WO1993018146A2 - Proteins forming complexes with chaperones and ligands thereof, fragments thereof, preparation thereof and biological uses thereof - Google Patents

Proteins forming complexes with chaperones and ligands thereof, fragments thereof, preparation thereof and biological uses thereof Download PDF

Info

Publication number
WO1993018146A2
WO1993018146A2 PCT/FR1993/000219 FR9300219W WO9318146A2 WO 1993018146 A2 WO1993018146 A2 WO 1993018146A2 FR 9300219 W FR9300219 W FR 9300219W WO 9318146 A2 WO9318146 A2 WO 9318146A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequences
sequence
proteins
nucieotides
protein
Prior art date
Application number
PCT/FR1993/000219
Other languages
French (fr)
Other versions
WO1993018146A3 (en
Inventor
Marie-Claire Lebeau
Nelly Massol
Michel Renoir
Christine Radanyi
Jean-Paul Mornon
Isabelle Callebaut
Etienne-Emile Baulieu
Béatrice CHAMBRAUD
Original Assignee
Institut National De La Sante Et De La Recherche Medicale (I.N.S.E.R.M.)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National De La Sante Et De La Recherche Medicale (I.N.S.E.R.M.) filed Critical Institut National De La Sante Et De La Recherche Medicale (I.N.S.E.R.M.)
Publication of WO1993018146A2 publication Critical patent/WO1993018146A2/en
Publication of WO1993018146A3 publication Critical patent/WO1993018146A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Nucleotide sequences capable of hybridizing with the nucleotide sequence shown in figure 1, and the corresponding coded amino acid sequences, are disclosed. Said nucleotide sequences are particularly suitable for detecting complementary sequences in biological samples.

