is about 7 to about 19 nucleotide long, each extension arm is about 5 to about 9 nucleotides long, and each primer is about 10 to about 20 nucleotides long. In another embodiment, only the DNA internal (or probe) segment of the polynucleotide (or fluorescent beacon) is complementary to a universal microbial nucleic acid sequence. Although the DNA arm segments are complementary to one another, one or both of them can be unrelated to the universal microbial nucleic acid sequence. In the latter case, although the length of the different parts of the fluorogenic beacon are similar to the one described above, the arm segments preferably comprise at least one C or G nucleotide at the 5′ terminus in a similar number of complementary nucleotide at the 3′ terminus, which permits the formation of G:C pairs by hybridization. More preferably the arm segments comprise about 1 to 8 C or G nucleotide at the 5′ terminus and I to 8 complementary nucleotide(s) at the 3′ terminus. Still more preferably 2 to 6 G or C nucleotide(s) at the 5′ nucleotide at the 5′ terminus and 2 to 6 complementary nucleotide at the 3′ terminus. In addition, the DNA arm segments may further comprise one or more A or T nucleotide(s) vicinal or next to the C or G nucleotide at the 5′ terminus, and the other arm comprises a similar number of complementary nucleotides vicinal to the G or C nucleotide(s) at the 3′ terminus, thereby reinforcing the strength of the double stranded DNA portion. Preferably, the A or T nucleotide segments comprises 1 to 4 nucleotide(s) vicinal to the C or G nucleotide(s) at the 5′ terminus and the other arm segment comprises 1 to 4 complementary nucleotide(s) to the A or T, which are placed vicinal or next to the G or C nucleotide(s) at the 3′ terminus. In another embodiment, the DNA internal segment is complementary to a bacteria-specific nucleic acid sequence. Although the DNA arm segments are still complementary to one another, one or both can be unrelated to the bacteria-specific nucleic acid sequence. In this case, one of the DNA arm segments of the polynucleotide (or beacon) comprises at least one and up to 8 C or G nucleotide(s) at the 5′ terminus and the other arm segment comprises a similar number of complementary nucleotides at the 3′ terminus. As already explained above, the DNA arm segments can additionally comprise 1 to 4 A or T nucleotides(s) next to the C or G nucleotide(s) at the 5′ terminus and the other arm comprises 1 to 4 complementary nucleotide vicinal to the one or more G or C nucleotide(s) at the 3′ terminus. Examples of sequences suitable for use as arm segments are 5′- GCTAG -3′ (SEQ. ID NO: 11 8) and 5′-CTAGC-3′ (SEQ. ID NO: 119), although many others are also suitable. By means of example, the internal DNA segment of the fluorogenic beacon may be complementary to a conserved region of a small ribosomal RNA (rRNA) operon, a first primer may comprise 5′-GCTAAGGTCCCAAAGT-3′ (SEQ. ID NO: 120), and a second primer may comprise 5′-AGAACGCTCTCCTACC-3′ (SEQ. ID NO: 121). Another example is that where the DNA internal segment of the polynucleotide (or fluorescent beacon) is complementary to a conserved region of the small rRNA operon encoding a 23S rRNA, wherein the internal DNA segment of the beacon is complementary to the sequence 5′- CTTAGAAGCAG -3′-3′ (SEQ. ID NO: 122). The oligonucleotide primers of the present invention, useful in the present kit, are optionally connected at their 5′-ends to a fluorogen, e.g., fluoroscein, or at their 3′-ends to a quencher, e.g., dabcyl.

The universal or specific nucleic acid sequence may be selected, and the complementary internal DNA segment of the polynucleotide (or fluorescent beacon) designed, for microorganisms such as bacteria, yeast, mold or protista. The DNA internal segment may be complementary to a contiguous nucleic acid sequence which is universal to a class of microbes as opposed to all microbes. Examples of these are provided below. The DNA internal segment moreover, may be complementary to a contiguous nucleic acid sequence which is virus-specific or specific to a class of viruses. When the kit is applied to the detection of bacteria at large, the DNA internal segment can comprise a sequence that is complementary to a contiguous universal bacteria-specific bacterial nucleic acid sequence, such as 5′-CCACCGAATCTTCGTCGGTGG-3′ (SEQ ID NO: 144), or its complement, although others are also suitable. In another embodiment both the DNA internal segment and the arm segments comprise a nucleic acid sequence, such as 5-CCACCGACGACGAAGATTCGGTGG-3′ (SEQ. ID. NO.: 117); although others may also utilized. Where the present technology is applied to the detection of virus, the DNA internal segment or both the DNA internal segment and the arm segments may be complementary to a nucleic acid which is conserved in all viruses, conserved over a class of viruses or a virus-specific nucleic acid sequence.

Any fluorogen (or fluorogenic agent) known in the art may be utilized with the present technology. Particularly suitable are pico green, fluorescein, edans, and the like. However, others may also be utilized. Similarly, any quencher known in the art is suitable for use herein. By means of example, dabcyl is suitable for the present purpose, although others may be utilized. Both the fluorogenic agent and the quencher are linked to the DNA portion of the fluorogenic beacon by C6-thio or C7-amino linkers known in the art, and the linkage is conducted as is known in the art. See, for example, Columns 1-2, page 1143, Schofield et al., Appl. & Ennison. Microbiol. 63(3):1143 (1997); Tyagi & Kramer, Nature Biotech. 14:303 (1996), the text of which is incorporated herein by reference.

In one preferred embodiment of the present kit, the primers and the polynucleotide (or fluorescent beacon) are pre-mixed in bulk, or in unitary amounts and provided in unitary form. The kit may also comprise one or more controls such as universal microbial and viral nucleic acid sequences and/or microbe-specific and viral-specific nucleic acid sequences. The controls may be provided as a panel for all microorganisms and/or viruses as well as different classes or specific species of bacteria or viruses.

In a preferred embodiment of this invention, the DNA primers comprise universal DNA oligomers, which are suitable for amplifying all eukaryotic and prokaryotic microorganisms, including bacteria, mold, yeast and/or protista, or viruses. In a broadly encompassing embodiment of the method of this invention, a predetermined volume of sample is mixed with the primers and other PCR reagents, a PCR reaction conducted, a fluorogenic beacon added and fluorescence detected.

The kit may further comprise PCR reagents. A most preferred embodiment of the kit, comprises a “pre-mix” of reagents, and instructions for DNA amplification and for conducting a PCR under specific cycling conditions. As already indicated, the kit of the invention may be a kit for generally assessing the presence or absence of microorganisms, e.g., bacteria, in a sample or may be custom tailored for the detection of specific organisms, such as any desired bacterium. An embodiment of the method and kit of the invention suitable for the determination of bacterial contamination in general may comprise a bacteria-specific nucleic acid sequence and its corresponding primers. The inventor has found that when a bacteria-specific sequence and its primers are subjected to PCR under certain conditions, the method of the invention provides high specificity for the bacterial genus. The universal microbial and/or viral nucleic acid sequence is preferably provided in the form of a stem-loop structure. However, the nucleic acid sequence need not be in this form. The nucleic acid target sequence may be in linear and/or circular form, as well. The polynucleotide (or fluorescent beacon), however, must generally conform to a stem-loop structure, and must comprise at least an DNA internal segment which is complementary to the target sequence. See, Tyagi and Kramer, Nature Biotech. 14:303 (1996). If the microbial and/or viral target sequence is not in the form of a stem-loop structure, the polynucleotide (or fluorescent beacon) must contain additional nucleotides at either, or both, end(s) of the complementary region to form a “false stem-loop” (arm segments). See, Schofield et al., App. & Environmental Microbiol. 63(3):1143 (1997).

