WO1992013091A1 - Methods of transcriptionally modulating expression of oncogenes and tumor suppressor genes - Google Patents

Methods of transcriptionally modulating expression of oncogenes and tumor suppressor genes Download PDF

Info

Publication number
WO1992013091A1
WO1992013091A1 PCT/US1992/000421 US9200421W WO9213091A1 WO 1992013091 A1 WO1992013091 A1 WO 1992013091A1 US 9200421 W US9200421 W US 9200421W WO 9213091 A1 WO9213091 A1 WO 9213091A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
molecule
oncogene
tumor suppressor
expression
Prior art date
Application number
PCT/US1992/000421
Other languages
French (fr)
Inventor
J. Gordon Foulkes
Richard Michitch
Franz Leichtfried
Christian Pieler
John Stevenson
Original Assignee
Oncogene Science, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncogene Science, Inc. filed Critical Oncogene Science, Inc.
Publication of WO1992013091A1 publication Critical patent/WO1992013091A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0069Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y113/00Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/12Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of one atom of oxygen (internal monooxygenases or internal mixed function oxidases)(1.13.12)
    • C12Y113/12007Photinus-luciferin 4-monooxygenase (ATP-hydrolysing) (1.13.12.7), i.e. firefly-luciferase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/15Nucleic acids forming more than 2 strands, e.g. TFOs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention provides a method for directly effecting transcription of an oncogene or tumor suppressor gene; a method for testing compounds for directly effecting transcription by measuring the product polypeptide produced; and a method for testing compounds for directly effecting transcription by measuring the mRNA produced.