Description

PROTEINES FORMANT DES COMPLEXES AVEC DES CHAPERONES ET LEURS LIGANDS, LEURS FRAGMENTS, LEUR OBTENTION ET LEURS APPLICATIONS BIOLOGIQUES.PROTEINS FORMING COMPLEXES WITH CHAPERONES AND THEIR LIGANDS, THEIR FRAGMENTS, THEIR PRODUCTION AND THEIR BIOLOGICAL APPLICATIONS.
L'invention a pour objet des protéines immunophilines, protéines p59 et apparentées, formant des complexes avec des chaperones et leurs ligands.The invention relates to immunophilin proteins, p59 and related proteins, forming complexes with chaperones and their ligands.
Elle se rapporte plus particulièrement aux séquences de nucieotides codant pour des protéines apparentées à celles de ces complexes, ou à des fragments de ces protéines, ainsi qu'aux protéines et fragments correspondants.It relates more particularly to the sequences of nucieotides encoding proteins related to those of these complexes, or to fragments of these proteins, as well as to the corresponding proteins and fragments.
L'invention concerne également les applications biologiques de ces séquences de nucieotides et de protéines, en particulier à des fins de recherche et d'étude de nouveaux ligands pharmacologiques de 1'immunophiline ainsi qu'à des fins de diagnostic clinique.The invention also relates to the biological applications of these nucieotide and protein sequences, in particular for research and study of new pharmacological ligands for immunophilin as well as for clinical diagnosis.
Par protéine chaperone, on désigne des protéines associées à d'autres protéines biologiquement actives avec lesquelles elles interagissent et modifient leur fonctionnement. L'invention vise en particulier des protéines formant des complexes avec la chaperone hsp90 qui est une protéine de choc thermique capable de se lier avec de nombreux ligands tels que les récepteurs des hormones stéroïdes, de la vitamine D, et de la dioxine et tels que les tyrosine inases des oncogènes viraux (par exemple ppδOsrc), l'actine, la tubuline et d'autres protéines dont le changement de structure et le trafic intracellulaire sont importants pour la physiologie et la pathologie de la cellule. Dans le cadre de travaux sur les récepteurs des hormones stéroïdes, certains des co-inventeurs de la présente demande ont décrit la liaison de la hsp90 aux récepteurs des hormones stéroïdes et son rôle pour empêcher l'interaction de ces récepteurs avec l'ADN (voir Joab et al., 1984, Nature, 308, 840, 853 et Catelli et al., 1989, EMBO J.4, 3131-3135).The term chaperone protein denotes proteins associated with other biologically active proteins with which they interact and modify their functioning. The invention relates in particular to proteins forming complexes with the hsp90 chaperone which is a heat shock protein capable of binding with numerous ligands such as the receptors for steroid hormones, vitamin D, and dioxin and such as tyrosine inases of viral oncogenes (for example ppδOsrc), actin, tubulin and other proteins whose structural change and intracellular traffic are important for the physiology and pathology of the cell. In the context of work on steroid hormone receptors, some of the co-inventors of the present application have described the binding of hsp90 to steroid hormone receptors and its role in preventing the interaction of these receptors with DNA (see Joab et al., 1984, Nature, 308, 840, 853 and Catelli et al., 1989, EMBO J.4, 3131-3135).
Une protéine de poids moléculaire 59kDa a également été caractérisée chez le lapin lors de la purification de ces récepteurs. En l'absence de ligand, les récepteurs de toutes les hormones stéroïdes se retrouvent associés dans la cellule avec d'autres protéines ne liant pas l'hormone, constituant la forme non activée de ces récepteurs. La séparation des protéines libérera le récepteur lui-même qui pourra alors interagir avec l'ADN (Baulieu et al., 1971, Rec. Progr. Horm. Res. 27, 351-419 et Sherman et al., 1984, Ann. Rev. Physiol. 46, 83-125).A protein of molecular weight 59kDa has also been characterized in rabbits during the purification of these receptors. In the absence of a ligand, the receptors for all steroid hormones are found associated in the cell with other proteins which do not bind the hormone, constituting the non-activated form of these receptors. The separation of proteins will release the receptor itself which will then be able to interact with DNA (Baulieu et al., 1971, Rec. Progr. Horm. Res. 27, 351-419 and Sherman et al., 1984, Ann. Rev Physiol. 46, 83-125).
Les structures et séquences de ces protéines du type p59 n'ayant pas été élucidées à ce jour, leur fonction dans la cellule n'a pu être définie précisément.The structures and sequences of these p59 type proteins have not been elucidated to date, their function in the cell could not be precisely defined.
Par criblage d'une banque d'ADN-c de foie de lapin, les inventeurs ont réussi à isoler et à séquencer des clones renfermant une séquence de nucieotides capable de coder pour une protéine homologue à la protéine p59 de lapin telle qu'elle a été définie par son immunoréaction avec l'anticorps monoclonal KN382/EC1. (Nakao et al., 1985, Can. J. Biochem. Cell. Biol. 63, 33-40).By screening a rabbit liver c-DNA library, the inventors succeeded in isolating and sequencing clones containing a sequence of nucieotides capable of coding for a protein homologous to the rabbit p59 protein as it has was defined by its immunoreaction with the monoclonal antibody KN382 / EC1. (Nakao et al., 1985, Can. J. Biochem. Cell. Biol. 63, 33-40).
L'invention a donc pour but de fournir de telles séquences de nucieotides ainsi que les séquences d'acides aminés exprimées ou déduites des séquences de nucieotides.The object of the invention is therefore to provide such nucieotide sequences as well as the amino acid sequences expressed or deduced from the nucieotide sequences.
Elle vise également l'obtention de ces différentes séquences.It also aims to obtain these different sequences.
L'invention a également pour but de fournir les anticorps polyclonaux et monoclonaux dirigés contre ces protéines ou fragments de protéines obtenus.The invention also aims to provide polyclonal and monoclonal antibodies directed against these proteins or protein fragments obtained.
Selon un autre aspect, l'invention vise l'utilisation des séquences de nucieotides ou de protéines, ou des anticorps, dans des applications biologiques, en particulier à des fins de diagnostic.According to another aspect, the invention relates to the use of the sequences of nucieotides or proteins, or antibodies, in biological applications, in particular for diagnostic purposes.
Les séquences de nucieotides de 1'invention sont caractérisées en ce qu'elles comprennent ou qu'elles sont formées par un enchaînement de nucieotides capable de s'hybrider dans des conditions stringentes avec une ou plusieurs séquences d'un gène dont 1'ADNc présente une séquence correspondant à 1'enchaînement (I) de nucieotides. Les enchaînements des séquences de nucieotides et de protéines auxquels il est fait référence dans la description et les revendications sont donnés en fin de description.The nucieotide sequences of the invention are characterized in that they include or are formed by a sequence of nucieotides capable of hybridize under stringent conditions with one or more sequences of a gene whose cDNA has a sequence corresponding to the sequence (I) of nucieotides. The sequences of the nucieotide and protein sequences to which reference is made in the description and the claims are given at the end of the description.
L'expression "conditions stringentes" telle qu'utilisée dans ce texte signifie qu'on obtient une hybridation en opérant selon les conditions décrites par Sambrook, Fritsch Maniatis dans "Molecular Cloning", 1989.The expression "stringent conditions" as used in this text means that a hybridization is obtained by operating according to the conditions described by Sambrook, Fritsch Maniatis in "Molecular Cloning", 1989.
Selon une disposition de l'invention, les séquences de nucieotides sont caractérisées en ce qu'elles contiennent 1'information génétique pour coder pour tout ou partie de la protéine répondant à l'enchaînement II.According to a provision of the invention, the nucieotide sequences are characterized in that they contain the genetic information to code for all or part of the protein responding to sequence II.
Des séquences de ce type sont caractérisées en ce qu'elles sont formées, ou qu'elles comprennent, au moins une partie de 1'enchaînement I.Sequences of this type are characterized in that they are formed, or that they comprise, at least part of the sequence I.
L'invention vise en particulier des séquences de nucieotides constituées par une partie ou la totalité du cadre ouvert de lecture allant dans 1'enchaînement (I) de la position 4 à la position 1380.The invention relates in particular to sequences of nucieotides constituted by a part or the whole of the open reading frame going in the sequence (I) from position 4 to position 1380.
Cette séquence, sans la séquence leader, comporte 2067 paires de base. De telles séquences sont encore caractérisées en ce qu'elles sont capables de coder pour une protéine potentielle de 458 acides aminés répondant à l'enchaînement II.This sequence, without the leader sequence, has 2067 base pairs. Such sequences are further characterized in that they are capable of coding for a potential protein of 458 amino acids responding to sequence II.
Des séquences de grand intérêt comportent 1'information génétique pour coder pour une ou plusieurs séquences d'acides aminés de l'enchaînement II correspondant à une région de cet enchaînement capable de se lier avec un immunosuppresseur du type FK 506 possédant les caractéristiques structurales pour une activité rotamase.Sequences of great interest include the genetic information to code for one or more amino acid sequences of sequence II corresponding to a region of this sequence capable of binding with an immunosuppressant of the FK 506 type having the structural characteristics for a rotamase activity.
D'autres séquences préférées comportent 1'information génétique pour coder pour une ou plusieurs séquences d'acides aminés de l'enchaînement II correspondant à une région capable de se lier à l'ATP (adénosine triphosphate) / GTP (guanosine triphosphate) .Other preferred sequences include genetic information to code for one or more sequence II amino acid sequences corresponding to a region capable of binding to ATP (adenosine triphosphate) / GTP (guanosine triphosphate).
D'autres séquences préférées encore comportentStill other preferred sequences include
1'information génétique pour coder pour une ou plusieurs séquences d'acides aminés de l'enchaînement II correspondant à une région capable de se lier à la calmodulineGenetic information to code for one or more sequence II amino acid sequences corresponding to a region capable of binding to calmodulin
Selon un autre aspect, l'invention vise une séquence recombinante comprenant l'une des séquences définies ci-dessus, le cas échéant associée à un promoteur capable de contrôler la transcription de la séquence et une séquence d'ADN codant pour les signaux de terminaison de la transcription.-According to another aspect, the invention relates to a recombinant sequence comprising one of the sequences defined above, optionally associated with a promoter capable of controlling the transcription of the sequence and a DNA sequence coding for the termination signals of the transcription.
De telles séquences renferment avantageusement des séquences codantes pour des chaperones.Such sequences advantageously contain sequences coding for chaperones.
Des séquences de ce type préférées renferment des séquences codantes pour la hsp90, en particulier pour la région A hydrophile, de cette protéine, fortement chargée négativement (Binart et al., J. Steroid. Biochem. 1989, vol. 34, n° 1, 369-374).Preferred sequences of this type contain coding sequences for hsp90, in particular for the hydrophilic region A, of this negatively charged protein (Binart et al., J. Steroid. Biochem. 1989, vol. 34, no. 1) , 369-374).
Les bases puriques et pyrimidiques des séquences de nucieotides considérées peuvent présenter un ordre différent de celui trouvé dans l'ADNc clone et/ou le cas échéant, peuvent être substituées. Il est entendu que de telles séquences entrent dans le cadre de l'invention, dès lors qu'un fragment de ces séquences utilisé comme sonde donne lieu à une hybridation avec un gène codant pour des protéines telles que définies ci-dessus.The purine and pyrimidine bases of the nucieotide sequences under consideration may have a different order than that found in the cloned cDNA and / or if appropriate, may be substituted. It is understood that such sequences fall within the scope of the invention, when a fragment of these sequences used as a probe gives rise to hybridization with a gene coding for proteins as defined above.
L'invention vise également les ARN et les séquences complémentaires des différents enchaînements nuclêotidiques définis ainsi que les protéines codées correspondantes.The invention also relates to the RNAs and the complementary sequences of the various defined nucleotide sequences as well as the corresponding coded proteins.
L'invention se rapporte également aux vecteurs recombinants de clonage et d'expression capables de transformer une cellule hôte appropriée, comportant au moins une partie d'une séquence de nucieotides telle que définie ci-dessus, sous le contrôle d'éléments de régulation permettant son expression. Les souches de microorganismes transformées ou transfectées vont également dans le cadre de l'invention.The invention also relates to recombinant cloning and expression vectors capable of transforming an appropriate host cell, comprising at least part of a nucieotide sequence as defined above, under the control of regulatory elements allowing his expression. The strains of transformed or transfected microorganisms also fall within the scope of the invention.
Ces souches comportent 1'une des séquences de nucieotides définies ci-dessus ou encore un vecteur recombinant tel que défini précédemment.These strains comprise one of the nucieotide sequences defined above or else a recombinant vector as defined above.
L'invention vise également les séquences d'acides aminés déduites, selon le code génétique universel, des séquences de nucieotides définies plus haut, et les protéines exprimées par les gènes comportant ces séquences. Des séquences selon l'invention, présentant un grand intérêt au regard des applications envisagées en diagnostic, sont caractérisées en ce qu'elles correspondent à des séquences capables de se lier à des protéines de choc thermique ou qu'elles possèdent les propriétés de telles protéines.The invention also relates to the amino acid sequences deduced, according to the universal genetic code, from the nucieotide sequences defined above, and the proteins expressed by the genes comprising these sequences. Sequences according to the invention, which are of great interest with regard to the applications envisaged in diagnosis, are characterized in that they correspond to sequences capable of binding to heat shock proteins or that they have the properties of such proteins .
Selon une autre disposition avantageuse de l'invention, il s'agit de séquences capables de se lier à la hsp90, même lorsque la hsp90 est impliquée dans des complexes hétéro-oligomères avec d'autres protéines comme indiqué plus haut. Il peut s'agir de complexes impliqués dans la formation des récepteurs des stéroïdes ou dans d'autres complexes, par exemple avec des oncogènes et des protéines du cytosquelette.According to another advantageous arrangement of the invention, these are sequences capable of binding to hsp90, even when hsp90 is involved in hetero-oligomeric complexes with other proteins as indicated above. These may be complexes involved in the formation of steroid receptors or in other complexes, for example with oncogenes and proteins of the cytoskeleton.
Les complexes de ces séquences protéiques avec la hsp90 ou avec d'autres protéines de choc thermique impliquées dans ces hétéro-oligomères, ou avec des régions de ces différentes protéines, font également partie de 1'invention.The complexes of these protein sequences with hsp90 or with other heat shock proteins involved in these hetero-oligomers, or with regions of these different proteins, are also part of the invention.
Selon une autre disposition de l'invention, le cas échéant prise en combinaison avec au moins 1'une de celles qui précèdent, les séquences d'acides aminés sont caractérisées en ce qu'elles possèdent un ou plusieurs domaines du type de la FKBP, identiques ou différents les uns des autres. Les protéines correspondantes seront appelées ci-après protéines HBI, c'est-à-dire protéines du type de 1'immunophiline liant les protéines de choc thermique. La FKBP est une immunophiline liant au moins deux médicaments immunosuppresseurs à savoir le FK506 et la rapamycine.According to another arrangement of the invention, if necessary taken in combination with at least one of the above, the amino acid sequences are characterized in that they have one or more domains of the type of FKBP, identical or different from each other. The corresponding proteins will hereinafter be called HBI proteins, that is to say proteins of the immunophilin type binding heat shock proteins. FKBP is an immunophilin that binds at least two immunosuppressive drugs, namely FK506 and rapamycin.
De telles séquences d'acides aminés sont plus spécialement caractérisées en ce qu'elles possèdent les caractéristiques structurales pour une liaison avec un immunosuppresseur du type FK506 et pour une activité peptidyl-prolyl isomérase cis-trans.Such amino acid sequences are more particularly characterized in that they have the structural characteristics for binding with an immunosuppressant of the FK506 type and for peptidyl-prolyl isomerase cis-trans activity.