A preferred “false stem-loop” comprises one or more of G:C, C:G, T:A, A:T, G:C, b/e last and/or C:G 1st, and the false stem-loop sequence is generally about 3 to about 51 nucleotides long, and preferably about 7 to about 31, and more preferably about 12 to about 28 nucleotides long. Most preferred are false stem-loop segments about 13, about 15, about 17, about 19 and about 21 nucleotides long. However, other lengths are also suitable. The nucleotide segments may also comprise even numbers of nucleotide. However, odd-number nucleotide segments are preferred because they provide a trans-hybridization configuration which yields greater fluorescence. Where a preferred false stem structure may not attainable, the nucleotide segment of the polynucleotide (or beacon) must comprise at least about 2 G:C nucleotide pairs positioned at the termini (linker arm ends), and up-stream from it, preferably immediately up-stream, at least one T:A nucleotide pair(s) to prevent slipping in the stem hybrid (G:C,C:G, T:A, . . .) for proper attachment of the polynucleotide's (or beacon's) arms where in single stranded form. This sequence is generally followed by at least about 1, preferably about 2 more complementary base pairs, and up to about 8 complementary base pairs, preferably G:C pairs, to require a high enough melting temperature for the stem hybrid structure to remain stable at ambient temperature.

A preferred polynucleotide (or beacon molecule) for the universal detection of bacteria comprises 5′-GGTGGCTGCTTCTAAGCCACC-3′ (SEQ. ID. NO: 141) or analogues thereof which hybridize under the following conditions, and preferably under stringent conditions, to a DNA sequence complementary thereto. Other polynucleotide DNAs (or beacon molecules) are also suitable and may be utilized in conjunction with this invention. Such molecules are designed to be complementary to conserved regions in the small rRNA operon encoding the 23S rRNA. Its corresponding primers comprise segments 5′-GCTAAGGTCCCAAAGT-3′ (SEQ. ID. NO. 120), and 5′-AGAACGCTCTCCTACC-3′ (SEQ. ID. NO. 121). These sequences were deduced from highly conserved regions of the rRNA operon encoding 23s rRNA. Other universal probes or internal DNA segments suitable for use with this invention are those which have a sequence complementary to the target nucleic acid sequences described by Hill (1996), supra, and include highly conserved sequences such as a 16S rRNA, an rRNA spacer, a 16S rDNA, a 16S DNA, which are listed in Table 2 of the publication. Hill (1996), supra also provides in Table 2 sequences specific for individual microorganism targets, including Aeromonas hydrophila aer, Brucella spp. 1 6S rDNA, Brucella spp. Putative OMP, Campylobacterjejuni flaA, E. coli flaA, C.jejuni 16S rRNA, E. coli 16S rRNA, C. Lari 16S rRNA, Clostridia 16S rDNA (2 sequences), Clostridium botulinum Neurotoxin A, Clostridium botulinum Neurotoxin B, etc. Some of the sequences encompassed by the group to which the invention is applicable are listed below. This, however, is not an all inclusive list of known highly conserved and specific sequences for microbial and viral targets.

TABLE 1
Examples of Highly Conserved Target Sequences
Size Ann. Temp.
Organism Target (bp) Primer Sequences (° C.) Cycles
All Bacteria 16S rRNA   408 CAGCMGCCGCGGTAATWC 50 30
CCGTCAATTCMTTTRAGTTT
(SEQ. ID NO: 1)
All Bacteria rRNA Spacer Varies GAAGTCGTAACAAGG 55 25
CAAGGCATCCACCGT
(SEQ. ID NO: 2)
All Bacteria 16S rDNA −335 GAGTTTGATCCTGGCUCA 60 35
(SEQ. ID NO: 3)

Table 2 below shows several sequences of molecular beacons and indicates whether the sequences are universal or specific for a certain organism. See, Hill, W. E., Crit. Rev. Food Sci. & Nutrition 36(1 & 2):123 (1996).

TABLE 2
Examples of Molecular Beacon Sequences
Organism Molecular Beacon Sequence
Universal 5′-CCTGCACGGGCGGTGTGTACGCAGG-3′
(SEQ. ID NO: 123)
Ruminococ- 5′-CCCCCGTCATGCGGCTTCGTTATGGGGG-3′
cus albus 8 (SEQ. ID NO: 124)
Fibrobacter 5′-GCTGCCTGCCCCTGAACTATCCAAGAGGCAGC-3′
succinogenes (SEQ. ID NO: 125)
S85

Examples of sequences for organism specific targets and the respective organism are provided in Table 3 below.