Description

METHODS OF TRANSCRIPTIONALLY MODULATING EXPRESSION OF ONCOGENES AMD TUMOR SUPPRESSOR GENES
This application is a continuation-in-part of U.S. Serial No. 644,293, filed January 18, 1991, the contents of which are hereby incorporated by reference into the present application.
Background of the Invention
Throughout this application, various publications are referenced by Arabic numerals within parentheses. Full citations for these publications may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.
The genomes of higher eucaryotic cells contain specific genes that, when activated by any one of several mechanisms, are capable of transforming normal cells to the malignant state. These genes, termed oncogenes, can be loosely defined as genes whose abnormal expression or altered gene product directly contributes to the production of the malignant phenotype. More than 50 such oncogenes have been identified thus far, and current estimates suggest that as many as 200 may be found to exist.
Oncogenes derive from normal cellular progenitors, called proto-oncogenes, many of which code for proteins which are involved in cell division or differentiation. Proto- oncogene encoded products include growth factor-like molecules (int-21 , receptors with tyrosine kinase activity (c-erbB2) , nuclear proteins (c-mγc) , membrane bound proteins with GTPase activity (∑as) , transcription factors (c- un) and hormone receptors (c-erbAlϊ (58) . The generation of oncogenes from their non-transforming homologues can occur via several different mechanisms; (a) retroviral transduction of proto-oncogenes from a donor cell to host cell during viral replication, placing the donor's proto-oncogene under control of the strong retroviral promoter and resulting in the constitutive over production of a normal protein or in a mutated activation of the protein as a consequence of the transduction event, (b) gene amplification, leading to an increased concentration of the proto-oncogene product (c) binds to DNA or RNA, or chromosomal translocation, resulting in either a novel fusion protein with increased biochemical activity or else overproduction of the translocated cellular gene product by virtue of its placement in proximity to another cellular gene's strong promoter (d) mutation within a proto-oncogene's coding region resulting in a protein product with altered biochemical function(s) .
Although a relatively large number of oncogenes with potential transforming capabilities exist, the majority have not been implicated in human malignancies. Only about 10 oncogenes have been clearly demonstrated to be involved in human disease.
Recently, a set of cellular genes different from oncogenes, namely tumor suppressor genes or anti- oncogenes, have been implicated in tumorigenesis. Anti- oncogenes have been defined as genes whose repression, inactivation, dysfunction or loss results in cell transformation. Tumor suppressor genes has been defined experimentally as genes whose introduction, activation or expression results in the inhibition or suppression of the tumorigenic phenotype. Clearly these definitions are not mutually exclusive, anti-oncogenes can function as tumor suppressor genes and vice-versa. The biochemical function(s) of anti-oncogene products remain to be elucidated; however, two anti-oncogene products, Rb, the protein product of the cellular retinoblasto a gene, and p53, have been shown to bind transforming viral proteins. Loss or inactivation of anti-oncogenes (by allelic deletion or mutational alteration) may therefore be involved in tumorigenesis by their failure to interact with and suppress the activity of transforming oncogenes. In several cases a direct role of tumor suppressor in control of the cell cycle has been implied.
As stated previously, only a limited number of oncogene and anti-oncogenes have been shown to be present in human cancers. Within this group, an even smaller number are thought to play a critical role in a large percentage of specific cancers or multiple type of neoplasias. The following is a brief description of those genes which belong to this latter category.
A. ras; in mammalian species, the ras family of proto- oncogenes consists of three closely related members, termed H, K, and N-ras. Each codes for a 21 kd protein (p21) with GTP binding and hydrolysis activities. The most common mechanism of activation of the ras oncogene is a signal point mutation, frequently occurring in the protein's twelfth codon, which results in a decreased GTPase activity and a concomitant acquisition of transforming potential in experimental systems. Furthermore, ras mutations are found in a large percent of cancers, supporting the supposition that the mutated protein's altered biochemical function plays a critical role in neoplasias. Specifically, mutated K-ras has been found in adenocarcinoma of the lung, colon and pancreas, occurring in 30%, 50% and greater than 70% of those tumors, respectively (1,2)
K-ras mutations have also been reported in over 20% of melanoma tumor samples recently examined (3) . Between 50 and 70% of the different tumor types are refractory to current methods of therapy and eventually prove fatal.
In addition to the preponderance of mutated ras protein in human cancer, a number of reports suggests a link between overexpression of the normal ras gene and neoplastic transformation (4,5,6). Regardless of the mechanism of activation, the ras oncogene is the most implicated of all oncogenes in its wide range and high percentage that is found in a variety of human neoplasias.
erbB2 (neu) : The erbB2 gene encodes a 185 Kd transmembrane protein-tyrosine kinase which closely resembles the EGF receptor. .Amplification of the erbB2 gene has been found to occur in 30% of breast cancer (7) . Amplification is found in both early and late stages of disease, and is maintained in the metastases. Furthermore, there is a direct correlation between gene amplification and overexpression of the erbB2 protein, although numerous examples of tumors which overexpress protein in the absence of gene amplification also exist. Overexpression of the erbB2 protein also occurs in 30% of ovarian cancers. In both tumor types, erbB2 overexpression correlates with poor patient prognosis, with a shorter time to relapse as well as a decreased overall survival rate.
In experimental systems, overexpression of the normal human erbB2 gene in urine fibroblasts to levels similar to those in human breast and ovarian cancers have been shown to induce cell transformation (8,9). In addition, erbB2 overexpression in the human MCF-7 breast cancer line allows these cells to grow as tumors in nude mice. Furthermore, monoclonal antibodies to human erbB2 have specific anti-proliferative effects in vitro of human breast tumor cells which overexpress erbB2 (10) . These and other data strongly suggest that the erbB2 gene plays an important role in the onset and progression of breast and other cancers.
p53: The first host protein shown to bind specifically to the product of a DNA tumor virus oncogene (SV40 large T-antigen) was p53 (11,12).
Recent studies examining the genetic alterations which occur during the development of colorectal tumors have indicated a common mutation to be deletions of the short arm of chromosome 17, the region where the p53 gene is located. Chromosome 17p deletions are often late events associated with the transition from the benign (adenomatous) to the malignant (carcinomatous) state (13) . In a vast majority of colorectal carcinomas examined, allelic deletions of 17p were found to occur. The remaining p53 allele was shown to contain point mutations suggesting that p53 gene mutations may be involved in colorectal neoplasias, perhaps through inactivation of a tumor suppressor function of the wild type p53 gene (14) . Allelic loss of p53
(chromosome 17p) has also been observed in a large number of breast and lung tumors analyzed. In a study involving a limited number of hepatocellular carcinoma-derived cell lines, six of seven showed p53 abnormalities (15) suggesting a general mechanism of p53 inactivation in several different human neoplasias (16,17,18) Recently specific mutations in p53 have been found in a large percentage of cases of malignant melanoma.
The specific cellular function of p53 has not yet been determined, although several lines of evidence suggest a role in the regulation of DNA replication
(19) . Loss of one p53 allele followed by mutational inactivation of the remaining allele could therefore result in a mutated p53 protein incapable of carrying out its normal function, one proposed function being tumor suppressor activity. There is increasing evidence that mutated p53 may play an active role in transformation suggesting that p53 may act as either an oncogene or an anti-oncogene depending on whether it is mutant or wild-type.
Pharmaceuticals which increase or decrease the expression of oncogenes, anti-oncogenes or tumor suppressor genes will have important clinical applications for the treatment of various neoplasias. We describe herein a method for discovery of compounds which modulate the expression of these genes and describe the use of such compounds. The general approach is to screen compound libraries for substances which increase or decrease expression of oncogenes, anti-oncogenes, tumor suppressor genes or proto-oncogenes.
The expression of a specific gene can be regulated at any step in the process of producing an active protein. Modulation of total protein activity may occur via transcriptional, transcript-processing, translational or post-translational mechanisms. Transcription may be modulated by altering the rate of transcriptional initiation or the progression of RNA polymerase (28) . Transcript-processing may be influenced by circumstances such as the pattern of RNA splicing, the rate of mRNA transport to the cytoplasm or mRNA stability. This invention concerns the use of molecules which act by modulating the in vivo concentration of their target proteins via regulating gene transcription. The functional properties of these chemicals are distinct from previously described molecules which also affect gene transcription.
Researchers have documented the regulation of transcription in bacteria by low molecular weight chemicals (20, 21). Extracellular xenobiotics, amino acids and sugars have been reported to interact directly with an intracellular proteinaceous transcriptional activator or repressor to affect the transcription of specific genes.
Transcriptional regulation is sufficiently different between procaryotic and eucaryotic organisms so that a direct comparison cannot readily be made. For example, procaryotic cells lack a distinct membrane bound nuclear compartment. Furthermore the structure and organization of procaryotic DNA elements responsible for initiation of transcription differ markedly from those of eucaryotic cells.
The eucaryotic transcriptional unit is much more complex than its procaryotic counterpart and consists of additional elements which are not commonly found in bacteria, including enhancers and other cis-acting DNA sequences (22, 23). Procaryotic transcription factors most commonly exhibit a "helix-turn-helix" motif in the DNA binding domain of the protein (24, 25). Eucaryotic transcriptional factors frequently contain a "zinc finger" (25, 26), "helix-loop-helix" or a "leucine zipper" (27) in addition to sometimes possessing the "helix-turn-helix" motif (28) . Furthermore, several critical mechanisms at the post-transcriptional level such as RNA splicing and polyadenylation are not typically found in procaryotic systems (29, 30).
In higher eucaryotes, modulation of gene transcription in response to extracellular factors can be regulated in both a temporal and tissue specific manner (31) . For example, extracellular factors can exert their effects by directly or indirectly activating or inhibiting tissue specific transcription factors (31, 32) .
Modulators of transcription factors involved in direct regulation of gene expression have been described, and include those extracellular chemicals entering the cell passively and binding with high affinity to their receptor-transcription factors. This class of direct transcriptional modulators include steroid hormones and their analogs, thyroid hormones, retinoic acid, vitamin D3 and its derivatives, and dioxins, a chemical family of polycyclic aromatic hydrocarbons (26, 33, 34). Dioxins are molecules generally known to modulate transcription, however, dioxins bind to naturally-occurring receptors which respond normally to xenobiotic agents via transcriptionally activating the expression of cytochrome P450, part of an enzyme involved in detoxification. Similarly, plants also have naturally occurring receptors to xenobiotics to induce defense pathways. For example, the fungal pathogen Phytophthora megasperma induces an anti-fungal compound in soybeans. Such molecules which bind to the defined ligand binding domains of such naturally occurring receptors are not included on the scope of this invention.
The clinical use of steroid hormones, thyroid hormones, vitamin Dj and their analogs demonstrates that agents which modulate gene transcription can be used for beneficial effects, although these agents can exhibit significant adverse side effects. Obviously, analogs of these agents could have similar clinical utility as their naturally occurring counterparts by binding to the same ligand binding domain of such receptors. These types of molecules do not fall within the scope of this invention because they function by binding to the ligand-binding domain of a receptor normally associated with a defined physiological effect.
Indirect transcriptional regulation involves one or more signal transduction mechanisms. This type of regulation typically involves interaction with a trans-membrane signal transducing protein, the protein being part of a multistep intracellular signaling pathway, the pathway ultimately modulating the activity of nuclear transcription factors. This class of indirect transcriptional modulators include polypeptide growth factors such as platelet-derived growth factor, epidermal growth factor, cyclic nucleotide analogs, and mitogenic tumor promoters such as PMA (35, 36, 37).
It is well documented that a large number of chemicals, both organic and inorganic, e.g. metal ions, can non-specifically modulate transcription. Most heavy metals modulate gene expression through receptors in a mechanism similar to that employed by dioxin, steroid hormones, vitamin D3 and retinoic acid.
Researchers have used nucleotide analogs in methods to non-specifically modulate transcription. The mechanism involves incorporating nucleotide analogs into nascent mRNA or non-specifically blocking mRNA synthesis. Similarly, researchers have used alkylating agents, e.g. cyclophosphamide, or intercalating agents, e.g. doxorubicin, to non-specifically inhibit transcription.
Moreover, chemical inhibitors of hydroxymethyl-glutaryl CoA reductase, e.g. lovastatin, are known to indirectly modulate transcription by increasing expression of hepatic low density lipoprotein receptors as a consequence of lowered cholesterol levels.
Signal effector type molecules such as cyclic AMP, diacylglycerol, and their analogs are known to non-specifically regulate transcription by acting as part of a multistep protein kinase cascade reaction. These signal effector type molecules bind to domains on proteins which are thus subject to normal physiological regulation by low molecular weight ligands (38, 39).
The specific use of sterol regulatory elements from the
LDL receptor gene to control expression of a reporter gene has recently been documented in PCT/US88/10095. One aspect of PCT/US88/10095 deals with the use of specific sterol regulatory elements coupled to a reporter as a means to screen for drugs capable of stimulating cells to synthesize the LDL receptor. PCT/US88/10095 describes neither the concept of simultaneously screening large numbers of chemicals against multiple target genes nor the existence of transcriptional modulators which (a) do not naturally occur in the cell, (b) specifically transcriptionally modulate expression of the gene encoding the oncogene or tumor suppressor gene product, and (c) binds to DNA or RNA, or bind to DNA or RNA or bind to a protein through a domain of such protein which is not a defined ligand binding domain of a nuclear, transcriptionally activating receptor which naturally occurs in the cell, the binding of a ligand to which ligand binding domain is normally associated with a defined physiological effect. The main focus of PCT/US88/10095 is the use of the sterol regulatory elements from the LDL receptor as a means to inhibit expression of toxic recombinant biologicals.
The use of molecules to specifically modulate transcription of oncogenes and tumor suppressor genes as described herein has not previously been reported and its use will bring surprise since available literature does not propose the use of a molecule, as described, in a method to specifically modulate transcription. Instead, the available literature has reported methods which define domains of transcriptional regulating elements of a gene.
Further, the practice of using a reporter gene to analyze nucleotide sequences which regulate transcription of a gene-of-interest is well documented. The demonstrated utility of a reporter gene is in its ability to define domains of transcriptional regulatory elements of a gene- of-interest. Reporter genes which express proteins, e.g. luciferase, are widely utilized in such studies. Luciferases expressed by the North .American firefly, Photinus pyralis and the bacterium, Vibrio fischeri were first described as transcriptional reporters in 1985 (40, 41) . Reporter genes have not been previously used to identify compounds which (a) do not naturally occur in the cell, (b) specifically transcriptionally modulate expression of the gene encoding the oncogene or the tumor suppressor gene product, and (c) binds to DNA or RNA, or bind to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
A method to define domains of transcriptional regulating elements of a gene-of-interest typically has also involved use of phorbol esters, cyclic nucleotide analogs, concanavalin A, or steroids, molecules which are commonly known as transcriptional modulators. However, available literature shows that researchers have not considered using a transcription screen to identify specific transcriptional modulators. Apparently, success would be unlikely in doing so, however, we have demonstrated herein that this is not the case.
There is utility in developing the method of transcriptional modulation of oncogenes and tumor suppressor genes by using such molecule as described herein. This method will allow the development of novel pharmaceuticals and circumvent many of the problems associated with the therapeutic use of recombinant biological factors where clinical the use of protein factors is relevant.
Problems associated with the therapeutic use of recombinant biological factors include the technical difficulties of large scale protein purification, the high costs of protein production, the limited shelf-life of most proteins and in some cases a short biological half-life of the administered protein in the organism. Additionally, therapeutic delivery of proteins normally requires injection. The method described herein provides a means of upregulating the expression of proteins which are not readily amenable to administration as injectable biologicals.
Furthermore, molecules specifically regulating the activity of one member of a group of closely related proteins are difficult to identify. Bioactive molecules, structurally related at the protein level, may possess distinct regulatory elements at the DNA level which control their expression. Thus, molecules such as the chemical transcriptional modulators defined herein can provide a greater opportunity for specifically modulating the activity of structurally related proteins.
Finally, the molecules described herein may also serve to mimic normal physiological response mechanisms, typically involving the coordinated expression of one or more groups of functionally related genes. Therefore, determining whether a molecule can specifically transcriptionally modulate the expression of an oncogene or tumor suppressor gene and the ultimate clinical use of the molecule provides a therapeutic advantage over the use of single recombinant biologicals, or drugs which bind directly to the final target protein encoded by the gene-of-interest. a.^mmmγ- of h« Invention
The invention provides a method of directly transcriptionally modulating the expression of an oncogene or a tumor suppressor gene, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism. This method comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the oncogene or the tumor suppressor gene product(s) encoded by the gene which is expressed by the cell. In this method the molecule (a) does not naturally occur in the cell and (b) specifically transcriptionally modulates expression of the oncogene or the tumor suppressor gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
The invention further provides for a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or a tumor suppressor gene. This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the oncogene or the tumor suppressor gene, (ii) a promoter of the oncogene or the tumor suppressor gene, and (iii) a DNA sequence encoding a polypeptide other than the oncogene or the tumor suppressor, which polypeptide is capable of producing a detectable signal, and which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or the tumor suppressor gene, causes a measurable detectable signal to be produced by the polypeptide so expressed. The amount of the signal produced, is quantitatively determined and the amount so determined compared with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule. So as to identify the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or the tumor suppressor gene.
Additionally the invention provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or a tumor suppressor gene. The method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested. The cells so contacted comprise DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the oncogene or the tumor suppressor gene, (ii) a promoter of the oncogene or the tumor suppressor gene, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or the tumor suppressor gene, causes a measurable change in the 1C amount of the polypeptide produced. The amount of the polypeptide so produced, is quantitatively determined and the amount so determined is compared with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule. So as to identify the molecule as one which causes a change in the amount of the polypeptide expressed, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or the tumor suppressor gene.
A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or a tumor suppressor gene, is also provided. This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested. Each of the cells so contacted comprises DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the oncogene or the tumor suppressor gene, (ii) a promoter of the oncogene or the tumor suppressor gene, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter. The contacting is effected under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or the tumor suppressor gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence. The amount of the mRNA produced is quantitatively determined and the amount so determined compared with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule so as to identify the molecule as one which causes a change in the detectable mRNA amount of, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or tumor suppressor gene.
A screening method which comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested, is also provided.
Further provided is a method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more oncogenes or tumor suppressor genes according to the methods mentioned above.
Further provided is a method for directly transcriptionally modulating in a multicellular organism the expression of an oncogene or a tumor suppressor gene, the expression of which is associated with a defined physiological or pathological effect in the organism. This method comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect. In this method the molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the oncogene or the tumor suppressor gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect. 18 Brief Description of the Figures
Figure 1 is a view of the mammalian expression shuttle vector pUV102 with its features. The mammalian expression shuttle vector was designed to allow the construction of the promoter-reporter gene fusions and the insertion of a neomycin resistance gene coupled to the herpes simplex virus thymidine kinase promoter (TK-NEO) .
Figure 2 is a partial restriction enzyme cleavage map of the plasmid pD0432 which contains the luciferase gene from the firefly, Photinus pyralis.
Figure 3 is a partial restriction enzyme cleavage map of the plasmid pSVLuci which contains the luciferase gene from the firefly, Photinus pyralis.
Figure 4 is a partial restriction enzyme cleavage map of the plasmid pMLuci which contains the luciferase gene of the firefly, Photinus pyralis and the mouse mammary tumor virus long terminal repeat.
Figure 5 provides the nucleotide sequences of six oligonucleotides, pUV-1 through pϋV-6, which were annealed, ligated, and inserted into the Sall/EcoRl sites of the plasmid pTZ18R.
Figure 6 is a diagrammatic representation of the construction of the plasmid pUVOOl from the plasmids pTZ18R and pBluescript ¥S(+) .
Figure 7 is a diagrammatic representation of the construction of the plasmid pUVlOO from the plasmid pUVOOl and two DNA fragments, the Xbal/Xmal fragment from pMLuci and the Xmal/BamHI fragment from pMSG.
Figure 8 is a diagrammatic representation of the construction of the plasmid pUV100-3 from the plasmid pUVlOO and a 476 b fragment containing a dimeric SV40 polyadenylation site.
Figure 9 is a diagrammatic representation of the construction of the plasmids pUV102 and pUV103 from the plasmid pUV100-3 and D-link oligonucleotides and the plasmid pUV100-3 and R-link oligonucleotides, respectively.
Figure 10 provides the nucleotide sequences of oligos 1-4 used for the construction of a synthetic HSV-thymidine kinase promoter and provides a diagrammatic representation of the HSV-TK promoter.
Figure 11 is a diagrammatic representation of the construction of the plasmid pTKLlOO which contains the luciferase gene from the firefly, Photinus pyralis and the HSV-TK promoter sequence.
Figure 12 is a diagrammatic representation of the construction of the plasmid pTKNEO which contains the neo gene, from about 3.5 kb Nhel/Xmal fragment from pTKLlOO, and the about 0.9 kb BstBI/Bglll fragment containing the neo coding region from pRSVNEO.
Figure 13 is a diagrammatic representation of the construction of the plasmid pTKNE02 from the plasmid pTKNEO and the oligonucleotides Neo 1 and 2.
Figure 14 is a diagrammatic representation of the construction of the plasmid pTKNE03 from the plasmid PTKNE02 and about 0.9 kb EcoRl/Sall fragment from pMClNEO.
Figure 15 is a partial restriction enzyme cleavage map of the plasmid pNEU106 which contains neu upstream sequences fused to the luciferase coding region.
Figure 16 is a partial restriction enzyme cleavage map of the plasmid pKRAS106 which contains K-ras upstream sequences fused to the luciferase gene from the firefly, Photinus pyralis.
Figure 17 is a partial restriction enzyme cleavage map of the plasmid pHRAS106 which contains human H-ras upstream sequences fused to the luciferase gene from the firefly, Photinus pyralis.
Figure 18 is a partial restriction enzyme cleavage map of the plasmid pNRA 106 which contains human N-ras upstream sequences fused to the luciferase gene from the firefly, Photinus pyralis.
Figure 19 is a diagrammatic representation of the phi gene. Shown are EcoRI sites and genomic fragments used in defining the phi promoter.
Figure 20 is a diagrammatic representation of the various phl-luciferase fusion plasmids used to define the phi promoter. Plasmid 4 was used to create the stably transfected phi reporter cell line.
Figure 21 is a partial restriction enzyme cleavage map of the plasmid pP531106 which contains human p53 Pl promoter upstream sequences fused to the luciferase gene from the firefly, Photinus pyralis. Figure 22 is a partial restriction enzyme cleavage map of the plasmid pP532106 which contains human p53 P2 promoter upstream sequences fused to the luciferase gene from the firefly, Pho inus pyralis.
Figure 23 is a partial restriction enzyme cleavage map of the plasmid pCM106 which contains the Cytomegalovirus immediate early promoter fused to the luciferase gene from the firefly, Photinus pyralis.
Figure 24 is a partial restriction enzyme cleavage map of a human neu minigene which contains the neu upstream regulatory elements fused to the neu cDNA.
Figure 25 is a partial restriction enzyme cleavage map of a human K-ras minigene which contains the K-ras upstream regulatory elements fused to the neu cDNA.
Figure 26 is a graphical representation of the decay of reporter gene signal after treatment of cells with Actinomycin D. Plotted is relative intensity of the signal versus time after ActD addition.
Figure 27 is an autoradiogram of a Southern blot showing the correct luciferase vector integration of five independently isolated H-ras transfectants. Lanes 1 and 2 are plasmid controls. The expected result is a single band of the same molecular weight as the control.
Figure 28 is an autoradiogram of PCR reactions detecting varying amounts of M-CSF mRNA and a constant amount of lambda DNA.
Figure 29 is an interpretation of the data presented in Figure 28. Relative band intensity of the M-CSF band is plotted against the total RNA.
Figure 30 is an ethidium bromide stained gel showing the reaction products of PCR reactions designed to specifically detect N-ras. neu. K-ras and H-ras mRNAs. 10 and 0.4 ng of U5637 total RNA was used. In each sample a sample of phage lambda DNA and lambda control oligos was added to control for the efficiency of the PCR reaction. This is the uppermost, consistent band in each lane. In each case the oligos specifically amplifies a DNA fragment of the correct molecular weight. A few extra bands of unknown origin appear in the c-erbB2 lanes and in the lane representing the highest concentration of H-ras mRNA.
Figure 31 is a quality assurance analysis of a high throughput screen measuring the ratios of negative values at various positions within a plate. The expected value is 1.0.
Figure 32 is a quality assurance analysis of a high throughput screen measuring a coefficient of variance for the negative controls on a number of plates. Values less than 10 are acceptable.
Figure 33 is a quality assurance analysis of a high throughput screen measuring a coefficient of variance for the positive controls on a number of plates. Values less than 10 are acceptable.
Figure 34 is a quality assurance analysis of a high throughput screen measuring a response of a reporter cell line to three different concentrations of a compound known to induce transcription. Detailed Description of the Invention
As used in this application, the following words or phrases have the meanings specified.
Antisense nucleic acid means an RNA or DNA molecule or a chemically modified RNA or DNA molecule which is complementary to a sequence present within an RNA transcript of a gene.
Directly transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of the gene through the binding of a molecule to (1) the gene (2) an RNA transcript of the gene, or (3) a protein which binds to (i) such gene or RNA transcript, or (ii) a protein which binds to such gene or RNA transcript.
A gene means a nucleic acid molecule, the sequence of which includes all the information required for the normal regulated production of a particular protein, including the structural coding sequence, promoters and enhancers.
Indirectly transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of such gene through the action of a molecule which cause enzymatic modification of a protein which binds to (l) the gene or (2) an RNA transcript of the gene, or (3) protein which binds to (i) the gene or (ii) an RNA transcript of the gene. For example, altering the activity of a kinase which subsequently phosphorylates and alters the activity of a transcription factor constitutes indirect transcript modulation.
Ligand means a molecule with a molecular weight of less than 5,000, which binds to a transcription factor for a gene. The binding of the ligand to the transcription factor transcriptionally modulates the expression of the gene.
Ligand binding domain of a transcription factor means the site on the transcription factor at which the ligand binds.
Modulatable transcriptional regulatory sequence of a gene means a nucleic acid sequence within the gene to which a transcription factor binds so as to transcriptionally modulate the expression of the gene.
Oncogene means a normal cellular gene which has been activated by one of several possible mechanisms, including point mutations, translation, amplification or overexpression contributes to the malignant phenotype of a cancer cell.
Receptor means a transcription factor containing a ligand binding domain.
Specifically transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of such gene alone, or together with a limited number of other genes.
Transcription means a cellular process involving the interaction of an RNA polymerase with a gene which directs the expression as RNA of the structural information present in the coding sequences of the gene. The process includes, but is not limited to the following steps: (1) the transcription initiation, (2) transcript elongation, (3) transcript splicing, (4) transcript capping, (5) transcript termination, (6) transcript polyadenylation, (7) nuclear export of the transcript,
(8) transcript editing, and (9) stabilizing the transcript.
Transcription factor for a gene means a cytoplasmic or nuclear protein which binds to (1) such gene, (2) an .RNA transcript of such gene, or (3) a protein which binds to
(i) such gene or such RNA transcript or (ii) a protein which binds to such gene or such RNA transcript, so as to thereby transcriptionally modulate expression of the gene.
Transcriptionally modulate the expression of a gene means to change the rate of transcription of such gene.
Triple helix means a helical structure resulting from the binding of one or more oligonucleotide to double stranded DNA.
Tumor suppressor gene means a normal cellular gene, the loss of whose function contributes to the malignant phenotype of a cancer cell.
The invention provides a method of directly transcriptionally modulating the expression of an oncogene or a tumor suppressor gene, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism. This method comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the oncogene or the tumor suppressor gene product encoded by the gene which is expressed by the cell. In this 2C method the molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the oncogene or the tumor suppressor gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
In one embodiment the molecule does not naturally occur in any cell of a lower eucaryotic organism such as yeast.
In a preferred embodiment, the molecule does not naturally occur in any cell, whether of a multicellular or a unicellular organism. Alternatively, the molecule is naturally occurring, but not normally found in the cell. In a presently more preferred embodiment, the molecule is not a naturally occurring molecule, e.g. is a chemically synthesized entity.
The cell in the above methods may be a cell of the multicellular organism, such as an animal cell, e.g. a human cell.
The method of the invention permits modulation of the transcription of the gene which results in upregulation or downregulation of expression of the oncogene or the tumor suppressor gene, depending on the identity of the molecule which contacts the cell.
In one embodiment the molecule binds to a modulatable transcription sequence of the gene. For example, the molecule may bind to a promoter region upstream of the coding sequence encoding the oncogene or the tumor suppressor gene.
In one embodiment of the method of the invention the molecule comprises an antisense nucleic acid which is complementary to a sequence present in a modulatable, transcriptional sequence. The molecule may also be a double-stranded nucleic acid or a nucleic acid capable of forming a triple helix with a double-stranded DNA.
In accordance with the method of this invention, the oncogene may be a mutant c-neu gene, a mutant c-K-ras gene, a mutant c-H-ras gene, a mutant c-N-ras gene, a phl-abl gene fusion, a mutant myc gene, a mutant fms gene, a mutant erbA gene, a retroviral oncogene or a mutant p53 gene. The tumor suppressor gene may be a p53 gene, a retinoblastoma gene, a Wilms' tumor gene, a neurofibromatosis type 1 gene, a DCC gene, an erbA gene, or an adenomatous polyposis coli gene.
The invention further provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or the tumor suppressor gene. This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the oncogene or the tumor suppressor gene, (ii) a promoter of the oncogene or the tumor suppressor gene, and (iii) a DNA sequence encoding a polypeptide other than the oncogene or the tumor suppressor gene product, which polypeptide is capable of producing a detectable signal and which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or the tumor suppressor gene, causes a measurable detectable signal to be produced by the polypeptide so expressed. The amount of the signal produced is quantitatively determined and the amount so determined compared with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule so as to identify the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and identify the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or the tumor suppressor gene.
Additionally, the invention provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or a tumor suppressor gene. The method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested. The cells comprise DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the oncogene or the tumor suppressor gene, (ii) a promoter of the oncogene or the tumor suppressor gene, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or tumor suppressor gene, causes a measurable change in the amount of the polypeptide produced. The amount of the polypeptide is quantitatively determined and compared with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule so as to identify the molecule as one which causes a change in the amount of the polypeptide expressed, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or the tumor suppressor gene.
A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or a tumor suppressor gene, is also provided. This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested. Each of the cells comprise DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the oncogene or the tumor suppressor gene, (ii) a promoter of the oncogene or tumor suppressor gene, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or the tumor suppressor gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence. The amount of the mRNA produced is quantitatively determined the amount so determined compared with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule so as to identify the molecule as one which causes a change in the detectable mRNA amount of, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or the tumor suppressor gene.
In the above methods the sample preferably comprises cells in monolayers or suspension. The cells are typically animal cells, e.g. human cells. The predefined 30 number of cells is preferably from about 1 to about 5 X 105 cells, or from about 2 X 102 to about 5 X 104 cells. The predetermined amount or concentration of the molecule to be tested is typically based upon the volume of the sample, or be from about 1.0 pM to about 20 μM, or from about lOμM to about 500μM. The contacting may be effected from about 1 to about 24 hours, or from about 2 to about 12 hours, it may also be effected with more than one predetermined amount of the molecule to be tested.
The molecule to be tested may be a purified molecule. Additionally the modulatable transcriptional regulatory sequence may comprises a cloned genomic regulatory sequence. The DNA referred to in the above methods may consist essentially of more than one modulatable transcriptional regulatory sequence. The DNA sequence encoding the polypeptide may be inserted downstream of the promoter of the oncogene or tumor suppressor gene by homologous recombination.
In these methods the polypeptide may be a luciferase, chloramphenicol acetyltransferase, β glucuronidase, β galactosidase, neomycin phosphotransferase, alkaline phosphatase or guanine xanthine phosphσribosyltransferase. The polypeptide may be capable of complexing with an antibody, or biotin.
The mRNA may be detected by quantitative polymerase chain reaction.
A screening method which comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested, is also included.
The plurality of samples may comprises more that about 10* samples, or more than about 5 X 10* samples.
Pursuant to the provisions of the Budapest Treaty on the International Recognition of Deposit of Microorganisms for Purpose of Patent Procedure, the plasmid and the cell lines listed below have been deposited with the American Type Culture Collection ("ATCC") , 12301 Parklawn Drive, Rockville, Maryland 20852, U.S.A.,:
1. a plasmid designated pUV106, deposited under ATCC Accession No. 40946.
2. a human colon adenocarcinoma cell line, transfected with pHRA521, designated H21, deposited under ATCC Accession No. CRL 10640.
3. a HTB-30 human colon adenocarcinoma cell line, transfected with pNEU106, designated N-2, deposited under ATCC Accession No. CRL 10658.
4. a SW 480 human breast carcinoma cell line, transfected with pKRAS106, designated K-2, deposited under ATCC Accession No. CRL 10662.
5. a K562 cell line, transfected with pNEU106, designated bK108, deposited under ATCC Accession No. CRL 10665.
6. a NIH Swiss mouse embryo cell line, NIH 3T3, transfected with the MMTV reporter plasmid, designated M10, deposited under ATCC Accession No. CRL 10659. Further provided is a method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more oncogenes or tumor suppressor genes according to the methods described above.
A screening method where more than about 103 samples per week are contacted with different molecules is encompassed by this invention.
Further provided is a method for directly transcriptionally modulating in a multicellular organism the expression of an oncogene or a tumor suppressor gene, the expression of which is associated with a defined physiological or pathological effect in the organism. This method comprises administering to the organism an a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect. In this method the molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the oncogene or the tumor suppressor gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
The molecule may bind to a modulatable transcription sequence of the gene. The molecule may comprise an antisense nucleic acid, a double-stranded nucleic acid molecule, a nucleic acid capable of forming a triple helix with double-stranded DNA. The multicellular organism may be an animal including a human being.
The physiological effect may be the protection of non- neoplastic cells from damage by chemotherapeutic agents and the defined pathological effect may be a disorder and modulated expression of an oncogene or tumor suppressor gene is associated with amelioration of the disorder. The defined pathological effect may be cancer or leukemia. The cancer may include malignant melanoma, lung cancer, colon cancer, pancreatic cancer, ovarian cancer or breast cancer.
The administering in the preceeding method may comprise topical contact, oral, transdermal, intravenous, intramuscular or subcutaneous administration.
Methods of administration of molecules in the practice of the invention are well known to those skilled in the art as are methods of formulating the molecule for administration depending on the specific route of administration being employed.
This invention is illustrated in the Experimental Detail section which follow. These sections are set forth to aid in an understanding of the invention but are not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow thereafter.
EXPERIMENTAL DETAILS
MATERIALS AND METHODS
A. Cell Culture
All media and reagents used for routine cell culture were purchased from Gibco (Grand Island, NY) , Hazelton
(Lenexa, KS) , or Whittaker M.A. Biologicals (Walkersville, MD) . Fetal calf serum (FCS) was from
Hyclone (Logan, UT) .
A human colon adenocarcinoma cell line, SW480 (ATCC CCL 228) was used for experiments concerning expression of the three ras proto-oncogenes and the p53 tumor suppressor gene. This cell line was maintained on DMEM, 15% fetal calf serum (FCS), 1% Nonessential amino acids (NEAA) . Stable transfectants of this cell line were selected in the same medium with the addition of G418 (Geneticin, Gibco) to a final concentration of 0.6 mg/ml.
A human breast adenocarcinoma derived cell line, SK-BR-3 (ATCC HTB 30) was used for the e.xperiments concerning expression of the neu (erbB2) proto-oncogene. This cell line was maintained on DMEM, 15% FCS and 1 μg/ml insulin. Stable transfectants of this cell line were selected in this same medium with the addition of G418 to a final concentration of 0.4 mg/ml.
A human chronic myelogenous leukemia derived cell line, K562 (ATCC CCL 243) was used for experiments concerning the expression of the phi promoter.
A human hepatocellular carcinoma derived cell line, Hep3B (ATCC# HB8064) , was used for transfection of plas ids containing the cytomegalovirus (CMV) promoter (used as a control for the high throughput screen) . These cells were maintained on MEM:OptiMEM (1:1) supplemented with 10% FCS.
A murine embryonic fibroblast cell line, NIH3T3 (ATCC# CCL92) , was used for the transfection of plasmids carrying the MMTV promoter (a control cell line) . These cells were maintained on DMEM, supplemented with 10% FCS.
B. Construction of the Luciferase-Fusion Reporter Vector
Unless otherwise indicated, molecular cloning procedures were performed essentially according to Maniatis et al. (42) . Oligonucleotides were synthesized by the beta-σyanoethyl phosphoramidite method according to protocols provided by the manufacturer of the DNA-synthesizer (Model 380A, Applied Biosystems (Foster City, CA) .
A mammalian expression shuttle vector was designed to allow the construction of the promoter-reporter gene fusions to be used in high-throughput screens to identify transcriptionally modulating chemicals. Features of the plasmid are shown in Figure 1. The shuttle vector was constructed in several steps.
The firefly luciferase gene was removed from the plant expression plasmid pD0432 (111) (Figure 2) as a 1.9 kb BamHI fragment and cloned into the BamHI site of pSVL (Pharmacia, Pisσataway, NJ) , a mammalian expression vector containing the SV40 promoter. The resulting plasmid (pSVLuci; Figure 3) was digested with Xhol and Sail to produce a 2.4 kb fragment containing the luciferase coding sequences and the SV40 late polyadenylation site. This fragment was inserted into the Xhol site of pMSG (Pharmacia, Piscataway, NJ) , a eucaryotic expression vector containing the MMTV promoter. The resulting MMTV promoter-luciferase fusion plasmid (pMLuci; Figure 4) was used to transfect NIH/3T3 cells as described below. Similar constructs can be made using luciferase vectors from Clontech (Palo Alto, CA) .
Six oligonucleotides (pUV-1 through pUV-6) were synthesized (see Figure 5 for sequence) (SEQ ID NO: 1-6) . The sequences of pUV-1, pUV-2 and pUV-3 correspond to a multicloning site, the beta-globin leader sequence and the first 53 bases of the firefly luciferase coding region. The sequences of pUV-4, pUV-5 and pUV-6 are complementary to the first three oligonucleotides. The pUV oligonucleotides were annealed, ligated and inserted into the Sall/EcoRI sites of pTZ18R (Pharmacia, Piscataway NJ) (Figure 6) . The resulting vector was then digested with Smal/PvuII and the oligonucleotide containing fragment was cloned into the pBluescriptKS(+) plasmid (Stratagene, La Jolla, CA) , previously digested with PvuII, to yield pUVOOl (Figure 6) . Several fragments were ligated into pUVOOl to create pUVlOO. The luciferase coding sequences (except first 53 bases) and polyadenylation site were obtained as a 1.8 kilobase Xbal/Xmal fragment from pMLuci (section B-l, Figure 4) . The SV40 early splice site and the SV40 late polyadenylation site were obtained as an 871 bp Xmal/Ba HI fragment from pMSG (Pharmacia, Piscataway NJ, Figure 7). Both DNA fragments were cloned into pUVOOl, previously digested with Xbal/BamHI to yield pUVlOO (Figure 7) .
A 476 bp fragment containing a dimeric SV40 polyadenylation site was then cloned into the Bell site of pUVlOO (Figure 8) . To do this, a 238 bp BclI/BamHI fragment was obtained from SV40 genomic DNA (BRL) , ligated, digested with BclI/BamHI, gel isolated, and inserted into pUVlOO, resulting in the vector pUV100-3 (Figure 8) . Linkers containing one Sfil and one Notl restriction site were then cloned into the PvuII/BamHI sites of pUVlOO-3. Two sets of linkers were synthesized containing the Sfil site in opposite orientations (oligonucleotides D-linkl and D-link2 and oligonucleotides R-linkl and R-link2). The sequences of the oligonucleotides (SEQ ID NO: 7-10) were:
5' GATCGGCCCCTAGGGCCGCGGCCGCAT 3' (D-linkl) 5' ATGCGGCCGCGGCCCTAGGGGCC 3' (D-link2) 5' GATCGGCCCTAGGGGCGGCCGCAT 3' (R-linkl) 5' ATGCGGCCGCGGCCCCCTAGGGCC 3« (R-link2)
The plasmid that contains D-link oligonucleotides was named pUV102 and the plasmid that contains R-link oligonucleotides was named pUV103 (Figure 9) .
The neomycin resistance gene (neo) was then placed under control of the Herpes Simplex Virus thymidine kinase (HSV-TK) promoter to generate a resistance cassette which is free of known enhancer sequences. To do this the HSV-TK promoter was synthesized using four oligonucleotides (Figure 10) (SEQ ID NO: 11-14) designed according to published sequence information (44) , and including an Sfil restriction site 5' of the HSV-TK sequences. These oligonucleotides were phosphorylated, annealed, ligated and inserted into pUVlOO digested previously with Hindlll/Nhel, generating the vector pTKL 100 (Figure 11) . After verifying the HSV-TK sequence, the about 3.5 kb Nhel/Smal fragment was isolated from pTKLlOO, and the about 0.9 kb BstBI/Bglll fragment containing the neo coding region was isolated from pRSVNEO (45) . These two fragments were filled in with Klenow polymerase and ligated to form pTKNEO (Figure 12) . An additional Sfil site was then inserted 3' of the neo gene by isolating the about 1.8 kb Sfil/BamHI and about 2.6 kb Sfil/PVUII fragments of pTKNEO and conducting a three way ligation along with a synthesized Sfil oligonucleotide generating pTKNE02 (Figure 13) (SEQ ID NO: 15-16) . The HSV-TK/NEO vector containing an optimized Kozac sequence was also utilized (Stratagene, La Jolla, CA, pMClNEO) . An additional vector was constructed by replacing the about 0.9 kb EcoRI/Sall fragment of pTKNE02 with the about 0.9 kb EcoRI/Sall fragment from pMClNEO. This vector was termed pTKNE03. (Figure 14). The Sfil fragment of pTKNE03, containing the TK promoter and the neomycin resistance gene, was cloned into the Sfil site of pUV102 to yield pUV106.
C. Molecular Cloning of Oncogene and Tumor Suppressor Promoters and Insertion into the ammalian Expression Shuttle Vector
Strategy: This section describes (a) the molecular cloning of the promoter and transcriptionally modulatable regulatory sequences of the human (I) neu (c-erbB2) , (II) K-ras. (Ill) H-rasf (IV) N-ras proto-oncogenes, the (V) phi promoter (responsible for the expression of the phl- abl oncogene fusion following the translocation event characteristically observed in chronic myelogenous leukemia (generating the Philadelphia chromosome) , and the (VI) p53 tumor suppressor gene, and (b) the making of constructs where these regulatory sequences control the expression of the firefly luciferase gene. These constructs were transfected into cells as described in below and analyzed for their utility as reporters for the discovery of gene expression modulating compounds (for example, in a high-throughput screen to identify chemicals acting as specific transcriptional modulators.
To make such constructs, several kilobases of sequence upstream of the transcription start site, along with 5' untranslated sequences up to the translation start site (ATG) , of a gene of interest were inserted 5' of the luciferase coding region, along with any additional sequences (e.g. intronic enhancers) required for properly regulated expression of the luciferase reporter. In this way constructs can be made where all sequences upstream of their translation start site are from the gene of interest, and all coding sequences are from the luciferase gene. How this was accomplished for the individual oncogenes is described below.
1. neu (c-erbB2 reporter vector
Oligonucleotide probes based on the published sequence (46) of the 5' region of the c-erbB2 gene were synthesized and used to screen a human leukocyte genomic library (Clontech Inc.). A 3.2 kb Bgll fragment from a positive plaque, containing the upstream regulatory elements, the 5' untranslated leader and exon 1 was then subcloned into pBluscriptKS(+) , generating pNEUOOl. A 1.8 kb HincII-NcoI fragment from pNEUOOl, containing the upstream regulatory elements and most of the 5' untranslated leader was purified by preparative gel electrophoresis and ligated into pUV103 previously digested with SnaBI and Ncol, generating pNEU002. Two oligonucleotides (SEQ ID NO: 17-18) were synthesized:
5'-CATGGGGCCGGAGCCGCAGTGAGCAC-3• and 5'-CATGGTGCTCACTGCGGCTCCGGCCC-3' 40
These oligonucleotides were annealed to one another, phosphorylated and ligated into Ncol digested pNEU002, generating pNEU103. The synthetic linker fuses the DNA coding for the neu 5' untranslated leader to the luciferase open reading frame such that the AUG utilized for translation initiation of the neu gene forms the first codon of the luciferase gene. The Scal-Xbal fragment of pNEU103, containing vector sequences, the upstream regulatory elements, the 5'untranslated leader and a portion of the luciferase open reading frame, was purified by preparative gel electrophoresis and ligated into pUV106 which had previously been digested with Seal and Xbal, generating pNEU106 (Figure 15) . Linearized pNEU106 was used in the transfeetions to generate the neu-luciferase reporter cell lines as described below.
2. K-ras reporter vector
Oligonucleotides based on the published K-ras sequence (47) were used to isolate two genomic clones by standard methods from a human leukocyte library (Clontech) . DNA from these two phages was subcloned into pBluscriptKS(+) (Stratagene) generating pKS4 and pKSll.
A 4 kb Xhol-Stul fragment of pKSll, containing most of intron 1 and exon 1 up to a point 11 bases 5' of the point of translation initiation, was isolated by preparative gel electrophoresis and ligated into Xhol- Stul digested pGEM7Zf (Promega) which had been previously modified by inserting an adaptor the Apal and Xhol sites in the original vector. This adaptor comprised of two Oligonucleotides (S'-TCGAGATCTGAGGCCTGCTGACCATGGGGGCC-S' and 5•-CCCATGGTCAGCAGGCCTCAGATC-3») (SEQ ID NO: 19-20) annealed to one another and was used to allow the proper alignment of the K-ras ATG initiator codon with the luciferase ORF in the final construct (below) . The resulting plasmid was designated pGEM715.
A 3 kb HinDIII-XhoI fragment from pKS4, comprising 2.2 kb of K-ras untranscribed upstream DNA and sequences coding for exon 0 and part of intron 1 was purified by preparative gel electrophoresis and ligated into pGEM715 which ad been previously digested with HinDIII and Xhol to generate pGEM7.
A 7.7 kb HinDIII-NcoI fragment of pGEM7, comprising 2.2 kb of K-ras upstream regulatory elements, exon 0, intron 1, and part of exon 1 (to the ATG at the Ncol site) , was purified by preparative gel electrophoresis and ligated int pUV102 which had previously been digested with HinDIII and Ncol to generate pKRAS102. The TK-Neo fragment from pTKNeo3 was then ligated into the Sfil site of pKRAS102 to generate pKRAS106 (Figure 16) , the vector used foe transfections to generated the stable reporter cell lines.
3. H-ras reporter vector
A 6.4 kb .BamHI fragment, containing the entire H-ras gene was isolated from a genomic DNA library by conventional means. This BamHI fragment was subcloned into the BamHI site of pSV2Neo (48) generating pHRASOOl. A 1.7 kb
BamHI-Mstll fragment containing the H-ras untranscribed regulatory elements and the 5' untranslated leader including intron-1 (up to within 9 bp of the sequences encoding the H-ras ATG translation initiation site) was purified by preparative gel electrophoresis, and along with an adaptor (5'-TGAGGAGC-3' and 5•-CATGGCTCC-3' annealed together) ligated into Bglll-Ncol cut pUV102 generating pHRAS102. The TK-Neo3 fragment of pT.KNeo3 was then ligated into the Sfil site of pHRAS102 to generate pHRAS106 (Figure 17), the vector used to generate the stable H-ras reporter cell line.
_, N-ras reporter vector
Oligonucleotides, based on the published sequence of the human N-ras gene (57) are synthesized and used to screen a human leukocyte genomic library (Clontech) . Positive plaques are subcloned as 8 kb EcoRI fragments containing the upstream regulatory elements, 5* untranslated leader, exons 1 and 2, intron 1 and a portion of intron 2, into pBluscriptKS(+) , generating pNRASOOl. A 4.5 Kb Ncol- HinDIII fragment containing the upstream regulatory elements and most of the 5' untranslated leader, is purified by preparative gel electrophoresis and ligated along with a 75 bp synthetic HinDIII-NcoI linker, into pUV102 which had previously been digested with Ncol, generating pNRAS102. The Sfil pTKNeo3 fragment containing the neomycin resistance gene was then ligated into the Sfil site of pNRAS102, generating, pNRAS106 the final reporter vector (Figure 18) .
5. phl-abl reporter vector
For the isolation of the phi promoter, five oligonucleotides were synthesized which were complementary to regions within the first exon. These oligonucleotides were used to screen a human leukocyte genomic library (Clontech) . Positive clones were restriction mapped, subcloned and sequenced. one subclone contained 534 bases upstream of the putative transcription start site (based on a published cDNA sequence) , the region corresponding to the long 5• untranslated leader (472 bases) , and 175 bases of the coding region in the first exon (Figure 19) . This subclone was used to construct a series of four promoter- luciferase reporter vectors, each with a different amount of 5' upstream DNA. These plasmids are illustrated in Figure 20. Plasmid 1 consists of the 4 kb Xba I fragment ligated into Xba I-Spe I digested pUV103. Plasmid 2 consists of the 1.2 kb Bgl 11-Xba I fragment ligated into Bgl II-Xba I digested pUV103. Plasmid 3 consists of Bal I-SnaB I deletion of Plasmid 2. Plasmid 4 consists of the 135 bp X a I-Xba I fragment inserted into pUVl03.
6. P53 reporter vector
The arrangement of promoters, 5' untranslated exons and a large (10 kb) first intron precludes the construction of a p53 reporter vector which includes all of the promoter elements and the complete untranslated leader such that the AUG initiator codon of the normal p53 0RF becomes the first codon of the luciferase ORF. As an alternative, fusion constructs which are similar to those successfully employed by others for the analysis of the expression of this gene are used. There are two promoters which play a role in the regulated expression of the p53 tumor suppressor gene. Because it is not yet clear which of these two promoters is the most important for determination of the cellular level of the p53 protein, two plasmids are constructed, each fusing one of the promoters to the luciferase open reading frame. Oligonucleotides based on the published sequence are used as probes to isolate genomic p53 clones from a human leukocyte library (Clontech) . Subclones of this original clone serve as a source of the fragments used to construct both of the p53 reporter vectors. The p53Pl containing region is isolated as a 2.4 kb EcoRI-Xbal fragment essentially as described in reference (49) . This 44 fragment is rendered blunt ended by Klenow fragment and ligated into SnaBI digested pUV106, the proper orientation of the fragment is confirmed by restriction mapping, generating pP53ll06 (Figure 21) . The p532 promoter is isolated as a 1.4 kb Xbal-Bglll fragment, essentially as described in (50) . The Xbal site is rendered blunt ended with Klenow fragment prior to the secondary digestion by Bglll. The resulting fragment is purified by preparative gel electrophoresis, and this fragment is then ligated into pUV106 which had previously been digested with SnaBI and Bglll, generating pP532106 (Figure 22) .
7. CMV reporter vector
A 580 bp cytomegalovirus genomic fragment containing the immediate early promoters and enhancers (51) was ligated into pUVlOO previously digested with Notl and Nhel and rendered blunt ended by treatment with Klenow fragment, generating pUVCM. An 888 bp Nael-Xbal fragment from pUVCM, including the CMV promoter and enhancers plus a portion of the luciferase coding region, was purified by preparative gel electrophoresis and ligated into pUV106 which had previously been digested with SnaBI and Xbal, generating pCM106 (Figure 23) , the vector used to transfect the CMV reporter cell lines.
D. Construction of Mini-genes
As a secondary analysis of compounds identified as able to repress the synthesis of specific oncogenes, a series of "mini-genes" were constructed. A mini-gene is the fusion of promoter elements identical to those used to construct luciferase reporter vectors, fused to the cDNA of the activated oncogene. These constructs, when transfected into an appropriate host cell line, lead to its phenotypic transformation. Compounds which repress the activity of the regulatory elements lead to a reversal of the transformed phenotype. The construction of the c-erbB2 and K-ras minigenes are described below.
i c-erbB2 minigene
The 1.7 kb erbB2 promoter fragment (Sall-Ncol) was purified from pNEU102 and combined an Ncol-Sall cDNA fragment isolated form a commercially available breast carcinoma cDNA library (Clontech) according to the supplier's directions. A 26 bp linker was inserted into the Ncol site to correctly fuse the untranslated leader to the ATG initiation codon (Figure 24) .
2__ K-ras minigene
The K-ras promoter fragment was isolated as a HinDIII- Stul fragment from pKRAS106. A K-ras cDNA containing plasmid was obtained from the ATCC (ATCC# 41027) and mutated by oligonucleotide mutagenesis (Ammersham) to generate a cDNA encoding a mutant K-ras protein with an aspartic acid at position 12. A Stul-Xhol fragment containing the K-ras coding region was ligated to the promoter fragment, generating the final minigene (Figure 25).
E. Liquid Scintillation Counter Bioluminescence Assay
To assay for luciferase expression in transient expression assays in the various transfected clones (see below) , cells were incubated with various transcriptional inducers in serum free defined media, washed 3 times with Dulbecco's phosphate-buffered saline (D-PBS, Gibco) and lysed in Lysis Buffer 1 (50 mM Tris acetate pH 7.9, 1 mM EDTA, 10 mM magnesium acetate, 1 mg/ml bovine serum albumin [BSA], 0.5% Brij 58, 2 mM ATP, 100 mM dithiothreitol [DTT]) . All reagents were obtained from Sigma except for DTT which was from Boehringer Mannheim. After lysis, cell debris was sedimented by brief centrifugation, and 950 μl of supernatant extract were added to a glass scintillation vial. Samples were counted individually in an LKB (Gaithersburg, MD) scintillation counter on a setting which allows measurement of individual photons by switching off the coincidence circuit. The reaction was started by addition of 50 μl of 2mM luciferin (Sigma, St. Louis, MO or Boehringer. Mannheim, Indianapolis IN) in Buffer B (Buffer B-Lysis Buffer 1 without Brij 58, ATP and DTT) to the 950 μl of lysate. Measurement was started 20 seconds after luciferin addition and continued for 1 minute. Results were normalized to protein concentration using the Bradford protein assay (BioRad, Richmond CA) or to cell numbers using Trypan Blue (Sigma) exclusion counting in a hemocytometer.
F. Transfection
Cell were transfected by one of three methods, following manufacturer's instructions; by calcium phosphate precipitation (Pharmacia) , lipofection (Life Technologies Inc.) or electroporation (BioRad). In most cases, 25-75 μg of plasmid DNA, linearized by a single restriction endonuclease cut within the vector sequences, was electroporated into approximately 5 million cells. When co-transfection of a separate neomycin resistant plasmid was employed the molar ratio of luciferase fusion plasmid to neomycin resistant plasmid was either 10:1 or 20:1. Neomycin resistant clones were selected by growth in media containing G418 (Geneticin, Gibco) .
G. Southern blotting
To monitor correct and complete stable integration of transfected promoter/reporter constructs, stably transfected cell clones were subjected to Southern blot analysis (52) . Genomic DNA was prepared of each clone to be tested and restriction-cut with Dral or another appropriate restriction endonuclease. After electrophoresis, transfer to nylon filters and immobilization by UV irradiation using a Stratalinker UV device (Stratagene, La Jolla, California) , integrated promoter/luciferase fusion constructs were visualized by probing with radioactively labelled Xbal-EcoRI fragments of the luciferase coding region. Probes were labelled using the random primer method (53) . Since Dral cuts in the SV40 polyadenylation sites located in the mammalian expression shuttle vector just upstream the inserted promoter sequences as well as downstream of the luciferase coding region, but not in most of the promoter sequences used for generating stably transfected cell clones, a single fragment should be visualized by the probe used. The size of that fragment should be characteristic for each of the promoter sequences analyzed.
.Ϊ Isolation of Total Cellular RNA
Total cellular RNA was isolated from the luciferase- fusion containing cell clones or from untransfected host cells following incubation with various transcriptionally modulating chemicals known previously to affect gene expression. Total cellular RNA was isolated using the RNAZol method (CINNA/BIOTECX, Friendswood, TX, Laboratories international. Inc.). Cells were resuspended and lysed with RNAZol solution (1.5 ml/9 cm petri dish) and the RNA was solubilized by passing the lysate a few times through a pipette. Chloroform was added to the homogenate (0.1 ml/1.0 ml), and samples were shaken for 15 seconds followed by a 5 minute incubation on ice. After centrifuging for 10 minutes, the upper phase was collected and an equal volume of isopropanol was added. Samples were incubated for 45 minutes at -20°C, and the RNA was pelleted for 15 minutes at 12,000 x g at 4°C. The RNA pellet was then washed with 70% ethanol and dried briefly under vacuum.
I. Polymerase Chain Reaction
Total RNA was isolated using the approach described above, first strand cDNA generated by either oligo dT, random hexamer or gene specific oligonucleotide priming. Specific amplification oligonucleotides were added, and the polymerase chain reaction carried out according to established methods (54) .
RNA levels are quantitated by established methods (55) which include the addition of varying amounts of a control RNA and thereby establishing a standard curve. PCR products are visualized on an ethidium bromide stained agarose gel and are quantitated by measuring the incorporation of radiolabelled deoxynucleotide triphosphates using liquid scintillation.
J. Specific PCR mRNA Detection and Quantitation of Oncogenes and Tumor Suppressor Genes
Oligonucleotides (SEQ ID NO: 21-34) were designed for the specific detection of each of the genes to be analyzed:
-CTCTTGGATATTCTCGACACACAGCA-3' -GTGTCTACTGTTCTAGAAGG-3*
GCACGCACTGTGGAATCTCGG-3• -ACGTCGAGTACGTCGGCCCCGGTG-3'
-GCCCACGAACTGGCCAAGAGTT-3• -CTGAGTCCCATCATCACTGCTCTT-3»
-CCAATGCCAGCCTGTCCTTCCTGCAG-3' -GATCAAGACCCCTCCTTTCAAGATCT-3'
-ATTCCGCTGACCATCAATAAGGAAG-3• -ATAGCCTAAGACCCGGAGCTTTTCAC-3'
-GATGGAGAATATTTCACCCTTCAG-3' -CTGACCCTTTTTGGACTTCAGGTGG-3•
-CTCCAGCCCGCAGCTCCAGGAGTCTG-3'
Figure imgf000051_0001
-CCCTCTACACTGGCAGTTCCACCTG-3'
In each case, these oligonucleotides were chosen to amplify sequences which span intron splice junctions in order to minimalize the nonspecific signal generated by contaminating genomic DNA (55) . In the case of the K- ras oligos bind to sequences within exons II and III, flanking intron 2. In the case of H-ras and N-ras. the oligos bind to sequences within exons III and IV, flanking intron 3. In the case of c-erbB2. the oligos bind to sequences in exons II and IV flanking introns 2 and 3 and amplifying DNA corresponding to exon III. In the case of phl-abl the oligos bind to sequences within exon III of the bcr region and exon II of abl flanking two introns in the chimeric message and amplifying DNA corresponding to exon I of abl. In the case of p53 the oligos bind to sequences within exons IX and XI and amplify DNA corresponding to exon X. The oligonucleotides for M-CSF are used in control experiments and are complementary to regions of M-CSF exons VI and VIII and amplify the region corresponding to exon VII.
K. High Throughput Quantitative PCR
Current methods for measuring changes in gene expression suffer from various limitations. Conventional direct analysis of changes in mRNA levels (nuclease protection, Northern blot, primer extension) lack sufficient sensitivity for use with high throughput formats (e.g. 96 well plate cell culture) . These methods also require difficult analytical procedures (e.g. sequencing gels) complicating automation. The use of gene fusions (luciferase or CAT transcriptional fusions) as demonstrated above, provide sufficient sensitivity and ease of analysis but require disruption of the native transcription unit and loss of chromosomal context, leading to potential artifact. This section of the invention proposes to circumvent the sensitivity limitation of direct analysis by using the amplification potential inherent in the polymerase chain reaction. Combining PCR with the ease of florescence detection of will allow direct mRNA analysis in a high throughput mode.
The following description outlines a high throughput drug screen utilizing direct PCR quantitation of mRNA in its most simple format. 1. Grow cells. Cells are grown in 96 well microtiter plates as described above. The final detection step is a fluorescence measurement, so an opaque (non- reflecting black) plate is required.
2. Add compounds. As with the luciferase reporter screen, compounds are added at several concentrations and at several replications. The number of duplicate samples required can be determined statistically after the basic assay is formatted (currently, quadruplicates are required) .
3. Incubate. The incubation time depends on the biology of the systems studied. As with the current luciferase reporter assay, the incubation time is 24 hours.
4. Lyse cells: The cells are lysed in a buffer which satisfies several important criteria: A. avoidance of extremes of temperature; B. complete inactivation of contaminating cellular nucleases; C. compatible with subsequent RNA purification steps; D. rapid and efficient lysis. Chaotropic buffers have been described which satisfy these requirements. Guanidine HC1 (6M) will efficiently lyse cells and effectively inactivate cellular nucleases. The kinetics of nucleic acid hybridization are largely unaffected by these conditions. Thus, the subsequent RNA purification (separation using magnetic oligo dT beads, see below) does not require a buffer change.
5. Add external control: The exponential nature of the PCR amplification step tends to magnify small differences in conditions. Key to the usefulness of this approach is the careful inclusion of appropriate standards for control purposes. An artificial polyadenylated RNA (generated with phage T7 RNA polymerase and commercially available vectors, Promega Madison WI) is added at this point. This RNA serves as a control for all of the following steps: purification, cDNA synthesis, PCR amplification, PCR product purification and detection. This control RNA is added to several lysates at varying concentrations, generating a standard curve.
6. Purify RNA: RNA is purified using commercially available oligo-dT tagged magnetic beads. These beads are added to the lysate, allowed to hybridize to the mRNA, brought to the bottom of the plate using a strong magnet, and extensively washed to remove protein and DNA.
7. Synthesize cDNA: cDNA is generated using the 3' end of the bead bound oligo-dT.
8. Add PCR primers: Each gene (or control) to be assayed requires two oligos. The pair are designed so that they span a large intron. This makes the amplification much more RNA specific. The short, spliced RNA target is much more efficiently amplified than the longer, contaminating genomic DNA target. One of the oligo pair is tagged at its 5' end with a fluorescent label. The other oligo is tagged at its 5' end with biotin (for future purification, see below) . Several sets of oligos are added to each lysate. A set for each control and a set for each gene to be assayed. Every set has a different fluorescent tag. 9. PCR Amplification: Simultaneous incubation of many plates is frequently required, so either a large array of blocks or a large capacity convection oven is necessary.
10. Purification of PCR products: The PCR products are separated from the unreacted oligos using a method similar to the one employed for the initial RNA purification. Magnetic beads, tagged with streptavidan are added to the mixture. PCR products are tagged on one end with biotin (on the other with a fluorescent label) and tightly attach to the magnetic beads. The beads, along with the labeled oligonucleotides, are brought to the bottom of the plate with a magnet and extensively washed. Alternatively, fluorescently tagged PCR products are resolved electrophoretically and quantitated with a scanning gel fluorimeter (Applied Biosystems) .
11. Detection: The plates are read in a 96 well fluorimeter (Ammersham) .
12. Data analysis: A ratio of fluorescence from a particular gene's PCR product to the signal from the "constitutive" internal control gives the relative mRNA level. Changes in this ratio indicates a change in gene expression. Absolute mRNA levels are determined by control experiments using carefully quantitated artificial RNAs to construct standard curves for each gene studied. This establishes a given ratio (to the internal control) for a given cellular RNA concentration. L. Isolation of Single Cell Clones Containing Various Promoter-Luciferase Fusion Constructs
1. PMluci into NIH3T3 fMMTV control cell line!
pMluci and pSV2Neo, an antibiotic resistance plasmid (48) , were co-transfected into NIH/3T3 mouse fibroblast cells using the calcium phosphate precipitation method (56) with a commercially available kit (Pharmacia, Piscataway NJ) . Two days later, cells were transferred to media containing 0.4 mg/ml G418 and were grown for an additional 10-14 days. G418-resistant clones were isolated by standard methods. Once sufficient cell numbers were .obtained, clones were analyzed based on several criteria: constitutive luciferase production, induction of luciferase expression by dexamethasone (1 μ , Sigma, St. Louis, MO) , satisfactory attachment to microtiter plates used in the high-throughput screen (see section G) and acceptable standard deviation in multiple luciferase expression assays (see below for assay protocol) . This analysis was carried out using the luciferase assay conditions described above. Of the clones which satisfied the above criteria for the high throughput screen, one clone, M10, was selected for use.
2. neu fpNEU106i into HTB30
75 micrograms of the pNEU106 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into HTB30 human breast carcinoma cells. Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below) . The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone N-2) .
3. K-ras (PKRAS106Ϊ into SW480
75 micrograms of the pKRAS106 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into SW480 human breast carcinoma cells. Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below) . The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone K-2) .
4. H-ras (PHRA521) into human colon adenocarcinoma cell line
75 micrograms of the pHRA521 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into a human colon adenocarcinoma cell line. Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below) . The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone H21)
6. phi (PPHL106) into K562
75 micrograms of the pPHL106 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into K562 cells. Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below) . The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone bK108) .
7. P53 CPP531106 and PP532106) in SW480
75 micrograms of both the pP531106 and pP532106 plasmids are linearized by a single restriction endonuclease cleavage within the vector backbone and separately electroporated into SW480 human colon carcinoma cells. Neomycin resistant clones are isolated and tested for luciferase activity. Clones which test positive for luciferase production are subjected to Southern blot analysis (see below) . The best clones (producing the highest signal and carrying a single intact copy of the transfected DNA) representing each plasmid are utilized for high throughput screening (designated clones P531 and P532) .
8. pCM106 into Hep3B (a control cell line)
Hep3B hepatocellular carcinoma cells were transfected by electroporation with 75 micrograms of pCM106 which had been linearized by a single Seal cut within the vector backbone. Neomycin resistant colonies were isolated and tested for luciferase activity. Luciferase positive, neomycin resistant clones were subjected to Southern blot analysis (see below) . The best clone, producing the most luciferase activity from a single, correctly integrated vector was selected for use as the CMV reporter cell line in the HTP screen (this clone was designated CM1) . £ Hioh-Throuohput (HTPΪ Screening
Cell plating: Dynatech Microliter 96 well plates were custom pretreated for cell attachment by Dynatech Laboratories, Inc. (Chantilly, VA) . Alternatively, the 96 well plates were treated with 50 μl per well of human fibronectin (hFN, 15 μg/ l in PBS, Collaborative Research, Bedford, MA) overnight at 37°C. hFN-treated plates were washed with PBS using an Ultrawash 2 Microplate Washer (Dynatech Labs) , to remove excess hFN prior to cell plating. N-2 (the neu reporter) K-2 (the K-ras reporter) and CM1 (the CMV reporter, added as a control) maintained in their respective serum media (with 0.2 mg/ml G418) were washed with PBS, harvested by trypsinization, and counted using a hemocytometer and the Trypan Blue exclusion method according to protocols provided by Sigma, St. Louis, MO Chemical Company. Cells were then diluted into media (with 0.2 mg/ml G418), and 0.2 ml of cell suspension per well was plated using a Millipore MultiDrop Dispenser (Millipore Corp. , Bedford, MA) . Plates were incubated overnight at 37°C in a humidified 5% C02 atmosphere. Chemicals from the chemical file of one of Oncogene Science's corporate partners were dissolved in DMSO at concentrations of 3-30 mg/ml. The next day a fully automated device, as described in U.S. patent application #382,483, was used to incubate luciferase reporter cells in 96-well microtiter plates, transfer chemicals and known transcriptional modulators to the cells, incubate cells with the chemicals, remove the chemicals by washing with PBS, add lysis buffer to the cells and measure the bioluminescence produced. The cell lysis buffer was modified to also contain the luciferin. Therefore, lysis of cells and the bioluminescence reaction begin simultaneously and the production of bioluminescent light reaches a maximum at about 5 min. The level of light output declines by about 20% within further 30 min. For better lysis buffer stability bovine serum albumin has been omitted. This improved lysis buffer has been shown to remain fully functional for at least 12 hours, when kept on ice and protected from direct light.
RESULTS
A. In vivo signal half-life of the luciferase reporter system
When screening for inhibitors rather than inducers of transcription, the half-life of the reporter molecule becomes a crucial parameter in determining the minimal incubation time that would be necessary to allow enough decay of reporter molecules so that the inhibition of their synthesis became visible. The oncogene reporter cell line were therefore tested for the time dependency of luciferase activity after treatment of the cells with Actinomycin D an inhibitor of transcription. This experiment measured the combined half-life of luciferase mRNA and of the luciferase protein and compares the rate of signal decay of the H-ras. K-ras and c-erbB2 reporter cell lines to a CMV reporter cell line control. Cells derived from clones CMl (CMV) , K-2 (K-ras) , H21 (H-ras) and N-2 (c-erbB2) were seeded into 96-well microtiter plates and incubated overnight. At time 0, Actinomycin D (25 μg/ l) was added. At the times indicated in Figure 26, cells were washed with PBS and luciferase activity of Actinomycin-treated cells determined as described in Materials and Methods. The signal from the treated cells was compared to the luciferase activity of untreated controls. The logarithm of the treated/untreated ratio was plotted versus time, this data is shown in Figure 26. The calculated half-life of the signal from each of the four cell lines is shown in table 1. The half-lives were found to range from about 3 to 10 hours indicating that a 24 hour incubation with a 100% efficient inhibitor of transcription would be sufficient to reduce luciferase levels to 6% of the control in the tested cell lines.
Figure imgf000062_0001
B. Southern Blot
An autoradiogram from a typical Southern blot analysis is shown in Figure 27. Genomic DNA from five neomycin resistant, luciferase producing clones, transfected with the H-ras reporter vector pHRASlOβ was digested with Dral, blotted and probed as described in Materials and Methods, along with two control samples; one consisting only of genomic DNA from the untransfected host strain (SW480) and the other consisting of a mixture of SW480 genomic DNA and Dral digested pHRASlOβ (to provide a size control for the expected band. In this case all five clone produced the expected band (and no other) demonstrating that the transfected vector had integrated into the host cell genome with out undergoing gross rearrangement. In other transfections, correctly integrated vectors represented between 100% and 20% of the neomycin resistant, luciferase producing clones.
C. PCR Detection and Quantitation
To test the quantitative ability of the polymerase chain reaction, total RNA was isolated form U5637 bladder carcinoma cells and diluted in two-fold serial steps to yield samples ranging from 4 to 0.05 μg. These RNA samples were used to generate cDNA using random primers (55) and then mixed with a constant amount of phage lambda DNA (0.2 ng) as a control for amplification efficiency. Alpha-32P-dATP was included in the PCR buffer to allow quantitation of the amplified products. The M-CSF specific PCR oligonucleotides describe above were added to the standard reaction mixture (2 pmoles per sample) and PCR carried out for 35 cycles in a Perkin- Elmer-Cetus thermal cycler. The products of the reaction were electrophoresed on a 3% NuSieve agarose gel. The gel was dried and used to expose Kodak X-OMAT AR film. The resulting autoradiogram is shown in Figure 28. This autoradiogram was quantitated using an LKB laser densitometer, the data are shown in Figure 29. The graph plots the amount of M-CSF specific product divided by the constant lambda DNA signal. The reaction was clearly quantitative for the RNA samples between 0.05 and 1 μg (total RNA) , and proved to be a very sensitive assay for M-CSF mRNA, which is barely detectable in this cell line by conventional SI analysis.
To test the specificity of the PCR reaction, the oligos for detection of c-erbB2. N-ras. H-ras and K-ras were used to amplify cDNA derived from 10 and 0.4 ng of U5637 total RNA. The data are shown in Figure 30. In each sample a sample of phage lambda DNA and lambda control oligos was added to control for the efficiency of the PCR reaction. This is the uppermost, consistent band in each lane. In each case the oligos specifically amplifies a DNA fragment of the correct molecular weight. A few extra bands of unknown origin appear in the c-erbB2 lanes and in the lane representing the highest concentration of H-ras mRNA. H* Quality Assurance Analysis
A number of quality assurance criteria are routinely assessed during the course of high throughput screens. Data from QA analysis of a portion of Screen III are shown in Figures 31-34. Figure 31 shows an analysis of the consistency of the luciferase signal on various areas of each plate. The ratios of negative control values from three different areas within each plate are calculated and plotted versus plate number. The expected value is 1.0. Values greater than 1.5 or less than 0.4 indicate uneven signal generation across the plate. In this example 240 plates, representing 1440 compounds, tested against three cell lines, are shown. The coefficient of variance for the 12 negative control values from each of the same 240 plates are represented by the data shown in Figure 32. Values less than 20% are considered acceptable. Similar data for the 12 positive control values of the same plates are shown in Figure 33. Figure 34 shows the transcription induction ratio (TIR) for the positive controls of one cell line represented in the same set of 240 plates. The TIR is the ratio of the experimental values to the untreated controls. In this case the cell line is the K-ras reporter and the positive control is Actinomycin D a potent general inhibitor of transcription. Three values are shown for each plot, representing three different concentrations of Actinomycin D. The expected value for such an analysis depends on the half life of the signal and the incubation time (here 24 hours) , but for this combination, typical values range from 0.4 to 0.3 fold. E. Hjgh-Throuohput Drug Screen
Table 2 presents the data from a three week high throughput screen of 2334 compounds. Three cell lines were utilized; CMl (the CMV reporter cell line) as a control for nonspecific effects. N-2 (the c-erbB2 reporter cell line) and K-2 (the K-ras reporter cell line) . Each compound was assayed at three concentrations in quadruplicate. Each microtiter plate included a negative control row (no added compound) and a positive control row (Actinomycin D at three concentrations) . The data are reported as TIR (transcription induction ratio) which is the median of the samples quadruplicate values divided by the median of the negative control values. In this case transcriptional inhibitors are sought, so the selection criteria for lead compounds is that the test promoter be inhibited to 0.4 of the negative control while the other cell lines remain within 0.8X of the control value. During these three weeks 10 compounds scored positive for the specific inhibition of the K-ras promoter, 19 scored as leads for the inhibition of the c- erbB2 promoter and 39 compounds inhibited nonspecifically. Compounds scoring as leads in the primary screen are repeated and then subjected to secondary analysis such as effects on the minigene transfectant phenotypes (see above) .
REFERENCES
1. Bos, J.L. , 1989, Mutation Res. 195:255.
2. Perucho, M. , 1990, AACR Meeting, Washington, DC, abs 478). 3. Shakla, V.K. et al. (1989), Oncogene Res. 5:121)
4. Viola, M.V. et al. (1986) New Eng. J. Med., 314:133.
5. Curosa, M.A. et al. (1989) . J. Natl. Cancer Inst. fil: 63.
6. Fujita, K. et al. (1987) Gastroenterology 83:1339. 7. Slamon, D.J. et al, (1987), Science 235:177-182.
8. De Fiore, P.P. and Crawford, L.U., (1979), Nature 278:261.
9. Hudziak, R.M. et al, (1987), Proc. Natl. Acad. Sci. USA £1:7159. 10. Slamon, D.J., (1990), AACR Meeting, Washington, DC.
12. Linzer, D.I.H. and Levine, A.J., 1979, Cell 17:43.
13. Vogelstein, B. et al., (1988), New Engl. J. Med. 319:525.
14. Baker, S. et al., (1989), Science 244:217. 15. Bressac, B. et al., (1990), Proc. Natl. Acad. Sci. 87:1973.
16. Mackey, J. et al., (1988), Lancet II, 1384.
17. James, CD. et al., (1988), Cancer Res. 48:5546.
18. Yakota, J. et al., (1987), Proc Natl. Acad. Sci. M:9252.
19. Lane, D.P. and Benchimol, S., (1990), Genes and Devel. 4.:1.
20. Yanofsky, C. and Crawford, I.P. (1987) The Tryptophan Operon. In Escherichia coli and Salmonella typhimurium; Cellular and Molecular Biology (F.C. Neidhardt et al., eds.) Vol. 2, p. 1453.
21. Schlief, R. (1987) The L-Arabinose Operon. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (F.C. Neidhardt et al., eds.) Vol. 2, p. 1473.
22. McClure (1985), Ann. Rev. Biochem., 54:171.
23. Hoopes, B.C. and McClure, W.R. (1987) Strategies in Regulation of Transcription Initiation. In
5. Escherichia coli and Salmonella Typhimurium: Cellular and Molecular Biology (F.C. Neidhardt et al., eds.) Vol. 2, p. 1231.
24. Matthews, B.W. (1987), Cro repressor structure and its interaction with DNA. In DNA: Protein 0 Interactions and Gene Regulation (E.B. Thompson and J. Papaconstantinou, eds.) University of Texas Press, Austin.
25. Schlief, R. (1988), Science, 241:1182.
26. Evans, R.M. and Hollenberg, S.M. (1988), Cell, 52:1. 5 27. Landschulz, W.H. et al., (1988), Science, 240:1759.
28. Levine, M. and Hoey, T. (1988), Cell, ≤£:537.
29. Krainer, A.R. and Maniatis, T. (1988), RNA splicing. In Transcription and Splicing (Hames, B.D. and Glover, D.M., eds.) IRL Press, Washington, D.C., £ Vol. 1.
30. Proudfoot, N.J. and Whitelaw, E. (1988) Termination and 3' end processing of eukaryotic RNA. In Transcription and Splicing (Hames, B.D. and Glover, D.M., eds.) ERL Press, Washington, D.C., Vol. 1, p. 1 97.
31. La Thangue, N.B. and Rigby, P.W.J. (1988) Transacting protein factors and the regulation of eukaryotic transcription. In Transcription and Splicing (Hames, B.D. and Glover, D.M. , eds) IRL 0 Press, Washington, D.C., Vol. 1.
32. Maniatis, T. et al., (1987), Science, 236:1237.
33. Yamamoto, K.R. (1985), Ann. Rev., Genet., .19:209.
34. Denison, M.S. et al., (1988), Proc. Natl. Acad. Sci. USA, 15_:2528. 5 35. Hoeffler, J.P. et al.. Science, 242:1430. 36. Angel, P. et al., (1987), Mol. Cell. Biol., 7:2256.
37. Angel, P. et al., (1987), Cell, 4£:729.
38. Edelman, A.M. et al., (1987), P r o t e i n Serine/Threonine Kinases Ann. Rev. 56:567-613. 39. Yamamoto, K.K. et al., (1988), Nature, 334:494.
40. De Wet, J.R. et al., (1985), Proc. Natl. Acad. Sci. USA, 32:7870.
41. Engebrecht, J.M. et al., (1985), Science, 227:1345.
42. Maniatis, T. et al., (1987), Science, 236:1237. 43. Ow, D.W. et al., (1987) Science 234:856-859.
44. McKnight, S.L. (1982), Cell, 31:355.
45. Gorman, C. (1985), Vectors used in mammalian cell expression. In DNA Cloning. Vol. II (D.M. Glover, ed) . IRL Press, Washington, D.C. 46. Tal, M. et al., (1987), Mol. Cell. Biol. 7:2597- 2601.
47. Shimizu, K. et al. (1983), Nature 304: 497.
48. Pouwels, Ph.H. et al., (1985), Cloning Vectors. Elsevier Science Publishers, B.V. , Amsterdam. 49. Tuck, S.P and Crawford, L. (1989), Mol. Cell. Biol. :2163-2172. 50. Reisman, D. et al., (1988), Proc. Natl. Acad. Sci.
USA ≤S:5146-5150. 52. Southern, E. (1980), Methods in Enzymology, 69:152. 53. Feinberg, A. and Vogelstein, B. (1984), Anal. Biochem. 137:266. 54. Innis, M.A., Gelfand, D.H. , Sninsky, J.J. and White, T.J. (1990) , PCR Protocols: A Guide to Methods and Applications. Academic Press Inc. San Diego. 55. Wang, A. M. et al., (1989), Proc. Acad. Sci USA 81:9717-9721.
56. Graham, F.L. and Van der Ed, A.J. (1973), Virology, 5_2:456.
57. Taparowsky, E. et al., (1983), Cell :581-586. 58. Lau, L.F and Nathans, D. , (1991), Genes induced by serum growth factors, in The Hormonal Control of
Gene Transcription. (Cohen, P. and Foulkes, G.J., eds.), Elsevier Science Publishers, B.V. , Amsterdam, p 257.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Oncogene, Science Inc.
(ii) TITLE OF INVENTION: Methods of Transcriptionally Modulating Expression of Oncogenes and Tumor Suppressor Genes
(iii) NUMBER OF SEQUENCES: 34
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: John P. White, Esq.
(B) STREET: 30 Rockefeller Plaza
(C) CITY: New York
(D) STATE: New York
(E) COUNTRY: USA
(F) ZIP: 10112
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version
#1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: 17-JAN-1992
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: White, John P.
(B) REGISTRATION NUMBER: 28,678
(C) REFERENCE/DOCKET NUMBER: 26134-EI-PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 212-977-9550
(B) TELEFAX: 212-664-0525
(C) TELEX: 422523 coop ui
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
TGGATCGCAG CGCTGCCTTT CCT 23 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
CATGAGGAAA GGCAGCGCTG CGATCCAGCA C 31
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:3
TGGCGCAGCG CTCCAGGAGA AGCTG 25
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CGCTATGGAG TTGGCTCAAG CAGCCTGC
28
(2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GGCGGGTCTG TAGGCAGGTC GGCTC 25 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRI.PTION: SEQ ID NO:6:
CAGTAAGAGC TCAGCCCTTG CCCTGGGCAG G 31
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CTCCAGCCCG CAGCTCCAGG AGTCTG
26
5.
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs fi (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) 5
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: 0 CCCTCTACAC TGGCAGTTCC ACCTG
25
(2) INFORMATION FOR SEQ ID NO:9: 5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear 0
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GGCCAAGGAG GCCGAGAATA TCACG 25 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: 72
GCCAGACTTC TACGGCCTGC TGCCCGAC 28
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single 10 (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
15
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
TCAGCAATTG AGAGCATTCT TAAA 24
20
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs 25. (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
30
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
25 GTCCTTGATA TGGATTGGAT GTCG
24
(2) INFORMATION FOR SEQ ID NO:13:
4.0 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
45
(ii) MOLECUL. E TYPE: DNA (genomic)
0 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: ACTAATAATG TAAAAGACGT CACTAAATTG 30 (2) INFORMATION FOR SEQ ID NO:14:
5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
10
(ii) MOLECULE TYPE: DNA (genomic)
15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TCTCGCTTAT CCAACAATGA CTTGG 25
2.0 (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid 5 (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
30
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
CCAGAACAGC TAAACGGAGT CGCCACACCA CTGTTTGTGC 5 40
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS: 0 (A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear 5 (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: 0
CATGGGGCCG GAGCCGCAGT GAGCAC 26 (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: CATGGTGCTC ACTGCGGCTC CGGCCC
26
(2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
TCGAGATCTG AGGCCTGCTG ACCATGGGGG CC 32 (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
CCCATGGTCA GCAGGCCTCA GATC 24
(2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECU.LE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
CTCTTGGATA TTCTCGACAC ACAGCA 26
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: GTGTCTACTG TTCTAGAAGG
20
(2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS:
(A) .LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
GCACGCACTG TGGAATCTCG G 21 (2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
ACGTCGAGTA CGTCGGCCCC GGTG 24 (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
GCCCACGAAC TGGCCAAGAG TT 22
(2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
CTGAGTCCCA TCATCACTGC TCTT 24
(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ϋ) MOLECU.LE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
CCAATGCCAG CCTGTCCTTC CTGCAG 26
(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
GATCAAGACC CCTCCTTTCA AGATCT 26
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
AATTCCGCTG ACCATCAATA AGGAAG 26
(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECU.LE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
ATAGCCTAAG ACCCGGAGCT TTTCAC 26
(2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
GATGGAGAAT ATTTCACCCT TCAG 24
(2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: CTGACCCTTT TTGGACTTCA GGTGG
25
(2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: CTCCAGCCCG CAGCTCCAGG AGTCTG
26
(2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
CTCCAGCCCG CAGCTCCAGG AGTCTG 26 (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
CCCTCTACAC TGGCAGTTCC ACCTG 25

Claims

What is claimed is:
1. A method of directly transcriptionally modulating the expression of an oncogene or tumor suppressor gene, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism, which comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the oncogene or tumor suppressor gene product(s) encoded by the gene which is expressed by the cell, which molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the oncogene or tumor suppressor gene, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
2. A method of claim 1, wherein the molecule does not naturally occur in any cell of a lower eucaryotic organism.
3. A method of claim 1, wherein the molecule does not naturally occur in any cell.
4. A method of claim 1, wherein the molecule is not a naturally occurring molecule.
5. A method of claim 1, wherein the cell is a cell of the multicellular organism.
6. A method of claim 1, wherein the cell is an animal cell.
7. A method of claim 6, wherein the animal cell is a human cell.
8. A method of claim l, wherein the transcriptional modulation comprises upregulation of expression of the oncogene or tumor suppressor gene.
9. A method of claim 1, wherein the transcriptional modulation comprises downregulation of expression of the oncogene or tumor suppressor gene.
10. A method of claim 1, wherein the molecule binds to a modulatable transcription sequence of the gene.
11. A method of claims 1, wherein the molecule comprises an antisense nucleic acid.
12. A method of claim 1, wherein the molecule comprises double-stranded nucleic acid.
13. A method of claim 1 wherein the molecule comprises a nucleic acid capable of forming a triple helix with double-stranded DNA.
14. A method of claim 1, wherein the gene is an oncogene.
15. A method of claim 14, wherein the oncogene is a c- neu gene.
16. A method of claim 14, wherein the oncogene is a c-K- ras gene.
17. A method of claim 14, wherein the oncogene is a c-H- ras gene.
18. A method of claim 14, wherein the oncogene is a c-N- ras gene.
19. A method of claim 14, wherein the oncogene is a phl- abl gene fusion.
20. A method of claim 14, wherein the oncogene is a myc gene.
21. A method of claim 14, wherein the oncogene is a fms gene.
22. A method of claim 14, wherein the oncogene is a erbA gene.
23. A method of claim 14, wherein the oncogene is a p53 gene.
24. A method of claim 14, wherein the oncogene is a retroviral oncogene.
25. A method of claim 1, wherein the gene is a tumor suppressor gene.
26. A method of claim 25 wherein the tumor suppressor gene is a p53 gene.
27. A method of claim 25 wherein the tumor suppressor gene is a retinoblastoma gene.
28. A method of claim 25 wherein the tumor suppressor gene is a Wilms' tumor gene.
29. A method of claim 25 wherein the tumor suppressor gene is a neurofibromatosis type 1 gene.
30. A method of claim 25 wherein the tumor suppressor gene is a DCC gene.
31. A method of claim 25 wherein the tumor suppressor gene is an erbA gene.
32. A method of claim 25 wherein the tumor suppressor gene is an adenomatous polyposis coli gene.
33. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or tumor suppressor gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the oncogene or tumor suppressor gene,
(ii) a promoter of the oncogene or tumor suppressor gene, and (iii) a DNA sequence encoding a polypeptide other than the oncogene or tumor suppressor, which polypeptide being capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or tumor suppressor gene, causes a measurable detectable signal to be produced by the 84 polypeptide so expressed, quantitatively determining the amount of the signal produced, comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or tumor suppressor gene.
34. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or tumor suppressor gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the oncogene or tumor suppressor, (ii) a promoter of the oncogene or tumor suppressor gene, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or tumor suppressor gene, causes a measurable change in the amount of the polypeptide produced, quantitatively determining the amount of the polypeptide so produced, comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the amount of the polypeptide expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or tumor suppressor gene.
35. A method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of an oncogene or tumor suppressor gene, which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the oncogene or tumor suppressor gene, (ii) a promoter of the oncogene or tumor suppressor gene, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the oncogene or tumor suppressor gene, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence, quantitatively determining the amount of the mRNA produced, comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identifying the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the oncogene or tumor suppressor gene.
36. A method of claim 33, 34 or 35, wherein the sample comprises cells in monolayers.
37. A method of claim 33, 34, or 35, wherein the sample comprises cells in suspension.
38. A method of claim 33, 34 or 35, wherein the cells comprise animal cells.
39. A method of claim 38, where the animal cells are human cells.
40. A method of claim 33, 34 or 35, wherein the predefined number of cells is from about 1 to about 5 X 105.cells.
41. A method of claim 40, wherein the predefined number of cells is from about 2 X 102 to about 5 X 10* cells.
42. A method of claim 33, 34 or 35, wherein the predetermined amount of the molecule to be tested is based upon the volume of the sample.
43. A method of claim 33, 34 or 35, wherein the predetermined amount is from about 1.0 pM to about
20 μM.
44. A method of claim 33, 34 or 35, wherein the predetermined amount is from about 10 nM to about 500 μM.
45. A method of claim 33, 34 or 35, wherein the contacting is effected from about 1 to about 24 hours.
46. A method of claim 45, wherein the contacting is effected from about 2 to about 12 hours.
47. A method of claim 33, 34 or 35, wherein the contacting is effected with more than one predetermined amount of the molecule to be tested.
48. A method of claim 33, 34 or 35, wherein the molecule to be tested is a purified molecule.
49. A method of claim 33, 34 or 35, wherein the modulatable transcriptional regulatory sequence comprises a cloned genomic regulatory sequence.
50. A method of claim 33, 34 or 35, wherein the DNA consists essentially of more than one modulatable transcriptional regulatory sequence.
51. A method of claim 33 or 34, wherein the DNA sequence encoding the polypeptide is inserted downstream of the promoter of the oncogene or tumor suppressor gene by homologous recombination.
52. A method of claim 33, wherein the polypeptide is a luciferase.
53. A method of claim 33, wherein the polypeptide is chloramphenicol acetyltransferase.
54. A method of claim 33, wherein the polypeptide is β glucuronidase.
55. A method of claim 33, wherein the polypeptide is β galactosidase.
56. A method of claim 33, wherein the polypeptide is neomycin phosphotransferase.
57. A method of claim 33, wherein the polypeptide is alkaline phosphatase.
58. A method of claim 33, wherein the polypeptide is guanine xanthine phosphoribosyltransferase.
59. A method of claim 34, wherein the polypeptide is capable of complexing with an antibody.
60. A method of claim 34, wherein the polypeptide is capable of complexing with biotin.
61. A method of claim 35, wherein mRNA is detected by quantitative polymerase chain reaction.
62. A screening method of claim 33, 34, 35 or 39 which comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested.
63. A screening method of claim 62, wherein the plurality of samples comprises more that about 104 samples.
64. A screening method of claim 62, wherein the plurality of samples comprises more than about 5 X 104 samples.
65. A method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more oncogenes or tumor suppressor genes which comprises essentially simultaneously screening the molecules against the oncogenes or tumor suppressor genes according to the method of claim 62.
66. A screening method of claim 64 or 65, where more than about 103 samples per week are contacted with different molecules.
67. A method for directly transcriptionally modulating in a multicellular organism the expression of a oncogene or tumor suppressor gene, the expression of which is associated with a defined physiological or pathological effect in the organism, which comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect, which molecule (a) does not naturally occur in the organism and (b) specifically transcriptionally modulates expression of the gene encoding an oncogene or tumor suppressor gene product(s) , and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand- binding domain is normally associated with a defined physiological or pathological effect.
68. A method of claim 67, wherein the molecule binds to a modulatable transcription sequence of the gene.
69. A method of claim 67, wherein the molecule comprises an antisense nucleic acid.
70. A method of claim 67, wherein the molecule comprises a double-stranded nucleic acid molecule.
71. A method of claim 67, wherein the molecule comprises a nucleic acid capable of forming a triple helix with double-stranded DNA.
72. A method of claim 67, wherein the multicellular organism is a human being.
73. A method of claim 67, wherein the multicellular organism is an animal.
74. A method of claim 72, wherein the physiological effect is the protection of non-neoplastic cells from damage by chemotherapeutic agents.
75. A method of claim 72, wherein the defined pathological effect is a disorder and modulated expression of an oncogene or tumor suppressor gene is associated with amelioration of the disorder.
76. A method of claim 72, wherein the defined pathological effect is cancer.
77. A method of claim 72, wherein the defined pathological effect is leukemia.
78. A method of claim 72, wherein the defined pathological effect is malignant melanoma.
79. A method of claim 72, wherein the defined pathological effect is lung cancer.
80. A method of claim 72, wherein the defined pathological effect is colon cancer.
81. A method of claim 72, wherein the defined pathological effect is pancreatic cancer.
82. A method of claim 72, wherein the defined pathological effect is ovarian cancer.
83. A method of claim 72, wherein the defined pathological effect is breast cancer.
84. A method of claim 67 or 72, wherein the administering comprises topical contact.
85. A method of claim 67 or 72, wherein the administering comprises oral, transdermal, intravenous, intramuscular or subcutaneous administration.
PCT/US1992/000421 1991-01-18 1992-01-17 Methods of transcriptionally modulating expression of oncogenes and tumor suppressor genes WO1992013091A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US64429391A 1991-01-18 1991-01-18
US644,293 1991-01-18

Publications (1)

Publication Number Publication Date
WO1992013091A1 true WO1992013091A1 (en) 1992-08-06

Family

ID=24584283

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/000421 WO1992013091A1 (en) 1991-01-18 1992-01-17 Methods of transcriptionally modulating expression of oncogenes and tumor suppressor genes

Country Status (2)

Country Link
AU (1) AU1536392A (en)
WO (1) WO1992013091A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995016694A1 (en) * 1993-12-16 1995-06-22 Cold Spring Harbor Laboratory Origin of replication complex genes, proteins and methods
US5445941A (en) * 1993-06-21 1995-08-29 Eli Lilly And Company Method for screening anti-osteoporosis agents
WO1996038590A1 (en) * 1995-06-02 1996-12-05 Osteoscreen, Inc. Methods and compositions for identifying osteogenic agents
US5604113A (en) * 1994-04-07 1997-02-18 Rutgers University Cells having oncogene-suppressed p53-mediated apoptosis and methods of use to identify anti-oncogenic compounds
WO1997014812A2 (en) * 1995-10-16 1997-04-24 Chiron Corporation Method of screening for factors that modulate gene expression
US5712094A (en) * 1995-03-27 1998-01-27 Ligand Pharmaceuticals, Inc. Methods for detecting modulators of cytokine action
EP0841068A1 (en) * 1995-06-01 1998-05-13 Kishimoto, Tadamitsu Leukemic cell growth inhibitor containing antisense oligonucleotide derivative against wilms' tumor gene (wt1)
WO1998022608A2 (en) * 1996-11-18 1998-05-28 Mcgill University Post-mitotic neurons containing adenovirus vectors that modulate apoptosis and growth
US5759776A (en) * 1995-06-05 1998-06-02 California Pacific Medical Center Targets for breast cancer diagnosis and treatment
US5776683A (en) * 1996-07-11 1998-07-07 California Pacific Medical Center Methods for identifying genes amplified in cancer cells
US5807692A (en) * 1993-11-10 1998-09-15 The Johns Hopkins University P21WAF1 derivatives and diagnostic methods
US5843683A (en) * 1993-07-14 1998-12-01 Brandeis University PAS domain proteins
WO1999047709A2 (en) * 1998-03-18 1999-09-23 Chinook Acquisition Corporation Methods for identifying anti-cancer agents
EP1288311A2 (en) * 1996-12-31 2003-03-05 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Method for testing small pharmaceutically active molecules in the activation of Pax4 and production of insulin producing beta-cells

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR930703462A (en) * 1990-09-24 1993-11-30 로저 브렌트 Search analysis method

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0117058A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods for producing mature protein in vertebrate host cells
US4535058A (en) * 1982-10-01 1985-08-13 Massachusetts Institute Of Technology Characterization of oncogenes and assays based thereon
US4601978A (en) * 1982-11-24 1986-07-22 The Regents Of The University Of California Mammalian metallothionein promoter system
US4699877A (en) * 1982-11-04 1987-10-13 The Regents Of The University Of California Methods and compositions for detecting human tumors
US4736866A (en) * 1984-06-22 1988-04-12 President And Fellows Of Harvard College Transgenic non-human mammals
US4738922A (en) * 1984-05-25 1988-04-19 Dana Farber Cancer Institute Trans-acting transcriptional factors
US4740461A (en) * 1983-12-27 1988-04-26 Genetics Institute, Inc. Vectors and methods for transformation of eucaryotic cells
US4740463A (en) * 1984-04-13 1988-04-26 Massachusetts Institute Of Technology Methods and artificial genes for antagonizing the function of an oncogene
US4761371A (en) * 1985-02-12 1988-08-02 Genentech, Inc. Insulin receptor
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
WO1989002472A1 (en) * 1987-09-21 1989-03-23 Amrad Corporation Limited Regulation of expression of gm-csf gene
US4861709A (en) * 1985-05-31 1989-08-29 Technicon Research A.G. Detection and/or identification of microorganisms in a test sample using bioluminescence or other exogenous genetically-introduced marker
US4885238A (en) * 1987-10-30 1989-12-05 The United States Of America As Represented By The Department Of Health And Human Services Immortalized human bronchial epitherial mesothelial cell lines
US4935363A (en) * 1987-03-30 1990-06-19 Board Of Regents, The University Of Texas System Sterol regulatory elements
US4981783A (en) * 1986-04-16 1991-01-01 Montefiore Medical Center Method for detecting pathological conditions
US5070012A (en) * 1988-03-30 1991-12-03 The Board Of Trustees Of The Leland Stanford Junior University Monitoring of cells and trans-activating transcription elements