Les séquences d'acides aminés de l'invention, selon une autre disposition de l'invention, prise le cas échéant en combinaison avec au moins 1'une de celles qui précèdent, comportent un site de liaison à l'ATP.The amino acid sequences of the invention, according to another provision of the invention, taken if appropriate in combination with at least one of the above, include an ATP binding site.
Selon un autre aspect, les séquences d'acides aminés de 1'invention sont caractérisées en ce qu'elles comportent une séquence consensus de liaison à la calmoduline.According to another aspect, the amino acid sequences of the invention are characterized in that they comprise a consensus sequence of binding to calmodulin.
Selon encore un autre aspect, les séquences d'acides aminés sont caractérisées en ce qu'elles correspondent aux régions charnières entre deux domaines. II s'agit plus spécialement de régions hydrophiles, accessibles à des enzymes protéolytiques.According to yet another aspect, the amino acid sequences are characterized in that they correspond to the hinge regions between two domains. They are more specifically hydrophilic regions, accessible to proteolytic enzymes.
Dans une variante de réalisation de l'invention, des séquences d'acides aminés du type FKBP comprennent ou sont formées par un seul des domaines du type FKBP. Dans une autre variante, elles comprennent ou sont formées par deux de ces domaines, identiques ou différents, reliés par une charnière.In an alternative embodiment of the invention, amino acid sequences of the FKBP type comprise or are formed by only one of the FKBP type domains. In another variant, they comprise or are formed by two of these areas, identical or different, connected by a hinge.
Dans une autre variante encore, les séquences d'acides aminés comportent ou sont formées par une pluralité de séquences identiques ou différentes correspondant à l'un des domaines du type FKBP.In yet another variant, the amino acid sequences comprise or are formed by a plurality of identical or different sequences corresponding to one of the domains of the FKBP type.
Dans ces différentes variantes, il s'agit de domaines ayant une très forte homologie de structure tridimensionnelle (3D) avec FKPB de l'ordre de 80 à 100 %, ou de domaines ayant une homologie inférieure, notamment de l'ordre de 35 à 80 %, voire de 25 à 35 % environ.In these different variants, these are domains having a very strong three-dimensional (3D) structure homology with FKPB of the order of 80 to 100%, or domains having a lower homology, in particular of the order of 35 to 80% or even 25 to 35% approximately.
Les séquences d'acides aminés de 1'invention sont également caractérisées en ce qu'elles sont telles qu'obtenues par transformation de cellules hôtes au moyen d'un vecteur recombinant comme défini ci-dessus, mise en culture, dans un milieu approprié, des cellules hôtes transformées ou transfectées et récupération de la protéine à partir de ces cellules ou directement à partir du milieu de culture.The amino acid sequences of the invention are also characterized in that they are such that obtained by transformation of host cells using a recombinant vector as defined above, culturing, in an appropriate medium, transformed or transfected host cells and recovery of the protein from these cells or directly from culture medium.
Les protéines ou séquences de l'invention peuvent donc éventuellement se trouver sous forme de protéines de fusion. La production de ces protéines par un tel procédé fait également partie de l'invention.The proteins or sequences of the invention can therefore possibly be in the form of fusion proteins. The production of these proteins by such a process also forms part of the invention.
Les protéines de 1'invention et leurs fragments, qui peuvent être également obtenus par synthèse chimique, présentent avantageusement un degré de pureté élevé et sont utilisés pour former, selon les techniques classiques, des anticorps polyclonaux et des anticorps monoclonaux.The proteins of the invention and their fragments, which can also be obtained by chemical synthesis, advantageously have a high degree of purity and are used to form, according to conventional techniques, polyclonal antibodies and monoclonal antibodies.
De tels anticorps polyclonaux, ainsi que les anticorps monoclonaux capables de reconnaître spécifiquement un épitope des séquences d'acides aminés ci-dessus, ou d'un fragment de ces séquences en donnant lieu à une réaction du type antigène-anticorps, sont également visés par l'invention.Such polyclonal antibodies, as well as monoclonal antibodies capable of specifically recognizing an epitope of the above amino acid sequences, or of a fragment of these sequences by giving rise to an antigen-antibody type reaction, are also targeted by the invention.
Des anticorps de grand intérêt sont dirigés contre l'un des domaines des protéines HBI et sont donc utiles pour détecter les récepteurs des immunosuppresseurs et peuvent servir à inhiber la fonction exercée par ce domaine.Antibodies of great interest are directed against one of the domains of the HBI proteins and are therefore useful for detecting the receptors of immunosuppressants and can serve to inhibit the function exerted by this domain.
L'invention vise en outre les applications biologiques des séquences de nucieotides, des protéines correspondantes et des anticorps monoclonaux ou polyclonau .The invention further relates to the biological applications of the nucieotide sequences, of the corresponding proteins and of the monoclonal or polyclonal antibodies.
Ces applications comprennent l'élaboration, à partir de fragments intragéniques purifiés, ou d'ARN correspondants, de sondes moléculaires pour rechercher la présence éventuelle dans divers types cellulaires de séquences de nucieotides apparentées au gène capable de coder pour des protéines associées à la hsp90 dans des complexes hétéro-oligomériques comme indiqué plus haut. L'élaboration de ces sondes comprend, notamment la dénaturation des séquences à double brins pour obtenir une séquence monobrin.These applications include the development, from purified intragenic fragments, or from corresponding RNA, of molecular probes to search for the possible presence in various cell types of sequences of nucieotides related to the gene capable of coding for proteins associated with hsp90 in hetero-oligomeric complexes as indicated above. The development of these probes includes, in particular the denaturation of the double-stranded sequences to obtain a single-stranded sequence.
Les essais effectués pour détecter la présence de séquences complémentaires dans diverses tumeurs et tissus chez l'homme ou l'animal ont mis en évidence la grande spécificité de ces fragments intragéniques.The tests carried out to detect the presence of complementary sequences in various tumors and tissues in humans or animals have demonstrated the great specificity of these intragenic fragments.
L'utilisation de ces sondes a ainsi permis de montrer que le gène renfermant les séquences nucléotidiques définies ci-dessus est exprimé chez les mammifères.The use of these probes has thus made it possible to show that the gene containing the nucleotide sequences defined above is expressed in mammals.
L'invention vise donc des sondes de détection caractérisées en ce qu'elles comprennent au moins une partie d'une séquence de nucieotides définie ci-dessus.The invention therefore relates to detection probes characterized in that they comprise at least part of a sequence of nucieotides defined above.
Des substitutions ou altérations de nucieotides peuvent être apportées dans ces séquences, dès lors que la sonde correspondante est capable de s'hybrider avec le gène de la protéine HBI comme défini plus haut.Substitutions or alterations of nucieotides can be made in these sequences, provided that the corresponding probe is capable of hybridizing with the gene for the HBI protein as defined above.
La construction de la sonde est avantageusement effectuée selon les techniques classiques, notamment on utilise un nombre de nucieotides suffisant pour obtenir la spécificité requise et la formation d'un hybride stable.The construction of the probe is advantageously carried out according to conventional techniques, in particular a sufficient number of nucieotides is used to obtain the required specificity and the formation of a stable hybrid.
Il est possible d'utiliser des fragments atteignant plusieurs kb, des résultats de haute spécificité étant cependant également obtenus avec des fragments plus courts d'environ 20 à 40 nucieotides.It is possible to use fragments reaching several kb, results of high specificity being however also obtained with shorter fragments of approximately 20 to 40 nucieotides.
Ces sondes sont avantageusement marquées par un groupe permettant leur reconnaissance à l'état hybride avec la préparation renfermant les nucieotides à étudier.These probes are advantageously marked with a group allowing their recognition in a hybrid state with the preparation containing the nucieotides to be studied.
Selon les techniques classiques, ces sondes sont mises en contact avec l'échantillon biologique à tester ou leurs acides nucléiques, dans des conditions permettant la réalisation de l'hybridation entre la séquence de nucieotides de la sonde et une séquence complémentaire, lorsqu'elle est contenue dans le produit étudié. On peut, par exemple, avoir recours à la méthode d'hybridation sur taches ou à la méthode d'hybridation sur réplique, selon la technique de Southern. Dans la première méthode, selon la technique classique, on dépose une quantité aliquote d'ADN dénaturé sur des membranes de nitrocellulose. La deuxième méthode comprend la séparation électrophorétique en gel d'agarose des fragments d'ADN engendrés après traitement de 1'ADN par des enzymes de restriction, le transfert après dénaturation alcaline sur des membranes appropriées et leur hybridation avec la sonde dans les conditions usuelles.According to conventional techniques, these probes are brought into contact with the biological sample to be tested or their nucleic acids, under conditions allowing hybridization between the nucieotide sequence of the probe and a complementary sequence, when it is contained in the product studied. One can, for example, have recourse to the method of hybridization on spots or to the method of hybridization on replica, according to the technique of Southern. In the first method, according to the conventional technique, a aliquot of denatured DNA on nitrocellulose membranes. The second method comprises the electrophoretic separation in agarose gel of the DNA fragments generated after treatment of the DNA with restriction enzymes, the transfer after alkaline denaturation on appropriate membranes and their hybridization with the probe under the usual conditions.
Ces sondes constituent des marqueurs en permettant la détection précoce de 1'expression du gène renfermant HBI, c'est-à-dire capable d'exprimer la protéine de l'enchaînement II, qui normalement n'est pas ou peu exprimé dans les tissus normaux correspondants. L'invention fournit ainsi des moyens permettant d'évaluer le développement e /ou la différentiation tumorale. L'invention vise également un procédé de détection in vitro de la présence dans un échantillon biologique de séquences complémentaires de celles définies ci-dessus.These probes constitute markers by allowing the early detection of the expression of the gene containing HBI, that is to say capable of expressing the protein of sequence II, which normally is little or not expressed in the tissues corresponding normal. The invention thus provides means for assessing tumor development and / or differentiation. The invention also relates to a method for detecting in vitro the presence in a biological sample of sequences complementary to those defined above.
Ce procédé est caractérisé en ce qu'il comprend les étapes de : - mise en contact de l'échantillon à étudier avec une sonde nucléotidique telle que définie ci-dessus, dans des conditions permettant une hybridation entre la sonde et la séquence de nucieotides recherchée, etThis method is characterized in that it comprises the steps of: - bringing the sample to be studied into contact with a nucleotide probe as defined above, under conditions allowing hybridization between the probe and the desired nucieotide sequence , and
- détection du complexe d'hybridation. Ce procédé permet une détection rapide et de grande spécificité des ADN et des différentes espèces d'ARNm de transcription.- detection of the hybridization complex. This method allows rapid and highly specific detection of DNAs and different species of transcription mRNA.
Il permet notamment le criblage d'une banque de tissus malades, l'étude du développement d'une différenciation tumorale et la détection précoce de 1'expression du gène de la protéine HBI.It allows in particular the screening of a bank of diseased tissues, the study of the development of tumor differentiation and the early detection of the expression of the gene for the HBI protein.
Le procédé défini ci-dessus de détection in vitro, basé sur l'utilisation de sondes nucléotidiques, est avantageusement mis en oeuvre à 1'aide de kits comprenant : - une quantité déterminée d'une sonde nucléotidique selon l'invention, - un milieu approprié à l'hybridation entre la sonde utilisée et la séquence à détecter, et avantageusement, des réactifs permettant la détection des complexes d'hybridation formés.The method defined above for in vitro detection, based on the use of nucleotide probes, is advantageously implemented using kits comprising: - a determined quantity of a nucleotide probe according to the invention, - a medium suitable for hybridization between the probe used and the sequence to be detected, and advantageously, reagents allowing the detection of the hybridization complexes formed.
L'invention vise également les applications immunologiques des séquences d'acides aminés définies ci- dessus, plus spécialement pour l'élaboration d'antiserums spécifiques ainsi que d'anticorps polyclonaux et monoclonaux.The invention also relates to the immunological applications of the amino acid sequences defined above, more especially for the development of specific antisera as well as polyclonal and monoclonal antibodies.
Les anticorps polyclonaux sont tels qu'induits selon les techniques classiques par injection des séquences d'acides aminés à des animaux, suivie de la récupération des antiserums puis, à partir de ces derniers, si on le souhaite des anticorps, par exemple par chromatographie d'affinité.The polyclonal antibodies are as induced according to conventional techniques by injection of the amino acid sequences into animals, followed by the recovery of the antisera then, from the latter, if desired antibodies, for example by chromatography of 'affinity.
Les anticorps monoclonaux sont produits de manière habituelle en fusionnant des cellules de myélomes avec des cellules de rates d'animaux préalablement immunisés à l'aide des protéines de l'invention. A cet égard, on opère avantageusement selon la technique décrite par Kôhler et Milstein dans Nature, vol 256, p 495, 1975.Monoclonal antibodies are produced in the usual way by fusing myeloma cells with spleen cells from animals previously immunized with the proteins of the invention. In this respect, one operates advantageously according to the technique described by Kôhler and Milstein in Nature, vol 256, p 495, 1975.
Les anticorps de l'invention permettent de détecter in vitro les produits d'expression des séquences nucléotidiques définies plus haut ou ceux des gènes codant pour une protéine de choc thermique apparentée à celles des complexes hétérooligomères définis ci-dessus, notamment des récepteurs de stéroïdes.The antibodies of the invention make it possible to detect in vitro the products of expression of the nucleotide sequences defined above or those of the genes coding for a heat shock protein related to those of the heterooligomeric complexes defined above, in particular steroid receptors.
La méthode de dépistage in - vitro dans un échantillon biologique de la présence éventuelle de ces produits d'expression est caractérisée en ce qu'elle comprend :The in-vitro screening method in a biological sample for the possible presence of these expression products is characterized in that it comprises:
- la mise en contact de l'échantillon à étudier avec un anticorps selon l'invention, dans des conditions permettant la formation d'un complexe immunologique entre tout ou partie des protéines exprimées par les séquences nucléotidiques et cet anticorps, etbringing the sample to be studied into contact with an antibody according to the invention, under conditions allowing the formation of an immunological complex between all or part of the proteins expressed by the nucleotide sequences and this antibody, and
- la détection du complexe immunologique. Pour cette méthode de dépistage in vitror on aura recours avantageusement à des kits, comprenant : - une quantité déterminée d'un anticorps polyclonal ou monoclonal selon 1'invention, - un milieu approprié à la réalisation d'une réaction immunologique entre au moins une partie des produits exprimés et l'anticorps et, avantageusement, des réactifs permettant la détection dess complexes immunologiques formés. Les séquences d'acides aminés définies ci-dessus constituent également des outils de grand intérêt pour l'étude et/ou la régulation des fonctions des protéines associées auxdits complexes.- detection of the immunological complex. For this in vitro screening method r advantageously use kits, comprising: - a determined quantity of a polyclonal or monoclonal antibody according to the invention, - a medium suitable for carrying out an immunological reaction between at least one part of the products expressed and the antibody and, advantageously, of the reagents allowing the detection of the immunological complexes formed. The amino acid sequences defined above also constitute tools of great interest for the study and / or regulation of the functions of proteins associated with said complexes.
L'invention fournit ainsi des moyens de grande efficacité pour étudier et prévenir ou traiter des pathologies liées au dysfonctionnement des protéines associées aux complexes hétéro-oligomériques évoqués ci- dessus.The invention thus provides very effective means for studying and preventing or treating pathologies linked to the dysfunction of proteins associated with the hetero-oligomeric complexes mentioned above.
On citera par exemple les maladies du système immunitaire ou auto-immunes, les cancers, les déficiences en vitamine D responsables de rachitisme, ou en acide rétinoïque ou encore l'intoxication par la dioxine ou produits apparentés.Mention will be made, for example, of diseases of the immune or autoimmune system, cancers, deficiencies in vitamin D responsible for rickets, or in retinoic acid or even intoxication by dioxin or related products.
Ces moyens, qu'il s'agisse des polynucléotides, des séquences d'acides aminés ou des anticorps permettent également la localisation des protéines associées aux complexes hétéro-oligomériques décrits plus haut.These means, whether polynucleotides, amino acid sequences or antibodies also allow the localization of proteins associated with the hetero-oligomeric complexes described above.
Il a été ainsi possible de constater que la protéine naturelle associée à la hsp90 dans ces complexes est localisée dans le noyau des cellules de tissus normaux alors que dans les cellules tumorales, elle apparaît de manière abondante dans le cytoplasme. L'utilisation des moyens de l'invention permet donc d'effectuer des différences de localisation significatives de pathologies. Selon un autre aspect de grand intérêt, ils permettent également de trouver des ligands naturels susceptibles d'occuper les sites de liaison reconnus par les immunosuppresseurs. Les protéines HBI sont utiles pour la recherche de nouveaux réactifs et médicaments se liant à cette protéine, et pouvant influencer le fonctionnement de la protéine de choc thermique et des protéines qui lui sont associées sur des récepteurs des hormones stéroïdes et des autres ligands des récepteurs de la même famille, sur l'activité d'oncogènes ayant une activité protéine kinase, sur la structure et le fonctionnement des protéines du cytosquelette et de toute protéine associée à la hsp90. Il en résulte des applications de grand intérêt dans les domaines endocriniens, cancérologiques et immunologiques.It was thus possible to note that the natural protein associated with hsp90 in these complexes is localized in the nucleus of normal tissue cells whereas in tumor cells, it appears abundantly in the cytoplasm. The use of the means of the invention therefore makes it possible to make significant localization differences in pathologies. According to another aspect of great interest, they also make it possible to find natural ligands capable of occupying the binding sites recognized by the immunosuppressants. The HBI proteins are useful for the search for new reagents and drugs which bind to this protein, and which can influence the functioning of the heat shock protein and the proteins associated with it on receptors for steroid hormones and other ligands for receptors for the same family, on the activity of oncogenes having protein kinase activity, on the structure and functioning of cytoskeleton proteins and any protein associated with hsp90. This results in applications of great interest in the endocrine, cancer and immunological fields.
On rapporte dans les exemples qui suivent d'autres caractéristiques et avantages de l'invention.In the examples which follow, other characteristics and advantages of the invention are reported.
Dans ces exemples, il est fait référence aux figures 1 à 7 qui représentent respectivement :In these examples, reference is made to FIGS. 1 to 7 which respectively represent:
- la figure 1, la séquence d'ADNc de foie de lapin codant pour une protéine HBI et la séquence en acides aminés correspondante,FIG. 1, the rabbit liver cDNA sequence coding for an HBI protein and the corresponding amino acid sequence,
- la figure 2, les représentations établies par la méthode d'analyse des clusters hydrophobes (ACH) des domaines d'une protéine HBI comparés à la FKBP et à des domaines de type FKBP identifiés dans diverses protéines,FIG. 2, the representations established by the method of analysis of hydrophobic clusters (ACH) of the domains of an HBI protein compared to the FKBP and to domains of the FKBP type identified in various proteins,
- les figures 3 et 4, les représentations ACH de la FKBP humaine et de la protéine HBI et les alignements des séquences correspondantes d'acides aminés,FIGS. 3 and 4, the ACH representations of human FKBP and of the HBI protein and the alignments of the corresponding amino acid sequences,
- la figure 5, une représentation de la structure des domaines de la pHBI en utilisant comme matrice la chaîne principale de FKBP,FIG. 5, a representation of the structure of the domains of pHBI using the main chain of FKBP as a matrix,
- la figure 6, une représentation schématique des caractéristiques principales de la pHBI, la figure 7, un schéma représentant la construction d'une cassette pour la production de fragments de la pHBI, etFIG. 6, a schematic representation of the main characteristics of pHBI, FIG. 7, a diagram representing the construction of a cassette for the production of fragments of pHBI, and
- la figure 8, les résultats d'un Western blot réalisé avec un anticorps polyclonal anti-HBI de- Figure 8, the results of a Western blot performed with an anti-HBI polyclonal antibody
1'invention. Exemple 1 : Clonage et séquençage de 1'ADNc codant pour une protéine HBI.The invention. Example 1: Cloning and sequencing of the cDNA coding for an HBI protein.
Aux fins de clonage d'une banque d'ADNc de foie de lapin, on construit des sondes à partir d'oligonucléotides dont la séquence a été déduite de celle d'un fragment de 19 acides aminés répondant à la séquence :For the purpose of cloning a rabbit liver cDNA library, probes are constructed from oligonucleotides whose sequence has been deduced from that of a fragment of 19 amino acids corresponding to the sequence:
ALA GLU GLU MET LYS ALA THR GLU SER GLY ALA GLN X ALA PRO LEU PRO MET GLUALA GLU GLU MET LYS ALA THR GLU SER GLY ALA GLN X ALA PRO LEU PRO MET GLU
Il s'agit du fragment de la partie N-terminale d'une protéine identifiée dans des complexes de récepteurs de stéroïdes non transformés décrite par Sanchez et al. dans Biochemistry 1990, 29, 5145-5152. La construction de la sonde est effectuée en opérant selon l'ouvrage de Maniatis précité Tome 2, chapitre 11 "Synthetic oligonucleotidic probes".It is the fragment of the N-terminal part of a protein identified in complexes of unprocessed steroid receptors described by Sanchez et al. in Biochemistry 1990, 29, 5145-5152. The construction of the probe is carried out by operating according to the aforementioned work of Maniatis Volume 2, chapter 11 "Synthetic oligonucleotidic probes".
Le criblage de la banque d'ADNc est effectué selon la méthode décrite dans le chapitre 8 de 1'ouvrage précité "Construction and analysis of cDNA libraries".The screening of the cDNA library is carried out according to the method described in chapter 8 of the abovementioned book "Construction and analysis of cDNA libraries".
L'ADNc du clone positif le plus long est isolé et sous-cloné dans pGEM 7Zf (Promega Biotec), transcrit et traduit dans un système de lysat de réticulocytes de lapin. La transcription et la traduction sont réalisées comme décrit par le fabricant du plasmide en présence de 35s méthionine.The longest positive clone cDNA is isolated and subcloned into pGEM 7Zf (Promega Biotec), transcribed and translated into a rabbit reticulocyte lysate system. Transcription and translation are carried out as described by the manufacturer of the plasmid in the presence of 35s methionine.
L'ADNc sous-cloné dans le vecteur pGEM 7Zf est digéré par 1'exonucléase III pour générer des sous clones de délétion qui sont alors séquences en utilisant le promoteur de l'ARN polymérase T7 comme amorce. On peut également sous-cloner l'ADNc dans les vecteurs M13 MP 18/19 et sequencer selon la technique classique comme décrit par exemple dans l'ouvrage de Maniatis précité.The cDNA subcloned into the vector pGEM 7Zf is digested with exonuclease III to generate deletion subclones which are then sequenced using the T7 RNA polymerase promoter as a primer. The cDNA can also be subcloned into the vectors M13 MP 18/19 and sequenced according to the conventional technique as described for example in the aforementioned work by Maniatis.
La séquence de nucieotides et la séquence d'acides aminés dérivée du cadre ouvert de lecture entier sont rapportées sur la figure 1. La séquence soulignée correspond à celle utilisée pour générer 1'anticorps polyclonal dont il est question ci-après dans 1'exemple 3. La ligne en pointillés indique la région correspondant au site d'interaction avec la calmoduline.The nucieotide sequence and the amino acid sequence derived from the entire open reading frame are reported in Figure 1. The underlined sequence corresponds to that used to generate the polyclonal antibody discussed below in Example 3 . The dotted line indicates the region corresponding to the site of interaction with calmodulin.
Ex mpl 2 : Etude de la protéine HBI, appelée ci- après pHBI, par la méthode d'analyse des clusters hydrophobes (en abrégé ACH)Ex mpl 2: Study of the HBI protein, hereinafter called pHBI, by the method of analysis of hydrophobic clusters (abbreviated ACH)
MATERIEL ET METHODESMATERIAL AND METHODS
Les stratégies d'analyses de clusters hydrophobesHydrophobic cluster analysis strategies
2D (ACH) et leurs applications ont été proposées la première fois par Gaboriaud et al., 1987, FEBS Lett. 224, 149, 155 et sont décrites en détail par Lemesle-Varloot et al., 1990, Biochimie, 72, 555-574. ACH constitue une méthode utilisant les principes généraux de repliement des protéines. Elle est basée sur la recherche de correspondances successives de clusters hydrophobes qui sont pertinentes vis-à-vis de la structure secondaire et du repliement 3D des domaines des protéines. Dans les protéines apparentées, il est possible de déduire un alignement de séquences précis à partir des représentations ACH en procédant à partir du noyau hydrophobe de clusters similaires vers des régions liant des clusters (boucles) où les insertions/délétions sont permises.2D (ACH) and their applications were first proposed by Gaboriaud et al., 1987, FEBS Lett. 224, 149, 155 and are described in detail by Lemesle-Varloot et al., 1990, Biochemistry, 72, 555-574. ACH is a method using the general principles of protein folding. It is based on the search for successive correspondences of hydrophobic clusters which are relevant to the secondary structure and the 3D folding of the protein domains. In related proteins, it is possible to deduce precise alignment of sequences from ACH representations by proceeding from the hydrophobic nucleus of similar clusters to regions linking clusters (loops) where insertions / deletions are allowed.
Pour ces alignements HCA, une valeur numérique (score HCA) peu.t être calculée entre les clusters pour déterminer les alignements.For these HCA alignments, a numerical value (HCA score) can be calculated between the clusters to determine the alignments.
Les études 3D ont été effectuées avec le programme MANOSK (Cherfils et al. 1988, J. Mol. Graph. 6, 155-160) sur Evans & Sutherland PS390.The 3D studies were carried out with the MANOSK program (Cherfils et al. 1988, J. Mol. Graph. 6, 155-160) on Evans & Sutherland PS390.
L'analyse de la pHBI montre qu'elle comporte, en partant de l'extrémité N-terminale, trois domaines successifs. , Identification de domaines immunophilines : domaines pHBI I et pHBI II.The analysis of the pHBI shows that it comprises, starting from the N-terminal end, three successive domains. , Identification of immunophilin domains: pHBI I and pHBI II domains.
La figure 2 donne alignées, les représentations établies par ACH de la FKBP humaine (FKBPh) et des domaines I et II de la pHBI. Cette figure mentionne également les domaines de type FKBP déjà identifiés chez d'autres protéines. Il s'agit de la protéine RBP1 liant la rapamycine de Saccharomyces cerevisiae (Koltin et al. 1991, Mol. Cell Biol. 11, 1718-1723), la FKBP de Neurospora crassa (Tropschug et al. 1990, Nature, 346, 674-677, une séquence cryptique de Neisseria meningiditis (Perry et al. 1988, J. Bact. 170, 1691-1697), une protéine de 25,3 kDa de Pseudomonas aeruginosa (n° JQ 0140), la protéine de surface cellulaire mip de Legionella pneumophila (Engleberg et al. 1989 Inf. Immunity 57, 1263-1270), la protéine L2 de Chlamydia trachomatis (Lundemose et al. 1991, Mol. Microbiology 5, 109-115).Figure 2 gives aligned, ACH representations of human FKBP (FKBPh) and domains I and II of pHBI. This figure also mentions the FKBP type domains already identified in other proteins. It is the RBP1 protein binding rapamycin from Saccharomyces cerevisiae (Koltin et al. 1991, Mol. Cell Biol. 11, 1718-1723), the FKBP from Neurospora crassa (Tropschug et al. 1990, Nature, 346, 674 -677, a cryptic sequence of Neisseria meningiditis (Perry et al. 1988, J. Bact. 170, 1691-1697), a 25.3 kDa protein from Pseudomonas aeruginosa (n ° JQ 0140), the cell surface protein mip from Legionella pneumophila (Engleberg et al. 1989 Inf. Immunity 57, 1263-1270), the L2 protein of Chlamydia trachomatis (Lundemose et al. 1991, Mol. Microbiology 5, 109-115).
Les clusters hydrophobes hachurés mettent en évidence les points d'ancrage pour les alignements de séquences.Hatched hydrophobic clusters highlight anchor points for sequence alignments.
La structure secondaire de la FKB h est indiquée au-dessus de sa séquence conformément à la description de la structure 3D. Les feuillets β sont indiqués par les symboles O^ e-t les hélices α par UH-X .The secondary structure of the FKB h is indicated above its sequence in accordance with the description of the 3D structure. The β sheets are indicated by the symbols O ^ and are helices α by UH-X.
Les colonnes noires indiquent les résidus conservés, les colonnes grises et avec des pointillés les résidus homologues hydrophobes et hydrophiles et celles ouvertes les particulièrement riches en P, G, S, T et/ou A. Les acides aminés (chaînes principales et/ou latérales) qui sont essentiels pour la liaison de FK506 à FKBP et sont pleinement conservés pour p59 I sont indiqués par des flèches. On a mentionné des parenthèses lorsque l'alignement entre acides aminés n'est pas possible. L'analyse de cette figure montre que la pHBI comprend deux domaines successifs d'environ 100 résidus (pHBI I et pHBI II) ayant une forte homologie avec la FKBP.The black columns indicate the conserved residues, the gray columns and with dotted lines the hydrophobic and hydrophilic homologous residues and those open those particularly rich in P, G, S, T and / or A. Amino acids (main and / or side chains ) which are essential for the binding of FK506 to FKBP and are fully conserved for p59 I are indicated by arrows. Parentheses have been mentioned when alignment between amino acids is not possible. Analysis of this figure shows that the pHBI comprises two successive domains of approximately 100 residues (pHBI I and pHBI II) having a strong homology with the FKBP.
Le premier domaine présente une identité de séquence de 49 % avec FKBP sans introduction de délétion ou d'insertion.The first domain has a sequence identity of 49% with FKBP without the introduction of deletion or insertion.
Le deuxième domaine présente une identité de séquence de 28 % avec FKBP et comprend 4 zones d'insertion ou de délétion totalisant 9 acides aminés. On attribue à ces domaines, au vu de leur homologie de structure avec FKBP, une topologie de repliement des feuillets β anti-parallèle, accompagnée d'une hélice α et d'un feuillet β supplémentaire. II est fait référence à ce feuillet β comme étant du type A (chaînes Al à A5).The second domain has a 28% sequence identity with FKBP and comprises 4 insertion or deletion zones totaling 9 amino acids. These domains are assigned, in view of their structural homology with FKBP, a topology for folding anti-parallel β sheets, accompanied by an α helix and an additional β sheet. Reference is made to this β sheet as being of type A (chains A1 to A5).
Sur la figure 3, on rapporte les représentations graphiques selon ACH de la FKBP humaine et de la pHBI segmentée de manière à montrer sa symétrie interne. Au- dessus de la représentation de la FKBP, on indique comme dans la figure 2, sa structure secondaire.In FIG. 3, the graphical representations according to ACH of the human FKBP and of the segmented pHBI are reported so as to show its internal symmetry. Above the representation of the FKBP, we indicate as in Figure 2, its secondary structure.
Les séquences protéiques sont dessinées sur hélice α classique applatie sur un cylindre, coupé parallèlement à son axe et déroulé pour fournir une représentation à deux dimensions.The protein sequences are drawn on a conventional α helix flattened on a cylinder, cut parallel to its axis and unrolled to provide a two-dimensional representation.
La représentation est doublée verticalement pour restaurer un environnement bidimensionnel complet pour chaque acide aminé.The representation is doubled vertically to restore a complete two-dimensional environment for each amino acid.
Un groupe d'acides aminés hydrophiles (VILFWMY) sont encerclés en clusters. On utilise le code à lettres classique pour tous les acides aminés, excepté pour PA group of hydrophilic amino acids (VILFWMY) are surrounded in clusters. The classic letter code is used for all amino acids, except for P
(désigné par une étoile) qui est un interrupteur de clusters, G (désigné par un symbole en forme de diamant) qui montre une grande flexibilité conformationnelle et T et S (carrés ouverts et en pointillés respectivement) qui sont fréquemment rencontrés dans des boucles, mais peuvent être également trouvés dans des environnements hydrophobes où(designated by a star) which is a cluster switch, G (designated by a diamond-shaped symbol) which shows great conformational flexibility and T and S (open and dotted squares respectively) which are frequently encountered in loops, but can also be found in hydrophobic environments where
1'hydrophilicité de leurs groupes hydroxyle est neutralisée par des liaisons hydrogène avec les chaînes principales. L'encadré reproduisant la partie N-terminale de la pHBI indique également comment s'effectue de manière linéaire la lecture de la séquence (voir flèche légèrement obliqu ).The hydrophilicity of their hydroxyl groups is neutralized by hydrogen bonds with the main chains. The box reproducing the N-terminal part of the pHBI also indicates how the sequence is read linearly (see slightly oblique arrow).
Les lignes verticales délimitent la segmentation des structures (SI à S6) à l'intérieur des domaines.The vertical lines delimit the segmentation of the structures (SI to S6) inside the domains.
Les clusters hydrophobes hachurés mettent en évidence les points d'ancrage pour les alignements de séquences. L'examen de la figure 3 montre que la segmentation classique des domaines globulaires en structures secondaires régulières (feuillets β et hélices α), statistiquement centrés sur les clusters hydrophobes des représentations selon ACH et dans les boucles liant ces structures est nettement conservée pour FKBP, pHBI I et pHBI II.Hatched hydrophobic clusters highlight anchor points for sequence alignments. The examination of FIG. 3 shows that the classic segmentation of the globular domains into regular secondary structures (β sheets and α helices), statistically centered on the hydrophobic clusters of the representations according to ACH and in the loops linking these structures is clearly preserved for FKBP, pHBI I and pHBI II.
On constate une similarité globale centrée sur le segment S4, entre pHBI I, pHBI II et un allongement de séquence suivant pHBI II.There is an overall similarity centered on the S4 segment, between pHBI I, pHBI II and an extension of sequence according to pHBI II.
Cet allongement est attribué à un troisième domaine globulaire de pHBI (pHBI III).This extension is attributed to a third globular domain of pHBI (pHBI III).
En utilisant comme points d'ancrage les segments S4, S5 et S6 des représentations graphiques selon ACH des domaines pHBI I et pHBI II, on a procédé à un alignement acide aminé par acide aminé.Using the S4, S5 and S6 graphical representations according to ACH of the pHBI I and pHBI II domains as anchor points, amino acid by amino acid alignment was carried out.
Ces alignements sont représentés sur la figure 4.These alignments are shown in Figure 4.
Les lignes appuyées représentent les limites de noyaux des séquences du troisième domaine de la pHBI (pHBI III) utilisé pour établir statistiquement les alignements.The pressed lines represent the nuclei limits of the sequences of the third domain of pHBI (pHBI III) used to establish the alignments statistically.
Leurs dimensions sont de 8, 7, 2, 23, 6, 12 acides aminés pour les comparaisons pHBI III / pHBI II et de 6,8,3,27,7,11 acides aminés pour les comparaisons pHBI III / pHBI I, à savoir respectivement 58 et 62 acides aminés.Their dimensions are 8, 7, 2, 23, 6, 12 amino acids for the pHBI III / pHBI II comparisons and 6,8,3,27,7,11 amino acids for the pHBI III / pHBI I comparisons, at namely 58 and 62 amino acids respectively.
Au-dessus et en-dessous, on a indiqué par des cercles pleins et des barres les indentités de séquences et les mutations conservatoires pour pHBI III / pHBI II et pHBI III / pHBI I. On constate une identité de séquence de 13 % environ entre le domaine pHBI III et pHBI II.Above and below, the circle identities and the conservative mutations for pHBI III / pHBI II and pHBI III / pHBI I have been indicated by solid circles and bars. A sequence identity of approximately 13% is observed between the pHBI III and pHBI II domains.
Le domaine pHBI III présente une identité de séquence de 10 % avec le domaine pHBI I.The pHBI III domain has a 10% sequence identity with the pHBI I domain.
Une comparaison entre pHBI III et les deux autres domaines de la pHBI permet d'établir une relation entre eux, basée sur les observations suivantes : - les positions des insertions et des délétions présentes entre les domaines pHBI I et pHBI II sont toutes conservées,A comparison between pHBI III and the two other domains of pHBI makes it possible to establish a relationship between them, based on the following observations: - the positions of the insertions and deletions present between the pHBI I and pHBI II domains are all preserved,
- la pHBI III partage également 13 % d'identité de séquence avec la protéine L2 du type FKBP de Chlamydia trachomatis dont la séquence est rapportée sur la figure 2. Dans cette séquence, un allongement de 21 acides aminés (273-293 de pHBI III et 135-152 de L2) présente 45 % d'identité avec pHBI III.the pHBI III also shares 13% of sequence identity with the L2 protein of the FKBP type of Chlamydia trachomatis, the sequence of which is reported in FIG. 2. In this sequence, an extension of 21 amino acids (273-293 of pHBI III and 135-152 of L2) has 45% identity with pHBI III.
Caractéristiques principales des domaines de la pHBI.Main characteristics of the pHBI domains.
Il sera fait référence dans ce qui suit aux figures 2 et 3 déjà considérées et à la figure 5 qui donne une représentation de la structure complète de la pHBI I en utilisant comme matrice la chaîne principale de FKBP en forme de ruban (on notera qu'il n'existe pas d'insertions ou de délétions entre les domaines de ces deux protéines). La numérotation des résidus de pHBI I est indiquée de cinq en cinq.Reference will be made in the following to FIGS. 2 and 3 already considered and to FIG. 5 which gives a representation of the complete structure of pHBI I using as matrix the main chain of FKBP in the form of a ribbon (it will be noted that there are no insertions or deletions between the domains of these two proteins). The numbering of pHBI I residues is indicated five by five.
Le ligande FK506 lié à FKBP a été conservé comme référence (boules).The FK506 ligand linked to FKBP was kept as reference (balls).
Les chaînes latérales d'acides aminés qui peuvent être critiques pour une liaison hypothétique d'un ligand similaire à FK506 sont complètement représentées (voir fig. 2). Les spécificités du domaine pHBI II sont soulignés :The side chains of amino acids that can be critical for a hypothetical binding of a ligand similar to FK506 are fully represented (see Fig. 2). The specificities of the pHBI II domain are underlined:
1/ raccourcissement (4 acides aminés) de la boucle de 38-45 (numérotation FKBP), 2/ allongement (3 acides aminés) de la boucle 55-1 / shortening (4 amino acids) of the 38-45 loop (FKBP numbering), 2 / lengthening (3 amino acids) of the 55- loop
56 (site de liaison à l'ATP,56 (ATP binding site,
3/ insertion (un acide aminé) dans la boucle 87-90 (stabilisation ATP phosphate),3 / insertion (an amino acid) into the 87-90 loop (ATP phosphate stabilization),
4/ suppression (un acide aminé) dans la boucle 31- 35. pHBI I : On n'observe pas de délétions ou d'insertions dans pHBI I par rapport à FKBP. Toutes les chaînes principales ou secondaires impliquées dans la liaison de FK506 par FKBP sont conservées dans le domaine de la pHBI I.4 / deletion (an amino acid) in the loop 31-35. PHBI I: No deletions or insertions are observed in pHBI I with respect to FKBP. All the main or secondary chains involved in the binding of FK506 by FKBP are conserved in the domain of pHBI I.
En effet, on peut noter que le remplacement de FKBP Q53 par une glycine dans HBI I ne modifie pas 1'interaction de la chaîne principale correspondante CO avec le ligand, s'il existe.Indeed, it can be noted that the replacement of FKBP Q53 by a glycine in HBI I does not modify the interaction of the corresponding main chain CO with the ligand, if it exists.
De même, le remplacement de H87 par une serine paraît avoir seulement une faible influence puisqu'il interagit par un contact Van der Waals à une distance plutôt longue (3,8-4A).Similarly, the replacement of H87 with a serine seems to have only a weak influence since it interacts by a Van der Waals contact at a rather long distance (3,8-4A).
Une mutation similaire (alanine) se produit à la même place pour la protéine humaine FKBP13. En conséquence, toutes les exigences de structure reliées au site catalytique de FKBP apparaissent conservées dans pHBI I. pHBI II : Bien que le domaine de la p59 II soit clairement apparenté à la matrice de FKBP, il présente des caractéristiques spécifiques comme le montrent les figures 2, 3 et 5. 1/ 8 des 12 amino-acides essentiels pour la liaison de FK506 à FKBP ne sont pas conservés.A similar mutation (alanine) occurs in the same place for the human protein FKBP13. Consequently, all the structural requirements related to the catalytic site of FKBP appear preserved in pHBI I. pHBI II: Although the domain of p59 II is clearly related to the matrix of FKBP, it has specific characteristics as shown in the figures 2, 3 and 5. 1/8 of the 12 essential amino acids for the binding of FK506 to FKBP are not conserved.
2/ La boucle v55 _ τ.56 (boucle du type β/α - numérotation FKBP) de FKBP est allongée de 3 acides aminés rendant impossible le maintien de la liaison d'un ligand semblable à FK506, étant donné que ces résidus sont en contact avec le cycle pipecolinyle très important de FK506 (partie la plus profonde du site actif).2 / The v55 _ τ.56 loop (β / α type loop - FKBP numbering) of FKBP is extended by 3 amino acids making it impossible to maintain the binding of a ligand similar to FK506, since these residues are in contact with the very important pipecolinyl cycle of FK506 (deepest part of the active site).
3/ La boucle 87-90 (boucle A2-A3) est largement modifiée avec allongement d'un acide aminé et introduction de résidus basiques, (voir symbole en flocons de neige sur la figure 5).3 / The loop 87-90 (loop A2-A3) is largely modified with elongation of an amino acid and introduction of basic residues, (see symbol in snowflakes in figure 5).
4/ La boucle oméga bien exposée de 38 à 45 (boucle4 / The well exposed omega loop from 38 to 45 (loop
A5-β) est raccourcie de 4 acides aminés (grande étoile), conduisant à un lien direct entre les positions 39 et 45 par l'intermédiaire d'une chaîne β continue reliant A5 et βA5-β) is shortened by 4 amino acids (large star), leading to a direct link between positions 39 and 45 via a continuous β chain connecting A5 and β
(voir figures 2 et 5).(see figures 2 and 5).
5/ La boucle 31-35 (boucle A4-A5) est légèrement modifiée par une délétion (G33 ; petite étoile) pHBI III : ce domaine partage avec pHBI II la même distribution d'insertions et de délétions par rapport au premier domaine et possède une séquence apparentée de manière significative à ce premier domaine. Cependant, elle est dépourvue de nombreuses caractéristiques de la FKBP qui apparaissent dans les deux premiers domaines. Tous les acides aminés essentiels pour la liaison à FK506 ont été mutés et l'indentite de séquence avec FKBP n'est que de 5,7 %. Régions charnières - régions N et C terminales.5 / Loop 31-35 (loop A4-A5) is slightly modified by a deletion (G33; small star) pHBI III: this domain shares with pHBI II the same distribution of insertions and deletions with respect to the first domain and has a sequence significantly related to this first domain. However, it lacks many of the characteristics of FKBP that appear in the first two areas. All essential amino acids for binding to FK506 have been mutated and the sequence identity with FKBP is only 5.7%. Hinge regions - N and C terminal regions.
Les régions charnières liant les domaines globulaires ci-dessus sont indiqués sur les figures 2, 3 et 6.The hinge regions linking the above globular domains are indicated in FIGS. 2, 3 and 6.
La figure 6 donne une représentation schématique des caractéristiques principales de structure de la pHBI avec indication des identités de séquence de pHBI II (26 %) et de pHBI I (13 %) par rapport à pHBI I (100 %).Figure 6 gives a schematic representation of the main structural characteristics of pHBI with indication of the sequence identities of pHBI II (26%) and pHBI I (13%) compared to pHBI I (100%).
Comme le montrent les figures ci-dessus, la charnière 1 relie pHBI I et pHBI II par l'intermédiaire de 10 acides aminés fortement hydrophiles et acides. La charnière 2 relie pHBI II et pHBI III par l'intermédiaire de 13 résidus majoritairement acides.As shown in the figures above, the hinge 1 connects pHBI I and pHBI II via 10 strongly hydrophilic and acidic amino acids. Hinge 2 links pHBI II and pHBI III via 13 mainly acidic residues.
La pHBI comporte une partie N-terminale courte avant pHBI I et est après pHBI III une partie C-terminale plus longue.The pHBI has a short N-terminal part before pHBI I and is after pHBI III a longer C-terminal part.
Fχepp,^ 3 : Obtention de fragments de la pHBI :F χ epp, ^ 3: Obtaining fragments of pHBI:
Etant donné la structure en domaines de la protéine pHBI, son cDNA a été découpé en 4 fragments correspondant aux différents domaines. Ces fragments ont été sous-clones dans des vecteurs permettant leur expression soit dans E.Coli, soit dans des cellules de mammifères, soit dans un lysat de réticulocytes. La stratégie de découpage permet de recombiner chaque domaine avec tous les autres.Given the domain structure of the pHBI protein, its cDNA was cut into 4 fragments corresponding to the different domains. These fragments were subcloned into vectors allowing their expression either in E.Coli, or in mammalian cells, or in a lysate of reticulocytes. The division strategy allows each domain to be recombined with all the others.
Les protéines exprimées, correspondant à un, deux ou trois domaines, permettent de déterminer les fonctions de chaque domaine indépendemment, ainsi que l'influence d'un domaine sur l'autre. L'activité peptidyl-prolyl isomérase de ces protéines tronquées, exprimées sous forme de protéine de fusion avec la glutathion-S- transférase, a été étudiée ainsi que leur liaison aux immunosuppresseurs. Le site d'association de la pHBI avec la protéine de choc thermique hsp90 a été recherché en exprimant ces protéines mutées dans un lysat de réticulocytes ou dans des cellules de mammifères. Il a également été possible de déterminer dans quel domaine se trouve 1'épitope de 1'anticorps monoclonal KN382 EC-1 dont il est question dans le début de la description. Ces protéines correspondant aux domaines isolés ont des propriétés analogues ou différentes de la FKBP12. Cette dernière ressemble surtout au domaine HBI-1, qui contient un site actif de liaison des immunosuppresseurs. Les domaines de la pHBI pourraient expliquer certains effets secondaires observés in vivo lors de l'administration, à des fins immunosuppressives, du FK 506 et de la rapamycine. On mesurera le grand intérêt, tant pharmacologique que thérapeutique, des domaines isolés en tant que réactifs pour étudier ces effets. Les anticorps générés contre les domaines isolés, permettent par exemple d'inhiber une fonction correspondant à l'un ou l'autre domaine.The expressed proteins, corresponding to one, two or three domains, make it possible to determine the functions of each domain independently, as well as the influence of one domain on the other. The peptidyl-prolyl isomerase activity of these truncated proteins, expressed in the form of a fusion protein with glutathione-S-transferase, has been studied as well as their binding to immunosuppressants. The site of association of the pHBI with the heat shock protein hsp90 was sought by expressing these mutated proteins in a reticulocyte lysate or in mammalian cells. It was also possible to determine in which domain the epitope of the monoclonal antibody KN382 EC-1 which is mentioned in the beginning of the description is found. These proteins corresponding to the isolated domains have similar or different properties to FKBP12. The latter mainly resembles the HBI-1 domain, which contains an active binding site for immunosuppressants. The domains of pHBI could explain certain side effects observed in vivo during the administration, for immunosuppressive purposes, of FK 506 and rapamycin. We will measure the great interest, both pharmacological and therapeutic, of isolated domains as reagents to study these effects. The antibodies generated against the isolated domains make it possible, for example, to inhibit a function corresponding to one or the other domain.
MATERIEL ET METHODESMATERIAL AND METHODS
Dans le cDNA codant pour la protéine pHBI, clone dans le vecteur pGEM 72f au site Eco RI, 5 sites de restriction ont été introduits par mutagenèse dirigée aux extrémités N et C terminales des différents domaines de la protéine.In the cDNA coding for the pHBI protein, cloned into the vector pGEM 72f at the Eco RI site, 5 restriction sites were introduced by site-directed mutagenesis at the N and C ends of the different domains of the protein.
Ces sites de restriction ont été choisis de telle façon qu'ils n'existent ni dans le cDNA ni dans le vecteur, qu'ils soient compatibles entre eux, et qu'ils ne changent pas la phase de lecture de la protéine.These restriction sites were chosen so that they do not exist in the cDNA or in the vector, that they are compatible with each other, and that they do not change the reading phase of the protein.
Le site Eco RV a été introduit dans la partie N- terminale de la protéine, juste après le codon initiateur Met ; le site Bail a été introduit dans la partie C terminale de la protéine, juste après l'acide aminé 458 et avant le codon STOP. Les sites Hpal, NruI, et Eco47III ont été introduits respectivement entre les acides aminés 148 et 149, entre 267 et 268 et entre 374 et 375 comme indiqué sur la figure 7.The Eco RV site was introduced into the N-terminal part of the protein, just after the initiator codon Met; the Bail site was introduced into the terminal C part of the protein, just after amino acid 458 and before the STOP codon. The Hpal, NruI, and Eco47III sites were introduced respectively between amino acids 148 and 149, between 267 and 268 and between 374 and 375 as indicated in FIG. 7.
A partir de cette molécule construite en cassette les différents domaines indépendants ont été obtenus par la technique de sous-clonage classique (voir l'ouvrage "Molecular Cloning" de Sambrook, Fritsch et Maniatis mentionné plus haut). Après hydrolyse de cette molécule cassette par Hpal et Bail, le fragment de 4100 paires de bases correspondant au vecteur pGEM 72f, plus le premier domaine a été ligué et transformé dans E.Coli pour obtenir le premier domaine. Le deuxième domaine a été obtenu en liguant le fragment Hpa I-Nru I de 350 paires de bases avec le fragment Eco RV-Bal I de la molécule cassette. Ce processus a été appliqué à l'obtention des autres domaines.From this molecule constructed in cassette, the different independent domains were obtained by the classic subcloning technique (see the work "Molecular Cloning" by Sambrook, Fritsch and Maniatis mentioned above). After hydrolysis of this cassette molecule by Hpal and Bail, the fragment of 4100 base pairs corresponding to the vector pGEM 72f, plus the first domain was ligated and transformed in E.Coli to obtain the first domain. The second domain was obtained by ligating the 350 base pair Hpa I-Nru I fragment with the Eco RV-Bal I fragment of the cassette molecule. This process was applied to obtaining the other domains.
Les domaines I, II, III, IV ont été ainsi construits de façon indépendante, ainsi que les domaines I+II, III+IV, I+II+III, II+III et II+III+IV (voir figure 7). Les séquences de ces constructions ont été vérifiées (technique de Sanger). Lors de leur expression dans le lysat de réticulocytes de lapin, la taille des protéines obtenues correspondait à cette attendue. Certaines de ces constructions ont été sous-clonées au site Eco RI, soit dans le vecteur pGEX 1\ T (Pharmacia) pour pouvoir les exprimer en grande quantité dans E.Coli comme protéine de fusion avec la glutathion-S-transférase, soit dans le vecteur pSG5 (Stratagene) qui permet une expression transitoire dans des cellules Cos (lignée établie de cellules de rein de singe transformées par SV40).Domains I, II, III, IV were thus constructed independently, as well as domains I + II, III + IV, I + II + III, II + III and II + III + IV (see Figure 7). The sequences of these constructions have been verified (Sanger technique). When expressed in the rabbit reticulocyte lysate, the size of the proteins obtained corresponded to this expected. Some of these constructions have been subcloned at the Eco RI site, either in the vector pGEX 1 \ T (Pharmacia) in order to be able to express them in large quantities in E.Coli as a fusion protein with glutathione-S-transferase, or in the vector pSG5 (Stratagene) which allows transient expression in Cos cells (established line of monkey kidney cells transformed by SV40).
Ex-am l.=. 4 : Préparation d'anticorps anti-HBIEx-am l. =. 4: Preparation of anti-HBI antibodies
On utilise la séquence d'acides aminés de la partie carboxy terminale de l'enchaînement II allant de la position 441 à 458. Ce fragment peptidique est couplé à KLH et injecté à des lapins selon les techniques habituelles.The amino acid sequence of the terminal carboxy part of the sequence II going from position 441 to 458 is used. This peptide fragment is coupled to KLH and injected into rabbits according to the usual techniques.
Les fractions d'IgG récupérées sont purifiées par précipitation avec du sulfate d'ammonium et chromatographie d'échanges d'ions à chaque saignement.The IgG fractions recovered are purified by precipitation with ammonium sulphate and ion exchange chromatography with each bleeding.
Les préparations d'anticorps polyclonaux sont utilisées soit pour l'analyse d'immunoblots, soit pour l'analyse de gradient de densité pour étudier leur capacité à reconnaître la pHBI dans différents tissus et- espèces, ainsi que dans la structure hétérooligomérique de la progestérone.Polyclonal antibody preparations are used either for immunoblot analysis or for density gradient analysis to study their ability to recognize pHBI in different tissues and species, as well as in the heterooligomeric structure of progesterone .
On rapporte les résultats de Western blot sur la figure 8, avec différents échantillons, à savoir du cytosol d'utérus de lapin (piste 1, 10 μl), des cellules d'hépatomes de rat (piste 2) et des cytosols de cellules humaines HeLa (piste 3) soumis à une électrophorèse après chromatographie d'échanges d'ions.The Western blot results are reported in FIG. 8, with different samples, namely rabbit uterus cytosol (lane 1, 10 μl), rat hepatoma cells (lane 2) and human cell cytosols HeLa (lane 3) subjected to electrophoresis after ion exchange chromatography.
La position des marqueurs est indiquée sur la gauche de la figure. HC désigne les chaînes lourdes d'immunoglobulines de lapin détectées par un deuxième anticorps anti-lapin.The position of the markers is indicated on the left of the figure. HC designates the heavy chains of rabbit immunoglobulins detected by a second anti-rabbit antibody.
On observe avec l'anticorps anti-HBI utilisé une seule bande à 59 kDa à la même position que celle reconnue par EC1 (voir référence de Nakao et al. ci-dessus). Cet anticorps réagit également avec la protéine humaine et reconnaît une protéine de la même taille chez le rat, qui n'est pas détectée par EC-1. With the anti-HBI antibody used, a single band at 59 kDa is observed at the same position as that recognized by EC1 (see reference by Nakao et al. Above). This antibody also reacts with human protein and recognizes a protein of the same size in rats, which is not detected by EC-1.
SéquencesSequences
1 : séquences de nucieotides enchaînement I1: sequence of nucieotides sequence I
10 20 30 40 50 6010 20 30 40 50 60
GCCATGACCG CCGAGGAGAT GAAGGCGGCC GAGAGCGGGG CGCAGTCGGC GCCGCTGCCCGCCATGACCG CCGAGGAGAT GAAGGCGGCC GAGAGCGGGG CGCAGTCGGC GCCGCTGCCC
70 80 90 100 110 12070 80 90 100 110 120
CTCGAGGGCG TGGACATCAG CCCCAAGCAA GACGAAGGCG TGCTGAAGGT CATCAAGCGACTCGAGGGCG TGGACATCAG CCCCAAGCAA GACGAAGGCG TGCTGAAGGT CATCAAGCGA
130 140 150 160 170 180 GAGGGCACAG GCACCGAGAC ACCCATGATC GGGGACCGAG TCTTTGTCCA CTACACTGGC130 140 150 160 170 180 GAGGGCACAG GCACCGAGAC ACCCATGATC GGGGACCGAG TCTTTGTCCA CTACACTGGC
190 200 210 220 230 240 TGGCTCTTGG ATGGCACGAA GTTTGACTCC AGTCTGGACC GCAAGGACAA ATTCTCCTTT190 200 210 220 230 240 TGGCTCTTGG ATGGCACGAA GTTTGACTCC AGTCTGGACC GCAAGGACAA ATTCTCCTTT
250 260 270 280 290 300 GACCTGGGAA AAGGGGAGGT CATCAAGGCT TGGGACATTG CTGTTGCAAC CATGAAGGTG250 260 270 280 290 300 GACCTGGGAA AAGGGGAGGT CATCAAGGCT TGGGACATTG CTGTTGCAAC CATGAAGGTG
310 320 330 340 350 360 GGGGAATTGT GCCGCATCAC CTGCAAACCC GAATATGCCT ACGGTTCGGC AGGCAGCCCT310 320 330 340 350 360 GGGGAATTGT GCCGCATCAC CTGCAAACCC GAATATGCCT ACGGTTCGGC AGGCAGCCCT
370 380 390 400 410 420 CCAAAGATCC CCCCCAACGC CACACTTGTG TTCGAGGTGG AATTGTTTGA GTTCAAGGGA370 380 390 400 410 420 CCAAAGATCC CCCCCAACGC CACACTTGTG TTCGAGGTGG AATTGTTTGA GTTCAAGGGA
430 440 450 460 470 480 GAGGATCTGA CAGACGACGA AGACGGCGGA ATCATCCGCA GAATACGGAC TCGGGGTGAA430 440 450 460 470 480 GAGGATCTGA CAGACGACGA AGACGGCGGA ATCATCCGCA GAATACGGAC TCGGGGTGAA
490 500 510 520 530 540 GGCTATGCTA GGCCCAACGA TGGTGCTATT GTGGAGGTCG CACTGGAAGG GTACTACAAG490 500 510 520 530 540 GGCTATGCTA GGCCCAACGA TGGTGCTATT GTGGAGGTCG CACTGGAAGG GTACTACAAG
550 560 570 580 590 600 GACCGGCTCT TTGACCAGCG GGAACTCCGC TTTGAGGTCG GCGAGGGGGA GAGTCTGGAT550 560 570 580 590 600 GACCGGCTCT TTGACCAGCG GGAACTCCGC TTTGAGGTCG GCGAGGGGGA GAGTCTGGAT
610 620 630 640 650 660 CTGCCTTGTG GGCTAGAGAA GGCCATTCAG CGCATGGAGA AAGGCGAACA TTCCATCTTG610 620 630 640 650 660 CTGCCTTGTG GGCTAGAGAA GGCCATTCAG CGCATGGAGA AAGGCGAACA TTCCATCTTG
670 .680 690 700 710 720 TACCTCAAGC CCAGTTACGC GTTTGGCAAT GCTGGGAAGG AAAAGTTTCA GATCCCGCCA670 .680 690 700 710 720 TACCTCAAGC CCAGTTACGC GTTTGGCAAT GCTGGGAAGG AAAAGTTTCA GATCCCGCCA
730 740 750 760 770 780 TATGCTGAGC TGAAATATGA AGTCCACCTC AAGAGTTTTG AGAAGGCCAA GGAGTCCTGG730 740 750 760 770 780 TATGCTGAGC TGAAATATGA AGTCCACCTC AAGAGTTTTG AGAAGGCCAA GGAGTCCTGG
790 800 810 820 830 840 GAGATGAGCT CGGAGGAGAA GCTGGAGCAG AGCGCCATCG TGAAAGAGCG AGGCACCGTG790 800 810 820 830 840 GAGATGAGCT CGGAGGAGAA GCTGGAGCAG AGCGCCATCG TGAAAGAGCG AGGCACCGTG
850 860 870 880 890 900 TACTTCAAGG AAGGCAAGTA CAAGCAGGCT CTGCTACAGT ACAAGAAGAT TGTGTCTTGG850 860 870 880 890 900 TACTTCAAGG AAGGCAAGTA CAAGCAGGCT CTGCTACAGT ACAAGAAGAT TGTGTCTTGG
910 920 930 940 950 960 CTGGAATACG AGTCAAGTTT TTCCAGTGAG GAAGTGCAAA AGGCACAGGC CCTGCGCCTG910 920 930 940 950 960 CTGGAATACG AGTCAAGTTT TTCCAGTGAG GAAGTGCAAA AGGCACAGGC CCTGCGCCTG
970 980 990 1000 1010 1020970 980 990 1000 1010 1020
GCCTCCCACC TCAACCTGGC TATGTGTCAC CTGAAGCTAC AGGCCTTCTC GGCAGCCGTGGCCTCCCACC TCAACCTGGC TATGTGTCAC CTGAAGCTAC AGGCCTTCTC GGCAGCCGTG
1030 1040 1050 1060 1070 10801030 1040 1050 1060 1070 1080
GAAAGCTGTA ACAAGGCCCT GGAACTGGAC AGCAACAACG AGAAGGGCCT CTTCCGCCGGGAAAGCTGTA ACAAGGCCCT GGAACTGGAC AGCAACAACG AGAAGGGCCT CTTCCGCCGG
1090 1100 1110 1120 1130 11401090 1100 1110 1120 1130 1140
GGAGAGGCCC ACCTGGCTGT GAACGACTTT GACCTGGCAC GGGCTGACTT CCAGAAGGTCGGAGAGGCCC ACCTGGCTGT GAACGACTTT GACCTGGCAC GGGCTGACTT CCAGAAGGTC
1150 1160 1170 1180 1190 12001150 1160 1170 1180 1190 1200
CTGCAGCTCT ACCCCAGCAA CAAAGCGGCT AAGGCCCAGC TGGCTGTGTG CCAGCAGCGGCTGCAGCTCT ACCCCAGCAA CAAAGCGGCT AAGGCCCAGC TGGCTGTGTG CCAGCAGCGG
1210 1220 1230 1240 1250 12601210 1220 1230 1240 1250 1260
ATCCGCAAGC AGATTGCCCG GGAGAAGAAG CTCTACGCCA ACATGTTTGA GAGGCTGGCAATCCGCAAGC AGATTGCCCG GGAGAAGAAG CTCTACGCCA ACATGTTTGA GAGGCTGGCA
1270 1280 1290 1300 1310 13201270 1280 1290 1300 1310 1320
GAGGAGGAGA ACAAGGCGAA GGCAGAAGTG GCCGCAGGCG ACCATCCCAT GGACACAGAGGAGGAGGAGA ACAAGGCGAA GGCAGAAGTG GCCGCAGGCG ACCATCCCAT GGACACAGAG
1330 1340 1350 1360 1370 13801330 1340 1350 1360 1370 1380
ATGAAGGATG AGCGGAACGA CGTGGCTGGA AGCCAGTCTC AGGTGGAGAC AGAAGCATAGATGAAGGATG AGCGGAACGA CGTGGCTGGA AGCCAGTCTC AGGTGGAGAC AGAAGCATAG
1390 1400 1410 1420 1430 14401390 1400 1410 1420 1430 1440
CCTCTCTGGC CTGACTCCTG CGACTGCCCG CCTCCTGCTC CCCTGCCCTA CTCCACCCTGCCTCTCTGGC CTGACTCCTG CGACTGCCCG CCTCCTGCTC CCCTGCCCTA CTCCACCCTG
1450 1460 1470 1480 1490 15001450 1460 1470 1480 1490 1500
TTAGTTTTGT AAAAACTGAA GAATTTTGAG TGACTTAGAC CTTTATTTTT CTATCTGGTT Enchaînement I suiteTTAGTTTTGT AAAAACTGAA GAATTTTGAG TGACTTAGAC CTTTATTTTT CTATCTGGTT Chain I continued
1510 1520 1530 1540 1550 15601510 1520 1530 1540 1550 1560
GGATGGTGGC TTTGCGAGGA GGGGGGAAAG ACTAGGCTGG GAACGCTGAG GTAGGGCTGAGGATGGTGGC TTTGCGAGGA GGGGGGAAAG ACTAGGCTGG GAACGCTGAG GTAGGGCTGA
1570 1580 1590 1600 1610 16201570 1580 1590 1600 1610 1620
TTCTAGGGAG TGTCACCCGC CCCCCTTCCC CCATCACACG TGAATGTACA TCCATCCACATTCTAGGGAG TGTCACCCGC CCCCCTTCCC CCATCACACG TGAATGTACA TCCATCCACA
1630 1640 1650 1660 1670 16801630 1640 1650 1660 1670 1680
CACACGCAAC TGAATGTTCG TGCATTTTGC TCCCTCTGTT AGGTCTACTC TGCAAATGGTCACACGCAAC TGAATGTTCG TGCATTTTGC TCCCTCTGTT AGGTCTACTC TGCAAATGGT
1690 1700 1710 1720 1730 1740 AGAAGGGGGC AAGTGGTGGG GATGGGGTCT GATGTGAAAC CAGGGTGGAG AGGGAGACCG1690 1700 1710 1720 1730 1740 AGAAGGGGGC AAGTGGTGGG GATGGGGTCT GATGTGAAAC CAGGGTGGAG AGGGAGACCG
1750 1760 1770 1780 1790 1800 ACTCCTGGGC AGCTGCTTTC CTGATCCTTG TCCTCTCCCA GTCCCTTTCA AACTGTGGCC1750 1760 1770 1780 1790 1800 ACTCCTGGGC AGCTGCTTTC CTGATCCTTG TCCTCTCCCA GTCCCTTTCA AACTGTGGCC
1810 1820 1830 1840 1850 1860 TCCAGGTGGG GGGTGCTGGG GGTGGGGAAA CCATTGCTGT GCCTGTTACC TCTCAGTCCC1810 1820 1830 1840 1850 1860 TCCAGGTGGG GGGTGCTGGG GGTGGGGAAA CCATTGCTGT GCCTGTTACC TCTCAGTCCC
1870 1880 1890 1900 1910 1920 TTCCTCACCC CAGATGGTGT GGCTGACTGT GTCTGGTGTC CAAGACCACC CCCGTCCCCC1870 1880 1890 1900 1910 1920 TTCCTCACCC CAGATGGTGT GGCTGACTGT GTCTGGTGTC CAAGACCACC CCCGTCCCCC
1930 1940 1950 1960 .1970 1980 ATTCTGGTAT TGGCCTTCCT AGCAGTTTCC CTTCTCAGCC AGGTTGTATC CCCACCCTCC1930 1940 1950 1960. 1970 1970 ATTCTGGTAT TGGCCTTCCT AGCAGTTTCC CTTCTCAGCC AGGTTGTATC CCCACCCTCC
1990 2000 2010 2020 2030 2040 CACCCTGTCA GCCTCTTCTC TGCACGTTGC TGAAAGTCCA GGCTCGCCTC AAGTTCTGTG1990 2000 2010 2020 2030 2040 CACCCTGTCA GCCTCTTCTC TGCACGTTGC TGAAAGTCCA GGCTCGCCTC AAGTTCTGTG
2050 2060 2070 CTTGAGCAAT AAAGTGGAAA CAATAAAAAA 2050 2060 2070 CTTGAGCAAT AAAGTGGAAA CAATAAAAAA
2. Séquences d'acides aminés : enchaînement II2. Amino acid sequences: sequence II
10 20 3010 20 30
MTAEEMKAAE SGAQSAPLPL EGVDISPKQDMTAEEMKAAE SGAQSAPLPL EGVDISPKQD
40 50 6040 50 60
EGVLKVIKRE GTGTETPMIG DRVFVHYTGWEGVLKVIKRE GTGTETPMIG DRVFVHYTGW
70 80 9070 80 90
LLDGTKFDSS LDRKDKFSFD LGKGEVIKAWLLDGTKFDSS LDRKDKFSFD LGKGEVIKAW
100 110 120 DIAVATMKVG ELCRITCKPE YAYGSAGSPP100 110 120 DIAVATMKVG ELCRITCKPE YAYGSAGSPP
130 140 150 KIPPNATLVF EVELFEFKGE DLTDDEDGGI130 140 150 KIPPNATLVF EVELFEFKGE DLTDDEDGGI
160 170 180 IRRIRTRGEG YARPNDGAIV EVALEGYYKD160 170 180 IRRIRTRGEG YARPNDGAIV EVALEGYYKD
190 200 210 RLFDQRELRF EVGEGESLDL PCGLEKAIQR190 200 210 RLFDQRELRF EVGEGESLDL PCGLEKAIQR
220 230 240 MEKGEHSILY LKPSYAFGNA GKEKFQIPPY220 230 240 MEKGEHSILY LKPSYAFGNA GKEKFQIPPY
250 260 270 AELKYEVHLK SFEKAKES E MSSEEKLEQS250 260 270 AELKYEVHLK SFEKAKES E MSSEEKLEQS
280 290 300 AIVKERGTVY FKEGKYKQAL LQYKKIVSWL280 290 300 AIVKERGTVY FKEGKYKQAL LQYKKIVSWL
310 320 330 EYESSFSSEE VQKAQALRLA SHLNLAMCHL310 320 330 EYESSFSSEE VQKAQALRLA SHLNLAMCHL
340 350 360 KLQAFSAAVE SCNKALELDS NNEKGLFRRG340 350 360 KLQAFSAAVE SCNKALELDS NNEKGLFRRG
370 380 390 EAHLAVNDFD LARADFQKVL QLYPSNKAAK370 380 390 EAHLAVNDFD LARADFQKVL QLYPSNKAAK
400 410 420 AQLAVCQQRI JSKQIAREKKL YANMFERLAE400 410 420 AQLAVCQQRI JSKQIAREKKL YANMFERLAE
430 " "44"0~ 450 EENKAKAEVA AGDHPHDTEM KDERNDVAGS430 "" 44 " 0 ~ 450 EENKAKAEVA AGDHPHDTEM KDERNDVAGS
458 QSQVETEA Exemple 5 : Applications de la protéine pHBI et de ses constituants.458 QSQVETEA Example 5: Applications of the pHBI protein and its constituents.
Le fonctionnement de certains récepteurs des hormones stéroïdes peut être modifé par la liaison des immunosuppresseurs à pHBI. (Renoir et al, C.R. Acad. Sci. Paris, t.135, Série III, p 421-428, 1992).The functioning of certain steroid hormone receptors can be affected by the binding of immunosuppressants to pHBI. (Renoir et al, C.R. Acad. Sci. Paris, t.135, Série III, p 421-428, 1992).
La protéine pHBI et ses constituants sont donc utilisables pour rechercher des immunosuppresseurs qui n'interréagissent pas avec HBI. On mesurera l'intérêt de tels résultats qui permettent d'éviter 1'effet endocrinien des immunosuppresseurs, comme 1'hyperandrogynie avec hirsutisme qui a été observée au cours de traitements immunosuppresseurs. . Le mécanisme des complications cérébrales dues aux immunosuppresseurs est mal connu. Or, en utilisant la pHBI ou ses constituants, on peut détecter des interactions autres que celles de la FKBP12 avec certaines protéines impliquées dans le mécanisme d'action des neurotrans- metteurs.The pHBI protein and its constituents can therefore be used to search for immunosuppressants which do not interact with HBI. We will measure the interest of such results which make it possible to avoid the endocrine effect of immunosuppressants, such as the hyperandrogyny with hirsutism which has been observed during immunosuppressive treatments. . The mechanism of brain complications due to immunosuppressants is poorly understood. However, by using pHBI or its constituents, one can detect interactions other than those of FKBP12 with certain proteins involved in the mechanism of action of neurotransmitters.
L'utilisation d'anticorps dirigés contre la protéine pHBI ou ses constituants permet de détecter la présence de récepteurs membranaires des immunosuppresseurs et de les localiser (N.A. Cacalano et al, PNAS, 1992, £2., p 4353-4357).The use of antibodies directed against the pHBI protein or its constituents makes it possible to detect the presence of membrane receptors of the immunosuppressants and to locate them (N.A. Cacalano et al, PNAS, 1992, £ 2., P 4353-4357).
rc^mp1"- fi : Détection d'ARN-m de la protéine pHBI dans divers tions.rc ^ mp 1 "- fi: Detection of m-RNA of the protein pHBI in various conditions.
L'ADN codant pour la protéine pHBI a été utilisé pour détecter la présence de son ARN-m dans divers tissus. Les techniques de Northern suivie d'hybridation ont été utilisées en suivant le protocole décrit dans l'ouvrage de Maniatis précité. La présence d'ARNm de la pHBI a été mise en évidence chez le rat dans le placenta, le coeur, le thymus, la rate, le cerveau et l'utérus. En revanche, dans les conditions de l'expérience, aucune détection n'a pu être effectuée dans le foie de poulet ou de xénopus. En utilisant un Southern blot commercialisé par Clontech contenant de l'ADN genomique, l'ADN de la pHBI a été détecté dans le placenta humain, le foie de singe, de souris, de rat, le rein de chien, le foie de bovin et de lapin. Dans les conditions de l'expérience, la détection a été négative chez S-cerevisiae. DNA encoding the pHBI protein has been used to detect the presence of its mRNA in various tissues. Northern techniques followed by hybridization were used following the protocol described in the aforementioned work by Maniatis. The presence of pHBI mRNA has been demonstrated in rats in the placenta, heart, thymus, spleen, brain and uterus. On the other hand, under the conditions of the experiment, no detection could be carried out in the liver of chicken or xenopus. Using a Southern blot marketed by Clontech containing genomic DNA, pHBI DNA was detected in human placenta, monkey, mouse, rat liver, dog kidney, bovine liver and rabbit. Under the conditions of the experiment, the detection was negative in S-cerevisiae.

Claims

REVENDICATIONS
1/ Séquences de nucieotides, caractérisées en ce qu'elles comprennent ou qu'elles sont formées par un enchaînement de nucieotides capable de s'hybrider, dans des conditions stringentes, avec une ou plusieurs séquences d'un gène dont 1'ADNc présente une séquence correspondant à 1'enchaînement (I) de nucieotides.1 / Sequences of nucieotides, characterized in that they comprise or that they are formed by a sequence of nucieotides capable of hybridizing, under stringent conditions, with one or more sequences of a gene whose cDNA has a sequence corresponding to the sequence (I) of nucieotides.
2/ Séquences de nucieotides, caractérisées en ce qu'elles contiennent l'information génétique pour coder pour tout ou partie de la protéine répondant à l'enchaînement II. 3/ Séquences de nucieotides, caractérisées en ce qu'elles sont formées, ou qu'elles comprennent, au moins une partie de l'enchaînement I.2 / Sequences of nucieotides, characterized in that they contain the genetic information to code for all or part of the protein responding to sequence II. 3 / Sequences of nucieotides, characterized in that they are formed, or that they comprise, at least part of the sequence I.
4/ Séquences de nucieotides selon la revendication 3, constituées par une partie ou la totalité du cadre ouvert de lecture allant dans 1'enchaînement (I) de la position 4 à la position 1380.4 / Sequences of nucieotides according to claim 3, constituted by part or all of the open reading frame going in the sequence (I) from position 4 to position 1380.
5/ Séquences de nucieotides selon la revendication 3, capables de coder pour une protéine potentielle de 458 acides aminés répondant à l'enchaînement II. 6/ Séquences de nucieotides selon l'une des revendications précédentes, caractérisées en ce qu'elles comportent l'information génétique pour coder pour une ou plusieurs séquences d'acides aminés de l'enchaînement II correspondant à une région capable de se lier avec un immunosuppresseur du type FK 506 et possédant les caractéristiques structurales pour une activité rotamase.5 / Sequences of nucieotides according to claim 3, capable of coding for a potential protein of 458 amino acids responding to sequence II. 6 / Sequences of nucieotides according to one of the preceding claims, characterized in that they include the genetic information to code for one or more amino acid sequences of sequence II corresponding to a region capable of binding with a immunosuppressant type FK 506 and having the structural characteristics for rotamase activity.
7/ Séquences de nucieotides selon l'une des revendications 1 à 6, caractérisées en ce qu'elles comportent l'information génétique pour coder pour une ou plusieurs séquences d'acides aminés de l'enchaînement II, correspondant à une région capable de se lier à 1'ATP/GTP.7 / Sequences of nucieotides according to one of claims 1 to 6, characterized in that they include the genetic information to code for one or more amino acid sequences of sequence II, corresponding to a region capable of bind to ATP / GTP.
8/ Séquences de nucieotides selon l'une des revendications 1 à 7, caractérisées en ce qu'elles comportent l'information génétique pour coder pour une ou plusieurs séquences d'acides aminés de l'enchaînement II correspondant à une région capable de se lier à la calmoduline. 9/ Séquence recombinante comprenant l'une des séquences de nucieotides définies dans l'une quelconque des revendications 1 à 8, le cas échéant associée à un promoteur capable de contrôler la transcription de la séquence et une séquence d'ADN codant pour les signaux de terminaison de la transcription.8 / Sequences of nucieotides according to one of claims 1 to 7, characterized in that they contain genetic information to code for one or more sequence II amino acid sequences corresponding to a region capable of binding to calmodulin. 9 / Recombinant sequence comprising one of the nucieotide sequences defined in any one of claims 1 to 8, if appropriate associated with a promoter capable of controlling the transcription of the sequence and a DNA sequence coding for the signals of termination of transcription.
10/ Séquences de nucieotides selon l'une des revendications 1 à 9, caractérisées en ce qu'elles renferment des séquences codantes pour des protéines chaperones, en particulier des séquences codantes pour la hsp90, notamment pour la région A hydrophile de cette protéine.10 / Sequences of nucieotides according to one of claims 1 to 9, characterized in that they contain coding sequences for chaperone proteins, in particular coding sequences for hsp90, in particular for the hydrophilic region A of this protein.
11/ Les ARN et les séquences complémentaires des différents enchaînements nucléotidiques définis dans l'une des revendications 1 à 10, ainsi que les protéines codées correspondantes.11 / The RNAs and the complementary sequences of the various nucleotide sequences defined in one of claims 1 to 10, as well as the corresponding coded proteins.
12/ Vecteurs recombinants de clonage et d'expression capables de transformer une cellule hôte appropriée, comportant au moins une partie d'une séquence de nucieotides selon 1'une quelconque des revendications 1 à 11, sous le contrôle d'éléments de régulation permettant son expression.12 / Recombinant cloning and expression vectors capable of transforming an appropriate host cell, comprising at least part of a nucieotide sequence according to any one of claims 1 to 11, under the control of regulatory elements allowing its expression.
13/ Souches de microorganismes transformées ou transfectées, caractérisées en ce qu'elles comportent au moins 1'une des séquences de nucieotides définies dans l'une des revendications 1 à 11, ou encore un vecteur recombinant tel que défini dans la revendication 12.13 / Strains of transformed or transfected microorganisms, characterized in that they comprise at least one of the nucieotide sequences defined in one of claims 1 to 11, or also a recombinant vector as defined in claim 12.
14/ Séquences d'acides aminés déduites, selon le code génétique universel, des séquences de nucieotides selon l'une des revendications 1 à 11 et les protéines exprimées par les gènes comportant ces séquences.14 / Amino acid sequences deduced, according to the universal genetic code, nucieotide sequences according to one of claims 1 to 11 and the proteins expressed by the genes comprising these sequences.
15/ Séquences d'acides aminés selon la revendication 14, caractérisées en ce qu'elles correspondent à des séquences capables de se lier à des protéines de choc thermique ou qu'elles possèdent les propriétés de ces protéines, et qu'en particulier elles sont des séquences codantes pour des protéines chaperones, en particulier des séquences codantes pour la hsp90, notamment pour la région A hydrophile de cette protéine.15 / Amino acid sequences according to claim 14, characterized in that they correspond to sequences capable of binding to heat shock proteins or that they have the properties of these proteins, and that in particular they are coding sequences for chaperone proteins, in particular coding sequences for hsp90, in particular for the hydrophilic A region of this protein.
16/ Séquences d'acides aminés selon l'une des revendications 14 ou 15, caractérisées en ce qu'elles possèdent un ou plusieurs domaines du type de la FKBP, identiques ou différents, en particulier qu'elles possèdent les caractéristiques structurales pour une liaison avec un immunosuppresseur du type FK506 et pour une activité rotamase, et/ou qu'elles comportent un site de liaison à l'ATP, et/ou une séquence consensus de liaison à la calmoduline, et/ou qu'elles correspondent aux régions charnières entre deux domaines.16 / Amino acid sequences according to one of claims 14 or 15, characterized in that they have one or more domains of the type of FKBP, identical or different, in particular that they have the structural characteristics for a bond with an immunosuppressant of the FK506 type and for a rotamase activity, and / or that they comprise an ATP binding site, and / or a consensus binding sequence to calmodulin, and / or that they correspond to the hinge regions between two areas.
17/ Séquences d'acides aminés selon l'une des revendications 10 à 16, caractérisées en ce qu'elles sont telles qu'obtenues par transformation de cellules hôtes au moyen d'un vecteur recombinant selon la revendication 12, mise en culture, dans un milieu approprié, des cellules hôtes transformées ou transfectées et récupération de la protéine à partir de ces cellules, ou directement à partir du milieu de culture.17 / Amino acid sequences according to one of claims 10 to 16, characterized in that they are such as obtained by transformation of host cells using a recombinant vector according to claim 12, cultured in an appropriate medium, transformed or transfected host cells and recovery of the protein from these cells, or directly from the culture medium.
18/ Les complexes des protéines des séquences d'acides aminés selon l'une des revendications 1, 4 à 17 avec la hsp90 ou avec d'autres protéines de choc thermique impliquées dans ces hétéro-oligomères, ou avec des régions de ces différentes protéines.18 / The complexes of the proteins of the amino acid sequences according to one of claims 1, 4 to 17 with hsp90 or with other heat shock proteins involved in these hetero-oligomers, or with regions of these different proteins .
19/ Anticorps polyclonaux et monoclonaux capables de reconnaître spécifiquement les séquences d'acides aminés et les complexes selon l'une des revendications 14 à 18.19 / Polyclonal and monoclonal antibodies capable of specifically recognizing the amino acid sequences and the complexes according to one of claims 14 to 18.
20/ Application des séquences de nucieotides selon l'une des revendications 1 à 11 pour l'élaboration de sondes de détection de gènes codant pour des protéines formant des complexes avec des chaperones et leurs ligands.20 / Application of the nucieotide sequences according to one of claims 1 to 11 for the development of probes for detecting genes coding for proteins forming complexes with chaperones and their ligands.
21/ Procédé de détection in vitro de la présence dans un échantillon biologique de séquences de nucieotides complémentaires de celles définies dans l'une des revendications 1 à 11, comprenant les étapes de21 / Method for in vitro detection of the presence in a biological sample of nucieotide sequences complementary to those defined in one of claims 1 to 11, comprising the steps of
- mise en contact de l'échantillon à étudier avec une sonde nucléotidique élaborée à l'aide d'une séquence selon l'une des revendications 1 à 11, dans des conditions permettant une hybridation entre la sonde et la séquence de nucieotides recherchée, etbringing the sample to be studied into contact with a nucleotide probe produced using a sequence according to one of claims 1 to 11, under conditions allowing hybridization between the probe and the desired nucieotide sequence, and
- détection du complexe d'hybridation.- detection of the hybridization complex.
22/ Kits pour la détection in vitro de la présence dans un échantillon biologique de séquences de nucieotides complémentaires de celles définies dans l'une des revendications 1 à 11, caractérisés en ce qu'ils comprennent22 / Kits for the In Vitro Detection of the Presence in a Biological Sample of Nucieotide Sequences Complementary to Those Defined in One of Claims 1 to 11, characterized in that they comprise
- une quantité déterminée d'une sonde nucléotidique élaborée à partir d'une séquence de nucieotides selon l'une des revendications 1 à 11,a determined quantity of a nucleotide probe produced from a sequence of nucieotides according to one of claims 1 to 11,
- un milieu approprié à l'hybridation entre la sonde utilisée et la séquence à détecter, et avantageusement, - des réactifs permettant la détection des complexes d'hybridation formés.- a medium suitable for hybridization between the probe used and the sequence to be detected, and advantageously, - reagents for the detection of the hybridization complexes formed.
23/ Méthode de dépistage in vitro dans un échantillon biologique de la présence éventuelle des produits d'expression des séquences de nucieotides selon l'une des revendications 1 à 11 ou ceux des gènes codant pour une protéine de choc thermique, caractérisée en ce qu'elle comprend23 / Method for in vitro screening in a biological sample of the possible presence of the expression products of the nucieotide sequences according to one of claims 1 to 11 or those of the genes coding for a heat shock protein, characterized in that she understands
- la mise en contact de l'échantillon à étudier avec un anticorps selon la revendication 19, dans des conditions permettant la formation d'un complexe immunologique entre tout ou partie des protéines exprimées par les séquences nucléotidiques et cet anticorps, etcontacting the sample to be studied with an antibody according to claim 19, under conditions allowing the formation of an immunological complex between all or part of the proteins expressed by the nucleotide sequences and this antibody, and
- la détection du complexe immunologique.- detection of the immunological complex.
24/ Kits pour la détection in vitro dans un échantillon biologique de la présence éventuelle des produits d'expression des séquences de nucieotides selon l'une des revendications 1 à 11 ou ceux des gènes codant pour une protéine de choc thermique, caractérisés en ce qu'ils comprennent : une quantité déterminée d'un anticorps polyclonal ou monoclonal selon la revendication 19, - un milieu approprié à la réalisation d'une réaction immunologique entre au moins une partie des produits exprimés et l'anticorps et, avantageusement, des réactifs permettant la détection des complexes immunologiques formés. 24 / Kits for the in vitro detection in a biological sample of the possible presence of the expression products of the nucieotide sequences according to one of claims 1 to 11 or those of the genes encoding for a heat shock protein, characterized in that they comprise: a determined quantity of a polyclonal or monoclonal antibody according to claim 19, - a medium suitable for carrying out an immunological reaction between at least part of the products expressed and the antibody and, advantageously, reagents allowing the detection of the immunological complexes formed.
PCT/FR1993/000219 1992-03-04 1993-03-04 Proteins forming complexes with chaperones and ligands thereof, fragments thereof, preparation thereof and biological uses thereof WO1993018146A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR92/02612 1992-03-04
FR9202612A FR2688227A1 (en) 1992-03-04 1992-03-04 PROTEINS FORMING COMPLEXES WITH CHAPERONES AND THEIR LIGANDS, THEIR FRAGMENTS, THEIR PRODUCTION AND THEIR BIOLOGICAL APPLICATIONS.