TABLE 3
Examples of Specific Target Sequences
Ann. Temp.
Organism Target (bp) Size Primer Sequences (° C.) Cycles
All Bacteria 16S rRNA 408 CAGCMGCCGCGGTAATWC 50 30
CCGTCAATTCMTTTRAGTTT(SEQ
ID NO:1)
All Bacteria rRNA Variable GAAGTCGTAACAAGG 55 25
spacer CAAGGCATCCACCGT (SEQ ID
NO:2)
All Bacteria 16S rDNA ˜335   GAGTTTGATCCTGGCUCA 60 35
CTGCTGCCTCCCGTA (SEQ ID
NO:3)
Eubacteria 16S DNA ˜1500    AGAGTTTGATCCTGGCTCAG 55 26
AAGGAGGTGATCCAGCCGCA 42 25-30
(SEQ ID NO:4)
Aeromonas aer 209 CCAAGGGGTCTGTGGCGACA 55 30
hydrophila TTTCACCGGTAACAGGATTG (SEQ
ID NO:5)
Brucella spp. 16S rDNA 801 TGCTAATACCGTATGTGCTT 50 ?
TAACCGCGACCGGGATGTCAA
(SEQ ID NO:6)
Brucella spp. Putative 635 Sequences not reported 60 50
OMP
Campylobacter flaA 560 ATGGGATTTCGTATTAAC 37 25
jejuni and GAACTTGAACCGATTTG (SEQ ID
Campylobacter NO:7)
coli
Campylobacter 16S rRNA 426 ACCTTGTTACGACTTCACCCCA 52 40
jejuni, GAGAGTTTGATCCTGGCTCAG
Campylobacter (SEQ ID NO:8)
coli,
Campylobacter
lari
Clostridium 16S rRNA ˜1371    GATCCTGGCTCAG 50 40
spp. GACGGGCGGTGTGTACAA (SEQ
ID NO:9)
Clostridium 16S rDNA ˜502   AAACTCAAATGAATTGACGG 50 40
spp. GACGGGCGGTGTGTACAA (SEQ
ID NO:10)
Clostridium Neurotoxin ˜1500    GATGGAACCACCATTTGCWAG 37 25
botulinum B WACATCWATACAWATTCCTGG
(SEQ ID NO:11)
Clostridium Neurotoxin ˜1340    GATCCTGTAAATGGTGTTG 55 35
botulinum A CAAGTCCCAATTATTATAACTTTG
AT (SEQ ID NO:12)
Coliform lacZ ? TGAAAGCTGGCTACAGGAAGGCC 60 30
bacteria GGTTTATGCAGCAACGGACGTCA
(SEQ ID NO:13)
Entamoeba cEH-P1 482 GCAACTACTGTTAGTTA 42 25-35
histolytica clone CCTCCAAGATATGTTTTAAC (SEQ
ID NO:14)
Escherichia afa 750 GCTGGGCAGCAAACTGATAACTC 65 25
coli TCCATCAAGCTGTTTGTTCGTCCG
CCG (SEQ ID NO:15)
Escherichia elt 275 TTACGGCGTTACTATCCTCTCTA 55 30
coli GGTCTCGGTCAGATATGTGATTC
(SEQ ID NO:16)
Escherichia eltB 195 CCTCTCTATATGCACACGGAGCTC 54 40
coli CCAGCTATATTGTTGACTGCCCGG
GACTTCGACC (SEQ ID NO:17)
Escherichia sltllva 490 TGTGTTTGCTTGTCTTCAGC 55 30
coli ATGCGCGGGGTCATGGAACGT
(SEQ ID NO:18)
Escherichia coli elt 750 GGCGACACATTATACCGTGC 43 26
CCGAATTCTGTTATATATGTC
(SEQ ID NO:19)
Escherichia coli est 186 TCTGTATTGTCTTTTTCACC 43 26
TTAATAGCACCCGGTACAAGC
(SEQ ID NO:20)
Escherichia coli estA 175 TTTTTTCTGTATTTTCTTTIICII 55 30
CTTIIITCAGGCAGGATTACAA
CAIAITTCACAGC (SEQ ID
NO:21)
Escherichia coli malB 595 TCGCCACACGCTGACGCTGAC 60, 65, 70 65
CATTACATGACCTCGCTTTAG
TTCACAGA (SEQ ID NO:22)
Escherichia coli papC 328 GACGGCTGTACTGCAGGGTGT 65 25
GGCGATATCCTTTCTGCAGGG
ATGCAATA (SEQ ID NO:23)
Escherichia coli 410 CTCCGGAGAACTGGGTGCATC 65 25
TTACCGGAGGAGTAATTACA
AACCTGGCA (SEQ ID NO:24)
Escherichia coli sltA 140 ACCCTGTAAACGAAGTTTGCG 55 30
ATCTCATGCGACTACTTGAC
(SEQ ID NO:25)
Escherichia coli STI (a and ? TTAATAGCACCCGGTACAAGC 58 35
b) AGGCCTGACTCTTCAAAAGA
GAAAATTAC (SEQ ID NO:26)
Escherichia coli toxA 110 CCGGTATTACAGAAATCTGA 55 35
GTGCATGATGAATCCAGGGT
(SEQ ID NO:27)
Escherichia coli toxB (eltB) 298 CAGTCTATTACAGAACTATG 30 25
CCATACTGATTGCCGCAATTG
(SEQ ID NO:28)
Escherichia coli stx/slt-IA 680 GACAGGATTTGTTAACAGG 55 30
TTCCAGTTACACAATCAGGCC
(SEQ ID NO:29)
Escherichia coli sltl 614 ACACTGGATGATCTCAGTGG 60 35
CTGAATCCCCCTCCATTATG
(SEQ ID NO:30)
Escherichia coli sltll 779 CCATGACAACGGACAGCAGT 60 35
T
CCTGTCAACTGAGCACTTTG
(SEQ ID NO:31)
Escherichia coli SLT-IA 370 AAATCGCCATTCGTTGACTAC 60 35
TTCT
TGCCATTCTGGCAACTCGCGA
TGCA (SEQ ID NO:32)
Escherichia coli SLT-IIA 283 CAGTCGTCACTCACTGGTTTC 60 35
ATCA
GGATATTCTCCCCACTCTGAC
ACC (SEQ ID NO:33)
Escherichia coli SLTIA, 224, 227 TTTACGATAGACTTTTCGAC 43 30
SLTIIA CACATATAAATTATTTCGCTC
(SEQ ID NO:34)
Escherichia coli slt-II (vtx2) 285 AAGAAGATGTTTATGGCGGT 55 ?
CACGAATCAGGTTATGCCTC
(SEQ ID NO:35)
Escherichia coli vtx2 385 CATTCACAGTAAAAGTGGCC 45 ?
GGGTGCCTCCCGGTGAGTTC
(SEQ ID NO:36)
Escherichia coli, lamB 346 CTGATCGAATGGCTGCCAGGC 60 30
Salmonella spp. and TCCCAACCAGACGATAGTTAT
Shigella spp. CACGCA (SEQ ID NO:37)
Escherichia coli and Putative inv 760 TAATACTCCTGAACGGCG 55-65 30
Shigella spp. TTAGGTGTCGGCTTTTCTG
(SEQ ID NO:38)
Escherichia stx, sltl 130 GAAGAGTCCGTGGGATTACG 55 30
coli and AGCGATGCAGCTATTAATAA
Shigella spp. (SEQ ID NO:39)
Escherichia uidA 166 TATGGAATTTCGCCGATTTT 50 25
coli and TGTTTGCCTCCCTGCTGCGG (SEQ
Shigella spp. ID NO:40)
Escherichia uidR 153 TGTTACGTCCTGTAGAAAGCCC 59 25
coli and AAACTGCCTGGCACAGCAATT
Shigella spp. (SEQ ID NO:41)
uidR 154 TGTTACGTCCTGTAGAAAGCCC 60 (30)
AAAACTGCCTGGCACAGCAATT
(SEQ ID NO:145)
Shigella ail 320 CTGGATGGTATGGTGAGG 43 26
dysenteriae ial GGAGGCCAACAATTATTTCC (SEQ 43 25-30
ID NO:42)
Shigella ipaH 700 GTTCCTTGACCGCCTTTCCGATAC 60 35
dysenteriae GCCGGTCAGCCACCCTC (SEQ ID
NO:43)
Giardia spp. Giardin 171 AAGTGCGTCAACGAGCAGCT 60 25
TTAGTGCTTTGTGACCATCGA
(SEQ ID NO:44)
Giardia Giardin 218 CATAACGACGCCATCGCGGCTCT 60 25
duodenalis CAGGAA
TTTGTGAGCGCTTCTGTCGTGGCA
GCGCTAA (SEQ ID NO:45)
Helicobacter 16S rDNA 109 CTGGAGAGACTAACGGGTGG 60 40
pylori ATTACTGACGCTGATTCTGC (SEQ
ID NO:46)
Helicobacter 16S rRNA ˜500   TGGCAATCAGCGTCAGGTAATG 55 40
pylori GCTAAGAGATCAGCCTATGTCC
(SEQ ID NO:47)
Helicobacter ureA 412 GCCAATGGTAAATTAGTT ? 26
pylori CTCCTTAATTGTTTTTAC (SEQ ID
NO:48)
Helicobacter ureA and 2396  AGGAGGATGAGATGA 50 30
pylori ureB ACTTTATTGGCTGGT (SEQ ID
NO:49)
Listeria spp. 16S rDNA 938 CAGCMGCCGCGGTAATWC 50 30
CTCCATAAAGGTGACCCT (SEQ ID
NO:50)
Listeria spp. iap 1454  ATGAATATGAAAAAAGCAAC 50 30
TTATACGCGACCGAAGCCAA
(SEQ ID NO:51)
Listeria iap 1448  GCTACAGCTGGGATTGCGGT 55 40
monocytogenes TTATACGCGACCGAAGCCAA
and Listeria (SEQ ID NO:52)
innocua
Listeria iap ˜870   ACTAGCACTCCAGTTGTTAA 62 30
innocua TTATACGCGACCGAAGCCAA
(SEQ ID NO:53)
Listeria iap 1243  TTACTGAGGTAGCRAGC 58 30
invanovii, TTATACGCGACCGAAGCCAA
Listeria (SEQ ID NO:54)
seeligeri, and
Listeria
welshimeri
Listeria 16S rRNA  70 CACGTGCTACAATGGATAG 48 40
monocytogenes AGAATAGTTTTATGGGATTAG
(SEQ ID NO:55)
Listeria hylA 417 CATCGACGGCAACCTCGGAGA 62 30
monocylogenes ATACAATTACCGTTCTCCACCATT
C (SEQ ID NO:56)
Listeria hylA 520 AACCTATCCAGGTGCTC 60 35
monocytogenes CGCCACACTTGAGATAT (SEQ ID
NO:57)
Listeria hlyA 174 GCATCTGCATTCAATAAAGA 56 30
monocytogenes TGTCACTGCATCTCCGTGGT (SEQ
ID NO:58)
Listeria hlyA 234 CGGAGGTTCCGCAAAAGATG 50, 55 30
monocytogenes CCTCCAGAGTGATCGATGTT (SEQ 56 30
ID NO:59)
Listeria hlyA 606 Sequence not reported 51 30
monocytogenes
Listeria hlyA 685c CCTAAGACGCCAATCGAA 50 30
monocytogenes AAGCGCTTGCAACTGCTC (SEQ ID
NO:60)
Listeria hlyA 702 CCTAAGACGCCAATCGAA 50 30
monocytogenes AAGCGCTTGCAACTGCTC (SEQ ID
NO:61)
Listeria hlyA 234 ATTGCGAAATTTGGTACAGC 55 30
monocytogenes ACTTGAGATATATGCAGGAG
(SEQ ID NO:62)
Listeria downstream ? Sequences not reported 55 30
monocytogenes from hlyA
Listeria iap (msp) 131 ACAAGCTGCACCTGTTGCAG 55 30
monocytogenes TGACAGCGTGTGTAGTAGCA
(SEQ ID NO:63)
Listeria iap 544 CAAGCAACTACACCTGCGCC 50 30
monocytogenes GAACCTTGTTAGCATTCGT (SEQ
ID NO:64)
Listeria msp (iap) 593 ACAAGCTGCACCTGTTGCAG 50 30
monocytogenes GAACCTTGTTAGCATTCGT (SEQ
ID NO:65)
Listeria iap 287 CGAATCTAACGGCTGGCACA 50 30
monocytogenes GCCCAAATAGTGTCACCGCT (SEQ
ID NO:66)
Listeria iap 380+/ CAAACTGCTAACACAGCTACT 65 35
monocytogenes −40d GCACTTGAATTGCTGTTATTG
(SEQ ID NO:67)
Listeria Dth-18 326 CCGGGAGCTGCTAAAGCGGT 54 30
monocytogenes GCCAAACCACCGAAAATACC
(SEQ ID NO:68)
Listeria Dth-18 122 GAAGCACCTTTTGACGAAGC 54 30
monocytogenes GCTGGTGCTACAGGTGTTTC (SEQ
ID NO:69)
Listeria ImaA 257 AACAAGGTCTAACTGTAAAC 55 30
monocytogenes ACTATAGTCAGCTACAATTG (SEQ
ID NO:70)
Salmonella spp. DNA rep. 163 TTATTAGGATCGCGCCAGGC 50 35
ori. AAAGAATAACCGTTGTTCAC (SEQ
ID NO:71)
Staphylococcus entA 120 TTGGAAACGGTTAAACGAA 55 ?
aureus GAACCTTCCCATCAAAAACA
(SEQ ID NO:72)
Staphylococcus entB 478 TCGCATCAAACTGACAAACG 55 ?
aureus GCAGGTACTCTATAAGTGCC (SEQ
ID NO:73)
Staphylococcus entB 593 GAGAGTCAACCAGATCCTAAACC 50 50
aureus AGATACCAAAAGCTATTCTCATTT
TCT (SEQ ID NO:74)
Staphylococcus entC1 801 ATGAATAAGAGTCGATTTATTTC 50 50
aureus ATTTATCCATTCTTTGTTGTAAGG
TGG (SEQ ID NO:75)
Staphylococcus entC1 631 ACACCCAACGTATTAGCAGAGAG 50 50
aureus CCCCTGGTGCAGGCATCATATCA
TACC (SEQ ID NO:76)
Staphylococcus entC1 257 GACATAAAAGCTAGGAATTT 55 ?
aureus AAATCGGATTAACATTATCC (SEQ
ID NO:77)
Staphylococcus entD 317 CTAGTTTGGTAATATCTCCT 55 ?
aureus TAATGCTATATCTTATAGGG (SEQ
ID NO:78)
Staphylococcus entE 170 TAGATAAAGTTAAAACAAGC 55 ?
aureus TAACTTACCGTGGACCCTTC (SEQ
ID NO:79)
Staphylococcus tst 186e TTCACTATTTGTAAAAGTGTCAGA 55 40
aureus CCCCACTTACTAATGAATTTTTTT
ATCGTAAGCCCTT (SEQ ID NO:80)
Staphylococcus tst 350 ATGGCAGCATCAGCTTGATA 55 ?
aureus TTTCCAATAACCACCCGTTT (SEQ
ID NO:81)
Staphylococcus eat 119 CTAGTGCATTTGTTATTCAA 55 ?
aureus TGCATTGACACCATAGTACT (SEQ
ID NO:82)
Staphylococcus etb 200 ACGGCTATATACATTCAATT 55 ?
aureus TCCATCGATAATATACCTAA (SEQ
ID NO:83)
Staphylococcus nuc 450 AGTATATAGTGCAACTTCAACTA 50 50
aureus AAATCAGCGTTGTCTTCGCTCCAA
ATA (SEQ ID NO:84)
Staphylococcus nuc ˜270   GCGATTGATGGTGATACGGTT 55 37
aureus AGCCAAGCCTTGACGAACTAAAG
C (SEQ ID NO:85)
Vibrio cholerae ctx 302 CTCAGACGGGATTTGTTAGGCAC 60 30, 40
GTCTATCTCTGTAGCCCCTATTAC
G (SEQ ID NO:86)
Vibrio cholerae ctx 384 CGGGCAGATTCTAGACCTTC 62 25
GCACCCCAAATAGAACTCGA
(SEQ ID NO:87)
Vibrio cholerae ctxA 564 CGGGCAGATTCTAGACCTCCTGC 60 55
GATGATCTTGGAGCATTCCCAC
(SEQ ID NO:88)
Vibrio cholerae ctxAB 777 TGAAATAAAGCAGTCAGGTGGTG 55 25-35
ATTCTGCACACAAATCAG
GGTATTCTGCACACAAATCAG
(SEQ ID NO:89)
Vibrio cholerae luxA 350 GGAAGCTTCCAATGATTCTAAGC 55 25
TGGATGGGAATTCTCAGGCGTCC
CTACTGGGTT (SEQ ID NO:90)
Vibrio tdh 648 CTGTCCCTTTTCCTGCCCCCG 62 25
parahaemolyticus GCTCTTAGCTGCGGCGGTGGT
(SEQ ID NO:91)
Vibrio Cytolysin 388 CGCCGCTCACTGGGGCACTGGCT 65 40, 50
vulnificus GCCAGCCGTTAAGCGAACCACCC
GC (SEQ ID NO:92)
Vibrio Cytolysin 519 CCGCGGTACAGGTTGGCGCA 67-69 30
vulnificus CGCCACCCACTTTCGGGCC
(SEQ ID NO:93)
Yersinia ail 273 GAACTCGATGATAACTGGG 65 35
enterocolitica GCAATTCAACCCACTTCAA
(SEQ ID NO:94)
Yersinia ail 170 ACTCGATGATAACTGGGGAG 55 25, 30
enterocolitica CCCCCAGTAATCCATAAAGG
(SEQ ID NO:95)
Yersinia ail 425 TTAATGTGTACGCTGCGAGTG 57 35
enterocolitica GGAGTATTCATATGAAGCGTC
(SEQ ID NO:96)
Yersinia inv 359 CTATTGGTTATGCGCAAAGC ? ?
enterocolitica TGGAAGTGGGTTGAATTGCA
(SEQ ID NO:97)
Yersinia yst 163 AATGCTGTCTTCATTTGGAGC 60 35
enterocolitica GCAACATACATCACAGCAAT
C (SEQ ID NO:98)
Yersinia yst AAAGATATTTTTGTTCTTGT 43 30
enterocolitica GCAGCCAGCACACGCGGG
(SEQ ID NO:99)
Yersinia inv 295 TAAGGGTACTATCGAGGCGG 55 25, 30
pseudotuberculosis ACGTGAAATTAACCGTCACAC
T (SEQ ID NO:100)
Yersinia virF 590 TCATGGCAGAACAGCAGTCA ? ?
virulence GACTCATCTTACCATTAAGAA
plasmid G (SEQ ID NO:101)
Yersinia virF 590 CATGGCAGAACAGCAGTCAG 57 35
virulence ACTCATCTTACCATTAAGAAG
plasmid (SEQ ID NO:102)
Norwalk virus Near 3′ end 456 ATTGAGAGCCTCCGCGTG 49 30-40
GGTGGCGAAGCGGCCCTC
(SEQ ID NO:103)
Norwalk virus pol 470 CTTGTTGGTTTGAGGCCATAT 55 40
ATAAAAGTTGGCATGAACA
(SEQ ID NO:104)
Norwalk virus pol 260 CAAATTATGACAGAATCCTTC 55 40
GAGAAATATGACATGGATTG
C (SEQ ID NO:105)
Norwalk virus IP 224 CACCACCATAAACAGGCTG 50 40
AGCCTGATAGAGCATTCTTT
(SEQ ID NO:106)
Rotavirus vp7 1036  GGCTTTAAAAGAGAGAATTTC 42 25
CGTCTGG
GGTCACATCATACAATTCCTA
ATCTAAG (SEQ ID NO:107)
Rotavirus Gottfried ? CCATATCAGCCAACGAGT 42 30
gene 4 seg. TTACTACTTCTACATCAGGT
(SEQ ID NO:108)
Rotavirus OSU gene 4 ? CATACCAACCAACCACTTTC 42 30
seg. TGATGTCATATTTACTGTGT
(SEQ ID NO:109)
Rotavirus near 5′ end 259 GGCTTTTAAACGAAGTCTTC 55 30
(group A) TCAACAATGCGTCTAAGTTCA
CAG (SEQ ID NO:110)
Hepatitis A VP1 302 TCCCAGAGCTCCATTGAA 37 30
virus CATTATTTCATGCTCCTCAG
(SEQ ID NO:111)
Hepatitis A VP3 207 ACAGGTATACAAAGTCAG 37 30
virus CTCCAGAATGATCTCC (SEQ
ID NO:112)
Hepatitus A VP3 207 CTCCAGAATCATCTCC 49 40
virus ACAGGTATACAAAGTCAG
(SEQ ID NO:113)
? ? Sequences not reported ? 30
Enteroviruses Near 5′ end 154 CCTCCGGCCCCTGAATGCGGC 50 25, 50
TAATTAACAGTGGATTCGTCG
GT (SEQ ID NO:114)

