WO1994000136A1

WO1994000136A1 - A COMBINATION OF ANTI-erbB-2 MONOCLONAL ANTIBODIES AND METHOD OF USING

Info

Publication number: WO1994000136A1
Application number: PCT/US1992/008545
Authority: WO
Inventors: Philip G. Kasprzyk; Charles R. King
Original assignee: Oncologix, Inc.
Priority date: 1992-06-30
Filing date: 1992-10-21
Publication date: 1994-01-06
Also published as: JPH08504172A; KR950700075A; CA2120745A1; EP0655924A1; EP0655924A4; AU687346B2; AU3773393A; KR100269879B1

Abstract

The present invention relates to a combination of at least two monolconal antibodies which are capable of preventing and treating human malignancies wherein the malignant cells overexpress gp185erbB-2. The monoclonal antibodies of the combination recognize different epitopes of the gp185 expression product of erbB-2, therefore, the antibodies do not cross react with each other. Preferably, the combination decreases the expression product of the erbB-2 gene. In another embodiment, the combination does not essentially increase tyrosine phosphorylation of the gp185 expression product.

Description

A COMBINATION OF ANTI-erbB-2 MONOCLONAL ANTIBODIES AND METHOD OF USING

The present invention relates to a combination o monoclonal antibodies capable of preventing and treatin tumors. More specifically, the monoclonal antibodies ar single chain monoclonal antibodies which are capable o treating and preventing tumors.

Amplification and/or overexpression of the erbB-2 gen (also called HER-2 or neu) results in overexpression o erbB-2 RNA and proteins and has been demonstrated in 20-30 of adenocarcinomas of the breast (1-5), ovary (3), lung (6 and stomach (7). Two lines of evidence implicate erbB- overexpression in the pathogenesis of human neoplasia First, overexpression has been linked with poor prognosis i breast (8-11), ovarian (12), stomach (13), and lung cance (14), indicating that overexpression alters the cancer cell Second, artificial overexpression of erbB-2 induces transformed phenotype in NIH/3T3 fibroblasts (15, 16) a well as in mammary epithelial cells (17) suggesting tha overexpression can contribute directly to the development o the malignant phenotype. Due to the extensive homology between gpl85erbB-2 an the epidermal growth factor receptor (EGFR), it is widel assumed that their activation might proceed through simila mechanisms. One such mechanism involves recepto dimerization/oligomerization which is thought to be a important step in the activation of the EGFR intrinsi tyrosine kinase function (18, 19). Interfering wit receptor-receptor interactions has been evaluated as potential therapeutic approach to treatment of cance rs wit erbB-2 overexpression. Previous studies have evaluated th use of single monoclonal antibodies directed against erbB- WO94/00136 PCI7US92/08545

(20) and the related Epidermal Growth Factor Receptor (EGF protein (21) as potential therapeutic agents for t treatment of cancer.

Use of single monoclonal antibodies directed again erbB-2 which have been evaluated as potential therapeut agents have resulted in increased gpl85e ^*bB autophosphorylation, resulting from increases in t activity of tyrosine kinase. Single antibody agents ha shown promise as potential anticancer therapies (20, 27).

SUMMARY OF THE INVENTION

One object of Applicant's invention relates to combination of at least two monoclonal antibodies capable treating or preventing human malignancies wherein t malignant cells overexpress gpl85 ~ . The combinati comprises at least a first and second antibody each of whi recognizes the gpl85 extracellular domain of erbB-2. T activity demonstrated by the combination antibody treatme has shown greater activity than expected by the sum of t individual antibodies at the same overall antibo concentration.

Another object of the present invention provides f the use of monoclonal antibodies which are single cha monoclonal antibodies. The single chain antibodies can used to form a bispecific antibody.

DETAILED DESCRIPTION OF THE DRAWINGS

Figure 1A. Specificity of monoclonal antibodies # and #23. Subconfluent SK-Br-3 monolayers were metabolical labeled with 35S-Cys (spec. act. 1000 Ci/m ol). Total cel proteins were immunoprecipitated with 10 μg of the indicat antibodies. The immune complexes were recovered by Protei G Agarose (Genex, Gaithersburg, MD) and analyzed by SDS-PA on an 8- 16% Tri s-Glycine gel . The gel was exposed to fi l at -70°C overnight with an intensifying screen .

