WO1990008187A1 - Soluble two domain cd2 protein - Google Patents

Abstract

A soluble CD2 peptide having an LFA-3 binding domain and antigenic epitopes recognized by antibodies raised against native CD2 on the surface of T cells and is capable of forming at least two intramolecular disulfide bonds. The peptide is capable of binding LFA-3, inhibiting CD2-mediated T cell activation and reacting with antibodies raised against CD2. Preferably, the soluble peptide comprises an amino acid sequence of 182 residues in length which is encoded by two extracellular segment exons of the gene encoding human CD2 glycoprotein.

Description

SOLUBLE TWO DOMAIN CD2 PROTEIN

Background

The human CD2 (T11) molecule is a 50KD surface glycoprotein expressed on >95% of thymocytes and virtual ly all peripheral T lymphocytes which

mediates both adhesion between these cells and their cognate partners as well as subsequent activation events. Specific combinations of antibodies against the surface-bound molecule can activate IL-2

dependent T cell proliferation, helper T cell function and cytotoxicity by natural killer cells and cytolytic T lymphocytes (Meuer, S.C., e t al . ,

Cell 36:897-906 (1984); Brottier, P., et al., J. Immunol., 135:1624-1631 (1985); Siliciano, R.F., et al . , Nature 317: 428-430 (1985)) in the absence of cellular adhesion. In addition, thymocyte

activation can be mediated via CD2 (Fox, D.A., e t a l . , J. Immunol. 134:330-335 (1985); Denning, S.M., et al.., J. Imminol. 139:2573-2578 (1987)). The role of CD2 in approximation of T cells to various cell types including human thymic epithelial cells, B cells, target cells and sheep erythrocytes has been demonstrated to depend on direct interaction between CD2 and the broadly distributed human lymphocyte function-associated, antigen 3 (LFA-3) surface glycoprotein or its sheep homologue, TUTS (Denning, S.M., et al.., J. Immunol. 139: 2573-2578 (1987); Hunig, T., J. Exp. Med. 162 : 890-901 (1985); Hunig, T., et al., Nature 326: 298-301 (1987); Shaw, S. et al., Nature 323: 262-264 (1986); Selvaraj, P., et al., Nature 326 : 400-403 (1987); Vollger, et al . , J. Immunol. 138:358-363 (1987)). Biochemical analyses using specific monoclonal antibodies show that CD2 is T lineage-specific and exists on the cell surface in several differentially glycosylated forms (Howard, F.D., e t al., J.

Immunol. 126:2117-2122 (1981); Brown, M.H., et al., In Leucocyte Typing III ed McMichael, A.J., Oxford University Press pp. 110-112 (1987); Sayre, P.H., et al., Proc. Natl. Acad. Sci. USA 84:2941-2945

(1987)). CD2 cDNA clones predict a cleaved signal peptide of 24 amino acid residues, an extracellular segment of 185 residues, a transmembrane domain of 25 residues and a cytoplasmic region of 117 residues (Sayre, P.H., et al., Proc. Natl. Acad. Sci. USA 84:2941-2945 (1987); Sewell, W.A., et al., Proc. Natl. Acad. Sci. USA 83:8718-8722 (1986); Seed, B. and A. Aruffo, Proc. Natl. Acad. Sci. USA

84:3365-3369 (1987); Clayton, L.K., et al., Eur. J. Immunol. 17:1367-1370 (1987)). The corresponding genomic organization reveals a single exon encoding the signal peptide (less four residues), two exons encoding the extracellular segment, one exon

encoding the transmembrane domain and charged membrane anchor segment, and one exon encoding the cytoplasmic region (Diamond, D.J., et al . , Proc. Natl. Acad. Sci. USA 85:1615-1619 (1988)). Summary of the Invention

This invention pertains to a soluble peptide having a lymphocyte function-associated antigen 3 (LFA-3) binding domain and antigenic epitopes recognized by antibodies raised against native surface CD2 on resting T lymphocytes. The soluble peptide is capable of forming at least two intramolecular disulfide bonds and binds the surfacebound CD2 legand, LFA-3. The soluble peptides of this invention exist as monomers in an aqueous medium. Preferably, the soluble peptides have an amino acid sequence encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein. Most preferably, the soluble peptides have about 182 amino acid residues encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein. Soluble peptides of this invention can be made by enzymatic fragmentation, peptide synthesis, or recombinant DNA technology. They can be used to block T cell function which is dependent upon antigen activation.

Brief Description of th Drawings

Figure 1 shows the amino acid sequence and exon organization of human CD2.

Figure la shows the DNA sequence of human CD2 glycoprotein.

Figure 2 shows the structure of recombinant soluble T11_ex2, native CD2 and its genomic

organization.

Figure 3 shows the construction of expression plasmid for production of the CD2 external segment molecule T11_ex2.

Figure 4 shows SDS-PAGE analysis of purified, radioiodinated and endoglyos idase digested T11_ex2.

Figure 5 shows equilibrium sedimentation data.

Figure 6 shows the circular dichroism spectra of T11_ex2. Figure 7 shows the competitive inhibition of radioiodinated T11_ex2 binding of JY cells.

Figure 8 shows the saturation binding of T11_ex2. to JY cells and Scatchard analysis.

Detailed Description of the Invention

This invention pertains to a soluble peptide having a lymphocyte function-associated antigen 3 (LFA-3) binding domain and antigenic epitopes

recognized by antibodies raised against native surface CD2 on resting T lymphocytes. The soluble peptide is capable of forming at least two intramolecular disulfide bonds and binds the surface¬bound CD2 ligand, LFA-3. Specifically, the antigenic epitopes which are localized on the peptide are T11₁, T11₂ and T11₃. The soluble peptides are further capable of inhibiting CD2-mediated T cell activation and are soluble in aqueous medium and exist as monomers in the same.

In one embodiment, the soluble peptides have an amino acid sequence encoded by the two extracellular segment exons of the gene encoding human CD2

glycoprotein. The soluble peptides are capable of binding the surface-bound CD2 ligand, LFA-3, and can react with antibodies raised against native CD2 on the surface of human T cells. The soluble peptides are further capable of inhibiting CD2-mediated T cell activation. The peptides exist as monomers in an aqueous medium.

In the preferred embodiment, the soluble peptide comprises about 182 amino acid residues encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein. The soluble peptide is monomeric in aqueous medium and comprises four cysteine residues located in the carboxy-terminal region of the amino acid sequence. The peptide is capable of forming at least two sets of intramolecular disulfide bonds between the amino-terminal cysteines and the carboxy-terminal cysteines. Preferably, the peptide has the

following amino acid sequence: ammo

Lys Glu He Thr Asn Ala Leu Glu Thr Trp

11 Gly Ala Leu Gly Gln Asp He Asn Leu Asp

21 He Pro Ser Phe Gln Met Ser Asp Asp He

31 Asp Asp He Lys Trp Glu Lys Thr Ser Asp

41 Lys Lys Lys He Ala Gln Phe Arg Lys Glu

51 Lys Glu Thr Phe Lys Glu Lys Asp Thr Tyr

61 Lys Leu Phe Lys Asn Gly Thr Leu Lys He

71 Lys His Leu Lys Thr Asp Asp Gln Asp He

81 Tyr Lys Val Ser He Tyr Asp Thr Lys Gly

91 Lys Asn Val Leu Glu Lys He Phe Asp Leu

01 Lys He Gln Glu Arg Val Ser Lys Pro Lys

11 He Ser Trp Thr Cys He Asn Thr Thr Leu

21 Thr Cys Glu Val Met Asn Gly Thr Asp Pro

31 Glu Leu Asn Leu Tyr Gln Asp Gly Lys His

41 Leu Lys Leu Ser Gln Arg Val He Thr His

51 Lys Trp Thr Thr Ser Leu Ser Ala Lys Phe

61 Lys Cys Thr Ala Gly Asn Lys Val Ser Lys

71 Glu Ser Ser Val Glu Pro Val Ser Cys Pro

81 Glu Lys

carboxy The soluble peptide of about 182 amino acid residues in length has an LFA-3 binding domain and comprises the antigenic epitopes T11₁, T11₂ and T11₃ which are localized on the soluble peptide. The epitopes, which are localized on this peptide are antigenic determinants which are recognized by antibodies against the native surface CD2 structure on resting T lymphocytes. Thus, the peptides of this invention can be used to inhibit CD2-mediated T cell

activation.

The above amino acid sequence corresponds with a portion of the naturally occurring extracellular domain of CD2 that is capable of binding LFA-3, inhibiting CD2-mediated T cell activation and reacting with antibodies raised against native CD2 on the surface of human T cells. Amino acid

sequences embraced by this invention include

analogous or homologous sequences which encode proteins capable of binding LFA-3, inhibiting

CD2-mediated T cell activation and reacting with antibodies raised against native CD2. In addition, the peptide structure can be modified by deletions, additions, inversions, insertions or substitutions of one or more amino acid residues in the sequence to yield peptides having the characteristics of the peptides of this invention. All such modifications of the above amino acid sequence are embraced by this invention without essentially detracting from the properties of the peptide, i.e., the capacity of the peptide to bind LFA-3, inhibit CD2-mediated T cell activation and react with antibodies raised against native CD2 on the surface of human T cells. Naturally occurin allelic variations and

modifications are included within the scope of the invention so long as the variation does not

substantially reduce the ability of the peptide to bind LFA-3 and inhibit CD2-mediated T cell

activation.

The soluble peptides of this invention carry epitopes recognized by antibodies against native surface CD2 structure on resting T lymphocytes and interacts specifically with the surface-bound CD2 ligand, LFA-3. Additionally, the soluble peptide exists as a monomer in aqueous medium and includes a proteolytically-resistant amino-terminal fragment encoded by the first extracellular segment exon of the gene encoding human CD2 glycoprotein. The proteolytically resistant fragment comprises about 100 amino acid residues which correspond with the amino-terminal portion of the extracellular domain of human CD2 glycoprotein and is capable of

inhibiting CD2-mediated T cell activation. The 100 amino acid fragment has been described in U.S.

Patent Application Serial No. 07/293,330 filed

January 4, 1989, by Reinherz et al. , the teachings of which are incorporated herein by reference. The entire amino acid sequence and exon organization of human CD2 glycoprotein is shown in Figure 1. This amino acid sequence of human CD2 was deduced from cDNA (Sayre, P.H., et al., Proc. Natl. Acad. Sci.

USA 84:2941-2945 (1987); Sewell, W.A., et al., Proc. Natl. Acad. Sci. USA 83:8718-8722 (1986); Seed, B. and A. Aruffo, Proc. Natl. Acad. Sci. USA

84:3365-3369 (1987)) and genomic clones (Diamond, et al., Proc. Natl. Acad. Sci. USA 85:1615-1619

(1988)). This invention also pertains to an isolated DNA sequence that encodes a soluble monomeric human CD2 peptide having an LFA-3 binding domain and antigenic epitopes recognized by antibodies raised against native CD2 on the surface of human T cells and is capable of forming at least two intramolecular disulfide bonds. Specifically, the antigenic epitopes are T11₁, T11₂ and T11₃. The peptide that is encoded by the isolated DNA of this invention and is capable of binding LFA-3, inhibiting CD2-mediated T cell activation and reacting with antibodies raised against native CD2 on the surface of human T cells. In a preferred embodiment, the isolated DNA sequence encodes a soluble peptide having an amino acid sequence encoded by the two extracellular segment exons of the gene encoding the human CD2 glycoprotein. The encoded peptide Is capable of binding LFA-3, inhibiting CD2-mediated T cell activation and reacting with antibodies raised against native CD2. Preferably, the isolated DNA of the invention encodes the 182 amino acid sequence shown above or substantial coding equivalent thereof. The DNA sequence can be modified by deletion, insertion or substitution of nucleotides to yield peptides which exhibit substantially the same properties of the above peptide of about 182 amino acid residues. All such modifications of the DNA sequence are within the scope of this invention so long as the DNA sequence encodes a soluble peptide that is capable of binding LFA-3 and inhibiting CD2 -mediated T cell activation. The isolated DNA sequences of the invention can be made using recombinant DNA technology or chemically synthesized. The DNA sequence for CD2 glycoprotein is shown in Figure la.

This invention further pertains to a

recombinant expression vector comprising the DNA sequence encoding a soluble, monomeric human CD2 peptide having an LFA-3 binding domain and the antigenic epitopes T11₁, T11₂ and T11₃. The

antigenic epitopes are recognized by antibodies raised against native CD2 on resting T cells and interacts specifically with LFA-3. The encoded soluble protein is capable of forming at least two intramolecular disulfide bonds. Alternatively, the expression vector comprises a DNA sequence encoding a soluble CD2 protein encoded by the two extracellular segment exons of the gene encoding human CD2 which is capable of inhibiting CD2-mediated T cell activation and LFA-3 binding. Preferably, the expression vector is a baculovirus transfer vector and comprises a DNA sequence which encodes a peptide of about 182 amino acid residues as shown above. Other vectors, however, may be used, including prokaryotic and eukaryotic expression systems.