Species specific primers and nucleic acid target sequences for C. jejuni are provided in Table 4 below. See, Day et al., Appl. Environ. Microbiol.: 1019 (March 1997).

TABLE 4
Further Species Specific Sequences
Primers Target Sequence
Organism (5′ to 3′) (5′ to 3′)
Campylobacter jejuni
AGTCAGCCAC (SEQ. ID NO: 126) ATCGGGCTGTTATGATGATA (SEQ. ID NO: 127)
AATCGGGATG (SEQ. ID NO: 128) ATCACTGGGGGAGCTAATAT (SEQ. ID NO: 129)
AGGGGTCTTG (SEQ. ID NO: 130) TAAGGTTAAAGTTGTTGTGAATC (SEQ. ID NO: 131)
AGCCAGCGAA (SEQ. ID NO: 132) CATATCCAGAGCCTCTGGAT (SEQ. ID NO: 133)
GAAACGGGTG (SEQ. ID NO: 134) GTAGCCTCTTCATCGTCGTCTAA (SEQ. ID NO: 135)
GTGACGTAGG (SEQ. ID NO: 136) CACCCGCTTTAACGCCAAGA (SEQ. ID NO: 137)

The construction of the DNA beacon molecule, PCR reaction conditions, and sample preparation are detailed below. Briefly, generally known PCR reaction conditions are suitable. For example, a master pre-mix for a standard 50 μl reaction, although the volume may be reduced to as small as a 10 μl per reaction, may be as follows. 24 μl water free of nucleases, proteases, heavy metals and DNA/RNA may be mixed with 5 μl of a 2% PVPP aqueous solution (polyvinylpolypyrrolidone), 5 μl of 10×PCR buffer, e.g. 100 mM tris-HCl, pH 8.3, 500 mM KCl, 5 μl of 25 mM MgCl2, 1.25 μl 50 ng/μl of each primer, 1 μl 10 mM of each dNTP, 2.5 μl of enzyme, e.g. AmpliTaq LD at a 1:5 dilution and 2 μl of DNA template preparation, as described below. The cycling parameters may be 30 sec. at 95 ° C., 30 sec. at 58° C. and 60 sec. at 74° C. This routine may be repeated 30-50 times depending on the sensitivity needed, which is generally empirically determined by the type of sample and sample preparation without undue experimentation.