___. KR

Figure IB. gpl85 overexpression in the gastri cell line N87 and a tumor from N87 mouse xenografts compare to high and low gpl85erbB—2 overexpressers. Cells or tumo were lysed in sample buffer which contained 0.125

Tris-HCl, 4% SDS, 0.002% bro ophenol blue, and 15% glycerol

5% β-mercaptoethanol was added after the protei concentration was determined. ^' Samples (10 μg total protein were boiled for 3 min, fractionated by SDS-PAGE on 8-16

Tris-Glycine gel and transferred to nitrocellulose

___<» TD

Detection of gpl85 was performed with a monoclona antibody to the c-terminal portion of the protein.

Figure lC. Southern blot analysis of the erbB-2 gen in N87 (gastric), SK-Br-3 (breast), and SK-OV-3 (ovarian cell lines and human placenta. DNA was extracted from cel lines and human placenta tissue using guanidine thiocyanat and cesium gradient centrifugation. DNA (15 μg) was cleave with restriction enzyme HinDIII, separated b electrophoresis on a 1% agarose gel, transferred t nitrocellulose, and probed with radioactive erbB-2 cDN probe as previously described (26). The cDNA prob corresponds to the entire erbB-2 protein coding region.

Figure 2. Effects of Ab#21 and Ab#23 on the growth o human N87 gastric tumor cells in a monolayer MTT growt assay. A single cell suspension of 10,000 cells/well wa plated in a chemically defined medium consisting o RPMI-1640 supplemented with Insulin (5 μg/ml ) , huma transferrin (10 μg/ml) , 17-β-estradiol (10 nM), sodiu selenite (5 nM), and 10 mM Hepes. PBS, Ab#21, Ab#23 or combination of Ab#21 and Ab#23 at the indicate concentration were then added. The plates were grown a 37°C in a 5% CO. humidified atmosphere. After 7 days, 50 μ of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazoliu bromide (0.1 mg) were added and allowed to incubate for hours at 37°C. 90% of the media was then removed and th crystals solubilized in 0.175 ml DMSO. Optical densitie were measured at 540 nm in a Molecular Devices Vmax kineti microplate reader. Results are the average -of eight well with standard deviations noted. Under the conditions used the cell number is directly proportional to MTT reduction.

Figure 3A. Effects of treatment with Ab#21 ( ) Ab#23( ), a combination of Ab#21 and Ab#23 ( ) , or PB ( ) on the growth of N87 tumor xenografts in BNX mice Tumor cells (5 X 10 /mouse) were subcutaneously injecte into the flanks of BNX (beige, nude, xid) mice. Treatmen begun on day 1 consisted of four trial groups (3 mice pe group) each given 0.2 ml intraperitoneal injections twice week of either PBS ( ) , 200 μg purified Ab#21 (0), 200 μ purified Ab#23 ( ) , or a mixture of 100 μg purified Ab#2 and 100 μg of purified Ab#23 ( ) for three weeks. Tumo growth is reported as an average relative tumor volume ε.e.m. ±15%. Two repeats of the experiment gave the sam results.

Figure 3B. Effect of treatment after the formation o small tumors. Cells were injected using the same treatmen protocol as above except for the fact the treatment wa begun 4 days after cell injection instead of 1 day after Animal care was in accordance with institutional guidelines

Figure A. Effect of antibody binding on erbB- protein turnover. Subconfluent N87 cell monolayers wer pulse-labeled 1 h with 20 μCi 35S-Cysteine and then chase with 5 mM Cys in the presence of Ab#21 alone, Ab#23 alone or a 1:1 combination of Ab#21 and Ab#23 (10 μg/ml)for 24 h

Total cellular protein was immunoprecipitated as describe in Figure 1 using a monoclonal antibody directed against th c-terminus of gpl85

coupled to Sepharose and analyzed by SDS-PAGE. The gel was exposed to film at -70°C overnight with an intensifying screen.

Figure 4B. Measurement of tyrosine phosphorylation of gp!85 ~ after incubation with antibody combination. Cells were plated as in Figure 4A. After 1 h cells were processed as in Figure IB. The proteins were electroblotted onto nitrocellulose paper and incubated with anti-phosphotyrosine IgG (polyclonal, Upstate Biotechnology, Inc.) and immunodetected using an ECL western blotting detection system (Amersham) . The film was exposed for 5 min at room temperature.