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4535058A (en) * 1982-10-01 1985-08-13 Massachusetts Institute Of Technology Characterization of oncogenes and assays based thereon
US4699877A (en) * 1982-11-04 1987-10-13 The Regents Of The University Of California Methods and compositions for detecting human tumors
US4601978A (en) * 1982-11-24 1986-07-22 The Regents Of The University Of California Mammalian metallothionein promoter system
EP0117058A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods for producing mature protein in vertebrate host cells
US4740461A (en) * 1983-12-27 1988-04-26 Genetics Institute, Inc. Vectors and methods for transformation of eucaryotic cells
US4740463A (en) * 1984-04-13 1988-04-26 Massachusetts Institute Of Technology Methods and artificial genes for antagonizing the function of an oncogene
US4738922A (en) * 1984-05-25 1988-04-19 Dana Farber Cancer Institute Trans-acting transcriptional factors
US4736866A (en) * 1984-06-22 1988-04-12 President And Fellows Of Harvard College Transgenic non-human mammals
US4736866B1 (en) * 1984-06-22 1988-04-12 Transgenic non-human mammals
US4761371A (en) * 1985-02-12 1988-08-02 Genentech, Inc. Insulin receptor
US4861709A (en) * 1985-05-31 1989-08-29 Technicon Research A.G. Detection and/or identification of microorganisms in a test sample using bioluminescence or other exogenous genetically-introduced marker
US4981783A (en) * 1986-04-16 1991-01-01 Montefiore Medical Center Method for detecting pathological conditions
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US4935363A (en) * 1987-03-30 1990-06-19 Board Of Regents, The University Of Texas System Sterol regulatory elements
WO1989002472A1 (en) * 1987-09-21 1989-03-23 Amrad Corporation Limited Regulation of expression of gm-csf gene
US4885238A (en) * 1987-10-30 1989-12-05 The United States Of America As Represented By The Department Of Health And Human Services Immortalized human bronchial epitherial mesothelial cell lines
US5070012A (en) * 1988-03-30 1991-12-03 The Board Of Trustees Of The Leland Stanford Junior University Monitoring of cells and trans-activating transcription elements

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, BRASLER et al., "Optimized Use of the Firefly Luciferase Assay as a Reporter Gene in Mammalian Cell Lines", pages 1116-1122. *
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, BRENNER et al., "Message Amplification Phenotyping (MAPPing): A Technique to Simultaneously Measure Multiple mRNAs from Small Numbers Of Cells", pages 1096-1103. *
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, MUNJAAL et al., "In Situ Detection of Progesterone Receptor mRNA in the Chicken Oviduct Using Probe-On Slides", pages 1104-1108. *
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, SLACK et al., Application of the Multiscreen System to Cytokine Radioreceptor Assays", pages 1132-1138. *
BIO/TECHNIQUES, Vol. 7, No. 6, issued June 1989, CAO et al., "A Simple and Inexpensive System to Amplify DNA by PCR", pages 566-567. *
BIO/TECHNIQUES, Vol. 7, No. 6, issued June 1989, LIM et al., "A Simple Assay for DNA Transfection by Incubation of the Cells in Culture Dishes With Substrates for Beta-Galactosidase", pages 576-579. *
BIO/TECHNIQUES, Vol. 8, No. 1, issued January 1990, RAO et al., "A Quantitative Assay for Beta-D-Glucuronidase (GUS) Using Microtiter Plates", pages 38-40. *
BIO/TECHNIQUES, Vol. 8, No. 3, issued March 1990, WILLINGHAM et al., "A Reversible Multi-Well Chamber for Incubation of Cultured Cells With Small Volumes: Application to Screening of Hybridoma Fusions Using Immunofluorescence Microscopy", pages 320-324. *
BIO/TECHNIQUES, Vol. 9, No. 4, issued October 1990, PONS et al., "A New Cellular Model of Response to Estrogens: A Bioluminescent Test to Characterize (Anti) Estrogen Molecules", pages 450-459. *
BIO/TECHNOL., Vol. 7, issued March 1989, MCCALL et al., "Biotherapy: A New Dimension in Cancer Treatment", pages 231-240. *
BIO/TECHNOL., Vol. 7, issued March 1989, RATNER, "Can the Antisense Message be Delivered?", page 207. *
CELL, Vol. 49, issued 19 June 1987, ANGEL et al., "Phorbol Ester-Inducible Genes Contain a Common Cis Element Recognized by a TPA-Modulated Trans-Acting Factor", pages 729-739. *
CELL, Volume 47, issued 10 October 1986, YANG et al., "Human IL-3 (Multi-CSF): Identification by Expression Cloning of a Novel Hematopoietic Growth Factor Related to Murine IL-3", pages 3-10. *
DE SERRES et al., "Chemical Mutagens. Principles and Methods for their Detection", published 1980 by PLENUM PRESS (NEW YORK), pages 331, and 365-473. *
EMBO J., Volume 5, No. 3, issued March 1986, NAGATA et al., "The Chromosomal Gene Structure and Two mRNAs for Human Granulocyte Colony-Stimulating Factor", pages 575-581. *
EMBO J., Volume 6, No. 4, issued April 1987, LEFEVRE et al., "Tissue-Specific Expression of the Human Growth Hormone Gene is Conferred in Part by the Binding of a Specific Trans-Acting Factor", pages 971-981. *
EMBO J., Volume 6, No. 9, issued September 1987, LADNER et al., "Human CSF-1: Gene Structure and Alternative Splicing of mRNA precursors", pages 2693-2698. *
EXP. HEMATOL., Vol. 16, issued 1988, BICKEL et al., "Granulocyte-Macrophage Colony-Stimulating Factor Regulation in Murine T Cells and its Relation to Cyclosporin A", pages 691-695. *
GENE AMPLIFICATION, (SCHIMKE, R.T., ed.), issued 1982, MAYO et al., "Altered Regulation of the Mouse Metallothionein I Gene Following Gene Amplification or Transfection", pages 67-73. *
J. IMMUNOL., Vol. 143, No. 2, issued 15 July 1989, TOCCI et al., "The Immunosuppressant FK506 Selectively Inhibits Expression of Early T Cell Activation Genes", pages 718-726. *
MOL. CELL. BIOL., Volume 7, No. 6, issued June 1987, ANGEL et al., "12-O-Tetradecanoyl-Phorbol-13-Acetate Induction of the Human Collagenase Gene is Mediated by an Inducible Enhancer Element Located in the 5'-Flanking Region", pages 2256-2266. *
MOLEC. CELL. BIOL., Volume 7, No. 2, issued February 1987, DE WET et al., "Firefly Luciferase Gene: Structure and Expression in Mammalian Cells", pages 725-737. *
NATURE, Vol. 346, issued 16 August 1990, STANDAERT et al., "Molecular Cloning and Overexpression of the Human FK506-Binding Protein FKBP", pages 671-674. *
PROC. NATL. ACAD. SCI. USA, Vol. 81, issued August 1984, KRONKE et al., "Cyclosporin A Inhibits T-Cell Growth Factor Gene Expression at the Level of mRNA Transcription", pages 5214-5218. *
PROC. NATL. ACAD. SCI. USA, Volume 82, issued November 1985, LIN et al., "Cloning and Expression of the Human Erythropoietin Gene", pages 7580-7584. *
PROC. NATL. ACAD. SCI. USA, Volume 83, issued May 1986, KAUSHANSKY et al., "Genomic Cloning, Characterization, Multilineage Growth Promoting Activity of Human Granulocyte-Macrophage Colony-Stimulating Factor", pages 3101-3105. *
SCIENCE, Vol. 230, issued 18 October 1985, KAWASAKI et al., "Molecular Cloning of a Complementary DNA Encoding Human Macrophage-Specific Colony-Stimulating Factor (CSF-1)", pages 291-296. *
SCIENCE, Volume 227, issued 16 March 1985, ENGEBRECHT et al., "Measuring Gene Expression with Light", pages 1345-1347. *
SCIENCE, Volume 236, issued 05 June 1987, MANIATIS et al., "Regulation of Inducible Tissue-Specific Gene Expression", pages 1237-1245. *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5445941A (en) * 1993-06-21 1995-08-29 Eli Lilly And Company Method for screening anti-osteoporosis agents
US5843683A (en) * 1993-07-14 1998-12-01 Brandeis University PAS domain proteins
US5807692A (en) * 1993-11-10 1998-09-15 The Johns Hopkins University P21WAF1 derivatives and diagnostic methods
US6300059B1 (en) 1993-11-10 2001-10-09 Johns Hopkins University Cancer diagnosis and WAF1
US5871968A (en) * 1993-11-10 1999-02-16 The Johns Hopkins University P21WAF1 derivatives and diagnostic methods
WO1995016694A1 (en) * 1993-12-16 1995-06-22 Cold Spring Harbor Laboratory Origin of replication complex genes, proteins and methods
US5604113A (en) * 1994-04-07 1997-02-18 Rutgers University Cells having oncogene-suppressed p53-mediated apoptosis and methods of use to identify anti-oncogenic compounds
US5712094A (en) * 1995-03-27 1998-01-27 Ligand Pharmaceuticals, Inc. Methods for detecting modulators of cytokine action
EP0841068A4 (en) * 1995-06-01 2004-07-07 Kishimoto Tadamitsu Leukemic cell growth inhibitor containing antisense oligonucleotide derivative against wilms' tumor gene (wt1)
EP0841068A1 (en) * 1995-06-01 1998-05-13 Kishimoto, Tadamitsu Leukemic cell growth inhibitor containing antisense oligonucleotide derivative against wilms' tumor gene (wt1)
US6083690A (en) * 1995-06-02 2000-07-04 Osteoscreen, Inc. Methods and compositions for identifying osteogenic agents
WO1996038590A1 (en) * 1995-06-02 1996-12-05 Osteoscreen, Inc. Methods and compositions for identifying osteogenic agents
US5759776A (en) * 1995-06-05 1998-06-02 California Pacific Medical Center Targets for breast cancer diagnosis and treatment
WO1997014812A3 (en) * 1995-10-16 1997-06-19 Chiron Corp Method of screening for factors that modulate gene expression
WO1997014812A2 (en) * 1995-10-16 1997-04-24 Chiron Corporation Method of screening for factors that modulate gene expression
US5776683A (en) * 1996-07-11 1998-07-07 California Pacific Medical Center Methods for identifying genes amplified in cancer cells
WO1998022608A3 (en) * 1996-11-18 1998-09-03 Univ Mcgill Post-mitotic neurons containing adenovirus vectors that modulate apoptosis and growth
US6060247A (en) * 1996-11-18 2000-05-09 Mcgill University Post-mitotic neurons containing adenovirus vectors that modulate apoptosis and growth
WO1998022608A2 (en) * 1996-11-18 1998-05-28 Mcgill University Post-mitotic neurons containing adenovirus vectors that modulate apoptosis and growth
EP1288311A3 (en) * 1996-12-31 2004-09-29 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Method for testing small pharmaceutically active molecules in the activation of Pax4 and production of insulin producing beta-cells
EP1288311A2 (en) * 1996-12-31 2003-03-05 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Method for testing small pharmaceutically active molecules in the activation of Pax4 and production of insulin producing beta-cells
WO1999047709A3 (en) * 1998-03-18 2000-01-06 Genquest Inc Methods for identifying anti-cancer agents
US6413717B1 (en) 1998-03-18 2002-07-02 Corixa Corporation Methods for indentifying anti-cancer agents
WO1999047709A2 (en) * 1998-03-18 1999-09-23 Chinook Acquisition Corporation Methods for identifying anti-cancer agents

Also Published As

Publication number Publication date
AU1536392A (en) 1992-08-27

Similar Documents

Publication Publication Date Title
US5776502A (en) Methods of transcriptionally modulating gene expression
US6203976B1 (en) Methods of preparing compositions comprising chemicals capable of transcriptional modulation
Hu et al. The inducible Iac operator-repressor system is functional in mammalian cells
Jousse et al. Inhibition of CHOP translation by a peptide encoded by an open reading frame localized in the chop 5′ UTR
Braun et al. Identification of target genes for the Ewing's sarcoma EWS/FLI fusion protein by representational difference analysis
Weeks et al. E1A control of gene expression is mediated by sequences 5′ to the transcriptional starts of the early viral genes
Chen et al. The (CGG) n repeat element within the 5′ untranslated region of the FMR1 message provides both positive and negative cis effects on in vivo translation of a downstream reporter
EP0483249B1 (en) Method of transcriptionally modulating gene expression and of discovering chemicals capable of functioning as gene expression modulators
Südhof et al. 42 bp element from LDL receptor gene confers end-product repression by sterols when inserted into viral TK promoter
Johansen et al. Regulated expression at high copy number allows production of a growth-inhibitory oncogene product in Drosophila Schneider cells.
Labow et al. Conversion of the lac repressor into an allosterically regulated transcriptional activator for mammalian cells
WO1992013091A1 (en) Methods of transcriptionally modulating expression of oncogenes and tumor suppressor genes
AU708981B2 (en) Expression augmenting sequence elements (ease) for eukaryotic expression systems
US5674730A (en) Eukaryotic cells comprising a DNA sequence encoding a bacterial-viral chimeric transactivator protein
US6653132B1 (en) IRES sequences with high translational efficiency and expression vectors containing the sequence
WO1998037189A9 (en) Ires sequences with high translational efficiency and expression vectors containing the sequence
Rutherford et al. Human globin gene promoter sequences are sufficient for specific expression of a hybrid gene transfected into tissue culture cells
US5556954A (en) Hematopoietic stem cell specific gene expression
WO1992013063A1 (en) Methods of transcriptionally modulating expression of growth factor genes and growth factor receptor genes
HUT66062A (en) Expression systems
Hu et al. Functional analyses of albumin expression in a series of hepatocyte cell lines and in primary hepatocytes
Surmacz et al. Activation of the ribosomal DNA promoter in cells exposed to insulinlike growth factor I
Murray et al. Construction and use of a dominant, selectable marker: a Harvey sarcoma virus-dihydrofolate reductase chimera
Radomska et al. Multiple control elements are required for expression of the human CD34 gene
Elnitski et al. Efficient and reliable transfection of mouse erythroleukemia cells using cationic lipids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI HU JP KR NO RU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase