WO1994017185A1 - G-csf analog compositions and methods - Google Patents
G-csf analog compositions and methods Download PDFInfo
- Publication number
- WO1994017185A1 WO1994017185A1 PCT/US1994/000913 US9400913W WO9417185A1 WO 1994017185 A1 WO1994017185 A1 WO 1994017185A1 US 9400913 W US9400913 W US 9400913W WO 9417185 A1 WO9417185 A1 WO 9417185A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- leu
- ala
- gln
- csf
- ser
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/53—Colony-stimulating factor [CSF]
- C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2299/00—Coordinates from 3D structures of peptides, e.g. proteins or enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Definitions
- This invention relates to granulocyte colony stimulating factor ("G-CSF") analogs, compositions containing such analogs, and related compositions.
- G-CSF granulocyte colony stimulating factor
- the present invention relates to nucleic acids encoding the present analogs or related nucleic acids, related host cells and vectors.
- the invention relates to computer programs and apparatuses for expressing the three dimensional structure of G-CSF and analogs thereof.
- the invention relates to methods for rationally designing G-CSF analogs and related compositions.
- the present invention relates to methods for treatment using the present G-CSF analogs.
- Hematopoiesis is controlled by two systems: the cells within the bone marrow microenvironment and growth factors.
- the growth factors also called colony stimulating factors, stimulate committed progenitor cells to proliferate and to form colonies of
- G-CSF granulocyte colony stimulating factor
- G-CSF is produced by fibroblasts, macrophages, T cells trophoblasts,
- endothelial cells and epithelial cells and is the expression product of a single copy gene comprised of four exons and five introns located on chromosome seventeen. Transcription of this locus produces a mRNA species which is differentially processed, resulting in two forms of G-CSF mRNA, one version coding for a protein of 177 amino acids, the other coding for a protein of 174 amino acids, Nagata et al., EMBO J 5: 575-581 (1986), and the form comprised of 174 amino acids has been found to have the greatest specific in vivo biological activity.
- G-CSF is species cross- reactive, such that when human G-CSF is administered to another mammal such as a mouse, canine or monkey, sustained neutrophil leukocytosis is elicited. Moore et al., PNAS-USA 84: 7134-7138 (1987).
- Human G-CSF can be obtained and purified from a number of sources. Natural human G-CSF (nhG-CSF) can be isolated from the supernatants of cultured human tumor cell lines.
- nhG-CSF Natural human G-CSF
- the development of recombinant DNA technology see, for instance, U.S. Patent 4,810,643 (Souza) incorporated herein by reference, has enabled the production of commercial scale quantities of G-CSF in glycosylated form as a product of eukaryotic host cell expression, and of G-CSF in non-glycosylated form as a product of prokaryotic host cell expression.
- G-CSF has been found to be useful in the treatment of indications where an increase in
- G-CSF is beneficial as a means of selectively stimulating neutrophil production to compensate for hematopoietic deficits resulting from chemotherapy or radiation therapy.
- Other indications include treatment of various infectious diseases and related conditions, such as sepsis, which is typically caused by a metabolite of bacteria.
- G-CSF is also useful alone, or in combination with other compounds, such as other cytokines, for growth or expansion of cells in culture, for example, for bone marrow
- G-CSF binds to a cell-surface receptor which apparently initiates the changes within particular progenitor cells, leading to cell differentiation.
- G-CSF' s have been reported.
- certain changes are known to have certain structural effects. For example, deleting one cysteine could result in the unfolding of a molecule which is, in its unaltered state, is normally folded via a disulfide bridge.
- disulfide bridge There are other known methods for adding, deleting or substituting amino acids in order to change the function of a protein.
- polypeptide analogs and peptide fragments of G-CSF are disclosed generally.
- Specific G-CSF analogs disclosed include those with the cysteins at positions 17, 36, 42, 64, and 74 (of the 174 amino acid species or of those having 175 amino acids, the additional amino acid being an
- N-terminal methionine substituted with another amino acid, (such as serine), and G-CSF with an alanine in the first (N-terminal) position.
- EP 0 335 423 entitled “Modified human G-CSF” reportedly discloses the modification of at least one amino group in a polypeptide having hG-CSF activity.
- EP 0 272 703 entitled “Novel Polypeptide” reportedly discloses G-CSF derivatives having an amino acid substituted or deleted at or "in the neighborhood" of the N terminus.
- EP 0 459 630 entitled “Polypeptides” reportedly discloses derivatives of naturally occurring G-CSF having at least one of the biological properties of naturally occurring G-CSF and a solution stability of at least 35% at 5 mg/ml in which the derivative has at least Cys 17 of the native sequence replaced by a Ser 17 residue and Asp 27 of the native sequence replaced by a Ser 27 residue.
- EP 0 256 843 entitled “Expression of G-CSF and Muteins Thereof and Their Uses” reportedly discloses a modified DNA sequence encoding G-CSF wherein the
- N-terminus is modified for enhanced expression of protein in recombinant host cells, without changing the amino acid sequence of the protein.
- EP 0 243 153 entitled “Human G-CSF Protein Expression” reportedly discloses G-CSF to be modified by inactivating at least one yeast KEX2 protease processing site for increased yield in recombinant production using yeast.
- Polypeptides reportedly discloses lysine altered proteins.
- WO/9012874 reportedly discloses cysteine altered variants of proteins.
- Recombinant Proteins reportedly discloses the addition of amino acids to either terminus of a G-CSF molecule for the purpose of aiding in the folding of the molecule after prokaryotic expression.
- Australian patent application Document No. AU- A-76380/91 entitled, "Muteins of the Granulocyte Colony Stimulating Factor (G-CSF)” reportedly discloses muteins of the granulocyte stimulating factor G-CSF in the sequence Leu-Gly-His-Ser-Leu-Gly-Ile at position 50-56 of G-CSF with 174 amino acids, and position 53 to 59 of the G-CSF with 177 amino acids, or/and at least one of the four histadine residues at positions 43, 79, 156 and 170 of the mature G-CSF with 174 amino acids or at positions 46, 82, 159, or 173 of the mature G-CSF with 177 amino acids.
- Granulocyte Colony Stimulating Factor Gene reportedly discloses a synthetic G-CSF-encoding nucleic acid sequence incorporating restriction sites to facilitate the cassette mutagenesis of selected regions, and flanking restriction sites to facilitate the
- G-CSF has reportedly been crystallized to some extent, e.g., EP 344 796, and the overall structure of G-CSF has been surmised, but only on a gross level.
- the three dimensional structure of G-CSF has now been determined to the atomic level. From this three-dimensional structure, one can now forecast with substantial certainty how changes in the composition of a G-CSF molecule may result in structural changes.
- Relative hydrophobicity is important because it directly relates to the stability of the molecule.
- biological molecules found in aqueous environments, are externally hydrophilic and internally hydrophobic; in accordance with the second law of thermodynamics provides, this is the lowest energy state and provides for stability.
- G-CSF's internal core would be
- hydrophobic or hydrophilic areas With the presently provided knowledge of areas of hydrophobicity/- philicity, one may forecast with substantial certainty which changes to the G-CSF molecule will affect the overall structure of the molecule.
- biological activity being used here in its broadest sense to denote function.
- biological activity being used here in its broadest sense to denote function.
- the mutation has no biological function. If, however, the structure is not changed and the mutation does affect biological activity, then the residue (or atom) is essential to at least one
- G-CSF analogs are molecules which have more, fewer, different or modified amino acid residues from the G-CSF amino acid sequence.
- the modifications may be by addition, substitution, or deletion of one or more amino acid residues.
- the modification may include the addition or substitution of analogs of the amino acids themselves, such as
- the G-CSF used as a basis for comparison may be of human, animal or recombinant nucleic acid-technology origin (although the working examples disclosed herein are based on the recombinant production of the 174 amino acid species of human G-CSF, having an extra N-terminus methionyl residue).
- the analogs may possess functions different from natural human G-CSF molecule, or may exhibit the same functions, or varying degrees of the same functions. For example, the analogs may be designed to have a higher or lower biological activity, have a longer shelf-life or a decrease in stability, be easier to formulate, or more difficult to combine with other ingredients.
- the analogs may have no hematopoietic activity, and may therefore be useful as an antagonist against G-CSF effect (as, for example, in the overproduction of
- G-CSF G-CSF
- the present invention relates to related compositions containing a G-CSF analog as an active ingredient.
- the term, "related composition,” as used herein, is meant to denote a composition which may be obtained once the identity of the G-CSF analog is ascertained (such as a G-CSF analog labeled with a detectable label, related receptor or pharmaceutical composition).
- Also considered a related composition are chemically modified versions of the G-CSF analog, such as those having attached at least one polyethylene glycol molecule.
- a G-CSF analog to which a detectable label is attached, such as a
- compositions which may be formulated by known techniques using known materials, see, e.g., Remington's
- G-CSF analog may be administered by
- G-CSF analogs may be inserted into liposomes or other microcarriers for delivery, and may be formulated in gels or other compositions for sustained release.
- preferred compositions will vary depending on the use to which the composition will be put, generally, for G-CSF analogs having at least one of the biological activities of natural G-CSF, preferred pharmaceutical compositions are those prepared for subcutaneous injection or for pulmonary administration via inhalation, although the particular formulations for each type of administration will depend on the characteristics of the analog.
- receptor indicates a moiety which selectively binds to the present analog molecule.
- antibodies, or fragments thereof, or “recombinant antibodies” may be used as receptors. Selective binding does not mean only specific binding (although binding-specific receptors are encompassed herein), but rather that the binding is not a random event.
- Receptors may be on the cell surface or intra- or extra-cellular, and may act to effectuate, inhibit or localize the biological activity of the present analogs. Receptor binding may also be a triggering mechanism for a cascade of activity
- nucleic acids contemplated herein are nucleic acids, vectors
- nucleic acids containing such nucleic acids and host cells containing such nucleic acids which encode such receptors.
- Another example of a related composition is a G-CSF analog with a chemical moiety attached.
- chemical modification may alter biological activity or antigenicity of a protein, or may alter other characteristics, and these factors will be taken into account by a skilled practitioner.
- one example of such chemical moiety is polyethylene glycol.
- Modification may include the addition of one or more hydrophilic or hydrophobic polymer molecules, fatty acid molecules, or polysaccharide molecules.
- Examples of chemical modifiers include polyethylene glycol, alklpolyethylene glycols, Dl-poly (amino acids),
- chemical modification may include an additional protein or portion thereof, use of a cytotoxic agent, or an antibody.
- modification may also include lecithin.
- the present invention relates to nucleic acids encoding such analogs.
- the nucleic acids may be DNAs or RNAs or derivatives thereof, and will typically be cloned and expressed on a vector, such as a phage or plasmid containing
- nucleic acids may be labeled (such as using a radioactive,
- nucleic acid sequence may be optimized for expression, such as including codons preferred for bacterial expression.
- nucleic acid and its complementary strand, and modifications thereof which do not prevent encoooding of the desired analog are here contemplated.
- the present invention relates to host cells containing the above nucleic acids encoding the present analogs.
- Host cells may be eukaryotic or prokaryotic, and expression systems may include extra steps relating to the attachment (or prevention) of sugar groups (glycosylation), proper folding of the molecule, the addition or deletion of leader sequences or other factors incident to
- the present invention relates to antisense nucleic acids which act to prevent or modify the type or amount of expression of such nucleic acid sequences. These may be prepared by known methods.
- the nucleic acids encoding a present analog may be used for gene therapy purposes, for example, by placing a vector containing the analog-encoding sequence into a recipient so the nucleic acid itself is expressed inside the recipient who is in need of the analog composition.
- the vector may first be placed in a carrier, such as a cell, and then the carrier placed into the recipient.
- a carrier such as a cell
- Such expression may be localized or systemic.
- Other carriers include non-naturally occurring carriers, such as liposomes or other microcarriers or particles, which may act to mediate gene transfer into a recipient.
- the present invention also provides for computer programs for the expression (such as visual display) of the G-CSF or analog three dimensional structure, and further, a computer program which
- inputting of the coordinates for the three dimensional structure of a molecule i.e., for example, a numerical assignment for each atom of a G-CSF molecule along an x, y, and z axis
- means to express such as visually display
- means to alter
- crystallographic information i.e., the coordinates of the location of the atoms of a G-CSF molecule in three dimension space, wherein such coordinates have been obtained from crystallographic analysis of said G-CSF molecule
- a computer program for the expression such as visual display
- a computer program for the expression of G-CSF analog three dimensional structure Preferred is the computer program Insight II, version 4, available from Biosym, San Diego, California, with the coordinates as set forth in FIGURE 5 input.
- Preferred expression means is on a Silicon Graphics 320 VGX computer, with Crystal Eyes glasses (also available from Silicon
- Another aspect of the present invention is a computer program for the expression of the three dimensional structure of a G-CSF molecule. Also provided is said computer program for visual display of the three dimensional structure of a G-CSF molecule; and further, said program having means for altering such visual display. Apparatus useful for expression of such computer program, particularly for the visual display of the computer image of said three dimensional structure of a G-CSF molecule or analog thereof is also therefore here provided, as well as means for preparing said computer program and apparatus.