Figure 5. Effects of Ab#21 and Ab#23 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with Insulin (5 μg/ml), human transferrin (10 μg/ml) , 17-β-estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepeε. PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 at the indicated concentration were then added. The plates were grown at 37°C in a 5% CO- humidified atmosphere. After 7 days, 50 μl of 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37°C. 90% of the media was then removed and the crystals solubiJized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular-Devices V ax kinetic icroplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

Figure 6. Effects of Ab#23 and Ab#94 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined medi consisting of RPMI-1640 supplemented with Insulin (5 μg/ml human transferrin (10 μg/ml), 17-β-estradiol (10 nM), sodi selenite (5 nM), and 10 mM Hepes. PBS, Ab#23, Ab#94 or combination of Ab#21 and Ab#23 at the indicat concentration were then added. The plates . were grown 37°C in a 5% C0₂ humidified atmosphere. After 7 days, 50 of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazoli bromide (0.1 mg) were added and allowed to incubate for hours at 37°C. 90% of the media was then removed and t crystals solubilized in 0.175 ml DMSO. Optical densiti were measured at 540 nm in a Molecular Devices Vmax kinet microplate reader. Results are the average of eight wel with standard deviations noted. Under the conditions use the cell number is directly proportional to MTT reduction.

Figure 7. The cDNA sequence for the *single cha anti-erbB2 antibody, Ab#23.

Figure 8. The cDNA sequence for the *single cha anti-erbB2 antibody, Ab#21 (e22).

DETAILED DESCRIPTION OF THE INVENTION

One object of the present invention is a combination at least two monoclonal antibodies, which is capable preventing and treating human malignancies, wherein t malignant cells overexpress gpl85 ~ and wherein said least two different antibodies each recognize a differe epitope of the gpl85 expression product of erbB-2, therefo the antibodies do not cross react with each other. embodiment of the present invention provides for t combination to comprise first and second antibodies whi are preferably combined such that the resulting ratio of t first to second is effective for decreasing the expressi product of the erbB-2 gene. A convenient method f measuring the expression product of erbB-2 gene may be found in Figure 4A. The decrease in the expression of the erbB-2 gene product is the result of the combination decreasing the half life of erbB-2 protein in the cell. In another embodiment of the present invention, the combination of the antibodies has the characteristic trait of essentially not increasing the tyrosine phosphorylation of gpl85 expression product.

An example of a first to second antibodies ratio having the activity necessary to decrease the expression product of the erbB-2 gene comprises a ratio of from about 1:2 to about 2:1. Preferably, such a ratio is 1:1. The present invention, however, is not intended to be limited to the antibody ratios discussed herein. The fact that other ratios are effective and may yield higher activity than the 1:1 ratio used as an example is recognized and acknowledged by the inventors as being within the scope of this invention.

The activity of this combination is exemplified in Figures 1A-C, 2 and 3A, B as follows. Figure 1A-C demonstrate that the N87 cells overexpress the gpl85 erbB-2 protein as a result of erbB-2 gene amplification. Figure 2 shows that a combination of Ab#21 and Ab#23 inhibits the growth of N87 cells dji vitro. Similar results have been demonstrated using the combination of Ab#23 and Ab#94 as well as Ab#23 and Ab#21, on the growth of human Calu-3 lung adenocarcinoma (See Figures 5 and 6). Figure 3A and B show the activity of combinations of Ab#21 and Ab#23 inhibiting and reversing the growth of N87 cells growing as tumors in immunodeficient mice. These results indicate the general nature of the application of combinations of antibodies.

The antibodies against the erbB2 gene encoded product used in this invention can be designed as chimeric antibodies. Chimeric antibodies have variable region (antigen binding regions) of nonhuman (e.g., murine) origi and constant regions of human origin. Because they ar predominantly human, chimeric antibodies are les immunogenic in humans, which can help overcome problem associated with administering foreign proteins to humans.

In addition, the antibodies of the present inventio may be produced through genetic recombination or th Kohler-Milstein hybridoma method for production o antibodies. It is also recognized that fragments, analogue or derivatives of the antibodies themselves can be utilize in this invention in place of the entire antibody.

