WO1992007574A1

WO1992007574A1 - Glycoproteins associated with membrane-bound immunoglobulins as antibody targets on b cells

Info

Publication number: WO1992007574A1
Application number: PCT/US1991/007886
Authority: WO
Inventors: Tse Wen Chang; Liming Yu
Original assignee: Tanox Biosystems, Inc.
Priority date: 1990-10-25
Filing date: 1991-10-22
Publication date: 1992-05-14
Also published as: AU9016591A

Abstract

Disclosed are monoclonal antibodies and related products including mAb fragments and mAb-toxin conjugates, which are associated with membrane-bound immunoglobulins, such as the IgD-α or IgM-α proteins. Also disclosed are anti-idiotype antibodies and peptides which induce production of antibodies which target such proteins, and the use of such mAbs and related products in suppression or depletion of B cells. Targeting IgD-α or IgM-α can be used to suppress or deplete activated or resting B cells. Uses in causing immunosuppression, treating autoimmune diseases, and enhancing the immune response against particular antigens are also disclosed.

Description

GLYCOPROTEINS ASSOCIATED WITH MEMBRANE- BOUND IMMUNOGLOBULINS AS ANTIBODY TARGETS

ON B CELLS

Field of the Invention

The invention relates to suppression or depletion of B cells through targeting, with monoclonal antibodies and related products, proteins which are associated specifically with membrane-bound immunoglobulins. Background of the Invention

The applications for the present invention include induction of humoral immunosuppression, which is accomplished by destroying, suppressing or down- regulating B cells. Diagnostic and other applications for the present invention are also included.

Suppression of the immune response is desirable in a number of situations. It can be used in treatment of autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, myastlienia gravis, pemphigus vulgaris, scleroderma, Graves' disease, Addison's disease, Type I and Type II autoimmune polyglandular syndrome, pernicious

anemia, idiopathic thrombocytopenia purpura, insulin dependent diabetes, Sjorgren's syndrome, and cryoglobulinaemia. See U.S. Patent Application Serial No. 07/408,123, filed September 15, 1989; published International Application PCT/US90/05229.

All autoimmune diseases are caused by abnormal immune reactions in the affected individuals against autologous antigens. One major causative mechanism is that autoimmune antibodies bind to autologous antigens in the

body fluids or on the surface of cells forming immune complexes. This leads to a broad range of immune mechanisms resulting in inflammation, tissue damage and alteration in cell functions, and to other manifestations of autoimmune diseases.

In patients with rheumatoid arthritis, for example, some species of IgG have abnormal epitopes that bind to IgG and IgM, known as rheumatoid factors, forming immune complexes, leading to the pathogenesis of rheumatoid arthritis diseases. In many autoimmune diseases other than rheumatoid arthritis, the production of autoimmune IgG and IgM is stimulated. In some autoimmune

diseases, the production of autoimmune antibodies of other isotypes may be stimulated.

There are no selective and effective treatments for the majority of the autoimmune diseases. The available treatments offer pain relief, or involve use of antiinflammatory drugs which decrease the disease symptoms. Cytocidal steroids and other general immunosuppressants such as cyclosporin, methotrexate, and cyclophosphamide are also used in treatment, but they act to suppress the overall function of the immune system, which causes deleterious side-effects in most patients.

Recently, monoclonal antibodies specific for surface antigens of T

lymphocytes (T cells) or active immunocytes have been examined in animal model systems and in human clinical trials as therapeutic agents for autoimmune diseases. Some examples are monoclonal antibodies against: (1) CD4 antigen on helper T cells {See Wofsy, D. et al. , J. Exp. Med. 161:378 (1985); Waldor,

M.K. et al. Science 227:415 (1985); Shizuru, J. A. et al. Science 240:659 (1987)); (2) la antigen on macrophages/monocytes, B cells and active T cells

{See Steinman, L. et al, Proc. Natl. Acad. Sci. U.S.A. 78:7111 (1981);

Sriram, S. et al. J. Exp. Med. 158:1362 (1983); McDevitt, H.O. et al. Ciba

Found. Symp. 129:84 (1987)); (3) Interleukin-2 receptors on activated T cells

{See Kelley, V.E. et al, J. Immunol, 140:59 (1988); Strom, T.B. et al. Proc. Clin. Biol. Res. 224:227 (1986)). These monoclonal antibodies have been shown to be able to destroy or down-regulate in vivo lymphocytes bearing the

^• surface antigens with which the antibodies react. The antibodies specific for surface antigens of T cells or activated immunocytes can suppress the entire immune systems and, therefore, the antibody responses against the autologous antigens. This general immunosuppression alleviates the severity of the

autoimmune diseases in patients.

General immunosuppression resulting from the depletion of T cells or activated T cells, however, can be a therapy with side-effects so deleterious that they outweigh the benefits for many patients. T cells play central roles in the development, maturation, and regulation of various branches of the immune system, including cytotoxic T cells, antibody response, and phagocytic mononuclear and polymorphonuclear cells. For many autoimmune diseases, it is, therefore, desirable to develop a therapy that will supress only the humoral immunity and not cause general immunosuppression.

Suppression of the immune response is also desirable when mAbs, or related products such as mAbs conjugated with cytotoxic or cytolytic agents, are administered for therapy. Monoclonal antibodies and related products have a number of therapeutic uses. For example, mAbs (or conjugates and related products) can be used, as described above, for treating B cell lymphoma or B cell leukemia. Monoclonal antibodies (or conjugates and related products) specific for the gpl20 envelope protein of human immunodeficiency virus type 1 (HIV-1) can be used in therapy for AIDS or AIDS related complex (ARC), or in prophylactic treatment of seropositive but asymptomatic individuals, or prophylactic treatment of uninfected individuals who have been exposed or are at a high risk of exposure to HIV-1. See U.S. Application Serial No. 07/343,540, filed April 25, 1989; published International Application No. PCT/US88/01797. They can also be used to target isotype-specific markers other than those targeted in the present invention, and suppress or deplete B cells expressing particular isotypes (especially IgM and IgG) for treatment of autoimmune diseases. See U.S. Patent Application Serial No. 07/408, 123, filed September 15, 1989; published International Application No. PCT/US90/05229. Suppressing or depleting the IgE expressing B cells with mAbs (or mAb- conjugates) may also be an effective therapy for IgE-mediated allergies. See

U.S. Application Serial No. 07/515,604, filed April 27, 1990; published International Application No. PCT/US 88/04706.

One problem associated with in vivo administration of mAbs and related products arises because mAbs are generally animal-derived, and most often, mouse-derived. Murine antibodies are foreign proteins and often evoke an endogenous in vivo immune response which may reduce or destroy their therapeutic effectiveness. In addition, murine antibodies may cause an allergic or hypersensitivity reaction. In therapy, there is a need to readminister the antibody, and this re-administration increases the likelihood that these undesirable immune-related reactions will occur. One way to ameliorate the problems associated with administering murine antibodies is to convert them to "chimeric" antibodies, consisting of the variable region of the animal or murine antibody joined to a human constant region. See, e.g. , Morrison, S.L. et al. Proc. Natl. Acad. Sci. USA 81:6851

(1984); International Application No. PCT/GB85 00392; Sun, L.K. et a , Proc. Natl. Acad. Sci. USA 84:214 (1987); Liu, A.Y. et al , J. Immunol. 139:3521 (1987); Sahagan, B.G. et al , J. Immunol. 137:1066 (1986); Liu, A.Y. et al , Proc. Natl. Acad. Sci. USA 84:3439 (1987). Because chimeric antibodies have a human constant regidh, and the constant region is the larger region which is believed to be primarily responsible for inducing immune or allergic responses against antibody, chimeric antibodies are less likely to evoke an undesirable immune-related response in humans. Nevertheless, an immune or allergic

response against the murine variable region of the chimeric antibody or against the regions at the interface of the constant and variable regions can still result. It is further noted that other animal or plant derived substances used in therapy or immunization, e.g., animal or plant derived toxins, hormones, and animal sera^", are often highly immunogenic or allergenic. In addition, when a mAb is conjugated to a toxin, the conjugate may be more immunogenic or allergenic than the toxin or mAb alone. Treatment with any of these agents may not be possible in certain individuals without suppressing the immune/allergic response.

As is true for treating autoimmune disease, immunosuppressive agents, such as cytocidal steroids, cyclosporin, methotrexate, and cyclophosphamide, may be used to suppress such undesirable immune-related responses. However, as noted above, they can produce serious side-effects.

The desirability of suppressing the immune response when foreign therapeutic proteins are administered has been recognized. See published International Application No. PCT/US89/02166. It has also been recognized in U.S. Patent No. 4,861,579 that suppressing or depleting B cells by administering and B-cell antibodies, or fragments or conjugates thereof, may be used in conjunction with administration of conventional mAbs, in order to suppress the undesirable immune responses against the conventional mAbs. However, this patent does not mention the depleting, suppressing or down- regulating B cells through targeting the epitopes targeted by the mAbs or related

products of the invention. Thus, it can be seen that depleting, suppressing, or down-regulating B cells is desirable for humoral immunosuppression, which is useful in several situations, including the treatment of autoimmune disease. A marker for B cells

which could be targeted by antibodies and related products, could be used to attain these desirable goals. Such a marker is associated with membrane-bound immunoglobulins.

Extending from the C-termini of the immunoglobulin heavy chains are

membrane anchoring peptides, which span the cell membrane lipid bilayer and affix the associated immunoglobulin to the cell membrane surface. These extracellular segments are not present on the secreted, soluble form of the immunoglobulins, which are not bound to the cell surface by the membrane

anchoring peptides. Thus, immunoglobulins exist in two different forms: the membrane-bound form and the secreted form.

Two markers associated with membrane-bound immunoglobulins which have been previously discovered are designated IgM-α and IgD-α, respectively. It has been noted that membrane-bound immunoglobulins are associated with two different glycoproteins, respectively designated IgM-α and IgD-α.. See Venkitaraman, A.R. et al, Nature 352:777-81 (1991). It has also been discovered that the IgM-α. and IgD-α. polypeptides differ only in their N-linked glycosylation. Campbell, K.S. et al , J. Immunol. 147:1575-1580 (1991).

Segments of IgD-α and Ig-jS are expressed on the outer B cell membrane. See Wienands, J. et al, The EMBO J. 9:449-455 (1990) (hereinafter "Weinands et al. "). It is suggested that the NH₂ terminal portion of IgM-α, which is about two-thirds of the total protein, is the extracellular domain. See Sakaguchi, N. et al, The EMBO J. 7:3457-3464 (1988) (hereinafter "Sakaguchi et al.");

Weinands et al. at p. 449. Because both IgD-α and IgM-α: have a large extracellular segments, each can be targeted by mAbs and related products.

This can allow depletion, suppression, or down-regulation of the B cells expressing the immunoglobulins.

Targeting IgM-α or IgD-α; with certain mAbs or related products would allow depletion of tumorous B cells through antibody-dependent cellular cytotoxicity (ADCC) or complement mediated cytolysis. This would be a useful treatment for B-cell lymphoma or B-cell leukemia, as mAbs and related products which target IgM-o; and IgD-α could be used to deplete or eliminate tumorous B cells.

Another potential use for mAbs and related products which target IgM-α: or IgD-α: is in enhancing the immune response against particular selected antigens. It has been found that injecting mice with a conjugate of bovine serum albumin ("BSA") and a monoclonal antibody (mAb) specific for IgD of the a allotype induced (in mice expressing Ig of a allotype or in mice which are a x b heterozygotes) an anti-antigen response more than 1000 times greater than those induced by injection of antigen alone, and 100 times larger than that induced by injecting unconjugated antigen plus the antibody. Similarly, mice which are ax b heterozygotes and which were injected with a conjugate of BSA and a monoclonal antibody (mAb) specific for IgD of the b allotype induced greatly enhanced anti -BSA antibody production, but this same effect did not occur in mice expressing Ig of a allotype. A large antibody response was also observed in mice when antigens other than BSA were used as part of the conjugate, provided that the mice did not recognize allotypic determinants on the anti-IgD antibody as foreign and produce a neutralizing antibody response. See Lees, A. et al., "Rapid Stimulation of Large Specific Antibody Responses

with Conjugates of Antigen and Anti-IgD Antibody" J. Immunol. 145: 3594-99 (1990). Innoculating a mammal with a conjugate of an antigen and an anti-IgM- a or an anti-IgD-α antibody (or related product) should produce the same large anti-antigen response as observed in mice injected with the conjugate of antigen and anti-IgD antibody. Summary of the Invention

The invention includes the application of monoclonal antibodies and related products, including mAb fragments and mAb-toxin conjugates which are associated with membrane-bound immunoglobulins. The invention further includes anti-idiotype antibodies to these mAbs, and peptides including an immunogenic segment of the IgD-α and IgM-α proteins, and their applications. The invention further includes the use of such peptides, anti-idiotypes, mAbs and related products in depletion, suppression, or down-regulation of B cells. Where mAbs or mAb fragments are the targeting entities, the targeted B cells are eliminated or controlled by a number of immune cytolytic or regulatory mechanisms. Where mAb-toxin conjugates are the targeting entities, the toxin is itself cytotoxic or cytolytic, and eliminates the targeted B cells. The peptides and anti-idiotypes induce endogenous production of antibodies which target and then deplete or suppress B cells bearing the IgD-α: and IgM-α proteins. The invention also allows targeting of IgD-α or IgM-α to suppress or deplete resting B cells which have not been activated. Resting B cells express IgM and IgD on their surface. Thus, through immune cytolytic or regulatory mechanisms, or through direct cytotoxic or cytolytic activity in the case of a mAb-conjugate, a mAb (or related product) which targets IgD-α or IgM-α can deplete or suppress resting B cells before they become activated.

The antibodies and methods of the invention can cause humoral immunosuppression. Humoral immunosuppression is useful, as noted above, in combination with antibody therapy. Also as noted above, humoral immunosuppression is useful for treating autoimmune disease. The invention can also be used to deplete tumorous B cells, thereby treating those B cell lymphomas or B cell leukemias.

The antibodies and related products of the invention can also be conjugated to particular antigens, e.g. , recombinant peptides derived from HIV- 1, hepatitis B virus, or other viral or bacterial pathogens. This may allow an enhanced immune response against the antigens.

The invention further includes using the mAbs (and related products) which bind to IgD-α and IgM-α as diagnostics. Monoclonal antibodies and related products which target IgM-α or IgD-α can be used to determine the number of B cells in a serum sample using standard immunostaining techniques. These diagnostic assays can be designed in a manner well-known to those of ordinary skill in the art, and would be suitable for use against patient serum, to make the appropriate determination.

The invention also further includes using the peptides including an immunogenic segment of IgM-α or IgD-α, or the anti-idiotypes which specifically bind to the mAbs of the invention, in determining the concentration of anti-IgM-α or anti-IgD-α antibodies in a serum sample. Such a diagnostic assay can be designed in a manner well-known to those of ordinary skill in the art, and would be suitable for use against patient serum. One preferred method is to use the peptides or antiidiotypes as solid phase antigens in ELISA. This determination would be useful in determining whether further administration of anti-IgM-α or anti-IgD-α antibodies was needed to deplete B cells, and/or whether the peptides or anti-idiotypes were effective in inducing endogenous antibody production.

The invention will now be described in greater detail with specific reference to its manner and process of making and using. Detailed Description of the Invention As noted above, IgD-α and IgM-α are associated with membrane-bound

immunoglobulins. IgD-α and IgM-α likely have a large extracellular segment. Therefore, B cells bearing either molecule can be targeted by mAbs and related products.

IgM-α is believed to be the product of the B cell specific gene mb-l. See Sakaguchi et al. The cDNA sequence and the deduced amino acid sequence for the murine mb-l gene is shown in Sakaguchi et al, Fig. 5B. Sakaguchi et

al. have demonstrated that a partial sequence of corresponding human cDNA showed strong homology (about 90%) in nucleotide and amino acid sequences to the corresponding partial sequence of the murine mb-l gene. At the amino acid sequence level, in fact, human and murine mb-l do share a high homology in their transmembrane and intracytoplasmic segments. Murine IgD-α also has an extracellular domain. Weinands et al

Human IgD-α is likely to be a protein with similar topology in relation to the plasma membrane. Segments of IgD-α and Ig-0 are expressed on the outer murine B cell membrane. See Wienands et al. It is suggested that the NH₂ terminal portion of IgM-α, which is about two-thirds of the total protein, is the extracellular domain. See -Sakaguchi et al ', Weinands et al. at p. 449. Because both IgD-α and IgM-α have a large extracellular segments, each can be targeted by mAbs and related products.

The peptides of the invention are those corresponding to the sequence of human IgM-α or IgD-α, or immunogenic segments or immunologic equivalents of these peptides. The peptides of the invention can be used as immunogens. Such immunogenic peptides can be synthesized by conventional techniques, such as with the RaMP system (DuPont DeNemours & Co.), which applies Fmoc chemistry. Alternatively, recombinant peptides or recombinant IgM-α or IgD-α chains (or portions thereof or the exterior domain thereof or portions thereof) containing these peptides may be biosynthesized by expressing in E. coli or eukaryotic cells the gene segments containing the appropriate coding sequences, as has been performed with many cell surface proteins, such as CD4 and the interleukin-1 receptor.

When using a synthetic peptide segment as an immunogen, it is usually more effective to conjugate it to a protein carrier, for example, hepatitis B surface antigen ("HBsAg"), core antigen, or tetanus purified protein derivative, which have been used in vaccines or against which the patients have immune memory. It is sometimes desirable to add a cysteine residue at the N- or C-

terminal end.

Multiple molecules of peptides can be conjugated to each molecule of the carrier protein. With HBsAg, a preferred molar ratio for peptide/HBsAg is 5- 10. The method of conjugation is very well established. Cross-linkers such as glutaraldehyde or bis (sulfosuccinimidyl) suberate or preferably disulfosuccinimidyl tartrate (Catalogue #21579, 20591, Pierce Chemical Co., Rockford, IL) can be used.

As immunogens, the peptides of the invention can be used to make mAbs which are specific for them, using the protocol described further below.

Monoclonal antibodies have been made to peptide segments shorter than the extracellular portion of IgM-α, and therefore, it should be possible to make mAbs to the peptides of the invention. For example, the extracellular segment of the membrane anchoring peptide of human e chain is 15 amino acids in length. Examples of making mAbs to this 15 amino acid segment, using essentially the same protocol described below, appear in published International Application PCT/US 88/04706.

One peptide of the invention suitable for use in immunization to make mAbs against IgM-α is sixteen amino acids in total length. Referring to Fig. 1, this peptide has the sequence of from amino acid residue number 37 (which is Lys) to number 51 (which is His), and also has an additional Lysine residue on the C-terminal end.

The immunogenic peptides of the invention can also be used to immunize rabbits, goats, rats, or mice (or even another human being) to prepare polyclonal antibodies to these peptides. Monoclonal antibodies which react with the peptides of the invention can be further screened for positive specific reactivity with cells bearing the peptides of the invention (preferably, IgM-α or IgD-α). The mAbs can then be applied in vivo. Polyclonal antibodies made against peptides of the invention, however, generally contain almost entirely antibodies that react with the synthetic peptide but not the native molecules. Whether the polyclonal antibodies made against synthetic peptides can react with intact cells must be tested.

When preparing mAbs, it is not necessary to use the synthetic or recombinant peptides in both immunization and antibody identification. For example, in immunizing mice for preparing spleen cells for fusion with myeloma cells, the immunogen may be the native purified IgM-α or IgD-α chains isolated from the plasma membrane of IgM or IgD bearing myeloma cells, such as IM-9 cells, or it may be the myeloma cells themselves. Transfectomas, which are developed by transfecting mouse myeloma cells with genes of human IgM-α or IgD-α chains, may also be used as immunogens. For initial mAb identification following immunization, the aforementioned synthetic peptides conjugated to ovalbumin or bovine serum albumin, which are not used as carrier proteins in immunization, are preferably used. Lymphocytes from the spleen or lymph nodes of immune mice and rats can also be used to prepare hybridomas secreting mAbs specific for the peptides of the invention. A preferred protocol for preparing mAbs is to fuse immune spleen cells of mice with non-secreting mouse myeloma cells, such as NS-1 or SP2/0 cells, using polyethylene glycol. A preferred immunization protocol for preparing mAbs is to inject into each mouse 50 μg of the conjugate of keyhole limpet hemocyanin ("KLH") and

the recombinant or synthetic peptides of the invention in complete Fruend's adjuvant. Two and four weeks later, the same amount of antigen is given subcutaneously in incomplete Fruend's adjuvant. After about six weeks, the fourth antigen injection is given intraperitoneally in saline. If human

immunoglobulin-bearing cells, or transfected cells which express human

immunoglobulins, are used as the immunogen, 1 x 10⁷ cells are injected intraperitoneally at two week intervals.

Mice are sacrificed 4 days after the last injection. The spleens are removed for preparing single cell suspensions for fusion with myeloma cells.

The fusion procedure with polyethylene glycol and other various procedures concerning cloning and hybridoma culturing have been well established. The preferred protocol is the well-known one described by Hudson,

L. and Hay. F.C. (Practical Immunology, 2nd edition, pp. 303-313, 1980,

Blackwell Publishing Co., Boston).

The screening of hybridomas for mAbs (or the identification of polyclonal antibodies) reactive with the peptides of the invention can be performed with an enzyme linked immunosorbent assay (ELISA) using the synthetic peptide as the solid phase antigen. A preferred solid phase antigen is the conjugate of a synthetic peptide of IgM-α or IgD-α with a carrier protein different from that used in the immunogen, such as bovine serum albumin or ovalbumin. Monoclonal antibodies specific for either IgM-α or IgD-α will then be screened for specific binding to B cell lines and B cells expressing each of these peptides, by using immunofluorescence flow cytometric analyses.

Generally, the mAbs specific for the peptides of the invention which are first obtained will be murine-derived, and thus may be immunogenic or allergenic in human therapy. It is therefore desirable to produce chimeric antibodies (having an animal variable region and a human constant region), or to use human expression libraries (Stratagene Corp., La Jolla, California) to produce fragments of human antibodies (V_H, V_L, F_v, Fd, Fab, or F(ab')₂) and then construct whole human antibodies using techniques similar to those for producing chimeric antibodies. In addition, one can create antibodies in which the entire constant portion and most of the variable region are human-derived, and, only the antigen binding site is mammalian derived. See Riechmann, L. et al, Nature 332:323-327 (1988). Further, one can create single peptide chain antibodies in which the heavy and light chain F_v regions are connected. See Huston, J.S. et al, Proc. Natl. Acad. Sci. USA 85:5879-5883 (1983). All of the wholly and partially human antibodies are less immunogenic than mammalian equivalents, and the fragments and single chain antibodies are less immunogenic than whole antibodies. All these types of antibodies are therefore less likely to evoke an undesirable immune or allergic response. An immune response could reduce the effects of the antibodies which are administered before such antibodies could function to suppress or destroy the B cells. Monoclonal antibodies specific for the peptides of the invention can be used to reduce or eliminate the B cells by ADCC, complement-mediated cytolysis, or other cytolytic or regulatory immune mechanisms. For example,

antibodies of certain IgG subclasses, such as mouse IgGj, and human IgG, and IgG₃, can mediate ADCC carried out by certain Fc receptor-bearing phagocytic leukocytes. Administration of such mouse IgG₂, antibodies, chimeric antibodies bearing human 7-I or -3 chains, or human I G_! or IgG₃ antibodies can be used

to down-regulate or lyse B cells of a particular isotype. These antibodies can be administered to suppress the immune system, or destroy tumorous cells, because they cause lysis of substantially all the B cells. The mAbs of the invention can also be used as targeting agents for cytotoxic cells.

The mAbs of the invention can also be used as carrier agents of cytotoxic drugs or for delivering an effector substance, by conjugating the mAbs to these substances. A toxin-antibody conjugate will bind and directly kill B cells. These toxins are cytolytic or cytotoxic agents, including cytotoxic steroids, gelonin, abrin, ricin, Pseudomonas toxin, diphtheria toxin, pokeweed antiviral peptide, tricothecenes, radioactive nuclides, and membrane-lytic enzymes (such as phospholipase). The antibody and the agent can be conjugated by chemical or by genetic engineering techniques. The toxin-antibody conjugates may be

used alone or in combination with the free antibodies of the invention.

The antibodies of the invention (and the toxin conjugates, fragments, and other derivatives such as peptides and anti-idiotypes) are administered systemically, and preferably intravenously. They can be administered in any pharmaceutically acceptable vehicle. To enhance immunosuppression, more than one antibody of the invention can be administered at the same time. For example, anti-IgM-α and anti-IgD-α antibodies can be used simultaneously, to achieve better immunosuppression than that which would be achieved using only one of these antibodies.

Another therapeutic alternative involves active immunization, wherein antibodies specific to the peptides of the invention are endogenously produced in vivo. These endogenously produced antibodies bind these peptides and cause destruction of the associated B cells.

Production of such antibodies can be induced by administering an immunogenic peptide of the invention, or an immunogenic segment or an immunogenic equivalent of such peptide, conjugated to a suitable carrier.

Suitable carriers include tetanus purified protein derivative, HBsAg and core antigen, which are immunogenic or have been developed for vaccines.

Rather than using a peptide of the invention, one could also use a paratope-specific, anti-idiotypic antibody to induce an antibody response. Anti- idiotype antibodies against the paratope of the antibodies of the invention conformationally resemble the extracellular epitopes of the peptides of the

invention. These anti-idiotypic antibodies can be used in the same ways described for the peptides of the invention.

The peptides of the invention or the paratope-specific, anti-idiotyptic antibodies are preferably administered to a patient in an immunogenic amount

sufficient to induce the formation of antibodies against B cells. The anti- idiotypic antibodies are preferably administered as chimeric antibodies or human antibodies, to minimize any undesired immune response against other epitopes on them. Fragments of the anti-idiotypes, V_H, V_L, F_v, Fd, Fab, or F(ab')₂,

which also may be chimeric or human in nature, may also be used.

Certain factors, such as granulocyte monocyte-colony stimulation factor (GM-CSF) or monocyte-colony stimulation factor (M-CSF), are known to induce the proliferation of leukocytes, including those mediating ADCC. In in vitro experiments, GM-CSF and M-CSF have been shown to augment the ADCC activity on tumor cells mediated by mAbs specific for surface antigens expressed on the tumor cells. The effect of specific mAbs of the invention, conjugates, or polyclonal antibodies in suppressing the immune response or killing tumorous cells could perhaps be enhanced by combining them with factors that augment ADCC activities.

Derivative antibodies can be made which draw cytotoxic cells such as macrophages or cytotoxic T cells toward the targeted immunoglobulin- expressing B cells. These derivative antibodies include bi-specific antibodies having a specificity for a receptor of a cytotoxic cell and a specificity for the targeted B cells. Such hybrid bi-specific antibodies can include two different Fab moieties, one Fab moiety having antigen specificity for the targeted epitopes, and the other Fab moiety having antigen specificity for a surface antigen of a cytotoxic cell, such as CD3 or CD8. The bi-specific antibodies of the invention can be a single antibody having two specificities, or a heteroaggregate of two or more antibodies or antibody fragments. See, e.g. , C. Reading, U.S. Patent Nos. 4,474,893 and 4,714,681; Segal et al , U.S. Patent No. 4,676,980. While mAbs of the invention can be used for in vivo applications, they

may also be used in extra-corporeal ex-vivo applications. The IgM-α or IgD-α bearing B cells in the circulation of the patients can be removed by an affinity matrix (antibody immobilized on a solid phase) which is conjugated with the

mAbs of the invention.

Another use for the antibodies of the invention is for determining number

of B lymphocytes bearing immunoglobulins in mixed leukocyte populations. The IgM-α and IgD-α specific antibodies will not react with cells which bear secreted immunoglobulins via such cells' Fc receptors. Such cells include macrophages and activated T cells. The profile of the B cells may indicate the immune status of the individual, and whether further immunosuppression is desirable. The same information can also indicate how much antibody is needed to deplete a substantial portion of tumorous B cells bearing a particular isotype.

For this purpose, antibodies can be used in standard assays which are used to

^• determine cell surface antigens. In general, the antibodies are contacted with a sample of the leukocytes to be tested under conditions which allow the antibodies to bind isotype-bearing cells in the sample. The cells are then examined for binding of antibody. This can be accomplished by conventional cell staining procedures, for example, a fluorescently labeled second antibody can be used to detect binding of antibody.

Another use for the antibodies and related products of the invention is in innoculating mammals with a conjugate of an antigen and an anti-IgM-α or an anti-IgD-α antibody (or related product) in order to produce an enhanced anti-antigen response. The antibodies and related products can be conjugated to various antigens, including synthetic or recombinant peptides derived from HIV-l, hepatitis B virus, or other viral or bacterial pathogens. The antigen may also be peptide segments unique to membrane-bound immunoglobulins of different isotypes, i.e. , the migis peptides. For example, the antibody may be the migis-e peptide, which would induce the antibody response against mlgE- expressing B cells, or the migis-y peptide, which would induce an antibody response against mlgG-expressing B cells.

The method of conjugation is well established. Cross-linkers such as glutaraldehyde, or bis (sulfosuccinimidyl) suberate and preferably disulfosuccinimidyl tartarate, both available from Pierce Chemical Co., ^" Rockford, IL (Catalogue Nos. 21579, 20591) can be used.

Rather than chemically conjugating the antigen with the antibody, the antigen and the heavy or the light chain of the antibody can be produced as a contiguous peptide by expressing a composite gene containing the DNA segment encoding the heavy or light chain and the DNA segment encoding the antigen. See, e.g., International Patent Application No. WO/US88/09344 (Disclosing methods suitable for producing such a contiguous peptide). This molecular biological method will be most appropriate for expressing shortened heavy or light chains, e.g. , the variable regions, and the antigens.

Example of Sequencing IgM-α and IgD-α RNA PCR was carried out with the total RNA isolated from a fresh mouse spleen as the template. The two primers, primer A

( G A G G C C C G C C T C A C C T G T G A ) a n d p r i m e r B (CAGTCGTCCAGGTTCAGGCC) were derived from the known mouse mb-l cDNA sequence (of Sakaguchi et al.) position 133-152 and position 568-587 (complementary) respectively. A 450 bp DNA segment was amplified by PCR and cloned into pUC19 plasmid. Sequence analysis confirmed that it was amplified from the mouse mb-l transcript. This DNA segment was used as the probe for the screening of human mb-l cDNA library.

A cDNA library was constructed from poly (A)⁺ RNA of mIgM⁺ human Burkitt lymphoma cell line RAMOS. A total of 6 x 10⁷ recombinants were prepared, and 3.6 x 10⁵ were screened in duplicates with the ³²P-labelled mouse mb-l cDNA segment as the probe. Under the final washing condition of 0.5 x SSC, 0.1% SDS at 55° C, 150 positive clones were identified. Eight of those clones were selected for plaque purification by the second round of screening. The isolated phage clones were changed into plasmids (referred to as phagemid) by in vivo excision as described in the Zap-cDNA synthesis kit protocal (Stratagene). Among the 8 clones, 4 contained inserts longer than 1 kb and 3 of them were full length human mb-l cDNA as confirmed by the sequencing analysis.

One of the full length cDNA clones was further restriction digested and the resulting smaller segments were subcloned into a pUC19 plasmid for sequencing analysis. The predicted human mb-l coding region has been sequenced on both strands. The human mb-l cDNA (as shown in FIG. 1)

contains 1068 bp (poly A tail not included) with the longest open reading frame of 678 bp. Comparatively, the murine mb-l cDNA has 897 bp and its longest open reading frame is 660 bp. The human and mouse mb-l share a 70% homology at the nucleotide sequence level across the entire length of the cDNA.

At the amino acid sequence level, the two deduced MB-1 peptides have an overall homology of 69%. However, in the transmembrane and intracytoplasmic segments, the homology is as high as 93% (including similarity).

The sequence determined for the human-mb -7 cDNA clone was substantially different from the partial human _?zb-_ sequence published by Sakaguchi et al , which consists of two discontinuous segments. One segment is 97 bp and encodes for cytoplasmic tail, and the other is 157 bp in the 3' untranslated region. The determined sequence is nearly identical to Sakaguchi et al. in the

first segment (94 out of 97 bp) but shows drastic differences in the second segment. FIG. 2 shows the sequence as determined from the human-wzb-i cDNA clone.

To investigate the mb-l expression among human B cells bearing different mlg isotypes, the RNA from a panel of human B cell lines has been analyzed by Northern blotting with ³²P-labelled human mb-l cDNA as the probe. Among the cell lines studied, RAMOS, RPMI 1788 and DAUDI are mIgM⁺, IM-9 and ARH-77 are mIgG⁺, DAKIKI and BCK F10 are mIgA⁺, and SKO-007 is rnlgE^"1". The presence of specific mlg classes on these cells was

confirmed by fluorescence flow cytometric analyses. In the Northern analyses, the hybridized filters were washed with a high stringency of 0.2 x SSC and 0.1 % SDS at 68° C. Two bands were revealed in samples with all cell lines

except SKO-007. One major band of about 1.6 kb was identified as the mature mRNA of human mb-l. A weaker band of about 4 kb was also identified, and it is possibly a precursor RNA of mb-l, since total RNA was used for the Northern blot analysis.

In th e RNA P CR an aly sis , th e 5 ' prim er C (GAATTCGATGCCTGGGGGTCCA) was derived from the 5' end human mb-l cDNA sequence. Primer B (CAGTCGTCCAGGTTCAGGCC) was used as the 3' primer. Both primers were located in relatively conserved regions. The temperature cycling condition for PCR was 94 °C (1 min.), 55°C (2 min.), and 72°C (1 min.) for 30 cycles on Programmable Cyclic Reactor (Ericomp, San Diego, CA). A DNA segment was amplified by PCR in samples with all cell lines except SKO-007. The size of this DNA segment, 600bp, was consistent with the predicted distance between the locations of primer C and primer B in the human mb-l cDNA sequence.

Two of these PCR amplified DNA segments, i.e., from ARH-77 (mIgG⁺) and from BCK F10 (mIgA⁺), were subcloned into pUC19 and their sequences determined. They are identical to human mb-l cDNA sequence determined from mIgM⁺ B cell line RAMOS. These results indicated that mb-l is expressed not only by B cell lines expressing mlgM, but also by B cell lines expressing IgA or IgG. The terms, expressions and examples herein are exemplary only and not limiting, and those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embod¬ iments of the invention described herein. All such equivalents are intended to be encompassed by the following claims.

Claims

WHAT IS CLAIMED IS:

1. An antibody, or fragment or a peptide containing the antigen combining portion of the antibody fragment, which binds to an extracellular surface epitope

present on either IgM-α or IgD-α.

2. The antibody of claim 1 which is a monoclonal antibody.

3. The antibody of claim 2 wherein said monoclonal antibody is a chimeric antibody having at least some of the variable regions are of rodent origin and the constant regions are of human origin.

4. The antibody of claim 3 wherein the variable regions are of mouse origin.

5. The antibody of claim 2 wherein said monoclonal antibody is a human monoclonal antibody or a fragment thereof.

6. The antibody of claim 4 wherein said monoclonal antibody has at least some of its complementarity determining region derived from a rodent and its constant region derived from a human.

7. The antibody of claim 5 wherein the human antibody fragment is selected from the group consisting of V_H, V_L, F_v, Fd, Fab, Fab', F(ab')₂, and protein or peptide analogues thereof.

8. The antibody of claim 2 wherein said monoclonal antibody is one of the following: murine IgG2a, human IgGl and human IgG3.

9. An antibody which binds to a peptide including some or all of the amino acid sequence of FIG. 1.

10. A continuous, stable cell line which produces a monoclonal antibody of claim 2.

11. The cell line of claim 10 which is a hybridoma.

12. The cell line of claim 11 which is a murine hybridoma.

13. Isolated DNA comprising functionally rearranged genes encoding for the variable region of a light or heavy chain of an antibody which binds to IgM-α or IgD-α, and whereby upon such binding the associated B cell is targeted for destruction.

14. A DNA construct comprising the DNA of claim 13 linked to DNA encoding a human light or heavy chain constant region.

15. A host cell transfected with the DNA construct of claim 14.

16. A monoclonal anti-idiotypic antibody specific for the paratope of an antibody which binds to an extracellular epitope on IgM-α or IgD-α, and whereby upon such binding the associated B cell is targeted for destruction.

17. An antigen binding fragment of the monoclonal antibody of claim 16.

18. A nucleotide including some or all of the nucleotide sequence of FIG. 1, or a homologous or degenerate sequence.

19. A peptide comprising an immunogenic portion of IgM-α or IgD-α.

20. A peptide comprising an immunogenic portion of the amino acid sequence of FIG. 1.

21. The peptide of claim 19 conjugated to an immunogenic carrier.

22. The peptide of claim 21 wherein the carrier is tetanus purified protein derivative, HBsAg or core antigen.

23. A pharmaceutical preparation comprising an antibody, or fragment or a peptide containing the antigen combining portion of the antibody fragment, which binds to an extracellular surface epitope present on either IgM-α or IgD-α and a pharmaceutical vehicle, suitable for administration to a patient such that B cells can be targeted by the antibody, fragment, or peptide.

24. A conjugate comprising an antibody or fragment or a peptide containing the antigen combining portion of the antibody fragment which binds to an extracellular surface epitope present on either IgM-α or IgD-α, and an antigen.

25. The conjugate of claim 24 wherein the antigen is a recombinant peptide derived from HIV-1 , hepatitis B virus, or from other viral or bacterial pathogens