- the computer program is useful for preparation of G-CSF analogs because one may select specific sites on the G-CSF molecule for alteration and readily ascertain the effect the alteration will have on the overall structure of the G-CSF molecule. Selection of said site for alteration will depend on the desired biological characteristic of the G-CSF analog. If one were to randomly change said G-CSF molecule
- the selection for sites of alteration is no longer a random event, but sites for alteration may be determined rationally.
- identity of the three dimensional structure of G-CSF, including the placement of each constituent down to the atomic level has now yielded information regarding which moieties are necessary to maintain the overall structure of the G-CSF molecule.
- one may test such analog for a desired characteristic.
- the overall structure is presented in Figures 2, 3, and 4, and is described in more detail below. Maintenance of the overall structure may ensure receptor binding, a necessary characteristic for an analog possessing the hematopoietic capabilities of natural G-CSF (if no receptor binding, signal transduction does not result from the presence of the analog). It is contemplated that one class of G-CSF analogs will possess the three dimensional core
- G-CSF analogs are those with a different overall structure which diminishes the ability of a G-CSF analog molecule to bind to a G-CSF receptor, and possesses a diminished ability to
- G-CSF analogs which possess the same hydrophobicity as (non-altered) natural or recombinant G-CSF. More particularly, another class of G-CSF analogs possesses the same hydrophobic moieties within the four helical bundle of its internal core as those hydrophobic moieties possessed by (non-altered) natural or recombinant G-CSF yet have a composition different from said non-altered natural or recombinant G-CSF.
- Another example relates to external loops which are structures which connect the internal core (helices) of the G-CSF molecule. From the three dimensional structure — including information regarding the spatial location of the amino acid residues — one may forecast that certain changes in certain loops will not result in overall conformational changes.
- another class of G-CSF analogs provided herein is that having an altered external loop but possessing the same overall structure as (non-altered) natural or recombinant G-CSF. More particularly, another class of G-CSF analogs provided herein are those having an altered external loop, said loop being selected from the loop present between helices A and B; between helices B and C; between helices C and D;
- said loops preferably the AB loop and/or the CD loop are altered to increase the half life of the molecule by stabilizing said loops.
- stabilization may be by connecting all or a portion of said loop(s) to a portion of an alpha helical bundle found in the core of a G-CSF (or analog) molecule.
- Such connection may be via beta sheet, salt bridge, disulfide bonds, hydrophobic interaction or other connecting means available to those skilled in the art, wherein such connecting means serves to stabilize said external loop or loops.
- one may stabilize the AB or CD loops by connecting the AB loop to one of the helices within the internal region of the molecule.
- the N-terminus also may be altered without change in the overall structure of a G-CSF molecule, because the N-terminus does not effect structural stability of the internal helices, and, although the external loops are preferred for modification, the same general statements apply to the N-terminus.
- such external loops may be the site(s) for chemical modification because in (non- altered) natural or recombinant G-CSF such loops are relatively flexible and tend not to interfere with receptor binding.
- the chemical moiety may be selected from a variety of moieties available for modification of one or more function of a G-CSF molecule.
- an external loop may provide sites for the addition of one or more polymer which serves to increase serum half-life, such as a polyethylene glycol molecule.
- Such polyethylene glycol molecule (s) may be added wherein said loop is altered to include additional lysines which have reactive side groups to which polyethylene glycol moieties are capable of attaching.
- Other classes of chemical moieties may also be attached to one or more external loops,
- G-CSF analogs include those with at least one
- alteration in an external loop wherein said alteration provides for the addition of a chemical moiety such as at least one polyethylene glycol molecule.
- G-CSF analogs include those with at least one alteration in an external loop wherein said alteration decreases the turnover of said analog by proteases.
- Preferred loops for such alterations are the AB loop and the CD loop.
- Another example relates to the relative charges between amino acid residues which are in proximity to each other.
- the G-CSF molecule contains a relatively tightly packed four helical bundle. Some of the faces on the helices face other helices. At the point (such as a residue) where a helix faces another helix, the two amino acid moieties which face each other may have the same charge, and thus tend to repel each other, which lends instability to the overall molecule. This may be eliminated by changing the charge (to an opposite charge or a neutral charge) of one or both of the amino acid moieties so that there is no repelling. Therefore, another class of G-CSF analogs includes those G-CSF analogs having been altered to modify instability due to surface interactions, such as electron charge location.
- the present invention relates to methods for designing G-CSF analogs and related compositions and the products of those methods.
- the end products of the methods may be the G-CSF analogs as defined above or related compositions.
- the examples disclosed herein demonstrate (a) the effects of changes in the constituents (i.e., chemical moieties) of the G-CSF molecule on the G-CSF structure and (b) the effects of changes in structure on
- Another aspect of the present invention is a method for
- Another aspect of the present invention is therefore a computer based method for preparing a G-CSF analog comprising the steps of:
- the present invention provides a method for preparing a G-CSF analog
- the present invention relates to methods of using the present G-CSF analogs and related compositions and methods for the treatment or protection of mammals, either alone or in combination with other hematopoietic factors or drugs in the
- G-CSF analogs will be the goal of enhancing or modifying the
- the present analogs may possess enhanced or modified activities, so, where G-CSF is useful in the treatment of (for example) neutropenia, the present compositions and methods may also be of such use.
- Another example is the modification of G-CSF for the purpose of interacting more effectively when used in combination with other factors particularly in the treatment of hematopoietic disorders.
- One example of such combination use is to use an early-acting hematopoietic factor (i.e., a factor which acts earlier in the hematopoiesis cascade on relatively
- G-CSF hematopoietic factor
- neutrophils neutrophils
- present methods and compositions may be useful in therapy involving such combinations or "cocktails" of hematopoietic factors.
- compositions and methods may also be useful in the treatment of leukopenia, mylogenous leukemia, severe chronic neutropenia, aplastic anemia, glycogen storage disease, mucosistitis, and other bone marrow failure states.
- present compositions and methods may also be useful in the treatment of
- progenitor cells for transplantation may be enhanced by application of the present compositions (proteins or nucleic acids for gene therapy) and
- the present compositions and methods may also be useful in the treatment of infectious diseases, such in the context of wound healing, burn treatment, bacteremia, septicemia, fungal infections, endocarditis, osteopyelitis, infection related to abdominal trauma, infections not responding to antibiotics, pneumonia and the treatment of bacterial inflammation may also benefit from the application of the present compositions and methods.
- the present compositions and methods may be useful in the treatment of leukemia based upon a reported ability to differentiate leukemic cells. Welte et al., PNAS-USA 82: 1526-1530 (1985).
- Other applications include the treatment of individuals with tumors, using the present compositions and methods, optionally in the presence of receptors (such as
- compositions and methods may also be useful to act as intermediaries in the production of other moieties; for example, G-CSF has been reported to influence the production of other hematopoietic factors and this function (if ascertained) may be enhanced or modified via the present compositions and/or methods.
- compositions related to the present G-CSF analogs may be useful to act as an antagonist which prevents the activity of G-CSF or an analog.
- One may obtain a composition with some or all of the activity of non-altered G-CSF or a G-CSF analog, and add one or more chemical moieties to alter one or more properties of such G-CSF or analog. With knowledge of the three dimensional conformation, one may forecast the best geographic location for such chemical
- General objectives in chemical modification may include improved half-life (such as reduced renal, immunological or cellular clearance), altered
- bioactivity such as altered enzymatic properties, dissociated bioactivities or activity in organic
- FIGURE 1 is an illustration of the amino acid sequence of the 174 amino acid species of G-CSF with an additional N-terminal methionine (Seq. ID No.: 1) (Seq. ID No. : 2).
- FIGURE 2 is an topology diagram of the crystalline structure of G-CSF, as well as hGH, pGH,
- GM-CSF GM-CSF, INF-B, IL-2, and IL-4. These illustrations are based on inspection of cited references. The length of secondary structural elements are drawn in proportion to the number of residues. A, B, C, and D helices are labeled according to the scheme used herein for G-CSF.
- FIGURE 3 is an "ribbon diagram" of the three dimensional structure of G-CSF.
- Helix A is amino acid residues 11-39 (numbered according to Figure 1, above)
- helix B is amino acid residues 72-91
- helix C is amino acid residues 100-123
- helix D is amino acid residues 143-173.
- the relatively short 3 10 helix is at amino acid residues 45-48
- the alpha helix is at amino acid residues 48-53.
- Residues 93-95 form almost one turn of a left handed helix.
- FIGURE 4 is a "barrel diagram" of the three dimensional structure of G-CSF. Shown in various shades of gray are the overall cylinders and their orientations for the three dimensional structure of G-CSF. The numbers indicate amino acid residue position according to FIGURE 1 above.
- FIGURE 5 is a list of the coordinates used to generate a computer-aided visual image of the three- dimensional structure of G-CSF.
- the coordinates are set forth below.
- the columns correspond to separate field: (i) Field 1 (from the left hand side) is the atom.
- Field 2 is the assigned atom number
- Field 3 is the atom name (according to the periodic table standard nomenclature, with CB being carbon atom Beta, CG is Carbon atom Gamma, etc.);
- Field 4 is the residue type (according to three letter nomenclature for amino acids as found in, e.g., Stryer, Biochemistry, 3d Ed., W.H. Freeman and Company, N.Y. 1988, inside back cover);
- Fields 5-7 are the x-axis, y-axis and z-axis positions of the atom;
- Field 10 designates the molecule designation.
- Three molecules designated a, b, and c) of G-CSF crystallized together as a unit.
- a, b, or c indicates which coordinates are from which molecule.
- the number after the letter (1, 2, or 3) indicates the assigned amino acid residue
- FIGURE 6 is a schematic representation of the strategy involved in refining the crystallization matrix for parameters involved in crystallization.
- the crystallization matrix corresponds to the final
- concentrations are produced by pipetting the appropriate volume of stock solutions into the wells of the microtiter plate. To design the matrix, the
- concentration of the component can be pipetted along either the rows (e.g., A1-A6, B1-B6, C1-C6 or D1-D6) or along the entire tray (A1-D6).
- the former method is useful for checking reproducibility of crystal growth of a single component along a limited number of wells, whereas the later method is more useful in initial screening.
- the results of several stages of refinement of the crystallization matrix are illustrated by a representation of three plates. The increase in shading in the wells indicates a positive crystallization result which, in the final stages, would be X-ray quality crystals but in the initial stages could be oil droplets, granular
- Part A represents an initial screen of one parameter in which the range of concentration between the first well (A1) and last well (D6) is large and the concentration increase between wells is
- Part B represents that in later stages of the crystallization matrix refinement of the concentration spread between Al and D6 would be reduced which would result in more crystals formed per plate.
- Part C indicates a final stage of matrix refinement in which quality crystals are found in most wells of the plate.
- the present invention grows out of the discovery of the three dimensional structure of G-CSF. This three dimensional structure has been expressed via computer program for stereoscopic viewing. By viewing this stereoscopically, structure-function relationships identified and G-CSF analogs have been designed and made.
- the Overall Three Dimensional Structure of G-CSF has been expressed via computer program for stereoscopic viewing. By viewing this stereoscopically, structure-function relationships identified and G-CSF analogs have been designed and made.
- the G-CSF used to ascertain the structure was a non-glycosylated 174 amino acid species having an extra N-terminal methionine residue incident to
- FIGURE 1 The DNA and amino acid sequence of this G-CSF are illustrated in FIGURE 1.
- the three dimensional structure of G-CSF is predominantly helical, with 103 of the 175 residues forming a 4-alpha-helical bundle.
- the only other secondary structure is found in the loop between the first two long helices where a 4 residue 3 10 helix is immediately followed by a 6 residue alpha helix.
- FIGURE 2 the overall structure has been compared with the structure reported for other proteins: growth hormone (Abdel-Meguid et al., PNAS-USA 84: 6434 (1987) and Vos et al., Science 255: 305-312 (1992)), granulocyte macrophage colony stimulating factor
- This Example describes the preparation of crystalline G-CSF, the visualization of the three dimensional structure of recombinant human G-CSF via computer-generated image, the preparation of analogs, using site-directed mutagenesis or nucleic acid
- the size, reproducibility and quality of the crystals was improved by a seeding method in which the number of "nucleation initiating units" was estimated by serial dilution of a seeding solution. These methods yielded reproducible growth of 2.0 mm r-hu-G-CSF
- crystals diffracting to at least about 2.5 Angstroms, preferably having at least portions diffracting to below 2 Angstroms, and more preferably, approximately 1 Angstrom were produced in a few days.
- the method for crystallization which may be used with any protein one desires to crystallize, comprises the steps of:
- precrystalline forms are so produced, increasing the protein starting concentration of said aqueous aliquots of protein;
- step (c) after said salt or said precipitant concentration is selected, repeating step (a) with said previously unselected solution in the presence of said selected concentration;
- step (d) repeating step (b) and step (a) until a crystal of desired quality is obtained.
- the above method may optionally be automated, which provides vast savings in time and labor.
- Preferred protein starting concentrations are between 10mg/ml and 20mg/ml, however this starting concentration will vary with the protein (the G-CSF below was analyzed using 33mg/ml).
- a preferred range of salt solution to begin analysis with is (NaCl) of 0-2.5M.
- a preferred precipitant is polyethylene glycol 8000, however, other precipitants include organic solvents (such as ethanol), polyethylene glycol molecules having a molecular weight in the range of 500-20,000, and other precipitants known to those skilled in the art.
- the preferred pH range is pH 4.5 , 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0.
- Precrystallization forms include oils,
- the preferred time for waiting to see a crystalline structure is 48 hours, although weekly observation is also preferred, and generally, after about one month, a different protein concentration is utilized (generally the protein
- protein with a concentration between 10 mg/ml and 20 mg/ml was combined with a range of NaCl solutions from 0-2.5 M, and each such
- Drops and reservoir solutions were prepared by an Accuflex pipetting system (ICN Pharmaceuticals, Costa Mesa, CA) which is controlled by a personal computer that sends ASCII codes through a standard serial
- the pipetter samples six different solutions by means of a rotating valve and pipettes these
- the vertical component of the system manipulates a syringe that is capable both of dispensing and retrieving liquid.
- the software provided with the Accuflex was based on the SAGS method as proposed by Cox and Weber, J.Appl. Crystallogr. 20 : 366-373 (1987). This method involves the systematic variation of two major
- the hardware changes allowed the use of two different micro-titer trays, one used for handing drop and one used for sitting drop experiments, and a Plexiglas tray which held 24 additional buffer, salt and precipitant solutions. These additional solutions expanded the grid of crystallizing conditions that could be surveyed.
- the pipetting software was written in two subroutines; one subroutine allows the crystallographer to design a matrix of crystallization solutions based on the
- concentration matrices can be generated by either of two programs.
- the first program (MRF, available from Amgen, Inc., Thousand Oaks, CA) refers to a list of stock solution concentrations supplied by the crystallographer and calculates the required volume to be pipette to achieve the designated concentration.
- the second method which is preferred, incorporates a spread sheet program (Lotus ) which can be used to make more
- concentration matrix created by either program is interpreted by the control program (SUX, a modification of the program found in the Accuflex pipetter originally and available from Amgen, Inc., Thousand Oaks, CA) and the wells are filled accordingly.
- SUX a modification of the program found in the Accuflex pipetter originally and available from Amgen, Inc., Thousand Oaks, CA
- Combinations of calcium and phosphate which immediately precipitated were eliminated, leaving 70 distinct combinations of precipitants, salts and buffers. These combinations were prepared using the automated pipetter and incubated for 1 week. The mixtures were inspected and solutions which formed precipitants were prepared again with lower concentrations of their components. This was repeated until all wells were clear of
- crystallization result results were scored as follows: crystals, birefringement precipitate, granular precipitate, oil droplets and amorphous mass. If the concentration of a crystallization parameter did not produce at least a precipitant, the concentration of that parameter was increased until a precipitant formed. After each tray was produced, it was left undisturbed for at least two days and then inspected for crystal growth. After this initial screening, the trays were then inspected on a weekly basis.
- the presently provided method for seeding crystals establishes the number of nucleation initiation units in each individual well used (here, after the optimum conditions for growing crystals had been
- the method here is advantageous in that the number of "seeds" affects the quality of the
- the present seeding here also provides advantages in that with seeding, G-CSF crystal grows in a period of about 3 days, whereas without seeding, the growth takes approximately three weeks.
- Crystallization conditions were followed as described above except that a pipette tip employed in previously had been reused. Presumably, the crystal showering effect was caused by small nucleation units which had formed in the used tip and which provided sites of nucleation for the crystals. Addition of a small amount (0.5 ul) of the drops containing the crystal showers to a new drop under standard production growth conditions resulted in a shower of crystals overnight. This method was used to produce several trays of drops containing crystal showers which we termed "seed stock".
- the number of nucleation initiation units (NIU) contained within the "seed stock” drops was estimated to attempt to improve the reproducibility and quality of the r-hu-GCSF crystals.
- NIU nucleation initiation units
- the solution in the well was mixed and 3 ul was then transferred to the next well along the row of the microtiter plate.
- Each row of the microtiter plate was similarly prepared and the tray was sealed with plastic tape.
- Overnight, small crystals formed in the bottom of the wells of the microtiter plate and the number of crystals in the wells were correlated to the dilution of the original "seed stock".
- the "seed stock" drop was appropriately diluted into fresh CGS and then an aliquot of this solution containing the NIU was
- Crystals suitable for X-ray analysis were obtained by vapor-diffusion equilibrium using hanging drops.
- 7 ul of the protein solution at 33 mg/ml (as prepared above) was mixed with an equal volume of the well solution, placed on
- crystallization system are as follows. A PC-DOS computer system was used to design a matrix of
- This file contains the information required by the SUX program to pipette the appropriate volume of the stock solutions to obtain the concentrations described in the matrices.
- the SUX program information was passed through a serial I/O port and used to dictate to the Accuflex pipetting system the position of the valve relative to the stock solutions, the amount of solution to be retrieved, and then pipetted into the wells of the microtiter plates and the X-Y position of each well (the column/row of each well). Addition information was transmitted to the pipetter which included the Z position (height) of the syringe during filling as well as the position of a drain where the system pauses to purge the syringe between fillings of different
- the 24 well microtiter plate (either Linbro or Cryschem) and cover slip holder was placed on a plate which was moved in the X-Y plane. Movement of the plate allowed the pipetter to position the syringe to pipette into the wells. It also positioned the coverslips and vials and extract solutions from these sources. Prior the pipetting, the Linbro microtiter plates had a thin film of grease applied around the edges of the wells. After the crystallization solutions were prepared in the wells and before they were transferred to the cover slips, the microtiter plate was removed from the pipetting system, and solutions were allowed to mix on a table top shaker for ten minutes. After mixing, the well solution was either transferred to the cover slips (in the case of the hanging drop protocol) or
- crystal growth was performed utilizing a "production" method.
- the crystallization solution which contained 100 mM Mes pH 5.8, 380 mM MgCl2, 220 mM LiSO4, and 8% PEG 8K was made in 1 liter quantities. Utilizing an Eppindorf syringe pipetter, 1 ml aliquots of this solution were pipetted into each of the wells of the Linbro plate. A solution containing 50% of this solution and 50% G-CSF (33 mg/ml) was mixed and pipetted onto the siliconized cover slips. Typical volumes of these drops were between 50 and 100 ul and because of the large size of these drops, great care was taken in flipping the coverslips and suspending the drops over the wells.
- r-hu-G-CSF As an effective recombinant human therapeutic, r-hu-G-CSF has been produced in large quantities and gram levels have been made available for structural analysis.
- the crystallization methods provided herein are likely to find other applications as other proteins of interest become available. This method can be applied to any crystallographic project which has large quantities of protein (approximately >200 mg).
- the present materials and methods may be modified and equivalent materials and methods may be available for crystallization of other proteins.
- Figures herein are useful for visualizing the three dimensional structure of G-CSF, a computer program which allows for stereoscopic viewing of the molecule is contemplated as preferred.
- the computer programs contemplated herein also allow one to change perspective of the viewing angle of the molecule, for example by rotating the molecule.
- the contemplated programs also respond to changes so that one may, for example, delete, add, or substitute one or more images of atoms, including entire amino acid residues, or add chemical moieties to
- Other computer based systems may be used; the elements being: (a) a means for entering information, such as orthogonal coordinates or other numerically assigned coordinates of the three dimensional structure of G-CSF; (b) a means for expressing such coordinates, such as visual means so that one may view the three dimensional structure and correlate such three
- composition of the G-CSF molecule such as the amino acid composition
- the coordinates for the preferred computer program used are presented in FIGURE 5.
- the preferred computer program is Insight II, version 4, available from Biosym in San Diego, CA.
- the preferred computer system for display is Silicon Graphics 320 VGX (San Diego, CA).
- eyewear Crystal Eyes, Silicon Graphics
- stereoscopic viewing one may wear eyewear (Crystal Eyes, Silicon Graphics) which allows one to visualize the G-CSF molecule in three dimensions stereoscopically, so one may turn the molecule and envision molecular design.
- the present invention provides a method of designing or preparing a G-CSF analog with the aid of a computer comprising:
- the alteration may be selected based on the desired structural characteristics of the end-product G-CSF analog, and considerations for such design are described in more detail below. Such considerations include the location and compositions of hydrophobic amino acid residues, particularly residues internal to the helical structures of a G-CSF molecule which residues, when altered, alter the overall structure of the internal core of the molecule and may prevent receptor binding; the location and compositions of external loop
- FIGURES 2-4 illustrate the overall three dimensional conformation in different ways.
- topological diagram the ribbon diagram, and the barrel diagram all illustrate aspects of the conformation of G-CSF.
- FIGURE 2 illustrates a comparison between G-CSF and other molecules. There is a similarity of architecture, although these growth factors differ in the local conformations of their loops and bundle geometries. The up-up-down-down topology with two long crossover connections is conserved, however, among all six of these molecules, despite the dissimilarity in amino acid sequence.
- FIGURE 3 illustrates in more detail the secondary structure of recombinant human G-CSF. This ribbon diagram illustrates the handedness of the helices and their positions relative to each other.
- FIGURE 4 illustrates in a different way the conformation of recombinant human G-CSF.
- This "barrel" diagram illustrates the overall architecture of
- This example relates to the preparation of G-CSF analogs using site directed mutagenesis techniques involving the single stranded bacteriophage M13, according to methods published in PCT Application No. WO 85/00817 (Souza et al., published February 28, 1985, herein incorporated by reference). This method
- the original G-CSF nucleic acid sequence used is presented in FIGURE 1, and the oligonucleotides containing the mutagenized nucleic acid(s) are presented in Table 2.
- Abbreviations used herein for amino acid residues and nucleotides are conventional, see Stryer, Biochemistry, 3d Ed., W.H. Freeman and Company, N.Y., N.Y. 1988, inside back cover.
- the original G-CSF nucleic acid sequence was first placed into vector M13mp21. The DNA from single stranded phage M13mp21 containing the original G-CSF sequence was then isolated, and resuspended in water.
- Plaques were screened by lifting the plaques with nitrocellulose filters, and then
- the filters were washed at 0-3°C below the melt temperature of the oligo (2°C for A-T, 4°C for G-C) which selectively left autoradiography signals corresponding to plaques with phage containing the mutated sequence. Positive clones were confirmed by sequencing.
- oligonucleotides used for each G-CSF analog prepared via the M13 mutagenesis method.
- the nomenclature indicates the residue and the position of the original amino acid (e.g., Lysine at position 17), and the residue and position of the substituted amino acid (e.g., arginine 17).
- oligonucleotide sequences used for M13-based mutagenesis are next indicated; these oligonucleotides were manufactured synthetically, although the method of preparation is not critical, any nucleic acid synthesis method and/or equipment may be used. The length of the oligo is also indicated. As indicated above, these oligos were allowed to contact the single stranded phage vector, and then single nucleotides were added to complete the G-CSF analog nucleic acid sequence.
- This analog came about during the preparation of G-CSF analog Glu 20 ->Ala 20 .
- the Glu 20 ->Ala 20 As several clones were being sequenced to identify the Glu 20 ->Ala 20 analog, the Glu 20 ->Ala 20 ;
- This example relates to methods for producing G-CSF analogs using a DNA amplification technique.
- DNA encoding each analog was amplified in two separate pieces, combined, and then the total sequence itself amplified.
- internal primers were used to incorporate the change, and generate the two separate amplified pieces.
- a 5' flanking primer (complementary to a sequence of the plasmid upstream from the G-CSF original DNA) was used at one end of the region to be amplified, and an internal primer, capable of hybridizing to the original DNA but incorporating the desired change, was used for priming the other end.
- the resulting amplified region stretched from the 5' flanking primer through the internal primer.
- the above process may be modified to incorporate the change into the internal primer, or the process may be repeated using a different internal primer.
- the gene amplification process may be used with other methods for creating changes in nucleic acid sequence, such as the phage based mutagenesis technique as described above. Examples of process for preparing analogs with more than one change are described below.
- the template DNA used was the sequence as in FIGURE 1 plus certain flanking regions (from a plasmid containing the G-CSF coding region). These flanking regions were used as the 5' and 3' flanking primers and are set forth below.
- the amplification reactions were performed in 40 ul volumes containing 10 mM Tris-HCl, 1.5 mM MgCl 2 , 50 mM KCl, 0.1 mg/ml gelatin, pH 8.3 at 20°C.
- the 40 ul reactions also contained 0.1mM of each dNTP, 10 pmoles of each primer, and 1 ng of template DNA.
- amplification was repeated for 15 cycles. Each cycle consisted of 0.5 minutes at 94°C, 0.5 minutes at 50°C, and 0.75 minutes at 72°C. Flanking primers were 20 nucleotides in length and internal primers were 20 to 25 nucleotides in length. This resulted in multiple copies of double stranded DNA encoding either the front portion or the back portion of the desired G-CSF analog.
- the completed, amplified analog DNA sequence was cleaved with Xbal and Xhol restriction endonuclease to produce cohesive ends for insertion into a vector.
- the cleaved DNA was placed into a plasmid vector, and that vector was used to transform E. coli.
- G-CSF analog Gln 12 , 21 ->Glu 12 , 21 two separate DNA amplifications were conducted to create the two DNA mutations.
- the template DNA used was the sequence as in FIGURE 1 plus certain flanking regions (from a plasmid containing the G-CSF coding region). The precise sequences are listed below.
- Each of the two DNA amplification reactions were carried out using a Perkin Elmer/Cetus DNA Thermal Cycler.
- the 40 ul reaction mix consisted of 1X PCR Buffer (Cetus), 0.2 mM each of the 4 dXTPs (Cetus), 50 pmoles of each primer oligonucleotide, 2 ng of G-CSF template DNA (on a plasmid vector), and 1 unit of Taq polymerase (Cetus).
- the amplification process was carried out for 30 cycles. Each cycle consisted of lminute at 94°C, 2 minutes at 50°C, and 3 minutes at 72°C.
- DNA amplification "A” used the oligonucleotides: 5' CCACTGGCGGTGATACTGAGC 3' (Seq. ID 63) and
- DNA amplification "B” used the oligonucleotides:
- the "A" and “B” fragments were ligated together with a 4.8 kilo-base pair Xbal to BsmI DNA plasmid vector fragment .
- the ligation mix consisted of equal molar DNA restriction fragments, ligation buffer (25 mM Tris-HCl pH 7.8, 10 mM MgCl 2 , 2 mM DTT, 0.5 mM rATP, and 100 ug/ml BSA) and T4 DNA ligase and was incubated overnight at 14°C.
- the ligated DNA was then transformed into E. coli FM5 cells by electroporation using a Bio Rad Gene Pulsar apparatus (BioRad, Richmond, CA).
- a clone was isolated and the plasmid construct verified to contain the two mutations by DNA sequencing. This 'intermediate' vector also contained a deletion of a 193 base pair BsmI to BsmI DNA fragment. The final plasmid vector was constructed by ligation and
- any combination of mutagenesis techniques may be used to generate a G-CSF analog nucleic acid (and expression product) having one or more than one alteration.
- the G-CSF analog DNAs were then placed into a plasmid vector and used to transform E. coli strain FM5 (ATCC#53911).
- the present G-CSF analog DNAs contained on plasmids and in bacterial host cells are available from the American Type Culture Collection, Rockville, MD, and the accession designations are indicated below.
- prokaryotic or eukaryotic host cells may also be used, such as other bacterial cells, strains or species, mammalian cells in culture (COS, CHO or other types) insect cells or multicellular organs or
- G-CSF analogs and related compositions may also be prepared synthetically, as, for example, by solid phase peptide synthesis methds, or other chemical manufacturing techniques. Other cloning and expression systems will be apparent to those skilled in the art.
- Cells were harvested by centrifugation (10,000 x G, 20 minutes, 4°C). The pellet (usually 5 grams) was resuspended in 30 ml of ImM DTT and passed three times through a French press cell at 10,000 psi. The broken cell suspension was centrifuged at 10,000g for 30 minutes, the supernatant removed, and the pellet
- the analogs were eluted with 20mM Tris /NaCl (between 35mM to 100mM depending on the analog, as indicated below), pH 7.7.
- the eluent from the DEAE column was adjusted to a pH of 5.4, with 50% acetic acid and diluted as necessary (to obtain the proper conductivity) with 5mM sodium acetate pH 5.4.
- the solution was then loaded onto a CM-sepharose column equilibrated in 20 mM sodium acetate, pH 5.4.
- the column was then washed with 20mM NaAc, pH 5.4 until the absorbance at 280 nm was approximately zero.
- the G-CSF analog was then eluted with sodium acetate/NaCl in concentrations as described below in Table 4.
- the DEAE column eluents for those analogs not applied to the CM-sepharose column were dialyzed directly into 10mM NaAc, ph 4.0 buffer.
- the purified G-CSF analogs were then suitably isolated for in vitro analysis.
- the salt concentrations used for eluting the analogs varied, as noted above. Below, the salt concentrations for the DEAE cellulose column and for the CM-sepharose column are listed:
- the analogs were subject to assays for biological activity. Tritiated thymidine assays were conducted to ascertain the degree of cell division. Other biological assays, however, may be used to ascertain the desired activity. Biological assays such as assaying for the ability to induce terminal differentiation in mouse WEHI-3B (D+) leukemic cell line, also provides indication of G-CSF activity. See Nicola, et al., Blood 54: 614-27 (1979). Other in vitro assays may be used to ascertain biological activity. See Nicola, Annu. Rev. Biochem. 58: 45-77 (1989).
- test for biological activity should provide analysis for the desired result, such as increase or decrease in biological activity (as compared to non-altered G-CSF), different biological activity (as compared to non-altered G-CSF), receptor affinity analysis, or serum half-life analysis.
- analysis for the desired result such as increase or decrease in biological activity (as compared to non-altered G-CSF), different biological activity (as compared to non-altered G-CSF), receptor affinity analysis, or serum half-life analysis.
- the 3 H-thymidine assay was performed using standard methods. Bone marrow was obtained from
- Relative HPLC peak position is the position of the analog G-CSF relative to the control standard (non- altered G-CSF) peak.
- the "+" or “-” symbols indicate whether the analog HPLC peak was in advance of or followed the control standard peak (in minutes). Not all of the variants had been analyzed for relative HPLC peak, and only those so analyzed are included below. Also presented are the American Type Culture Collection designations for E. coli host cells containing the nucleic acids coding for the present analogs, as prepared above.
- N/A indicates data which are not available.
- the first step used to design the present analogs was to determine what moieties are necessary for structural integrity of the G-CSF molecule. This was done at the amino acid residue level, although the atomic level is also available for analysis.
- Modification of the residues necessary for structural integrity results in change in the overall structure of the G-CSF molecule. This may or may not be desirable, depending on the analog one wishes to produce.
- the working examples here were designed to maintain the overall structural integrity of the G-CSF molecule, for the purpose of maintain G-CSF receptor binding of the analog to the G-CSF receptor (as used in this section below, the "G-CSF receptor” refers to the natural G-CSF receptor, found on hematopoietic cells). It was assumed, and confirmed by the studies presented here, that G-CSF receptor binding is a necessary step for at least one biological activity, as determined by the above biological assays.
- G-CSF (here, recombinant human met-G-CSF) is an antiparallel 4-alpha helical bundle with a left-handed twist, and with overall dimensions of 45 ⁇ x 30 ⁇ x 24 ⁇ .
- the four helices within the bundle are referred to as helices A, B, C and D, and their connecting loops are known as the AB, BC and CD loops.
- the helix crossing angles range from -167.5° to -159.4°.
- Helices A, B, and C are straight, whereas helix D contains two kinds of
- G-CSF molecules is a bundle of four helices, connected in series by external loops. This structural information was then correlated with known functional information. It was known that residues (including methionine at position 1) 47, 23, 24, 20, 21, 44, 53, 113, 110, 28 and 114 may be modified, and the effect on biological activity would be substantial.
- Lys 24 are found on the hydrophilic face of the A helix (residues 20-37). Substitution of the residues with the non-charged alanine residue at positions 20 and 23 resulted in similar HPLC retention times, indicating similarity in structure. Alteration of these sites altered the biological activity (as indicated by the present assays). Substitution at Lys 24 altered
- the second site at which alteration lowered biological activity involves the AB helix. Changing glutamine at position 47 to alanine (analog no. 19, above) reduced biological activity (in the thymidine uptake assay) to zero.
- the 7AB helix is predominantly hydrophobic, except at the amino and carboxy termini; it contains one turn of a 3 10 helix.
- the hydrophobic internal residues are essential for structural integrity.
- the internal hydrophobic residues are (with methionine being position 1) Phe 14, Cys 18, Val 22, Ile 25, Ile 32 and Leu 36.
- the hydrophobic internal residues are essential for structural integrity.
- the internal hydrophobic residues are (with methionine being position 1 as in FIGURE 1) Phe 14, Cys 18, Val 22, Ile 25, Ile 32 and Leu 36.
- hydrophobic residues are: helix B, Ala 72, Leu 76, Leu 79, Leu 83, Tyr 86, Leu 90 Leu 93; helix C, Leu 104, Leu 107, Val 111, Ala 114, Ile 118, Met 122; and helix D, Val 154, Val 158, Phe 161, Val 164, Val 168, Leu 172.
- Preferred loops for analog prepration are the AB loop and the CD loop.
- the loops are relatively flexible structures as compared to the helices.
- the loops may contribute to the proteolysis of the molecule.
- G-CSF is relatively fast acting in vivo as the purpose the molecule serves is to generate a response to a biological challenge, i.e., selectively stimulate neutrophils.
- the G-CSF turnover rate is also relatively fast.
- the flexibility of the loops may provide a "handle" for proteases to attach to the molecule to inactivate the molecule. Modification of the loops to prevent protease degradation, yet have (via retention of the overall structure of non-modified
- G-CSF molecule may also be common to the other molecules with known similar overall structures, as presented in Figure 2. Alteration of the external loop of, for example hGH, Interferon B, IL-2, GM-CSF and IL-4 may provide the least change to the overall structure.
- the external loops on the GM-CSF molecule are not as flexible as those found on the G-CSF molecule, and this may indicate a longer serum life, consistent with the broader biological activity of GM-CSF.
- the external loops of GM-CSF may be modified by releasing the external loops from the beta-sheet structure, which may make the loops more flexible (similar to those
- G-CSF G-CSF
- Alteration of these external loops may be effected by stabilizing the loops by connection to one or more of the internal helices.
- Connecting means are known to those in the art, such as the formation of a beta sheet, salt bridge, disulfide bonding or
- the external loops preferably the AB loop (amino acids 58-72 of r-hu-met G-CSF) or the CD loop (amino acids 119 to 145 of
- Analog 23 contains a substitution of the charged asparagine residue at position 28 for the neutrally-charged alanine residue in that position, and such substitution resulted in a 50% increase in the biological activity (as measured by the disclosed thymidine uptake assays).
- the asparagine residue at position 28 has a surface interaction with the
- the domains required for G-CSF receptor binding were also determined based on the above analogs prepared and the G-CSF structure.
- the G-CSF receptor binding domain is located at residues (with methionine being position 1) 11-57 (between the A and AB helix) and 100-118 (between the B and C helices).
- Site A is located on a helix which is constrained by salt bridge contacts between two other members of the helical bundle.
- Site B is located on a relatively more flexible helix, AB.
- the AB helix is potentially more sensitive to local pH changes because of the type and position of the residues at the carboxy and amino termini. The functional importance of this flexible helix may be important in a conformationally induced fit when binding to the G-CSF receptor.
- the extended portion of the D helix is also indicated to be a G-CSF receptor binding domain, as ascertained by direct mutational and indirect comparative protein structure analysis. Deletion of the carboxy terminal end of r-hu-met-G-CSF reduces activity as it does for hGH, see, Cunningham and Wells, Science 244: 1081-1084 (1989). Cytokines which have similar structures, such as IL-6 and GM-CSF with predicted similar topology also center their biological activity along the carboxy end of the D helix, see Bazan,
- the G-CSF receptor binding determinates identified for G-CSF are located in the same relative positions as those identified for hGH.
- the G-CSF receptor binding site located in the connecting region between helix A and B on the AB helix (Site A) is similar in position to that reported for a small piece of helix (residues 38-47) of hGH.
- a single point mutation in the AB helix of G-CSF significantly reduces biological activity (as ascertained in the present assays), indicating the role in a G-CSF receptor-ligand interface. Binding of the G-CSF receptor may
- the first helix of the bundle donates residues to both of the binding sites required to dimerize the hGH receptor
- Mutational analysis of the corresponding helix of G-CSF (helix A) has identified three residues which are required for biological activity. Of these three residues, Glu 20 and Arg 24 lie on one face of the helical bundle towards helix C, whereas the side chain of Arg 23 (in two of the three molecules in the asymmetric unit) points to the face of the bundle towards helix D.
- the position of side chains of these biologically important residues indicates that similar to hGH, G-CSF may have a second G-CSF receptor binding site along the interface between helix A and helix C.
- the amino terminus of G-CSF has a limited biological role as deletion of the first 11 residues has little effect on the biological activity.
- G-CSF has a topological similarity with other cytokines.
- a correlation of the structure with previous biochemical studies, mutational analysis and direct comparison of specific, residues of the hGH receptor complex indicates that G-CSF has two receptor binding sites.
- Site A lies along the interface of the A and D helices and includes residues in the small AB helix.
- Site B also includes residues in the A helix but lies along the interface between helices A and C.
- the conservation of structure and relative positions of biologically important residues between G-CSF and hGH is one indication of a common method of signal transduction in that the receptor is bound in two places. It is therefore found that G-CSF analogs possessing altered G-CSF receptor binding domains may be prepared by alteration at either of the G-CSF receptor binding sites (residues 20-57 and 145-175) .
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA
- MOLECULE TYPE DNA
- SEQUENCE DESCRIPTION SEQ ID NO:42:
- MOLECULE TYPE DNA
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU60957/94A AU697451B2 (en) | 1993-01-28 | 1994-01-25 | G-CSF analog compositions and methods |
NZ261765A NZ261765A (en) | 1993-01-28 | 1994-01-25 | G-csf and their preparation with the aid of computer imaging |
JP6517294A JPH08506018A (en) | 1993-01-28 | 1994-01-25 | G-CSF analog compositions and methods |
NO952974A NO952974L (en) | 1993-01-28 | 1995-07-27 | G-CSF analog preparations and methods |
FI953593A FI120769B (en) | 1993-01-28 | 1995-07-27 | G-CSF analog compositions and methods |
NO20031497A NO20031497D0 (en) | 1993-01-28 | 2003-04-02 | Computer-based apparatus for displaying the three-dimensional structure of a molecule and process for crystallizing a protein |
FI20090384A FI123078B (en) | 1993-01-28 | 2009-10-21 | Process for producing a modified G-CSF polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/010,099 | 1993-01-28 | ||
US08/010,099 US5581476A (en) | 1993-01-28 | 1993-01-28 | Computer-based methods and articles of manufacture for preparing G-CSF analogs |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1994017185A1 true WO1994017185A1 (en) | 1994-08-04 |
Family
ID=21743861
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1994/000913 WO1994017185A1 (en) | 1993-01-28 | 1994-01-25 | G-csf analog compositions and methods |
Country Status (22)
Country | Link |
---|---|
US (6) | US5581476A (en) |
EP (8) | EP0890640A3 (en) |
JP (7) | JPH08506018A (en) |
KR (2) | KR100375274B1 (en) |
CN (3) | CN1118572C (en) |
AT (2) | ATE553199T1 (en) |
AU (2) | AU697451B2 (en) |
CA (4) | CA2381489C (en) |
DE (1) | DE69425516T2 (en) |
DK (3) | DK2345724T3 (en) |
ES (3) | ES2422269T3 (en) |
FI (2) | FI120769B (en) |
GR (1) | GR3034745T3 (en) |
HK (2) | HK1009288A1 (en) |
IL (6) | IL145994A (en) |
LU (1) | LU92265I2 (en) |
LV (1) | LV12642B (en) |
NO (3) | NO952974L (en) |
NZ (5) | NZ314960A (en) |
PT (3) | PT612846E (en) |
WO (1) | WO1994017185A1 (en) |
ZA (1) | ZA94568B (en) |
Cited By (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997041211A1 (en) * | 1996-04-30 | 1997-11-06 | Vertex Pharmaceuticals Incorporated | Molecules comprising an impdh-like binding pocket and encoded data storage medium capable of graphically displaying them |
US5824784A (en) * | 1994-10-12 | 1998-10-20 | Amgen Inc. | N-terminally chemically modified protein compositions and methods |
WO2000040728A1 (en) * | 1999-01-06 | 2000-07-13 | Xencor, Inc. | Nucleic acids and proteins corresponding to mutants of g-csf with granulopoietic activity |
WO2000052057A1 (en) * | 1999-03-04 | 2000-09-08 | Biomolecular Engineering Research Institute | Crystals and structural coordinate of protein complex and utilisation of the structural coordinate |
US6204247B1 (en) | 1997-08-15 | 2001-03-20 | Amgen Inc. | Chemical modification of proteins to improve biocompatibility and bioactivity |
US6245740B1 (en) | 1998-12-23 | 2001-06-12 | Amgen Inc. | Polyol:oil suspensions for the sustained release of proteins |
WO2002020751A2 (en) * | 2000-09-07 | 2002-03-14 | Eli Lilly And Company | Hyperglycosylated polypeptides |
WO2002036626A1 (en) * | 2000-11-02 | 2002-05-10 | Maxygen Aps | Single-chain multimeric polypeptides |
US6420339B1 (en) | 1998-10-14 | 2002-07-16 | Amgen Inc. | Site-directed dual pegylation of proteins for improved bioactivity and biocompatibility |
US6541033B1 (en) | 1998-06-30 | 2003-04-01 | Amgen Inc. | Thermosensitive biodegradable hydrogels for sustained delivery of leptin |
WO2003086444A1 (en) | 2002-04-04 | 2003-10-23 | Amgen Inc. | Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins |
US7208473B2 (en) | 1999-01-06 | 2007-04-24 | Xencor, Inc. | Nucleic acids and protein variants of hG-CSF with granulopoietic activity |
EP2286791A1 (en) | 2003-12-30 | 2011-02-23 | Durect Corporation | Polymeric implants, preferably containing a mixture of PEG and PLG, for controlled release of active agents, preferably a GnRH |
US8106098B2 (en) | 1999-08-09 | 2012-01-31 | The General Hospital Corporation | Protein conjugates with a water-soluble biocompatible, biodegradable polymer |
WO2015047062A1 (en) | 2013-09-27 | 2015-04-02 | Uab Profarma | Fused proteins of granulocyte colony-stimulating factor with other partners of growth factor, preferably with stem cell factor, and method of preparation thereof |
WO2021068074A1 (en) * | 2019-10-08 | 2021-04-15 | Zymeworks Inc. | Modified extracellular domain of granulocyte colony-stimulating factor receptor (g-csfr) and cytokines binding same |
WO2021123033A1 (en) | 2019-12-17 | 2021-06-24 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Novel g-csf mimics and their applications |
US11535659B2 (en) | 2010-09-28 | 2022-12-27 | Amryt Pharmaceuticals Inc. | Engineered polypeptides having enhanced duration of action |
Families Citing this family (122)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2006596C (en) * | 1988-12-22 | 2000-09-05 | Rika Ishikawa | Chemically-modified g-csf |
US20020177688A1 (en) * | 1988-12-22 | 2002-11-28 | Kirin-Amgen, Inc., | Chemically-modified G-CSF |
US5581476A (en) * | 1993-01-28 | 1996-12-03 | Amgen Inc. | Computer-based methods and articles of manufacture for preparing G-CSF analogs |
US20030053982A1 (en) * | 1994-09-26 | 2003-03-20 | Kinstler Olaf B. | N-terminally chemically modified protein compositions and methods |
JP3708151B2 (en) * | 1994-12-15 | 2005-10-19 | 協和醗酵工業株式会社 | Quantification of PEGylated human granulocyte colony-stimulating factor |
DE69737809T2 (en) * | 1996-01-22 | 2008-02-21 | Curis, Inc., Cambridge | METHODS OF PREPARING OP-1 MORPHOGEN ANALOGUE |
US20030185792A1 (en) * | 1996-01-22 | 2003-10-02 | Curis, Inc. | Morphogen analogs of bone morphogenic proteins |
US5835382A (en) | 1996-04-26 | 1998-11-10 | The Scripps Research Institute | Small molecule mimetics of erythropoietin |
US20080076706A1 (en) | 1997-07-14 | 2008-03-27 | Bolder Biotechnology, Inc. | Derivatives of Growth Hormone and Related Proteins, and Methods of Use Thereof |
EP1012184B1 (en) * | 1997-07-14 | 2007-10-10 | Bolder Biotechnology, Inc. | Derivatives of growth hormone and related proteins |
US6753165B1 (en) | 1999-01-14 | 2004-06-22 | Bolder Biotechnology, Inc. | Methods for making proteins containing free cysteine residues |
CN1061992C (en) * | 1997-11-19 | 2001-02-14 | 蒋永平 | Colony stimulating factor for recombination of human granulocytes and medicinal composition thereof |
TWI242563B (en) * | 1998-04-30 | 2005-11-01 | Tanox Inc | Monoclonal agonist antibodies which specifically bind to or interact with human G-CSF receptor |
CA2326755A1 (en) * | 1998-04-30 | 1999-11-04 | Tanox, Inc. | G-csf receptor agonist antibodies and screening method therefor |
US6979442B1 (en) | 1998-08-17 | 2005-12-27 | Pfizer Inc. | Stabilized protein compositions |
US6451346B1 (en) * | 1998-12-23 | 2002-09-17 | Amgen Inc | Biodegradable pH/thermosensitive hydrogels for sustained delivery of biologically active agents |
US8288126B2 (en) | 1999-01-14 | 2012-10-16 | Bolder Biotechnology, Inc. | Methods for making proteins containing free cysteine residues |
DE60004172T2 (en) * | 1999-01-29 | 2004-04-22 | F. Hoffmann-La Roche Ag | GCSF CONJUGATE |
US6500418B1 (en) * | 1999-02-12 | 2002-12-31 | The Washington University | Stimulating neutrophil function to treat inflammatory bowel disease |
US7214540B2 (en) | 1999-04-06 | 2007-05-08 | Uab Research Foundation | Method for screening crystallization conditions in solution crystal growth |
US7247490B2 (en) | 1999-04-06 | 2007-07-24 | Uab Research Foundation | Method for screening crystallization conditions in solution crystal growth |
MXPA01009999A (en) * | 1999-04-06 | 2003-07-14 | Uab Research Foundation | Method for screening crystallization conditions in solution crystal growth. |
US7244396B2 (en) | 1999-04-06 | 2007-07-17 | Uab Research Foundation | Method for preparation of microarrays for screening of crystal growth conditions |
US7250305B2 (en) | 2001-07-30 | 2007-07-31 | Uab Research Foundation | Use of dye to distinguish salt and protein crystals under microcrystallization conditions |
US20030022383A1 (en) * | 1999-04-06 | 2003-01-30 | Uab Research Foundation | Method for screening crystallization conditions in solution crystal growth |
CA2372526A1 (en) * | 1999-05-10 | 2000-11-16 | Michael D. Wyrsta | Methods and compositions for controlled polypeptide synthesis |
US6296673B1 (en) * | 1999-06-18 | 2001-10-02 | The Regents Of The University Of California | Methods and apparatus for performing array microcrystallizations |
US6630006B2 (en) * | 1999-06-18 | 2003-10-07 | The Regents Of The University Of California | Method for screening microcrystallizations for crystal formation |
US7058517B1 (en) | 1999-06-25 | 2006-06-06 | Genaissance Pharmaceuticals, Inc. | Methods for obtaining and using haplotype data |
JP4944324B2 (en) * | 1999-07-13 | 2012-05-30 | ボルダー バイオテクノロジー, インコーポレイテッド | Immunoglobulin fusion protein |
EP2133098A1 (en) | 2000-01-10 | 2009-12-16 | Maxygen Holdings Ltd | G-CSF conjugates |
US6555660B2 (en) * | 2000-01-10 | 2003-04-29 | Maxygen Holdings Ltd. | G-CSF conjugates |
US6646110B2 (en) | 2000-01-10 | 2003-11-11 | Maxygen Holdings Ltd. | G-CSF polypeptides and conjugates |
US6831158B2 (en) * | 2000-01-10 | 2004-12-14 | Maxygen Holdings Ltd. | G-CSF conjugates |
GB0008563D0 (en) * | 2000-04-07 | 2000-05-24 | Cambridge Discovery Chemistry | Investigating different physical and/or chemical forms of materials |
PT1043239E (en) * | 2000-06-16 | 2004-05-31 | Vsi Holding As | CONTAINER WITH COLAPSAVE SIDES |
US6931326B1 (en) | 2000-06-26 | 2005-08-16 | Genaissance Pharmaceuticals, Inc. | Methods for obtaining and using haplotype data |
US7792645B2 (en) * | 2000-08-30 | 2010-09-07 | The Salk Institute For Biological Studies | Three-dimensional structure of chalcone isomerase and methods of use thereof |
MXPA03002045A (en) * | 2000-09-08 | 2003-07-24 | Amgen Inc | G-csf analog compositions and methods. |
CA2440467A1 (en) * | 2001-03-12 | 2002-09-19 | Board Of Regents, University Of Texas System | Ensemble-based strategy for the design of protein pharmaceuticals |
DE10112825A1 (en) * | 2001-03-16 | 2002-10-02 | Fresenius Kabi De Gmbh | HESylation of active ingredients in aqueous solution |
US7670429B2 (en) | 2001-04-05 | 2010-03-02 | The California Institute Of Technology | High throughput screening of crystallization of materials |