Another object of the present invention provides fo antibodies against erbB-2 gene encoded product which ar designed as single chain antibodies. A single chai antibody is one in which the light and heavy variabl regions of the antibody are linked together to form a singl chain antibody. It is contemplated in this application tha a combination of these antibodies include antibodies whic are combined as an admixture as discussed above an antibodies which are combined to form a bispecific antibody

A bispecific antibody is an artificially produce antibody usually comprised of two single chain antibodie each of which is recognizes a different antigen bindin site.

The following are examples of some of the huma malignancies which may be treated or prevented using th present invention; adenocarcinonas of the breast, ovary lung and stomach.

Another embodiment of applicants' invention provides method for preventing and eradicating the human malignancie described above. The method involves administering to patient an effective dose of a combination of anti-erbB- antibodies to achieve an effective concentration of the antibody combination at the tumor site; for example, a concentration of at least lμg/ml. Preferably the concentration at the tumor site does not exceed about lOμg/ml. In general, in order to achieve the desired concentration of the combination at the tumor site the combination is administered in a dose from about .1 mg/kg to about 10 mg/kg of body weight.

Another embodiment of Applicants' invention provides for the antibody combination to be used in passive tumor therapy, wherein an effective dose of the antibody combination is administered in or with a pharmaceutically acceptable vehicle to a patient afflicted with a human malignancy overexpressing gpl85erbB-2. Examples of vehicles are non-toxic buffers, physiological saline, etc.

Applicants' invention also provides for at least one of the antibodies of the antibody combination to be used as a component of an immunotoxin. For immunotoxin therapy, at least one antibody of the combination can be linked to an anti-cancer pharmaceutical or a cytotoxin to form an immunotoxin. Various pharmaceutical or cytotoxic agents can be chemically or genetically coupled to the combination. Examples of some useful therapeutic agents include: radioactive compounds (e.g., isotopes of Boron and Rhenium); agents which bind DNA, such as alkylating agents or various antibodies (e.g., daunomysin, adriamycin, chlorambucil) ; anti-metabolites (e.g., methotrexate) ; and inhibitors of protein synthesis (e.g., diphtheria toxin and toxic plant proteins). The use of the combination, wherein at least one of the antibodies in the combination is coupled to an immunotoxin will increase the efficacy of the therapy.

Administration to a patient of an effective dose of the combination of antibodies described herein may be accomplished via chronic intraveneous administration for period of time sufficient to result in the regression o eradication of the human malignancy being treated Administration of the combination may also be accomplishe in a patient by direct injection or delivery of th combination to the tumor site. Such administration would b of sufficient duration and concentration to result i eradication or reduction of the tumor.

Although the scope of the present invention is no intended to be limited to any theoretical reasoning, th following theories may explain a mechanism by which dow regulation and protection from human malignant cell overexpressing gpl85 ^" is achieved by the two antibod combination.

One mechanism which has been postulated is that the tw antibody combination acts by constraining gpl85^{er "} int an activated conformation thus mimicking an agonist ligand If the two antibody combination mimics the ligand, the treatment using the combination should result in increase gpl85 ~ autophosphorylation. Anti-phosphotyrosin immunoblots were used to test this hypothesis. As shown i Figure 4B, no increase in tyrosine phosphorylation o gpl85^er ~ from N87 cells was observed 1 or 2 hours afte the addition of the antibody combination or up to 24 h o treatment. This suggests that the antibody combination doe not increase the autophosphorylation of gpl85 an therefore does not act to inhibit the activity of th tyrosine kinase.

The results demonstrate that a combination o anti-receptor antibodies leads to different and more poten anti-tumor activities than single antibodies. Mor specifically, results indicate that the combination antibod therapy is a useful approach to treatment of huma ___ *hR malignancies overexpressing gpl85 This approach may b particularly important in the treatment of gastric cancer, disease which responds poorly to current systemi chemotherapies.

The present invention is further illustrated by th following Examples which are not intended to limit the scop of the invention.

EXAMPLE 1

Preparation of Antibodies

As a source of human erbB-2 protein we used a NIH/3T cell engineered to express the human erbB-2 protein on it surface (N/erbB-2). Membrane preparations of these cell were prepared by hypotonic lysis in 2mM Hepes pH 7.4, removal of nuclei by centrifugation at 5,000 x g an isolation of membranes by centrifugation at 100,000 x g. Mice were immunized with lOOμg of N/erbB-2 membran preparation in a 50:50 mix of adjuvant in 200μl. Adjuvan was Freund's complete for the first injection followed b Freund'ε incomplete adjuvant. Mice were given intraperitoneal injections over 4 weeks. One week followin the last boost sera was obtained and an anti-erbB-2 immun response was determined to exist by immunoprecipitio analysis of gpl85 erbB-2 protein from metabolically labele cells. An immune mouse was then selected and boosted wit lOOμg of N/erbB-2 membrane preparation and fusion wit Ag8.653 myelomea cells conducted according to standar methods. Selection of hybrid clones was by resistence t hypoxanthine, aminopterin, and thymine (HAT) containin media again according to standard methods. Identificatio of hybridomas secreting an anti-erbB-2 monoclonal antibod was by ELISA using as antigen N/erbB-2 membrane protei attached to 96 well dishes. ELISA reaction was develope using peroxidase coupled goat anti-mouse antibody an standard methods. Hybridoma cultures secreting a anti-erbB-2 antibody were subjected to two rounds of singl cell cloning and identification of positive subclones b ELISA as described above.

The above procedure is used to produce three monoclona antibodies designated as Ab#21; Ab#23; and Ab#94.

Monoclonal antibodies directed against th erbB-2 extracellular domain of gpl85 were tested for specifi reaction to N/erbB-2 cell membranes in an ELISA assay. Tw of these designated Ab#21 and Ab#23 after screening i growth assays exhibited the highest biological activity an were used in this study. Antibodies were isolated in larg amounts from ascites fluid and purified by HPLC with

Gammabind Ultra column (Genex, Gaithersburg, MD) . Standar

SDS-PAGE gel electrophoresis was run under non-reducin conditions using Coomassie blue staining with a single ban of 130 kd observed indicating a >98% purified preparatio

(data not shown).

Both antibodies - specifically immunoprecipitated

35 single S-labeled protein of MW 185,000 from SK-Br-3 cceellll

(a breast cancer cell line which overexpresses gpl85erB- protein) (22) as shown in Figure 1A. No immunoprecipitatio was detected in cells which do not overexpress th gpl85 protein (e.g. MDA-MB-468, data not shown).

The effect of these antibodies on cell proliferatio was studied on a gastric cell line, N87, which overexpresse gpl85^{er "} at levels commensurate with SK-Br-3. A immunoblot of the N87 cell line and a nude mouse tumo xenograft from N87 is shown in Figure IB compared to th breast cell lines SK-Br-3 (high level of gpl85 overexpression) and MDA-MB-231 (low level of gpl85^er overexpression) The levels of erbB-2 gene amplification i N87 as shown in Figure 1C surpassed those found in the wel characterized SK-Br-3 and SK-OV-3 cell lines (22).

EXAMPLE 2

Effect of Antibodies on Tumor Growth In Vitro

The effect of these antibodies on growth was firs studied .in vitro using a semiauto ated colorimetric MT assay. A single cell suspension of 10,000 cells/well wa plated in a chemically defined media consisting of RPMI-164 supplemented with insulin, human transferrin, 17 -estradiol sodium selemite and Hepes buffer. PBS, Ab#21, Ab#23 or combination of Ab#21 and Ab#23 were then added. The cell were allowed to grow at 37°C in a 5% C0_ humidifie atomosphere. After 7 days, 3- (4,5 dimethylthiazol-2-y)-2,5-diphenyl tetrazoliu bromide (MT reagent) was added and allowed to incubate for 4 hours a 37°C, 90% of the media was then removed and the crystal solubilized in DMSO. Optical densities were measured at 54 nm in a molecular devices Vmax kinetic microplate reader. dose response analysis of the effects of the antibodies o N87 cell proliferation is shown in Figure 2. Antibodie Ab#21 or Ab#23 administered individually had no effect o the monolayer growth of cells up to a concentration of 1 μg/ml (6 μM) . Administration of a 1:1 combination of Ab#2 and Ab#23, however, markedly affected cell proliferation a doses as low as 1 μg/ml. Fab fragments prepared from bot antibodies also had no effect on cell growth alone or i combination (data not shown) . In analogous experiments wit three other gastric cell lines displaying little or n overexpression by immunoblot analysis, no inhibition o growth even at the highest dose was observed with th antibody combination or the antibodies alone. EXAMPLE 3

Preventive Combination Antibody Therapy

The efficacy of combination antibody therapy was teste on the growth of N87 tumor xenografts. One inoculation o five million N87 cells were injected subcutaneouεly int nude mice produce rapidly growing tumors, with a shor latency. Tumor growth at the injection site was easil quantitated. As shown in Figure 3A, the N87 cells did no form tumors in the animals treated twice a week for thre weeks with a total of 200 μg of antibodies per injectio with the combination of Ab#21 and Ab#23. In sharp contras they were potently tumorigenic in animals treated with th

3 single antibodies or PBS and the tumor grew to over 1 cm i tumor volume over the period measured. In contrast to i vitro experiments, each monoclonal antibody alone may hav limited activity to partially restrict the rate of tumo growth. However, the activity exhibited by the combinatio far exceeded the cumulative effect expected from th combination.

To determine if the combined therapy with Ab#21 an

Ab#23 was able to eradicate established tumors, a experiment was performed in which tumors were allowed t grow to measurable sizes prior to antibody treatment. Th results are illustrated in Figure 3B. In animal group randomized so that the starting size of the tumors was nea

3 the same volume (100 mm ), the tumors continued to grow whe the animals were given single antibody treatment of Ab#21 o

Ab#23 (200 μg/injection, 2 injection/week, 3 weeks, 6 mice)

In contrast, in the animals given two antibody combinatio treatment of Ab#21 and Ab#23, results shown are the averag of 6 animals, tumors completely regressed after 11 days ( treatments of 200 μg of total antibody) . This is the firs reported observation of tumor xenograft regresεion induce by a combination of anti-erbB-2 monoclonal antibodieε Previouε studieε have shown that two anti-neu antibodies ca inhibit the growth of tumors by murine cells transformed b the mutationally activated neu oncogene (23). Th activation of the murine neu oncogene is accomplished b point mutation as evidenced by qualitative interference i the structure and function of the neu gene, whereas th human erbB-2 oncogene is activated by overexpresεion o erbB-2, a quantitative interference of the apparently norma protein which results in tumor formation.

Since the mechanisms for tumor growth are εo differen between murine and human, it is totally unexpected tha similar mechanisms of neutralization of the genes involve would be effective. This effect is also seen with th inhibition of leukemic tumor cell growth usin anti-transferrin monoclonal antibodies (24) .

EXAMPLE 4

Antiproliferative Effects of Antibody Combination

To investigate the molecular basis for th antiproliferative effects of Ab#21 and Ab#23, we measure the rate of gpl85 turnover in the presence or absenc of antibodies. N87 cells were pulse-labeled with 35S-Cy and then chased for various times in the presence of singl antibody or the Ab#21/#23 combination. The results of a 24 h chase are shown in Figure 4A. Th øY_"^R antibody gpl85 ^" combination induced rapid degradatio of gpl85^er ~ while the individual antibody treatment ha little or no effect. Thus, the antiproliferative effect o

Ab#21/Ab#23 treatment might likely be explained by thei ability to increase the turnover of gpl85erbB-2

EXAMPLE 5 Combination Antibody Treatment Effects the Growth of Calu- Cells

In order to demonstrate that the effect of combinatio of anti-erbB-2 antibodies Ab #21 and Ab #23 is not limite to effect on the N87 gastric cancer cell line, w investigated the human lung adenocarcinoma cell line Calu-3. This cell overexpresses the gpl85 erbB-2 protein a determined by immunoblot analysiε (data not shown). I experiments very similar to that described above, th combination of Ab #21 and Ab #23 show dramatic inhibition o cell growth as measured in an MTT assay (figure 5). In thi experiment, a single cell suspension of 10,000 cells/well was plated in a chemically defined media consisting o RPMI-1640 supplemented with insulin, human transferrin, 17- eεtradiol. sodium selenite, and Hepes buffer. PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 were then added. The cells were allowed to grow at 37°C in a 5% CO, humidified atmosphere. After 7 days, MTT reagent was adde and allowed to incubate for 4 hours at 37°C. 90% of the media was then removed and the crystals solubilized in DMSO. Optical densities were measured at 540 nm in a Molecula Devices Vmax kinetic microplate reader. A dose respons analysis of the effects of antibody treatment iε shown i figure 5. This result indicates that combination antibod therapy is not limited in effectiveness to N87 cells o gastric cancer cells. It alεo indicateε that combinatio antibody therapy may have effectiveneεs in the treatment o adenocarcinoma of the lung.