Publications (2)

Publication Number Publication Date
WO1993018146A2 true WO1993018146A2 (en) 1993-09-16
WO1993018146A3 WO1993018146A3 (en) 1993-11-11

Family

ID=9427364

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1993/000219 WO1993018146A2 (en) 1992-03-04 1993-03-04 Proteins forming complexes with chaperones and ligands thereof, fragments thereof, preparation thereof and biological uses thereof

Country Status (2)

Country Link
FR (1) FR2688227A1 (en)
WO (1) WO1993018146A2 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995024923A2 (en) * 1994-03-16 1995-09-21 Mount Sinai School Of Medicine Of The City University Of New York Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens
US5646249A (en) * 1994-02-28 1997-07-08 The United States Of America As Represented By The Department Of Health And Human Services Isolation and characterization of a novel chaperone protein
WO1998011909A1 (en) * 1996-09-18 1998-03-26 Zetesis S.P.A. Use of proteins as agents against autoimmune diseases
US5750119A (en) * 1994-01-13 1998-05-12 Mount Sinai School Of Medicine Of The City University Of New York Immunotherapeutic stress protein-peptide complexes against cancer
US5830464A (en) * 1997-02-07 1998-11-03 Fordham University Compositions and methods for the treatment and growth inhibition of cancer using heat shock/stress protein-peptide complexes in combination with adoptive immunotherapy
US5837251A (en) * 1995-09-13 1998-11-17 Fordham University Compositions and methods using complexes of heat shock proteins and antigenic molecules for the treatment and prevention of neoplastic diseases
US5935576A (en) * 1995-09-13 1999-08-10 Fordham University Compositions and methods for the treatment and prevention of neoplastic diseases using heat shock proteins complexed with exogenous antigens
US5948646A (en) * 1997-12-11 1999-09-07 Fordham University Methods for preparation of vaccines against cancer comprising heat shock protein-peptide complexes
US5985270A (en) * 1995-09-13 1999-11-16 Fordham University Adoptive immunotherapy using macrophages sensitized with heat shock protein-epitope complexes
US5997873A (en) * 1994-01-13 1999-12-07 Mount Sinai School Of Medicine Of The City University Of New York Method of preparation of heat shock protein 70-peptide complexes
US6017540A (en) * 1997-02-07 2000-01-25 Fordham University Prevention and treatment of primary and metastatic neoplastic diseases and infectious diseases with heat shock/stress protein-peptide complexes
DE19907598A1 (en) * 1999-02-22 2000-08-24 Schulz Burkhard New DNA encoding plant FK506-binding protein analog useful for producing transgenic plants with altered architecture and for studying immunosuppressants
US6255283B1 (en) * 1997-03-25 2001-07-03 Zetesis S.P.A. Use of proteins extractable from animal organs for the preparation of medicaments for the treatment of pathological conditions characterized by hyperproduction of tumor necrosis factor (TNF)
US7449557B2 (en) 2000-06-02 2008-11-11 University Of Connecticut Health Center Complexes of alpha (2) macroglobulin and antigenic molecules for immunotherapy
US7666581B2 (en) 2001-08-20 2010-02-23 University Of Connecticut Health Center Methods for preparing compositions comprising heat shock proteins useful for the treatment of cancer and infectious disease
US8475785B2 (en) 2008-03-03 2013-07-02 The University Of Miami Allogeneic cancer cell-based immunotherapy
US8685384B2 (en) 1998-02-20 2014-04-01 University Of Miami Recombinant cancer cell secreting modified heat shock protein-antigenic peptide complex
US10046047B2 (en) 2015-02-06 2018-08-14 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
US11548930B2 (en) 2017-04-04 2023-01-10 Heat Biologics, Inc. Intratumoral vaccination
US11666649B2 (en) 2016-10-11 2023-06-06 University Of Miami Vectors and vaccine cells for immunity against Zika virus

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996012018A2 (en) * 1994-10-14 1996-04-25 The Salk Institute For Biological Studies Novel immunophilins and corresponding nucleic acids
US6335157B1 (en) 1999-05-07 2002-01-01 The European Molecular Biology Laboratory Method based on localization of Hsp90 to the centrosome
CA2718884C (en) 2008-03-20 2016-11-22 University Of Miami Heat shock protein gp96 vaccination and methods of using same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991004321A1 (en) * 1989-09-25 1991-04-04 President And Fellows Of Harvard College Receptor for fk-506
WO1992001052A1 (en) * 1990-07-11 1992-01-23 Tonen Corporation Dna coding for human fk506-binding protein and expression thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991004321A1 (en) * 1989-09-25 1991-04-04 President And Fellows Of Harvard College Receptor for fk-506
WO1992001052A1 (en) * 1990-07-11 1992-01-23 Tonen Corporation Dna coding for human fk506-binding protein and expression thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BIOCHEMISTRY. vol. 29, no. 21, 1990, EASTON, PA US pages 5145 - 5152 SANCHEZ R. ET AL. 'The 56-59-kilodalton protein identified in untransformed receptor complexes is...' cité dans la demande *
GENBANK DATABASE,BETHESDA US Acc.No.x17069,Nelki S. al.:'Identification and DNA sequence of a family of related cDNA's one of which is haploid specific and...' *

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5997873A (en) * 1994-01-13 1999-12-07 Mount Sinai School Of Medicine Of The City University Of New York Method of preparation of heat shock protein 70-peptide complexes
US5750119A (en) * 1994-01-13 1998-05-12 Mount Sinai School Of Medicine Of The City University Of New York Immunotherapeutic stress protein-peptide complexes against cancer
US6610659B1 (en) 1994-01-13 2003-08-26 Mount Sinai School Of Medicine Of New York University Use of heat shock protein 70 preparations in vaccination against cancer and infectious disease
US6468540B1 (en) 1994-01-13 2002-10-22 Mount Sinai School Of Medicine Of New York University Immunotherapeutic stress protein-peptide complexes against cancer
US6017544A (en) * 1994-01-13 2000-01-25 Mount Sinai School Of Medicine Of The University Of New York Composition comprising immunogenic stress protein-peptide complexes against cancer and a cytokine
US5646249A (en) * 1994-02-28 1997-07-08 The United States Of America As Represented By The Department Of Health And Human Services Isolation and characterization of a novel chaperone protein
WO1995024923A3 (en) * 1994-03-16 1995-10-12 Sinai School Medicine Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens
US6455503B1 (en) 1994-03-16 2002-09-24 Mount Sinai School Of Medicine Of New York University Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens
US6048530A (en) * 1994-03-16 2000-04-11 Mount Sinai School Of Medicine Of New York University Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens
WO1995024923A2 (en) * 1994-03-16 1995-09-21 Mount Sinai School Of Medicine Of The City University Of New York Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens
US5961979A (en) * 1994-03-16 1999-10-05 Mount Sinai School Of Medicine Of The City University Of New York Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens
US5837251A (en) * 1995-09-13 1998-11-17 Fordham University Compositions and methods using complexes of heat shock proteins and antigenic molecules for the treatment and prevention of neoplastic diseases
US6139841A (en) * 1995-09-13 2000-10-31 Fordham University Compositions and methods using complexes of heat shock protein 70 and antigenic molecules for the treatment and prevention of infectious diseases
US5935576A (en) * 1995-09-13 1999-08-10 Fordham University Compositions and methods for the treatment and prevention of neoplastic diseases using heat shock proteins complexed with exogenous antigens
US6030618A (en) * 1995-09-13 2000-02-29 Fordham University Therapeutic and prophylactic methods using heat shock proteins
US6410028B1 (en) 1995-09-13 2002-06-25 Fordham University Therapeutic and prophylactic methods using heat shock proteins
US6461615B1 (en) 1995-09-13 2002-10-08 Fordham University Therapeutic and prophylactic methods using heat shock proteins
US6136315A (en) * 1995-09-13 2000-10-24 Fordham University Compositions and methods using complexes of heat shock protein 70 and antigenic molecules for the treatment and prevention of neoplastic diseases
US5985270A (en) * 1995-09-13 1999-11-16 Fordham University Adoptive immunotherapy using macrophages sensitized with heat shock protein-epitope complexes
US6143299A (en) * 1995-09-13 2000-11-07 Fordham University Compositions and methods using complexes of heat shock protein gp96 and antigenic molecules for the treatment and prevention of infectious diseases
US6156302A (en) * 1995-09-13 2000-12-05 Fordham University Adoptive immunotherapy using macrophages sensitized with heat shock protein-epitope complexes
US6162436A (en) * 1995-09-13 2000-12-19 Fordham University Compositions and methods using complexes of heat shock protein 90 and antigenic molecules for the treatment and prevention of neoplastic diseases
US6187312B1 (en) 1995-09-13 2001-02-13 Fordham University Compositions and methods using complexes of heat shock protein 90 and antigenic molecules for the treatment and prevention of infectious diseases
US7601359B1 (en) 1995-09-13 2009-10-13 Fordham University Compositions and methods for the prevention and treatment of primary and metastatic neoplastic diseases and infectious diseases with heat shock/stress proteins
US6447781B1 (en) 1995-09-13 2002-09-10 Fordham University Therapeutic and prophylactic methods using heat shock proteins
US6468536B1 (en) 1996-09-18 2002-10-22 Zetesis S.P.A. Use of proteins as anti-diabetes agents
WO1998011909A1 (en) * 1996-09-18 1998-03-26 Zetesis S.P.A. Use of proteins as agents against autoimmune diseases
US6455048B1 (en) 1997-02-07 2002-09-24 Fordham University Prevention of primary and metastatic neoplastic diseases with hsp70-peptide complexes
US6403095B1 (en) 1997-02-07 2002-06-11 Fordham University Treatment of primary and metastatic neoplastic diseases with HSP70-peptide complexes
US6017540A (en) * 1997-02-07 2000-01-25 Fordham University Prevention and treatment of primary and metastatic neoplastic diseases and infectious diseases with heat shock/stress protein-peptide complexes
US6387374B1 (en) 1997-02-07 2002-05-14 Fordham University Treatment of primary and metastatic neoplastic diseases with hsp90-peptide complexes
US5830464A (en) * 1997-02-07 1998-11-03 Fordham University Compositions and methods for the treatment and growth inhibition of cancer using heat shock/stress protein-peptide complexes in combination with adoptive immunotherapy
US6399070B1 (en) 1997-02-07 2002-06-04 Fordham University Methods and compositions for eliciting an immune response with hsp90-peptide complexes
US6383494B1 (en) 1997-02-07 2002-05-07 Fordham University Methods and composition for eliciting an immune response with gp96-peptide complexes
US6436404B1 (en) 1997-02-07 2002-08-20 Fordham University Prevention of primary and metastatic neoplastic diseases with GP96-peptide complexes
US6322790B1 (en) 1997-02-07 2001-11-27 Fordham University Compositions and methods for eliciting an immune response using heat shock/stress protein-peptide complexes in combination with adoptive immunotherapy
US6447780B1 (en) 1997-02-07 2002-09-10 Fordham University Prevention of primary and metastatic neoplastic diseases with hsp90-peptide complexes
US6383493B1 (en) 1997-02-07 2002-05-07 Fordham University Methods and compositions for eliciting an immune response with hsp70-peptide complexes
US6255283B1 (en) * 1997-03-25 2001-07-03 Zetesis S.P.A. Use of proteins extractable from animal organs for the preparation of medicaments for the treatment of pathological conditions characterized by hyperproduction of tumor necrosis factor (TNF)
US6406700B1 (en) 1997-12-11 2002-06-18 Fordham University Methods for preparation of vaccines against cancer
US6410027B1 (en) 1997-12-11 2002-06-25 Fordham University Methods for preparation of vaccines against cancer
US6410026B1 (en) 1997-12-11 2002-06-25 Fordham University Methods for preparation of vaccines against cancer
US5948646A (en) * 1997-12-11 1999-09-07 Fordham University Methods for preparation of vaccines against cancer comprising heat shock protein-peptide complexes
US8685384B2 (en) 1998-02-20 2014-04-01 University Of Miami Recombinant cancer cell secreting modified heat shock protein-antigenic peptide complex
DE19907598A1 (en) * 1999-02-22 2000-08-24 Schulz Burkhard New DNA encoding plant FK506-binding protein analog useful for producing transgenic plants with altered architecture and for studying immunosuppressants
US7449557B2 (en) 2000-06-02 2008-11-11 University Of Connecticut Health Center Complexes of alpha (2) macroglobulin and antigenic molecules for immunotherapy
US7666581B2 (en) 2001-08-20 2010-02-23 University Of Connecticut Health Center Methods for preparing compositions comprising heat shock proteins useful for the treatment of cancer and infectious disease
US8475785B2 (en) 2008-03-03 2013-07-02 The University Of Miami Allogeneic cancer cell-based immunotherapy
US10046047B2 (en) 2015-02-06 2018-08-14 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
US10758611B2 (en) 2015-02-06 2020-09-01 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
US10780161B2 (en) 2015-02-06 2020-09-22 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
US11666649B2 (en) 2016-10-11 2023-06-06 University Of Miami Vectors and vaccine cells for immunity against Zika virus
US11548930B2 (en) 2017-04-04 2023-01-10 Heat Biologics, Inc. Intratumoral vaccination

Also Published As

Publication number Publication date
FR2688227A1 (en) 1993-09-10
WO1993018146A3 (en) 1993-11-11

Similar Documents

Publication Publication Date Title
WO1993018146A2 (en) Proteins forming complexes with chaperones and ligands thereof, fragments thereof, preparation thereof and biological uses thereof
Li et al. Targeting of proteins to the outer envelope membrane uses a different pathway than transport into chloroplasts.
Travis et al. Targeting of a germ cell-specific type 1 hexokinase lacking a porin-binding domain to the mitochondria as well as to the head and fibrous sheath of murine spermatozoa
Kamma et al. Molecular characterization of the hnRNP A2/B1 proteins: tissue-specific expression and novel isoforms
Barroso et al. Transcytosis-associated protein (TAP)/p115 is a general fusion factor required for binding of vesicles to acceptor membranes.
Kistner et al. SAP90, a rat presynaptic protein related to the product of the Drosophila tumor suppressor gene dlg-A.
Wozniak et al. POM152 is an integral protein of the pore membrane domain of the yeast nuclear envelope.
Perin et al. The structure of cytochrome b561, a secretory vesicle‐specific electron transport protein.
Xiang et al. Molecular cloning and expression of alternatively spliced PITSLRE protein kinase isoforms.
Otzen et al. Hansenula polymorpha Pex20p is an oligomer that binds the peroxisomal targeting signal 2 (PTS2)
Wyszynski et al. Biochemical and immunocytochemical characterization of GRIP, a putative AMPA receptor anchoring protein, in rat brain
CN110382526A (en) TfR transgenic models
Yaffe et al. The major 45-kDa protein of the yeast mitochondrial outer membrane is not essential for cell growth or mitochondrial function
FR2692268A1 (en) New polypeptides having NMDA receptor activity, nucleic acids encoding these polypeptides and uses.
Ghys et al. Functional studies on human Pex7p: subcellular localization and interaction with proteins containing a peroxisome-targeting signal type 2 and other peroxins
EP0514481B1 (en) Merosin, nucleic acids encoding, fragments and uses thereof
CA2323091A1 (en) Nephrin gene and protein
FR2829581A1 (en) New synthetic peptide from apolipoprotein AIV related protein, useful for raising antibodies, used for diagnosis and treatment of disorders of lipid metabolism
JP2002504827A (en) Prenylcysteine carboxylmethyltransferase, DNA encoding the same, and screening method for its inhibitor
KR101458483B1 (en) Diagnostic Composition and Kit for Renal Cell Carcinoma
Jing-Ping et al. p55 protein is a member of PSD scaffold proteins in the rat brain and interacts with various PSD proteins
CA2364106A1 (en) Polynucleotide and protein involved in synaptogenesis, their variants and their therapeutic and diagnostic applications
JPH09194502A (en) New chondroitin sulfate proteoglycan, its core protein, dna coding the same and antibody to the same
US5599709A (en) Recombinant DNA encoding neuronal α-bungarotoxin-binding proteins
WO2003093311A1 (en) Proteins with deglycating activities and methods of using same

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

AK Designated states

Kind code of ref document: A3

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase