WO1992012635A1

WO1992012635A1 - Methods of transcriptionally modulating gene expression of viral genes and other genes

Info

Publication number: WO1992012635A1
Application number: PCT/US1992/000424
Authority: WO
Inventors: J. Gordon Foulkes; Casey C. Case; Franz Leichtfried; Christian Pieler; John Stephenson
Original assignee: Oncogene Science, Inc.
Priority date: 1991-01-18
Filing date: 1992-01-17
Publication date: 1992-08-06
Also published as: AU1347292A

Abstract

The invention provided for a method of directly transcriptionally modulating the expression of a gene encoding a gene product, the expression of which gene is associated with the production of the gene product. The invention further provides a method of directly transcriptionally modulating the expression of a gene encoding a protein of a virus, the expression of which is associated with a defined pathological effect caused by the virus within a multicellular organism. Screening methods, including methods of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more viral genes or other genes associated with the production of polypeptides or other desired products are also provided. Lastly, a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding a viral gene, the expression of which is associated with a defined physiological or pathological effect caused by the virus, whose genome includes such a gene, in the organism, is provided.

Description

METHODS OF TRANSCRIPTIONALLY MODULATING GENE EXPRESSION OF VIRAL GENES AND OTHER GENES

This application is a continuation-in-part of U.S. Serial No. 644,233, filed January 18, 1991. The contents of which are hereby incorporated by reference into the present application.

Background of the Invention

Throughout this application, various publications are referenced by Arabic numerals within parentheses. Full citations for these publications may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.

PROMOTERS USEFUL FOR RECOMBINANT PROTEIN EXPRESSION

Relatively large amounts of substantially pure protein are often necessary (1) to carry out in vitro or in vivo experimentation or (2) for protein structure determination. Often the normal tissue or cell source harboring the protein of interest may be in short supply or contain insufficient endogenous quantities. Further complicating the ability to obtain adequate amounts of protein is the need to devise often lengthy and multi-step purification procedures which must usually be specifically designed for a particular protein to be isolated and can ultimately result in drastic losses of product with each successive step being carried out as well as the potential loss of critical protein function due to the inclusion of reagents in the protocol which may be necessary for protein isolation but detrimental to its activity. As a means to circumvent these and other problems encountered when attempting to isolate large amounts of functional protein, investigators have turned to the use of a variety of different expression systems with which to produce proteins.

Major expression systems common to investigators include bacterial, yeast, insect and mammalian cells (1) . The method of choice is usually dictated by a number of criteria, including size of protein being produced, whether or not the protein is secreted, the presence of host modifying enzymes which can affect the recombinant protein's structure or function, and the specific purpose for which the expressed protein will be used. With these and other parameters in mind, a number of different expression vectors with which to insert the appropriate genetic material have been developed. These often include segments from viral or yeast promoter regions which, when orientated in the proper context to the gene, or cDNA to be expressed, can be recognized by the host cell's transcriptional machinery and result in the production of protein. The next section of this introduction will deal with some of the more common viral and yeast promoters used for this purpose.

Viral Promoters

A number of viral vectors have been described including those made from various promoters and other regulatory elements derived from virus sources (2) . Promoters consist of short arrays of nucleic acid sequences that interact specifically with cellular proteins involved in transcription. The combination of different recognition sequences and the cellular concentration of the cognate transcription factors determines the efficiency with which a gene is transcribed in a particular cell type (3) . Below is a brief description of some viral vectors and their promoters which are used for expressing recombinant proteins.

1. Papovavirus: These are small, non-enveloped DNA containing viruses SV-40 and polyo a being two of the best studied papovavirus examples (4) . The viral genome of SV-40 is a covalently closed circular double- stranded DNA molecule of 5243 bp. The genome is divided into early and late regions which are transcribed from the two DNA strands in opposite directions. Various plasmid-based expression vectors contain specific regulatory regions derived from SV-40, the most commonly used being a 300 bp segment which lies between the viral early and late transcription units and containing a number of different cis-acting elements, including the DNA origin of replications and promoters, and sites of initiation of transcription of early and late mRNAs (5) . Use of the strong promoters in the SV-40 regulatory region can result in high levels of expression in transfected host cells.

2. Cytomegalovirus (CMV) : The human CMV immediate early promoters serves as an efficient transcription element with which to express foreign proteins. In combination with the CMV enhancer element, the CMV promoter's transcriptional activity can be increased to 10 to 100- fold. The human CMV enhancers are also active in a wide variety of cells from many species (97) .

3. Mouse Mammary Tumor Virus (MMTV) : The long terminal repeat (LTR) promoter region of MMTV is probably the best studied example of glucocorticoid-inducible promoters. The glucocorticoid-responsive element (GRE) behaves as an enhancer element and has been localized between -100 and -200 of the MMTV LTR (6) . High level protein expression, using the MMTV LTR in combination with other viral promoters/enhancers, can occur in glucocorticoid-responsive cells.

4. Baculovirus: High level expression of foreign proteins in insect cells has been demonstrated using the Baculovirus expression vectors (7,8). The baculovirus vector utilizes the highly expressed and regulated Autographa californica nuclear polyhedrosis virus polyhedron promoter which has been modified for the insertion of foreign genes. The viral genome consists of double-stranded circular, supercoiled DNA 128 kilobases long. Most transfer vectors contain the promoter of the polyhedron gene (which is non-essential for replication or production of extracellular virus in cultured cells) . The foreign gene sequences in the recombinant plasmid can be transferred to the wild type virus by homologous recombination within a cell transfected with both the plasmid and wild-type virus DNAs.

Yeast Promoters

Protein expression in yeast offers certain advantages over bacterial expression systems (described below) . Yeast, being eucaryotic, possess much of the complex cell biology typical of multicellular organisms, including a highly compartmentalized intracellular organization and an elaborate secretory pathway which mediates the secretion and modification of many host proteins (9) . Using a yeast expression system thus affords a broader range of potential applications than is possible with bacterial expression systems. A number of yeast promoters are available for high level protein expression. Below is a brief description of yeast promoters commonly used in protein expression systems.

1. Galactose-inducible Promoters (GAL) : The Saccharomyces galactose-inducible promoters GAL1, GAL7 and GAL10 have been used for high-level protein production in yeast (10) . These promoters can be switched off and on by the addition of galactose to a nonglucose-containing medium. A number of GAL promoter-containing plasmids are available for protein expression in yeast.

2. Copper Metallothionine Promoter: Induction of the yeast metallothionine (MT) promoter results in high level expression of recombinant genes. The MT promoter, located upstream of the CUPI coding sequence, is rapidly induced during addition of copper ions to the media. The promoter comprises a 450 bp fragment which contains the metal regulatory sequences, the mRNA cap site, the TATA box and associated transcription signals (11).

3. CYC1: The CYC1 gene of Saccharomyces cerevisiae encodes the cytochro e C protein. Two independent upstream activation sequenced (UAS) are found in the CYC1 gene, which appears to function as regulatory sites.

4. Alcohol dehydrogenase 2 (ADH2) promoter: The ADH2 gene is regulated by glucose repression. When yeast are grown on glucose, ADH2 transcription is undetectable; however, derepression to a level which ultimately produces about 1% of soluble cellular protein, occurs when yeast are grown on a non-fermentable carbon source (12) . Analysis of the ADH2 promoter reveals two cis- acting regulatory components (upstream activation sequences) which mediates derepression (13,14). Both of these elements act synergistically to confer maximum expression on the promoter. The ADH2 promoter provides a strong transcriptional start signal for heterologous gene expression. Furthermore, because ADH2 promoter transcription is highly repressed by glucose, cultures can be grown to a high density in the presence of glucose without overexpressing the protein. When glucose becomes depleted by normal cellular metabolism the promote is derepressed alleviating the need for changing the growth medium, adding inducing compounds, or changing the temperature as is required by other the promoters.

The most straight forward application of this invention is the use of the transcriptionally modulating compounds described herein to increase the production of proteins whose coding sequence has been put under the transcriptional control of one of the claimed promoters. Examples of this are the use of compounds to increase recombinant protein production in tissue culture application, increase monoclonal antibody production by including active compounds in Ascites injections, increase protein production in fungal fermentations, etc. Fungal and Viral promoters are used in the biotechnology industry for the production of protein because they are considerably stronger than typical mammalian promoters. An additional benefit of screening for compounds which increase viral and fungal promoter transcription is that inevitably compounds will be found which do just the opposite. These compounds could potentially be developed into pharmaceuticals useful for the treatment of viral or fungal infections.

Viral Diseases

The analysis of viral and yeast promoters offers the opportunity to identify compounds which inhibit the expression of viral and yeast genes critical for the growth of these organisms. Such compounds could be developed into efficacious pharmacological agents for use in the treatment of diseases caused by viruses or fungi.

A. Viral Diseases: The list of viral-related diseases is extensive. Additionally, a number of different viruses can infect a particular organ or tissue, thereby leading to disease. A few examples:

(A) Cytomegalovirus (CMV) : In vivo, CMV infects a wide range of host tissues (15), causing pneumonitis, retinitis, gastrointestinal disease, hepatitis, renalitis and encephalitis. Most CMV-related diseases occur in immunocompromised patients, either those undergoing immunosuppression to prevent transplant rejection or presenting with HIV infection. CMV is a common infection in high risk populations for HIV infection; nearly all homosexual men have εerologic evidence of recently acquired or reactivated CMV infection, and 30% shed CMV in the urine intermittently (16) . Current therapy of CMV disease treatment includes discontinuation, if possible, of immunosuppressive therapy or use of a variety of anti-viral agents. This approach has not been shown to be particularly efficacious in patients with serious CMV disease.

(B) Human papillomaviruses (HPV) : Infection with HPV is widespread throughout the population. HPV produce epithelial tumors of the skin and mucous membranes, and have been associated with genital tract malignancies. Papillomaviruses are highly species-specific, and cross- species infections occur rarely. Approximately 57 different HPV types have been identified, causing diseases which range from cutaneous and anogenital warts to respiratory papillomatosis (17) . Certain HPVs have been associated with genital tract neoplasia, particularly of the uterine cervix (18).

(C) Epstein-Barr Virus (EBV) : EBV is lymphotropic, infecting and replicating within lymphocytes. It has been identified in other organs (ie. , the salivary gland, the tongue, and in T-cell lymphomas (19) . The paradigm for EBV- induced illness is acute infectious ononucleosis. EBV- associated malignancies have also been described, particularly Burkitt's lymphoma in which 95% of tumors from endemic (African) cases are EBV-positive (20) . Nasopharyngeal carcinoma is also EBV-associated, along with much rarer human cancers including some salivary tumors, malignant thymomas, and squamous tumors of the head, neck and lung (21) .

(D) Hepatitis Virus: Viral hepatitis encompasses at least five different diseases caused by five separate viruses. The hepatitis B virus (HBV) , which causes classical serum hepatitis (22) can also lead to a chronic hepatitis. HBV replicates largely in the liver. During the early replicative phase, serum levels of HBV are highest. After a 1-4 month incubation period, clinical symptoms and biochemical evidence of liver injury appear. The disease typically lasts 2-8 weeks. Not all patients with acute hepatitis B recover completely; a proportion develop chronic hepatitis B infections. Primary hepatocellular carcinoma (HCC) represents a complication of chronic hepatitis (23) . Epidemiological and molecular biological evidence have linked HCC with chronic HBV infection. Chronic HBV infection appears to be the single major etiologic factor in the development of this tumor.

(E) Human Immunodeficiency Virus (HIV) : HIV is a retrovirus in which the single-stranded RNA genome is converted into a double-stranded DNA provirus in the host cell by reverse transcriptase (98) . HIV codes for a number of regulatory proteins which act in trans to regulate HIV- transcription. The virus infects and kills CD4 helper T lymphocytes. Infection of monocyte-macrophage and possibly other cells may also be a critical aspect of the pathogenesis of HIV-infection (24) . Clinically, asymptomatic individuals, seropositive for HIV, may maintain their status for a year to decades. When present, clinical manifestations include fever, lymphadenopathy, pharyngitis, aseptic meningitis and a mild erythematous macular exanthem (25). Opportunistic infections or malignancies (ie., pneumonia, encephalitis, Kaposi's sarcoma and lymphoma of the brain, or other non-Hodgkin's, non T-cell lymphomas) may eventually develop as result of suppression of a functional immune system.

Fungal diseases

Fungal infections are a critical and rapidly increasing health problem. Typically, fungi are opportunistic pathogens, requiring an immunocompromised host or facilitated entry allowing acute infection (e.g. through catheters) . Multiple factors have contributed to the recent increase in the number of immunosuppressed individuals, the most significant of which is the AIDS epidemic. Nearly 60% of AIDS patients develop life threatening opportunistic fungal infections (in particular Crvptocoσcus neoformans) . In addition, the increase in transplantations, with the concomitant use of immunosuppressive drugs, has uncovered a critical new need for effective anti-fungal therapies. Fungal infections are also serious problem in patients suffering from neutropenic leukemias or undergoing intensive chemotherapy. Tissue and/or systemic fungal infections occur in 25-40% of persistently febrile granulocytopenic hosts .

Herein we describe a method to find small molecular weight organic compounds, which modulate the expression of promoters useful for the production of proteins, and compounds which could be developed into antiviral and antifungal drugs. The general approach is to screen large chemical libraries for compounds with the desired biological activity. In this case the desired biological effect is a modulation of transcription of a particular gene.

The expression of a specific gene can be regulated at any step in the process of producing an active protein. Modulation of total protein activity may occur via transcriptional, transcript-processing, translational or post-translational mechanisms. Transcription may be modulated by altering the rate of transcriptional initiation or the progression of RNA polymerase (26) . Transcript-processing may be influenced by circumstances such as the pattern of RNA splicing, the rate of mRNA transport to the cytoplasm or mRNA stability. This invention concerns the use of molecules which act by modulating the in vivo concentration of their target proteins via regulating gene transcription. The functional properties of these chemicals are distinct from previously described molecules which also affect gene transcription.

The regulation of transcription in bacteria by low molecular weight chemicals has been documented (27,28) . Additionally, extracellular xenobiotics, amino acids and sugars have been reported to interact directly with an intracellular proteinaceous transcriptional activator or repressor to affect the transcription of specific genes.

Transcriptional regulation is sufficiently different between procaryotic and eucaryotic organisms so that a direct comparison cannot readily be made. For example, procaryotic cells lack a distinct membrane bound nuclear compartment. Furthermore, the structure and organization of procaryotic DNA elements responsible for initiation of transcription differ markedly from those of eucaryotic cells.

The eucaryotic transcriptional unit is much more complex than its procaryotic counterpart and consists of additional elements which are not commonly found in bacteria, including enhancers and other cis-acting DNA sequences (29,30). Procaryotic transcription factors most commonly exhibit a "helix-turn-helix" motif in the DNA binding domain of the protein (31,32). Eucaryotic transcriptional factors frequently contain a "zinc finger" (32,33), a "helix-loop- helix" or a "leucine zipper" (34) in addition to sometimes possessing the "helix-turn-helix" motif (35) . Furthermore, several critical mechanisms at the post-transcriptional level such as RNA splicing and polyadenylation are not found in procaryotic systems (36,37).

In higher eucaryotes, modulation of gene transcription in response to extracellular factors can be regulated in both a temporal and tissue specific manner (38) . For example, extracellular factors can exert their effects by directly or indirectly activating or inhibiting tissue-specific transcription factors (38,39).

Modulators of transcription factors involved in direct regulation of gene expression have been described, and include those extracellular chemicals entering the cell passively and binding with high affinity to their receptor-transcription factors. This class of direct transcriptional modulators include steroid hormones and their analogs, thyroid hormones, retinoic acid, vitamin D₃ and its derivatives, and dioxins, a chemical family of polycyclic aromatic hydrocarbons (33,40,41).

Dioxins are molecules generally known to modulate transcription. Dioxins, however, bind to naturally- occurring receptors which respond normally to xenobiotic agents via transcriptionally activating the expression of cytochrome P450, part of an enzyme involved in detoxifi¬ cation. Similarly, plants also have naturally occurring receptors to xenobiotics to induce defense pathways. For example, the fungal pathogen Phytophthora megasperma induces an anti-fungal compound in soybeans. Such molecules which bind to the defined ligand binding domains of such naturally occurring receptors are not included on the scope of this invention.

The clinical use of steroid hormones, thyroid hormones, vitamin D₃ and their analogs demonstrates that agents which modulate gene transcription can be used for beneficial effects, although these agents can exhibit significant adverse side effects. Analogs of these agents could have similar clinical utility as their naturally occurring counterparts by binding to the same ligand binding domain of such receptors. These types of molecules do not fall within the scope of this invention because they function by binding to the ligand-binding domain of a receptor normally associated with a defined physiological effect.

Indirect transcriptional regulation involves one or more signal transduction mechanisms. This type of regulation typically involves interaction with a receptor, the receptor being part of a multistep intracellular signaling pathway, the pathway ultimately modulating the activity of nuclear transcription factors. This class of indirect transcriptional modulators include polypeptide growth factors such as platelet-derived growth factor, epidermal growth factor, cyclic nucleotide analogs, and mitogenic tumor promoters such as PMA (42,43,44).

It is well documented that a large number of chemicals, both organic and inorganic, e.g. metal ions, can non-speσifically modulate transcription. Most heavy metals modulate gene expression through receptors in a mechanism similar to that employed by dioxin, steroid hormones, vitamin D3 and retinoic acid.

Researchers have used nucleotide analogs in methods to non- specifically modulate transcription. The mechanism involves incorporating nucleotide analogs into nascent mRNA or non-specifically blocking mRNA synthesis. Similarly, researchers have used alkylating agents, e.g. cyclophosphamide, or intercalating agents, e.g. doxorubicin, to non-specifically inhibit transcription.

Moreover, chemical inhibitors of hydroxymethyl-glutaryl CoA reductase (e.g. lovastatin) are known to indirectly modulate transcription by increasing expression of hepatic low density lipoprotein receptors as a consequence of lowered cholesterol levels.

Signal effector type molecules such as cyclic AMP, diacylglycerol, and their analogs are known to non-specifically regulate transcription by acting as part of a multistep protein kinase cascade reaction. These signal effector type molecules bind to domains on proteins which are thus subject to normal physiological regulation by low molecular weight ligands (45,46).

The specific use of sterol regulatory elements from the LDL receptor gene to control expression of a reporter gene has recently been documented in PCT/US88/10095. One aspect of PCT/US88/10095 deals with the use of specific sterol regulatory elements coupled to a reporter as a means to screen for drugs capable of stimulating cells to synthesize the LDL receptor. PCT/US88/10095 describes neither the concept of simultaneously screening large numbers of chemicals against multiple target genes nor the existence of transcriptional modulators which (a) do not naturally occur in the cell, (b) specifically transcriptionally modulate expression of the genes of interest, and (c) binds to DNA or RNA, or bind to a protein through a domain of such protein which is not a defined ligand binding domain which naturally occurs in the cell, the binding of a ligand to which ligand binding domain is normally associated with the production in cell culture of the protein encoded by the gene. The main focus of PCT/US88/10095 is the use of the sterol regulatory elements from the LDL receptor as a means to inhibit expression of toxic recombinant biologicals.

The use of molecules to specifically modulate transcription of a gene as described herein has not previously been reported. In fact available literature does not propose the use of a molecule, as described, in a method to specifically modulate transcription. Instead, the available literature has reported methods which define domains of transcriptional regulating elements of particular genes.

Further, the practice of using a reporter gene to analyze nucleotide sequences which regulate transcription of a gene- of-interest is well documented. The demonstrated utility of a reporter gene is in its ability to define domains of transcriptional regulatory elements of a gene-of-interest. Reporter genes which express proteins, e.g. luciferase, are widely utilized in such studies. Luciferases expressed by the North American firefly, Photinus pyralis and the bacterium. Vibrio fischeri were first described as transcriptional reporters in 1985 (47,48). Reporter genes have not been previously used to identify compounds which (a) do not naturally occur in the cell and (b) specifically transcriptionally modulate expression of the gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with the production in cell culture of the protein encoded by the gene.

A method to define domains of transcriptional regulating elements of a gene-of-interest typically has also involved use of phorbol esters, cyclic nucleotide analogs, concanavalin A, or steroids, molecules which are commonly known as transcriptional modulators. However, available literature shows that researchers have not considered using a transcription screen to identify specific transcriptional modulators. Apparently, success would be unlikely in doing so, however, we have demonstrated herein that this is not the case.

There is utility in developing the method of transcriptional modulation of genes by using such molecules as described herein. This method will increase the production capacity of recombinant proteins and allow the development of novel pharmaceuticals.

g..iMn»τy of the Invention

This invention provides a method of obtaining a gene product of interest, which comprises culturing cells capable of expressing a gene encoding the gene product in the presence of a molecule at a concentration effective to directly transcriptionally modulate expression of the gene so as to increase the biosynthesis of the gene product expressed by the cells and recovering the gene product. In this production method the molecule (a) does not naturally occur in the cells, (b) specifically transcriptionally modulates expression of the gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with the production in cell culture of the gene product.

The present invention further includes a method of directly transcriptionally modulating the expression of a gene encoding a viral protein, the expression of which gene is associated with a defined pathological effect within a multicellular organism, which comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the protein encoded by the gene which is expressed by the cell. In this method the molecule (a) does not naturally occur in the cell and (b) specifically transcriptionally modulates expression of the gene encoding the protein, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined pathological effect.

Additionally, this present invention also provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which gene is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence encoding a polypeptide, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable detectable signal to be produced by the polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Further provided is a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which gene is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

The present invention includes a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which gene is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Also, this invention includes a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence encoding a polypeptide, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable detectable signal to be produced by the polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Additionally, this present invention provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

In addition, this invention provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and

(iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Finally, a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding a viral gene, the expression of which is associated with a defined physiological or pathological effect in the organism, is also included. This method comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined pathological effect. In this method the molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the gene encoding the viral gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined pathological effect.

Brief Description of the Figures

Figure 1 is a view of the mammalian expression shuttle vector pUV102 with its features. The mammalian expression shuttle vector was designed to allow the construction of the promoter-reporter gene fusions and the insertion of a neomycin resistance gene coupled to the herpes simplex virus thymidine kinase promoter (TK-NEO) .

Figure 2 is a partial restriction enzyme cleavage map of the plasmid pD0432 which contains the luciferase gene from the firefly, Photinus pyralis.

Figure 3 is a partial restriction enzyme cleavage map of the plasmid pSVLuci which contains the luciferase gene from the firefly, Photinus pyralis.

Figure 4 is a partial restriction enzyme cleavage map of the plasmid pMLuci which contains the luciferase gene of the firefly, Photinus pyralis and the mouse mammary tumor virus long terminal repeat.

Figure 5 provides the nucleotide sequences of six oligonucletides, pUV-1 through pUV-6, which were annealed, ligated, and inserted into the Sall/EcoRl sites of the plasmid pTZ18R.

Figure 6 is a diagrammatic representation of the construction of the plasmid pUVOOl from the plasmids pTZ18R and pBluescript KS(+). Figure 7 is a diagrammatic representation of the construction of the plasmid pUVlOO from the plasmid pUVOOl and two DNA fragments, the Xbal/Xmal fragment from pMLuci and the Xmal/BamHI fragment from pMSG.

Figure 8 is a diagrammatic representation of the construction of the plasmid pUVlOO-3 from the plasmid pUVlOO and a 476 bp fragment containing a dimeric SV40 polyadenylation site.

Figure 9 is a diagrammatic representation of the construction of the plasmids pUV102 and pUV103 from the plasmid pUVlOO-3 and D-link oligonucleotides and the plasmid pUV100-3 and R-link oligonucleotides, respectively.

Figure 10 provides the nucleotide sequences of oligos 1-4 used for the construction of a synthetic HSV-Thymidine Kinase promoter and provides a diagrammatic representation of the HSV-TK promoter.

Figure 11 is a diagrammatic representation of the construction of the plasmid pTKLlOO which contains the luciferase gene from the firefly, Photinus pyralis and the HSV-TK promoter sequence.

Figure 12 is a diagrammatic representation of the construction of the plasmid pTKNEO which contains the neo gene, from about 3.5 kb Nhel/X al fragment from pTKLlOO, and the about 0.9 kb BstBI/Bglll fragment containing the neo coding region from pRSVNEO. Figure 13 is a diagrammatic representation of the construction of the plasmid pTKNE02 from the plasmid pTKNEO and the oligonucleotides Neo 1 and 2.

Figure 14 is a diagrammatic representation of the construction of the plasmid pTKNE03 from the plasmid PTKNE02 and about 0.9 kb EcoRl/Sall fragment from pMClNEO.

Figure 15 is a partial restriction enzyme cleavage map of the plasmid pCM106 which contains CMV upstream sequences fused to the luciferase gene.

Figure 16 is a partial restriction enzyme cleavage map of the plasmid pCM106 which contains the Cytomegalovirus immediate early promoter fused to the luciferase gene from the firefly, Photinus pyralis.

Figure 17 is a partial restriction enzyme cleavage map of the plasmid pNEU106 which contains neu upstream sequences fused to the luciferase coding region.

Figure 18 is a partial restriction enzyme cleavage map of the plasmid pKRASlOδ which contains K-ras upstream sequences fused to the luciferase gene from the firefly, Photinus pyralis.

Figure 19 is an autoradiogram of a Southern blot showing the correct luciferase vector integration of independently isolated SV40 reporter vector transfectants. Lane 1 is a plasmid control. The expected result is a single band of the same molecular weight as the control.

Figure 20 is an autoradiogram of a Southern blot showing the correct luciferase vector integration of independently isolated CMV reportervector transfectants. Lane l is a plasmid control. The expected result is a single band of the same molecular weight as the control.

Figure 21 is a graphical representation of the response of the MMTV reporter cell line to various steroids. Relative light production is compared to an untreated control.

Figure 22 is a graphical representation of the decay of reporter gene signal after treatment of cells with Actinomycin D. Plotted is relative intensity of the signal versus time after ActD addition.

Figure 23 is a graphical representation of the linearity of response of the yeast luciferase reporter system. Light intensity versus cell number is plotted.

Figure 24 is a quality assurance analysis of a high throughput screen measuring the ratios of negative values at various positions within a plate. The expected value is 1.0.

Figure 25 is a quality assurance analysis of a high throughput screen measuring a coefficient of variance for the negative controls on a number of plates. Values less than 10 are acceptable. Figure 26 is a quality assurance analysis of a high throughput screen measuring a coefficient of variance for the positive controls on a number of plates. Values less than 10 are acceptable.

Figure 27 is a quality assurance analysis of a high throughput screen measuring a response of a reporter cell line to three different concentrations of a compound known to induce transcription.

Figure 28 is a bar graph illustrating specific induction of luciferase expression in reporter cell lines for MMTV

(M10) , human growth hormone (532) and human G-CSF (G21) promoters in response to chemicals identified in a high throughput screen and known transcriptional inducers.

Figure 29 is a bar graph illustrating specific inhibition of luciferase expression in reporter cell lines for MMTV (M10) , human growth hormone (532) , and human G-CSF (G21) in response to chemicals identified in a high throughput screen.

Detailed Description of the Invention

As used in this application, the following words or phrases have the meanings specified.

Antisense nucleic acid means an RNA or DNA molecule or a chemically modified RNA or DNA molecule which is complementary to a sequence present within an RNA transcript of a gene.

Cell culture means the in vitro growth of either single cells or groups of cells by means of tissue culture or fermentation.

Directly transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of the gene through the binding of a molecule to (1) the gene (2) an RNA transcript of the gene, or (3) a protein which binds to (i) such gene or RNA transcript, or (ii) a protein which binds to such gene or RNA transcript.

A gene means a nucleic acid molecule, the sequence of which includes all the information required for the normal regulated production of a particular protein, including the structural coding sequence, promoters and enhancers.

Indirectly transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of such gene through the action of a molecule which cause enzymatic modification of a protein which binds to (1) the gene or (2) an RNA transcript of the gene, or (3) protein which binds to (i) the gene or (ii) an RNA transcript of the gene. For example, altering the activity of a kinase which subsequently phosphorylates and alters the activity of a transcription factor constitutes indirect transcript modulation.

Ligand means a molecule with a molecular weight of less than 5,000, which binds to a transcription factor for a gene. The binding of the ligand to the transcription factor transcriptionally modulates the expression of the gene.

Ligand binding domain of a transcription f ctor means the cite on the transcription factor at which the ligand binds.

Modulatable transcriptional regulatory sequence of a gene means a nucleic acid sequence within the gene to which a transcription factor binds so as to transcriptionally modulate the expression of the gene.

Receptor means a transcription factor containing a ligand binding domain.

Specifically transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of such gene alone, or together with a limited number of other genes.

Transcription means a cellular process involving the interaction of an RNA polymerase with a gene which directs the expression as RNA of the structural information present in the coding sequences of the gene. The process includes, but is not limited to the following steps: (1) transcription initiation, (2) transcript elongation, (3) transcript splicing, (4) transcript capping, (5) transcript termination, (6) transcript polyadenylation, (7) nuclear export of the transcript, (8) transcript editing, and (9) stabilizing the transcript.

Transcription factor for a gene means a cytoplasmic or nuclear protein which binds to (1) such gene, (2) an RNA transcript of such gene, or (3) a protein which binds to (i) such gene or such RNA transcript or (ii) a protein which binds to such gene or such RNA transcript, so as to thereby transcriptionally modulate expression of the gene.

Transcriptionally modulate the expression of a gene means to change the rate of transcription of such gene.

Triple helix means a helical structure resulting from the binding of one or more oligonucleotide to double stranded DNA.

The invention further provides a method of directly transcriptionally modulating the expression of a gene encoding a viral protein, the expression of which is associated with a defined pathological effect within a multicellular organism, which comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the protein encoded by the gene which is expressed by the cell. In this method the molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the gene encoding the protein, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined pathological effect.

In one embodiment of the invention, the molecule does not naturally occur in any cell of a lower eucaryotic organism such as yeast. In a preferred embodiment, the molecule does not naturally occur in any cell, whether of a multicellular or a unicellular organism. Alternatively, the molecule is naturally occurring, but not normally found in the cell. In a presently more preferred embodiment, the molecule is not a naturally occurring molecule, e.g. is a chemically synthesized entity.

In accordance with the invention the cell contacted with the molecule may be a cell of a multicellular organism, for example, an insect cell, an animal cell or a human cell, a hybridoma, a COS cell, a CHO cell, a HeLa cell, a fungal cell. (e.g. a yeast cell) of a plant cell.

The method of the invention permits modulating or a transcription of the gene which results in upregulation or downregulation of the expression of the gene (either the gene encoding the gene product or the gene encoding the viral protein) .

Additionally, the methods of the invention are most advantageouslyemployed to specificallytranscriptionally modulate expression of such genes.

In one example, the molecule may bind to a promoter region upstream of the coding sequence encoding the viral gene.

In one embodiment of the method of the invention the molecule comprises an antisense nucleic acid which is complementary to a sequence present in a modulatable transcriptional sequence. The molecule may also be a double stranded nucleic acid or a nucleic acid capable of forming a triple helix with a double stranded DNA.

In one embodiment the molecule bonds to a modulatable transcription sequence of the gene.

In the case of genes encoding viral proteins, the gene is typically associated with amelioration of a disorder caused by the virus such as a virus infection.

Examples of viruses, the genes of which are subject to transcriptional modulation include cytomegalovirus, hepatitis, herpes, HIV, EBV, papilloma virus, cytomegalovirus, rhinovirus, influenza virus, varicella- zoster virus, parainfluenza virus, mumps virus, respiratory syncytial virus, adenovirus, measles virus, rubella virus, human parvovirus, poliovirus, rotavirus, echovirus, arbovirus, human T cell leukemia-lymphoma virus.

In the practice of this invention a gene encoding the gene product is a gene encoding any protein or RNA of industrial of commercial significance. Many such proteins are either already available commercially or are under commercial development. Merely, by way of example such proteins include human and animal growth hormones, tissue plasminogen activators, erythropoietin, and factor VIII.

The invention may be employed to augment the production of such protein in cell culture, particularly in animal cell culture such as in CHO cells grown in culture and thereby reduce the substantial costs involved in commercial production of such proteins.

The present invention further provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene. Such a method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence encoding a polypeptide, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable detectable signal to be produced by the polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Also provided is a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

The invention further includes a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which is associated with production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Also provided by this invention is a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence encoding a polypeptide, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable detectable signal to be produced by the polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Additionally, the invention provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

The invention further provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

Further, the sample comprises cells in monolayerε. Optionally, the sample comprises cells in suspension.

Cells may include animal cells (such as human cells) , fungal cells, insect cells, and plant cells.

In accordance with the practice of the invention, the predefined number of cells may be from about 1 to about 5 X 10⁵ cells. Alternatively, the predefined number of cells may be from about 2 X 10² to about 5 X 10⁴ cells.

Further, in accordance with the practice of the invention, the predetermined amount of the molecule to be tested is based upon the volume of the sample. In one example of the invention, the predetermined amount is from about 1.0 pM to about 20 μM. In another example, the predetermined amount is from about 10 nM to about 500μM.

Additionally, in keeping with the practice of the invention, the contacting is effected from about 1 to about 24 hours. In one example, the contacting is effected from about 2 to about 12 hours. Also, the contacting may be effected with more than one predetermined amount of the molecule to be tested.

Further, the molecule to be tested may be a purified molecule. Moreover, the modulatable transcriptional regulatory sequence may comprise a cloned genomic regulatory sequence. The DNA may consist essentially of more than one modulatable transcriptional regulatory sequence. In accordance with this invention the polypeptide may be a luciferase, chloramphenicol acetyltransferase, ,9 glucuronidase, β galactosidase, neomycin phosphotransferase, alkaline phosphatase, or guanine xanthine phosphoribosyltransferase. Further, the polypeptide may be capable of recognizing and binding to an antibody. Alternatively, the polypeptide may be capable of recognizing and binding to biotin.

Additionally, in accordance with the practice of this invention, mRNA may be detected by quantitative polymerase chain reaction.

The invention further provides the above-described screening method which further comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested. In accordance with the practice of the invention, the plurality of samples may comprise more that about 10* samples. Alternatively, the plurality of samples may comprise more than about 5 X 10⁴ samples.

Additionally, the present invention provides a method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more genes. The method comprises essentially simultaneously screening the molecules against the genes encoding the proteins of interest according to the above-describe method. In accordance with the practice of this invention, more than about 10³ samples per week are contacted with different molecules.

Pursuant to the provisions of the Budapest Treaty on the International Recognition of Deposit of Microorganisms for Purpose of Patent Procedure, the plasmid and the cell lines listed below have been deposited with the American Type Culture Collection ("ATCC"), 12301 Parklawn Drive, Rockville, Maryland 20852, U.S.A.:

1. a plasmid designated pUV106, deposited under ATCC Accession No. 40946;

2. a human colon adenocarcinoma cell line, transfected with pHRA521, designated H21, deposited under ATCC Accession No. CRL 10640;

3. a HTB-30 human colon adenocarcinoma cell line, transfected with pNEUl06, designated N-2, deposited under ATCC Accession No. CRL 10658;

4. a SW 480 human breast carcinoma cell line, transfected with pKRAS106, designated K-2, deposited under ATCC Accession No. CRL 10662;

5. a NIH Swiss mouse embryo cell line, NIH 3T3, transfected with the MMTV reporter plasmid, designated M10, deposited under ATCC Accession No. CRL 10659.

Further, in accordance with the invention, a cell containing a gene comprising a heterologous regulatory element or a strong promoter (such as an immunoglobulin promoter) may be fused to a coding sequence so as to produce a desired protein encoded by such sequence. Contacting the cell (which is capable of expressing the gene) with a molecule having the properties described herein may be effective to transcriptionally modulate expression of the gene and increase the level of the protein expressed by the cell. Examples of suitable promoters include a viral promoter. Examples of such include an adenovirus promoter, an simian virus 40 (SV40) promoter, a cytomegalovirus (CMV) promoter, a mouse mammary tumor virus (MMTV) promoter, a Malony urine leukemia virus promoter, a murine sarcoma virus promoter, and a Rous sarcoma virus promoter.

Further, another suitable promoter is a heat shock promoter. Additionally, a suitable promoter is a bacteriophage promoter. Examples of suitable bacteriophage promoters include a T7 promoter, a T3 promoter, an SP6 promoter, a lambda promoter, a baculovirus promoter.

Also suitable as a promoter is an animal cell promoter such as an interferon promoter, a metallothionein promoter, an immunoglobulin promoter. A fungal promoter is also a suitable promoter. Examples of fungal promoters include an ADC1 promoter, an ARG promoter, an ADH promoter, a CYC1 promoter, a CUP promoter, an EN01 promoter, a GAL promoter, a PHO promoter, a PGK promoter, a GAPDH promoter, a mating type factor promoter. Further, plant cell promoters and insect cell promoters are also suitable for the methods described herein.

Further provided is a method of obtaining a polypeptide, which comprises culturing cells capable of expressing a gene encoding the polypeptide in the presence of a molecule at a concentration effective to directly transcriptionally modulate expression of the gene so as to increase the biosynthesis of the polypeptide expressed by the cells and recovering the polypeptide. In this production method the molecule (a) does not naturally occur in the cells, (b) specifically transcriptionally modulates expression of the gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with the production in cell culture of the polypeptide. In one example of the invention, wherein the polypeptide is a homologous polypeptide.

Further, in another example of the invention the polypeptide is a desired product. Further, in another example of the invention, the desired product is a monoclonal antibody. Moreover, in a further example of the invention, the DNA is recombinant DNA. Further, in the method of the invention, the cell is a animal cell, a plant cell, a bacterial cell or a fungal cell.

Further, in another example of the invention, the polypeptide is associated with production of a desired product. Examples of desired products include is an antibiotic, citric acid, a desired antigen for the development of a vaccine, tissue plasminogen activator, a growth hormone, a blood clotting factor, erythropoietin, an interleukin, a colony stimulating factor, a transforming growth factor.

The following provides a biological method for recovering a substance from a mixture containing the substance which involves contacting the mixture with cells so as to separately recover the substance, which cells (i) comprise DNA encoding, and (ii) are capable of expressing a gene product, which gene product facilitates separating the substance from the mixture so as to recover the substance from the mixture, the improvement comprising (1) treating the cells with a molecule which (a) does not naturally occur in the cell and (b) binds to DNA or RNA or binds to a protein through a domain of such protein which is not a ligand binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand binding domain is normally associated with increased production of the gene product.

Further, in another example of the invention, the substance is a metal. The following provides a biological method for treating a substance with cells so as to effect a biochemical transformation by contacting the substance with cells which (i) comprises DNA encoding, and (ii) is capable of expressing a gene product which permits biochemical transformation, the improvement comprising contacting the cells with a molecule which (a) does not naturally occur in the cell and (b) binds to DNA or RNA or binds to a protein through a domain of such protein which is not a ligand binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand binding domain is normally associated with enhanced production of the gene product.

In examples of the invention, the biochemical transformation is associated with the production of a steroid, an alcohol or with the degradation of petroleum products.

Clearly, this invention would have commercial applications both in the case where the polypeptide itself is commercially important, and in the case where expression of the polypeptide mediates the production of a molecule which is commercially important. Examples include, but are not limited to:

1. increasing expression of a polypeptide which is associated with the rate limiting step in antigen production wherein the antigen is produced for a vaccine. Vaccines can be used against viral, bacterial or parasitic infections. Such viral vaccines include poliomyelitis, measles, mumps and rubella. In addition, foot and mouth disease vaccine and rabies vaccine are of major commercial importance. Viable, disease-associated viruses can be subsequently inactivated, live viruses can be attenuated to lose their pathogenicity or genetically engineered. The expression of a viral antigen could be under the control of a heterologous promoter (59) ; 2. increasing expression of monoclonal antibodies by hybridoma cells, ie., cell lines resulting from the fusion of a B-lymphocytes with a myeloma cell lines. Monoclonal antibodies could be produced by growing the hybridoma in tissue culture or in vivo (59) ;

3. increasing the expression of a heterologous polypeptide by a cell (i.e. a polypeptide introduced into the cell by genetic engineering) , typically, under the control of a strong promoter. Examples of such promoters include the promoter of the SV40 virus, the immediate early promoter of the cytomegalovirus or the baculovirus promoter. Examples of heterologous polypeptides would include tissue plasminogen activator, human or animal growth hormones, blood clotting factors, erythropoietin, interleukins, interferons, the colony stimulating factors G-, GM- and M-CSF, and transforming growth factors-,91, -,92 and -,93. In a variation of this invention, the polypeptide of interest could be expressed by the cell without genetic engineering. One example would be the production of interferon alpha by the lymphoblastoid cell line •Namala' (59);

4. increasing plant derived products as used in fragrances and perfumes, flavoring compounds or sweeteners e.g. the basic proteins from Thaumatococcus danielli, insecticides, anti-fungal compounds or pesticides (60) ; 5. increasing the expression of a polypeptide which is associated with the rate limiting step in bioleaching of metals such as uranium, copper, silver, manganese etc. For example, as carried out by the organism Thiobacillus sp. , algae or fungi (61);

6. increasing the expression of a polypeptide which is associated with the rate limiting step in removal of nitrogen or phosphate or toxic waste minerals from water, e.g. as carried out by Nitrobacter sp. or Actinetobacter sp. (62) ;

7. increasing the expression of a polypeptide which is associated with the rate limiting step in stimulating methane production from biological waste, typically from the methanogenic micro¬ organisms archaebacteria (63) ;

8. increasing the expression of a polypeptide which is associated with the rate limiting step in the biodegradation of marine oil spills (e.g., aliphatic hydrocarbons, halogenated aliphatics, halogenated aromatics) . In one instance, biodegradation is effected by the conversion of petroleum products to emulsified fatty acids. Bacteria useful in this invention include, but are not restricted to, Archromobacter, Arthrobacter, Flavobacteriu , Nocardia, Pseudomonas (e.g. Pseudomonas oleovorans) and Cytophaga. Yeast useful in this invention include, but are not restricted to, Candida (e.g., Candida tropicalis) , Rhodotorula, and Trichosporon (64) ;

9. increasing the expression of a polypeptide which is associated with the rate limiting step in biodegradation of lignin (64) ;

10. increasing the expression of a polypeptide which is associated with the rate limiting step in the biotransformation of : - steroids and sterols (65), e.g., by Rhizopus sp. , Saccharomyces (66) Corynebacterium sp. D sorbitol to L sorbose by Acetobacter suboxydans (67)

- racemic mixtures (68) - prochiral substrates

- terpenoids (69)

- alicyclic and heteroalicylic compounds (70)

- antibiotics (71)

- aromatic and heterocyclic structures including phthalic acid esters, lignosulfonates, surfactants and dyes (72)

- naphthyridines by Penicillium sp (72)

- polynuclear aromatic hydrocarbons (72) aliphatic hydrocarbons (73) - amino acid and peptides (68) glucose to fructose (67)

- glucose to gluconic acid (67)

- raffinose to sucrose and galactose (60)

- lactose - sucrose

11. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of commercially important enzymes from micro-organisms, e.g. lactase from Aspergillus oryzae, Escherichia coli. Bacillus stearothermophilus;

12. increasing the expression of a polypeptide which is associated with the rate limiting step in the growth of Saccharomyces on molasses (74) ;

13. increasing the expression of a polypeptide which is associated with the rate limiting step in the growth of Candida on spent sulphite liquor (74) ;

14. increasing the expression of a polypeptide which is associated with the rate limiting step in the growth of yeast on higher n-alkanes (75) ;

15. increasing the expression of a polypeptide which is associated with the rate limiting step in the growth of bacteria on higher n-alkanes (75) ;

16. increasing the expression of a polypeptide which is associated with the rate limiting step in the growth of bacteria or yeast on methane or methanol (76);

17. increasing the expression of a polypeptide which is associated with the rate limiting step in the assimilation of atmospheric nitrogen by e.g., Azotobacteria sp., Rhizobium sp. , or Cyanobacteria; 18. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of insecticides from Bacillus sp. , e.g. Bacillus thuringiensis (77) ;

19. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of insecticides from entomogenous fungi such as Deuteromycetes, e.g. Verticillium lecanii and Hirsutella thompsonii (78) ;

20. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of ethanol from cellulosic materials, starch crops, sugar cane, fodder beats, molasses by, for example, Saccharomyces cerevisiae, S. uvarum, Schizosaccharomyces pombe or Kluyveromyces sp. (78, 79);

21. increasing the expression of a polypeptide which is associated with the rate limiting step in acetic acid production from ethanol by Acetobacter sp. or Gluconobacter sp. (78) ;

22. increasing the expression of a polypeptide which is associated with the rate limiting step in the lactic acid production by the family of Lactobacillaceae (80) ;

23. increasing the expression of a polypeptide which is associated with the rate limiting step in the citric acid production by Candida sp. , Aspergillus niger using e.g., molasses or starch (80);

24. increasing the expression of a polypeptide which is associated with the rate limiting step in gluconic acid production by e.g. Pseudomonas sp., Gluconobacter sp., and Acetobacter sp. (81);

25. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of amino acids by bacteria or fungi (82);

26. increasing the expression of a enzyme in a cell, which enzyme catalyzes the resolution of racemic mixtures of amino acids (82) ;

27. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of extracellular polysaccharides, e.g. by Corynebacterium sp., Pseudomonas sp., or Erwinia tahitica. Other examples include the production of scleroglycan from the fungus Sclerotium sr. , pullulan from Aureobasidium pullulans, curdlan from Alcaligens faecalis, and dextrans from Streptobacterium sp. or Streptocucus sp. Other examples include anionic polysaccharides from Arthrobacter viscosus, bacterial alginates from Azotobacter vinelandii, xanthan from Xanthomonas campestris.

28. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of an antifungal compound (e.g. Griseofulvin) and penicillins from Penicillium sps.

29. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of antibiotics by fungi, e.g. polyether antibiotics (83) , chloramphenicol (83) , ansamycines (84) , tetracyclines (85) , macrolides (86) , aminoglycosides (87) , clavans, cephalosporins, cephamycins (88) from Streptomyces sp. ;

30. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of antitumor substances, e.g., actinomycin D, anthracyclines, and bleomycin from Streptomyces sp. ;

31. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of nucleic acids, nucleotides and related compounds, e.g., 5' inosinate (IMP), 5' guanylate (GMP) , cAMP by e.g. Brevibacterium ammoniagenes (89) ;

32. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of vitamins, e.g. vitamin B12 by Pseudomonas denitrificans, Propionibacterium shermanii, or Rhodopseudomonas protamicus;

33. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of riboflavin by Ashbya gossypii or Bacillus subtilis. ;

34. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of ergosterol by yeast, e.g. Saccharomyces cerevisiae;

35. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of ergot alkaloids by Claviceps sp (90) ;

36. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of secondary metabolites useful for selected therapeutic uses in human medicine, e.g. cyclosporin from Trichoderma polysporum (91) ;

37. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of secondary products from plant cell cultures, e.g. cinnamic acid derivatives in Coleuε blume; shikonins from Lithospermum erythrophizon (92);

38. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of wine and beer by Sacchromyces sp. (93, 94);

39. increasing the expression of a polypeptide which is associated with the rate limiting step in the production of yogurt or cheese by Staphylococcus sp., Lactobacillus sp. and Propionibacterium sp. (95, 96);

40. increasing the expression of a polypeptide which is associated with the rate limiting step in the fermentation of cocoa from Theobroma cacao by fungi and bacteria;

41. increasing the expression of a polypeptide which is associated with the rate limiting step in the fermentation of coffee beans from Coffea sp. by fungi and bacteria.

In each case the invention would include the following steps (i) identification of the protein responsible for controlling the rate limiting step and (ii) screening for molecules capable of increasing the production of that protein using the methods described herein as will be clearly and readily understood by one skilled in the art.

The invention provides both for the method of screening for such molecules and for the use of such molecules to regulate expression of a rate limiting polypeptide as described herein.

A method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding a viral gene, the expression of which is associated with a defined physiological or pathological effect in the organism, is also included. This method comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined pathological effect. In this method the molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the gene encoding the viral gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined pathological effect.

In the method discussed above the molecule may bind to a modulatable transcription sequence of the gene. Also, the method discussed above includes the use of a molecule of an antisense nucleic acid, a double stranded nucleic acid, or a nucleic acid capable of forming a triple helix with double-stranded DNA.

The virus may be one which is associated with a pathological effect such as cancer. For example,the cancer may be a hepatocellular carcinoma, a leukemia, or a cervical carcinoma. The pathological effect may also be AIDS, cytomegalovirus infection, influenza, infectious mononucleosis, mumps, poliomyelitis, measles, rubella, herpes or hepatitis.

The administering discussed in the preceding methods may comprise topical contact, or oral, transdermal, intravenous, intramuscular or subcutaneous administration. Methods of administration of molecules in the practice of the invention are well known to those skilled in the art as are methods of formulating the molecule for administration depending on the specific route of administration being employed.

This invention is illustrated in the Experimental Detail section which follow. These sections are set forth to aid in an understanding of the invention but are not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow thereafter.

EXPERIMENTAL DETAILS

MATERIALS AND METHODS

A, Cell Culture

All media and reagents used for routine cell culture were purchased from Gibco (Grand Island, NY) , Hazelton (Lenexa, KS) , or Whittaker M.A. Biologicals (Walkersville, MD) . Fetal calf serum (FCS) was from Hyclone (Logan, UT) , and nutrients used for serum-free defined media were purchased from Sigma (St. Louis, MO) , BoehringerMannheim (Indianapolis, IN), Bachem (Torrance, CA) and Collaborative Research (Bedford, MA) . (49,50).

A human hepatocellular carcinoma derived cell line, Hep3B (ATCC# HB8064) , was used for transfection of plasmids containing the SV40 and CMV promoters. These cells were maintained on MEM:OptiMEM (1:1) supplemented with 10% FCS.

A murine embryonic fibroblast cell line, NIH3T3 (ATCCf CCL92) , was used for the transfection of plasmids carrying the MMTV promoter. These cells were maintained on DMEM, supplemented with 10% FCS.

A human colon adenocarcinoma cell line, SW480 (ATCC CCL 228) was used for experiments concerning expression of the K-ras proto-oncogene (used as a control) . This cell line was maintained on DMEM, 15% fetal calf serum (FCS) , 1% Nonessential amino acids (NEAA) . Stable transfectants of this cell line were selected in the same medium with the addition of G418 (Geneticin, Gibco) to a final concentration of 0.6 mg/ml.

A human breast adenocarcinoma derived cell line, SK-BR-3 (ATCC HTB 30) was used for the experiments concerning expression of the neu (ErbB2) proto-oncogene (also used as a control) . This cell line was maintained on DMEM, 15% FCS and 1 ug/ml insulin. Stable transfectants of this cell line were selected in this same medium with the addition of G418 to a final concentration of 0.4 mg/ml.

B. Construction of the OSI Luciferase-Fusion Reporter

Vector

Unless otherwise indicated, molecular cloning procedures were performed essentially according to Maniatis et al.

(51) . Oligonucleotides were synthesized by the beta-cyanoethyl phosphoramidite method according to protocols provided by the manufacturer of the

DNA-synthesizer (Model 380A, Applied Biosystems (Foster

City, CA) .

A mammalian expression shuttle vector was designed to allow the construction of the promoter-reporter gene fusions to be used in high-throughput screens to identify transcriptionally modulating chemicals. Features of the plasmid are shown in Figure 1. The shuttle vector was constructed in several steps.

The firefly luciferase gene was removed from the plant expression plasmid pD0432 (52) (Figure 2) as a 1.9 kb BamHI fragment and cloned into the BamHI site of pSVL

(Pharmacia, Piscataway, NJ) , a mammalian expression vector containing the SV40 promoter. The resulting plasmid (pSVLuci; Figure 3) was digested with Xhol and Sail to produce a 2.4 kb fragment containing the luciferase coding sequences and the SV40 late polyadenylation site. This fragment was inserted into the Xhol site of pMSG (Pharmacia, Piscataway, NJ) , a eucaryotic expression vector containing the MMTV promoter. The resulting MMTV promoter-luciferase fusion plasmid (pMLuci; Figure 4) was used to transfect NIH/3T3 cells as described below. Similar constructs can be made using luciferase vectors from Clontech (Palo Alto, CA) .

Six oligonucleotides (pUV-1 through pUV-6) were synthesized (see Figure 5 for sequence) (SEQ ID NO: 1-6) . The sequences of pUV-1, pUV-2 and pUV-3 correspond to a multicloning site, the beta-globin leader sequence and the first 53 bases of the firefly luciferase coding region. The sequences of pUV-4, pUV-5 and pUV-6 are complementary to the first three oligonucleotides. The pUV oligonucleotides were annealed, ligated and inserted into the Sall/EcoRI sites of pTZ18R (Pharmacia, Piscataway NJ) (Figure 6) . The resulting vector was then digested with Smal/PvuII and the oligonucleotide containing fragment was cloned into the pBluescriptKS(+) plasmid (Stratagene, La Jolla, CA) , previously digested with PvuII, to yield pUVOOl (Figure 6) . Several fragments were ligated into pUVOOl to create pUVlOO. The luciferase coding sequences (except first 53 bases) and polyadenylation site were obtained as a 1.8 kilobase Xbal/Xmal fragment from pMLuci (section B-l, Figure 4) . The SV40 early splice site and the SV40 late polyadenylation site were obtained as an 871 bp Xmal/BamHI fragment from pMSG (Pharmacia, Piscataway NJ, Figure 7) . Both DNA fragments were cloned into pUVOOl, previously digested with Xbal/BamHI to yield pUVlOO (Figure 7) .

A 476 b fragment containing a dimeric SV40 polyadenylation site was then cloned into the Bell site of pUVlOO (Figure 8) . To do this, a 238 bp BclI/BamHI fragment was obtained from SV40 genomic DNA (BRL) , ligated, digested with BclI/BamHI, gel isolated, and inserted into pUVlOO, resulting in the vector pUV100-3 (Figure 8) . Linkers containing one Sfil and one NotI restriction site were then cloned into the PvuII/BamHI sites of pUV100-3. Two sets of linkers were synthesized containing the Sfil site in opposite orientations (oligonucleotides D-linkl and D-link2 and oligonucleotides R-linkl and R-link2) . The sequences of the oligonucleotides (SEQ ID NO: 7-10) were:

5' GATCGGCCCCTAGGGCCGCGGCCGCAT 3¹ (D-linkl) 5' ATGCGGCCGCGGCCCTAGGGGCC 3' (D-link2) 5' GATCGGCCCTAGGGGCGGCCGCAT 3' (R-linkl) 5' ATGCGGCCGCGGCCCCCTAGGGCC 3' (R-link2)

The plasmid that contains D-link oligonucleotides was named pUV102 and the plasmid that contains R-link oligonucleotides was named pUV103 (Figure 9) .

The neomycin resistance gene (neo) was then placed under control of the Herpes Simplex Virus thymidine kinase (HSV-TK) promoter to generate a resistance cassette which is free of known enhancer sequences. To do this the HSV-TK promoter was synthesized using four oligonucleotides (Figure 10) (SEQ ID NO: 11-14) designed according to published sequence information (53) , and including an Sfil restriction site 5' of the HSV-TK sequences. These oligonucleotides were phosphorylated, annealed, ligated and inserted into pUVlOO digested previously with Hindlll/Nhel, generating the vector pTKL 100 (Figure 11) . After verifying the HSV-TK sequence, the about 3.5 kb Nhel/Smal fragment was isolated from pTKLlOO, and the about 0.9 kb BstBI/Bglll fragment containing the neo coding region was isolated from pRSVNEO (54) . These two fragments were filled in with Klenow polymerase and ligated to form pTKNEO (Figure 12) . An additional Sfil site was then inserted 3* of the neo gene by isolating the about 1.8 kb Sfil/BamHI and about 2.6 kb Sfil/PVUII fragments of pTKNEO and conducting a three way ligation along with a synthesized Sfil oligonucleotide generating pTKNE02 (Figure 13) (SEQ ID NO: 15-16) . The HSV-TK/NEO vector containing an optimized Kozac sequence was also utilized (Stratagene, La Jolla, CA, pMClNEO) . An additional vector was constructed by replacing the about 0.9 kb EcoRI/Sall fragment of pTKNE02 with the about 0.9 kb EcoRI/Sall fragment from pMClNEO. This vector was termed pTKNE03. (Figure 14). The Sfil fragment of pTKNEO3, containing the TK promoter and the neomycin resistance gene, was cloned into the Sfil site of pUV102 to yield pUV106.

C. SV40 reporter vector

A 352 bp fragment containing the SV40 early promoter (55) was purified and ligated into pUV102 which had previously been digested with NotI (the ends rendered blunt by treatment with Klenow fragment) and HinDIII, generating pUVSV. A 666 bp Nael-Xbal fragment from pUVSV containing the SV40 promoter and a portion of the luciferase open reading frame was purified by preparative gel electrophoresis, and ligated int pUV106 which had previously been digested with SnaBI and Xbal, generating pSV106 (Figure 15) , the vector used to transfeet the SV40 reporter cell lines.

D. CMV reporter vector

A 580 bp cytomegalovirus genomic fragment containing the immediate early promoters and enhancers (56) was ligated into pUVlOO previously digested with NotI and Nhel and rendered blunt ended by treatment with Klenow fragment, generating pUVCM. An 888 bp Nael-Xbal fragment from pUVCM, including the CMV promoter and enhancers plus a portion of the luciferase coding region, was purified by preparative gel electrophoresis and ligated into pUV106 which had previously been digested with SnaBI and Xbal, generating pCMV106 (Figure 16) , the vector used to transfect the CMV reporter cell lines.

E. neu fc-ErbB2ϊ reporter vector (a specificity control^

Oligonucleotide probes based on the published sequence of the 5' region of the c-ErbB2 gene were synthesized and used to screen a human leukocyte genomic library (Clontech Inc.). A 3.2 kb Bgll fragment from a positive plaque, containing the upstream regulatory elements, the 5' untranslated leader and exon 1 was then subcloned into pBluscriptKS(+) , generating pNEUOOl. A 1.8 kb HincII- Ncol fragment from pNEUOOl, containing the upstream regulatory elements and most of the 5' untranslated leader was purified by preparative gel electrophoresis and ligated into pUV103 previously digested with SnaBI and Ncol, generating pNEU002. Two oligonucleotides were synthesized (SEQ ID NO: 17-18) : 5•-CATGGGGCCGGAGCCGCAGTGAGCAC-3' and 5'-CATGGTGCTCACTGCGGCTCCGGCCC-3'

These oligonucleotides were annealed to one another, phosphorylated and ligated into Ncol digested pNEU002, generating pNEU103. The synthetic linker fuses the DNA coding for the neu 5' untranslated leader to the luciferase open reading frame such that the AUG utilized for translation initiation of the neu gene forms the first codon of the luciferase gene. The Seal-Xbal fragment of pNEU103, containing vector sequences, the upstream regulatory elements, the 5'untranslated leader and a portion of the luciferase open reading frame, was purified by preparative gel electrophoresis and ligated into pUV106 which had previously been digested with Seal and Xbal, generating pNEU106 (Figure 17) . Linearized pNEU106 was used in the transfections to generate the neu-luciferase reporter cell lines as described below.

F. K-ras reporter vector fa specificity control)

Oligonucleotides based on the published K-ras sequence were used to isolate two genomic clones by standard methods from a human leukocyte library (Clontech) . DNA from these two phages was subcloned into pBluscriptKS(+) (Stratagene) generating pKS4 and pKSll.

A 4 kb XhoI-StuI fragment of pKSll, containing most of intron 1 and exon 1 up to a point 11 bases 5* of the point of translation initiation, was isolated by preparative gel electrophoresis and ligated into Xhol- StuI digested pGEM7Zf (Promega) which had been previously modified by inserting an adaptor the Apal and Xhol sites in the original vector. This adaptor comprised of two oligonucleotides (SEQ ID NO: 19-20)

(5•-TCGAGATCTGAGGCCTGCTGACCATGGGGGCC-3• and 5'- CCCATGGTCAGCAGGCCTCAGATC-3') annealed to one another and was used to allow the proper alignment of the K-ras ATG initiator codon with the luciferase ORF in the final construct (below) . The resulting plasmid was designated PGEM715.

A 3 kb HinDIII-XhoI fragment from pKS4, comprising 2.2 kb of K-ras untranscribed upstream DNA and sequences coding for exon 0 and part of intron 1 was purified by preparative gel electrophoresis and ligated into pGEM715 which ad been previously digested with HinDIII and Xhol to generate pGEM7.

A 7.7 kb HinDIII-Ncol fragment of pGEM7, comprising 2.2 kb of K-ras upstream regulatory elements, exon 0, intron 1, and part of exon 1 (to the ATG at the Ncol site) , was purified by preparative gel electrophoresis and ligated int pUV102 which had previously been digested with HinDIII and Ncol to generate pKRAS102. The TK-Neo fragment from pTKNeo3 was then ligated into the Sfil site of pKRAS102 to generate pKRAS106 (Figure 18) , the vector used for transfections to generate the stable K-ras reporter cell lines.

To assay for luciferase expression in transient expression assays in the various transfected clones, cells were incubated with various transcriptional inducers in serum free defined media, washed 3 times with Dulbecco's phosphate-buffered saline (D-PBS, Gibco) and lysed in Lysis Buffer 1 (50 mM Tris acetate pH 7.9, 1 mM EDTA, 10 mM magnesium acetate, 1 mg/ml bovine serum albumin [BSA], 0.5% Brij 58, 2 mM ATP, 100 mM dithiothreitol [DTT]). All reagents were obtained from Sigma except for DTT which was from Boehringer Mannheim. After lysis, cell debris was sedi ented by brief centrifugation, and 950 μl of supernatant extract were added to a glass scintillation vial. Samples were counted individually in an LKB (Gaithersburg, MD) scintillation counter on a setting which allows measurement of individual photons by switching off the coincidence circuit. The reaction was started by addition of 50 μl of 2 mM luciferin (Sigma, St. Louis, MO or Boehringer Mannheim, Indianapolis IN) in Buffer B (Buffer B-Lysis Buffer 1 without Brij 58, ATP and DTT) to the 950 μl of lysate. Measurement was started 20 seconds after luciferin addition and continued for 1 minute. Results were normalized to protein concentration using the Bradford protein assay (BioRad, Richmond CA) or to cell numbers using Trypan Blue (Sigma) exclusion counting in a hemocytometer. H. Transfection

Cell were transfected by one of three methods, following manufacturer's instructions; by calcium phosphate precipitation (Pharmacia) , lipofection (Life Technologies Inc.) or electroporation (BioRad). In most cases, 25-75 ug of plasmid DNA, linearized by a single restriction endonuclease cut within the vector sequences, was electroporated into approximately 5 million cells. When co-transfection of a separate neomycin resistant plasmid was employed the molar ratio of luciferase fusion plasmid to neomycin resistant plasmid was either 10:1 or 20:1. Neomycin resistant clones were selected by growth in media containing G418 (Geneticin, Gibco) .

I. Isolation of Single Cell Clones Containing Various Promoter-Luciferase Fusion Constructs

1. pMluci (MMTV cell line)

pMluci and pSV2Neo, an antibiotic resistance plasmid (112) , were co-transfected into NIH/3T3 mouse fibroblast cells using the calcium phosphate precipitation method (103) with a commercially available kit (Pharmacia, Piscataway NJ) . Two days later, cells were transferred to media containing 0.4 mg/ml G 18 and were grown for an additional 10-14 days. G418-resistant clones were isolated by standard methods. Once sufficient cell numbers were obtained, clones were analyzed based on several criteria: constitutive luciferase production, induction of luciferase expression by dexamethasone (1 μm, Sigma, St. Louis, MO) , satisfactory attachment to microtiter plates used in the high-throughput screen and acceptable standard deviation in multiple luciferase expression assays (see below for assay protocol) . This analysis was carried out using the luciferase assay conditions described above. Of the clones which satisfied the above criteria for the high throughput screen, one clone, M10, was selected for use.

2. pSV106

Hep3B hepatocellular carcinoma cells were transfected by electroporation with 75 micrograms of pSV106 which had been linearized by a single Seal cut within the vector backbone. Neomycin resistant colonies were isolated and tested for luciferase activity. Luciferase positive, neomycin resistant clones were subjected to Southern blot analysis (see below) . The best clone, producing the most luciferase activity from a single, correctly integrated vector was selected for use as the SV40 reporter cell line in the high throughput screen (this clone was designated SV12) .

3. pCM106

Hep3B hepatocellular carcinoma cells were transfected by electroporation with 75 micrograms of pCM106 which had been linearized by a single Seal cut within the vector backbone. Neomycin resistant colonies were isolated and tested for luciferase activity. Luciferase positive, neomycin resistant clones were subjected to Southern blot analysis (see below) . The best clone, producing the most luciferase activity from a single, correctly integrated vector was selected for use as the CMV reporter cell line in the high throughput screen (this clone was designated CM1) .

4. pNEU106

75 micrograms of the pNEU106 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into HTB30 human breast carcinoma cells. Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below) . The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone N-2).

5. K-ras (pKRAS106) into SW480

75 micrograms of the pKRAS106 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into SW480 human colon carcinoma cells. Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below) . The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone K-2) .

J. Construction of a Yeast Expression Vector Plasmid pHZlδ (97,98) contains 2μ DNA for propagation in S. cerevisiae. the yeast promoter eye 1, which is compatible with expression in yeast cells, and the URA 3 gene for selection. The plasmid was linearized with BamHI, the ends were filled-in using deoxynucleotides and E.coli DNA polymerase Klenow fragment, and then the plasmid was digested with Aat II. A 4.1 kb fragment containing the cycl promoter, URA3 and 2μ genes was separated by agarose gel electrophoresis and subsequently purified by electroelution onto ion-exchange paper (Whatman, DE81) . Plasmid pBR322 was treated with endonucleases Aat II and Pvu II and a 2.2 kb fragment containing the plasmid's origin of replication and the amp^R gene was isolated by agarose gel electrophoresis and eluted onto DEδl paper.

The 2.2 kb pBR322 and 4.1 kb pHZlδ fragments were ligated using T4 DNA ligase according to standard procedures (94). The resulting 6.3 kb vector pHZBR was digested with BamHI for subsequent insertion of the luciferase coding sequence downstream of the cycl promoter.

An Neo I - Sal I fragment of pUV102 containing the luciferase gene starting at the second ATG, was made blunt-ended by filling in and ligated into the filled-in BamHI site of pHZBR. Clones of the correct orientation were identified via restriction mapping to yield plasmid pHZluci24. This plasmid was used to transform S.cerevisiae strain DB745.

K. Transformation of Yeast Cells S.cerevisiae DB745 were made competent according to published methods (99) . One and 4μg of either pHZluci24 or pHZlδ (transfection control) were added to the competent cells and incubated at 30^*C for 30 minutes. Lithium acetate-PEG was mixed gently with the cells and allowed to incubate for another 45 minutes at which time the cells were shifted to 42*C for 5 minutes. The cells were spread onto uracil(-) plates and incubated at 30*C for several days. Cell colonies were picked, grown to saturation in YPD media and analyzed for luciferase activity. Stock cultures were made from positive clones, and each was subsequently analyzed for suitability for the 96-well plate high-throughput assay.

L. Yeast Luciferase Bioluminescence Assay in Microtiter Plates

Expression of the firefly luciferase gene was determined by measuring luminescence in the presence of substrates essentially as described above.

Formatting the assay to a 96-well plate required optimization of cell lysis conditions, substrate concentrations and the reaction measurement time. Initial experiments were conducted using purified luciferase and substrates. Bioluminescence was measured either by scintillation counting or in a Dynatech ML1000 luminometer and the reaction conditions were optimized to provide the highest signal-to-noise ratio. Cell lysis conditions were optimized to result in complete lysis of the cells yet not interfere with the luciferase reaction. The detergent Brij 58 fulfilled these requirements. In the current format the 96-well assay was carried out as follows:

1-2 x 10⁴ yeast cells were seeded into 96-well plates which have been custom designed to allow filtration of the media while retaining the cells, and which are opaque to permit analysis using a luminometer (Millipore) . After the media was removed from the cells by suction, lOOμl of lysis buffer (50 mM Tris/acetate pH 7.9, l mM EDTA, 10 mM Mg-acetate, 0.5% Brij 5δ, 100 mM DTT and 4 mM ATP, 0.2 mM Luciferin, δOO U/ml lyticase) was added and the plates were incubated at room temperature for 10 minutes. Bioluminescence was monitored in a Dynatech ML1000 luminometer.

M. Southern blotting

To monitor correct and complete stable integration of transfected promoter/reporter constructs, stably transfected cell clones were subjected to Southern blot analysis (57) . Genomic DNA was prepared of each clone to be tested and restriction-cut with Dra I. After electrophoresis, transfer to nylon filters and immobilization by UV irradiation using a Stratalinker UV device (Stratagene, La Jolla, California) , integrated promoter/lueiferase fusion constructs were visualized by probing with radioactively labelled Xbal-EcoRI fragments of the luciferase coding region. Probes were labelled using the random primer method (5δ) . Since Dra I cuts in the SV40 polyadenylation sites located in the OSI mammalian expression shuttle vector just upstream the inserted promoter sequences as well as downstream of the luciferase coding region, but not in any of the promoter sequences used for generating stably transfected cell clones, a single fragment should be visualized by the probe used. The size of that fragment should be characteristic for each of the three promoter sequences analyzed.

N. High-Throughput fHTP) Screening of Mammalian Reporter Cells

Cell plating: Dynatech Microliter 96 well plates were custom pretreated for cell attachment by Dynatech Laboratories, Inc. (Chantilly, VA) . Alternatively, the 96 well plates were treated with 50 μl per well of human fibronectin (hFN, 15 μg/ml in PBS, Collaborative Research, Bedford, MA) overnight at 37°C. hFN-treated plates were washed with PBS using an Ultrawash 2 Microplate Washer (Dynatech Labs) , to remove excess hFN prior to cell plating. M10 and G21 cells maintained in their respective serum media (with 0.2 mg/ml G418) were washed with PBS, harvested by trypsinization, and counted using a hemocytometer and the Trypan Blue exclusion method according to protocols provided by Sigma, St. Louis, MO Chemical Company. Cells were then diluted into serum free defined media (with 0.2 mg/ml G41δ) , and 0.2 ml of cell suspension per well was plated onto Dynatech treated plates (G21) or hFN-treated plates (M10) using a Cetus Pro/Pette (Cetus, Emeryville CA) . Plates were incubated overnight at 37oC in a humidified 5% C02 atmosphere.

Addition of Chemicals to Cells: Chemicals from the Oncogene Science file were dissolved in DMSO at concentrations of 3-30 mg/ml. A liquid handling laboratory work station (RSP 5052, Tecan U.S. Chapel Hill, NC) was used to dilute the chemicals (three dilutions; 5 fold, 110 fold, and 726 fold). 10 ul of each dilution were added to each of quadruplicate samples of cells contained in the wells of 96-well Dynatech Microliter Plates. Cell plates were then shaken on a microplate shaker (Dynatech, medium setting, 30 sec.) and incubated for 6 hours at 37oC, 5% C02.

Bioluminescence Assay: After incubation with OSI-file chemicals, cell plates were washed 3 times with PBS using an Ultrawash 2 Microplate Washer (Dynatech Labs) and 75 ul of Lysis Buffer 2 were added to each well (Lysis Buffer 2 is the same as Lysis buffer 1 except that the ATP and DTT concentrations were changed to 2.67 mM and 133 mM, respectively) . Bioluminescence was initiated by the addition of 25 ul 0.4 μm Luciferin in Buffer B to each well, and was measured in a Dynatech ML 1000 luminometer following a 1 minute incubation at room temperature. Data were captured and analyzed using Lotus-Measure (Lotus) software.

More recently the cell lysis buffer was modified to also contain the luciferin. Therefore, lysis of cells and the bioluminescence reaction begin simultaneously and the production of bioluminescent light reaches a maximum at about 5 min. The level of light output declines by about 20% within further 30 min. For better lysis buffer stability bovine serum albumin has been omitted. This improved lysis buffer has been shown to remain fully functional for at least 12 hours, when kept on ice and protected from direct light.

Also, more recently, a fully automated device as described in U.S. patent application #3S2,4δ3 was used to incubate luciferase reporter cells in 96-well microtiter plates, transfer chemicals and known transcriptional modulators to the cells, incubate cells with the chemicals, remove the chemicals by washing with PBS, add lysis buffer to the cells and measure the bioluminescence produced.

An additional recent improvement is the ability to screen suspension cell lines in the automated high through-put mode using custom manufactured, opaque, 96 well filter plates (Millititer Plates, Millipore Corp.). This involved the manufacture of a robotic filtration and washing station.

RESULTS

A. Validation of the Reporter Cell Lines

1.Southern Blots

Cell clones transfected with the OSI mammalian expression shuttle vector fused to the CMV, SV40 and MMTV promoters were analyzed for correct and complete integration of the promoter/lueiferase constructs by Southern blotting. Genomic DNA was prepared of each clone to be tested and restriction-cut with Dra I. Since Dra I cuts in the SV40 polyadenylation sites located in the OSI mammalian expression shuttle vector just upstream the inserted promoter sequences as well as downstream of the luciferase coding region, but not in any of the 3 promoter sequences used for generating stably transfected cell clones, a single fragment should be visualized on a blot if an appropriate probe is used. The size of that fragment should be characteristic for each of the three promoter sequences analyzed. The Southern blots were hybridized with either an end-labelled luciferase- specific 40 nucleotide oligomer (OSI, ON227) , or a random primer labelled DNA fragment corresponding to the 5' third of the luciferase open reading frame (an Xbal-EcoRI fragments of pUV106) . Figure 19 and 20 show the resulting autoradiograms. All but one of the luciferase expressing clones show the correct characteristic fragment. One of the clones has an extra unexpected fragment that may be the result of two insertion events, one resulting in an intact vector and the other rearranged. We selected a single, correctly integrated clone from each transfection for use in the high throughput screen.

2. Inducer Experiments

Cell clones with correctly integrated promoter-reporter constructs are routinely analyzed for correct reaction to known transcriptional inducers. In the case of the MMTV reporter cell line, M10, the response to steroid hormones is well documented. M10 cells were incubated with several different steroids for 6 hours. The cells were then harvested and assayed for luciferase as described above. The data are shown graphically in figure 21. Compared to an untreated control, the MMTV LTR was induced over 10 fold by the steroids known to have active steroid receptors in this cell line. The concentrations of steroids required for maximal induction of luciferase expression were approximately the same as those reported in the literature.

B. In vivo signal half-life of the luciferase reporter system

When screening for inhibitors rather than inducers of transcription, the half-life of the reporter molecule becomes a crucial parameter in determining the minimal incubation time that would be necessary to allow enough decay of reporter molecules so that the inhibition of their synthesis became visible. The CMV reporter cell line was therefore tested for the time dependency of luciferase activity after treatment of the cells with Actinomycin D, an inhibitor of transcription. This experiment measured the combined half-life of luciferase mRNA and of the luciferase protein and compares the rate of signal decay of the CMV reporter to three other well characterized genes; H-ras, K-ras and c-erbB2. Cells derived from clones CMl (CMV) , K-2 (K-ras) , H21 (H- ras) and N-2 (c-erbB2) were seeded into 96-well microtiter plates and incubated overnight. At time 0, Actinomycin D (25 μg/ml) was added. At the times indicated in Figure 22, cells were washed with PBS and luciferase activity of Actinomycin-treated cells determined as described in Materials and Methods. The signal from the treated cells was compared to the luciferase activity of untreated controls. The logarithm of the treated/untreated ratio was plotted versus time, this data is shown in figure 22. The calculated half- life of the signal from each of the four cell lines is shown in table 1. The half-lives were found to range 5 from about 3 to 10 hours indicating that a 24 hour incubation with a 100% efficient inhibitor of transcription would be sufficient to reduce luciferase levels to 6% of the control in the tested cell lines.

TABLE 1 Half-life Determinations

Signal Half-life 6.5 hours 6.5 hours 10 hours

3 hours

C. Luciferase expression assay in veast

The yeast expression plasmid carrying the luciferase gene under control of a yeast promoter was transfected into 5_. appropriate yeast cells. Using these cells as a model system, a format for a 96-well luciferase expression assay in yeast cells was developed as described in more detail in Materials and Methods.

Luciferase activity was assayed essentially as described 0 by De Wet et al. (1967) using a modified single step lysis-assay buffer which contained Lyticase, to break down the yeast cell wall, and the detergent Brij 58, to help effect lysis. Cells were grown in custom made, 96 well microtiter plates equipped with membrane-type filter bottoms. These plates retain liquid until vacuum is applied. Medium was removed by filtration, and the cells were washed with PBS. The lysis/assay buffer was added and resulting luminescence measured in a luminometer. 5. Representative data are shown in figure 23. This simple assay is reliable and sensitive. Small changes in luciferase expression from as few as 5,000 yeast cells was easily detected.

0 G. Quality Assurance Analysis

A number of quality assurance criteria are routinely assessed during the course of high throughput screens. Data from QA analysis of a portion of Screen IV are shown 5 in Figures 24-27. Figure 24 shows an analysis of the consistency of the luciferase signal on various areas of each plate. The ratios of negative control values from three different areas within each plate are calculated and plotted versus plate number. The expected value is 0 1.0. Values greater than 1.5 or less than 0.4 indicate uneven signal generation across the plate. In this example 240 plates, representing 1440 compounds, tested against three cell lines, are shown. The coefficient of variance for the 12 negative control values from each of the same 240 plates are represented by the data shown in Figure 25. Values less than 20% are considered acceptable. Similar data for the 12 positive control values of the same plates are shown in figure 26. Figure 27 shows the transcription induction ratio (TIR) for the positive controls of one cell line represented in the same set of 240 plates. The TIR is the ratio of the experimental values to the untreated controls. In this 7β case the cell line is the K-ras reporter and the positive control is Actinomycin D a potent general inhibitor of transcription. Three values are shown for each plot, representing three different concentrations of 5_. Actinomycin D. The expected value for such an analysis depends on the half life of the signal and the incubation time (here 24 hours) , but for this combination, typical values range from 0.4 to 0.3 fold.

10 C. High-Throuσhput Screen

1. Screen I

In an initial high throughput screen (Screen I) , 500 15 compounds, consisting of 96 fermentation broths and 404 pure chemicals, were tested against a G-CSF (G1002) reporter cell line and an MMTV reporter control cell line. The number of lead compounds identified in this screen are shown in table 2.

20

Table 2

SUMMARY OF HIGH THROUGHPUT SCREEN I

Number (%) of Chemicals Which Activate Expression:

2-3X 3-5X 5-7X 7-10X >10X Total

G-CSF 0 2 0 0 0 2

(0%) (0.4%) (0%) (0%) (0%) (0.4%)

MMTV 2 2 3 1 1 9

(0.4%) (0.4%) (0.6%) (0.2%) (0.2%) (1.8%)

CYTOTOXIC COMPOUNDS: 5 (1%) 2 . Screen II

An additional high throughput screen assayed aqueous clarified supernatants derived from individual Actinomyces colonies prepared by standard methods, as well as corresponding methanol extracts. These two sample types were subjected at 1:10 initial dilution to a fully automated, robotic High-Throughput luciferase assay using the system described in U.S. patent application #382,483. Out of 356 samples tested for modulation of the G-CSF, GM-CSF (both as specificity controls) and the MMTV promoters, 25 samples scored as positives, 7 of which were promoter-specific. A summary of the obtained results is contained in Tables 3 and 4.

TABLE 3

PROMOTER/LUCIFERASE PILOT SCREEN

OF FERMENTATION BROTH SAMPLES

LEAD SAMPLES

Fermentation Broths Promoter / TIR Number of Hits

G GM MTV Inducers Inhibitors

Methanol extracts: >2.0 0

176 total <0.6 >0.8 .0.8 0

>2.0 1

>0.8 <0.6 >0.8 0

>2.5 7 >0.δ >0.δ <0.6 0

Aqueous fractions: >2.0 7 lδO total <0.6 >0.β >0.δ 0

>1.8 1

>0.8 <0.6 >0.δ 1

>2.4 β

>0.δ >0.δ <0.6 0

TABLE 4

Promoter/Luciferase Pilot Screen of Fermentation Broth «»m ^•.«».«

Promoter-Specific Leads

Fermentation Broths Promoter/TIR Number of Specific Leads

G GM MTV Inducers Inhibitors

Menthanol extracts: >2.0 <1.8 <1.8 0

176 total >0.6 >0.δ >0.δ 0

<1.8 >2.0 <1.8 0

>0.8 <0.6 >0.8 0

<1.8 <l.β >2.5 4

>0.δ >0.β <0.6 0

Aqueous fractions: >2.0 <1.8 <l.β 0

180 total <0.6 >0.8 >0.8 0

<l,δ >l.β <1.8 0

>0.8 <0.6 >0.8 1

<1.8 <1.8 >2.4 2

>0.δ >0.β <0.6 0

3 . Screen III

Table 5 shows a summary of the results of a one-week, high-throughput screen of 2,000 chemicals to identify those chemicals specifically stimulating or inhibiting transcription from the MMTV, G-CSF or human Growth Hormone (the last two as controls for specificity) promoters. This screen as with the other screens, concurrently tested chemicals at three concentrations on quadruplicate samples of the M10, 532 and G21 cell lines. A minimum stimulation of one promoter, to the degree indicated, and less than 50% activation of the other promoter was required for a chemical to be considered a selective activator. A minimum inhibition of 3 fold of one promoter and less than 20% inhibition of the other promoter was required for a chemical to be considered a selective inhibitor. Chemicals which scored as positive in this screen are identified in Table 6. Figure 28 illustrates the transcriptional stimulation and Figure 29 the transcriptional inhibition observed with some of the lead chemicals.

TABLE 5

SUMMARY OF HIGH-THROUGHPUT SCREEN III

Number (%) of Chemicals Which Activate Expression:

2-3X 3-5X 5-7X 7-10X >10X Total

10 3

(0.5%) (0.15%)

(0.10%) (1.9%)

MMTV 15 1 0 1 1 8L (0.7%) (0.05%) (0%) (0.05%)

(0.05%) (0.9%)

GH NA NA 12 5 6

23

(0.6%) (0.03%)

(0.03%) (1.14%)

64

TABLE 5 CONT ' D.

SUMMARY OF HIGH-THROUGHPUT SCREEN III

Number (%) of Chemicals Which Inhibit Expression >3 Fold

Promoter

G-CSF 7 (0.35%)

MMTV 1 (0.05%) hGH 42 (2.1 %)

To determine the number of lead chemicals, which reproducibly score as positives in repeated luciferase assays, two types of experiments were conducted:

1) G-CSF lead chemicals #1760, #58, #1783, #1374 were subjected to 48 independent luciferase assays performed on the same day. Compounds #58, #1780 and #1374 scored as positives in every single one of these assays inducing luciferase expression between 2 and 28 fold (#5δ) , 20 and 80 fold (#1780) and 5 and 40 fold (#1374). Probably due to its relatively low induction of luciferase expression (1.5 to 8 fold), Compound #1783 scored as positive only in half of the 48 repeat assays.

2) All of the 18 lead chemicals inducing luciferase expression from the MMTV promoter were again subjected to luciferase assays: 10 chemicals (#453, #519, #562, #765, #828, #848, #1269, #1316, #1384 and #2148) (Table 6) again induced luciferase expression between 2.1 and 2.8 fold. Probably due to the relatively low induction level close to the background of the assay, the other eight lead chemicals did not repeat on that particular day. The most prominent lead chemical, #453 (13.3 fold induction in the original high-throughput assay) , was repeated in a total of 3 independent assays and consistently induced luciferase expression from the MMTV promoter between 10 and 35 fold. Replacing DMSO by methanol to dissolve the chemical did not affect its ability to activate the MMTV promoter.

TABLE 6

λ) SCREEN III TRANSCRIPTIONAL ACTIVATORS

FOLD INDUCTION RELATIVE TO SOLVENT CONTROL

Chemical# Chemical Name GCSF hGH MMTV

G-CSF:

40 3-Acetyl-2-6-Bis(tertiary butyl amino)-4-methyl-pyridine 58 1-Acetylimidazole

237 N-Carbethoxy-phthalimide

254 l-(2-Chloroethyl)piperidine

364 Melamine

473 1,3,5,-Triazine

542 5-Bromo-2*-deoxycytidine

543 5-Bromo-2'-deoxyuridine 878 Blueberry leaf extract 1025 Culvers Root extract

1234 4-Aminocinnamic Acid hydrochloride

1255 l-Bromo-3,5-dichlorobenzene

1374 4'-Amino-N-methylacetanilide

1375 4^•-(aminomethyl)benzene sulfonamide

hydrochloride

1376 2-Amino-5-Methyl benzene sulfonic 6.37 0.04 1.32 acid

1397 5-Amino-3-methylisothiazole 3.63 0.57 1.13 hydrochloride Table 6 (CONΓ.)

Chemical# Chemical Name

1482 2-Aminophenyl disulfide 1483 4-Aminophenyl disulfide 1521 2-Amino-6-purinethiol 1583 8-Bromoadenosine 1592 Bis(2,2,3,3,4,4,5,5,6,6,7,7,) dodecafluoroheptyl-(+)-camphorate

1783 Cupferron

1793 Cyanomethyl-N,N-dimethyl dithiocarbamate

1994 3-Bromobiphenyl

2001 l-Bromo-4-tertiary butyl benzene

2030 4-Bromo-2-fluoro-6-nitroanizol

2096 (+)-l-Bromo-3-Chloro-2methyl propane

2097 l-Bromo-5-Chloro pentane

2129 4-Chlorobenzyl Chloride

GROUP A:

378 7-0xo-7H-benzo[e]pyrimidine 4-carboxylic acid

423 Quinacrine dihydrochloride hydrate

427 Resazurin

836 Thionin

1776 Cresyl Violet Acetate

1904 9-Aminoacridine hydrochloride

Table 6 (CONT. i

sulfonic acid

1499 2-Amino-4-phenylthiazole 0.24 5.55 0.61 hydrobromide monohydrate

1550 2-Aminothiazole 0.04 5.44 0.87 86

Table 6 (CONT. )

Chemical# Chemical Name

1552 2-amino-2-thiazoline 1561 4-Amino-3,5,6-trichloropicolinic acid

1598 N,N'-Bis-[3-(4,5-dihydro-lH- imidizol-2-yl)phenyl] urea dipropanoate

1678 4,8-Bis(hydroxymethyl)-tricyclo [5,2,1,0²-⁶]decane

1740 5-carbethoxy-2-thiouracil

1747 N₆-carbobenzyloxy-L-lysine

1804 Cyclobutane carboxylic acid

1876 Alec Blue

1881 Alizarin Blue Black B

MMTV:

189 Bathocuproinedisulfonic Acid 1.06 1.47 2.80 disodium salt hydrate

453 2,2' :6•,2"-Terpyridine 519 b-Apo-8•-carotenal 562 Copaiva Balsam 629 Homoveratric acid 633 5-Iodorotic acid 765 Prednisolone-21-Acetate 828 2,4,5,4'-Tetrachlorodiphenylsulfide 848 Triamcinolone acetonide 944 Peanut

Table 6 .CONT. .

Chemical# Chemical Name

1269 5-Amino- ,6-dichloropyrimidine

1316 2-Aminofluorene 1318 2-Amino-9-fluorenone 1384 2-Amino-4'-methylbenzophenone 1573 5-Bromoacenapthene 2064 4-(Bromomethyl)-6,7-dimethoxy- coumarin

2148 2-chlorocyclohexanone 2191 Chloramphenicol

B) SCREEN III TRANSCRIPTIONAL INHIBITORS

FOLD INHIBITION RELATIVE TO SOLVENT

CONTROL

GCSF hGH V

Table 6 (CONT.)

FOLD INHIBITION

Chemical# Chemical Name GCSF hGH

hGH: 183 Auramine O

240 Carminic acid

443 Sulfamethazine

512 Amaranth

541 5-Bromo-4-Chloro-3-indoxyl- phosphate K-salt

556 Chromazurol S

561 Clove Oil

577 Na-Ne-Diacetyl-L-lysine

57δ Dibenzoyl-D-tartaric acid

630 Hydantoin-5-acetic acid

640 Kernechtrot

759 Piperidine

764 Prednisolone

875 Black Walnut extract

892 Colts Foot Leaves extract

893 Comfrey Leaf extract

920 Horehound Herb extract

921 Horsetail Grass extract

942 Pau D'Arco extract

970 Thyme extract

1591 1,2-Bis(di-p-tolylphosphino)-

ethane Table 6 (CONT.)

FOLD INHIBITION

Chemical# Chemical Name GCSF hGH MMTV

1604 2,4-Bis[5,6-bis(4-sulfophenyl)- 1,2,4-Triazine-3-yl)-pyridine, tetrasodium salt hydrate

1635 [ (15)-endo]-(-)-Borneol 1640 1,2-Bis(2-pyridyl)-ethylene 1641 2,3-Bis(2-pyridyl)-pyrazine

1648 2-[5,6-Bis(4-sulfophenyl)-1,2,4- triazine-3-yl]-4-(4-sulfophenyl)- pyridine, trisodium salt 0.66 7.69 1.00

1651 Bis(2,2,2-trifluoroethy1) (methocarbonyl- ethyl)- phosphonate

1655 2,5-Bis(trifluoro-methyl)benzoic acid

1703 3-Bromobenzonitrile 1704 4-Bromobenzonitrile 1705 4-Bromobenzophenone 1712 Calcein Blue 1720 (15)-(-)-Camphor 1764 7-(Carboxymethoxy)-4- Methylcoumarin

1770 Carminic acid 1771 L-Carnosine 1773 O-Cresolphthalein Complexone 1690 Alloxazine 2035 5-Bromofuroic acid

Table 6 -CONT..

FOLD INHIBITION

Chemical# Chemical Name GCSF hGH MMTV

2036 8-Bromoguanosine 0.58 4.34 0.81 2037 1-Bromohexadecane 0.51 4.00 0.50 MMTV: 2010 2-Bromo-4,6-dinitroaniline 0.80 0.63 3.57

4. Screen IV

Table 7 presents the data from one more high throughput screen. In this case the data are from a three week high throughput screen of 2334 compounds. Three cell lines were utilized; CMl (the CMV reporter cell line) . N-2

(the c-erbB2 reporter cell line) and K-2 (the K-ras reporter cell line) , both used as controls for specificity. Each compound was assayed at three concentrations in quadruplicate. Each microtiter plate included a negative control row (no added compound) and a positive control row (Actinomycin D at three concentrations) . The data are reported as TIR

(transcription induction ratio) which is the median of the samples quadruplicate values divided by the median of the negative control values. In this case, transcriptional inhibitors and inducers are sought, so the selection criteria for lead compounds is that the test promoter be inhibited to 0.4 or induced to 1.8X of the negative control while the other cell lines remain within 0.8X of the control value. During these three weeks 10 compounds scored positive for the specific inhibition of the K-ras promoter, 19 scored as leads for the inhibition of the c-erbB2 promoter and 39 compounds inhibited nonspecifically. Compounds scoring as leads in the primary screen are repeated and then subjected to secondary analysis such as effects on the minigene transfectant phenotypes (see above) .

TABLE 7

The Number (and %) of Compounds Scoring as Specific Repressors

Note: During the course of this screen 16 compounds (0.7%) specifically stimulated the transcriptional activity of the CMV promoter. TIR values for these compounds ranged from 2.0 to 15.5.

High-throughput screening of pure chemical or fermentation broth samples using a luciferase expression assay consistently leads to the discovery of lead samples with the potential to be developed into novel compounds for the modulation of promoters useful for the expression of recombinant proteins, or compounds useful for treating viral diseases. References

1. Goeddel, D.V. , (1990), In: Methods in Enzymology, Vol. 185, D.V. Goeddel, ed. , pg. 3.

2. Mocarski, E., (1986), Genes Dev. 2.(8) :926.

3. Molecular Cloning: A Laboratory Manual. (1989), J. Sambrook, E.F. Fritsch and T. Manaitis, eds, pg 165.

4. DNA Tumor Viruses. (1981), J. Tooze, ed.

5. McKnight, S. and Tjian, R. , (1986), Cell 46:795.

6. Kaufman, R.J. , (1990), In: Methods in Enzymology, Vol. 185, D.V. Goeddel, ed., pg. 487.

7. Smith, G.E., et al, (1983), J. Virol 4_6:584.

8. Smith, G.E., et al, (1983), Mol. Cell. Biol.2:2156.

9. Emr, S.D., (1990), In: Methods in Enzymology, Vol. 185 (Goeddel, D.V. , ed) , pg. 231.

10. Mylin, L.M. et al., (1990), In: Methods in Enzymology, Vol. 185 (Goeddel, D.V. , ed) , pg. 287.

11. Etcheverry, T., (1990), In: Methods in Enzymology, Vol. 165 (Goeddel, D.V., ed) , pg. 319.

12. Price, V.L. et al., (1990), In: Methods in Enzymology, Vol. 185 (Goeddel, D.V. , ed) , pg. 3δ.

13. Beier, D.R. et al., (1986), Mol. Cell. Biol. 5:1743.

14. Shuster, J. et al., (1986), Mol. Cell. Biol.1:1894.

15. Macaset, F.F. et al., (1975), Am.J.Clin. Pathol.63:859.

16. Mintz, L. et al., (1983), Amm. Intern. Med.99:326.

17. Richman, R.C. (1990), in Antiviral Agents and viral Diseases of Man. 3rd edition. Galasso, G.J., Whitley, R.J. and Merigan, T.C., eds. pg 301.

18. zur Hausen, H. (1985), Prog. Med. Virol.32:15.

19. Andiman, W. et al., (1983), J. Infect. Dis. 148:367 & Jones, J.F. et al., (1988), N. Engl. J. Med. 318:733.

20. De-The, G. (1982), in The Herpesvirus. Vol 1 (Roizman, B. , ed.) p25. 21. Leyeraz, S. et al., (1985), N.Engl. J.Med. 312:1296.

22. Tiollais, P. et al., (1985), Nature 317:489.

23. Shafritz, D.A. and Kew, M.C. (1981), Hepatology 1:1.

24. Richman, D.D. (1990), in Antiviral Agents and Viral Diseases of Man. 3rd edition (Galasso, G.J., Whiley, R.J. and Merigan, T.C., eds.) pg 581.

25. Cooper, D.A. et al., (1985), Lancet i:35.

26. Maniatis, T. et al., (1987), Science, 236:1237.

27. Yanofsky, C. and Crawford, I.P., (1987), The Tryptophan Operon. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (F.C. Neidhardt et al., eds.) Vol. 2, p. 1453.

28. Schlief, R. , (1987), The L-Arabinose Operon. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (F.C. Neidhardt et al., eds.) Vol. 2 , p. 1473.

29. McClure (1985) Ann. Rev. Biochem., 54:171.

30. Hoopes, B.C. and McClure, W.R. , (1987), Strategies in Regulation of Transcription Initiation. In Escherichia coli and Salmonella Typhimurium: Cellular and Molecular Biology (F.C. Neidhardt et al., eds.) Vol. 2, p. 1231.

31. Matthews, B.W. , (1987), Cro repressor structure and its interaction with DNA. In DNA: Protein Interactions and Gene Regulation (E.B. Thompson and J. Papaconstantinou, eds.) University of Texas Press, Austin.

32. Schlief, R. (1988), Science, 241:1182.

33. Evans, R.M. and Hollenberg, S.M. (1988), Cell, 52:1.

34. Landschulz, W.H. et al., (1988), Science, 240:1759.

35. Levine, M. and Hoey, T. (1988), Cell, 55:537.

36. Krainer, A.R. and Maniatis, T. (1988) RNA splicing. In Transcription and Splicing (Hames, B.D. and Glover, D.M., eds.) IRL Press, Washington, D.C., Vol . 1.

37. Proudfoot, N.J. and Whitelaw, E. (1986) Termination and 3' end processing of eukaryotic RNA. In Transcription and Splicing (Ha es, B.D. and Glover, D.M., eds.) ERL Press, Washington, D.C., Vol. l, p. 97.

38. La Thangue, N.B. and Rigby, P.W.J. (1988) Transacting protein factors and the regulation of eukaryotic transcription. In Transcription and Splicing (Hames, B.D. and Glover, D.M. , eds) IRL Press, Washington, D.C., Vol. 1.

39. Maniatis, T. et al., (1987), Science, 226:1237.

40. Yamamoto, K.R. (1985), Ann. Rev., Genet., 19:209.

41. Denison, M.S. et al., (1988), Proc. Natl. Acad. Sci. USA, 8.5:2528.

42. Hoeffler, J.P. et al., (1988), Science, 211:1430.

43. Angel, P. et al., (1987), Mol. Cell. Biol., 2:2256.

44. Angel, P. et al., (1987), Cell, 49_:729.

45. Edelman, A.M. et al., (1987) Protein Serine/Threonine Kinases Ann. Rev. 56:567-613.

46. 'Yamamoto, K.K. et al., (198δ) , Nature, 334:494.

47. De Wet, J.R. et al., (1985), Proc. Natl. Acad. Sci. USA, 82:7670.

48. Engebrecht, J.M. et al., (1985), Science, 227:1345.

49. Bottenstein, J. et al., (1979), Methods of Enzymology, 58:94.

50. Hayashi, I. et al., (1978), In Vitro, 14:23.

51. Maniatis, T. et al., (1987), Science, 236:1237.

52. Ow, D.W. et al., (1987), Science 234:856-859.

53. McKnight, S.L. (1982), Cell, 31:355.

54. Gorman, C., (1985), Vectors used in mammalian cell expression. In DNA Cloning. Vol. II (D.M. Glover, ed) . IRL Press, Washington, D.C.

55. Kadesch, T. and Berg, P. (1986), Mol. Cell. Biol. 6:2593-2601. 56. Boshart, M. et al., (1985), Cell 11:521-530.

57. Southern, E. (1980), Methods in Enzymology, 69:152.

58. Feinberg, A. and Vogelstein (1984), Anal, Biochem. 117:266.

59. M. Butler (1988), Processes with Animal Cell and Tissue Culture," in Biotechnolog . Vol 6b, Chpt 10 (ed H.-J. Rehm) VCH press, Germany.

60. P.F. Heinstein and A. Emery (1988) "Processes with Plant Cell Cultures" In Biotechnology. Vol 6b, Chpt. 9 (ed H.-J. Rehm) VCH Press, Germany.

61. A.E. Torma (1988) "Biosensors and *Bioelectronics'" In Biotechnology. Vol 6b, Chpt 12 (ed H.-J. Rehm) VCH press, Germany.

62. S. Kunst and K. Mudrack (1988) "Microbial Elimination of Nitrogen and Phosphorus" In Biotechnology. Vol 6b, Chpt 14 (ed H.-J. Rehm) VCH press, Germany.

63. E.-J. Nyns (1986) "Biomethanation Processes" In Biotechnology. Vol 8, Chpt 5 (ed W. Schonborn) VCH press, Germany.

64. T. Leisinger and W. Brunner (1986) "Poorly Degradable Substances" In Biotechnology. Vol 8, Chpt 14 (ed W. Schonborn) VCH press, Germany.

65. C.K.A. Martin (1984) "Sterols" In Biotechnology. Vol 6a, Chpt. 3 (ed K. Kieslich) VCH Press, Germany.

66. L.L. Smith (1984) "Steroids" In Biotechnology. Vol 6a, Chpt. 2 (ed K. Kieslich) VCH Press, Germany.

67. A. Crueger and W. Crueger (1984) "Carbohydrates" In Biotechnology. Vol 6a, Chpt. 11 (ed K. Kieslich) VCH Press, Germany.

68. G. Schmidt-Kastner and P. Egerer (1984) "Amino Acids and Peptides" In Biotechnology. Vol 6a, Chpt. 10 (ed K. Kieslich) VCH Press, Germany.

69. V.A. Krasnobajew (1984) "Terpenoids" In Biotechnology. Vol 6a, Chpt. 4 (ed K. Kieslich) VCH Press, Germany.

70. A. Kergomard (1984) "Alicyclic and Heteroalicyclic Compounds" In Biotechnology. Vol 6a, Chpt. 5 (ed K. Kieslich) VCH Press, Germany.

71. O.K. Sebek (1984) "Antibiotics" In Biotechnology , Vol 6a, Chpt. 7 (ed K. Kieslich) VCH Press, Germany.

72. P.R. Wallnofer and G. Engelhardt (1984) "Aromatic and Heterocyclic Structures" In Biotechnology. Vol 6a, Chpt. 8 (ed K. Kieslich) VCH Press, Germany.

73. M. Buhler and J. Schindler (1984) "Aliphatic Hydrocarbons" In Biotechnology. Vol 6a, Chpt. 9 (ed K. Kieslich) VCH Press, Germany.

74. E. Oura (1983) "Biomass from Carbohydrates" In Biotechnology. Vol 3, Chpt. la (ed H. Dellweg) VCH Press, Germany.

75. A. Einsele (1983) "Biomass from Higher n-Alkanes" In Biotechnology. Vol 3, Chpt. lb (ed H. Dellweg) VCH Press, Germany.

76. U. Faust and P. Prave (1983) "Biomass from Methane and Methanol" In Biotechnology. Vol 3, Chpt. lc (ed H. Dellweg) VCH Press, Germany.

77. R.J. Quinlan and S.G. Lisansky (1983) "Microbial Insectidides" In Biotechnology. Vol 3, Chpt. 2e (ed H. Dellweg) VCH Press, Germany.

78. N. Kosaric, A. Wieczorek, G.P. Cosentino, R.J. Magee and J.E. Prenosil (1983) "Ethanol Fermentation" In Biotechnology. Vol 3, Chpt. 3a (ed H. Dellweg) VCH Press, Germany.

79. G.W. Barnard and D.O. Hall (1983) "Energy from Renewable Resources" In Biotechnology. Vol 3, Chpt. 4 (ed H. Dellweg) VCH Press, Germany.

80. M. Rohr, C.P. Kubicek and J. Kominek (1983) "Citric Acid" In Biotechnology. Vol 3, Chpt. 3d (ed H. Dellweg) VCH Press, Germany.

81. M. Rohr, C.P. Kubicek and J. Kominek (1983) "Gluconic Acid" In Biotechnology. Vol 3, Chpt. 3e (ed H. Dellweg) VCH Press, Germany.

82. K. Soda, H. Tanaka and N. Esaki (1983) "Amino Acids" In Biotechnology. Vol 3, Chpt. 3g (ed H. Dellweg) VCH Press, Germany.

83. J. Berdy (1986) "Further Antibiotics with Practical Application" In Biotechnology. Vol 4, Chpt. 15 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

84. G. Lancini (1986) "Ansamycins" In Biotechnology. Vol 4, Chpt. 14 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

85. Z. Hostalek and Z. Vanek (1986) "Tetracyclines" In Biotechnology. Vol 4, Chpt. 13 (eds H. Pape and H.- J. Rehm) VCH Press, Germany.

86. S. Omura and Y. Tanaka (1986) "Macrolide Antibiotics" In Biotechnology. Vol 4, Chpt. 12 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

87. S. Umezawa, S. Kondo and Y. Ito (1986) "Aminoglycoside Antibiotics" In Biotechnology. Vol 4, Chpt. 11 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

88. H. Kleinkauf and H. van Dohren (1986) "Peptide Antibiotics" In Biotechnology. Vol 4, Chpt. 10 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

89. A. Kuninaka (1986) "Nucleic Acids, Nucleotides, and Related Compounds" In Biotechnology. Vol 4, Chpt. 4 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

90. H. Kobel and J.-J. Sanglier (1986) "Ergot Alkaloids" In Biotechnology. Vol 4, Chpt. 18 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

91. T. Anke (1986) "Further Secondary Products of Biotechnological Interest" In Biotechnology. Vol 4, Chpt. 19 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

92. J. Berlin (1986) "Secondary Products from Plant Cell Cultures" In Biotechnology. Vol 4, Chpt. 20 (eds H. Pape and H.-J. Rehm) VCH Press, Germany.

93. S. Lafon-Lafourcade (1983) "Wine and Brandy" In Biotechnology, Vol 5, Chpt 2 (ed G. Reed) VCH press, Germany.

94. W.A. Hardwick (1983) "Beer" In Biotechnology. Vol 5, Chpt 3 (ed G. Reed) VCH press, Germany.

95. E.R. Vedamuthu and C. Washam (1983) "Cheese" In Biotechnology. Vol 5, Chpt 4 (ed G. Reed) VCH press, Germany.

96. V. Bottazzi (1983) "Other Fermented Dairy Products" In Biotechnology. Vol 5, Chpt 5 (ed G. Reed) VCH press, Germany.

97. Baeuerle, P.A. and Baltimore, D. , The physiology of the NF-kB transcription factor in The Hormonal Control of Gene Transcription. (Cohen, P. and Foulkes, G.J., eds.), Elsevier Science Publishers, B.V. , Amsterdam, p 440.

97. Rigby, P.W.J., The regulation of transcription during mouse embryogenesis in The Hormonal Control of Gene Transcription. (Cohen, P. and Foulkes, G.J., eds.) , Elsevier Science Publishers, B.V. , Amsterdam, p 471.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Oncogene, Science Inc.

(ii) TITLE OF INVENTION: Methods of Transcriptionally Modulating Expression of Viral Genes and Other Genes Useful for the Production of Proteins

(iii) NUMBER OF SEQUENCES: 20

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: John P. White, Esq.

(B) STREET: 30 Rockefeller Plaza

(C) CITY: New York

(D) STATE: New York

(E) COUNTRY: USA

(F) ZIP: 10112

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: 17-JAN-1992

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: White, John P.

(B) REGISTRATION NUMBER: 28,676

(C) REFERENCE/DOCKET NUMBER: 26134-Fl-PCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 212-977-9550

(B) TELEFAX: 212-664-0525

(C) TELEX: 422523 coop ui

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 40 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AAACAGTGGT GTGGCGACTC CGTTTAGCTG TTCTGGAGCT 40

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

TGGATCGCAG CGCTGCCTTT CCT 23

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

CATGAGGAAA GGCAGCGCTG CGATCCAGCA C 31

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

TGGCGCAGCG CTCCAGGAGA AGCTG 25

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base airs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

CGCTATGGAG TTGGCTCAAG CAGCCTGC 28

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

GGCGGGTCTG TAGGCAGGTC GGCTC 25

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

CAGTAAGAGC TCAGCCCTTG CCCTGGGCAG G 31

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CTCCAGCCCG CAGCTCCAGG AGTCTG 26

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

CCCTCTACAC TGGCAGTTCC ACCTG 25

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GGCCAAGGAG GCCGAGAATA TCACG 25

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

GCCAGACTTC TACGGCCTGC TGCCCGAC 28

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

TCAGCAATTG AGAGCATTCT TAAA 24

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13 GTCCTTGATA TGGATTGGAT GTCG 24

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

ACTAATAATG TAAAAGACGT CACTAAATTG 30

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

TCTCGCTTAT CCAACAATGA CTTGG 25

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 40 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

CCAGAACAGC TAAACGGAGT CGCCACACCA CTGTTTGTGC 40 (2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

CATGGGGCCG GAGCCGCAGT GAGCAC 26

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

CATGGTGCTC ACTGCGGCTC CGGCCC 26

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

( i) SEQUENCE DESCRIPTION: SEQ ID NO:19:

TCGAGATCTG AGGCCTGCTG ACCATGGGGG CC 32 (2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

CCCATGGTCA GCAGGCCTCA GATC 24

Claims

What is claimed is:

1. A method of obtaining a gene product of interest, which comprises culturing cells capable of expressing a gene encoding the gene product in the presence of a molecule at a concentration effective to directly transcriptionally modulate expression of the gene so as to increase the biosynthesis of the gene product expressed by the cells and recovering the gene product, wherein the molecule (a) does not naturally occur in the cells, (b) specifically transcriptionally modulates expression of the gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand- binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with the production in cell culture of the gene product.

2. A method of directly transcriptionally modulating the expression of a gene encoding a protein of a virus, the expression of which gene is associated with a defined pathological effect caused by the virus within a multicellular organism, which comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the concentration of the protein encoded by the gene which is expressed within the cell, which molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the gene encoding the viral protein, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.

3. A method of claim 1 or 2, wherein the molecule does not naturally occur in any cell of a lower eucaryotic organism.

4. A method of claim 1 or 2, wherein the molecule does not naturally occur in any cell.

5. A method of claim 1 or 2, wherein the molecule is not a naturally occurring molecule.

6. A method of claim 1 or 2, wherein the cell is a cell of the multicellular organism.

7. A method of claim 1 or 2, wherein the cell is an insect cell.

8. A method of claim 1 or 2, wherein the cell is an animal cell.

9. A method of claim 1, wherein the cell is a hybridoma cell.

10. A method of claim 1, wherein the cell is a COS cell.

11. A method of claim 1, wherein the cell is a CHO cell.

12. A method of claim 8, wherein the animal cell is a human cell.

13. A method of claim 1, wherein the cell is a HeLa cell .

14. A method of claim 1, wherein the cell is a fungal cell.

15. A method of claim 1, wherein the cell is a plant cell.

16. A method of claim 14, wherein the fungal cell is a yeast cell.

17. A method of claim 1 or 2, wherein the transcriptional modulation comprises upregulation of the expression of the gene.

18. A method of claim 1 or 2, wherein the transcriptional modulation comprises downregulation of the expression of the gene.

19. A method of claim 2, wherein the defined pathological effect is a disorder and modulation of the expression of the gene is associated with the amelioration of the disorder.

20. A method of claim 19, wherein the disorder is a viral infection.

21. A method of claim 20, wherein the viral infection is a cytomegalovirus infection.

22. A method of claim 20, wherein the viral infection is an hepatitis virus infection.

23. A method of claim 20, wherein the viral infection is an herpes virus infection.

24. A method of claim 20, wherein the viral infection is an HIV virus infection.

25. A method of claim 20, wherein the viral infection is an EBV virus infection.

26. A method of claim 20, wherein the viral infection is a papilloma virus infection.

27. A method of claim 20, wherein the viral infection is a rhinovirus infection.

28. A method of claim 20, wherein the viral infection is an influenza virus infection.

29. A method of claim 20, wherein the viral infection is a varicella-zoster virus infection.

30. A method of claim 20, wherein the viral infection is a parainfluenza virus infection.

31. A method of claim 20, wherein the viral infection is a mumps virus infection.

32. A method of claim 20, wherein the viral infection is a respiratory syncytial virus infection.

33. A method of claim 20, wherein the viral infection is an adenovirus infection.

34. A method of claim 20, wherein the viral infection is a measles virus infection.

35. A method of claim 20, wherein the viral infection is a rubella virus infection.

36. A method of claim 20, wherein the viral infection is a human parvovirus infection.

37. A method of claim 20, wherein the viral infection is a poliovirus infection.

38. A method of claim 20, wherein the viral infection is a rotavirus infection.

39. A method of claim 20, wherein the viral infection is an echovirus infection.

40. A method of claim 20, wherein the viral infection is a arbovirus infection.

41. A method of claim 20, wherein the viral infection is a human T cell leukemia-lymphoma virus infection.

42. A method of claim 19, wherein the disorder is cancer.

43. A method of claim 42, wherein the cancer is an hepatocellular carcinoma.

44. A method of claim 42, wherein the cancer is a leukemia.

45. A method of claim 42, wherein the cancer is a cervical carcinoma.

46. A method of claim 1 or 2, wherein the molecule binds to a modulatable transcriptional regulatory sequence of the gene.

47. A method of claim 1 or 2, wherein the molecule comprises an antisense nucleic acid.

48. A method of claim 1 or 2, wherein the molecule comprises double-stranded nucleic acid.

49. A method of claim 1, 4 or 46, wherein the molecule comprises a nucleic acid capable of forming a triple helix with double-stranded DNA.

50. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which gene is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence encoding a polypeptide, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable detectable signal to be produced by the polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

51. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which gene is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

52. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a protein of interest which gene is associated with the production in a cell culture of the protein encoded by the gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

53. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence encoding a polypeptide, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable detectable signal to be produced by the polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

54. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

55. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a viral protein, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene, (ii) the promoter, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene.

56. A method of claim 50, 51, 52, 53, 54 or 55, wherein the sample comprises cells in monolayers.

57. A method of claim 50, 51, 52, 53, 54 or 55, wherein the sample comprises cells in suspension.

58. A method of claim 50, 51, 52, 53, 54 or 55, wherein the cells comprise animal cells.

59. A method of claim 50, 51 or 52, wherein the cells comprise fungal cells.

60. A method of claim 50, 51 or 52, wherein the cells comprise insect cells.

61. A method of claim 50, 51 or 52, wherein the cells comprise plant cells.

62. A method of claim 58, wherein the animal cells are human cells.

63. A method of claim 50, 51, 52, 53, 54 or 55, wherein the predefined number of cells is from about 1 to about 5 X 10⁵ cells.

64. A method of claim 63, wherein the predefined number of cells is from about 2 X 10² to about 5 X 10⁴ cells.

65. A method of claim 50, 51, 52, 53, 54 or 55, wherein the predetermined amount of the molecule to be tested is based upon the volume of the sample.

66. A method of claim 50, 51, 52, 53, 54 or 55, wherein the predetermined amount is from about 1.0 pM to about 20 μM.

67. A method of claim 50, 51, 52, 53, 54 or 55, wherein the predetermined amount is from about 10 nM to about 500 μM.

68. A method of claim 50, 51, 52, 53, 54 or 55, wherein the contacting is effected from about 1 to about 24 hours.

69. A method of claim 66, wherein the contacting is effected from about 2 to about 12 hours.

70. A method of claim 50, 51, 52, 53, 54 or 55, wherein the contacting is effected with more than one predetermined amount of the molecule to be tested.

71. A method of claim 50, 51, 52, 53, 54 or 55, wherein the molecule to be tested is a purified molecule.

72. A method of claim 50, 51, 52, 53, 54 or 55, wherein the modulatable transcriptional regulatory sequence comprises a cloned genomic regulatory sequence.

73. A method of claim 50, 51, 52, 53, 54 or 55, wherein the DNA consists essentially of more than one modulatable transcriptional regulatory sequence.

74. A method of claim 50 or 53, wherein the polypeptide is a luciferase.

75. A method of claim 50 or 53, wherein the polypeptide is chloramphenicol acetyltransferase.

76. A method of claim 50 or 53, wherein the polypeptide is β glucuronidase.

77. A method of claim 50 or 53, wherein the polypeptide is β galactosidase.

78. A method of claim 50 or 53, wherein the polypeptide is neomycin phosphotransferase.

79. A method of claim 50 or 53, wherein the polypeptide is guanine xanthine phosphoribosyltransferase.

80. A method of claim 50 or 53, wherein the polypeptide is alkaline phosphatase.

81. A method of claim 51 or 54, wherein the polypeptide is capable of recognizing and binding to an antibody.

82. A method of claim 51 or 54, wherein the polypeptide is capable of recognizing and binding to biotin.

83. A method of claim 52 or 55, wherein mRNA is detected by quantitative polymerase chain reaction.

84. A screening method according to claim 50, 51, 52, 53, 54 or 55 which comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested.

85. A screening method of claim 84, wherein the plurality of samples comprises more that about 10⁴ samples .

86. A screening method of claim 85, wherein the plurality of samples comprises more than about 5 X 10⁴ samples.

87. A method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more genes, which comprises essentially simultaneously screening the molecules against the genes according to the method of claim 84.

88. A screening method of claim 84, wherein more than about 10³ samples per week are contacted with different molecules.

89. A screening method of claim 84, wherein more than about 10³ samples per week are contacted with different molecules.

90. A method of obtaining a polypeptide, which comprises culturing cells capable of expressing a gene encoding the polypeptide in the presence of a molecule at a concentration effective to directly transcriptionally modulate expression of the gene so as to increase the biosynthesis of the polypeptide expressed by the cells and recovering the polypeptide, wherein the molecule (a) does not naturally occur in the cells, (b) specifically transcriptionally modulates expression of the gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand- binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with the production in cell culture of the polypeptide.

91. A method of claim 90, wherein the polypeptide is a homologous polypeptide.

92. A method of claim 90, wherein the polypeptide is under the contol of a heterologous regulatory element.

93. A method of claim 90, wherein the DNA is recombinant DNA.

94. A method of claim 90, wherein the cell is an animal cell.

95. A method of claim 90, wherein the cell is a plant cell.

96. A method of claim 90, wherein the cell is a bacterial cell.

97. A method of claim 90, wherein the cell is a fungal cell.

98. A method of claim 90, wherein the polypeptide is a a component of a monoclonal antibody.

99. A method of claim 90, wherein the polypeptide is tissue plasminogen activator.

100. A method of claim 90, wherein the polypeptide is a growth hormone.

101. A method of claim 90, wherein the polypeptide is a blood clotting factor.

102. A method of claim 90, wherein the polypeptide is erythropoietin.

103. A method of claim 90, wherein the polypeptide is an interleukin.

104. A method of claim 90, wherein the polypeptide is an interferon.

105. A method of claim 90, wherein the polypeptide is a colony stimulating factor.

106. A method of claim 90, wherein the polypeptide is a transforming growth factor.

107. A method of claim 90, wherein expression of the polypeptide results in production of a desired product.

108. A method of claim 107, wherein the desired product is an antibiotic.

109. A method of claim 107, wherein the desired product is citric acid.

110. A method of claim 107, wherein the desired product is an antigen.

111. A method of claim 1, wherein the protein of interest is useful in effecting a biochemical transformation of industrial importance.

112. A method of claim 111, wherein the biochemical transformation is associated with the production of a steroid or steroid precursor.

113. A method of claim 111, wherein the biochemical transformation is associated with the production of an alcohol, aldehyde, ketone or carboxylic acid.

114. A method of claim 111, wherein the biochemical transformation is associated with the degradation of a petroleum products.

115. A method of claim 111, wherein the biochemical transformation is associated with detoxification.

116. A method of claim 111, wherein the biochemical transformation is useful for the recovery a metal.

117. A method of claim 1 wherein protein of interest is useful in a biological method for recovering a desired substance from a mixture containing the substance wherein the protein acts by binding or concentrating the substance thus aiding in the recovery of the substance.

118. A method of claim 117, wherein the substance is a metal.

119. A method of directly transcriptionally modulating the expression of a promoter useful for the production of recombinant proteins (the promoter) , which comprises contacting a cell, which is capable of using the promoter to initiate transcription, with a molecule at a concentration effective to specifically transcriptionally modulate expression of the promoter and thereby affect the production of the recombinant gene product encoded by sequences under the transcriptional control of the promoter, which molecule (a) does not naturally occur in the cell and (b) transcriptionally modulates expression of the promoter.

120. A method of claim 119, wherein the molecule does not naturally occur in any cell of a higher eucaryotic organism.

121. A method of claim 119, wherein the molecule does not naturally occur in any cell.

122. A method of claim 119, wherein the molecule is not a naturally occurring molecule.

123. A method of claim 119, wherein the cell is a cell of a multicellular organism.

124. A method of claim 123, wherein the cell is an insect cell.

125. A method of claim 123, wherein the cell is an animal cell.

126. A method of claim 125, wherein the animal cell is a hybridoma.

127. A method of claim 125, wherein the animal cell is a COS cell.

128. A method of claim 125, wherein the animal cell is a CHO cell.

129. A method of claim 125, wherein the animal cell is a human cell.

130. A method of claim 125, wherein the human cell is a HeLa cell.

131. A method of claim 123, wherein the cell is a fungal cell.

132. A method of claim 123, wherein the cell is a plant cell.

133. A method of claim 131, wherein the fungus is a yeast.

134. A method of claim 119, wherein the transcriptional modulation comprises upregulation of expression of the promoter.

135. A method of claim 119, wherein the transcriptional modulation comprises downregulation of expression of the promoter.

136. A method of claim 119, wherein the molecule comprises an antisense nucleic acid.

137. A method of claim 119, wherein the molecule comprises double stranded-nucleic acid.

138. A method of claim 119, wherein the molecule comprises a nucleic acid capable of forming a triple helix with double-stranded DNA.

139. A method of claim 119, wherein the promoter is a viral promoter.

140. A method of claim 119, wherein the promoter is a heat shock promoter.

141. A method of claim 119, wherein the promoter is an animal cell promoter.

142. A method of claim 119, wherein the promoter is a fungal promoter.

143. A method of claim 119, wherein the promoter is a plant cell promoter.

144. A method of claim 119, wherein the promoter is an insect cell promoter.

145. A method of claim 139, wherein the viral promoter is an simian virus 40 (SV40) promoter.

146. A method of claim 139, wherein the viral promoter is a cytomegalovirus (CMV) promoter.

147. A method of claim 139, wherein the viral promoter is a mouse mammary tumor virus (MMTV) promoter.

148. A method of claim 139, wherein the viral promoter is an adenovirus promoter.

149. A method of claim 139, wherein the viral promoter is a Malony murine leukemia virus promoter.

150. A method of claim 139, wherein the viral promoter is a murine sarcoma virus promoter.

151. A method of claim 139, wherein the viral promoter is a Rous sarcoma virus promoter.

152. A method of claim 142, wherein the fungal promoter is an ADC1 promoter.

153. A method of claim 142, wherein the fungal promoter is an ARG promoter.

154. A method of claim 142, wherein the fungal promoter is an ADH promoter.

155. A method of claim 142, wherein the fungal promoter is a CYC1 promoter.

156. A method of claim 142, wherein the fungal promoter is a CUP promoter.

157. A method of claim 142, wherein the fungal promoter is an EN01 promoter.

158. A method of claim 142, wherein the fungal promoter is a GAL promoter.

159. A method of claim 142, wherein the fungal promoter is a PHO promoter.

160. A method of claim 142, wherein the fungal promoter is a PGK promoter.

161. A method of claim 142, wherein the fungal promoter is a GAPDH promoter.

162. A method of claim 142, wherein the fungal promoter is a mating type factor promoter.

163. A method of claim 140, wherein the animal cell promoter is an interferon promoter.

164. A method of claim 140, wherein the animal cell promoter is a metallothionein promoter.

165. A method of claim 140, wherein the animal cell promoter is an immunoglobulin promoter.

166. A method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding a viral protein, the expression of which is associated with a defined physiological or pathological effect in the organism, which comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect, which molecule (a) does not naturally occur in the organism and (b) specifically transcriptionally modulates expression of the gene encoding the viral protein, and (c) binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.

167. A method of claim 166, wherein the molecule binds to a modulatable transcription sequence of the gene.

168. A method of claim 166, wherein the molecule comprises an antisense nucleic acid.

169. A method of claim 166, wherein the molecule comprises a double-stranded nucleic acid molecule.

170. A method of claim 166, wherein the molecule comprises a nucleic acid capable of forming a triple helix with double-stranded DNA.

171. A method of claim 166, wherein the multicellular organism is a human being.

172. A method of claim 166, wherein the defined pathological effect is a viral infection.

173. A method of claim 172, wherein the viral infection is AIDS.

174. A method of claim 172, wherein the viral infection is cytomegalovirus infection.

175. A method of claim 172, wherein the viral infection is influenza.

176. A method of claim 172, wherein the viral infection is infectious mononucleosis.

177. A method of claim 172, wherein the viral infection is mumps.

178. A method of claim 172, wherein the viral infection is measles.

179. A method of claim 172, wherein the viral infection is rubella.

180. A method of claim 172, wherein the viral infection is herpes.

181. A method of claim 172, wherein the viral infection is hepatitis.

182. A method of claim 172, wherein the viral infection is poliomyelitis.

183. A method of claim 172, wherein the viral infection causes cancer.

184. A method of claim 183, wherein the cancer is a cervical carcinoma.

185. A method of claim 183, wherein the cancer is a hepatocellular carcinoma.

186. A method of claim 183, wherein the cancer is a leukemia.

187. A method of claim 166 or 171, wherein the administering comprises topical contact.

188. A method of claim 166 or 171, wherein the administering comprises oral, transdermal, intravenous, intramuscular or subcutaneous administration.

189. A method of claim 45, 46 or 47, wherein the viral gene is a trans-activator protein.

190. A method of claim 188, wherein the trans-activator protein is a herpes virus intermediate early gene.

191. A method of claim 49, wherein the trans-activator protein is a TAT protein of a retrovirus. METHODS OF TRANSCRIPTIONALLY MODULATING EXPRESSION OF VIRAL GENES AND OTHER GENES USEFUL FOR PRODUCTION OF

PROTEINS

ABSTRACT OF THE INVENTION

The invention provided for a method of directly transcriptionally modulating the expression of a gene encoding a gene product, the expression of which gene is associated with the production of the gene product.

The invention further provides a method of directly transcriptionally modulating the expression of a gene encoding a protein of a virus, the expression of which is associated with a defined pathological effect caused by the virus within a multicellular organism.

Screening methods, including methods of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more viral genes or other genes associated with the production of polypeptides or other desired products are also provided.

Lastly, a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding a viral gene, the expression of which is associated with a defined physiological or pathological effect caused by the virus, whose genome includes such a gene, in the organism, is provided.