The preparation of the sample is adapted empirically based on whether or not there are interfering substances in the sample, and what type of substances they are, as is known in the art. Once the proper sample preparation is attained, DNA extraction may be attained, for example, by simple boiling for 10 min prior to utilization of the sample as DNA template or target in the reaction. For example, to test for sterility of shelf stable commercially sterile pudding, the pudding may be diluted in ultrapure water 1:30 and boiled for 10 min before adding to the PCR pre-mix.

The fluorescent beacon is constructed by assembly of the separate parts, that is the nucleic acid and the fluorophore and quencher are synthesized separately and then bound by means of linkers, e.g. amino linkers, as is known in the art.

A large variety of microorganisms are involved in the contamination of, for example, food, cosmetics, medical supplies and fuids, blood products, intravenous solutions, and the like, among other commercial products. Examples of these are E. coli, Salmonella, Bacillus, Clostridium, Listeria, Pseudomonas, and many others including those listed above, all of which are promptly detected by the present technology, which is suitable for the standardized testing of products samples to determine their suitability for administration to or use in humans or animals. A necessarily incomplete list of microorganisms commonly present in foodstuffs is listed by Hill W. E., in Critical Rev. Food Sci. and Nutrition 36 (1 & 2): 123 (1996), along with other universal and specific bacterial primers and PCR cycling temperature pairs, the relevant pages thereof being incorporated herein by reference, e.g. pp. 140-146, among others. Other universal and specific sequences of internal DNA segments plus DNA arms including the 5′ and 3′ termini of the beacon are also provided by Schofield et al., Appl. and Environ. Microbiol. 63(3): 1143 (1997), the relevant sections of which are incorporated herein by reference, e.g., Tables 1 and 2, and the section on Cultivation of Bacteria, among others.

The reaction conditions for nucleic acid amplification may be custom tailored for the specific primers employed, and an artisan would know how to easily and quickly determine suitable conditions for specific applications. When the sample to be analyzed is suspected of containing a sufficient quantity of bacteria, generally a nucleic acid sequence about 100 and up to about 500 nucleotide long, and preferably up to about 200 base pairs long or even longer, may be amplified, and a polynucleotide DNA (or fluorescent beacon probe) designed so that it hybridizes to a portion of the DNA fragment. However, longer and smaller segments of nucleotide may also be utilized. When hybridized to a target, the amount of fluorescence emitted by polynucleotide plus fluorogenic reagents (or by a fluorescent beacon) is proportional to the amount of amplified nucleic acid present in the sample. The PCR conditions are generally set up so that the expected nucleic acid product comprises about 100 about 400 base pairs and contains, among other sequences, the target sequence for the complementary polynucleotide DNA internal segment (probe). However, other lengths are also suitable. The PCR may be conducted for as many cycles as necessary to obtain enough nucleic acid to bind the DNA beacon and obtain a linear fluorescent signal. In most cases up to about 30 PCR cycles are sufficient to produce enough nucleic acid target for the the DNA polynucleotide (or beacon) to bind to, and to produce sufficient fluorescence for observation with the naked eye after gel electrophoresis. A specialized instrument or fluorometer may be utilized for the measurement of fluorescence during the course of the reaction, and the display of typical response curves.

A sample may be assayed side-by-side with proper positive and negative controls, as is known in the art, and whether or not the sample has bacterial contamination may be conclusively determined in as short a time as 10 minutes. Positive controls may be conducted by following the same steps performed on the test sample but by adding to the medium a target nucleic acid sequence, e.g. naked DNA or bacteria, viruses, and the like. Negative controls are conducted in a manner similar to that of the test sample but contain no target nucleic acid.

This invention was described above in relation to the universal detection of microorganisms and/or viruses, and for the specific detection of a class of microorganism(s), e.g. bacteria, as well as for implementation with one beacon and two DNA primers. The invention is, however, not limited to either the described sequences, nor the number of polynucleotides (or fluorescent beacons) and primers. In fact, any combination of primer and polynucleotide (or beacon) sequences that are specific or universal for microorganisms and viruses, including yeast, molds, and the like, may be substituted and/or added to the nucleic acid target subjected to PCR. Examples of nucleic acid targets which may be utilized are those specific for a microorganism, or genus or class of microorganisms, such as a nucleic acid segment imparting a virulence trait, DNA sequences that are order-, class-, strain- and/or species-specific, such as those based on immunological identity, e.g. antigenic proteins or flagella. A partial list of DNA target probe sequences and their corresponding primers is provided by Hill, E. W. et al., Critical Rev. Food Sci. & Nutrition 36(182):123 (1996), the relevant text of which is incorporated herein by reference.

Similarly, nucleic acid targets and primers may also be utilized to design polynucleotides (or fluorescent beacons) which specifically hybridize to a single species of virus or microorganism, bacteria such as E. coli, Salmonella, Listeria, etc., viruses such as Rotavirus, Influenza, etc., among others. Thus, the assay and the kit of the invention may also be targeted to the determination of specific microorganisms and/or viruses. The kit of this invention along with a instructions to custom tailor and perform PCR may be applied for the intended use in conjunction with any commercially available thermocycler. One embodiment of this invention, therefore, provides a kit which contains a pre-mixed composition comprising specific nucleic acid primers and beacon probes, which may carry a fluorescent molecule. Alternatively, the fluorogenic tag or beacon may be provided separately for attachment prior to use. The reaction mixture (pre-mix) is intended for direct mixing with a sample, and for practicing the present assay detecting the presence of microorganisms and viruses in as short a time as about 10 minutes after sample preparation. The kit of the invention may be pre-packaged in bulk for aliquoting by the user, or in unit form, as lyophilized or vitriculated form, in reaction vessels to ensure the stability of the components during shipping and storage. When in lyophilized or vitriculated form, the user may simply rehydrate the reaction ingredients in the vessel containing them or upon aliquoting, with a predetermined amount of sample preparation and conduct the detection step by placing the vessel in the fluorimeter.

The user of the kit of this invention need not be technically skilled to perform the assay provided here, to obtain accurate results. The present inventor has discovered and designed DNA segments for the universal detection of microorganisms, e.g. bacteria. Other DNA segments complementary to known nucleic acid sequences which have specificity for one or the other microorganism or virus may be designed and amplified by known PCR reactions for use with the present kit and assay. PCR reaction conditions are widely known in the art, and known and to-be-discovered universal and specific nucleic acid sequences, and primers, may be utilized with this technology. See, Hill (1996), supra.

The method and kit of the invention find numerous suitable applications, for example, in the food and cosmetic industry, as well as for the clinical diagnostic industry, e.g. for the detection of general or specific microorganisms and viruses, with simple instrumentation, and unskilled technicians.

EXAMPLES Example 1

Typical PCR Reaction Components & Conditions

A master pre-mix for a standard 50 μl reaction (may be reduced to as small as a 10 μl reaction) is prepared as follows.

24 μl ultra purified water free of nucleases, proteases, heavy metals and DNA/RNA are mixed with 5 μl of a 2% solution of PVPP (polyvinylpolypyrrolidone) in ultra purified water, 5 μl of 10×PCR buffer (100 mM tris-HCl, pH 8.3, 500 mM KCl in ultrapure water), 5 μl of MgCl2 (25 mM solution in ultrapure water), 1.25 μl of each primer (2 solutions at 50 ng/μl in ultrapure water), 1 μl of each dNTP (4 solutions at 10 mM in ultrapure water), 2.5 μl of enzyme (AmpliTaq LD at a 1:5 dilution in ultrapure water, Perkin-Elmer) and 2 μl of DNA template preparation as described below.

The mixture is then cycled under the following conditions: 30 sec at 95° C., 30 sec at 58° C. and 60 sec at 74° C. Each cycle is repeated 30-50 times depending on the sensitivity needed (determined by sample type and sample preparation, empirically).

Example 2

Sample Preparation

The conditions for the preparation of the sample are determined empirically based on the type and amount of the expected interfering substances to be present in the sample. However, once the proper blend of sample is finalized, a simple boil DNA extraction for 10 min is conducted prior to utilizing the sample as DNA template in the reaction.

To test for sterility of shelf stable commercially sterile pudding, for example, the pudding is diluted in ultrapure water 1:30 times, and boiled for 10 min before adding the pudding sample to a PCR pre-mix.

Example 3

Beacon Synthesis

Custom oligonucleotides having specified nucleotide sequences, a 5′-methoxytrityl protected C6 thio group, and a 3′-C7 amino linker group were utilized as starting materials for the synthesis. The synthetic sequence first converts the amine group of the oligomer to its dabcyl amide derivative, removes the methoxytrityl protective group, and converts the resulting thiol to edans or fluorescein thioether derivatives. Tyagi and Kramer's general synthetic strategy is employed by following Tyagi's supplemental procedures. See, Tyagi, S. And Kramer, R. R.,Molecular Beacons: Probes that Fluoresce upon Hybridization. Nature Biotechnology 14:303-308 (1996); modified as described here under the advise of Tyagi, S., Preparation of Molecular Beacons, Private Communication (1996).

Tyagi's procedure was modified for the present work in several ways, most significantly by changing reaction conditions during attachment of the edans of fluorescein groups, deletion of the precipitation step during the purification of the dabcylated intermediate and deletion of both HPLC and precipitation steps during purification of the final beacon product. In our hands, the precipitation of the dabcyl intermediate and the beacon product from ethanolic solution either did not occur or resulted in substantial losses of material. Under the conditions described here, conversion of the dabcyl intermediate to the beacon proceeded cleanly and, in many cases, HPLC purification of the product afforded little benefit.

DETAILED PREPARATION OF CODE 23 S-B′-FLUORESCEIN BEACON Example 4

Reconstitution of DNA Oligomer

The DNA oligomer is a lyophilized solid obtained from Midland Certified Reagent Co. (Lot 021098-175, 2008 nmoles). It was dissolved in 3.0 m/L 0.1 M carbonate buffer (pH=8.5) and 500 μl used for the following dabcylation reaction.

Example 5

Conversion of Oligomer to Dabcyl Derivative

Aliquots (10 μL) of a saturated solution of se-dabcyl (Molecular Probes, 4-((4-dimethylamino)phenyl)azo)benzoic acid, succinimidyl ester) in dimethylformamide (DMF) were added at approximately 30 min intervals to the stirred oligomer. The se-dabcyl reagent was made by mixing 12.2 mg se-dabcyl with 110 μL DMF. A total of 10 aliquots are added. The reaction was allowed to proceed at ambient temperature for about 29 hours.

Example 6

Purification of the Dabcyl Intermediate

The reaction mixture was transferred to a small centrifuge tube, centrifuged for 4 min. at 14000 rpm, and the supernatant transferred to a second centrifuge vial. Residual material in the reaction flask was washed with a total of 400 μL of 0.01M triethylammonium acetate (TEAA, pH=6.5), and the washings used to resuspend the solids from the first centrifugation. After centrifugation, the supernatant was added to that from the first centrifugation. The total volume of the combined supernatants was reduced to 500 μL by vacuum evaporation (Speed Vac). Unreacted se-dabcyl and other relatively small compounds were separated from the dabcyl derivative and other oligomeric species by gel permeation chromotography using an NAP-5 (Pharmacia) column and 0.01 M TEAA mobile phase. See below, for specific procedure used for a NAP-5 column). The fraction containing the higher molecular weight materials was concentrated to slightly less than 500 μL. Dabcyl intermediate was then separated from other oligomers via reversed phase HPLC (Vydac C 18 column, see note 2 for procedure) of two approximately 250 μL injections.

Under the HPLC conditions employed, the present dabcyl intermediate had a retention time of about 28-30 min and yields yellowish fractions. Several 1 mL fractions in this region were pooled and concentrated to 500 μl. The dabcyl intermediate was desalted by NAP-5 column chromatography using 0.01M TEAA mobile phase arid the resulting 1 mL eluate concentrated to about 250 μL.

Example 7

Conversion of Dabcyl Intermediate to Fluorescein Beacon

After removing a 5 μL sample (for analysis by HPLC, note 3), 10 μl of a freshly prepared aqueous silver nitrate (0.27 g AgNO3/10 mL, about a 5-fold molar excess of AgNO3 over DNA oligomer, solution was added and the mixture allowed to react for 30 min at room temperature with intermittent mixing. See, Connolly, B. A., Chemical Synthesis of Oligonucleotides Containing a Free Sulfhydryl Group and Subsequent Attachment of Thiol Specific Probes, Nucleic Acids Research 13 (12): 4485-4503 (1985).

15 μL of freshly prepared aqueous dithiothreitol solution (0.23 dithiothreitol/10 mL, about a 7-fold molar excess over DNA oligomer) were added and reaction proceeded for 5 min at ambient temperatures with occasional stirring. The reaction mixture was centrifuged, and the supernatant transferred to a fresh reaction vial. Another 5 μL analytical sample was removed. The pH of the remaining supernatant was then adjusted to about 9.0 by treating with an equal volume (about 265 μL) of 0.2M carbonate (pH=9.0). To this, 25 μL of a freshly prepared solution of 5-IAF in dimethylsulfoxide (DMSO) was added. This solution contained about 10.9 mg 5-IAF (Molecular Probes, 5-IAF iodoacetamidofluorescein) in 125 μL DMSO. This is about a 13.5-fold excess of 5-IAF over oligomer and about a 2.5-fold molar excess of 5-IAF. over total sulfhydryl groups (deprotected DNA oligomer and dithiothreitol). After brief mixing, reaction was allowed to proceed for about 3.5 days at refrigerator temperatures (about 5° C.).

Example 8

Purification of Fluorescein Beacon

The volume of the reaction mixture was reduced to 500 μL and the crude reaction mixture chromatographed on an NAP-5 column using 2 mM Tris buffer (pH=8.3, Trizma, Sigma). The higher molecular weight fraction was concentrated to 500 μL and again purified on an NAP-5 column with Tris mobile phase. The volume of the final preparation was adjusted to 500 μl.

Example 9

Fluorescein Beacon Yield

The concentration on the final beacon product was determined spectrophotometrically (absorbance at 260 nm) after correcting the observed reading for the spectral contribution of the dabcyl and fluorescein groups.

Abs 260 (corr)=Abs 260 (obs)/1.14

The yield from this preparation was about 31% based on amount of starting DNA oligomer.

Example 10

NAP-5 Gel Permeation Chromatography

A NAP-5 column was equilibrated to the particular mobile phase and used according to the manufacturer's directions. This entails allowing the excess liquid present with the commercial column to elute, equilibration with about 10 mL of mobile phase, and loading the sample (volume 500 μl max). During loading, all of the liquid phase was allowed to enter the column bed and eluting material is discarded. Subsequently, a small centrifuge vial was positioned to collect eluant and 1.0 mL of mobile phase was added. The approximately 1.0 mL eluting contains most of the desired DNA oligomeric materials.

Example 11

Reversed Phase HPLC

A Waters instrument equipped with dual pumps, a solvent programmer (Waters 600E System Controller), Vydac C18 RP column, UV-Vis detector (Waters 486 Tunable Absorbance Detector), A/D converter (PE Nelson 900 Series Interface), computer with associated chromatographic software (PE Nelson Turbochrom), and manual injector was used. The column flow rate used was 1.0 mL/min, and the detection wavelength was usually 260 (sometimes 490) mm. A linear solvent gradient changed solvent composition from 100% A to 100% B over a 40 min period. Solvent A was an 80:20 (v/v) mixture of 0. IM TEAA (pH=6.5) and acetonitrile; solvent B a 30:70 mixture of 0.1M TEAA and acetonitrile.

Example 12

Analytical HPLC

The composition of the starting material, the final product and intermediate preparations (both the protected and deprotected dabcyl species) were monitored by HPLC under conditions identical to those described below but using 20 μL injections. The aliquots noted above were concentrated enough that, after dilution about 10-fold (usually in 0.1M TEAA or 2 mM Tris buffers), adequate responses were detected.

Edans

The edans beacon referred to above results from reacting the deprotected sulfhydryl group with 1,5-IAEDANS (Molecular Probes, 1,5-IAEDANS stands for 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1 sulfonic acid).

References

1. Tyagi, S. And Kramer, R. R., 1996. Molecular Beacons: Probes that Fluoresce upon Hybridization. Nature Biotechnology 14:303-308.

2. Tyagi, S., 1996. Preparation of Molecular Beacons. Private communication.

3. Connolly, B. A. 1985. Chemical Synthesis of Oligonucleotides Containing a Free Sulfhydryl Group and Subsequent Attachment of Thiol Specific Probes. Nucleic Acids Research 13(12): 4485-4503.

Citas de patentes
Patente citada Fecha de presentación Fecha de publicación Solicitante Título
US46831957 Feb 198628 Jul 1987Cetus CorporationProcess for amplifying, detecting, and/or-cloning nucleic acid sequences
US468320225 Oct 198527 Nov 1990Bioniche Life Sciences Inc.Título no disponible
US480015917 Dic 198624 Ene 1989Cetus CorporationProcess for amplifying, detecting, and/or cloning nucleic acid sequences
US488981817 Jun 198726 Dic 1989Cetus CorporationPurified thermostable enzyme
US496518817 Jun 198723 Oct 1990Cetus CorporationProcess for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US52100156 Ago 199011 May 1993Hoffman-La Roche Inc.Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US53407289 Dic 199223 Ago 1994E. I. Du Pont De Nemours And CompanyMethod for amplification of targeted segments of nucleic acid using nested polymerase chain reaction
US557414215 Dic 199212 Nov 1996Microprobe CorporationPeptide linkers for improved oligonucleotide delivery
US58467836 Ago 19968 Dic 1998Gull LaboratoriesMethods and apparatus for preparing, amplifying, and discriminating multiple analytes
US58663363 Ene 19972 Feb 1999Oncor, Inc.Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
US592551712 May 199520 Jul 1999The Public Health Research Institute Of The City Of New York, Inc.Detectably labeled dual conformation oligonucleotide probes, assays and kits
US59940664 Nov 199630 Nov 1999Infectio Diagnostic, Inc.Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
WO1989003891A114 Oct 19885 May 1989Chiron CorporationNucleic acid multimers and amplified nucleic acid hybridization assays using same
WO1995013399A114 Nov 199418 May 1995The Public Health Research Institute Of The City OHybridization probes for nucleic acid detection, universal stems, methods and kits
WO1996024686A27 Feb 199615 Ago 1996Bio MerieuxDetection of bacteria of genus listeria using nucleic probe hybridisation techniques
Otras citas
Referencia
1Applied and Environmental Microbology, Mar. 1997, p. 1019-1023, Use of an Arbitrarily Primed PCR Product in the Development of a Campylobacter jejuni-Specific PCR, by Day, et al.
2Applied and Evironmenal Microbiology, Mar. 1997, p. 1143-1147, Molecular Beacons: Trial of a Flourescence-Based Solution Hybridization Technique for Ecological Studies with Ruminal Bacteria, by Schofieldet al.
3Branlant et al. "Structural study of ribosomal 23 sRNA from E. coli" FEBS Letters, 1979, 107(1): 177-181.*
4Erlich et al. Recent Advances in the Polymerase Chain Reaction Science, 1991, 252: 1643-1650.*
5Nature Biotechnology, vol. 14, Mar. 1996, Molecular Beacons: Probes that Fluoresce upon Hybridization, by Tuagi et al.
6The Polymerase Chain Reaction: Applications for the Detection of Foodborne Pathogens, by Walter E. Hill, 1996.
Citada por
Patente citante Fecha de presentación Fecha de publicación Solicitante Título
US725599212 Sep 200314 Ago 2007Isis Pharmaceuticals, IncMethods for rapid detection and identification of bioagents for environmental and product testing
US80885826 Abr 20073 Ene 2012Ibis Biosciences, Inc.Compositions for the use in identification of fungi
US809337213 Feb 200310 Ene 2012Life Technologies CorporationMethod for deblocking of labeled oligonucleotides
US82422547 Mar 200714 Ago 2012Ibis Biosciences, Inc.Compositions for use in identification of bacteria
US82885237 Mar 200716 Oct 2012Ibis Biosciences, Inc.Compositions for use in identification of bacteria
US829875824 Dic 200430 Oct 2012National Agriculture And Food Research OrganizationMethod of multiplex microorganism detection
US83949457 Mar 200712 Mar 2013Ibis Biosciences, Inc.Compositions for use in identification of bacteria
EP2272980A19 Jul 200912 Ene 2011Bioesplora SRLMolecular probes for target nucleic acid detection and quantification
WO2005024046A210 Mar 200417 Mar 2005Isis Pharmaceuticals, Inc.Methods of detection and notification of bioagent contamination
WO2005108579A110 May 200517 Nov 2005Hebert, AlexandrePolynucleotides for the detection of staphylococcus aureus
WO2005112544A219 Feb 20051 Dic 2005The Governors Of The University Of AlbertaLeptin promoter polymorphisms and uses thereof