WO1992007957A1

WO1992007957A1 - Methods and compositions for minimizing inhibition of nucleic acid amplification

Info

Publication number: WO1992007957A1
Application number: PCT/US1991/007895
Authority: WO
Inventors: George D. Cimino; Stephen T. Isaacs; John J. Sninsky
Original assignee: Cimino George D; Isaacs Stephen T; Sninsky John J
Priority date: 1990-10-31
Filing date: 1991-10-24
Publication date: 1992-05-14
Also published as: AU8920191A

Abstract

Methods and compositions are provided for improving the yield of products from nucleic acid amplification reactions, where the reaction mixture contains agents which render the post-amplification nucleic acids refractory to further amplification but which inhibit the amplification reaction.

Description

Methods and Compositions for Minimizing Inhibition of Nucleic Acid Amplification

Field of the Invention The present invention relates to nucleic acid amplification techniques. More particularly, the invention relates to methods and compositions for use with agents employed to prevent further amplification of nucleic acids.

Background of the Invention

Advances in nucleic acid technology have made possible the manipulation, selection and characterization of a large number of eukaryotic, pro aryotic and viral genes. The application of nucleic acid amplification techniques has provided access to greater volumes of nucleic acid within relatively short periods of time, thereby speeding each of these processes.

Currently, one of the most important nucleic acid amplification techniques is the poly erase chain reaction (PCR) . The basic PCR technique for increasing the concentration of a target sequence (amplification) in a nucleic acid mixture is described in U.S. Patent Nos. 4,683,195 and 4,683,202. This amplification technique consists of introducing a large excess of two oligonucleotide primers to the nucleic acid mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a nucleic acid polymerase, usually Thermus aσuaticus (Tag) polymerase. The primers are complementary to their respective strands of region surrounding the double-stranded target sequence. To effect amplification, the mixture is denatured and then the primers are allowed to anneal to their complementary sequences within the target molecule.

Following annealing, the primers are extended with a polymerase so as to form complementary strands. Each of these new products then forms a new target sequence capable of serving as a template for the primer pair. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e. denaturation, annealing and extension constitute one "cycle;" there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence. Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR-amplified".

Producing large quantities of DNA using amplification techniques raises the prospect of inadvertently releasing nucleic acid sequences into nature that are either modified but present in their normal host species or normal but present in a foreign host species. For this reason there is some concern that nucleic acid techniques pose a risk to human health. In the modern laboratory, the presence of containers having highly concentrated amounts of nucleic acid and the performance of reactions directed at amplifying nucleic acid sequences are relatively common. The screening of genomic DNA for single copy genes is perhaps the best example of a common procedure under which these conditions occur. With amplification reactions such as the PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies. However, improper handling of the reaction mixture after amplification can result in nucleic acid sequence carryover, such that subsequent amplifications contain sufficient template to result in a false positive signal (Kwok, S. and R. Higuchi, Nature 339:286 (1989); PCR Technology_f H.A. Erlich (ed.) Stockton Press (1989)). This carryover can occur either through aerosols containing nucleic acid sequences or through direct introduction. In order to avoid carryover, a method of nucleic acid sterilization has been developed wherein activation compounds, particularly photoreactive compounds, are included in the amplification reaction mixture as sterilizing compounds. Photoactivation compounds are activated by activating wavelengths of electromagnetic radiation. In one method of sterilizing, the amplification reaction is first performed in the presence of photoactivation compounds but in the absence of the activating wavelength. Once the reaction has been completed, an appropriate wavelength is used to activate the photoactivation compounds, thereby sterilizing the large quantity of amplified nucleic acid. Sterilization is believed to be achieved in part because,-- upon activation, these photoreactive compounds form covalently-bound photoadducts with nucleic acids. In certain PCR amplification systems it is necessary to operate with high concentrations of sterilizing compounds in order to ensure that carryover is avoided.

Summary of the Invention

It has been found that high concentrations of sterilizing compounds used to eliminate carryover can inhibit amplification in the PCR such that virtually no product is produced during each cycle. It is therefore an object of the present invention to provide methods for nucleic acid amplification which provide substantial amplification of the desired segment of a target sequence, but which permit the effective use of sterilizing compounds to avoid carryover.

It is also an object of the present invention to provide compositions useful in nucleic acid amplification techniques which increase the amplification of the desired segment of a target sequence in the presence of an effective amount of a sterilizing compound used to avoid carryover.

To achieve these objects, one aspect of the present invention provides a nucleic acid amplification reaction mixture composition comprising a nucleic acid sample containing at least one nucleic acid sequence of interest, all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, at least one amplification enzyme, at least one sterilizing compound, and a compound selected from the group consisting of DMSO and glycerol.

Another aspect of the invention provides a method for nucleic acid amplification comprising the steps of a) providing, in any order, a nucleic acid sample containing at least one amplifiable nucleic acid sequence, all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, at least one amplification enzyme capable of initiating an amplification reaction resulting in a nucleic acid product, at least one sterilizing compound, and a compound selected from the group consisting of DMSO and glycerol; b) adding, in any order, the nucleic acid sample, the amplification reagents, the sterilizing compound and the selected compound, to form a reaction mixture; and c) adding the amplification enzyme to initiate the amplification reaction. It is desired that the selected compound is added in an amount sufficient to increase the amount of nucleic acid product obtained from said nucleic acid sample by the amplification reaction performed in the presence of said sterilizing compound.

Another aspect of the invention provides a method for nucleic acid sterilization comprising the steps of a) providing, in any order, a nucleic acid sample containing at least one amplifiable nucleic acid sequence, all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, at least one amplification enzyme capable of initiating an amplification reaction resulting in a nucleic acid product, at least one sterilizing compound, and a compound selected from the group consisting of DMSO and glycerol; b) adding, in any order, the nucleic acid sample, the amplification reagents, the sterilizing compound and the selected compound, to form a reaction mixture; c) adding amplification enzyme to the reaction mixture so that the amplifiable nucleic acid sequence is amplified; and d) treating the reaction mixture so that the sterilizing compound renders the amplified nucleic acid substantially unamplifiable.

In a preferred embodiment, the sterilizing compound is a photoreactive compound and the treating of step (d) comprises photoactivating the photoreactive compound. In presently preferred embodiments of the invention, the nucleic acid is DNA or RNA, the standard amplification reagents and the amplification enzyme are those appropriate to the particular amplification system. For example, in the case of the polymerase chain reaction (PCR) , the amplification enzyme is Tag polymerase. Brief Description of the Drawings

Figure l is a photograph of an autoradiograph of electrophoresed, amplified nucleic acid generated in the presence or absence of unirradiated AMDMIP (200 μg/ml) using standard PCR conditions in the presence of 0%, 1%, 5% or 10% DMSO.

Figure 2 is a graph of photochemical binding results of isopsoralens to DNA in the presence of DMSO, showing that ³H-AMDMIP binding decreased as the percentage of DMSO was increased.

Figure 3 is a photograph of an autoradiograph of electrophoresed, amplified nucleic acid generated in the presence of unirradiated or irradiated AMDMIP (100 μg/ml) using standard PCR conditions in the presence of DMSO.

Figure 4 is a photograph of an autoradiograph of electrophoresed, amplified nucleic acid generated in the presence of unirradiated or irradiated AMDMIP (200 μg/ml) using standard PCR conditions in the presence of DMSO.

Figure 5 is a photograph of an autoradiograph of electrophoresed, amplified nucleic acid generated in the presence or absence of unirradiated AMDMIP using standard PCR conditions in the presence of glycerol.

Detailed Description of the Invention

Methods and compositions which are useful to achieve efficient nucleic acid amplification but avoid post-amplification carryover have been identified and described in detail in U.S. Patent applications serial numbers 07/428,510, 07/427,303 and 07/428,494, the entire contents of which are hereby incorporated by this reference. As indicated in those applications, something is "sterilized" when it is rendered incapable of replication. While the term "sterilization" has typically been applied only in the context of living organisms, it is here meant to be applied to in vitro amplification protocols of polynucleotides where a template polynucleotide functions in the nature of a germination seed for its further propagation.

It has now been found that the amount of a sterilizing compound capable of rendering amplified nucleic acids subsequently unamplifiable can also inhibit the amplification of the nucleic acid sequence of interest during the amplification reaction. The present invention is directed to an improvement in the above discussed sterilization technique whereby the impact of the unactivated, activation compound on the amplification reaction is minimized. Although the present invention is not dependent on a particular theory, a mechanism by which the unactivated, activation compound reduces the efficiency of the amplification reaction has been postulated: high concentrations of sterilizing compounds may function to stabilize amplified product (particularly long products or products which are exceptionally GC rich) , such that less of the double-stranded product will denature during each amplification cycle. This reduced availability of single-stranded product for subsequent priming and extension would reduce the product yield in each cycle. This reduced efficiency over many cycles would result in drastic reduction in the yield of PCR product.

If such a mechanism is correct, one method to overcome excessive stabilization of amplified product due to the use of sterilizing compounds is to modify the amplification conditions such that denaturation is carried out at higher (above 95°C) temperatures. In so doing, more of the double-stranded product is denatured each cycle, thereby providing more single-stranded target for subsequent priming and extension. While it might be expected that the net result of the modified conditions is a higher yield of product, such a modification has the disadvantage of concomitant inactivation of the amplification enzyme; even Tag polymerase would be inactivated at such temperatures. Thus the modification would require the addition of fresh Tag polymerase after each inactivation. This is both a costly proposition and one that risks further carryover problems.

The present invention involves a more desirable solution to the problem. The present invention involves adding a compound selected from the group consisting of dimethylsulfoxide (DMSO) and glycerol to the amplification reaction mixture. Specifically, in order to provide compositions useful in nucleic acid amplification techniques to increase the production of the desired segment of a nucleic acid target sequence in the presence of an effective amount of sterilizing compound used to avoid carryover, one aspect of the present invention provides a nucleic acid amplification reaction mixture composition comprising a nucleic acid sample containing at least one nucleic acid sequence of interest, all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, at least one amplification enzyme, at least one sterilizing compound, and a compound selected from the group consisting of DMSO and glycerol.

While not limited to the particular amplification system, the preferred amplification system of the present invention is the polymerase chain reaction (PCR) . PCR is a method for amplifying target nucleic acid sequences as disclosed in U.S. Patent Nos. 4,683,195 and 4,683,202, the entire contents of which are hereby incorporated by this reference. The standard reagents necessary to amplify a portion of a nucleic acid sequence ("amplification reagents") are defined as those reagents (primers, deoxyribonucleoside triphosphates, etc.) needed for amplification, except for a nucleic acid sequence template and the amplification enzyme. Standard reagents will vary, depending on the amplification reaction employed. For example, in the PCR, such standard reagents will include all reagents necessary to carry out amplification except polymerase and nucleic acid template. Standard PCR reagents normally include the deoxyribonucleoside triphosphates (dCTP, dTTP, etc.) and the nucleic acid primers in an appropriate buffered solvent (usually aqueous) (See, e*»g*», PCR Technology, supra) .

In the practice of the invention, a nucleic acid sample is employed which comprises nucleic acid sequences which may contain a target sequence of interest. Such a target sequence will include a nucleic acid template for the amplification reaction.

Any source of nucleic acid, in purified or non-purified form, can be utilized as the source for the nucleic acid sample. Thus, the practice of the invention may employ any nucleic acid, for example DNA or RNA, including messenger RNA, which may be single-stranded or double-stranded. In addition, a DNA-RNA hybrid which contains one strand of each distinct nucleic acid may be utilized. It is also possible to utilize a mixture of any one or more of such nucleic acids. In the practice of the invention, the nucleic acid sample does not need to be provided in pure form; it may be a fraction of a more complex mixture, e.g., it may constitute only a minor fraction of a particular sample of biological origin. In certain aspects of the present invention, it will be desirable to provide a nucleic acid sample from a particular organism, e.g., an animal, a plant or a microorganism.

The present invention utilizes "sterilizing compounds" and methods for using "sterilizing compounds." "Sterilizing compounds" are defined such that, when used to treat nucleic acid according to the sterilization method of the present invention, the nucleic acid is rendered substantially unamplifiable, i.e. substantially sterilized. The preferred sterilizing compounds of the present invention are activation compounds.

As disclosed in U.S. Patent application 07/427,303, photoreactive compounds are members of the activation compound family that undergo chemical change in response to electromagnetic radiation. Generally, such compounds are capable of forming covalent bonds with nucleic acids. Such photoreactive compounds include those identified in Table 1.

Table 1. Photoreactive Compounds

Actinomycins

Anthracyclinones

Anthramycin

Benzodipyrones

Fluorenes and fluorenones

Furocoumarins

Mitomycin

Monostral Fast Blue

Norphillin A

Organic dyes

Phenanthridines

Phenazathionium Salts

Phenazines

Phenothiazines

Phenylazides

Polycyclic hydrocarbons

Quinolines

Thiaxanthenones A presently preferred genus of photoreactive compounds is commonly referred to as the furocoumarins. The furocoumarins belong to two main categories:

1) psoralens [7H-furo(3,2-g)-(l)-benzopyran-7-one, or 5-lactones of 6-hydroxy-5-benzofuranacrylic acid] , which are linear and in which two oxygen residues appended to the central aromatic moiety have a 1, 3 orientation, and further in which the furan ring moiety is linked to the 6 position of the two ring coumarin system, and

2) isopsoralens [2H-furo(2,3-h)-(l)-benzopyran-2-one, or <S-lactones of 4-hydroxy-5-benzofuranacrylic acid], which are angular and in which the two oxygen residues appended to the central aromatic moiety have a 1, 3 orientation, and further in which the furan ring moiety is linked to the 8 position of the two ring coumarin system. Psoralen derivatives are obtained by substitution of the linear furocoumarin at the 3, 4, 5, 8, 4', or 5' positions, while isopsoralen derivatives are obtained by substitution of the angular furocoumarin at the 3, 4, 5, 6, 4¹, or 5' positions. Presently preferred photoreactive compounds are isopsoralens. In one embodiment, the isopsoralen(s) is selected from the group consisting of 5- methylisopsoralen (MIP) , 5-aminomethylisopsoralen (AMIP) , and their radiolabelled derivatives.

In still other embodiments, the isopsoralen is selected from the group consisting of 4,5*- dimethylisopsoralen (DMIP) , 4'-aminomethyl-4,5•- dimethylisopsoralen (AMDMIP) , and their radiolabelled derivatives.

In other embodiments, a mixture of isopsoralens will be used. While the preferred sterilizing compound for controlling carryover according to the method of the present invention is an isopsoralen, the present invention contemplates amplification reaction mixtures with psoralens as well. In one embodiment, the linear furocoumarin 4'-aminomethyl-4,5• , 8-trimethylpsoralen (AMT) is used as a post-amplification agent to render the nucleic acid substantially refractory to further amplification.

The compositions of the invention utilize compounds selected from the group consisting of glycerol and dimethylsulfoxide (DMSO) . It will be noted that these compounds have been used in particular nucleic acid techniques. See Nucleic Acid Hybridization: A Practical Approach. Hames and Higgins, Ed. (1985) . Furthermore, these compounds have been used in protocols for the PCR. For example, DMSO has been reported to improve DNA sequencing reactions using the PCR with Sequenase*™ (Winship, P.R., "An Improved Method For Directly Sequencing PCR Amplified Material Using Dimethyl Sulfoxide," Nucl. Acids Res. 17(3) :1266 (1989)) and to improve multiplex PCR (Chamberlain, J.S. et a_l., "Multiplex PCR for the Diagnosis of Duchenne Muscular Distrophy" in PCR Protocols: A Guide To Methods and Applications. Innis, M.A. et al. eds., pp. 272-281 (1990)). The use of 20% glycerol has been reported to improve the reproducibility of duplicate PCR-produced samples

(Dermer, S.J. and E.M. Johnson, "Rapid DNA Analysis of cϋ_j-Antitrypsin Deficiency: Application of an Improved Method For Amplifying Mutated Gene Sequences," Laboratory Investigation 59(3. :403-408 (1988)), and the amplification of herpesvirus DNAs at the 5-10% level (Smith, K.T. et a!. , "Using Cosolvents to Enhance PCR Amplification," In Press).

There are also reports, however, that these compounds inhibit amplification in some cases. For example, the use of DMSO in the PCR buffer is said to be "slightly inhibitory to Tag polymerase" and result in a decrease in overall amplification product yield at a 10% concentration (Saiki, R.K., "The Design and Optimization of the PCR," in PCR Technology, supra.. The same concentration of DMSO has been reported to facilitate certain PCR assays, but reduce dNTP incorporation activity by approximately 50% in a 70°C Tag polymerase activity assay. Tag polymerase activity was reportedly inhibited almost 90% at a DMSO concentration of 20% (Gelfand, D.H. "Tag DNA Polymerase," in PCR Technology, supra) .

This art highlights the sometimes useful, but unpredictable, nature of the use of these compounds in PCR assays. It should be noted that heretofore these compounds have never been used to address sterilization techniques.

Standard amplification reagents are defined as those reagents (primers, deoxyribonucleoside triphosphates, etc.) needed for nucleic acid amplification, except for nucleic acid sequence template and the amplification enzyme. Such reagents are specified in detail in publications known to those in the art (See, e.g. Saiki, R.K., "The Design and Optimization of the PCR," in PCR Technology, supra and Chamberlain, J.S. et al. in PCR Protocols. A Guide To Methods and Applications, supra) . The composition of the present invention will generally be held in a standard reaction vessel such as a test tube or microwell. As noted, the sterilizing compound used in the composition of the invention is preferably an isopsoralen. A preferred isopsoralen is 4'- aminomethyl-4,5•-dimethylisopsoralen (AMDMIP). AMDMIP is a known compound, the synthesis of which is described in U.S. Patent No. 4,312,883 to Baccichetti et al., the contents of which are hereby incorporated by reference.

The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Experimental

In the experimental disclosure which follows, all weights are given in grams (g) , milligrams (mg) or micrograms (μg) , all lengths are given as centimeters (cm) , millimeters (mm) , micrometers (μm) or nanometers (nm) , all pressures are given as pounds per square inch (psi) , all temperatures are given as degrees Centigrade (°C), all concentrations are given as percent by weight (% or percent) , equivalents (eq) , Normal (N) , molar

(M) , millimolar (mM) or micromolar (μM) , all quantities are given as moles (mol), millimoles (mmol) ,.micromoles (μmol) or nanomoles (nmol) and all volumes are given as liters (1) or milliliters (ml) , unless otherwise indicated.

In addition, the following abbreviations have the indicated meanings: MW (molecular weight) ; OD (optical density) ; EDTA (ethylenediaminetetraacetic acid) ; TE buffer (buffer: lOmM Tris/1 mM EDTA, pH 7.5); TBE buffer (Tris-Borate-EDTA) ; TAE buffer

(Tris-Acetate-EDTA) ; Taq buffer (50mM KC1, 2.5 MgCl₂, lOmM Tris, pH 8.5, 200μg/ml gelatin); PAGE (polyacrylamide gel electrophoresis); V (volts) ; W (watts) ; mA (milliamps) ; bp (base pair) ; kb (kilobase pairs) and CPM (counts per minute) .

Generally, PCR was carried out using 175-200 μM dNTPs (deoxyribonucleoside 5'-triphosphates) and 0.5 to 1.0 μM primers. 5 Units/ 100 μl of Taq polymerase was used. PCR reactions were overlaid with 30-100 μl light mineral oil. A typical PCR cycle for HIV amplification using a Perkin-Elmer Cetus DNA Thermal Cycler (Part No. N8010150) was: denaturation at 93°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 1 minute. PCR cycles were normally carried out in this manner for 30 cycles followed by 7 minutes at 72°C.

In some instances below, amplification of HLA Class II genes was performed using primer pair RS-134/RS-135 and human placental DNA to produce a 242- mer product. The sequences of these primers are: RS-134 5'-GTGCTGCAGGTGTAAACTTGTACCAG-3' RS-135 5•-CACGGATCCGGTAGCAGCGGTAGAGTTG-3• These primers and other primers are described in PCR Protocols: A Guide To Methods and Applications_f Innis, M.A. et al. eds., pp. 261-271 (1990)). The sequence of the 242-mer product is:

242-mer 5'-GTGCTGCAGG TGTAAACTTG TACCAGTTTT

ACGGTCCCTC TGGCCAGTAC ACCCATGAAT TTGATGGAGA TGAGGAGTTC TACGTGGACC

TGGACAGGAA GGAGACTGCC TGGCGGTGGC CTGAGTTCAG CAAATTTGGA GGTTTTGACC CGCAGGGTGC ACTGAGAAAC ATGGCTGTGG CAAAACACAA CTTGAACATC ATGATTAAAC GCTACAACTC TACCGCTGCT ACCGGATCCG

TG-3'

In other cases, amplification of HIV sequences was performed using primer pair SK-145/SK-431 and plasmid pBKBHIOS, to produce a 142-mer product. The sequences of these primers are:

SKI45 5'-AGTGGGGGGACATCAAGCAGCCATGCAAAT-3^» SK431 5'-TGCTATGTCAGTTCCCCTTGGTTCTCT-3' The sequence of the 142-mer product is:

142-mer 5'-GTGGGGGGACATCAAGCAGCCATGCAAAT

GTTAAAAGAGACCATCAATGAGGAAGCTG

CAGAATGGGATAGAGTACATCCAGTGCAT GCAGGGCCTATTGCACCAGGCCAGATGAG

AGAACCAAGGGGAAGTGACATAGCA-3• The plasmid is described in AIDS Research and Ref rence Reagent Program Catalog. NIH Publication No. 90-1536 (1990) , and was contributed by Dr. John Rossi to the repository established by the National Institute of

Allergy and Infectious Diseases to provide reagents for AIDS researchers.

Photoactivation was performed using a device ("HRI-100") sold commercially by HRI Research Inc. (Berkeley, California, USA) and ULTRA-LUM, INC. (Carson, California, USA) .

The following examples are provided in order to demonstrate and further illuminate certain aspects of the practice of the invention.

Example 1

In this example, the effect of DMSO on PCR amplification of the HLA locus with primer pair RS-134/RS-135 in the presence of high concentrations of a sterilizing compound (AMDMIP) is demonstrated. Amplification of the HLA locus with primer pair

RS-134/RS-135 is inhibited at AMDMIP concentrations above lOOμg/ml (3.5 x 10~⁴M) , which is believed to result from stabilization of the 242-mer amplicon. If concentrations higher than lOOμg/ml are required for effective use of AMDMIP as a sterilizing compound, one possibility is to use DMSO during PCR.

Nucleic acid samples were prepared which contained lμg of human placental DNA, either with or without (unirradiated) AMDMIP (200 μg/ml) . The samples were amplified for 30 cycles under standard PCR conditions in the presence of 0%, 1%, 5% or 10% DMSO. The reaction mix contained α-³²P-dCTP. Following amplification, the samples were analyzed by PAGE. The results (Figure 1) indicated that, while

(unirradiated) AMDMIP completely inhibits nucleic acid amplification at a concentration of 200 μg/ml, the addition of DMSO allowed amplification to proceed in the presence of AMDMIP. Excision and counting of the product bands provided the following results for the AMDMIP-containing samples shown in Table 2.

Table 2

% = CPM(sample) ÷ CPM(X% DMSO, 0% AMDMIP)

Comparison of the control (no AMDMIP) PCR samples as a function of % DMSO in the reaction mixture showed a regular decrease in amplification yield (down to 54.7% of control for 10% DMSO) . However, the results indicated that, while (unirradiated) AMDMIP substantially inhibits nucleic acid amplification at a concentration of 200μg/ml (1.8% of control), the addition of DMSO allowed amplification to proceed with reasonable efficiency in the presence of AMDMIP (73.4% of control) .

This example demonstrates that DMSO (at the appropriate concentration) allowed amplification to proceed in the presence of 200μg/ml AMDMIP, where less than 2% of control amplification was achieved without DMSO. Example 2

To evaluate the effect of DMSO on the photochemical binding of isopsoralens to DNA, nucleic acid samples were prepared containing lOμg/ml calf thymus DNA and 50μg/ml ³H-AMDMIP in 1XTE buffer with

DMSO (0, 1, 3, 5, 10 or 20%). The samples were divided into two aliquots, one set was irradiated with the appropriate wavelength of light (15 min using the HRI- 0100 device) , and then both sets of aliquots were processed to determine the amount of ³H-AMDMIP covalently bound to the DNA. The separation of unbound from bound ³H-AMDMIP was performed by standard procedures (3x equal volume chloroform extraction; 2x ethanol precipitation) . This procedure removed essentially all the non-covalently bound ³H-AMDMIP from the samples (as verified by comparison to the controls) . The final DNA pellets were resuspended in water, their optical density determined, and bound H-AMDMIP was measured by scintillation counting. The results were the following: 119 covalent 4'-AMDMIP adducts/10³ base pairs (BP) with 0% DMSO; 108 adducts/10³ BP with 3%; 101 adducts/10³ BP with 5%; 88 adducts/10³ BP with 10%; 60 adducts/10³ BP with 20%. When plotted (Figure 2) , the results show that ³H-AMDMIP binding decreased as the percentage of DMSO was increased. However, binding was decreased less than 10% in the aliquot with 5% DMSO. With nucleic acid samples, the decreased binding caused by the DMSO will be more than offset by the increased overall binding due to using AMDMIP at 200 instead of lOOμg/ml. Thus, 5% DMSO minimally effects the photochemical addition of AMDMIP to DNA in a model system (Calf Thymus DNA in 1XTE) . Example 3

Amplification of the HLA locus using primer pair RS-134/RS-135 is inhibited by AMDMIP concentrations greater than lOOμg/ml (3.5 x 10~⁴M) . However, the use of 3% or 5% DMSO allows amplification to proceed in the presence of 200μg/ml AMDMIP. The ability of AMDMIP to sterilize the 242-mer amplicon with DMSO present is shown below.

Sterilization experiments were carried out with AMDMIP using DMSO as a PCR co-solvent. The 242-mer amplicon provided by primer pair RS-134/135 was used for the experiment. Amplifications (30 cycles; lμg human placental DNA template) were performed in the presence of either lOOμg/ml AMDMIP with 0, 3, or 5% DMSO, or 200μg/ml AMDMIP with 3 or 5% DMSO. Since 200μg/ml AMDMIP without DMSO inhibits PCR with the 242-mer amplicon, a 0% DMSO sample was not included. Following PCR, selected samples were irradiated then a dilution series prepared for each sample (10 , 10 and 10⁶ copies) followed by reamplification (30 cycles) . The results are shown in Figures 3 and 4. With lOOμg/ml AMDMIP (Figure 3) , sterilization efficiency with 0% DMSO was 91.6% (10⁹ copies), 94.0% (10⁸ copies), and 100% (10⁶ copies); with 3% DMSO was 97.6 (10⁹ copies), 100% (10⁸ copies), and 99.3% (10⁶ copies); and with 5% DMSO was 91.4 (10⁹9 copies), 93.0% (10⁸ copies), and 95.6% (10⁶ copies). With 200μg/ml AMDMIP (Figure 4) , sterilization efficiency with 3% DMSO was 100% (10⁹ copies), 100% (10⁸ copies), and 98.5% (10⁶ copies); and with 5% DMSO was 100% (10⁹ copies), 100% (10⁸ copies), and 97.9% (10 copies). These results demonstrate the advantage provided by 3% or 5% DMSO with AMDMIP at 200μg/ml. Example 4

In this example, the effect of glycerol on PCR amplification of the HLA locus with primer pair SK- 145/SK-431 in the presence of high concentrations of a sterilizing compound (AMDMIP) is demonstrated.

Amplification of the HLA locus with primer pair SK-145/SK-431 is inhibited at AMDMIP concentrations above lOOμg/ml (3.5 x lθ^"4M) . The inhibitory effect due to isopsoralen (i.e., low amplification efficiency) is particularly pronounced when less than 100 starting copies are present. If concentrations higher than lOOμg/ml are required for effective use of AMDMIP as a sterilizing compound, one possibility is to use glycerol during PCR. Nucleic acid samples were prepared which contained

100 copies of pBKBHIOS DNA template, with unirradiated AMDMIP at various concentrations (0, 50, 100 or 200 μg/ml) . The samples were amplified for 30 cycles under standard PCR conditions in the presence of 0% or 10% glycerol. The reaction mix contained α-³²P-dCTP.

Following amplification, the samples were analyzed by PAGE.

The results (Figure 5) indicated that, while (unirradiated) AMDMIP completely inhibits nucleic acid amplification at a concentration of 200 μg/ml, the addition of glycerol allowed amplification to proceed in the presence of AMDMIP. Thus, using glycerol allows the use of an isopsoralen concentration which provides a high level of sterilization under conditions which do not compromise the PCR. From the above, it is clear that the inhibitory effect of the sterilizing compound can be overcome by the use of either DMSO or glycerol in the PCR mix, thereby restoring amplification efficiency to the level which occurs in the absence of the sterilizing compound. The DMSO or glycerol effect is quite broad, and will reestablish amplification of a low copy sample (e.g., 10 copies) in the presence of a high concentration of isopsoralen. While the precise mechanism is not clear, these results may be understood by considering that the presence of positively charged isopsoralens act to stabilize the double-stranded amplicon and that these effects will be more pronounced as the length of the amplicon increases. When a high copy number is amplified (10⁵/10⁶ starting copies) , the inhibitory effect may be concealed because the reaction still achieves plateau after 30 cycles. When this occurs, the amplification efficiency appears to be the same. As the starting copy number decreases, plateau is no longer reached and differences in PCR efficiency become apparent. By addition of a polar organic compound to the solution mix, the interaction between the isopsoralen and the DNA prior to photoreaction is weakened, perhaps reducing the enhanced stability of the amplicon duplex. While a concomitant reduction in isopsoralen photoaddition to DNA in the presence of effective concentrations of DMSO or glycerol is found, the observed reduction in photoreactivity is so great as to impact sterilization significantly. It should be emphasized that careful selection of the sterilizing compound concentration is important. For example, where the sterilizing compound is an isopsoralen, if the initial copy number is high (e.g., genomic DNA) , a relatively high concentration of isopsoralen is preferred. If the copy number is low or unknown, then either a lower isopsoralen concentration is preferred or a higher concentration of isopsoralen together with DMSO or glycerol is advised to assure that all samples will amplify. All patent publications cited in this specification are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be readily apparent to those of ordinary skill in the art in light of the teaching of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

1. A method for nucleic acid amplification comprising the steps of: a) providing in any order; i) a nucleic acid sample containing at least one amplifiable nucleic acid sequence, ii) all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, iii) at least one amplification enzyme capable of initiating an amplification reaction resulting in a nucleic acid product, iv) at least one sterilizing compound, and v) a compound selected from the group consisting of dimethylsulfoxide and glycerol in an amount sufficient to increase the amount of said nucleic acid product obtained from said nucleic acid sample by the amplification reaction; b) adding in any order: said nucleic acid sample, said amplification reagents, said sterilizing compound, and said selected compound, so as to form a reaction mixture; and c) adding said amplification enzyme to said reaction mixture.

2. The method of claim 1 wherein said selected compound is dimethylsulfoxide.

3. The method of claim 2 wherein said dimethyl sulfoxide is in a concentration of at least 3 percent by weight of said reaction mixture.

4. The method of claim 1 wherein said selected compound is glycerol in a concentration of from 10 to 20 percent by weight of said reaction mixture.

5. The method of claim 1 wherein said amplification enzyme is a nucleic acid polymerase capable of functioning in the temperature range of from 25°C to 95°C.

6. The method of claim 5 wherein said polymerase is Thermus aquaticus polymerase.

7. The method of claim 1 wherein said nucleic acid is deoxyribonucleic acid.

8. The method of claim 1 wherein said nucleic acid is ribonucleic acid.

9. The method of claim 1 wherein said sterilizing compound is a photoreactive compound.

10. The method of claim 9 wherein said photoreactive compound is at least one member selected from the group of furocoumarin derivatives.

11. The method of claim 10 wherein said furocoumarin derivative is a psoralen.

12. The method of claim 10 wherein said furocoumarin derivative is an isopsoralen.

13. The method of claim 12 wherein said isopsoralen is at least one member selected from the group consisting of 5-methylisopsoralen (MIP) , 5- aminomethylisopsoralen (AMIP) , and their radiolabelled derivatives.

14. The method of claim 12 wherein said isopsoralen is at least one member selected from the group consisting of 4,5'-dimethylisopsoralen (DMIP) , 4'-aminomethyl-4,5•-dimethylisopsoralen (AMDMIP) , and their radiolabelled derivatives.

15. The method of claim 11 wherein said psoralen is 4'-aminomethyl-4,5* , 8-trimethylpsoralen.

16. A method for nucleic acid sterilization comprising the steps of: a) providing in any order; i) a nucleic acid sample containing at least one amplifiable nucleic acid seguence, ii) all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, iii) at least one amplification enzyme capable of initiating an amplification reaction resulting in a nucleic acid product, iv) at least one sterilizing compound, and v) a compound selected from the group consisting of dimethylsulfoxide and glycerol in an amount sufficient to increase the amount of said nucleic acid product obtained from said nucleic acid sample by the amplification reaction; b) adding in any order: said nucleic acid sample, said amplification reagents, said sterilizing compound, and said selected compound, so as to form a reaction mixture; c) adding said amplification enzyme to said reaction mixture so that said amplifiable nucleic acid sequence is amplified; and d) treating said reaction mixture so that said sterilizing compound renders said amplified nucleic acid substantially unamplifiable.

17. The method of claim 16 wherein said sterilizing compound is a photoreactive compound.

18. The method of claim 17 wherein said treating of step (d) comprises photoactivating said photoreactive compound.

19. A nucleic acid amplification reaction mixture composition comprising: i) a nucleic acid sample containing at least one nucleic acid sequence of interest, ii) all standard reagents necessary to amplify at least a portion of said nucleic acid sequence, iϋ) at least one amplification enzyme, iv) at least one sterilizing compound; and v) at least one compound selected from the group consisting of dimethylsulfoxide and glycerol in an amount sufficient to increase the amount of nucleic acid product obtained from said nucleic acid sample by the amplification reaction.

20. The composition of claim 19 wherein said selected compound is dimethylsulfoxide.

21. The composition of claim 20 wherein said dimethylsulfoxide is in a concentration of at least 3 percent by weight of said reaction mixture.

22. The composition of claim 19 wherein said selected compound is glycerol in a concentration of from 10 to 20 percent by weight of said reaction mixture.

23. The composition of claim 19 wherein said amplification enzyme is a nucleic acid polymerase capable of functioning in the temperature range of from 25°C to 95°C.

24. The composition of claim 23 wherein said polymerase is Thermus aguaticus polymerase.

25. The composition of claim 19 wherein said nucleic acid is deoxyribonucleic acid.

26. The composition of claim 19 wherein said nucleic acid is ribonucleic acid.

27. The composition of claim 19 wherein said sterilizing compound is a photoreactive compound.

28. The composition of claim 27 wherein said photoreactive compound is at least one member selected from the group consisting of furocoumarin derivatives.

29. The composition of claim 28 wherein said furocoumarin derivative is a psoralen.

30. The composition of claim 28 wherein said furocoumarin derivatives is an isopsoralen.