EXAMPLE 6

Effectivenesε of Other Combinationε of Antibodies i

Inhibiting Cell Growth In order to determine if Ab#21 and Ab#23 are unique i their ability to combine to cause growth inhibition, we investigated the combination of Ab#94 and Ab#23 on the growth of Calu-3 cells in vitro. An MTT assay of cell growth was conducted as described in EXAMPLE 5. As shown in figure 6, the combination of antibodies inhibits cell growth and the individual antibodies do not. This indicates that the ability to combine antibodies to produce a more profound growth inhibition is not limited to a particular antibody combination.

Antibodies #21; Ab#23; and Ab#94 have been deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852, USA. Ab#21 was deposited on and given ATCC # . Ab#23 was deposited on and given ATCC # . Ab#94 was deposited on and given ATCC # .

While the present invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art in view of the foregoing description. Accordingly, the invention is intended to embrace all such alternatives, modifications and variations in following within the broadest scope and εpirit of the following claims. Example 7 Generation of a single chain (Fv) from mAb e23

Poly A RNA was extracted from hybrido a cells using oligo dT affinity chromatography (In vitrogen) . cDNA was prepared using random primer (N_&) (Boerhinger Mannheim). The immunoglobulin light and heavy chain clones were isolated using PCR and the primers: light chain, 5' CAC GTC GAC ATT CAG CTG ACC CAC TCT CCA and GAT GGA TCC AGT TGG TGC AGC ATC3*; heavy chain 5'C GGA ATT TCA GGT TCT GCA GIA GTC WGG3' and 5' AGC GGA TCC AGG GGC CAG TGG ATA GAC3' [G,A,C, stand for standard nucleotides; I for inosine, W for A

T] . The products of the PCR reaction wre cloned into PUC1

Linkage into a SC(Fv) was by PCR giving the individual lig and heavy cDNA clones and 4 oligonucleotides

5' - cgagatgagtccagctgacccagtctc

5' - gaagatttaccagaaccagaggtagaaccttttatttccagcttgga

5' - ctggttctggtaaatcttctgaaggtaaaggtgtgcagctgcaggag

5' - cgagtgcaagcttaggagacggtgaccgt .

The light and heavy chain coding regions were joined by synthetic linker GSTSGSGKSSEGKG specified by overlappin oligonucleotides as described. The intact scFv codin region was inserted in frame with an E.coli OMPA leade sequence under direction of the lambda P_ promoter

Induction of protein and bacterial lysis and refolding wa as previuosly described (28). scFv was purified as a singl peak from CM chromatography and judged to be >70% by SDS ge electrophoresis.

Example 8

Generation of a scFv from mAb e21

Poly A RNA was extracted from hybridoma cells usin oligo dT affinity chromatography (In vitrogen) . cDNA wa prepared using random primer (N_β) (Boerhinger Mannheim) The immunoglobulin light and heavy chain clones wer isolated using PCR and the primers: light chain, 5' CAC GT GAC ATT CAG CTG ACC CAC TCT CCA and GAT GGA TCC AGT TGG TG AGC ATC3'; heavy chain 5'C GGA ATT TCA GGT TCT GCA GIA GT WGG3' and 5' AGC GGA TCC AGG GGC CAG TGG ATA GAC3* [G,A,C, stand for standard nucleotides; I for inosine, W for A o T] . The products of the PCR reaction wre cloned into PUC18 Linkage into a scFv was by PCR giving the individual ligh and heavy cDNA clones and 4 oligonucleotides 5' - cgagatgagtccagctgacccagtctc 5' - gaagatttaccagaaccagaggtagaaccttttatttccagcttgga 5' - ctggttctggtaaatcttctgaaggtaaaggtgtgcagctgcaggag 5' - cgagtgcaagcttaggagacggtgaccgt.

The light and heavy chain coding regions were joined by synthetic linker GSTSGSGKSSEGKG specified by overlappi oligonucleotides as described. The intact scFv codi region was inserted in frame with an E.coli OMPA lead sequence under direction of the lambda P. L_ promote

Induction of protein and bacterial lysis and refolding w as previuosly described (28). scFv was purified as a sing peak from CM chromatography and judged to be >70% by SDS g electrophoresis.

REFERENCES

I. C.R. King, M.H. Kraus, S.A. Aaronson, Science 229, 9 (1985).

2^~ D.J. Slamon, et al. , Science 235, 177 (1987).

3. D.J. Slamon, et al., Science 244, 707 (1-989).

4. J. Yokota, et al., Lancet 1, 765 (1986).

5. C.R. King, et al., Cancer Res. 49, 4185 (1989).

6. P.M. Schneider, et al., Cancer Res. 49, 4968 (1989).

7. J. Park, et al., Cancer Res. 49, 6605 (1989).

8. C. Wright, et al., Cancex- Res. 49: 2087 (1989).

9. A.K. Tandon, et al., J. Clin. Oncol. 7, 1120 (1989).

10. S. Paik, et al., J. Clin. Oncol. 8, 103 (1990).

II. A. Borg, et al., Cancer Res. 50, 4332 (1990).

12. A. Berchuck, et al., Cancer Res. 50, 4087 (1990).

13. Y. Yonemura, et al., Cancer Res. 51, 1034 (1991).

14. J.A. Kern, et al. , Cancer Res. 50, 5184 (1990).

15. P.P. Di Fiore, et al., Science 237, 178 (1986).

16. R.M. Hudziak, J. Schlesεinger, A. Ullrich, Pro. Nat Acad. Sci. U.S.A. 84, 7159 (1987).

17. Pierce, et al. , oncogene, in press.

18. Y. Yarden, A. Ullrich, Biochem. 27, 3114 (19.88).

19. J. Schlessinger, Biochem. 27, 3119 (1988).

20. R.M. Hudziak, et al. , Mol. Cell. Biol. 9, 11 (1989).

21. C.R. Divgi, et al. , JNCI 83, 97 (1991).

22. M. H. Kraus, N. C. Popescu, S. C. Amsbaugh, C. R. Kin EMBO J. 6, 605 (1987) .

23. J.A. Drebin, V.C. Link, M.I. Greene, Oncogene 2, 2 (1988).

24. S. White, et al., Cancer Res. 50, 6295 (1990).

25. R. Kumar, H.M. Shepard, J. Mendelsohn, Mol. Cell Biol. 11, 979 (1991). 26. C.R. King, et al., Cancer Res. 49,4185 (1989).

27. M.C. Hancock, et al., Cancer Res. 51,4575-4580 (1991).

28. M.W. Pantaliano, et al., Biochemistry 30, 117-125 (1991).

-2

Claims

WE CLAIM:

1. An antibody combination for treating or preventin human malignancies wherein the malignant cells overexpres erbB-2, said combination comprising: at least two different monoclonal antibodies, each of which recognizes a different epitope of the gpl85 expression product of erbB-2.

2. An antibody combination as in Claim 1, wherein said combination comprises: first and second different monoclonal antibodies, and wherein said combination decreases the expression product of the erbB-2 gene.

3. An antibody combination as in Claim 2, wherein said combination does not essentially increase tyrosine phosphorylation of the gpl85 expression product.

4. An antibody combination of Claim 2, wherein at least one of said antibodies in said antibody combination has been linked to an immunotoxin molecule.

5. A method of treating a patient afflicted with a human malignancy wherein the malignant cells overexpress erbB-2, the method comprising: administering to the patient afflicted with said human malignancy an effective amount of a combination of at least two different monoclonal antibodies which recognize different epitopes of the gpl85 expression product of erbB-2.

6. A method as in Claim 5, wherein said combination comprises: first and second different monoclonal antibodies and wherein said combination decreases the expression product of the erbB-2 gene.

7. A method as in Claim 6, wherein said combination does not essentially increase tyrosine phosphorylation of the gpl85 expression product.

8. A method as in Claim 6, wherein said effective amount provides a concentration of at least 1 μg/ml at the tumor site.

9. A method as in Claim 8, wherein said effective amount provides a concentration of not more than 10 μg/ml at the tumor site.

10. A method as in Claim 6, wherein said effective amount is a dose of from about .1 mg/kg to about 10 mg/kg of body weight of the patient.

11. A method as in Claim 6, wherein at least one of said antibodies of said combination has been linked to an immunotoxin molecule.

12. A composition capable of preventing or treating human malignancies wherein the malignant cells overexpress erbB-2 comprising:

(a) an effective amount of a combination of at least two different monoclonal antibodies which recognize different epitopes of the gpl85 expression product of erbB2; and

(b) a pharmaceutically acceptable carrier.