Modifications of the peptide in which amino acid residues have been deleted, inserted or substituted without essentially detracting from the properties of the peptide are embraced by the invention. The invention further pertains to cells transformed with the above expression vector.

Soluble peptides of this invention can be made by enzymatic fragmentation of human CD2 glycoprotein or a portion thereof, by peptide synthesis or recombinant DNA technology. Preferably, the soluble CD2 peptides will be produced by inserting DNA encoding a peptide sequence which is capable of binding LFA-3 and inhibiting CD2-mediated T cell activation (e.g., CD2 DNA which represents the desired amino acid sequence of the extracellular domain of CD2) into an expression vector. The transformed cells then express the soluble human CD2 peptide encoded by the two extracellular segment exons of the gene encoding the human CD2

glycoprotein. The peptide expressed by the

transformed cells is capable of binding LFA-3 and inhibiting CD2 -mediated T cell activation. In addition to genetic engineering techniques for synthesizing soluble peptides of the invention, the soluble peptides can be synthesized directly by procedures of chemical protein synthesis. For example, the above 182 amino acid sequence or modified equivalent thereof can be synthesized by the solid phase procedure of Merrifield.

This invention further pertains to a method of inhibiting T cell activation, comprising the step of administering to a patient, a soluble peptide having an LFA-3 binding domain, antigenic epitopes recognized by antibodies raised against native CD2 on the surface of human T cells and is capable of forming at least two intramolecular disulfide bonds. In another embodiment, a patient is administered a solution containing a soluble peptide having an amino acid sequence encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein. The peptide is capable of binding LFA-3, inhibiting T cell activation and reacting with antibodies raised against the native CD2 protein. Preferably, the soluble peptide comprises a sequence of about 182 amino acid residues which corresponds with the portion of the extracellular domain of human CD2 glycoprotein or fragment thereof which is capable of binding LFA-3 and inhibiting CD2-mediated T cell activation. In one embodiment of the method, the soluble peptide can be administered

intravenously.

The soluble CD2 peptides of this invention generally will bind to human lymphocytes and human red blood cells which express a homolgous set of surface structures. The soluble peptides are also capable of competing with the naturally-present CD2 on the surface of a human lymphocyte, thus

interfering with the ability of the lymphocyte to make contact with its target cells (if the

lymphocyte is a cytolytic cell), or with macrophages having CD2 binding structures which permit the cell-to-cell contact necessary for lymphocyte proliferation. To test a soluble peptide for the ability to inhibit lymphocyte proliferation, or the cytotoxic effector. function, the soluble peptide is contacted with the lymphocytes prior to stimulation with mitogen, and degree of proliferation is

measured, using standard techniques, and the result compared to a control in which the soluble peptide was not used. The soluble peptides of this invention can be used in a variety of diagnostic and therapeutic applications in which the CD2 surface glycoprotein Is expressed on the surface of many human T cell malignancies, e.g., T cell leukemias and lymphomas. In addition, autoimmune diseases, e.g., rheumatoid arthritis and Systemic Lupus Erhthmatosis (SLE), are characterized by the presence in the blood and lymph of large numbers of CD2-bearing T cells. Rapid cell turnover in these disease states can cause the shedding of the CD2 molecule into the bloodstream.

The CD2 soluble peptides of this invention can be used as an immunogen to produce polyclonal or monoclonal anti-CD2 antibodies, using conventional techniques. These antibodies can be labeled with any conventional label, e.g., radioisotopes, and used in conventional immunoassay methods to measure serum CD2 levels and thus monitor patients having T cell associated diseases. Particularly sensitive ELISA-type assays will employ two anti-CD2 antibodies, each to a different antigenic determinant on the surface of CD2, in a sandwich format.

The disease states which can be treated using the soluble peptides of this Invention Include medical conditions characterized by unwanted

activity of the immune system which results in excess T cell activation, which plays a key role in the amplification of the immune response. These conditions include SLE; juvenile onset diabetes; multiple sclerosis; allergic conditions;

inflammatory conditions such as exzema, ulcerative colitis, inflammatory bowel disease, and Crohn's disease; and allograft rejection (e.g., rejection of a transplanted heart or kidney). The soluble CD2 peptides compete with the surface-bound CD2 for its ligand on target cells thus dampening immune

response amplification. The soluble CD2 peptide admixed with a pharmaceutically acceptable carrier substance such as saline, is administered

intraveneously to a human patient in an effective amount, e.g., 20 μg to 500 μg per kg body weight. Preferably, the soluble peptide admixed with a pharmaceutically acceptable carrier comprises about 182 amino acid residues which correspond to a portion of the extracellular domain of CD2 that is capable of binding LFA-3 and inhibiting CD2-mediated CD2 activation. For some conditions, a soluble CD2 peptide can be administered directly to the site where needed most; for example, a soluble CD2 peptide can be injected directly into the inflammed joint of a human patient suffering from rhematoid arthritis.

This invention is further illustrated by the following Exemplification.

EXEMPLIFICATION

The term T11_ex2, as referred to in the

Exemplification, is defined herein to be a soluble protein having an amino acid sequence encoding the two extracellular segment exons and a codon

(182-Lys) derived from the transmembrane domain exon of the CD2 glycoprotein. The entire amino acid sequence for CD2 has been described. See U.S.

Patent Application Serial No. 932,871, filed

November 18, 1986, by Reinherz et al., the teachings of which are incorporated herein by reference.

Baculovirus Transfer Vector Plasmid_Construct _for

T11_ex2

The plasmid pAc373/T11_ex2 was constructed by digestion of pGEM-4-S1, a pGEM derivative containing a 950 bp fragment of the CD2 cDNA PB2 (Sayre et al., Proc. Natl. Acad. Sci. USA 84:2941-2945 (1987)) with PvuII, which digests the cDNA at nucleotide position 628 near the start of the transmembrane region. A double-stranded synthetic oligonucleotide linker:

CTGTCCAGAGAAATAAGGATCCT GACAGGTCTCTTTATTCCTAGGA containing the last base for the Ser-178 codon, codons for Cys-Pro-Glu-Lys, a stop codon and a BamHI restriction site was synthesized and ligated to the blunt PvuII ends. After BamHI digestion, the insert was cloned into the BamHI site of the pAc373

baculovirus transfer vector (Smith et al., Annu.

Rev.__Immuno. 2:319-333 (1985)). All restriction enzymes were produced from New England Biolabs

(Beverly, MA).

Recombinant protein production

Transfer of the T11_ex2 sequences from the plasmid vector to the AcNPV genome to generate recombinant baculovirus T11_ex2--AcNPV was ac complished essentially as described (Smith e t al_. , Proc. Natl. Acad. Sci. USA , 82:8404-8408 (1985);

Hussey e t aL._, Nature, 331:78-81 (1988). Metabolic labeling with ³⁵S-cysteine of T11_ex2-AcNPV-infected

SF9 cells was carried out as described (Hussey et al. , Nature 331:78-81 (1988). Metabolically labeled culture supernatants were harvested, microfuged for

10 min. and subjected to immunoprecipitation for 16 h at 4°C with a monoclonal anti-CD2 antibody

(anti-T11₁, 3T4-8B5) linked to Affigel-10 (Biorad)beads (10 mg monoclonal antibody/ml gel). After immunoabsorption the beads were washed twice with lysis buffer and bound material eluted with 0.1 M glycine, HCl buffer, pH2. Eluates were analyzed by

SDS-PAGE in 12.5% gels. Large protein production was performed as described (Hussey et al., Nature

331:78-81 (1988)) except that proteins were purified over an anti-T11₁ (3T4-8B5) immunoaffinity column. protein microseequencing

Proteins were prepared for microsequencing by electrophoresis on 12.5% polyacrylamide gels, followed by electroblotting onto polyvinylidene difluoride membranes according to the method of Matsudaira, J. Biol. Chem. 262:10035-10038 (1987). After visualization with Coomassie blue, stained bands were excised and loaded onto an Applied

Biosystems (Foster City, CA) 470A sequencer and sequenced using the O3RPTH program. Endoglycosidase F digestion of T11_ex2

1 μg samples of purified T11_ex2 dialyzed against PBS were incubated in Endo-F buffer (0.1 M sodium phosphate, 1% NP-40, 1% 2 -mercaptoethanol, 50 mM EDTA, 1 mM phenylmethyl-sulfonyl fluoride, pH 6.1) in the presence of 0.7 units Endo-F (NEN) in 7 μl reaction volumes. Digestion was arrested at the indicated times by addition of 15 μl SDS sample buffer, boiling for 5 min. and freezing at -20°C prior to analysis by 12.5% SDS-PAGE.

Equilibrium sedimentation

Sedimentation studies were performed using the short column, high speed meniscus-depletion method of Yphantis Biochem. 3:297-317 (1964); and

Richardson et al., Biochem. J. 135:87-92 (1973)). Standard double-sector cells, equipped with sapphire windows, 4 mm solution column lengths and a temperature of 21°C were used.

Papain digestion

Papain (32 ng) was added to 8 μg samples of T11_ex2 at 0.5 mg/ml in PBS containing 10 mM DTT for an enzyme:protein ratio of 1:250. Samples were incubated at 37°C for 15, 30, 45 or 60 min.

Digestions were stopped by the addition of SDS buffer and boiling for 5 min. Samples were

electrophoresed on a 12.5% polyacrylamide gel and stained with Coomassie blue. Circular dichroism

Far ultraviolet CD spectra were obtained on an Instruments SA Jobin Yvon circular dichrograph calibrated with (+) 10-camphorsulfonic acid and epiandos terone. Measurements were taken at 25, 50 and 80°C +/-0.1°C in 10 mM sodium phosphate pH 7.2 in a 1 mm cell. All spectra represent an average of 3 to 5 individual spectra with data taken at 0.5 mm intervals using a 10 second response time for each point. Protein concentrations were determined by quantitative amino acid analysis of aliquots taken from the sample ceils.

Rosette inhibition assay

Jurkat cells were washed with SMEM/2% FCS

(wash) and resuspended at 10 /ml. Sheep erythrocytes were washed twice in HBSS and resuspended in wash to 5% v/v. 10 μl of sheep erythrocytes were aliquoted into 12-75 mm plastic tubes and 100 μl wash, T11_ex2 protein or control soluble CD4 T4_ex1protein (Hussey et al., Nature 331:78-81 (1988) was added, followed by incubation at 4ºC for 30 min.

Subsequently, 20 μl of Jurkat cells were added after 5 min., centrifuged at 800 rpm in a Sorvall RT6000, followed by incubation at 4°C for 1 h. The cell mixture was gently resuspended and mounted on glass slides with cover slips and rosette formation assessed on a Zeiss photomicroscope. Radiolabeled T11_ex2 binding assays

The purified recombinant soluble CD2

extracellular domain molecule T11_ex2 was

radioiodinated as follows: 50 μl T11_ex2 (1 mg/ml) dialyzed against PBS was labeled with 10 μl

immobilized lactoperoxidase/ glucose oxidase

(Enzymobeads; Biorad Laboratories, Richmond, CA) in

40 mM sodium phosphate, pH 7.2, 0.4% glucose and 1 mCi ¹²⁵I for 5 min. After quenching the reaction for 20 min. with 20 mM sodium iodide and 0.02% sodium azide, 20 μl FCS was added and the free iodine separated on a 1 ml Bio-Gel P-6 column

(Biorad Laboratories) conditioned with 0.2M sodium phosphate pH 7.2, 10% FCS and run in the same buffer.

Cold competition studies: 5 × 10⁶ cpm radiolabelled T11_ex2 (2.8 × 10⁸ cpm/nmole) was added at

0.1 μM to 1.8 × 10⁶ JY cells overlayed onto 0.2 ml of a 1.5:1 mixture of dibutyl phthalate:dioctyl phthalate (Aldrich Chemical Co., Milwaukee, WI) in

0.5 ml plastic tubes as described in Teshigawara et al., J. Exp. Medicine 165:223-238 (1987).

Increasing concentrations of unlabelled T11_ex2 or

T4_ex1 were added in a final volume of 200 μl in RPMI

1640/10% FCS. After 1 h incubation at 4°C, the tubes were centrifuged (8,500 g for 1 min.), the tips of the tubes containing the cell pellets were cut, and the cell-bound and free radioactivity were determined in a gamma counter. To some tubes, anti-LFA-3 antibody TS2/9 (generously provided by Dr. Timothy Springer, Dana Farber Cancer Institute) was added at 50 μg/ml as a separate determination of nonspecific binding. This concentration of anti- LFA-3 was independently shown to give maximal inhibition of T11_ex2 binding. Specific activity was calculated using a MW for T11_ex2 of 30,000. Protein concentrations were determined by quantitative amino acid analysis of standard T11_ex2 samples.

Subsequent samples were compared to standards by

Coomassie blue staining of two-fold dilutions of standard and test samples run on the same gel and analyzed by densitometry.

Saturation binding studies: Increasing

concentrations of radiolabelled T11_ex2 (1.31 × 10⁷ cpm/nmole) were added to 2.6 × 10⁶ JY cells in the presence or absence of 50 μg/ml anti-LFA-3 antibody to determine nonspecific binding. Binding was carried out as above and the dissociation constant determined by Scatchard analysis after subtraction of nonspecific binding determined in the presence of anti-LFA-3.

RESULTS

Production and purification of T11_ex2

A construct for expression of a soluble

fragment of CD2 that included all the residues encoded by the leader and two extracellular segment exons was designed (Figure 2, exons 1-3).

Figure 2 shows a comparison of the 182 extracellular CD2 amino acids comprising T11_ex2 (top) to CD2 protein structure (middle). The positions of cysteine residues (C), carbohydrate addition sites (CHO), the CD2 leader segment (L) and the CD2 transmembrane domain (TM) are indicated. In the CD2 gene (bottom), exon 1 corresponds to CD2 amino acid residues -24 to -4, exon 2 to residues -4 to 104, exon 3 to residues 104 to 181, exon 4 to residues 181 to 222, and exon 5 to residues 222 to 327

(Diamond et al., PNAS USA 85:1615-1619 (1988).

The plasmid pAc373/T11_ex2 was constructed and encodes 182 amino acids of the predicted CD2 external segment including all of the residues derived from the two extracellular exons (Figure 2) and part of one codon (for Glu-181) and all of a second codon (for Lys-182) derived from the transmembrane domain exon. This construction, thus, includes all four extracellular cysteine residues located in domain II of CD2 and thereby avoids problems associated with intermolecular disulfide exchange observed with a previous construction (Richardson, et al._, Proc.

Natl. Acad. Sci USA 85:5176-5180 (1988)).

Plasmid pAc373/T11_ex2 was used to co-transfect SF9 with AcNPV baculoviral DNA. Recombinant baculovirus, termed T11_ex2-AcNPV, were selected, purified and used to infect small-scale cultures for

metabolic labeling. Immunoprecipitation of radiolabelled supernatants with anti-T11₁ (3T4-8B5), an anti-CD2 specific monoclonal antibody (Meuer et al.,

Cell 36:897-906 (1984), verified that T11_ex2-AcNPV directed the production of a recombinant CD2

molecule in SF9 cells (data now shown).

T11_ex2-AcNPV was therefore used to infect liter cultures for the production of large amounts of protein. T11_ex2 protein was purified from infected cell supernatants by affinity chromtography on an anti-T11 column.

The construction of expression plasmid for production of the CD2 external segment molecule T11_ex2 is shown in Figure 3. The plasmid pGEM-4-S1 carries a 950 bp fragment of the CD2 cDNA. After digestion of pGEM-4-S1 with PvuII, ligation of the double-stranded linker and further digestion with BamHI, the cDNA insert was isolated and ligated into the BamHI-digested baculoviral transfer vector pAc373. The resulting plasmid pAc373/T11_ex2 encodes 182 amino acids of the mature CD2 extracellular segment. The promoter for the polyhedrin gene in the pAc373 transfer vector is shown by the black box and the polyhedrin gene is indicated by the open box. The 950 bp CD2 coding fragment in pGEM-4-S1 is shown in a stippled box. The position of the T7 polymerase promoter in the pGEM vector is shown.

Biochemical characterization of T11_ex2

Figure 4 shows the purification,

radioiodination and endoglycosodase digestion of T11_ex2. Lanes a-d contain 1 λg T11_ex2 purified from large scale cultures of SF9 cells infected with T11_ex2-AcNPV was analyzed by Coomassie staining on a 12.5% polyacrylamide gel in the presence of 50 mM DTT (lane a) or in nonreducing conditions (lane b). An aliquot of T11_ex2 radioiodinated with solid-phase lac toperoxidase/glucose oxidase was analyzed on the same gel in the presence (lane c) or absence (lane d) of 50 Mm DTT by autoradiography. Lanes e-k contain 1 μg purified T11_ex2 which was digested with

9.7 units Endo-F for varying amounts of time and the reaction stopped by the addition of SDS sample buffer prior to SDS-PAGE analysis and Coomassle staining. Lane e contains no enzyme; f,

simultaneous addition of enzyme and sample buffer; g-j, 1 min, 5 min, 1 h, 18 h digestion; k, 0.7 units

Endo-F alone.

T11_ex2 migrates as a well-demarcated doublet in both reducing and non-reducing conditions in SDS-PAGE (Figure 4, lanes a and b). Two well-separated bands at 30-31KD are seen in the presence of 50 mM DTT (lane a), which migrate at 27-28KD in the absence of reducing agent (lane b). The clear-cut decrease in electrophoretic mobility after reduction with DTT strongly indicates that T11_ex2 contains intrachain disulfide bridges; it does not form interchain bridges. Although not shown, microsequencing analysis of S-cysteine labeled peptides verifies_^ that there are two sets of intrachain disulfide bonds in T11_ex2 between the amino-terminal cysteines and carboxy-terminal cysteines.

To investigate the difference between the two bands representing T11_ex2, 160 pmole of purified protein was separated by SDS-PAGE and blotted onto a PVDF membrane (Matsudiara, J. BioL Chem.

262:10035-10038 (1987)). The upper and lower bands were cut separately from the membrane for amino-terminal sequencing. Each band yielded the CD2 amino-terminal sequence, suggesting that they differ from one another by post-translational modification. As shown in Figure 4, endoglycosidase digestion generates at least five distinct bands. After short digestion times, two new lower molecular weight species are generated (lanes f-h). Some glycans on T11_ex2 are apparently . quite susceptible to digestion since even after simultaneous addition of enzyme and

SDS sample buffer, these new species are generated

(lane f). After 1 h digestion, most of the T11_ex2 protein is digested to a 25KD species (line i);

overnight digestion results in complete digestion to a single band at 25KD (lane j). Note that the band of approximately 45KD size represents the Endo-F enzyme since it appears in lane k, where an equivalent amount of enzyme alone has been analyzed. The origin of the faint band at 48KD in lane j is unclear.

To determine whether T11_ex2 exists as a noncovalently linked multimer in aqueous solution, it was subjected to equilibrium sedimentation by the high-speed meniscus depletion method (Yphantis,

Biochem. 3:297-317 (1964) in both aqueous and dissociating conditions. As shown in Figure 5, the calculated molecular weights for both conditions are very similar (25.3KD in aqueous solution vs. 24.7KD in dissociating conditions). This result

demonstrates that T11_ex2 exists as a monomer in solution.

Figure 5 shows the equilibrium sedimentation analysis as a plot of log (fringe displacement) against square of distance from center of rotation, r². T11_ex2 (0.05%) was analyzed by sedimentation equilibrium on a Beckman model E analytical ultracentrifuge in aqueous solution (PBS) at 30,000 rpm (ω - 3.142 X 10³ rad/sec) or in dissociating

conditions (6 M guanidine hydrochloride) at 44,000 rpm (ω - 4.608 x 10³ rad/sec). Data were obtained at 22°C (PBS) or 23ºC (guanidine-hydrochloride).

Assuming a partial specific volume of 0.725, the calculated molecular weight from the displayed slope and using the equation: MW = 4.606 RT × slope/[ω(1 - v^bar ω)] is 25,315 daltons in aqueous solution.

Assuming a partial specific volume (denoted as v^bar) of 0.725 - 0.1 in 6 M guanidine hydrochloride

(Richardson, N.E., et: al., Biqchem J. 135_:87-92 (1973)), the calculated molecular weight is 24,736 daltons in dissociating conditions.

The expression of CD2 epitopes was investigated by immunoprecipitation analysis. The T11_ex2 molecule can be immunoprecipitated by both anti-T11₁ and a second monoclonal antibody to a different epitope termed anti-T11₂. However, T11_ex2 is not immunoprecipitated by the anti-CD2 antibody, anti-T11₃, which defines an activation specific epitope on CD2.

Nevertheless, T11_ex2 was able to Inhibit the binding of anti-TlL-FITC to the T11₃ + Jurkat cell line at a concentration of 10 μm, implying its presence on T11_ex2 (data not shown). These results also suggest that the affinity of anti-T11₃ for its epitope is low.

Secondary structure predictions suggest the presence of both α-helical and β-sheet structure in the CD2 external domain (Clayton et al., Eur. J.

Immunol 17:1367-1370 (1987)). To more directly predict secondary structural characteristics, the T11_ex2 molecule was evaluated by circular dichroism.

Figure 6 shows the circular dichroism spectras of T11_ex2. Far ultraviolet circular dichroism spectra represent the average of 3-5 individual spectra with data taken at 0.5 nm wavelenght intervals in 10mM sodium phosphate, pH 7.2 A: spectrum at 25°C of untreated T11_ex2; B: spectrum of T11_ex2 reduced with

10 μM DTT and alkylated with 20μM iodacetamide; C: thermal denaturation of the sample in A; D: thermal denaturation of the sample in B.

As shown in Figure 6A, the far ultraviolet CD spectrum of T11_ex2 in 10 mM sodium phosphate shows a positive absorption maximum at about 200 nm (Δε =

0.459), a negative minimum at 215 nm (Δε = -1.94) and shoulder at 225 nm (Δε = -1.0). When the T11_ex2 molecule is reduced by 50 mM DTT and subsequently alkylated with iodoacetamide, the CD spectrum is substantially altered, pointing to a role for disulfide bridges in stabilizing secondary and tertiary structure (Figure 6B). The fact that the spectrum of the non-reduced molecule reflects significant thermal denaturation at 80°C (Figure 6C) confirms that substantial secondary structure is present in soluble T11_ex2. As expected, the pattern after thermal denaturation is the same for the reduced as for the non-reduced molecule (compare Figures 6C and 6D).

In its overall pattern, the CD spectrum

resembles that for Thy-1 (Campell e t al., Nature 282:341-342 (1979)) which is a well-recognized member of the immunoglobulin superfamily (Williams and Barclay, Annu. Rev. Immmunol. 6:381-405 (1988)) and Is therefore predicted to consist entirely of β-sheet. However, the shoulder at 225 nm is absent from the Thy-1 profile. To obtain a more objective prediction of secondary structure from the CD spectrum, the digitalized absorption data (Table I) were deconvoluted according to the inverse matrix method of Compton and Johnson, Anal. Biochem.

155:155-167 (1986). The resulting predictions for proportions of secondary elements are: α-helix, 20%; anti-parallel β-sheet, 13%; parallel β-sheet, 9%, turn, 20%, other, 46%. Since none of the protein In the data sets used to determine the matrix values are homologous to CD2, the predicted fractions of secondary structure are only approximate. When the same CD data are deconvoluted by the method of Yang et al., Meth. Enzymol. 130:208-209 (1986a), 15% α and 40% β structures are predicted.

TABLE I

DIGITIZED PROTEIN CIRCULAR DICHROISM SPECTRUM

FOR T11_ex2FROM 184-260 nm at 2 nm INTERVALS

Wavelength Δ∊ Wavelength Δ∊

184 -1.49 224 -1.002

186 -1.50 226 -0.923

188 -1.345 228 -0.856

190 -1.176 230 -0.743

192 -1.026 232 -0.629

194 -0.284 234 -0.515

196 0.241 236 -0.426

198 0.411 238 -0.348

200 0.459 240 -0.282

202 0.360 242 -0.234

204 0.027 244 -0.195

206 -0.432 246 -0.151

208 -0.959 248 -0.112

210 -1.467 250 -0.089

212 -1.750 252 -0.077

214 -1.949 254 -0.062

216 -1.930 256 -0.044

218 -1.771 258 -0.018

220 -1.515 260 -0.018

222 -1.241

Spectrum was taken in 10 mM sodium phosphate (pH 7.2) in a 1 mm cell at 22°C. Secondary structure predictions were calculated by taking dot products with inverse CD spectra for the five secondary structure categories as described In Table 6 of

Compton and Johnson, Appl. Biochem. 155:155-167

(1986). The calculated results are: α-helix, 20%; anti-parallel β-sheet, 13%; parallel β-sheet, 9%; turn, 20%; other, 46%. Units for Δε are M^-1cm

To investigate the presence of proteaseresistant domains in the T11_ex2 molecule, limited papain digestions were performed. Fifteen min.

digestion at an enzyme:protein ratio of 1:250 at 37°C yields a major band at 15KD when analyzed by SDS-PAGE (data not shown). Longer digestion times cause partial disappearance of the 15KD band.

Approximately 400 pmol of this 15KD material was blotted onto PVDF and sequenced, yielding 19 unambiguous residues corresponding to the CD2 aminoterminus. These results demonstrate that the carboxy region of T11_ex2 is much less resistant to papain digestion that its amino-terminal counterpart. T11_ex2 inhibits sheep erythrocyte rosetting

The ability of T11_ex2 to interact with the CD2 ligand expressed on the surface of various cell types was investigated. The capacity of T11_ex2 to inhibit sheep erythrocyte rosetting with T lymphocytes was tested. Table II shows that rosetting is completely inhibited at concentrations of T11_ex2 greater than 5 μM; half-maximal inhibition occurs between 0.63 and 1.25 μM T11_ex2. Note that the antl-T11₁ (3T4-8B5) antibody abrogates rosetting at a concentration as low as 0.007 μM (Table II). This result suggests that any direct interaction between the soluble T11_ex2 molecule and the CD2 ligand is of relatively low affinity. TABLE II

CONCENTRATI0N_DEPENDENCE OF T11_ex2 INHIBITION OF SHEEP ERYTHROCYTE-HUMAN T SELL ROSETTES

Protein Added (μm )

None 100

T11_ex2 20 0

10 0

5 0

2.5 4.8

1.25 9.9

0.63 122

0.31 84

0.16 116

0.08 110

T4_ex1 20 66

10 91

5 96

2.5 105

1.25 90

0.63 72

0.31 110

0.16 99

0.08 116

Anti- 0.7 0

CD2 0.07 0

0.006 0

For rosette formation, sheep erythrocytes were

preincubated with soluble protein or antibody at the indicated concentrations for 1 h at 4°C followed by the addition of Jurkat cells, co-centrifugation and a further 1 h incubation at 4°C. Rosettes were counted in a hemacytometer. Control value was the fraction of rosette formation in the absence of added protein.

Anti-CD2 was the anti-T11₁ antibody of 3T4-8B5. T11_ex2 blocks the binding of anti-LFA-3 monoclonal antibody

To investigate whether T11_ex2 could interact with a previously defined ligand for CD2 on human cells (Selveraj et al., Nature 326:400-403 (1987), Its ability to block the binding of monoclonal anti-LFA-3 antibody TS9/2 (Sanchez-Madrid et al., Proc. Natl. Acad. Sci. USA 79:7489-7493 (1982) to LFA-3 bearing cells was tested. Specifically, anti-LFA-3 reactivity was measured by FACS analysis on the human B lymphoblas toid line JY, which

expresses high levels of LFA-3. As shown in Table III, preincubation of JY cells with soluble CD4 does not affect this staining, whereas preincubation with 10 μM T11_ex2 causes a substantial decrease In observed fluorescence, reducing linear immunofluoroescence from channel 120 to 30.6. This represents a reduction of 85% of specific anti-LFA-3 reactivity (calculated after subtraction of the background fluorescence of 13.2 linear units).

Significant blocking is also seen at 1 μM but not at

0.1 μM. Addition of the control soluble CD4 T4_ex1 protein has no effect on anti-LFA-3 binding. Thus, by this measure, as well as by inhibition of sheep erythrocyte rosetting, the affinity of T11_ex2 for its ligand is apparently in the micromolar range. TABLE I I I

CONCENTRATION DEPENDENCE OF T11_ex2INHIBITION OF

MONOCLONAL ANTI-LFA-3 ANTIBODY BINDING

Anti-LFA-3 Mean Fluorescense

Protein Added Antibody Added Intensity

T11_ex2:

300 μg/ml (10 μM) + 30.6

30 μg/ml (1 μM) + 66.1

3 μg/ml (0.1 μM) + 109.1

0.3 μg/ml (0.01 μM) + 119.8

T4_ex2:

300 μg/ml + 125.1

30 μg/ml + 120.2

3 μg/ml + 117.6

0.3 μg/ml + 116.9

None + 123.7

- 13.2

Mean fluorescence intensities were obtained on a linear scale from 0-250. T11_ex2 b inds to LFA- 3 o n human β lymphoblas toid cells

Since T11_ex2 clearly inhibits sheep erythrocyte rosetting and blocks the binding of anti-LFA-3 antibody, we determined whether specific, saturable binding of T11_ex2 to human cells bearing LFA-3 could be detected. Two types of binding assays were employed. In the first, increasing amounts of unlabeled T11_ex2 was added to a mixture of the JY B lymphoblastoid cell line plus a constant amount of

¹²⁵I labeled T11_ex2 (ligand).

Figure 7 shows the competitive inhibition of radioiodinated T11_ex2 binding to JY cells. 5 × 10 cpm radiolabelled T11_ex2 (2.8 × 10 cpm/nmole) was added at 0.1 μM to 1.8 × 10 JY cells overlayed onto

0.2 ml of a 1.5:1 mixture of dibutyl phthalate:

dioctyl phthalate:dioctyl phthalate in 0.5 ml plastic tubes. Increasing concentrations of

unlabeled T11_ex2 (closed circles) or T4_ex1 as a control (open circles) were added in a final volume of 200 μl in RPMI 1640/10% FCS. After 1 h

incubation at 4°C, tubes were spun, cell pellets severed and bound radioactivity was determined. To one tube anti-LFA-3 antibody TS2/9 was added at 50 μg/ml as a determination of non-specific binding. Specific cpm are the total cpm minus cpm bound in the presence of anti-LFA-3 (9070 cpm). Binding in the presence on control anti-HLA monoclonal antibody W6/32 is also shown (triangle).

As shown in Figure 7, binding of radiolabeled T11_ex2 is progessively inhibited by the addition of increasing amounts of unlabeled molecules.

Half-maximal inhibition occurs at about 0.5 μM

T11_ex2. In contrast and as expected, addition of soluble CD4 T4_ex1 protein has no effect on

¹²⁵I-labeled T11_ex2 binding to JY.

As a second measure of binding, increasing amounts of labeled T11_ex2 were added to a constant number of JY cells. Figure 8 shows the saturation binding of T11_ex2 to JY cells and Scatchard

analysis: Increasing concentrations of radiolabeled

T11_ex2 (1.31 × 10⁷ cpm/nmole) were added to 2.6 ×

10⁶ JY cells in the presence or absence of 50 μg/ml anti-LFA-3 antibody to determine nonspecific

binding. Binding was carried out as above and the dissociation constant determined by Scatchard analysis after subtraction of nonspecific binding determined in the presence of anti-LFA-3. Top:

total binding (open circles) and specific binding

(closed circles). Botton: Scatchard analysis:

correlation coefficient = 0.98; -1/slope - K_d = 0.4 μM.

As shown in Figure 8 (top), specific binding is saturable. These saturation binding data were transformed by Scatchard analysis (Figure 8,

bottom). Specific T11_ex2 binding is saturated at about 300 × 10³ molecules per cell. The Scarchard plot yields an estimated dissociation constant of

0.4 μM for the TH_ex2-LFA-3 interaction. Note that although a single incubation period (1 h at 4°C) of cells with ligand was used in these experiments, kinetic analysis demonstrates that maximal

T11_ex2-LFA-3 binding occurs within 5 min. Conclusion

We have shown that a soluble, monomeric extracellular segment CD2 molecule, termed T11_ex2, carries epitopes recognized by antibodies against the native surface CD2 structure on resting T lymphocytes and interacts specifically with the surface-bound CD2 ligand, LFA-3. The measured dissociation constant for this interaction is 0.4 μM, implying a low affinity relative to hormone receptor-ligand interactions (i.e., for IL-2 K_d = 10^-11 M) (Smith, 1984) but equivalent to that of primary antibody responses (K_d = 10^-5 to 10^-6)

(Elsen and Siskind, 1964). The T11_ex2 molecule gives rise to a proteolytically-resis tant 15KD amino-terminal papain fragment, suggesting that the amino-terminal ~100 amino acid residues comprise a stable, well-folded domain corresponding to a polypeptide encoded by the first extracellular exon, In contrast, despite disulfide linkages, the

carboxy-terminal encoded extracellular domain is labile to papain.

Deposit

The virus, AcNP/T11_ex2 has been deposited at the American Type Culture Collection in Rockville, Maryland on January 19, 1989, and assigned the ATCC Accession Number .

- - - - - - - - - - - Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiment of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A soluble peptide having a lymphocyte functionassociated antigen 3 (LFA-3) binding domain and antigenic epitopes recognized by antibodies raised against native CD2 on the surface of human T cells; the peptide being capable of binding LFA-3 and forming at least two

intramolecular disulfide bonds.

2. A soluble peptide of Claim 1 wherein the

antigenic epitopes are T11₁, T11₂ and T11₃.

3. A soluble peptide of Claim 2 wherein the

peptide exists as a monomer in aqueous medium.

4. An isolated soluble peptide having an amino acid sequence encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein, the peptide being capable of binding LFA-3, inhibiting CD2-mediated T cell activation and reacting with antibodies raised against native CD2 on the surface of human T cells.

5. A soluble peptide of Claim 4 wherein the

peptide exists as a monomer in aqueous medium.

6. The soluble peptide of Claim 4 having the amino acid sequence:

Lys Glu He Thr Asn Ala Leu Glu Thr Trp

Gly Ala Leu Gly Gln Asp He Asn Leu Asp

He Pro Ser Phe Gln Met Ser Asp Asp He

Asp Asp He Lys Trp Glu Lys Thr Ser Asp

Lys Lys Lys He Ala Gln Phe Arg Lys Glu

Lys Glu Thr Phe Lys Glu Lys Asp Thr Tyr

Lys Leu Phe Lys Asn Gly Thr Leu Lys He

Lys His Leu Lys Thr Asp Asp Gln Asp He

Tyr Lys Val Ser He Tyr Asp Thr Lys Gly

Lys Asn Val Leu Glu Lys He Phe Asp Leu

Lys He Gln Glu Arg Val Ser Lys Pro Lys

He Ser Trp Thr Cys He Asn Thr Thr Leu

Thr Cys Glu Val Met Asn Gly Thr Asp Pro

Glu Leu Asn Leu Tyr Gln Asp Gly Lys His

Leu Lys Leu Ser Gln Arg Val He Thr His

Lys Trp Thr Thr Ser Leu Ser Ala Lys Phe

Lys Cys Thr Ala Gly Asn Lys Val Ser Lys

Glu Ser Ser Val Glu Pro Val Ser Cys Pro

Glu Lys and modifications of the peptide in which amino acid residues have been deleted, inserted or substituted without essentially detracting from the properties thereof.

7. The soluble peptide of Claim 6 comprising T11₁, T11₂ and T11₃ epitopes localized on the

peptide.

8. The soluble peptide of Claim 7 having the LFA-3 binding domain.

9. An isolated DNA sequence encoding a soluble

peptide having a lymphocyte function-associated antigen 3 binding domain and antigenic epitopes recognized by antibodies raised against native CD2 on the surface of human T cells; the peptide being capable of binding LFA-3 and forming at least two intramolecular disulfide bonds.

10. An isolated DNA sequence encoding a soluble

peptide having an amino acid sequence encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein, the peptide being capable of binding LFA-3, inhibiting CD2-mediated T cell activation and reacting with antibodies raised against native CD2 on the surface of human T cells.

11. An isolated DNA sequence encoding the amino acid sequence of Claim 6 or substantial coding equivalents thereof.

12. An expression vector having an isolated DNA sequence as claimed in Claim 9.

13. An expression vector having the isolated DNA sequence as claimed in Claim 10.

14. An expression vector having an isolated DNA sequence encoding the amino acid sequence of Claim 5.

15. An expression vector of Claim 9 wherein the vector is a baculovirus transfer vector.

16. A cell transformed with the expression vector of Claim 12.

17. A cell transformed with the expression vector of Claim 13.

18. A cell transformed with the expression vector of Claim 14.

19. A plasmid having the ATCC Accession Number

.

- - - - - - - - - -

20. A method of inhibiting T cell activation

comprising the step of administering to a patient a soluble peptide having a lymphocyte function- associated antigen 3 binding domain and antigenic epitopes recognized by antibodies raised against native CD2 on the surface of human T cells; the peptide being capable of binding LFA-3 and forming at least two

intramolecular disulfide bonds.

21. A method of Claim 20 wherein the soluble peptide is administered intravenously.

22. A method of inhibiting T cell activation

comprising the step of administering to a patient a soluble peptide having an amino acid sequence encoded by the two extracellular segment exons of the gene encoding human CD2 glycoprotein, the peptide being capable of binding LFA-3, inhibiting T cell activation and reacting with antibodies raised against the native CD2 protein on the surface of human T cells.

23. A method of Claim 22 wherein the soluble peptide comprise the amino acid sequence:

Lys Glu He Thr Asn Ala Leu Glu Thr Trp

Gly Ala Leu Gly Gln Asp He Asn Leu Asp

He Pro Ser Phe Gln Met Ser Asp Asp He

Asp Asp He Lys Trp Glu Lys Thr Ser Asp

Lys Lys Lys He Ala Gln Phe Arg Lys Glu

Lys Glu Thr Phe Lys Glu Lys Asp Thr Tyr

Lys Leu Phe Lys Asn Gly Thr Leu Lys He

Lys His Leu Lys Thr Asp Asp Gln Asp He

Tyr Lys Val Ser He Tyr Asp Thr Lys Gly

Lys Asn Val Leu Glu Lys He Phe Asp Leu

Lys He Gln Glu Arg Val Ser Lys Pro Lys

He Ser Trp Thr Cys He Asn Thr Thr Leu

Thr Cys Glu Val Met Asn Gly Thr Asp Pro

Glu Leu Asn Leu Tyr Gln Asp Gly Lys His

Leu Lys Leu Ser Gln Arg Val He Thr His

Lys Trp Thr Thr Ser Leu Ser Ala Lys Phe

Lys Cys Thr Ala Gly Asn Lys Val Ser Lys

Glu Ser Ser Val Glu Pro Val Ser Cys Pro

Glu Lys and modifications of the peptide in which amino acid residues have been deleted, inserted or substituted without essentially detracting from the properties thereof.

24. A method of Claim 23 wherein the soluble

peptide is administered intravenously.