US6998219B2 (en) * | 2001-06-27 | 2006-02-14 | University Of South Florida | Maskless photolithography for etching and deposition |
BR0211071A (en) * | 2001-07-11 | 2004-12-21 | Maxygen Holdings Ltd | Polypeptide conjugate showing g-csf activity, method for preparing a g-csf conjugate, composition, method for treating a mammal suffering from an insufficient neutrophilic level, and use of the polypeptide conjugate |
US20030104996A1 (en) * | 2001-08-30 | 2003-06-05 | Tiansheng Li | L-methionine as a stabilizer for NESP/EPO in HSA-free formulations |
US20040247562A1 (en) * | 2001-09-28 | 2004-12-09 | Sang Yup Lee | Diagnostic method for cancer characterized in the detection of the deletion of g-csf exon 3 |
DE10209821A1 (en) | 2002-03-06 | 2003-09-25 | Biotechnologie Ges Mittelhesse | Coupling of proteins to a modified polysaccharide |
DE10209822A1 (en) | 2002-03-06 | 2003-09-25 | Biotechnologie Ges Mittelhesse | Coupling of low molecular weight substances to a modified polysaccharide |
JP2006507562A (en) * | 2002-05-23 | 2006-03-02 | ザ ボード オブ レジェンツ−ザ ユニバーシティー オブ テキサス システム | Predicting the significance of single nucleotide polymorphisms (SNPS) using ensemble-based structural energy |
WO2004005898A1 (en) * | 2002-07-10 | 2004-01-15 | Uab Research Foundation | Method for distinguishing between biomolecule and non-biomolecule crystals |
AU2003263552A1 (en) * | 2002-09-09 | 2004-03-29 | Nautilus Biotech | Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules |
IL166506A0 (en) * | 2002-09-11 | 2006-01-15 | Fresenius Kabi De Gmbh | Hasylated polypeptides especially hasylated erythropoietin |
DE10242076A1 (en) * | 2002-09-11 | 2004-03-25 | Fresenius Kabi Deutschland Gmbh | New covalently bonded conjugates of hydroxyalkyl starch with allergens, useful as modified allergens with depot effect for use in specific immunotherapy for combating allergies, e.g. hay fever |
US9453251B2 (en) | 2002-10-08 | 2016-09-27 | Pfenex Inc. | Expression of mammalian proteins in Pseudomonas fluorescens |
AU2003273413A1 (en) * | 2002-10-08 | 2004-05-04 | Fresenius Kabi Deutschland Gmbh | Pharmaceutically active oligosaccharide conjugates |
AU2003303635B2 (en) * | 2002-12-26 | 2009-07-23 | Mountain View Pharmaceuticals, Inc. | Polymer conjugates of interferon-beta with enhanced biological potency |
WO2004060300A2 (en) * | 2002-12-26 | 2004-07-22 | Mountain View Pharmaceuticals, Inc. | Polymer conjugates of cytokines, chemokines, growth factors, polypeptide hormones and antagonists thereof with preserved receptor-binding activity |
US7785601B2 (en) | 2002-12-31 | 2010-08-31 | Sygnis Bioscience Gmbh & Co. Kg | Methods of treating neurological conditions with hematopoietic growth factors |
US7695723B2 (en) | 2002-12-31 | 2010-04-13 | Sygnis Bioscience Gmbh & Co. Kg | Methods of treating neurological conditions with hematopoietic growth factors |
ATE497974T1 (en) | 2003-07-21 | 2011-02-15 | Transgene Sa | MULTIFUNCTIONAL CYTOKINE |
US20080206182A1 (en) * | 2003-08-08 | 2008-08-28 | Fresenius Kabi Deutschland Gmbh | Conjugates of a Polymer and a Protein Linked by an Oxime Group |
WO2005014655A2 (en) * | 2003-08-08 | 2005-02-17 | Fresenius Kabi Deutschland Gmbh | Conjugates of hydroxyalkyl starch and a protein |
EP2196210A1 (en) * | 2003-10-24 | 2010-06-16 | Nora, LLC | A method for reducing the likelihood of preeclampsia in a subject in need thereof |
US20090226397A1 (en) * | 2003-10-24 | 2009-09-10 | Nora Therapeutics, Inc. | Compositions and methods for reducing the likelihood of implantation failure or miscarriage in recipients of artificial insemination |
US8338373B2 (en) * | 2003-10-24 | 2012-12-25 | Nora Therapeutics, Inc. | Method for reducing the risk of spontaneous abortion in a human female subject |
US7220407B2 (en) * | 2003-10-27 | 2007-05-22 | Amgen Inc. | G-CSF therapy as an adjunct to reperfusion therapy in the treatment of acute myocardial infarction |
US20060122784A1 (en) * | 2004-12-03 | 2006-06-08 | Ishikawa Muriel Y | System and method for augmenting a humoral immune response |
CN101659704A (en) | 2004-03-11 | 2010-03-03 | 弗雷泽纽斯卡比德国有限公司 | Conjugates of hydroxyalkyl starch and a protein, prepared by reductive amination |
AR048918A1 (en) * | 2004-03-11 | 2006-06-14 | Fresenius Kabi De Gmbh | CONJUGADOS DE ALMIDON DE HIDROXIETILO Y ERITROPOYETINA |
US8603824B2 (en) | 2004-07-26 | 2013-12-10 | Pfenex, Inc. | Process for improved protein expression by strain engineering |
CA2586365A1 (en) | 2004-11-05 | 2006-05-26 | Northwestern University | Use of scf and g-csf in the treatment of cerebral ischemia and neurological disorders |
WO2006063300A2 (en) * | 2004-12-10 | 2006-06-15 | Genentech, Inc. | Crystal structure of hepatocyte growth factor activator complexed with kunitz domain inhibitor |
US7790174B2 (en) | 2004-12-23 | 2010-09-07 | Merck Serono Sa | G-CSF polypeptides and uses thereof |
JP4951527B2 (en) | 2005-01-10 | 2012-06-13 | バイオジェネリックス アーゲー | GlycoPEGylated granulocyte colony stimulating factor |
KR100657749B1 (en) * | 2005-04-13 | 2006-12-20 | 씨제이 주식회사 | Human Granulocyte-Colony Stimulating Factor Isoform and Composition thereof |
AU2006254543A1 (en) * | 2005-06-01 | 2006-12-07 | Maxygen Holdings Ltd. | PEGylated G-CSF polypeptides and methods of producing same |
KR100694994B1 (en) * | 2005-06-13 | 2007-03-14 | 씨제이 주식회사 | Human Granulocyte-Colony Stimulating Factor Isoforms |
KR100735784B1 (en) | 2005-07-20 | 2007-07-06 | 재단법인 목암생명공학연구소 | Mutant of granulocyte-colony stimulating factorG-CSF and chemically conjugated polypeptide thereof |
JP5509444B2 (en) * | 2005-08-15 | 2014-06-04 | ファレス ファーマシューティカル リサーチ エヌ.ブイ. | Crystalline form of astaxanthin |
EP1946113A4 (en) * | 2005-08-22 | 2010-03-10 | Dana Farber Cancer Inst Inc | Mitochondrial localization of muc1 |
US20070112804A1 (en) * | 2005-11-07 | 2007-05-17 | Desimas Bruce E | Systems and methods for generating automated software workflows for biological testing |
GB0605684D0 (en) * | 2006-03-21 | 2006-05-03 | Sicor Biotech Uab | Method For Purifying Granulocyte-Colony Stimulating Factor |
US8129345B2 (en) * | 2006-07-20 | 2012-03-06 | Dana-Farber Cancer Institute, Inc. | MUC1-IκB kinase complexes and their activities |
WO2008097840A2 (en) | 2007-02-02 | 2008-08-14 | Dana-Farber Cancer Institute, Inc. | Methods and compositions relating to the regulation of muc1 by hsf1 and stat3 |
WO2008097844A2 (en) * | 2007-02-02 | 2008-08-14 | Dana -Farber Cancer Institute, Inc. | Methods and compositions relating to the regulation of apoptosis by muc1 and bh3- containing proapoptotic proteins |
JP4375412B2 (en) * | 2007-02-19 | 2009-12-02 | 株式会社デンソー | Evaporator unit |
US9580719B2 (en) | 2007-04-27 | 2017-02-28 | Pfenex, Inc. | Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins |
WO2008134461A2 (en) | 2007-04-27 | 2008-11-06 | Dow Global Technologies, Inc. | Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins |
EP2544008A1 (en) | 2007-07-03 | 2013-01-09 | Amgen Inc. | Measurement of protein using inclusion body dry weight |
DK3597659T3 (en) | 2007-07-09 | 2023-04-03 | Genentech Inc | Prevention of disulfide bond reduction during recombinant production of polypeptides |
EP2581441A1 (en) | 2007-08-09 | 2013-04-17 | Genzyme Corporation | Method of treating autoimmune disease with mesenchymal stem cells |
US8758761B2 (en) * | 2007-09-30 | 2014-06-24 | University Of Florida Research Foundation, Inc. | Combination therapies for treating type 1 diabetes |
US8570393B2 (en) * | 2007-11-30 | 2013-10-29 | Cognex Corporation | System and method for processing image data relative to a focus of attention within the overall image |
EP2070951A1 (en) * | 2007-12-14 | 2009-06-17 | Fresenius Kabi Deutschland GmbH | Method for producing a hydroxyalkyl starch derivatives with two linkers |
EP2070950A1 (en) * | 2007-12-14 | 2009-06-17 | Fresenius Kabi Deutschland GmbH | Hydroxyalkyl starch derivatives and process for their preparation |
NZ586947A (en) | 2008-02-08 | 2012-11-30 | Ambrx Inc | Modified leptin polypeptides and their uses |
US8629104B2 (en) | 2008-02-18 | 2014-01-14 | Jiangsu Hengrui Medicine Co. Ltd. | G-CSF and water-soluble polymer conjugate |
JOP20190083A1 (en) | 2008-06-04 | 2017-06-16 | Amgen Inc | Fgf21 mutant fusion polypeptides and uses thereof |
AU2009274022B2 (en) | 2008-07-22 | 2016-06-02 | Menogenix, Inc. | Compositions and methods for treating symptoms associated with menopause, hormonal variations and arthritis |
US10138283B2 (en) * | 2008-07-23 | 2018-11-27 | Ambrx, Inc. | Modified bovine G-CSF polypeptides and their uses |
US9151289B2 (en) | 2008-08-21 | 2015-10-06 | Cummins Inc. | Fuel pump |
PE20120021A1 (en) | 2008-10-10 | 2012-02-10 | Amgen Inc | MUTANTS FGF21 |
EP2352508B1 (en) | 2008-10-17 | 2014-04-02 | Dana-Farber Cancer Institute, Inc. | Muc-1 cytoplasmic domain peptides as inhibitors of cancer |
US9189670B2 (en) * | 2009-02-11 | 2015-11-17 | Cognex Corporation | System and method for capturing and detecting symbology features and parameters |
CA2760674A1 (en) | 2009-05-05 | 2010-11-11 | Amgen Inc. | Fgf21 mutants and uses thereof |
NZ596037A (en) | 2009-05-05 | 2013-10-25 | Amgen Inc | Fgf21 mutants and uses thereof |
EP2443145A1 (en) * | 2009-06-17 | 2012-04-25 | Amgen, Inc | Chimeric fgf19 polypeptides and uses thereof |
CA2782814A1 (en) | 2009-12-02 | 2011-06-09 | Amgen Inc. | Binding proteins that bind to human fgfr1c, human .beta.-klotho and both human fgfr1c and human .beta.-klotho |
UA109888C2 (en) | 2009-12-07 | 2015-10-26 | ANTIBODY OR ANTIBODILITY ANTIBODY OR ITS BINDING TO THE β-CLOTE, FGF RECEPTORS AND THEIR COMPLEXES | |
NZ600361A (en) | 2009-12-21 | 2014-06-27 | Ambrx Inc | Modified bovine somatotropin polypeptides and their uses |
CN107056929A (en) | 2009-12-21 | 2017-08-18 | Ambrx 公司 | Porcine somatotropin polypeptide and its purposes by modification |
EP2548017A2 (en) | 2010-03-15 | 2013-01-23 | Genus Oncology, Llc | Small molecule inhibitors of muc1 and methods of identifying the same |
DK2550366T3 (en) | 2010-03-23 | 2014-12-15 | Imba Inst Für Molekulare Biotechnologie Gmbh | Methods for identifying inhibitors of the type III secretion system |
US9517264B2 (en) | 2010-04-15 | 2016-12-13 | Amgen Inc. | Human FGF receptor and β-Klotho binding proteins |
TWI480288B (en) | 2010-09-23 | 2015-04-11 | Lilly Co Eli | Formulations for bovine granulocyte colony stimulating factor and variants thereof |
US8889630B2 (en) | 2011-12-23 | 2014-11-18 | Carlos Lopez | Method for hair regrowth using Granulocyte-Colony Stimulating Factor |
EP2897633B1 (en) | 2012-09-18 | 2020-01-01 | UTI Limited Partnership | Treatment of pain by inhibition of usp5 de-ubiquitinase |
FI3524617T3 (en) | 2013-03-15 | 2023-06-26 | Gladiator Biosciences Inc | Gla domains as therapeutic agents |
WO2015057724A1 (en) | 2013-10-14 | 2015-04-23 | Nora Therapeutics, Inc. | Use of g-csf for treating or preventing villitis of unknown etiology in a human female |
WO2016201448A2 (en) * | 2015-06-11 | 2016-12-15 | Prolong Pharmaceuticals, LLC | Pegylated granulocyte colony stimulating factor (gcsf) |
WO2017067958A1 (en) * | 2015-10-19 | 2017-04-27 | Sandoz Ag | Improved coding sequence for human g-csf |
CN108384747A (en) * | 2018-03-05 | 2018-08-10 | 安徽省农业科学院园艺研究所 | Express the Chinese hamster ovary celI serum free suspension cultural method of Rabies virus antibody |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1987001132A1 (en) * | 1985-08-23 | 1987-02-26 | Kirin-Amgen, Inc. | Production of pluripotent granulocyte colony-stimulating factor |
WO1988001775A1 (en) * | 1986-09-02 | 1988-03-10 | Genex Corporation | Macromolecule construction methods |
WO1989005824A1 (en) * | 1987-12-23 | 1989-06-29 | Genetics Institute, Inc. | Site-specific homogeneous modification of polypeptides to facilitate covalent linkages to a hydrophilic moiety |
EP0344796A2 (en) * | 1988-06-03 | 1989-12-06 | Chugai Seiyaku Kabushiki Kaisha | Crystalline human granulocyte colony stimulating factor and process for preparing the same |
EP0456200A1 (en) * | 1990-05-08 | 1991-11-13 | Roche Diagnostics GmbH | Mutein of granulocyte colony stimulating factor (G-CSF) |
WO1993025687A1 (en) * | 1992-06-09 | 1993-12-23 | Chiron Corporation | Crystallization of m-csf |
Family Cites Families (50)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4179337A (en) * | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
WO1985000817A1 (en) * | 1983-08-10 | 1985-02-28 | Amgen | Microbial expression of interleukin ii |
JPS6263335A (en) * | 1985-09-13 | 1987-03-20 | Fuji Photo Film Co Ltd | Processing method for chemical reaction information |
US4908773A (en) * | 1987-04-06 | 1990-03-13 | Genex Corporation | Computer designed stabilized proteins and method for producing same |
DK203187A (en) * | 1986-04-22 | 1987-10-23 | Immunex Corp | HUMAN G-CSF PROTEIN EXPRESSION |
EP0256843A1 (en) * | 1986-08-11 | 1988-02-24 | Cetus Corporation | Expression of g-csf and muteins thereof and their use |
DK174044B1 (en) * | 1986-12-23 | 2002-05-06 | Kyowa Hakko Kogyo Kk | Polypeptide derived from human granulocyte colony stimulating factor, and method of preparation thereof, DNA encoding said polypeptide, recombinant plasmid containing said DNA, and microorganisms containing said recombinant plasmid ....... |
US4853871A (en) * | 1987-04-06 | 1989-08-01 | Genex Corporation | Computer-based method for designing stablized proteins |
GB2213821B (en) * | 1987-12-23 | 1992-01-02 | British Bio Technology | Synthetic human granulocyte colony stimulating factor gene |
US5153265A (en) * | 1988-01-20 | 1992-10-06 | Cetus Corporation | Conjugation of polymer to colony stimulating factor-1 |
CA1340810C (en) * | 1988-03-31 | 1999-11-02 | Motoo Yamasaki | Polypeptide derivatives of human granulocyte colony stimulating factor |
US5025388A (en) * | 1988-08-26 | 1991-06-18 | Cramer Richard D Iii | Comparative molecular field analysis (CoMFA) |
US5218092A (en) | 1988-09-29 | 1993-06-08 | Kyowa Hakko Kogyo Co., Ltd. | Modified granulocyte-colony stimulating factor polypeptide with added carbohydrate chains |
US5166322A (en) * | 1989-04-21 | 1992-11-24 | Genetics Institute | Cysteine added variants of interleukin-3 and chemical modifications thereof |
US5109119A (en) * | 1989-06-06 | 1992-04-28 | Schering Corporation | Crystalline r-h-gm-csf and method |
US5265030A (en) * | 1990-04-24 | 1993-11-23 | Scripps Clinic And Research Foundation | System and method for determining three-dimensional structures of proteins |
GB9107846D0 (en) | 1990-04-30 | 1991-05-29 | Ici Plc | Polypeptides |
JP3249147B2 (en) | 1990-06-01 | 2002-01-21 | キリン−アムジエン・インコーポレーテツド | Oral preparation containing bioactive protein |
IE912365A1 (en) | 1990-07-23 | 1992-01-29 | Zeneca Ltd | Continuous release pharmaceutical compositions |
ATE167896T1 (en) * | 1990-08-29 | 1998-07-15 | Genetics Inst | MULTI-DOMAIN HEMATOPOASIS STIMULATORS |
US5124297A (en) | 1990-12-07 | 1992-06-23 | Amoco Corporation | Olefin polymerization and copolymerization catalyst |
DE4105480A1 (en) | 1991-02-21 | 1992-08-27 | Boehringer Mannheim Gmbh | IMPROVED ACTIVATION OF RECOMBINANT PROTEINS |
JPH06506217A (en) * | 1991-03-18 | 1994-07-14 | エンゾン,インコーポレーテッド | Hydrazine-containing conjugates of polypeptides or glycopolypeptides and polymers |
US5157736A (en) * | 1991-04-19 | 1992-10-20 | International Business Machines Corporation | Apparatus and method for optical recognition of chemical graphics |
US5386507A (en) * | 1991-07-18 | 1995-01-31 | Teig; Steven L. | Computer graphics system for selectively modelling molecules and investigating the chemical and physical properties thereof |
DE69227693T2 (en) * | 1991-08-30 | 1999-07-22 | Hutchinson Fred Cancer Res | HYBRID CYTOKINE |
JP2638359B2 (en) * | 1991-11-26 | 1997-08-06 | 富士通株式会社 | Constraint condition generator for molecular dynamics method |
US6057133A (en) | 1992-11-24 | 2000-05-02 | G. D. Searle | Multivariant human IL-3 fusion proteins and their recombinant production |
US6153183A (en) | 1992-11-24 | 2000-11-28 | G. D. Searle & Company | Co-administration of interleukin-3 mutant polypeptides with CSF's or cytokines for multi-lineage hematopoietic cell production |
US5738849A (en) | 1992-11-24 | 1998-04-14 | G. D. Searle & Co. | Interleukin-3 (IL-3) variant fusion proteins, their recombinant production, and therapeutic compositions comprising them |
US5772992A (en) | 1992-11-24 | 1998-06-30 | G.D. Searle & Co. | Compositions for co-administration of interleukin-3 mutants and other cytokines and hematopoietic factors |
EP0672145B1 (en) | 1992-11-24 | 2003-04-23 | G.D. Searle & Co. | Interleukin-3 (il-3) multiple mutation polypeptides |
US5424963A (en) * | 1992-11-25 | 1995-06-13 | Photon Research Associates, Inc. | Molecular dynamics simulation method and apparatus |
US5581476A (en) * | 1993-01-28 | 1996-12-03 | Amgen Inc. | Computer-based methods and articles of manufacture for preparing G-CSF analogs |
US5635599A (en) | 1994-04-08 | 1997-06-03 | The United States Of America As Represented By The Department Of Health And Human Services | Fusion proteins comprising circularly permuted ligands |
US5824784A (en) * | 1994-10-12 | 1998-10-20 | Amgen Inc. | N-terminally chemically modified protein compositions and methods |
JPH11500308A (en) | 1995-02-03 | 1999-01-12 | ジー.ディー.サール アンド カンパニー | New c-MPL ligand |
US6017523A (en) | 1995-06-06 | 2000-01-25 | G.D. Searle & Co. | Therapeutic methods employing mutant human interleukin-3 (IL-3) polypeptides |
CA2234061A1 (en) | 1995-10-05 | 1997-04-10 | G.D. Searle & Co. | Multi-functional hematopoietic receptor agonists |
EP0859843A1 (en) | 1995-10-05 | 1998-08-26 | G.D. Searle & Co. | Novel g-csf receptor agonists |
AU722759B2 (en) | 1995-10-05 | 2000-08-10 | G.D. Searle & Co. | Novel C-MPL receptor agonists |
US6100070A (en) | 1995-10-05 | 2000-08-08 | G. D. Searle & Co. | G-CSF receptor agonists |
US6066318A (en) | 1995-10-05 | 2000-05-23 | G.D. Searle & Co. | Multi-functional hematopoietic fusion proteins between sequence rearranged C-MPL receptor agonists and other hematopoietic factors |
US5969105A (en) | 1996-10-25 | 1999-10-19 | Feng; Yiqing | Stem cell factor receptor agonists |
US6660257B1 (en) | 1996-10-25 | 2003-12-09 | Pharmacia Corporation | Circular permuteins of flt3 ligand |
NZ335382A (en) | 1996-10-25 | 2001-03-30 | Searle & Co | Multi-functional chimeric hematopoietic polypeptides of IL-3, GCSF, Flt3L, EPO, stem cell factor, cmpl link with or without linker group consisting of Alanine, Glycine and/or Serine for treating autoimmune and tumour related diseases |
EP0973900A1 (en) | 1997-04-11 | 2000-01-26 | G.D. Searle & Co. | flt3 LIGAND CHIMERIC PROTEINS |
AU6246599A (en) | 1998-09-25 | 2000-04-17 | G.D. Searle & Co. | Method of producing permuteins by scanning permutagenesis |
US6555660B2 (en) * | 2000-01-10 | 2003-04-29 | Maxygen Holdings Ltd. | G-CSF conjugates |
ES2538342T3 (en) * | 2001-10-10 | 2015-06-19 | Ratiopharm Gmbh | Remodeling and glycoconjugation of follicle stimulating hormone (FSH) |
-
1993
- 1993-01-28 US US08/010,099 patent/US5581476A/en not_active Expired - Lifetime
-
1994
- 1994-01-25 KR KR1019950703096A patent/KR100375274B1/en not_active IP Right Cessation
- 1994-01-25 CA CA2381489A patent/CA2381489C/en not_active Expired - Lifetime
- 1994-01-25 CN CN94191031A patent/CN1118572C/en not_active Expired - Lifetime
- 1994-01-25 NZ NZ314960A patent/NZ314960A/en not_active IP Right Cessation
- 1994-01-25 WO PCT/US1994/000913 patent/WO1994017185A1/en active Application Filing
- 1994-01-25 CN CN2006101014030A patent/CN1970571B/en not_active Expired - Lifetime
- 1994-01-25 CA CA002153896A patent/CA2153896C/en not_active Expired - Lifetime
- 1994-01-25 CN CN03145268XA patent/CN1495197B/en not_active Expired - Lifetime
- 1994-01-25 NZ NZ332188A patent/NZ332188A/en not_active IP Right Cessation
- 1994-01-25 JP JP6517294A patent/JPH08506018A/en not_active Withdrawn
- 1994-01-25 NZ NZ261765A patent/NZ261765A/en not_active IP Right Cessation
- 1994-01-25 KR KR10-2001-7006530A patent/KR100390338B1/en not_active IP Right Cessation
- 1994-01-25 AU AU60957/94A patent/AU697451B2/en not_active Expired
- 1994-01-25 CA CA002239360A patent/CA2239360C/en not_active Expired - Lifetime
- 1994-01-25 CA CA2711007A patent/CA2711007C/en not_active Expired - Lifetime
- 1994-01-25 NZ NZ513422A patent/NZ513422A/en not_active IP Right Cessation
- 1994-01-26 IL IL145994A patent/IL145994A/en not_active IP Right Cessation
- 1994-01-26 IL IL124112A patent/IL124112A/en not_active IP Right Cessation
- 1994-01-26 IL IL10844694A patent/IL108446A/en not_active IP Right Cessation
- 1994-01-27 AT AT04019074T patent/ATE553199T1/en active
- 1994-01-27 EP EP98113221A patent/EP0890640A3/en not_active Withdrawn
- 1994-01-27 ES ES10011853T patent/ES2422269T3/en not_active Expired - Lifetime
- 1994-01-27 EP EP04019074A patent/EP1482046B1/en not_active Expired - Lifetime
- 1994-01-27 PT PT94101207T patent/PT612846E/en unknown
- 1994-01-27 EP EP99113571A patent/EP0974655A3/en not_active Withdrawn
- 1994-01-27 EP EP99112115A patent/EP0965638A3/en not_active Withdrawn
- 1994-01-27 PT PT100118538T patent/PT2345724E/en unknown
- 1994-01-27 ZA ZA94568A patent/ZA94568B/en unknown
- 1994-01-27 EP EP04019073A patent/EP1482045A3/en not_active Withdrawn
- 1994-01-27 PT PT04019074T patent/PT1482046E/en unknown
- 1994-01-27 EP EP94101207A patent/EP0612846B1/en not_active Expired - Lifetime
- 1994-01-27 AT AT94101207T patent/ATE195552T1/en active
- 1994-01-27 ES ES94101207T patent/ES2150951T3/en not_active Expired - Lifetime
- 1994-01-27 DK DK10011853.8T patent/DK2345724T3/en active
- 1994-01-27 EP EP10011853.8A patent/EP2345724B1/en not_active Revoked
- 1994-01-27 DE DE69425516T patent/DE69425516T2/en not_active Expired - Lifetime
- 1994-01-27 DK DK04019074.6T patent/DK1482046T3/en active
- 1994-01-27 EP EP01128744A patent/EP1233065A1/en not_active Withdrawn
- 1994-01-27 ES ES04019074T patent/ES2382927T3/en not_active Expired - Lifetime
- 1994-01-27 DK DK94101207T patent/DK0612846T3/en active
-
1995
- 1995-05-24 US US08/448,716 patent/US5790421A/en not_active Expired - Lifetime
- 1995-07-27 NO NO952974A patent/NO952974L/en not_active Application Discontinuation
- 1995-07-27 FI FI953593A patent/FI120769B/en not_active IP Right Cessation
-
1998
- 1998-04-15 IL IL12411198A patent/IL124111A/en not_active IP Right Cessation
- 1998-07-19 IL IL12539898A patent/IL125398A0/en not_active IP Right Cessation
- 1998-07-31 HK HK98109568A patent/HK1009288A1/en not_active IP Right Cessation
- 1998-08-28 AU AU81970/98A patent/AU8197098A/en not_active Abandoned
-
1999
- 1999-05-03 US US09/304,186 patent/US6261550B1/en not_active Expired - Lifetime
-
2000
- 2000-05-30 NZ NZ504840A patent/NZ504840A/en not_active IP Right Cessation
- 2000-11-02 GR GR20000402433T patent/GR3034745T3/en unknown
- 2000-11-23 LV LV000158A patent/LV12642B/en unknown
-
2001
- 2001-01-03 US US09/754,532 patent/US6632426B2/en not_active Expired - Fee Related
- 2001-10-17 IL IL14599401A patent/IL145994A0/en unknown
- 2001-12-20 US US10/032,108 patent/US7381804B2/en not_active Expired - Fee Related
-
2003
- 2003-04-02 NO NO20031497A patent/NO20031497D0/en unknown
- 2003-09-25 JP JP2003333761A patent/JP2004113243A/en not_active Withdrawn
-
2005
- 2005-04-25 US US11/113,581 patent/US8058398B2/en not_active Expired - Fee Related
- 2005-11-17 JP JP2005333254A patent/JP2006137762A/en not_active Withdrawn
- 2005-11-17 JP JP2005333253A patent/JP2006096762A/en not_active Withdrawn
-
2007
- 2007-11-27 HK HK07112941.8A patent/HK1107356A1/en unknown
-
2008
- 2008-07-15 JP JP2008183538A patent/JP2009057368A/en not_active Withdrawn
-
2009
- 2009-10-21 FI FI20090384A patent/FI123078B/en not_active IP Right Cessation
- 2009-10-30 JP JP2009249964A patent/JP2010059170A/en active Pending
- 2009-12-08 NO NO20093489A patent/NO20093489L/en not_active Application Discontinuation
-
2011
- 2011-04-11 JP JP2011087129A patent/JP2011207885A/en not_active Withdrawn
-
2013
- 2013-08-12 LU LU92265C patent/LU92265I2/en unknown
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1987001132A1 (en) * | 1985-08-23 | 1987-02-26 | Kirin-Amgen, Inc. | Production of pluripotent granulocyte colony-stimulating factor |
US4810643A (en) * | 1985-08-23 | 1989-03-07 | Kirin- Amgen Inc. | Production of pluripotent granulocyte colony-stimulating factor |
WO1988001775A1 (en) * | 1986-09-02 | 1988-03-10 | Genex Corporation | Macromolecule construction methods |
WO1989005824A1 (en) * | 1987-12-23 | 1989-06-29 | Genetics Institute, Inc. | Site-specific homogeneous modification of polypeptides to facilitate covalent linkages to a hydrophilic moiety |
US4904584A (en) * | 1987-12-23 | 1990-02-27 | Genetics Institute, Inc. | Site-specific homogeneous modification of polypeptides |
EP0344796A2 (en) * | 1988-06-03 | 1989-12-06 | Chugai Seiyaku Kabushiki Kaisha | Crystalline human granulocyte colony stimulating factor and process for preparing the same |
EP0456200A1 (en) * | 1990-05-08 | 1991-11-13 | Roche Diagnostics GmbH | Mutein of granulocyte colony stimulating factor (G-CSF) |
WO1993025687A1 (en) * | 1992-06-09 | 1993-12-23 | Chiron Corporation | Crystallization of m-csf |
Non-Patent Citations (10)
Title |
---|
A. OLSON ET AL: "Voir les Molécules biologiques", POUR LA SCIENCE, vol. 183, January 1993 (1993-01-01), pages 76 - 82, XP002126394 * |
C.P. HILL ET AL: "The structure of Granulocyte-colony-stimulating factor and its relationship to other growth factors", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 90, June 1993 (1993-06-01), WASHINGTON US, pages 5167 - 5171, XP002928762, DOI: doi:10.1073/pnas.90.11.5167 * |
J. E. LAYTON ET AL: "Interaction of G-CSF with its receptor : Dissociation of biological activity and Receptor binding", JOURNAL OF CELLULAR BIOCHEMISTRY SUPPL 0, no. 17B, 26 JANUARY-10 FEBRUARY 1993, pages 78, XP002175892 * |
J. PANDIT ET AL: "Three-dimensional Structure of dimeric human recombinant Macrophage Colony-Stimulating Factor", SCIENCE, vol. 258, 20 November 1992 (1992-11-20), LANCASTER, PA US, pages 1358 - 1362, XP002126391, DOI: doi:10.1126/science.1455231 * |
L. ABRAHMSEN ET AL: "Engineering subtilisin and its sustrates for efficient ligation of peptide bonds in aqueous solution", BIOCHEMISTRY, vol. 30, 1991, EASTON, PA US, pages 4151 - 4159 * |
M. KARPLUS: "The prediction and Analysis of mutant strutures", PROTEIN ENGINEERING, 1987, ALAN R. LISS, INC., pages 35 - 44, XP008037915 * |
M.J. COX ET AL: "Experiments with automated protein crystallization", JOURNAL OF APPLIED CRYSTALLOGRAPHY, vol. 20, 1987, pages 366 - 373, XP000865938, DOI: doi:10.1107/S0021889887086461 * |
MASAHARU ISHIKAWA ET AL: "The sustitution of Cysteine 17 of recombinant human G-CSF with Alanine greatly enhanced its stability", CELL STRUCTURE AND FUNCTION, vol. 17, no. 1, February 1992 (1992-02-01), pages 61 - 65, XP002636941, DOI: doi:10.1247/csf.17.61 * |
T. OSSLUND ET AL: "The structure of granulocyte-colony stimulating factor", DISSERTATION ABSTRACTS INTERNATIONAL B., vol. 54, no. 3, September 1993 (1993-09-01), pages 1239, XP002126395 * |
TETSURO KUGA ET AL: "Mutagenesis of human granulocyte colony stimulating factor", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 159, no. 1, 28 February 1989 (1989-02-28), DULUTH, MINNESOTA US, pages 103 - 111, XP002636942, DOI: doi:10.1016/0006-291X(89)92410-8 * |
Cited By (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2010215657A (en) * | 1994-10-12 | 2010-09-30 | Amgen | N-terminally chemically modified protein composition and method |
US5824784A (en) * | 1994-10-12 | 1998-10-20 | Amgen Inc. | N-terminally chemically modified protein compositions and methods |
US6128582A (en) * | 1996-04-30 | 2000-10-03 | Vertex Pharmaceuticals Incorporated | Molecules comprising an IMPDH-like binding pocket and encoded data storage medium capable of graphically displaying them |
WO1997041211A1 (en) * | 1996-04-30 | 1997-11-06 | Vertex Pharmaceuticals Incorporated | Molecules comprising an impdh-like binding pocket and encoded data storage medium capable of graphically displaying them |
US7216041B1 (en) | 1996-04-30 | 2007-05-08 | Vertex Pharmaceuticals Incorporated | Methods of using the structure coordinates of molecules comprising an IMPDH-like binding pocket |
US7527952B2 (en) | 1996-04-30 | 2009-05-05 | Vertex Pharmaceuticals Incorporated | Crystals of inosine monophosphate dehydrogenase/oxidized inosine monophosphate thiomidate intermediate/mycophenolic acid (IIMPDH/XMP*/MPA) |
US6770746B2 (en) | 1997-08-15 | 2004-08-03 | Amgen Inc. | Chemical modification of proteins to improve biocompatibility and bioactivity |
US6420340B2 (en) | 1997-08-15 | 2002-07-16 | Amgen Inc. | Chemical modification of proteins to improve biocompatibility and bioactivity |
US6204247B1 (en) | 1997-08-15 | 2001-03-20 | Amgen Inc. | Chemical modification of proteins to improve biocompatibility and bioactivity |
EP1762574A2 (en) | 1997-08-15 | 2007-03-14 | Amgen Inc. | Chemical modification of proteins to improve biocompatibility and bioactivity |
US6541033B1 (en) | 1998-06-30 | 2003-04-01 | Amgen Inc. | Thermosensitive biodegradable hydrogels for sustained delivery of leptin |
US6420339B1 (en) | 1998-10-14 | 2002-07-16 | Amgen Inc. | Site-directed dual pegylation of proteins for improved bioactivity and biocompatibility |
US6245740B1 (en) | 1998-12-23 | 2001-06-12 | Amgen Inc. | Polyol:oil suspensions for the sustained release of proteins |
US6979674B1 (en) | 1998-12-23 | 2005-12-27 | Amgen Inc. | Polyol/oil suspensions for the sustained release of proteins |
WO2000040728A1 (en) * | 1999-01-06 | 2000-07-13 | Xencor, Inc. | Nucleic acids and proteins corresponding to mutants of g-csf with granulopoietic activity |
US6627186B1 (en) | 1999-01-06 | 2003-09-30 | Xencor | Nucleic acids and protein variants of hG-CSF with granulopoietic activity |
US7208473B2 (en) | 1999-01-06 | 2007-04-24 | Xencor, Inc. | Nucleic acids and protein variants of hG-CSF with granulopoietic activity |
WO2000052057A1 (en) * | 1999-03-04 | 2000-09-08 | Biomolecular Engineering Research Institute | Crystals and structural coordinate of protein complex and utilisation of the structural coordinate |
US8106098B2 (en) | 1999-08-09 | 2012-01-31 | The General Hospital Corporation | Protein conjugates with a water-soluble biocompatible, biodegradable polymer |
WO2002020751A2 (en) * | 2000-09-07 | 2002-03-14 | Eli Lilly And Company | Hyperglycosylated polypeptides |
WO2002020751A3 (en) * | 2000-09-07 | 2003-08-07 | Lilly Co Eli | Hyperglycosylated polypeptides |
WO2002036626A1 (en) * | 2000-11-02 | 2002-05-10 | Maxygen Aps | Single-chain multimeric polypeptides |
WO2003086444A1 (en) | 2002-04-04 | 2003-10-23 | Amgen Inc. | Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins |
EP2298331A2 (en) | 2002-04-04 | 2011-03-23 | Amgen, Inc | Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins |
EP2286791A1 (en) | 2003-12-30 | 2011-02-23 | Durect Corporation | Polymeric implants, preferably containing a mixture of PEG and PLG, for controlled release of active agents, preferably a GnRH |
US11535659B2 (en) | 2010-09-28 | 2022-12-27 | Amryt Pharmaceuticals Inc. | Engineered polypeptides having enhanced duration of action |
WO2015047062A1 (en) | 2013-09-27 | 2015-04-02 | Uab Profarma | Fused proteins of granulocyte colony-stimulating factor with other partners of growth factor, preferably with stem cell factor, and method of preparation thereof |
LT6161B (en) | 2013-09-27 | 2015-06-25 | Uab Profarma | Fused proteins of granulocyte colony-stimulating factor with other partners of growh factor, preferably with stem cell factor, and method of preparation thereof |
WO2021068074A1 (en) * | 2019-10-08 | 2021-04-15 | Zymeworks Inc. | Modified extracellular domain of granulocyte colony-stimulating factor receptor (g-csfr) and cytokines binding same |
WO2021123033A1 (en) | 2019-12-17 | 2021-06-24 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Novel g-csf mimics and their applications |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6632426B2 (en) | G-CSF analog compositions and methods | |
AU724260B2 (en) | G-CSF analog compositions | |
AU2011201971B2 (en) | G-CSF analog compositions | |
AU3515001A (en) | G-CSF analog compositions | |
AU2012201071A1 (en) | G-CSF analog compositions |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 94191031.8 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB HU JP KP KR KZ LK LU LV MG MN MW NL NO NZ PL PT RO RU SD SE SK UA VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2153896 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 261765 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 953593 Country of ref document: FI Ref document number: 1019950703096 Country of ref document: KR |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1020017006530 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 20090384 Country of ref document: FI |