WO1994018314A1 - Oxidatively stable alpha-amylase - Google Patents

Oxidatively stable alpha-amylase Download PDF

Info

Publication number
WO1994018314A1
WO1994018314A1 PCT/US1994/001553 US9401553W WO9418314A1 WO 1994018314 A1 WO1994018314 A1 WO 1994018314A1 US 9401553 W US9401553 W US 9401553W WO 9418314 A1 WO9418314 A1 WO 9418314A1
Authority
WO
WIPO (PCT)
Prior art keywords
amylase
alpha
gly
ala
asp
Prior art date
Application number
PCT/US1994/001553
Other languages
French (fr)
Inventor
Richard L. Antrim
Christopher C. Barnett
Colin Mitchinson
Scott D. Power
Carol A. Requadt
Leif P. Solheim
Original Assignee
Genencor International, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=21776903&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1994018314(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to JP6518371A priority Critical patent/JPH08506491A/en
Priority to DE69415659T priority patent/DE69415659T3/en
Priority to KR1019950703350A priority patent/KR100322793B1/en
Priority to NZ262623A priority patent/NZ262623A/en
Priority to DK94909609T priority patent/DK0689589T4/en
Priority to AU62392/94A priority patent/AU682863C/en
Priority to CA002155831A priority patent/CA2155831C/en
Application filed by Genencor International, Inc. filed Critical Genencor International, Inc.
Priority to EP94909609A priority patent/EP0689589B2/en
Priority to HU9502364A priority patent/HU219675B/en
Priority to PL94310326A priority patent/PL310326A1/en
Priority to BR9405720A priority patent/BR9405720A/en
Publication of WO1994018314A1 publication Critical patent/WO1994018314A1/en
Priority to NO953147A priority patent/NO307187B1/en
Priority to FI953797A priority patent/FI119694B/en
Priority to FI20080005A priority patent/FI122574B/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2408Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411Amylases
    • C12N9/2414Alpha-amylase (3.2.1.1.)
    • C12N9/2417Alpha-amylase (3.2.1.1.) from microbiological source
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/14Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase

Definitions

  • the present invention relates to novel alpha-amylase mutants having an amino acid sequence not found in nature, such mutants having an amino acid sequence wherein one or more amino acid residue(s) of a precursor alpha-amylase, specifically any oxidizable amino acid, have been substituted with a different amino acid.
  • the mutant enzymes of the present invention exhibit altered stability/activity profiles including but not limited to altered oxidative stability, altered pH performance profile, altered specific activity and/or altered thermostability.
  • Alpha-amylases (alpha-1 ,4-glucan-4-glucanohydrolase, EC3.2.1 .1 ) hydrolyze internal alpha-1 ,4-glucosidic linkages in starch largely at random, to produce smaller molecular weight malto-dextrins.
  • Alpha-amylases are of considerable commercial value, being used in the initial stages (liquefaction) of starch processing; in alcohol production; as cleaning agents in detergent matrices; and in the textile industry for starch desizing.
  • Alpha-amylases are produced by a wide variety of microorganisms including Bacillus and Aspergillus, with most commercial amylases being produced from bacterial sources such as B. licheniformis, B. amyloliquefaciens, B. subtilis, or B. stearothermophilus. In recent years the preferred enzymes in commercial use have been those from B.
  • alpha-amylase is inactivated by hydrogen peroxide and other oxidants at pH's between 4 and 1 0.5 as described in the examples herein.
  • alpha-amylase enzymes can be used under dramatically different conditions such as both high and low pH conditions, depending on the commercial application.
  • alpha-amylases may be used in the liquefaction of starch, a process preferably performed at a low pH (pH ⁇ 5.5).
  • amylases may be used in commercial dish care or laundry detergents, which often contain oxidants such as bleach or peracids, and which are used in much more alkaline conditions.
  • amylase enzymes In order to alter the stability or activity profile of amylase enzymes under varying conditions, it has been found that selective replacement, substitution or deletion of oxidizable ammo acids, such as a methionine, tryptophan, tyrosine, histidine or cysteine, results in an altered profile of the variant enzyme as compared to its precursor. Because currently commercially available amylases are not acceptable (stable) under various conditions, there is a need for an amylase having an altered stability and/or activity profile This altered stability (oxidative, thermal or pH
  • the mutant enzymes of the present invention may also have altered pH performance profiles, which may be due to the enhanced oxidative stability of the enzyme.
  • the present invention relates to novel alpha-amylase mutants that are the expression product of a mutated DNA sequence encoding an alpha-amylase, the mutated DNA sequence being derived from a precursor alpha-amylase by the deletion or substitution (replacement) of one or more oxidizable ammo acid.
  • the mutant result from substituting a different amino acid for one or more methionine residue(s) in the precursor alpha-amylase.
  • the mutants comprise a substitution of one or more tryptophan residue alone or in combination with the substitution of one or more methionine residue in the precursor alpha-amylase.
  • Such mutant alpha-amylases are obtained by in vitro modification of a precursor DNA sequence encoding a naturally occurring or recombinant alpha-amylase to encode the substitution or deletion of one or more amino acid residues in a precursor amino acid sequence.
  • the substitution or deletion of one or more amino acid in the amino acid sequence is due to the replacement or deletion of one or more methionine, tryptophan, cysteine, histidine or tyrosine residues in such sequence, most preferably the residue which is changed is a methionine residue.
  • the oxidizable amino acid residues may be replaced by any of the other 20 naturally occurring amino acids. If the desired effect is to alter the oxidative stability of the precursor, the amino acid residue may be substituted with a non-oxidizable amino acid (such as alanine, arginine, asparagine, aspartic acid, glutamic acid, glutamine, glycine, isoleucine, leucine, lysine,
  • phenylalanine, proline, serine, threonine, or valine or another oxidizable amino acid (such as cysteine, methionine, tryptophan, tyrosine or histidine, listed in order of most easily oxidizable to less readily oxidizable).
  • cysteine may be substituted for methionine.
  • Preferred mutants comprise the substitution of a methionine residue equivalent to any of the methionine residues found in B. licheniformis alpha-amylase ( + 8, + 1 5, + 1 97, + 256, + 304, + 366 and +438). Most preferably the methionine to be replaced is a methionine at a position equivalent to position + 1 97 or + 1 5 in B. licheniformis alpha- amylase.
  • Preferred substitute amino acids to replace the methionine at position + 1 97 are alanine (A), isoleucine (I), threonine (T) or cysteine (C).
  • the preferred substitute amino acids at position + 1 5 are leucine (L), threonine (T), asparagine (N), aspartate (D), serine (S), valine (V) and isoleucine (I), although other substitute amino acids not specified above may be useful.
  • Two specifically preferred mutants of the present invention are M1 97T and M1 5L.
  • Another embodiment of this invention relates to mutants comprising the substitution of a tryptophan residue equivalent to any of the tryptophan residues found in B.
  • licheniformis alpha-amylase see Fig. 2.
  • the tryptophan to be replaced is at a position equivalent to + 1 38 in B. licheniformis alpha-amylase.
  • substitution at a tryptophan residue may be made alone or in combination with mutations at other oxidizable amino acid residues. Specifically, it may be advantageous to modify by substitution at least one tryptophan in combination with at least one methionine (for example, the double mutant + 1 38/+ 1 97).
  • the alpha-amylase mutants of the present invention in general, exhibit altered oxidative stability in the presence of hydrogen peroxide and other oxidants such as bleach or peracids, or, more specific, milder oxidants such as chloramine-T. Mutant enzymes having enhanced oxidative stability will be useful in extending the shelf life and bleach, perborate, percarbonate or peracid compatibility of amylases used in cleaning products. Similarly, reduced oxidative stability may be useful in industrial processes that require the rapid and efficient quenching of enzymatic activity.
  • the mutant enzymes of the present invention may also demonstrate a broadened pH performance profile whereby mutants such as M1 5L show stability for low pH starch liquefaction and mutants such as M1 97T show stability at high pH cleaning product conditions.
  • the mutants of the present invention may also have altered thermal stability whereby the mutant may have enhanced stability at either high or low temperatures. It is understood that any change (increase or decrease) in the mutant's enzymatic characteristic(s), as compared to its precursor, may be beneficial depending on the desired end use of the mutant alpha-amylase.
  • variant amylases of the present invention may be used in any application in which known amylases are used, for example, variant amylases can be used in textile processing, food processing, etc.
  • variant amylases can be used in textile processing, food processing, etc.
  • a variant enzyme such as M 1 97C, which is easily inactivated by oxidation, would be useful in a process where it is desirable to completely remove amylase activity at the end of the process, for example, in frozen food processing applications.
  • the preferred alpha-amylase mutants of the present invention are derived from a Bacillus strain such as B. licheniformis, B. amylo/iquefaciens, and B.
  • stearothermophilus and most preferably from Bacillus licheniformis.
  • a novel form of the alpha- amylase normally produced by B. licheniformis This novel form, designated as the A4 form, has an additional four alanine residues at the N-terminus of the secreted amylase.
  • FIG. 4b. Derivatives or mutants of the A4 form of alpha-amylase are encompassed within the present invention.
  • derivatives or mutants of the A4 form it is meant that the present invention comprises the A4 form alpha-amylase containing one or more additional mutations such as, for example, mutation (substitution, replacement or deletion) of one or more oxidizable amino acid(s).
  • detergent compositions liquid, gel or granular, comprising the alpha-amylase mutants described herein.
  • Particularly preferred are detergent compositions comprising a + 1 97 position mutant either alone or in combination with other enzymes such as endoglycosidases, cellulases, proteases, lipases or other amylase enzymes. Additionally, it is provided.
  • compositions of the present invention may include an alpha- amylase mutant having more than one site-specific mutation.
  • compositions useful in starch processing and particularly starch liquefaction preferably comprise an alpha- amylase mutant having a substitution or deletion at position M1 5. Additionally, it is contemplated that such compositions may comprise additional components as known to those skilled in the art, including, for example, antioxidants, calcium, ions, etc.
  • a process aspect of the present invention there are provided methods for liquefying starch, and particularly granular starch slurries, from either a wet or dry milled process.
  • the starch slurry is gelatinized by heating at a relatively high temperature (up to about 1 10°C). After the starch slurry is gelatinized it is liquefied and dextrinized using an alpha-amylase.
  • a relatively high temperature up to about 1 10°C
  • the present method for liquefying starch comprises adding to a starch slurry an effective amount of an alpha-amylase of the present invention, alone or in combination with additional excipients such as an antioxidant, and reacting the slurry for an appropriate time and temperature to liquefy the starch.
  • a further aspect of the present invention comprises the DNA encoding the mutant alpha-amylases of the present invention (including A4 form and mutants thereof) and expression vectors encoding the DNA as well as host cells transformed with such expression vectors.
  • Fig. 1 shows the DNA sequence of the gene for alpha-amylase from B. licheniformis (NCIB8061 ), Seq ID No 31 , and deduced translation product as described in Gray, G. et al. (1 986) J. Bacter. 166:635-643.
  • Fig. 2 shows the amino acid sequence of the mature alpha-amylase enzyme from B. licheniformis (NCIB8061 ), Seq ID No 32.
  • Fig. 3 shows an alignment of primary structures of Bacillus alpha-amylases.
  • the B. licheniformis amylase (Am-Lich), Seq ID No 33 is described by Gray, G. et al. (1 986) J. Bact. 166:635-643; the B. amyloliquefaciens amylase (Am-Amylo), Seq ID No 34, is described by Takkinen, K. et al. ( 1 983) J. Biol. Chem. 258: 1007-101 3; and the B. stearothermophilus (Am-Stearo), Seq ID No 35, is described by Ihara, H. et al. (1 985) J. Biochem. 98:95-103.
  • Fig. 4a shows the amino acid sequence of the mature alpha-amylase variant M1 97T, Seq ID No 36.
  • Fig. 4b shows the amino acid sequence of the A4 form of alpha-amylase from B.
  • licheniformis NCIB8061 Seq ID No 37. Numbering is from the N-terminus, starting with the four additional alanines.
  • Fig. 5 shows plasmid pA4BL wherein BLAA refers to B. licheniformis alpha-amylase gene, PstI to SstI; Amp R refers to the ampicillin-resistant gene from pBR322; and CAT refers to the Chioramphenicol-resistant gene from pC1 94.
  • BLAA refers to B. licheniformis alpha-amylase gene, PstI to SstI
  • Amp R refers to the ampicillin-resistant gene from pBR322
  • CAT refers to the Chioramphenicol-resistant gene from pC1 94.
  • Fig. 6 shows the signal sequence-mature protein junctions for B. licheniformis (Seq ID No 38), B. subtilis (Seq ID No 39), B. licheniformis in pA4BL (Seq ID No 40) and B. licheniformis in pBLapr (Seq ID No 41 ).
  • Fig. 7a shows inactivation of certain alpha-amylases (Spezyme ® AA20 and M1 97L (A4 form) with 0.88M H 2 O 2 at pH 5.0, 25 °C.
  • Fig. 7b shows inactivation of certain alpha-amylases (Spezyme ® AA20, M1 97T) with 0.88M H 2 O 2 at pH 10.0, 25 °C.
  • Fig. 7c shows inactivation of certain alpha-amylases (Spezyme ® AA20, M1 5L) with 0.88M H 2 O 2 at pH 5.0, 25 °C.
  • Fig. 8 shows a schematic for the production of M1 97X cassette mutants.
  • Fig. 9 shows expression of M1 97X variants.
  • Fig. 10 shows thermal stability of M1 97X variants at pH 5.0, 5mM CaCI 2 at 95 °C for 5 mins.
  • Figs. 11a and 11b show inactivation of certain amylases in automatic dish care detergents.
  • Fig. 11a shows the stability of certain amylases in CascadeTM (a
  • Fig. 11b shows the stability of certain amylases in SunlightTM (a commercially available dish care product) at 65 °C in the presence or absence of starch.
  • Fig. 12 shows a schematic for the production of M15X cassette mutants.
  • Fig. 13 shows expression of M15X variants.
  • Fig. 14 shows specific activity of M15X variants on soluble starch.
  • Fig. 15 shows heat stability of M15X variants at 90°C, pH 5.0, 5mM CaCI 2 , 5 mins.
  • Fig. 16 shows specific activity on starch and soluble substrate, and performance in jet liquefaction at pH 5.5, of M15 variants as a function of percent activity of B.
  • Fig. 17 shows the inactivation of B. licheniformis alpha-amylase (AA20 at 0.65 mg/ml) with chloramine-T at pH 8.0 as compared to variants M197A (1.7 mg/ml) and M197L (1.7 mg/ml).
  • Fig. 18 shows the inactivation of B. licheniformis alpha-amylase (AA20 at 0.22 mg/ml) with chloramine-T at pH 4.0 as compared to variants M197A (4.3 mg/ml) and M197L (0.53 mg/ml).
  • Fig. 1 9 shows the reaction of B. licheniformis alpha-amylase (AA20 at 0.75 mg/ml) with chloramine-T at pH 5.0 as compared to double variants M1 97T/W1 38F (0.64 mg/ml) and M 1 97T ⁇ /1 38Y (0.60 mg/ml) .
  • amylases used in starch liquefaction may be subject to some form of inactivation due to some activity present in the starch slurry (see commonly owned US applications 07/785,624 and 07/785,623 and US Patent 5, 1 80,669, issued January 1 9, 1 993, incorporated herein by reference).
  • use of an amylase in the presence of oxidants, such as in bleach or peracid containing detergents may result in partial or complete inactivation of the amylase. Therefore, the present invention focuses on altering the oxidative sensitivity of amylases.
  • the mutant enzymes of the present invention may also have an altered pH profile and/or altered thermal stability which may be due to the enhanced oxidative stability of the enzyme at low or high pH's.
  • Alpha-amylase as used herein includes naturally occurring amylases as well as recombinant amylases.
  • Preferred amylases in the present invention are alpha-amylases derived from B. licheniformis or B. stearothermophilus, including the A4 form of alphaamylase derived from B. licheniformis as described herein, as well as fungal alphaamylases as those derived from Aspergillus (i.e. as A. oryzae and A. niger).
  • Recombinant alpha-amylases refers to an alpha-amylase in which the DNA sequence encoding the naturally occurring alpha-amylase is modified to produce a mutant DNA sequence which encodes the substitution, insertion or deletion of one or more amino acids in the alpha-amylase sequence. Suitable modification methods are disclosed herein, and also in commonly owned US Patents 4,760,025 and 5, 1 85,258, the disclosure of which are incorporated herein by reference.
  • B. licheniformis amylase is about 66% , as determined by Holm, L. et al. (1 990) Protein Engineering 3 (3) pp. 1 81 -1 91 .
  • the sequence homology between B. licheniformis and B. amyloliquefaciens amylases is about 81 %, as per Holm, L. et al., supra. While sequence homology is important, it is generally recognized that structural homology is also important in comparing amylases or other enzymes. For example, structural homology between fungal amylases and bacterial (Bacillus) amylase have been suggested and, therefore, fungal amylases are encompassed within the present invention.
  • An alpha-amylase mutant has an amino acid sequence which is derived from the amino acid sequence of a precursor alpha-amylase.
  • the precursor alpha-amylases include naturally occurring alpha-amylases and recombinant alpha-amylases (as defined).
  • the amino acid sequence of the alpha-amylase mutant is derived from the precursor alpha amylase amino acid sequence by the substitution, deletion or insertion of one or more amino acids of the precursor amino acid sequence.
  • Such modification is of the precursor DNA sequence which encodes the amino acid sequence of the precursor alpha-amylase rather than manipulation of the precursor alpha-amylase enzyme per se. Suitable methods for such manipulation of the precursor DNA sequence include methods disclosed herein and in commonly owned US patent 4,760,025 and
  • amino acid position number refers to the number assigned to the mature Bacillus licheniformis alpha-amylase sequence presented in Fig. 2.
  • the invention is not limited to the mutation of this particular mature alpha-amylase (B. licheniformis) but extends to precursor alpha-amylases containing amino acid residues at positions which are equivalent to the particular identified residue in B. licheniformis alpha-amylase.
  • a residue (amino acid) of a precursor alpha-amylase is equivalent to a residue of B.
  • licheniformis alpha-amylase if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in B. licheniformis alpha-amylase (i.e., having the same or similar functional capacity to combine, react, or interact chemically or structurally).
  • stearothermophilus enzyme has been modeled on that of Taka-amylase A (Holm, L. et al. (1990) Protein Engineering 3: 1 81 -1 91 ).
  • the four highly conserved regions shown in Fig. 3 contain many residues thought to be part of the active-site (Matsuura, Y. et al. (1 984) J. Biochem. (Tokyo) 95:697-702; Buisson, G. et al. ( 1 987) EMBO J. 6:3909- 391 6; Vihinen, M. et al. (1 990) J. Biochem. 107:267-272) including, in the
  • Expression vector refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of said DNA in a suitable host.
  • control sequences may include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome-binding sites, and sequences which control termination of transcription and translation.
  • a preferred promoter is the B. subtilis aprE promoter.
  • the vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.
  • plasmid and vector are sometimes used interchangeably as the.
  • plasmid is the most commonly used form of vector at present
  • the invention is intended to include such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.
  • Host strains (or cells) useful in the present invention generally are procaryotic or eucaryotic hosts and include any transformable microorganism in which the expression of alpha-amylase can be achieved.
  • host strains of the same species or genus from which the alpha-amylase is derived are suitable, such as a Bacillus strain
  • an alpha-amylase negative Bacillus strain (genes deleted) and/or an alphaamylase and protease deleted Bacillus strain such as Bacillus subtilis strain BG2473 ( ⁇ amyE, ⁇ apr , ⁇ npr) is used
  • Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the alpha-amylase and its variants (mutants) or expressing the desired alpha-amylase.
  • mutants of the present invention are secreted into the culture medium during fermentation Any suitable signal sequence, such as the aprE signal peptide, can be used to achieve secretion
  • alpha-amylase mutants of the present invention are useful in formulating various detergent compositions, particularly certain dish care cleaning compositions, especially those cleaning compositions containing known oxidants
  • Alpha-amylase mutants of the invention can be formulated into known powdered, liquid or gel detergents having pH between 6.5 to 1 2 0. Suitable granular composition may be made as described in commonly owned US patent applications 07/429,881 ,
  • detergent cleaning compositions can also contain other enzymes, such as known proteases, lipases, cellulases, endoglycosidases or other amylases, as well as builders, stabilizers or other excipients known to those skilled in the art. These enzymes can be present as co-granules or as blended mixes or in any other manner known to those skilled in the art. Furthermore, it is contemplated by the present invention that multiple mutants may be useful in cleaning or other applications. For example, a mutant enzyme having changes at both + 1 5 and + 1 97 may exhibit enhanced performance useful in a cleaning product or a multiple mutant comprising changes at + 197 and + 138 may have improved performance.
  • alpha-amylase mutants of the present invention may also be useful in the liquefaction of starch.
  • Starch liquefaction particularly granular starch slurry liquefaction, is typically carried out at near neutral pH's and high temperatures.
  • an oxidizing agent or inactivating agent of some sort is also present in typical liquefaction processes, which may affect the enzyme activity; thus, in these related patent applications an antioxidant is added to the process to protect the enzyme.
  • preferred mutants of the present invention for use in liquefaction processes comprise mutants exhibiting altered pH performance profiles (i.e., low pH profile, pH ⁇ 6 and preferably pH ⁇ 5.5), and/or altered thermal stability (i.e., high temperature, about 90°-1 10°C), and/or altered oxidative stability (i.e., enhanced oxidative stability).
  • an improved method for liquefying starch comprising liquefying a granular starch slurry from either a wet or dry milling process at a pH from about 4 to 6 by adding an effective amount of an alpha-amylase mutant of the present invention to the starch slurry; optionally adding an effective amount of an antioxidant or other excipient to the slurry; and reacting the slurry for an appropriate time and temperature to liquefy the starch.
  • the alpha-amylase gene (Fig. 1 ) was cloned from B. licheniformis NCIB8061 obtained from the National Collection of Industrial Bacteria, Aberdeen, Scotland (Gray, G. et al. (1 986) J. Bacteriology 166:635-643).
  • the 1 .72kb Pstl-Sstl fragment, encoding the last three residues of the signal sequence; the entire mature protein and the terminator region was subcloned into M1 3MP1 8.
  • a synthetic terminator was added between the Bell and SstI sites using a synthetic oligonucleotide cassette of the form:
  • Seq ID No 1 designed to contain the B. amyloliquefaciens subtilisin transcriptional terminator (Wells et al. (1983) Nucleic Acid Research 1 1 :791 1 -7925).
  • oligonucleotides used essentially the protocol of Zoller, M. et al. (1 983) Meth. Enzymol. 100:468-500: briefly, 5'-phosphorylated oligonucleotide primers were used to introduce the desired mutations on the M1 3 single-stranded DNA template using the oligonucleotides listed in Table I to substitute for each of the seven methionines found in B. licheniformis alpha-amylase. Each mutagenic oligonucleotide also introduced a restriction endonuclease site to use as a screen for the linked mutation.
  • Bold letter indicate base changes introduced by oligonucleotide.
  • Underlining indicates restriction endonuclease site introduced by oligonucleotide.
  • the heteroduplex was used to transfect E. coli mutL cells (Kramer et al. (1984) Cell 38:879) and, after plaque-purification, clones were analyzed by restriction analysis of the RFI 's. Positives were confirmed by dideoxy sequencing (Sanger et al. ( 1 977) Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467) and the Pstl-SstI fragments for each subcloned into an E. coli vector, plasmid pA4BL.
  • licheniformis alpha-amylase gave pA4BL (Fig. 5) having the resulting aprE signal peptide-amylase junction as shown in Fig. 6.
  • pA4BL is a plasmid able to replicate in E. coli and integrate into the B. subtilis chromosome. Plasmids containing different variants were transformed into B. subtilis (Anagnostopoulos, C. and Spizizen, J. ( 1 961 ) J. Bacter. 81 :741 -746) and integrated into the chromosome at the aprE locus by a Campbell-type mechanism (Young, M.
  • Bacillus subtilis strain BG2473 was a derivative of 11 68 which had been deleted for amylase (LamyE) and two proteases (Aapr, Lnpr) (Stahl, M.L. and Ferrari, E., J. Bacter. 158:41 1 -41 8 and US Patent
  • B. licheniformis alpha-amylase such as Spezyme ® AA20 (commercially available from Genencor International, Inc.), is inactivated rapidly in the presence of hydrogen peroxide (Fig. 7).
  • Various methionine variants were expressed in shake-flask cultures of B. subtilis and the crude supernatants purified by ammonium sulphate cuts. The amylase was precipitated from a 20% saturated ammonium sulphate supernatant by raising the ammonium sulphate to 70% saturated, and then resuspended. The variants were then exposed to 0.88M hydrogen peroxide at pH 5.0, at 25 °C. Variants at six of the methionine positions in B.
  • licheniformis alpha-amylase were still subject to oxidation by peroxide while the substitution at position + 1 97 (M 1 97L) showed resistance to peroxide oxidation. (See Fig. 7.) However, subsequent analysis described in further detail below showed that while a variant may be susceptible to oxidation at pH 5.0, 25 °C, it may exhibit altered/enhanced properties under different conditions (i.e., liquefaction).
  • M1 97 variants (M1 97X) were produced in the A4 form by cassette mutagenesis, as outlined in Fig. 8:
  • Clal- Seq ID No 11 which also inserted an EcoRV site (codons 200-201 ) to replace the Clal site (codons 201 -202). (codons 201 -202).
  • primer LAAM1 2 (Table II) was used to introduce another silent restriction site (BstBI) over codons 1 86-1 88.
  • the cassettes were designed to destroy the EcoRV site upon ligation, thus plasmids from E. coli transformants were screened for loss of this unique site.
  • the common bottom strand of the cassette contained a frame-shift and encoded a Nsil site, thus transformants derived from this strand could be eliminated by screening for the presence of the unique Nsil site and would not be expected, in any case, to lead to expression of active amylase.
  • Soluble Substrate Assay A rate assay was developed based on an end-point assay kit supplied by Megazyme (Aust.) Pty. Ltd.: Each vial of substrate (p-nitrophenyl maltoheptaoside, BPNPG7) was dissolved in 1 0ml of sterile water, followed by a 1 to 4 dilution in assay buffer (50mM maleate buffer, pH 6.7, 5mM calcium chloride, 0.002% Tween20). Assays were performed by adding 1 0 ⁇ l of amylase to 790 ⁇ l of the substrate in a cuvette at 25 °C. Rates of hydrolysis were measured as the rate of change of absorbance at 410nm, after a delay of 75 seconds. The assay was linear up to rates of 0.4 absorption units/min.
  • amylase protein concentration was measured using the standard Bio-Rad assay (Bio-Rad Laboratories) based on the method of Bradford, M. ( 1 976) Anal. Biochem. 72:248) using bovine serum albumin standards.
  • V volume of sample (5ml)
  • Variant M1 5L made as per the prior examples did not show increased amylase activity (Table III) and was still inactivated by hydrogen peroxide (Fig. 7). It did, however, show significantly increased performance in jet-liquefaction of starch, especially at low pH as shown in Table IV below.
  • Starch liquefaction was typically performed using a Hydroheater M 103-M steam jet equipped with a 2.5 liter delay coil behind the mixing chamber and a terminal back pressure valve. Starch was fed to the jet by a Moyno pump and steam was supplied by a 1 50 psi steam line, reduced to 90-100 psi. Temperature probes were installed just after the Hydroheater jet and just before the back pressure valve.
  • Starch slurry was obtained from a corn wet miller and used within two days. The starch was diluted to the desired solids level with deionized water and the pH of the starch was adjusted with 2% NaOH or saturated Na 2 CO 3 . Typical liquefaction conditions were: Starch 32%-35 % solids
  • Starch was introduced into the jet at about 350 ml/min. The jet temperature was held at 105 °-107 °C. Samples of starch were transferred from the jet cooker to a 95 °C second stage liquefaction and held for 90 minutes.
  • the degree of starch liquefaction was measured immediately after the second stage liquefaction by determining the dextrose equivalence (DE) of the sample and by testing for the presence of raw starch, both according to the methods described in the Standard Analytical Methods of the Member Companies of the Corn Refiners
  • Starch when treated generally under the conditions given above and at pH 6.0, will yield a liquefied starch with a DE of about 10 and with no raw starch. Results of starch liquefaction tests using mutants of the present invention are provided in Table IV.
  • Site directed mutagenesis (via primer extension in M1 3) was used to introduce unique restriction sites flanking the M1 5 codon to facilitate insertion of a mutagenesis cassette. Specifically, a BstB1 site at codons 1 1 -13 and a Msc1 site at codons 18-20 were introduced using the two oligonucleotides shown below.
  • Msc1 Seq ID No 49 2 The vector for M1 5X cassette mutagenesis was then constructed by subcloning the Sfi 1 -Sstll fragment from the mutagenized amylase (BstB1 + , Msc1 + ) into plasmid pBLapr. The resulting plasmid was then digested with BstB1 and Msd and the large vector fragment isolated by electroelution from a polyacrylamide gel.
  • Mutagenesis cassettes were created as with the M1 97X variants. Synthetic oligomers, each encoding a substitution at codon 1 5, were annealed to a common bottom primer. Upon proper ligation of the cassette to the vector, the Msc1 is destroyed allowing for screening of positive transformants by loss of this site.
  • the bottom primer contains an unique SnaB1 site allowing for the transformants derived from the bottom strand to be eliminated by screening for the SnaBI site. This primer also contains a frameshift which would also eliminate amylase expression for the mutants derived from the common bottom strand.
  • Eleven alpha-amylase variants with substitutions for M1 5 made as per Example 5 were assayed for activity, as compared to Spezyme ® AA20 (commercially available from Genencor International, Inc.) in liquefaction at pH 5.5 using a bench liquefaction system.
  • the bench scale liquefaction system consisted of a stainless steel coil (0.25 inch diameter, approximately 350 ml volume) equipped with a 7 inch long static mixing element approximately 1 2 inches from the anterior end and a 30 psi back pressure valve at the posterior end. The coil, except for each end, was immersed in a glycerol- water bath equipped with thermostatically controlled heating elements that maintained the bath at 105-106°C.
  • amylase activity (measured in the soluble substrate assay) expressed by the M1 97X (A4 form) variants.
  • the amylases were partially purified from the supematants by precipitation with two volumes of ethanol and resuspension. They were then screened for thermal stability (Fig. 10) by heating at 95 °C for 5 minutes in 10mM acetate buffer pH 5.0, in the presence of 5mM calcium chloride; the A4 wild-type retained 28% of its activity after incubation.
  • M197W and M197P we were unable to recover active protein from the supernatants.
  • the M197H variant was found to contain a second mutation, N190K.
  • M197L was examined in a separate experiment and was one of the lowest thermally stable variants. There appears to be a broad correlation between expression of amylase activity and thermal stability.
  • the licheniformis amylase is restricted in what residues it can accommodate at position 197 in terms of retaining or enhancing thermal stability: cysteine and threonine are preferred for maximal thermal stability under these conditions whereas alanine and isoleucine are of intermediate stability.
  • other substitutions at position + 197 result in lowered thermal stability which may be useful for other applications.
  • different substitutions at + 197 may have other beneficial properties, such as altered pH performance profile or altered oxidative stability.
  • the M197C variant was found to inactivate readily by air oxidation but had enhanced thermal stability.
  • both M197T and M197A retained not only high thermal stability (Fig. 10), but also high activity (Table III), while maintaining resistance to inactivation by peroxide at pH 5 to pH 10 (Fig. 7).
  • the stability of the M197T (A4 form), M1 97T and M197A (A4 form) was measured in automatic dish care detergent (ADD) matrices. 2ppm SavinaseTM (a protease,
  • both forms of the M1 97T variant were much more stable than TermamylTM and M1 97A (A4 form), which were inactivated before the first assay could be performed.
  • This stability benefit was seen in the presence or absence of starch as determined by the following protocol. Amylases were added to 5ml of ADD and Savinase'", prewarmed in a test tube and, after vortexing, activities were assayed as a function of time, using the soluble substrate assay.
  • the " + starch” tube had spaghetti starch baked onto the sides (140°C, 60 mins.). The results are shown in Figs. 1 1 a and 1 1 b.
  • All M1 5X variants were propagated in Bacillus subtilis and the expression level monitored as shown in Fig. 1 3.
  • the amylase was isolated and partially purified by a 20-70% ammonium sulfate cut. The specific activity of these variants on the soluble substrate was determined as per Example 3 (Fig. 14). Many of the M1 5X amylases have specific activities greater than that of Spezyme ® AA20.
  • a benchtop heat stability assay was performed on the variants by heating the amylase at 90°C for 5 min. in 50 mM acetate buffer pH 5 in the presence of 5 mM CaCI 2 (Fig. 15). Most of the variants performed as well as Spezyme ® AA20 in this assay.
  • Chloramine-T sodium N-chloro-p-toluenesulfonimide
  • chloramine-T will modify both methionine and tryptophan (Schechter, Y., Burstein, Y. and Patchornik, A. ( 1 975) Biochemistry 14 (20) 4497-4503).
  • Fig. 1 7 shows the inactivation of B.
  • W1 38 (F, Y and A) were made as double mutants, with M1 97T (made as per the disclosure of Example 3).
  • the double mutants were made following the methods described in Examples 1 and 3.
  • single negative strands of DNA were prepared from an M13MP18 clone of the 1.72kb coding sequence (Pst l-Sst I) of the B. licheniformis alpha-amylase M1 97T mutant.
  • Site-directed mutagenesis was done using the primers listed below, essentially by the method of Zoller, M. et al.
  • T4 gene 32 protein and T4 polymerase were substituted for klenow.
  • the primers all contained unique sites, as well as the desired mutation, in order to identify those clones with the appropriate mutation.
  • mutants W138L, W138H and W1 38C were made by ligating synthetic cassettes into the pBLapr (BspE I, Xma I) vector using the following primers:
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:10:
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:27:
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • GACTGTCCAA ACATGGTTTA AGCCGCTTGC TTACGCTTTT ATTCTCACAA GGGAATCTGG 1320
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Abstract

Novel alpha-amylase mutants derived from the DNA sequences of naturally occurring or recombinant alpha-amylases are disclosed. The mutant alpha-amylases, in general, are obtained by in vitro modifications of a precursor DNA sequence encoding the naturally occurring or recombinant alpha-amylase to generate the substitution (replacement) or deletion of one or more oxidizable amino acid residues in the amino acid sequence of a precursor alpha-amylase. Such mutant alpha-amylases have altered oxidative stability and/or altered pH performance profiles and/or altered thermal stability as compared to the precursor. Also disclosed are detergent and starch liquefaction compositions comprising the mutant amylases, as well as methods of using the mutant amylases.

Description

OXIDATIVELY STABLE ALPHA-AMYLASE
Related Applications
This application is a continuation-in-part of USSN 08/01 6,395 filed February 1 1 , 1 993.
Field of the Invention
The present invention relates to novel alpha-amylase mutants having an amino acid sequence not found in nature, such mutants having an amino acid sequence wherein one or more amino acid residue(s) of a precursor alpha-amylase, specifically any oxidizable amino acid, have been substituted with a different amino acid. The mutant enzymes of the present invention exhibit altered stability/activity profiles including but not limited to altered oxidative stability, altered pH performance profile, altered specific activity and/or altered thermostability.
Background of the Invention
Alpha-amylases (alpha-1 ,4-glucan-4-glucanohydrolase, EC3.2.1 .1 ) hydrolyze internal alpha-1 ,4-glucosidic linkages in starch largely at random, to produce smaller molecular weight malto-dextrins. Alpha-amylases are of considerable commercial value, being used in the initial stages (liquefaction) of starch processing; in alcohol production; as cleaning agents in detergent matrices; and in the textile industry for starch desizing. Alpha-amylases are produced by a wide variety of microorganisms including Bacillus and Aspergillus, with most commercial amylases being produced from bacterial sources such as B. licheniformis, B. amyloliquefaciens, B. subtilis, or B. stearothermophilus. In recent years the preferred enzymes in commercial use have been those from B.
licheniformis because of their heat stability and performance, at least at neutral and mildly alkaline pH's.
Previously there have been studies using recombinant DNA techniques to explore which residues are important for the catalytic activity of amylases and/or to explore the effect of modifying certain amino acids within the active site of various amylases (Vihinen, M. et al. (1 990) J. Bichem. 107:267-272; Holm, L. et al. ( 1 990) Protein Engineering 3: 1 81 -1 91 ; Takase, K. et al. ( 1 992) Biochemica et Biophysica Acta, 1 120:281 -288; Matsui, I. et al. ( 1 992) Febs Letters Vol. 310, No. 3, pp. 21 6-21 8); which residues are important for thermal stability (Suzuki, Y. et al. ( 1 989) J. Biol. Chem. 264: 1 8933- 18938); and one group has used such methods to introduce mutations at various histidine residues in a B. licheniformis amylase, the rationale for making substitutions at histidine residues was that B. licheniformis amylase (known to be thermostable) when compared to other similar Bacillus amylases, has an excess of histidines and, therefore, it was suggested that replacing a histidine could affect the thermostability of the enzyme (Declerck, N. et al. ( 1 990) J. Biol. Chem. 265: 1 5481 -1 5488; FR 2 665 1 78- A1 ; Joyet, P. et al. ( 1 992) Bio/Technology 10: 1 579-1 583).
It has been found that alpha-amylase is inactivated by hydrogen peroxide and other oxidants at pH's between 4 and 1 0.5 as described in the examples herein.
Commercially, alpha-amylase enzymes can be used under dramatically different conditions such as both high and low pH conditions, depending on the commercial application. For example, alpha-amylases may be used in the liquefaction of starch, a process preferably performed at a low pH (pH < 5.5). On the other hand, amylases may be used in commercial dish care or laundry detergents, which often contain oxidants such as bleach or peracids, and which are used in much more alkaline conditions.
In order to alter the stability or activity profile of amylase enzymes under varying conditions, it has been found that selective replacement, substitution or deletion of oxidizable ammo acids, such as a methionine, tryptophan, tyrosine, histidine or cysteine, results in an altered profile of the variant enzyme as compared to its precursor. Because currently commercially available amylases are not acceptable (stable) under various conditions, there is a need for an amylase having an altered stability and/or activity profile This altered stability (oxidative, thermal or pH
performance profile) can be achieved while maintaining adequate enzymatic activity, as compared to the wild-type or precursor enzyme. The characteristic affected by introducing such mutations may be a change in oxidative stability while maintaining thermal stability or vice versa. Additionally, the substitution of different ammo acids for an oxidizable ammo acids in the alpha-amylase precursor sequence or the deletion of one or more oxidizable ammo acιd(s) may result in altered enzymatic activity at a pH other than that which is considered optimal for the precursor alpha-amylase. In other words, the mutant enzymes of the present invention may also have altered pH performance profiles, which may be due to the enhanced oxidative stability of the enzyme.
Summary of the Invention
The present invention relates to novel alpha-amylase mutants that are the expression product of a mutated DNA sequence encoding an alpha-amylase, the mutated DNA sequence being derived from a precursor alpha-amylase by the deletion or substitution (replacement) of one or more oxidizable ammo acid. In one preferred embodiment of the present invention the mutant result from substituting a different amino acid for one or more methionine residue(s) in the precursor alpha-amylase. In another embodiment of the present invention the mutants comprise a substitution of one or more tryptophan residue alone or in combination with the substitution of one or more methionine residue in the precursor alpha-amylase. Such mutant alpha-amylases, in general, are obtained by in vitro modification of a precursor DNA sequence encoding a naturally occurring or recombinant alpha-amylase to encode the substitution or deletion of one or more amino acid residues in a precursor amino acid sequence.
Preferably the substitution or deletion of one or more amino acid in the amino acid sequence is due to the replacement or deletion of one or more methionine, tryptophan, cysteine, histidine or tyrosine residues in such sequence, most preferably the residue which is changed is a methionine residue. The oxidizable amino acid residues may be replaced by any of the other 20 naturally occurring amino acids. If the desired effect is to alter the oxidative stability of the precursor, the amino acid residue may be substituted with a non-oxidizable amino acid (such as alanine, arginine, asparagine, aspartic acid, glutamic acid, glutamine, glycine, isoleucine, leucine, lysine,
phenylalanine, proline, serine, threonine, or valine) or another oxidizable amino acid (such as cysteine, methionine, tryptophan, tyrosine or histidine, listed in order of most easily oxidizable to less readily oxidizable). Likewise, if the desired effect is to alter thermostability, any of the other 20 naturally occurring amino acids may be substituted (i.e., cysteine may be substituted for methionine).
Preferred mutants comprise the substitution of a methionine residue equivalent to any of the methionine residues found in B. licheniformis alpha-amylase ( + 8, + 1 5, + 1 97, + 256, + 304, + 366 and +438). Most preferably the methionine to be replaced is a methionine at a position equivalent to position + 1 97 or + 1 5 in B. licheniformis alpha- amylase. Preferred substitute amino acids to replace the methionine at position + 1 97 are alanine (A), isoleucine (I), threonine (T) or cysteine (C). The preferred substitute amino acids at position + 1 5 are leucine (L), threonine (T), asparagine (N), aspartate (D), serine (S), valine (V) and isoleucine (I), although other substitute amino acids not specified above may be useful. Two specifically preferred mutants of the present invention are M1 97T and M1 5L.
Another embodiment of this invention relates to mutants comprising the substitution of a tryptophan residue equivalent to any of the tryptophan residues found in B.
licheniformis alpha-amylase (see Fig. 2). Preferably the tryptophan to be replaced is at a position equivalent to + 1 38 in B. licheniformis alpha-amylase. A mutation
(substitution) at a tryptophan residue may be made alone or in combination with mutations at other oxidizable amino acid residues. Specifically, it may be advantageous to modify by substitution at least one tryptophan in combination with at least one methionine (for example, the double mutant + 1 38/+ 1 97).
The alpha-amylase mutants of the present invention, in general, exhibit altered oxidative stability in the presence of hydrogen peroxide and other oxidants such as bleach or peracids, or, more specific, milder oxidants such as chloramine-T. Mutant enzymes having enhanced oxidative stability will be useful in extending the shelf life and bleach, perborate, percarbonate or peracid compatibility of amylases used in cleaning products. Similarly, reduced oxidative stability may be useful in industrial processes that require the rapid and efficient quenching of enzymatic activity. The mutant enzymes of the present invention may also demonstrate a broadened pH performance profile whereby mutants such as M1 5L show stability for low pH starch liquefaction and mutants such as M1 97T show stability at high pH cleaning product conditions. The mutants of the present invention may also have altered thermal stability whereby the mutant may have enhanced stability at either high or low temperatures. It is understood that any change (increase or decrease) in the mutant's enzymatic characteristic(s), as compared to its precursor, may be beneficial depending on the desired end use of the mutant alpha-amylase.
In addition to starch processing and cleaning applications, variant amylases of the present invention may be used in any application in which known amylases are used, for example, variant amylases can be used in textile processing, food processing, etc. Specifically, it is contemplated that a variant enzyme such as M 1 97C, which is easily inactivated by oxidation, would be useful in a process where it is desirable to completely remove amylase activity at the end of the process, for example, in frozen food processing applications.
The preferred alpha-amylase mutants of the present invention are derived from a Bacillus strain such as B. licheniformis, B. amylo/iquefaciens, and B.
stearothermophilus, and most preferably from Bacillus licheniformis.
In another aspect of the present invention there is provided a novel form of the alpha- amylase normally produced by B. licheniformis. This novel form, designated as the A4 form, has an additional four alanine residues at the N-terminus of the secreted amylase. (Fig. 4b.) Derivatives or mutants of the A4 form of alpha-amylase are encompassed within the present invention. By derivatives or mutants of the A4 form, it is meant that the present invention comprises the A4 form alpha-amylase containing one or more additional mutations such as, for example, mutation (substitution, replacement or deletion) of one or more oxidizable amino acid(s).
In a composition embodiment of the present invention there are provided detergent compositions, liquid, gel or granular, comprising the alpha-amylase mutants described herein. Particularly preferred are detergent compositions comprising a + 1 97 position mutant either alone or in combination with other enzymes such as endoglycosidases, cellulases, proteases, lipases or other amylase enzymes. Additionally, it is
contemplated that the compositions of the present invention may include an alpha- amylase mutant having more than one site-specific mutation.
In yet another composition embodiment of the present invention there are provided compositions useful in starch processing and particularly starch liquefaction. The starch liquefaction compositions of the present invention preferably comprise an alpha- amylase mutant having a substitution or deletion at position M1 5. Additionally, it is contemplated that such compositions may comprise additional components as known to those skilled in the art, including, for example, antioxidants, calcium, ions, etc.
In a process aspect of the present invention there are provided methods for liquefying starch, and particularly granular starch slurries, from either a wet or dry milled process. Generally, in the first step of the starch degradation process, the starch slurry is gelatinized by heating at a relatively high temperature (up to about 1 10°C). After the starch slurry is gelatinized it is liquefied and dextrinized using an alpha-amylase. The conditions for such liquefaction are described in commonly assigned US patent applications 07/785,624 and 07/785,623 and US Patent 5, 1 80,669, the disclosure of which are incorporated herein by reference. The present method for liquefying starch comprises adding to a starch slurry an effective amount of an alpha-amylase of the present invention, alone or in combination with additional excipients such as an antioxidant, and reacting the slurry for an appropriate time and temperature to liquefy the starch.
A further aspect of the present invention comprises the DNA encoding the mutant alpha-amylases of the present invention (including A4 form and mutants thereof) and expression vectors encoding the DNA as well as host cells transformed with such expression vectors.
Brief Description of the Drawings
Fig. 1 shows the DNA sequence of the gene for alpha-amylase from B. licheniformis (NCIB8061 ), Seq ID No 31 , and deduced translation product as described in Gray, G. et al. (1 986) J. Bacter. 166:635-643.
Fig. 2 shows the amino acid sequence of the mature alpha-amylase enzyme from B. licheniformis (NCIB8061 ), Seq ID No 32.
Fig. 3 shows an alignment of primary structures of Bacillus alpha-amylases. The B. licheniformis amylase (Am-Lich), Seq ID No 33, is described by Gray, G. et al. (1 986) J. Bact. 166:635-643; the B. amyloliquefaciens amylase (Am-Amylo), Seq ID No 34, is described by Takkinen, K. et al. ( 1 983) J. Biol. Chem. 258: 1007-101 3; and the B. stearothermophilus (Am-Stearo), Seq ID No 35, is described by Ihara, H. et al. (1 985) J. Biochem. 98:95-103.
Fig. 4a shows the amino acid sequence of the mature alpha-amylase variant M1 97T, Seq ID No 36. Fig. 4b shows the amino acid sequence of the A4 form of alpha-amylase from B.
licheniformis NCIB8061 , Seq ID No 37. Numbering is from the N-terminus, starting with the four additional alanines.
Fig. 5 shows plasmid pA4BL wherein BLAA refers to B. licheniformis alpha-amylase gene, PstI to SstI; AmpR refers to the ampicillin-resistant gene from pBR322; and CAT refers to the Chioramphenicol-resistant gene from pC1 94.
Fig. 6 shows the signal sequence-mature protein junctions for B. licheniformis (Seq ID No 38), B. subtilis (Seq ID No 39), B. licheniformis in pA4BL (Seq ID No 40) and B. licheniformis in pBLapr (Seq ID No 41 ).
Fig. 7a shows inactivation of certain alpha-amylases (Spezyme® AA20 and M1 97L (A4 form) with 0.88M H2O2 at pH 5.0, 25 °C.
Fig. 7b shows inactivation of certain alpha-amylases (Spezyme® AA20, M1 97T) with 0.88M H2O2 at pH 10.0, 25 °C.
Fig. 7c shows inactivation of certain alpha-amylases (Spezyme® AA20, M1 5L) with 0.88M H2O2 at pH 5.0, 25 °C.
Fig. 8 shows a schematic for the production of M1 97X cassette mutants.
Fig. 9 shows expression of M1 97X variants.
Fig. 10 shows thermal stability of M1 97X variants at pH 5.0, 5mM CaCI2 at 95 °C for 5 mins.
Figs. 11a and 11b show inactivation of certain amylases in automatic dish care detergents. Fig. 11a shows the stability of certain amylases in Cascade™ (a
commercially available dish care product) at 65°C in the presence or absence of starch. Fig. 11b shows the stability of certain amylases in Sunlight™ (a commercially available dish care product) at 65 °C in the presence or absence of starch.
Fig. 12 shows a schematic for the production of M15X cassette mutants.
Fig. 13 shows expression of M15X variants.
Fig. 14 shows specific activity of M15X variants on soluble starch.
Fig. 15 shows heat stability of M15X variants at 90°C, pH 5.0, 5mM CaCI2, 5 mins.
Fig. 16 shows specific activity on starch and soluble substrate, and performance in jet liquefaction at pH 5.5, of M15 variants as a function of percent activity of B.
licheniformis wild-type.
Fig. 17 shows the inactivation of B. licheniformis alpha-amylase (AA20 at 0.65 mg/ml) with chloramine-T at pH 8.0 as compared to variants M197A (1.7 mg/ml) and M197L (1.7 mg/ml).
Fig. 18 shows the inactivation of B. licheniformis alpha-amylase (AA20 at 0.22 mg/ml) with chloramine-T at pH 4.0 as compared to variants M197A (4.3 mg/ml) and M197L (0.53 mg/ml).
Fig. 1 9 shows the reaction of B. licheniformis alpha-amylase (AA20 at 0.75 mg/ml) with chloramine-T at pH 5.0 as compared to double variants M1 97T/W1 38F (0.64 mg/ml) and M 1 97TΛΛ/1 38Y (0.60 mg/ml) .
Detailed Description of the Invention
It is believed that amylases used in starch liquefaction may be subject to some form of inactivation due to some activity present in the starch slurry (see commonly owned US applications 07/785,624 and 07/785,623 and US Patent 5, 1 80,669, issued January 1 9, 1 993, incorporated herein by reference). Furthermore, use of an amylase in the presence of oxidants, such as in bleach or peracid containing detergents, may result in partial or complete inactivation of the amylase. Therefore, the present invention focuses on altering the oxidative sensitivity of amylases. The mutant enzymes of the present invention may also have an altered pH profile and/or altered thermal stability which may be due to the enhanced oxidative stability of the enzyme at low or high pH's.
Alpha-amylase as used herein includes naturally occurring amylases as well as recombinant amylases. Preferred amylases in the present invention are alpha-amylases derived from B. licheniformis or B. stearothermophilus, including the A4 form of alphaamylase derived from B. licheniformis as described herein, as well as fungal alphaamylases as those derived from Aspergillus (i.e. as A. oryzae and A. niger).
Recombinant alpha-amylases refers to an alpha-amylase in which the DNA sequence encoding the naturally occurring alpha-amylase is modified to produce a mutant DNA sequence which encodes the substitution, insertion or deletion of one or more amino acids in the alpha-amylase sequence. Suitable modification methods are disclosed herein, and also in commonly owned US Patents 4,760,025 and 5, 1 85,258, the disclosure of which are incorporated herein by reference.
Homologies have been found between almost all endo-amylases sequenced to date, ranging from plants, mammals, and bacteria (Nakajima, R.T. et al. ( 1 986) Appl.
Microbiol. Biotechnol. 23:355-360; Rogers, J.C. (1 985) Biochem. Biophys. Res.
Commun. 128:470-476). There are four areas of particularly high homology in certain Bacillus amylases, as shown in Fig. 3, wherein the underlined sections designate the areas of high homology. Further, sequence alignments have been used to map the relationship between Bacillus endo-amylases (Feng, D.F. and Doolittle, R.F. ( 1 987) J. Molec. Evol. 35:351 -360). The relative sequence homology between B.
stearothermophilus and B. licheniformis amylase is about 66% , as determined by Holm, L. et al. (1 990) Protein Engineering 3 (3) pp. 1 81 -1 91 . The sequence homology between B. licheniformis and B. amyloliquefaciens amylases is about 81 %, as per Holm, L. et al., supra. While sequence homology is important, it is generally recognized that structural homology is also important in comparing amylases or other enzymes. For example, structural homology between fungal amylases and bacterial (Bacillus) amylase have been suggested and, therefore, fungal amylases are encompassed within the present invention.
An alpha-amylase mutant has an amino acid sequence which is derived from the amino acid sequence of a precursor alpha-amylase. The precursor alpha-amylases include naturally occurring alpha-amylases and recombinant alpha-amylases (as defined). The amino acid sequence of the alpha-amylase mutant is derived from the precursor alpha amylase amino acid sequence by the substitution, deletion or insertion of one or more amino acids of the precursor amino acid sequence. Such modification is of the precursor DNA sequence which encodes the amino acid sequence of the precursor alpha-amylase rather than manipulation of the precursor alpha-amylase enzyme per se. Suitable methods for such manipulation of the precursor DNA sequence include methods disclosed herein and in commonly owned US patent 4,760,025 and
5,1 85,258.
Specific residues corresponding to positions M 1 97, M 1 5 and W1 38 of Bacillus licheniformis alpha-amylase are identified herein for substitution or deletion, as are all methionine, histidine, tryptophan, cysteine and tyrosine positions. The amino acid position number (i.e., + 1 97) refers to the number assigned to the mature Bacillus licheniformis alpha-amylase sequence presented in Fig. 2. The invention, however, is not limited to the mutation of this particular mature alpha-amylase (B. licheniformis) but extends to precursor alpha-amylases containing amino acid residues at positions which are equivalent to the particular identified residue in B. licheniformis alpha-amylase. A residue (amino acid) of a precursor alpha-amylase is equivalent to a residue of B.
licheniformis alpha-amylase if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in B. licheniformis alpha-amylase (i.e., having the same or similar functional capacity to combine, react, or interact chemically or structurally).
In order to establish homology to primary structure, the amino acid sequence of a precursor alpha-amylase is directly compared to the B. licheniformis alpha-amylase primary sequence and particularly to a set of residues known to be invariant to all alpha-amylases for which sequence is known, as seen in Fig. 3. It is possible also to determine equivalent residues by tertiary structure: crystal structures have been reported for porcine pancreatic alpha-amylase (Buisson, G. et al. ( 1 987) EMBO
J.6:3909-391 6); Taka-amylase A from Aspergillus oryzae (Matsuura, Y. et al. ( 1 984) J. Biochem. (Tokyo) 95:697-702); and an acid alpha-amylase from A. niger (Boel, E. et al. (1 990) Biochemistry 29:6244-6249), with the former two structures being similar. There are no published structures for Bacillus alpha-amylases, although there are predicted to be common super-secondary structures between glucanases (MacGregor, E.A. & Svensson, B. (1 989) Biochem. J. 259: 145-1 52) and a structure for the B.
stearothermophilus enzyme has been modeled on that of Taka-amylase A (Holm, L. et al. (1990) Protein Engineering 3: 1 81 -1 91 ). The four highly conserved regions shown in Fig. 3 contain many residues thought to be part of the active-site (Matsuura, Y. et al. (1 984) J. Biochem. (Tokyo) 95:697-702; Buisson, G. et al. ( 1 987) EMBO J. 6:3909- 391 6; Vihinen, M. et al. (1 990) J. Biochem. 107:267-272) including, in the
licheniformis numbering, His105; Arg229; Asp231 ; His235; Glu261 and Asp328.
Expression vector as used herein refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of said DNA in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome-binding sites, and sequences which control termination of transcription and translation. A preferred promoter is the B. subtilis aprE promoter. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, plasmid and vector are sometimes used interchangeably as the. plasmid is the most commonly used form of vector at present However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.
Host strains (or cells) useful in the present invention generally are procaryotic or eucaryotic hosts and include any transformable microorganism in which the expression of alpha-amylase can be achieved. Specifically, host strains of the same species or genus from which the alpha-amylase is derived are suitable, such as a Bacillus strain Preferably an alpha-amylase negative Bacillus strain (genes deleted) and/or an alphaamylase and protease deleted Bacillus strain such as Bacillus subtilis strain BG2473 (ΔamyE,Δapr ,Δnpr) is used Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the alpha-amylase and its variants (mutants) or expressing the desired alpha-amylase.
Preferably the mutants of the present invention are secreted into the culture medium during fermentation Any suitable signal sequence, such as the aprE signal peptide, can be used to achieve secretion
Many of the alpha-amylase mutants of the present invention are useful in formulating various detergent compositions, particularly certain dish care cleaning compositions, especially those cleaning compositions containing known oxidants Alpha-amylase mutants of the invention can be formulated into known powdered, liquid or gel detergents having pH between 6.5 to 1 2 0. Suitable granular composition may be made as described in commonly owned US patent applications 07/429,881 ,
07/533,721 and 07/957,973, all of which are incorporated herein by reference. These detergent cleaning compositions can also contain other enzymes, such as known proteases, lipases, cellulases, endoglycosidases or other amylases, as well as builders, stabilizers or other excipients known to those skilled in the art. These enzymes can be present as co-granules or as blended mixes or in any other manner known to those skilled in the art. Furthermore, it is contemplated by the present invention that multiple mutants may be useful in cleaning or other applications. For example, a mutant enzyme having changes at both + 1 5 and + 1 97 may exhibit enhanced performance useful in a cleaning product or a multiple mutant comprising changes at + 197 and + 138 may have improved performance.
As described previously, alpha-amylase mutants of the present invention may also be useful in the liquefaction of starch. Starch liquefaction, particularly granular starch slurry liquefaction, is typically carried out at near neutral pH's and high temperatures. As described in commonly owned US applications 07/788,624 and 07/785,623 and US Patent 5,180,669, it appears that an oxidizing agent or inactivating agent of some sort is also present in typical liquefaction processes, which may affect the enzyme activity; thus, in these related patent applications an antioxidant is added to the process to protect the enzyme.
Based on the conditions of a preferred liquefaction process, as described in commonly owned US applications 07/788,624 and 07/785,623 and US Patent 5,180,669, namely low pH, high temperature and potential oxidation conditions, preferred mutants of the present invention for use in liquefaction processes comprise mutants exhibiting altered pH performance profiles (i.e., low pH profile, pH < 6 and preferably pH < 5.5), and/or altered thermal stability (i.e., high temperature, about 90°-1 10°C), and/or altered oxidative stability (i.e., enhanced oxidative stability). Thus, an improved method for liquefying starch is taught by the present invention, the method comprising liquefying a granular starch slurry from either a wet or dry milling process at a pH from about 4 to 6 by adding an effective amount of an alpha-amylase mutant of the present invention to the starch slurry; optionally adding an effective amount of an antioxidant or other excipient to the slurry; and reacting the slurry for an appropriate time and temperature to liquefy the starch.
The following is presented by way of example and is not to be construed as a limitation to the scope of the claims. Abbreviations used herein, particularly three letter or one letter notations for amino acids are described in Dale, J.W., Molecular Genetics of Bacteria, John Wiley & Sons, ( 1 989) Appendix B.
Experimental
Example 1
Substitutions for the Methionine Residues in B. licheniformis Alpha-Amylase
The alpha-amylase gene (Fig. 1 ) was cloned from B. licheniformis NCIB8061 obtained from the National Collection of Industrial Bacteria, Aberdeen, Scotland (Gray, G. et al. (1 986) J. Bacteriology 166:635-643). The 1 .72kb Pstl-Sstl fragment, encoding the last three residues of the signal sequence; the entire mature protein and the terminator region was subcloned into M1 3MP1 8. A synthetic terminator was added between the Bell and SstI sites using a synthetic oligonucleotide cassette of the form:
Bcll SstI
5' GATCAAAACATAAAAAACCGGCCTTGGCCCCGCCGGTTTTTTATTAT T T T TGAGCT 3'
3' TTTTGTATTTTTTGGCCGGAACCGGGGCGGCCAAAAAATAATAAAAAC 5'
Seq ID No 1 designed to contain the B. amyloliquefaciens subtilisin transcriptional terminator (Wells et al. (1983) Nucleic Acid Research 1 1 :791 1 -7925).
Site-directed mutagenesis by oligonucleotides used essentially the protocol of Zoller, M. et al. (1 983) Meth. Enzymol. 100:468-500: briefly, 5'-phosphorylated oligonucleotide primers were used to introduce the desired mutations on the M1 3 single-stranded DNA template using the oligonucleotides listed in Table I to substitute for each of the seven methionines found in B. licheniformis alpha-amylase. Each mutagenic oligonucleotide also introduced a restriction endonuclease site to use as a screen for the linked mutation.
TABLE I
Mutagenic Oligonucleotides for the Substitution of the
Methionine Residues in B. licheniformis Alpha-Amylase
Figure imgf000021_0001
Bold letter indicate base changes introduced by oligonucleotide.
Codon changes indicated in the form M8A, where methionine (M) at position + 8 has been changed to alanine (A).
Underlining indicates restriction endonuclease site introduced by oligonucleotide.
The heteroduplex was used to transfect E. coli mutL cells (Kramer et al. (1984) Cell 38:879) and, after plaque-purification, clones were analyzed by restriction analysis of the RFI 's. Positives were confirmed by dideoxy sequencing (Sanger et al. ( 1 977) Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467) and the Pstl-SstI fragments for each subcloned into an E. coli vector, plasmid pA4BL.
Plasmid pA4BL
Following the methods described in US application 860,468 (Power et al.), which is incorporated herein by reference, a silent PstI site was introduced at codon + 1 (the first amino-acid following the signal cleavage site) of the aprE gene from pS 1 68-1 (Stahl, M.L. and Ferrari, E. (1 984) J. Bacter. 1 58:41 1 -41 8). The aprE promoter and signal peptide region was then cloned out of a pJH 1 01 plasmid (Ferrari, F.A. et al.
(1 983) J. Bacter. 1 54: 1 51 3-1 51 5) as a Hindlll-Pstl fragment and subcloned into the pUC 1 8-derived plasmid JM102 (Ferrari, E. and Hoch, J.A. ( 1 989) Bacillus, ed. C.R. Harwood, Plenum Pub., pp. 57-72). Addition of the Pstl-SstI fragment from B.
licheniformis alpha-amylase gave pA4BL (Fig. 5) having the resulting aprE signal peptide-amylase junction as shown in Fig. 6.
Transformation Into B. subtilis
pA4BL is a plasmid able to replicate in E. coli and integrate into the B. subtilis chromosome. Plasmids containing different variants were transformed into B. subtilis (Anagnostopoulos, C. and Spizizen, J. ( 1 961 ) J. Bacter. 81 :741 -746) and integrated into the chromosome at the aprE locus by a Campbell-type mechanism (Young, M.
(1 984) J. Gen. Microbiol. 130: 1 61 3-1 621 ). The Bacillus subtilis strain BG2473 was a derivative of 11 68 which had been deleted for amylase (LamyE) and two proteases (Aapr, Lnpr) (Stahl, M.L. and Ferrari, E., J. Bacter. 158:41 1 -41 8 and US Patent
5,264,366, incorporated herein by reference). After transformation the sacU32(Hy) (Henner, D.J. et al. (1988) J. Bacter. 170:296-300) mutation was introduced by PBS-1 mediated transduction (Hoch, J. A. ( 1 983) 1 54: 1 51 3-1 51 5).
N-terminal analysis of the amylase expressed from pA4BL in B. subtilis showed it to be processed having four extra alanines at the N-terminus of the secreted amylase protein ("A4 form"). These extra residues had no significant, deleterious effect on the activity or thermal stability of the A4 form and in some applications may enhance performance. In subsequent experiments the correctly processed forms of the licheniformis amylase and the variant M1 97T were made from a very similar construction (see Fig. 6).
Specifically, the 5' end of the A4 construction was subcloned on an EcoRI-Sstll fragment, from pA4BL (Fig. 5) into M 1 3BM20 (Boehringer Mannheim) in order to obtain a coding-strand template for the mutagenic oligonucleotide below:
5 '-CAT CAG CGT CCC ATT AAG ATT TGC AGC CTG CGC AGA CAT GTT GCT-3'
Seq ID No 10
This primer eliminated the codons for the extra four N-terminal alanines, correct forms being screened for by the absence of the PstI site. Subcloning the EcoRI-Sstll fragment back into the pA4BL vector (Fig. 5) gave plasmid pBLapr. The M1 97T substitution could then be moved, on a Sstll-Sstl fragment, out of pA4BL (M 1 97T) into the complementary pBLapr vector to give plasmid pBLapr (M1 97T). N-terminal analysis of the amylase expressed from pBLapr in B. subtilis showed it to be processed with the same N-terminus found in B. licheniformis alpha-amylase. Example 2
Oxidative Sensitivity of Methionine Variants
B. licheniformis alpha-amylase, such as Spezyme® AA20 (commercially available from Genencor International, Inc.), is inactivated rapidly in the presence of hydrogen peroxide (Fig. 7). Various methionine variants were expressed in shake-flask cultures of B. subtilis and the crude supernatants purified by ammonium sulphate cuts. The amylase was precipitated from a 20% saturated ammonium sulphate supernatant by raising the ammonium sulphate to 70% saturated, and then resuspended. The variants were then exposed to 0.88M hydrogen peroxide at pH 5.0, at 25 °C. Variants at six of the methionine positions in B. licheniformis alpha-amylase were still subject to oxidation by peroxide while the substitution at position + 1 97 (M 1 97L) showed resistance to peroxide oxidation. (See Fig. 7.) However, subsequent analysis described in further detail below showed that while a variant may be susceptible to oxidation at pH 5.0, 25 °C, it may exhibit altered/enhanced properties under different conditions (i.e., liquefaction).
Example 3
Construction of All Possible Variants at Position 1 97
All of the M1 97 variants (M1 97X) were produced in the A4 form by cassette mutagenesis, as outlined in Fig. 8:
1 ) Site directed mutagenesis (via primer extension in M1 3) was used to make M1 97A using the mutagenic oligonucleotide below:
M197A
5 '-GAT TAT TTG GCG TAT GCC GAT ATC GAC TAT GAC CAT-3 '
ECORV+
Clal- Seq ID No 11 which also inserted an EcoRV site (codons 200-201 ) to replace the Clal site (codons 201 -202). (codons 201 -202).
2) Then primer LAAM1 2 (Table II) was used to introduce another silent restriction site (BstBI) over codons 1 86-1 88.
3) The resultant M 1 97A (BstBI + , EcoRV + ) variant was then subcloned (Pstl-SstI fragment) into plasmid pA4BL and the resultant plasmid digested with BstBI and EcoRV and the large vector-containing fragment isolated by electroelution from agarose ge l.
4) Synthetic primers LAAM14-30 (Table II) were each annealed with the largely complementary common primer LAAM 1 3 (Table II). The resulting cassettes encoded for all the remaining naturally occurring amino acids at position + 1 97 and were ligated, individually, into the vector fragment prepared above.
TABLE II
Synthetic Oligonucleotides Used for Cassette Mutagenesis
to Produce M1 97X Variants
Figure imgf000025_0001
Figure imgf000026_0001
The cassettes were designed to destroy the EcoRV site upon ligation, thus plasmids from E. coli transformants were screened for loss of this unique site. In addition, the common bottom strand of the cassette contained a frame-shift and encoded a Nsil site, thus transformants derived from this strand could be eliminated by screening for the presence of the unique Nsil site and would not be expected, in any case, to lead to expression of active amylase.
Positives by restriction analysis were confirmed by sequencing and transformed in B. subtilis for expression in shake-flask cultures (Fig. 9). The specific activity of certain of the M1 97X mutants was then determined using a soluble substrate assay. The data generated using the following assay methods are presented below in Table III.
Soluble Substrate Assay: A rate assay was developed based on an end-point assay kit supplied by Megazyme (Aust.) Pty. Ltd.: Each vial of substrate (p-nitrophenyl maltoheptaoside, BPNPG7) was dissolved in 1 0ml of sterile water, followed by a 1 to 4 dilution in assay buffer (50mM maleate buffer, pH 6.7, 5mM calcium chloride, 0.002% Tween20). Assays were performed by adding 1 0μl of amylase to 790μl of the substrate in a cuvette at 25 °C. Rates of hydrolysis were measured as the rate of change of absorbance at 410nm, after a delay of 75 seconds. The assay was linear up to rates of 0.4 absorption units/min.
The amylase protein concentration was measured using the standard Bio-Rad assay (Bio-Rad Laboratories) based on the method of Bradford, M. ( 1 976) Anal. Biochem. 72:248) using bovine serum albumin standards.
Starch Hydrolysis Assay: The standard method for assaying the alpha-amylase activity of Spezyme® AA20 was used. This method is described in detail in Example 1 of
USSN 07/785,624, incorporated herein by reference. Native starch forms a blue color with iodine but fails to do so when it is hydrolyzed into shorter dextrin molecules. The substrate is soluble Lintner starch 5gm/liter in phosphate buffer, pH 6.2 (42.5gm/liter potassium dihydrogen phosphate, 3.1 6gm/liter sodium hydroxide). The sample is added in 25mM calcium chloride and activity is measured as the time taken to give a negative iodine test upon incubation at 30 °C. Activity is recorded in liquefons per gram or ml (LU) calculated according to the formula:
LU/ml or LU/g = 570 x D
V x t
Where LU = liquefon unit
V = volume of sample (5ml)
t = dextrinization time (minutes)
D = dilution factor = dilution volume/ml or g of added enzyme.
Figure imgf000028_0001
Example 4
Characterization of Variant M1 5L
Variant M1 5L made as per the prior examples did not show increased amylase activity (Table III) and was still inactivated by hydrogen peroxide (Fig. 7). It did, however, show significantly increased performance in jet-liquefaction of starch, especially at low pH as shown in Table IV below.
Starch liquefaction was typically performed using a Hydroheater M 103-M steam jet equipped with a 2.5 liter delay coil behind the mixing chamber and a terminal back pressure valve. Starch was fed to the jet by a Moyno pump and steam was supplied by a 1 50 psi steam line, reduced to 90-100 psi. Temperature probes were installed just after the Hydroheater jet and just before the back pressure valve.
Starch slurry was obtained from a corn wet miller and used within two days. The starch was diluted to the desired solids level with deionized water and the pH of the starch was adjusted with 2% NaOH or saturated Na2CO3. Typical liquefaction conditions were: Starch 32%-35 % solids
Calcium 40-50 ppm (30 ppm added)
pH 5.0-6.0
Alpha-amylase 1 2-14 LU/g starch dry basis
Starch was introduced into the jet at about 350 ml/min. The jet temperature was held at 105 °-107 °C. Samples of starch were transferred from the jet cooker to a 95 °C second stage liquefaction and held for 90 minutes.
The degree of starch liquefaction was measured immediately after the second stage liquefaction by determining the dextrose equivalence (DE) of the sample and by testing for the presence of raw starch, both according to the methods described in the Standard Analytical Methods of the Member Companies of the Corn Refiners
Association, Inc., sixth edition. Starch, when treated generally under the conditions given above and at pH 6.0, will yield a liquefied starch with a DE of about 10 and with no raw starch. Results of starch liquefaction tests using mutants of the present invention are provided in Table IV.
Figure imgf000030_0001
* average of three experiments
** average of two experiments
Example 5
Construction of M1 5X Variants
Following generally the processes described in Example 3 above, all variants at M1 5 (M1 5X) were produced in native B. licheniformis by cassette mutagenesis, as outlined in Fig. 12:
1 ) Site directed mutagenesis (via primer extension in M1 3) was used to introduce unique restriction sites flanking the M1 5 codon to facilitate insertion of a mutagenesis cassette. Specifically, a BstB1 site at codons 1 1 -13 and a Msc1 site at codons 18-20 were introduced using the two oligonucleotides shown below.
M15XBstB1 5'-G ATG CAG TAT TTC GAA CTGG TAT A-3'
BstB1 Seq ID No 48
M15XMSC1 5'-TG CCC AAT GAT GGC CAA CAT TGG AAG-3'
Msc1 Seq ID No 49 2) The vector for M1 5X cassette mutagenesis was then constructed by subcloning the Sfi 1 -Sstll fragment from the mutagenized amylase (BstB1 + , Msc1 + ) into plasmid pBLapr. The resulting plasmid was then digested with BstB1 and Msd and the large vector fragment isolated by electroelution from a polyacrylamide gel.
3) Mutagenesis cassettes were created as with the M1 97X variants. Synthetic oligomers, each encoding a substitution at codon 1 5, were annealed to a common bottom primer. Upon proper ligation of the cassette to the vector, the Msc1 is destroyed allowing for screening of positive transformants by loss of this site. The bottom primer contains an unique SnaB1 site allowing for the transformants derived from the bottom strand to be eliminated by screening for the SnaBI site. This primer also contains a frameshift which would also eliminate amylase expression for the mutants derived from the common bottom strand.
The synthetic cassettes are listed in Table V and the general cassette mutagenesis strategy is illustrated in Figure 1 2.
Figure imgf000032_0001
Underline indicates codon changes at amino acid position 15.
Conservative substitutions were made in some cases to prevent introduction of new restriction sites.
Example 6
Bench Liquefaction with M1 5X Variants
Eleven alpha-amylase variants with substitutions for M1 5 made as per Example 5 were assayed for activity, as compared to Spezyme® AA20 (commercially available from Genencor International, Inc.) in liquefaction at pH 5.5 using a bench liquefaction system. The bench scale liquefaction system consisted of a stainless steel coil (0.25 inch diameter, approximately 350 ml volume) equipped with a 7 inch long static mixing element approximately 1 2 inches from the anterior end and a 30 psi back pressure valve at the posterior end. The coil, except for each end, was immersed in a glycerol- water bath equipped with thermostatically controlled heating elements that maintained the bath at 105-106°C.
Starch slurry containing enzyme, maintained in suspension by stirring, was introduced into the reaction coil by a piston driven metering pump at about 70 ml/min. The starch was recovered from the end of the coil and was transferred to the secondary hold (95°C for 90 minutes). Immediately after the secondary hold, the DE of the liquefied starch was determined, as described in Example 4. The results are shown in Fig. 1 6.
Example 7
Characterization of M197X Variants
As can be seen in Fig. 9, there was a wide range of amylase activity (measured in the soluble substrate assay) expressed by the M1 97X (A4 form) variants. The amylases were partially purified from the supematants by precipitation with two volumes of ethanol and resuspension. They were then screened for thermal stability (Fig. 10) by heating at 95 °C for 5 minutes in 10mM acetate buffer pH 5.0, in the presence of 5mM calcium chloride; the A4 wild-type retained 28% of its activity after incubation. For M197W and M197P we were unable to recover active protein from the supernatants. Upon sequencing, the M197H variant was found to contain a second mutation, N190K. M197L was examined in a separate experiment and was one of the lowest thermally stable variants. There appears to be a broad correlation between expression of amylase activity and thermal stability. The licheniformis amylase is restricted in what residues it can accommodate at position 197 in terms of retaining or enhancing thermal stability: cysteine and threonine are preferred for maximal thermal stability under these conditions whereas alanine and isoleucine are of intermediate stability. However, other substitutions at position + 197 result in lowered thermal stability which may be useful for other applications. Additionally, different substitutions at + 197 may have other beneficial properties, such as altered pH performance profile or altered oxidative stability. For example, the M197C variant was found to inactivate readily by air oxidation but had enhanced thermal stability. Conversely, compared to the M197L variant, both M197T and M197A retained not only high thermal stability (Fig. 10), but also high activity (Table III), while maintaining resistance to inactivation by peroxide at pH 5 to pH 10 (Fig. 7).
Example 8
Stability and Performance in Detergent Formulation
The stability of the M197T (A4 form), M1 97T and M197A (A4 form) was measured in automatic dish care detergent (ADD) matrices. 2ppm Savinase™ (a protease,
commercially available from Novo Industries, of the type commonly used in ADD) were added to two commercially available bleach-containing ADD's: Cascade™ (Procter and Gamble, Ltd.) and Sunlight™ (Unilever) and the time course of inactivation of the amylase variants and Termamyl™ (a thermally stable alpha-amylase available from Novo Nordisk, A/S) followed at 65 °C. The concentration of ADD product used in both cases was equivalent to 'pre-soak' conditions: 14gm product per liter of water (7 grams per gallon hardness). As can be seen (Figs. 1 1 a and 1 1 b), both forms of the M1 97T variant were much more stable than Termamyl™ and M1 97A (A4 form), which were inactivated before the first assay could be performed. This stability benefit was seen in the presence or absence of starch as determined by the following protocol. Amylases were added to 5ml of ADD and Savinase'", prewarmed in a test tube and, after vortexing, activities were assayed as a function of time, using the soluble substrate assay. The " + starch" tube had spaghetti starch baked onto the sides (140°C, 60 mins.). The results are shown in Figs. 1 1 a and 1 1 b.
Example 9
Characterization of M1 5X Variants
All M1 5X variants were propagated in Bacillus subtilis and the expression level monitored as shown in Fig. 1 3. The amylase was isolated and partially purified by a 20-70% ammonium sulfate cut. The specific activity of these variants on the soluble substrate was determined as per Example 3 (Fig. 14). Many of the M1 5X amylases have specific activities greater than that of Spezyme® AA20. A benchtop heat stability assay was performed on the variants by heating the amylase at 90°C for 5 min. in 50 mM acetate buffer pH 5 in the presence of 5 mM CaCI2 (Fig. 15). Most of the variants performed as well as Spezyme® AA20 in this assay. Those variants that exhibited reasonable stability in this assay (reasonable stability defined as those that retained at least about 60% of Spezyme® AA20's heat stability) were tested for specific activity on starch and for liquefaction performance at pH 5.5. The most interesting of those mutants are shown in Fig. 1 6. M1 5D, N and T, along with L, outperformed Spezyme® AA20 in liquefaction at pH 5.5 and have increased specific activities in both the soluble substrate and starch hydrolysis assays. Generally, we have found that by substituting for the methionine at position 1 5, we can provide variants with increased low pH-liquefaction performance and/or increased specific activity.
Example 1 0
Tryptophan Sensitivity to Oxidation
Chloramine-T (sodium N-chloro-p-toluenesulfonimide) is a selective oxidant, which oxidizes methionine to methionine sulfoxide at neutral or alkaline pH. At acidic pH, chloramine-T will modify both methionine and tryptophan (Schechter, Y., Burstein, Y. and Patchornik, A. ( 1 975) Biochemistry 14 (20) 4497-4503). Fig. 1 7 shows the inactivation of B. licheniformis alpha-amylase with chloramine-T at pH 8.0 (AA20 = 0.65 mg/ml, M197A = 1 .7 mg/ml, M197L = 1 .7 mg/ml). The data shows that by changing the methionine at position 197 to leucine or alanine, the inactivation of alpha- amylase can be prevented. Conversely, as shown in Fig. 1 8, at pH 4.0 inactivation of the M1 97A and M197L proceeds, but require more equivalents of chloramine-T (Fig. 1 8; AA20 = 0.22 mg/ml, M1 97A = 4.3 mg/ml, M1 97L = 0.53 mg/ml; 200 mM NaAcetate at pH 4.0). This suggests that a tryptophan residue is also implicated in the chloramine-T mediated inactivation event. Furthermore, tryptic mapping and subsequent amino acid sequencing indicated that the tryptophan at position 1 38 was oxidized by chloramine-T (data not shown). To prove this, site-directed mutants were made at tryptophan 1 38 as provided below:
Preparation of Alpha-Amylase Double Mutants W1 38 and M1 97
Certain variants of W1 38 (F, Y and A) were made as double mutants, with M1 97T (made as per the disclosure of Example 3). The double mutants were made following the methods described in Examples 1 and 3. Generally, single negative strands of DNA were prepared from an M13MP18 clone of the 1.72kb coding sequence (Pst l-Sst I) of the B. licheniformis alpha-amylase M1 97T mutant. Site-directed mutagenesis was done using the primers listed below, essentially by the method of Zoller, M. et al.
(1983) except T4 gene 32 protein and T4 polymerase were substituted for klenow. The primers all contained unique sites, as well as the desired mutation, in order to identify those clones with the appropriate mutation.
Tryptophan 138 to Phenylalanine
133 134 135 136 137 138 139 140 141 142 143
CAC CTA ATT AAA GCT TTC ACA CAT TTT CAT TTT Seq ID No 42
Hind I I I
Tryptophan 138 to Tyrosine
133 134 135 136 137 138 139 140 141 142 143
CAC CTA ATT AAA GCT TAC ACA CAT TTT CAT TTT Seq ID No 43
Hind I II
Tryptophan 138 to Alanine - This primer also engineers unique sites upstream and downstream of the 138 position .
127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142
C CGC GTA ATT TCC GGA GAA CAC CTA ATT AAA GCC GCA ACA CAT TTT CAT
BspE I
143 144 145 146 147
TTT CCC GGG CGC GGC AG Seq ID No 44
Xma I
Mutants were identified by restriction analysis and W138F and W138Y confirmed by DNA sequencing. The W138A sequence revealed a nucleotide deletion between the unique BspE I and Xma I sites, however, the rest of the gene sequenced correctly. The 1.37kb Sstll/Sstl fragment containing both W138X and M197T mutations was moved from M13MP1 8 into the expression vector pBLapr resulting in pBLapr (W138F, M197T) and pBLapr (W1 38Y, M1 97T). The fragment containing unique BspE I and Xma I sites was cloned into pBLapr (BspE I, Xma I, M197T) since it is useful for cloning cassettes containing other amino acid substitutions at position 1 38. Single Mutations at Amino Acid Position1 38
Following the general methods described in the prior examples, certain single variants of W138 (F, Y, L, H and C) were made.
The 1 .24kb Asp718-Sstl fragment containing the M1 97T mutation in plasmid pBLapr (W138X, M197T) of Example 7 was replaced by the wild-type fragment with methionine at 197, resulting in pBLapr (W138F), pBLapr (W138Y) and pBLapr (BspE I, Xma I).
The mutants W138L, W138H and W1 38C were made by ligating synthetic cassettes into the pBLapr (BspE I, Xma I) vector using the following primers:
Tryptophan 138 to Leucine
CC GGA GAA CAC CTA ATT AAA GCC CTA ACA CAT TTT CAT TTT C
Seq ID No 45 Tryptophan 138 to Histidine
CC GGA GAA CAC CTA ATT AAA GCC CAC ACA CAT TTT CAT TTT C
Seq ID No 46 Tryptophan 138 to Cysteine
CC GGA GAA CAC CTA ATT AAA GCC TGC ACA CAT TTT CAT TTT C
Seq ID No 47
Reaction of the double mutants M197T/W138F and M1 97T/W138Y with chloramine-T was compared with wild-type (AA20 = 0.75 mg/ml, M197TΛΛ/1 38F = 0.64 mg/ml, M197T/W138Y = 0.60 mg/ml; 50 mM NaAcetate at pH 5.0). The results shown in Fig. 19 show that mutagenesis of tryptophan 1 38 has caused the variant to be more resistant to chloramine-T. SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: GENENCOR INTERNTIONAL, INC.
(ii) TITLE OF INVENTION: Oxidatively Stable Alpha-Amylase
(iii) NUMBER OF SEQUENCES: 68
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Genencor International, Inc.
(B) STREET: 180 Kimball Way
(C) CITY: South San Francisco
(D) STATE: CA
(E) COUNTRY: USA
(F) ZIP: 94080
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Horn, Margaret A.
(B) REGISTRATION NUMBER: 33,401
(C) REFERENCE/DOCKET NUMBER: GC220-2
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (415) 742-7536
(B) TELEFAX: (415) 742-7217
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GATCAAAACA TAAAAAACCG GCCTTGGCCC CGCCGGTTTT TTATTATTTT TGAGCT 56
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
TGGGACGCTG GCGCAGTACT TTGAATGGT 29
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
TGATGCAGTA CTTTGAATGG TACCTGCCCA ATGA 34
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GATTATTTGT TGTATGCCGA TATCGACTAT GACCAT 36
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CGGGGAAGGA GGCCTTTACG GTAGCT 26
(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
GCGGCTATGA CTTAAGGAAA TTGC 24
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CTACGGGGAT GCATACGGGA CGA 23
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CTACGGGGAT TACTACGGGA CCAAGGGAGA CTCCC 35
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CCGGTGGGGC CAAGCGGGCC TATGTTGGCC GGCAAA 36
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CATCAGCGTC CCATTAAGAT TTGCAGCCTG CGCAGACATG TTGCT 45
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
GATTATTTGG CGTATGCCGA TATCGACTAT GACCAT 36
(2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GGGAAGTTTC GAATGAAAAC G 21
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GTCGGCATAT GCATATAATC ATAGTTGCCG TTTTCATT 38
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
CGAATGAAAA CGGCAACTAT GATTATTTGA TCTATGCCGA C 41 (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
CGAATGAAAA CGGCAACTAT GATTATTTGT TCTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
CGAATGAAAA CGGCAACTAT GATTATTTGG TTTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
CGAATGAAAA CGGCAACTAT GATTATTTGA GCTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
CGAATGAAAA CGGCAACTAT GATTATTTGC CTTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
CGAATGAAAA CGGCAACTAT GATTATTTGA CATATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
CGAATGAAAA CGGCAACTAT GATTATTTGT ACTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
CGAATGAAAA CGGCAACTAT GATTATTTGC ACTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
CGAATGAAAA CGGCAACTAT GATTATTTGG GCTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
CGAATGAAAA CGGCAACTAT GATTATTTGC AATATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
CGAATGAAAA CGGCAACTAT GATTATTTGA ACTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
GCAATGAAAA CGGCAACTAT GATTATTTGA AATATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
CGAATGAAAA CGGCAACTAT GATTATTTGG ATTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
CGAATGAAAA CGGCAACTAT GATTATTTGG AATATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
CGAATGAAAA CGGCAACTAT GATTATTTGT GTATTGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
CGAATGAAAA CGGCAACTAT GATTATTTGT GGTATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
CGAATGAAAA CGGCAACTAT GATTATTTGA GATATGCCGA C 41
(2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1968 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
AGCTTGAAGA AGTGAAGAAG CAGAGAGGCT ATTGAATAAA TGAGTAGAAA GCGCCATATC 60 GGCGCTTTTC TTTTGGAAGA AAATATAGGG AAAATGGTAC TTGTTAAAAA TTCGGAATAT 120
TTATACAACA TCATATGTTT CACATTGAAA GGGGAGGAGA ATCATGAAAC AACAAAAACG 180
GCTTTACGCC CGATTGCTGA CGCTGTTATT TGCGCTCATC TTCTTGCTGC CTCATTCTGC 240
AGCAGCGGCG GCAAATCTTA ATGGGACGCT GATGCAGTAT TTTGAATGGT ACATGCCCAA 300
TGACGGCCAA CATTGGAAGC GTTTGCAAAA CGACTCGGCA TATTTGGCTG AACACGGTAT 360
TACTGCCGTC TGGATTCCCC CGGCATATAA GGGAACGAGC CAAGCGGATG TGGGCTACGG 420
TGCTTACGAC CTTTATGATT TAGGGGAGTT TCATCAAAAA GGGACGGTTC GGACAAAGTA 480
CGGCACAAAA GGAGAGCTGC AATCTGCGAT CAAAAGTCTT CATTCCCGCG ACATTAACGT 540
TTACGGGGAT GTGGTCATCA ACCACAAAGG CGGCGCTGAT GCGACCGAAG ATGTAACCGC 600
GGTTGAAGTC GATCCCGCTG ACCGCAACCG CGTAATTTCA GGAGAACACC TAATTAAAGC 660
CTGGACACAT TTTCATTTTC CGGGGCGCGG CAGCACATAC AGCGATTTTA AATGGCATTG 720
GTACCATTTT GACGGAACCG ATTGGGACGA GTCCCGAAAG CTGAACCGCA TCTATAAGTT 780
TCAAGGAAAG GCTTGGGATT GGGAAGTTTC CAATGAAAAC GGCAACTATG ATTATTTGAT 840
GTATGCCGAC ATCGATTATG ACCATCCTGA TGTCGCAGCA GAAATTAAGA GATGGGGCAC 900
TTGGTATGCC AATGAACTGC AATTGGACGG TTTCCGTCTT GATGCTGTCA AACACATTAA 960
ATTTTCTTTT TTGCGGGATT GGGTTAATCA TGTCAGGGAA AAAACGGGGA AGGAAATGTT 1020
TACGGTAGCT GAATATTGGC AGAATGACTT GGGCGCGCTG GAAAACTATT TGAACAAAAC 1080
AAATTTTAAT CATTCAGTGT TTGACGTGCC GCTTCATTAT CAGTTCCATG CTGCATCGAC 1140
ACAGGGAGGC GGCTATGATA TGAGGAAATT GCTGAACGGT ACGGTCGTTT CCAAGCATCC 1200
GTTGAAATCG GTTACATTTG TCGATAACCA TGATACACAG CCGGGGCAAT CGCTTGAGTC 1260
GACTGTCCAA ACATGGTTTA AGCCGCTTGC TTACGCTTTT ATTCTCACAA GGGAATCTGG 1320
ATACCCTCAG GTTTTCTACG GGGATATGTA CGGGACGAAA GGAGACTCCC AGCGCGAAAT 1380
TCCTGCCTTG AAACACAAAA TTGAACCGAT CTTAAAAGCG AGAAAACAGT ATGCGTACGG 1440
AGCACAGCAT GATTATTTCG ACCACCATGA CATTGTCGGC TGGACAAGGG AAGGCGACAG 1500
CTCGGTTGCA AATTCAGGTT TGGCGGCATT AATAACAGAC GGACCCGGTG GGGCAAAGCG 1560
AATGTATGTC GGCCGGCAAA ACGCCGGTGA GACATGGCAT GACATTACCG GAAACCGTTC 1620
GGAGCCGGTT GTCATCAATT CGGAAGGCTG GGGAGAGTTT CACGTAAACG GCGGGTCGGT 1680
TTCAATTTAT GTTCAAAGAT AGAAGAGCAG AGAGGACGGA TTTCCTGAAG GAAATCCGTT 1740
TTTTTATTTT GCCCGTCTTA TAAATTTCTT TGATTACATT TTATAATTAA TTTTAACAAA 1800
GTGTCATCAG CCCTCAGGAA GGACTTGCTG ACAGTTTGAA TCGCATAGGT AAGGCGGGGA 1860
TGAAATGGCA ACGTTATCTG ATGTAGCAAA GAAAGCAAAT GTGTCGAAAA TGACGGTATC 1920
GCGGGTGATC AATCATCCTG AGACTGTGAC GGATGAATTG AAAAAGCT 1968
(2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 483 amino acids (B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32:
Ala Asn Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Met Pro 1 5 10 15
Asn Asp Gly Gln His Trp Lys Arg Leu Gln Asn Asp Ser Ala Tyr Leu
20 25 30
Ala Glu His Gly lle Thr Ala Val Trp lle Pro Pro Ala Tyr Lys Gly
35 40 45
Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60
Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys 65 70 75 80
Gly Glu Leu Gln Ser Ala lle Lys Ser Leu His Ser Arg Asp lle Asn
85 90 95
Val Tyr Gly Asp Val Val lle Asn His Lys Gly Gly Ala Asp Ala Thr
100 105 110
Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val
115 120 125
lle Ser Gly Glu His Leu lle Lys Ala Trp Thr His Phe His Phe Pro 130 135 140
Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe 145 150 155 160
Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg lle Tyr Lys
165 170 175
Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn
180 185 190
Tyr Asp Tyr Leu Met Tyr Ala Asp lle Asp Tyr Asp His Pro Asp Val
195 200 205
Ala Ala Glu lle Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln 210 215 220
Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His lle Lys Phe Ser Phe 225 230 235 240
Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met
245 250 255
Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn
260 265 270
Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu
275 280 285
His Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met 290 295 300
Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser 305 310 315 320
Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu
325 330 335
Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe lle Leu
340 345 350
Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly
355 360 365
Thr Lys Gly Asp Ser Gln Arg Glu lle Pro Ala Leu Lys His Lys lle
370 375 380
Glu Pro lle Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His 385 390 395 400
Asp Tyr Phe Asp His His Asp lle Val Gly Trp Thr Arg Glu Gly Asp
405 410 415
Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu lle Thr Asp Gly Pro
420 425 430
Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr
435 440 445
Trp His Asp lle Thr Gly Asn Arg Ser Glu Pro Val Val lle Asn Ser
450 455 460
Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser lle Tyr 465 470 475 480
Val Gln Arg
(2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 511 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Met Lys Gln Gln Lys Arg Leu Tyr Ala Arg Leu Leu Thr Leu Leu Phe 1 5 10 15
Ala Leu lle Phe Leu Leu Pro His Ser Ala Ala Ala Ala Ala Asn Leu
20 25 30
Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Met Pro Asn Asp Gly
35 40 45
His Trp Lys Arg Leu Gln Asn Asp Ser Ala Tyr Leu Ala Glu His Gly 50 55 60
lle Thr Ala Val Trp lle Pro Pro Ala Tyr Lys Gly Thr Ser Gln Ala 65 70 75 80
Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu Gly Glu Phe His
85 90 95
Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys Gly Glu Leu Gln 100 105 110
Ser Ala lle Lys Ser Leu His Ser Arg Asp lle Asn Val Tyr Gly Asp
115 120 125
Val Val lle Asn His Lyl Gly Gly Ala Asp Ala Thr Glu Asp Val Thr 130 135 140
Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val lle Ser Gly Glu 145 150 155 160
His Leu lle Lys Ala Trp Thr His Phe His Phe Pro Gly Arg Gly Ser
165 170 175
Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe Asp Gly Thr Asp
180 185 190
Trp Asp Glu Ser Arg Lys Leu Asn Arg lle Tyr Lys Phe Gln Gly Lys
195 200 205
Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn Tyr Asp Tyr Leu 210 215 220
Met Tyr Ala Asp lle Asp Tyr Asp His Pro Asp Val Ala Ala Glu lle 225 230 235 240
Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln Leu Asp Gly Phe
245 250 255
Arg Leu Asp Ala Val Lys His lle Lys Phe Ser Phe Leu Arg Asp Trp
260 265 270
Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met Phe Thr Val Ala
275 280 285
Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn Tyr Leu Asn Lys 290 295 300
Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu His Tyr Gln Phe 305 310 315 320
His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met Arg Lys Leu Leu
325 330 335
Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser Val Thr Phe Val
340 345 350
Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu Ser Thr Val Gln
355 360 365
Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe lle Leu Thr Arg Glu Ser 370 375 380
Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly Thr Lys Gly Asp 385 390 395 400
Ser Gln Arg Glu lle Pro Ala Leu Lys His Lys lle Glu Pro lle Leu
405 410 415
Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His Asp Tyr Phe Asp
420 425 430
His His Asp lle Val Gly Trp Thr Arg Glu Gly Asp Ser Ser Val Ala
435 440 445
Asn Ser Gly Leu Ala Ala Leu lle Thr Asp Gly Pro Gly Gly Ala Lys 450 455 460 Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr Trp His Asp lle 465 470 475 480
Thr Gly Asn Arg Ser Glu Pro Val Val lle Asn Ser Glu Gly Trp Gly
485 490 495
Glu Phe His Val Asn Gly Gly Ser Val Ser lle Tyr Val Gln Arg
500 505 510
(2) INFORMATION FOR SEQ ID NO: 34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 520 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34:
Met Arg Gly Arg Gly Asn Met lle Gln Lys Arg Lys Arg Thr Val Ser 1 5 10 15
Phe Arg Leu Val Leu Met Cys Thr Leu Leu Phe Val Ser Leu Pro lle
20 25 30
Thr Lys Thr Ser Ala Val Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp
35 40 45
Tyr Thr Pro Asn Asp Gly Gln His Trp Lys Arg Leu Gln Asn Asp Ala 50 55 60
Glu His Leu Ser Asp lle Gly lle Thr Ala Val Trp lle Pro Pro Ala 65 70 75 80
Tyr Lys Gly Leu Ser Gln Ser Asp Asn Gly Tyr Gly Pro Tyr Asp Leu
85 90 95
Tyr Asp Leu Gly Glu Phe Gln Gln Lys Gly Thr Val Arg Thr Lys Tyr
100 105 110
Gly Thr Lys Ser Glu Leu Gln Asp Ala lle Gly Ser Leu His Ser Arg
115 120 125
Asn Val Gln Val Tyr Gly Asp Val Val Leu Asn His Lys Ala Gly Ala 130 135 140
Asp Ala Thr Glu Asp Val Thr Ala Val Glu Val Asn Pro Ala Asn Arg 145 150 155 160
Asn Gln Glu Thr Ser Glu Glu Tyr Gln lle Lys Ala Trp Thr Asp Phe
165 170 175
Arg Phe Pro Gly Arg Gly Asn Thr Tyr Ser Asp Phe Lys Trp His Trp
180 185 190
Tyr His Phe Asp Gly Ala Asp Trp Asp Glu Ser Arg Lys lle Ser Arg
195 200 205 lle Phe Lys Phe Arg Gly Glu Gly Lys Ala Trp Asp Trp Glu Val Ser 210 215 220
Ser Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Val Asp Tyr 225 230 235 240 Asp His Pro Asp Val Val Ala Glu Thr Lys Lys Trp Gly lle Trp Tyr 245 250 255
Ala Asn Glu Leu Ser Leu Asp Gly Phe Arg lle Asp Ala Ala Lys His
260 265 270 lle Lys Phe Ser Phe Leu Arg Asp Trp Val Gln Ala Val Arg Gln Ala
275 280 285
Thr Gly Lys Glu Met Phe Thr Val Ala Glu Tyr Trp Gln Asn Asn Ala 290 295 300
Gly Lys Leu Glu Asn Tyr Leu Asn Lys Thr Ser Phe Asn Gln Ser Val 305 310 315 320
Phe Asp Val Pro Leu His Phe Asn Leu Gln Ala Ala Ser Ser Gln Gly
325 330 335
Gly Gly Tyr Asp Met Arg Arg Leu Leu Asp Gly Thr Val Val Ser Arg
340 345 350
His Pro Glu Lys Ala Val Thr Phe Val Glu Asn His Asp Thr Gln Pro
355 360 365
Gly Gln Ser Leu Glu Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala 370 375 380
Tyr Ala Phe lle Leu Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr 385 390 395 400
Gly Asp Met Tyr Gly Thr Lys Gly Thr Ser Pro Lys Glu lle Pro Ser
405 410 415
Leu Lys Asp Asn lle Glu Pro lle Leu Lys Ala Arg Lys Glu Tyr Ala
420 425 430
Tyr Gly Pro Gln His Asp Tyr lle Asp His Pro Asp Val lle Gly Trp
435 440 445
Thr Arg Glu Gly Asp Ser Ser Ala Ala Lys Ser Gly Leu Ala Ala Leu 450 455 460
lle Thr Asp Gly Pro Gly Gly Ser Lys Arg Met Tyr Ala Gly Leu Lys 465 470 475 480
Asn Ala Gly Glu Thr Trp Tyr Asp lle Thr Gly Asn Arg Ser Asp Thr
485 490 495
Val Lys lle Gly Ser Asp Gly Trp Gly Glu Phe His Val Asn Asp Gly
500 505 510
Ser Val Ser lle Tyr Val Gln Lys
515 520
(2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 548 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: Val Leu Thr Phe His Arg Ile Ile Arg Lys Gly Trp Met Phe Leu Leu
1 5 10 15
Ala Phe Leu Leu Thr Ala Ser Leu Phe Cys Pro Thr Gly Arg His Ala
20 25 30
Lys Ala Ala Ala Pro Phe Asn Gly Thr Met Met Gln Tyr Phe Glu Trp
35 40 45
Tyr Leu Pro Asp Asp Gly Thr Leu Trp Thr Lys Val Ala Asn Glu Ala 50 55 60
Asn Asn Leu Ser Ser Leu Gly Ile Thr Ala Leu Ser Leu Pro Pro Ala 65 70 75 80
Tyr Lys Gly Thr Ser Arg Ser Asp Val Gly Tyr Gly Val Tyr Asp Leu
85 90 95
Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr Lys Tyr
100 105 110
Gly Thr Lys Ala Gln Tyr Leu Gln Ala Ile Gln Ala Ala His Ala Ala
115 120 125
Gly Met Gln Val Tyr Ala Asp Val Val Phe Asp His Lys Gly Gly Ala 130 135 140
Asp Gly Thr Glu Trp Val Asp Ala Val Glu Val Asn Pro Ser Asp Arg 145 150 155 160
Asn Gln Glu Ile Ser Gly Thr Tyr Gln Ile Gln Ala Trp Thr Lys Phe
165 170 175
Asp Phe Pro Gly Arg Gly Asn Thr Tyr Ser Ser Phe Lys Trp Arg Trp
180 185 190
Tyr His Phe Asp Gly Val Asp Trp Asp Glu Ser Arg Lys Leu Ser Arg
195 200 205
Ile Tyr Lys Phe Arg Gly Ile Gly Lys Ala Trp Asp Trp Glu Val Asp 210 215 220
Thr Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Leu Asp Met 225 230 235 240
Asp His Pro Glu Val Val Thr Glu Leu Lys Asn Trp Gly Lys Trp Tyr
245 250 255
Val Asn Thr Thr Asn Ile Asp Gly Phe Arg Leu Asp Gly Leu Lys His
260 265 270
Ile Lys Phe Ser Phe Phe Pro Asp Trp Leu Ser Tyr Val Arg Ser Gln
275 280 285
Thr Gly Lys Pro Leu Phe Thr Val Gly Glu Tyr Trp Ser Tyr Asp Ile 290 295 300
Asn Lys Leu His Asn Tyr Ile Thr Lys Thr Asn Gly Thr Met Ser Leu 305 310 315 320
Phe Asp Ala Pro Leu His Asn Lys Phe Tyr Thr Ala Ser Lys Ser Gly
325 330 335
Gly Ala Phe Asp Met Arg Thr Leu Met Thr Asn Thr Leu Met Lys Asp
340 345 350
Gln Pro Thr Leu Ala Val Thr Phe Val Asp Asn His Asp Thr Asn Pro
355 360 365 Ala Lys Arg Cys Ser His Gly Arg Pro Trp Phe Lys Pro Leu Ala Tyr 370 375 380
Ala Phe Ile Leu Thr Arg Gln Glu Gly Tyr Pro Cys Val Phe Tyr Gly 385 390 395 400
Asp Tyr Tyr Gly Ile Pro Gln Tyr Asn Ile Pro Ser Leu Lys Ser Lys
405 410 415 Ile Asp Pro Leu Leu Ile Ala Arg Arg Asp Tyr Ala Tyr Gly Thr Gln
420 425 430
His Asp Tyr Leu Asp His Ser Asp Ile Ile Gly Trp Thr Arg Glu Gly
435 440 445
Val Thr Glu Lys Pro Gly Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly 450 455 460
Ala Gly Arg Ser Lys Trp Met Tyr Val Gly Lys Gln His Ala Gly Lys 465 470 475 480
Val Phe Tyr Asp Leu Thr Gly Asn Arg Ser Asp Thr Val Thr Ile Asn
485 490 495
Ser Asp Gly Trp Gly Glu Phe Lys Val Asn Gly Gly Ser Val Ser Val
500 505 510
Trp Val Pro Arg Lys Thr Thr Val Ser Thr Ile Ala Arg Pro Ile Thr
515 520 525
Thr Arg Pro Trp Thr Gly Glu Phe Val Arg Trp His Glu Pro Arg Leu 530 535 540
Val Ala Trp Pro
545
(2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 483 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
Ala Asn Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Met Pro 1 5 10 15
Asn Asp Gly Gln His Trp Lys Arg Leu Gln Asn Asp Ser Ala Tyr Leu
20 25 30
Ala Glu His Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys Gly
35 40 45
Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60
Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys 65 70 75 80
Gly Glu Leu Gln Ser Ala Ile Lys Ser Leu His Ser Arg Asp Ile Asn
85 90 95 Val Tyr Gly Asp Val Val Ile Asn His Lys Gly Gly Ala Asp Ala Thr 100 105 110
Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val
115 120 125
Ile Ser Gly Glu His Leu Ile Lys Ala Trp Thr His Phe His Phe Pro 130 135 140
Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe 145 150 155 160
Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Ile Tyr Lys
165 170 175
Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn
180 185 190
Tyr Asp Tyr Leu Thr Tyr Ala Asp Ile Asp Tyr Asp His Pro Asp Val
195 200 205
Ala Ala Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln 210 215 220
Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe Ser Phe 225 230 235 240
Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met
245 250 255
Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn
260 265 270
Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu
275 280 285
His Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met 290 295 300
Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser 305 310 315 320
Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu
325 330 335
Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu
340 345 350
Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly
355 360 365
Thr Lys Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys His Lys Ile 370 375 380
Glu Pro Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His 385 390 395 400
Asp Tyr Phe Asp His His Asp Ile Val Gly Trp Thr Arg Glu Gly Asp
405 410 415
Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro
420 425 430
Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr
435 440 445
Trp His Asp Ile Thr Gly Asn Arg Ser Glu Pro Val Val Ile Asn Ser 450 455 460 Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser Ile Tyr 465 470 475 480
Val Gln Arg
(2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 487 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37:
Ala Ala Ala Ala Ala Asn Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu 1 5 10 15
Trp Tyr Met Pro Asn Asp Gly Gln His Trp Lys Arg Leu Gln Asn Asp
20 25 30
Ser Ala Tyr Leu Ala Glu His Gly Ile Thr Ala Val Trp Ile Pro Pro
35 40 45
Ala Tyr Lys Gly Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp 50 55 60
Leu Tyr Asp Leu Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys 65 70 75 80
Tyr Gly Thr Lys Gly Glu Leu Gln Ser Ala Ile Lys Ser Leu His Ser
85 90 95
Arg Asp Ile Asn Val Tyr Gly Asp Val Val Ile Asn His Lys Gly Gly
100 105 110
Ala Asp Ala Thr Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp
115 120 125
Arg Asn Arg Val Ile Ser Gly Glu His Leu Ile Lys Ala Trp Thr His 130 135 140
Phe His Phe Pro Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His 145 150 155 160
Trp Tyr His Phe Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn
165 170 175
Arg Ile Tyr Lys Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn
180 185 190
Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Ile Asp Tyr Asp
195 200 205
His Pro Asp Val Ala Ala Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala 210 215 220
Asn Glu Leu Gln Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile 225 230 235 240
Lys Phe Ser Phe Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr
245 250 255 Gly Lys Glu Met Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly 260 265 270
Ala Leu Glu Asn Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe
275 280 285
Asp Val Pro Leu His Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly 290 295 300
Gly Tyr Asp Met Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His 305 310 315 320
Pro Leu Lys Ser Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly
325 330 335
Gln Ser Leu Glu Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr
340 345 350
Ala Phe Ile Leu Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly
355 360 365
Asp Met Tyr Gly Thr Lys Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu 370 375 380
Lys His Lys Ile Glu Pro Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr 385 390 395 400
Gly Ala Gln His Asp Tyr Phe Asp His His Asp Ile Val Gly Trp Thr
405 410 415
Arg Glu Gly Asp Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Ile
420 425 430
Thr Asp Gly Pro Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn
435 440 445
Ala Gly Glu Thr Trp His Asp Ile Thr Gly Asn Arg Ser Glu Pro Val 450 455 460
Val Ile Asn Ser Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser 465 470 475 480
Val Ser Ile Tyr Val Gln Arg
485
(2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
Met Lys Gln Gln Lys Arg Leu Thr Ala Arg Leu Leu Thr Leu Leu Phe 1 5 10 15
Ala Leu Ile Phe Leu Leu Pro His Ser Ala Ala Ala Ala Ala Asn Leu
20 25 30
(2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Met Arg Ser Lys Thr Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu
1 5 10 15 Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys
20 25 30
Ser
(2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
Met Arg Ser Lys Thr Leu Trp He Ser Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Ala Ala
20 25 30
Ala Ala Asn
35
(2) INFORMATION FOR SEQ ID NO:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Met Arg Ser Lys Thr Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Asn Leu
20 25 30
(2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
CACCTAATTA AAGCTTTCAC ACATTTTCAT TTT 33
(2) INFORMATION FOR SEQ ID NO: 43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:
CACCTAATTA AAGCTTACAC ACATTTTCAT TTT 33
(2) INFORMATION FOR SEQ ID NO: 44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:
CCGCGTAATT TCCGGAGAAC ACCTAATTAA AGCCGCAACA CATTTTCATT TTCCCGGGCG 60 CGGCAG 66
(2) INFORMATION FOR SEQ ID NO:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:
CCGGAGAACA CCTAATTAAA GCCCTAACAC ATTTTCATTT TC 42
(2) INFORMATION FOR SEQ ID NO:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:
CCGGAGAACA CCTAATTAAA GCCCACACAC ATTTTCATTT TC 42
(2) INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:
CCGGAGAACA CCTAATTAAA GCCTGCACAC ATTTTCATTT TC 42
(2) INFORMATION FOR SEQ ID NO:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:
GATGCAGTAT TTCGAACTGG TATA 24
(2) INFORMATION FOR SEQ ID NO:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:
TGCCCAATGA TGGCCAACAT TGGAAG 26
(2) INFORMATION FOR SEQ ID NO:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:
CGAATGGTAT GCTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO: 51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:
CGAATGGTAT CGCCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO: 52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:
CGAATGGTAT AATCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO: 53:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:
CGAATGGTAT GATCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO: 54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:
CGAATGGTAT CACCCCAATG ACGG 24 (2) INFORMATION FOR SEQ ID NO:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:
CGAATGGTAT AAACCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:
CGAATGGTAT CCGCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO: 57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:
CGAATGGTAT TCTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO: 58:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic )
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:
CGAATGGTAC ACTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:
CGAATGGTAT GTTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:
CGAATGGTAT TGTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:61:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:
CGAATGGTAT CAACCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:62:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:
CGAATGGTAT GAACCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:63:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
( C) STRANDEDNESS : single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:
CGAATGGTAT GGTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:
CGAATGGTAT ATTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:65:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:
CGAATGGTAT TTTCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:66:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:
CGAATGGTAC TGGCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:67:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:
CGAATGGTAT TATCCCAATG ACGG 24
(2) INFORMATION FOR SEQ ID NO:68:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:
CCGTCATTGG GACTACGTAC CATT 24

Claims

WHAT IS CLAIMED IS:
1 . A mutant alpha-amylase that is the expression product of a mutated DNA sequence encoding an alpha-amylase, the mutated DNA sequence being derived from a precursor alpha-amylase by the deletion or substitution of one or more oxidizable amino acids selected from the group consisting of methionine, tryptophan, cysteine and tyrosine, in the precursor alpha-amylase.
2. A mutant alpha-amylase of Claim 1 wherein the oxidizable amino acid to be deleted or substituted is a methionine in the precursor alpha-amylase equivalent to + 8, + 15, + 1 97, + 256, + 304, + 366 or + 438 in Bacillus licheniformis alpha-amylase.
3. A mutant alpha-amylase of Claim 2 wherein the substitution or deletion is at a position equivalent to M + 1 97 in B. licheniformis alpha-amylase.
4. A mutant alpha-amylase of Claim 3 wherein an amino acid selected from the group consisting of alanine, isoleucine, threonine and cysteine is substituted for methionine at a position equivalent to + 197 in B. licheniformis alpha-amylase.
5. The mutant alpha-amylase of Claim 4 which is M197T.
6. A mutant alpha-amylase of Claim 2 wherein the substitution or deletion is at a position equivalent to M + 1 5 in B. licheniformis alpha-amylase.
7. A mutant alpha-amylase of Claim 6 wherein an amino acid selected from the group consisting of leucine, threonine, asparagine, aspartate, serine, valine and isoleucine is substituted for methionine at a position equivalent to + 15 in B. licheniformis alpha-amylase.
8. The mutant alpha-amylase of Claim 7 which is M1 5L.
9. A mutant alpha-amylase of Claim 1 wherein the oxidizable amino acid to be deleted or substituted is a tryptophan in the precursor alpha-amylase equivalent to any tryptophan in B. licheniformis alpha-amylase as shown in Seq ID No 32.
10. A mutant alpha-amylase of Claim 9 wherein the substitution or deletion is at a position equivalent to W138 in B. licheniformis alpha-amylase.
1 1 . A mutant alpha-amylase of Claim 1 comprising at least two substitutions in a precursor alpha-amylase at positions equivalent to + 1 5, + 1 38 or + 1 97 in B.
licheniformis alpha-amylase.
1 2. A mutant alpha-amylase of Claim 1 wherein the precursor alpha-amylase is a Bacillus alpha-amylase.
13. A mutant alpha-amylase of Claim 1 2 wherein the precursor is selected from the group B. licheniformis, B. stearothermophilus, and B. amyloliquefaciens.
14. A mutant alpha-amylase of Claim 1 3 wherein the precursor is Bacillus licheniformis alpha-amylase.
15. A mutant alpha-amylase of Claim 1 wherein the precursor alpha-amylase is a fungal alpha-amylase.
1 6. DNA encoding the mutant alpha-amylase of Claim 1 .
17. Expression vectors encoding the DNA of Claim 1 6.
18. Host cells transformed with the expression vector of Claim 1 7.
19. An alpha-amylase comprising an amino acid sequence corresponding to Seq ID No 37 or a derivative thereof.
20. DNA encoding the alpha-amylase of Claim 19.
21 . Expression vectors encoding the DNA of Claim 20.
22. Host cells transformed with the expression vector of Claim 21 .
23. A mutant alpha-amylase of Claim 1 having altered oxidative stability comprising a substitution of a different amino acid at a position equivalent to M197 in B.
licheniformis alpha-amylase.
24. The mutant alpha-amylase of Claim 23 which is M1 97T.
25. A mutant alpha-amylase having enhanced thermal stability, or an enhanced pH performance profile or enhanced oxidative stability, the mutant comprising a
substitution of a different amino acid at a position equivalent to M 1 5 in B. licheniformis alpha-amylase.
26. The mutant alpha-amylase of Claim 25 which is M1 5L.
27. A detergent composition comprising a mutant alpha-amylase of Claim 1 .
28. A detergent composition of Claim 27 wherein the mutation is at a position equivalent to M197 in B. licheniformis alpha-amylase.
29. A detergent composition of Claim 28 which is a liquid, gel or granular composition.
30. A detergent composition of Claim 27 further comprising one or more additional enzyme.
31 . A starch liquefying composition comprising a mutant alpha-amylase of Claim 1 .
32. A starch liquefying composition of Claim 31 wherein the mutation is at a position equivalent to M1 5 in B. licheniformis alpha-amylase.
33. A method of liquefying a granular starch slurry from either a wet or dry milling process at a pH of from about 4 to less than about 6 comprising:
a) adding an effective amount of an alpha-amylase mutant of Claim 1 to the slurry;
b) optionally adding an effective amount of an antioxidant to the slurry; and c) reacting the slurry for an appropriate time and at an appropriate temperature to liquefy the starch.
34. An improved method of liquefying a granular starch slurry from either a wet or dry milling process at a pH of from about 4 to less than about 6 comprising:
a) adding an effective amount of an alpha-amylase of Claim 9 to the slurry; b) optionally adding an effective amount of an antioxidant to the slurry; and c) reacting the slurry for an appropriate time and at an appropriate temperature to liquefy the starch.
PCT/US1994/001553 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase WO1994018314A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
BR9405720A BR9405720A (en) 1993-02-11 1994-02-10 Mutant alpha-amylase DNA expression vectors host cells detergent composition starch liquefaction composition and process for liquefying a granular starch suspension
CA002155831A CA2155831C (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase
KR1019950703350A KR100322793B1 (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase
NZ262623A NZ262623A (en) 1993-02-11 1994-02-10 Alpha-amylase mutant, dna and vectors encoding such and detergent compositions thereof
EP94909609A EP0689589B2 (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase
AU62392/94A AU682863C (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase
DE69415659T DE69415659T3 (en) 1993-02-11 1994-02-10 OXIDATIVE STABLE ALPHA AMYLASE
JP6518371A JPH08506491A (en) 1993-02-11 1994-02-10 Oxidative stable alpha-amylase
DK94909609T DK0689589T4 (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase
HU9502364A HU219675B (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase
PL94310326A PL310326A1 (en) 1993-02-11 1994-02-10 Novel oxidation-stable mutants of alpha-amylase as well as detergent and starch liquefaction compositions containing them
FI953797A FI119694B (en) 1993-02-11 1995-08-10 Oxidation-resistant alpha-amylase
NO953147A NO307187B1 (en) 1993-02-11 1995-08-10 Mutant alpha-amylase, DNA sequence encoding it, expression vectors, host cells and use of the alpha-amylase
FI20080005A FI122574B (en) 1993-02-11 2008-01-07 Oxidation-resistant alpha-amylase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1639593A 1993-02-11 1993-02-11
US08/016,395 1993-02-11

Publications (1)

Publication Number Publication Date
WO1994018314A1 true WO1994018314A1 (en) 1994-08-18

Family

ID=21776903

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/001553 WO1994018314A1 (en) 1993-02-11 1994-02-10 Oxidatively stable alpha-amylase

Country Status (20)

Country Link
US (3) US6297037B1 (en)
EP (2) EP0867504B2 (en)
JP (1) JPH08506491A (en)
KR (1) KR100322793B1 (en)
CN (1) CN1104499C (en)
AT (2) ATE239075T1 (en)
AU (1) AU682863C (en)
BR (1) BR9405720A (en)
CA (1) CA2155831C (en)
CZ (1) CZ293163B6 (en)
DE (2) DE69415659T3 (en)
DK (2) DK0689589T4 (en)
ES (2) ES2198617T5 (en)
FI (2) FI119694B (en)
HU (1) HU219675B (en)
NO (1) NO307187B1 (en)
NZ (1) NZ262623A (en)
PL (1) PL310326A1 (en)
PT (1) PT867504E (en)
WO (1) WO1994018314A1 (en)

Cited By (656)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995010603A1 (en) * 1993-10-08 1995-04-20 Novo Nordisk A/S Amylase variants
WO1995021247A1 (en) * 1994-02-02 1995-08-10 Novo Nordisk A/S The use of an alpha-amylase modified to improve oxidation stability in a combined desizing and bleaching process
WO1995035382A2 (en) * 1994-06-17 1995-12-28 Genecor International Inc. NOVEL AMYLOLYTIC ENZYMES DERIVED FROM THE B. LICHENIFORMIS α-AMYLASE, HAVING IMPROVED CHARACTERISTICS
WO1996005295A2 (en) * 1994-08-11 1996-02-22 Genencor International, Inc. An improved cleaning composition
WO1996023873A1 (en) * 1995-02-03 1996-08-08 Novo Nordisk A/S Amylase variants
WO1996023874A1 (en) * 1995-02-03 1996-08-08 Novo Nordisk A/S A method of designing alpha-amylase mutants with predetermined properties
WO1996030481A1 (en) * 1995-03-24 1996-10-03 Genencor International, Inc. An improved laundry detergent composition comprising amylase
EP0736597A1 (en) * 1995-04-03 1996-10-09 The Procter & Gamble Company Soaker compositions
WO1996039528A2 (en) * 1995-06-06 1996-12-12 Genencor International, Inc. MUTANT α-AMYLASE
EP0756000A1 (en) * 1995-07-24 1997-01-29 The Procter & Gamble Company Detergent compositions comprising specific amylase and linear alkyl benzene sulfonate surfactant
WO1997004066A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Detergent compositions comprising specific amylase and a specific surfactant system
WO1997004067A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Dingy fabric clean-up with amylase enzyme in detergent compositions
WO1997004053A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Detergent compositions comprising specific amylase and linear alkyl benzene sulfonate surfactant
WO1997004054A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Detergent compositions comprising a specific amylase and a protease
WO1997032961A2 (en) * 1996-03-07 1997-09-12 The Procter & Gamble Company Detergent compositions comprising improved amylases
EP0798371A1 (en) * 1996-03-29 1997-10-01 The Procter & Gamble Company Detergent compositions comprising specific amylase and alkyl poly glucoside surfactants
WO1997041213A1 (en) 1996-04-30 1997-11-06 Novo Nordisk A/S α-AMYLASE MUTANTS
WO1997042282A1 (en) 1996-05-03 1997-11-13 The Procter & Gamble Company Detergent compositions comprising polyamine polymers with improved soil dispersancy
WO1998005748A1 (en) * 1996-08-01 1998-02-12 The Procter & Gamble Company Detergent compositions comprising improved amylase for dingy fabric clean-up
US5763385A (en) * 1996-05-14 1998-06-09 Genencor International, Inc. Modified α-amylases having altered calcium binding properties
WO1998030669A1 (en) * 1997-01-08 1998-07-16 Henkel Kommanditgesellschaft Auf Aktien Protease and amylase-containing detergent
US5801043A (en) * 1993-10-08 1998-09-01 Novo Nordisk A/S Amylase variants
US5904161A (en) * 1994-05-25 1999-05-18 The Procter & Gamble Company Cleaning compositions containing bleach and stability-enhanced enzymes
US5922083A (en) * 1995-04-03 1999-07-13 Procter & Gamble Company Detergent composition comprising a mutant amylase enzyme and oxygen bleaching agent
US5958739A (en) * 1996-06-06 1999-09-28 Genencor International Inc. Mutant α-amylase
WO1999063038A1 (en) * 1998-06-03 1999-12-09 Henkel Kommanditgesellschaft Auf Aktien Detergents containing amylase and acetonitrile
US6046149A (en) * 1996-04-17 2000-04-04 Procter & Gamble Company Detergent compositions
US6080568A (en) * 1997-08-19 2000-06-27 Genencor International, Inc. Mutant α-amylase comprising modification at residues corresponding to A210, H405 and/or T412 in Bacillus licheniformis
US6093562A (en) * 1996-02-05 2000-07-25 Novo Nordisk A/S Amylase variants
WO2000060059A2 (en) * 1999-03-30 2000-10-12 NovozymesA/S Alpha-amylase variants
WO2000060058A2 (en) 1999-03-31 2000-10-12 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
US6140293A (en) * 1996-06-19 2000-10-31 The Procter & Gamble Company Detergent compositions comprising a specific amylase and a protease
US6153576A (en) * 1996-02-16 2000-11-28 Henkel Kommanditgesellschaft Auf Aktien Transition-metal complexes used as activators for peroxy compounds
WO2000071689A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 127 and 128
WO2000071685A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 132 and 133
WO2000071690A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 128 and 129
WO2000071688A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 126 and 127
WO2000071687A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 129 and 130
WO2000071691A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 125 and 126
WO2000077193A1 (en) * 1999-06-10 2000-12-21 Rijksuniversiteit Groningen Enzyme selection
US6194370B1 (en) 1996-12-31 2001-02-27 The Procter & Gamble Company Cost effective stain and soil removal aqueous heavy duty liquid laundry detergent compositions
US6197070B1 (en) 1996-05-15 2001-03-06 The Procter & Gamble Company Detergent compositions comprising alpha combination of α-amylases for malodor stripping
WO2001023274A1 (en) 1999-09-30 2001-04-05 The Procter & Gamble Company Detergent package with means to mask amine malodours
US6221824B1 (en) 1999-02-25 2001-04-24 Henkel Kommanditgesellschaft Auf Aktien Process for the production of compounded acetonitrile derivatives
US6221825B1 (en) 1996-12-31 2001-04-24 The Procter & Gamble Company Thickened, highly aqueous liquid detergent compositions
WO2001029166A1 (en) * 1999-10-15 2001-04-26 The Procter & Gamble Company Enzymatic liquid cleaning composition
US6225274B1 (en) 1996-11-29 2001-05-01 Henkel Kommandigesellschaft Auf Aktien Acetonitrile derivatives as bleaching activators in detergents
WO2001047956A2 (en) * 1999-12-23 2001-07-05 Genencor International, Inc. Method for obtaining proteins having improved functional characteristics
WO2001066712A2 (en) 2000-03-08 2001-09-13 Novozymes A/S Variants with altered properties
WO2001096537A2 (en) * 2000-06-14 2001-12-20 Novozymes A/S Pre-oxidized alpha-amylase
WO2002016547A2 (en) 2000-08-21 2002-02-28 Novozymes A/S Subtilase enzymes
US6380147B1 (en) 1998-06-03 2002-04-30 Henkel Kommanditgesellschaft Auf Aktien Detergents containing amylase and protease
US6410295B1 (en) 1999-03-30 2002-06-25 Novozymes A/S Alpha-amylase variants
US6417152B1 (en) 1997-07-30 2002-07-09 Henkel Kommanditgesellshaft Auf Aktien Detergent containing glucanase
US6440716B1 (en) 1995-02-03 2002-08-27 Novozymes A/S α-amylase mutants
US6462006B1 (en) * 1998-04-30 2002-10-08 Henkel Kommanditgesellschaft Auf Aktien Solid machine dishwashing detergent with phosphate and crystalline lamellar silicates
WO2002092797A2 (en) 2001-05-15 2002-11-21 Novozymes A/S Alpha-amylase variant with altered properties
US6486113B1 (en) 1997-03-31 2002-11-26 Kao Corporation Mutant α-amylases
WO2003000941A2 (en) 2001-06-26 2003-01-03 Novozymes A/S Polypeptides having cellobiohydrolase i activity and polynucleotides encoding same
WO2003006602A2 (en) 2001-07-12 2003-01-23 Novozymes A/S Subtilase variants
US6541233B1 (en) 1997-07-30 2003-04-01 Henkel Kommanditgesellschaft Auf Aktien β-glucanase from a bacillus
WO2003080827A2 (en) 2002-03-27 2003-10-02 Novozymes A/S Granules with filamentous coatings
US6649085B2 (en) 2000-11-25 2003-11-18 Clariant Gmbh Cyclic sugar ketones as catalysts for peroxygen compounds
WO2004003187A2 (en) 2002-07-01 2004-01-08 Novozymes A/S Mpg added to fermentation
US6703357B1 (en) 1997-07-30 2004-03-09 Henkel Kommanditgesellschaft Auf Aktien Cleaning agent for hard surfaces, containing glucanase
US6746996B2 (en) 2001-01-19 2004-06-08 Clariant Gmbh Use of transition metal complexes having oxime ligands as bleach catalysts
WO2004067739A2 (en) 2003-01-27 2004-08-12 Novozymes A/S Stabilization of granules
WO2005001064A2 (en) 2003-06-25 2005-01-06 Novozymes A/S Polypeptides having alpha-amylase activity and polypeptides encoding same
US6841614B1 (en) 1998-10-29 2005-01-11 Henkel Kommanditgesellschaft Auf Aktien Polymer granules produced by fluidized bed granulation
WO2005040372A1 (en) 2003-10-23 2005-05-06 Novozymes A/S Protease with improved stability in detergents
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP1597363A1 (en) * 2003-02-26 2005-11-23 Genencor International, Inc. Amylases producing an altered immunogenic response and methods of making and using the same
WO2005123911A2 (en) 2004-06-21 2005-12-29 Novozymes A/S Proteases
WO2006002643A2 (en) 2004-07-05 2006-01-12 Novozymes A/S Alpha-amylase variants with altered properties
WO2006032278A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032277A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032279A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP1700904A1 (en) 2005-03-11 2006-09-13 Unilever N.V. Liquid detergent composition
EP1700907A1 (en) 2005-03-11 2006-09-13 Unilever N.V. Liquid bleaching composition
US7115409B1 (en) 1995-02-03 2006-10-03 Novozymes A/S α-amylase mutants
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
US7153820B2 (en) 2001-08-13 2006-12-26 Ecolab Inc. Solid detergent composition and method for solidifying a detergent composition
WO2007006305A1 (en) 2005-07-08 2007-01-18 Novozymes A/S Subtilase variants
WO2007019858A2 (en) 2005-08-16 2007-02-22 Novozymes A/S Subtilases
WO2007036235A1 (en) 2005-09-30 2007-04-05 Novozymes A/S Immobilization of enzymes
EP1803817A1 (en) 1998-12-18 2007-07-04 Novozymes A/S Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region
EP1826261A2 (en) 2003-02-28 2007-08-29 The Procter & Gamble Company Foam-generating kit containing a foam-generating dispenser and a composition containing a high level of surfactant
WO2007098756A1 (en) 2006-03-02 2007-09-07 Novozymes A/S High capacity encapsulation process
WO2007107573A1 (en) 2006-03-22 2007-09-27 Novozymes A/S Use of polypeptides having antimicrobial activity
WO2007113241A1 (en) 2006-03-31 2007-10-11 Novozymes A/S A stabilized liquid enzyme composition
US7300782B2 (en) 2001-12-21 2007-11-27 B.R.A.I.N. Biotechnology Research And Information Network Ag Glycosyl hydrolases
WO2008021761A2 (en) 2006-08-11 2008-02-21 Novozymes Biologicals, Inc. Bacteria cultures and compositions comprising bacteria cultures
WO2008040818A1 (en) 2006-10-06 2008-04-10 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
WO2008057637A2 (en) 2006-07-21 2008-05-15 Novozymes, Inc. Methods of increasing secretion of polypeptides having biological activity
EP1923455A2 (en) 2003-02-18 2008-05-21 Novozymes A/S Detergent compositions
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
EP1975229A2 (en) 2000-10-13 2008-10-01 Novozymes A/S Alpha-amylase variant with altered properties
WO2008118377A2 (en) * 2007-03-23 2008-10-02 Danisco Us, Inc., Genencor Division Enhanced amylase production by n-terminal addition to mature amylase protein
WO2008118749A2 (en) 2007-03-23 2008-10-02 Novozymes Biologicals, Inc. Preventing and reducing biofilm formation and planktonic proliferation
EP2011864A1 (en) 1999-03-31 2009-01-07 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
WO2009050684A2 (en) 2007-10-18 2009-04-23 Ecolab Inc. Pressed, waxy, solid cleaning compositions and methods of making them
DE102007053615A1 (en) 2007-11-08 2009-05-14 Henkel Ag & Co. Kgaa Improvement of the fragrance effect of fragrance esters
EP2088186A1 (en) 2003-12-13 2009-08-12 Henkel AG & Co. KGaA Multi-component thin-to-thick system
US7618801B2 (en) 2007-10-30 2009-11-17 Danison US Inc. Streptomyces protease
EP2128247A1 (en) 2002-12-20 2009-12-02 Novozymes A/S Polypeptides having cellobiohydrolase II activity and polynucleotides encoding same
EP2138574A2 (en) 2002-11-06 2009-12-30 Novozymes A/S Subtilase variants
EP2149786A1 (en) 2008-08-01 2010-02-03 Unilever PLC Improvements relating to detergent analysis
EP2166076A1 (en) 2008-09-23 2010-03-24 The Procter & Gamble Company Cleaning composition
EP2166073A1 (en) 2008-09-23 2010-03-24 The Procter & Gamble Company Cleaning composition
EP2166075A1 (en) 2008-09-23 2010-03-24 The Procter and Gamble Company Cleaning composition
US7713723B1 (en) 2000-08-01 2010-05-11 Novozymes A/S Alpha-amylase mutants with altered properties
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2199386A1 (en) 1993-10-08 2010-06-23 Novozymes A/S Amylase variants
EP2202290A1 (en) 2008-12-23 2010-06-30 Unilever PLC A flowable laundry composition and packaging therefor
EP2204446A1 (en) 2000-08-01 2010-07-07 Novozymes A/S Alpha-amylase mutants with altered properties
EP2213723A1 (en) 2009-01-30 2010-08-04 Novozymes A/S Isomaltose for fungus fermentation
EP2216393A1 (en) 2009-02-09 2010-08-11 The Procter & Gamble Company Detergent composition
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
US7803604B2 (en) 2000-07-28 2010-09-28 Henkel Ag & Co. Kgaa Amylolytic enzyme extracted from Bacillus sp. A 7-7 (DSM 12368) and washing and cleaning agents containing this novel amylolytic enzyme
WO2010115021A2 (en) 2009-04-01 2010-10-07 Danisco Us Inc. Compositions and methods comprising alpha-amylase variants with altered properties
EP2261359A1 (en) 1998-06-10 2010-12-15 Novozymes A/S Mannanases
EP2267000A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
WO2011005730A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company A catalytic laundry detergent composition comprising relatively low levels of water-soluble electrolyte
WO2011005913A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company A catalytic laundry detergent composition comprising relatively low levels of water-soluble electrolyte
US7888104B2 (en) 2000-11-28 2011-02-15 Henkel Ag & Co. Kgaa Cyclodextrin glucanotransferase (CGTase), obtained from<I>Bacillus agaradherens<λ>(DSM 9948) and detergents and cleaning agents containing said novel cyclodextrin glucanotransferase
EP2284259A2 (en) 2003-10-10 2011-02-16 Novozymes A/S Protease variants
WO2011025615A2 (en) 2009-08-13 2011-03-03 The Procter & Gamble Company Method of laundering fabrics at low temperature
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2302027A2 (en) 1997-10-13 2011-03-30 Novozymes A/S Alpha-amylase mutants
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
EP2305821A2 (en) 2004-02-13 2011-04-06 Novozymes A/S Protease variants
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2333055A1 (en) 2000-10-13 2011-06-15 Novozymes A/S Subtilase variants
WO2011071994A2 (en) 2009-12-10 2011-06-16 The Procter & Gamble Company Detergent composition
WO2011071997A1 (en) 2009-12-10 2011-06-16 The Procter & Gamble Company Automatic dishwashing product and use thereof
WO2011072017A2 (en) 2009-12-10 2011-06-16 The Procter & Gamble Company Detergent composition
WO2011072117A1 (en) 2009-12-09 2011-06-16 The Procter & Gamble Company Fabric and home care products
EP2336331A1 (en) 1999-08-31 2011-06-22 Novozymes A/S Novel proteases and variants thereof
WO2011076897A1 (en) 2009-12-22 2011-06-30 Novozymes A/S Use of amylase variants at low temperature
WO2011080354A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
WO2011084319A1 (en) 2009-12-10 2011-07-14 The Procter & Gamble Company Detergent composition
EP2345599A1 (en) 2008-02-08 2011-07-20 The Procter & Gamble Company Water-soluble pouch
EP2357220A1 (en) 2010-02-10 2011-08-17 The Procter & Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
WO2011100667A1 (en) 2010-02-14 2011-08-18 Ls9, Inc. Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols
WO2011098531A1 (en) 2010-02-10 2011-08-18 Novozymes A/S Variants and compositions comprising variants with high stability in presence of a chelating agent
EP2361964A1 (en) 2010-02-25 2011-08-31 The Procter & Gamble Company Detergent composition
WO2011104339A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Variants of a lysozyme and polynucleotides encoding same
WO2011120882A1 (en) 2010-03-30 2011-10-06 Novozymes A/S Crystal metabolite recovery
EP2380962A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Particle
EP2380961A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Detergent composition
EP2380963A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Method of perfuming
EP2380481A2 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Automatic dishwashing product
WO2011133462A1 (en) 2010-04-23 2011-10-27 The Procter & Gamble Company Particle
WO2011134809A1 (en) 2010-04-26 2011-11-03 Novozymes A/S Enzyme granules
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
EP2386568A1 (en) 1997-10-30 2011-11-16 Novozymes A/S Alpha-amylase mutants
US8080401B2 (en) 2004-10-01 2011-12-20 Henkel Ag & Co. Kgaa Alpha-amylase variants having an elevated solvent stability, method for the production thereof and detergents and cleansers containing these alpha-amylase variants
US8084240B2 (en) 2008-06-06 2011-12-27 Danisco Us Inc. Geobacillus stearothermophilus α-amylase (AmyS) variants with improved properties
DE212009000119U1 (en) 2008-09-12 2011-12-30 Unilever N.V. Dispenser and pretreatment agent for viscous liquids
EP2420558A1 (en) 2010-08-17 2012-02-22 The Procter & Gamble Company Stable sustainable hand dish-washing detergents
EP2420557A1 (en) 2010-08-17 2012-02-22 The Procter & Gamble Company A method for hand washing dishes having long lasting suds
WO2012028483A1 (en) 2010-08-30 2012-03-08 Novozymes A/S A concentrated soak wash
WO2012028482A1 (en) 2010-08-30 2012-03-08 Novozymes A/S A two-soak wash
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
WO2012038144A1 (en) 2010-09-20 2012-03-29 Unilever Plc Fabric treatment compositions comprising target benefit agents
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US8153412B2 (en) 2007-11-05 2012-04-10 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
EP2450427A2 (en) 2010-11-05 2012-05-09 Respekt Danmark A/S Dishwasher detergent
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US8206966B2 (en) 2007-11-05 2012-06-26 Danisco Us Inc. Alpha-amylase variants with altered properties
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
US8236545B2 (en) 2008-02-04 2012-08-07 Danisco Us Inc., Genencor Division TS23 alpha-amylase variants with altered properties
WO2012104176A1 (en) 2011-01-31 2012-08-09 Novozymes A/S Use of browned glucose as a feed substrate
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012112718A1 (en) 2011-02-15 2012-08-23 Novozymes Biologicals, Inc. Mitigation of odor in cleaning machines and cleaning processes
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012151534A1 (en) 2011-05-05 2012-11-08 Danisco Us Inc. Compositions and methods comprising serine protease variants
WO2012151480A2 (en) 2011-05-05 2012-11-08 The Procter & Gamble Company Compositions and methods comprising serine protease variants
WO2012160498A2 (en) 2011-05-20 2012-11-29 Ecolab Usa Inc. Acid formulations for use in a system for warewashing
EP2500423A3 (en) * 2003-02-26 2012-12-12 Genencor International, Inc. Amylases producing an altered immunogenic response and methods of making and using the same
EP2537918A1 (en) 2011-06-20 2012-12-26 The Procter & Gamble Company Consumer products with lipase comprising coated particles
WO2012175401A2 (en) 2011-06-20 2012-12-27 Novozymes A/S Particulate composition
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
WO2013006871A2 (en) 2012-02-13 2013-01-10 Milliken & Company Laundry care compositions containing dyes
WO2013004635A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Liquid detergent composition
WO2013004636A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Stabilized subtilisin composition
WO2013007594A1 (en) 2011-07-12 2013-01-17 Novozymes A/S Storage-stable enzyme granules
EP2551335A1 (en) 2011-07-25 2013-01-30 The Procter & Gamble Company Enzyme stabilized liquid detergent composition
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
EP2584028A1 (en) 2011-10-19 2013-04-24 The Procter & Gamble Company Particle
WO2013076253A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013098205A2 (en) 2011-12-29 2013-07-04 Novozymes A/S Detergent compositions
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
EP2617804A1 (en) 2007-02-15 2013-07-24 Ecolab Inc. Fast dissolving solid detergent
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
EP2623586A2 (en) 2012-02-03 2013-08-07 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
US8507243B2 (en) 2008-09-25 2013-08-13 Danisco Us Inc. Alpha-amylase blends and methods for using said blends
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013131964A1 (en) 2012-03-07 2013-09-12 Novozymes A/S Detergent composition and substitution of optical brighteners in detergent compositions
WO2013138288A1 (en) 2012-03-16 2013-09-19 Monosol, Llc. Water soluble compositions incorporating enzymes, and method of making same
WO2013142486A1 (en) 2012-03-19 2013-09-26 The Procter & Gamble Company Laundry care compositions containing dyes
WO2013148492A1 (en) 2012-03-29 2013-10-03 Novozymes A/S Use of enzymes for preparing water soluble films
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013158364A1 (en) 2012-04-16 2013-10-24 Monosol, Llc Powdered pouch and method of making same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013171241A1 (en) 2012-05-16 2013-11-21 Novozymes A/S Compositions comprising lipase and methods of use thereof
EP2674475A1 (en) 2012-06-11 2013-12-18 The Procter & Gamble Company Detergent composition
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2014009473A1 (en) 2012-07-12 2014-01-16 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
CN101117629B (en) * 1995-02-03 2014-06-11 诺维信公司 Amylase variants
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
WO2014100100A1 (en) 2012-12-20 2014-06-26 The Procter & Gamble Company Detergent composition with silicate coated bleach
US8785365B2 (en) 2004-10-01 2014-07-22 Basf Se Alpha-amylase variants stabilized against dimerization and/or multimerization, method for the production thereof, and detergents and cleansers containing these alpha-amylase variants
WO2014138141A1 (en) 2013-03-05 2014-09-12 The Procter & Gamble Company Mixed sugar compositions
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014152674A1 (en) 2013-03-14 2014-09-25 Novozymes A/S Enzyme and inhibitor containing water-soluble films
WO2014160820A1 (en) 2013-03-28 2014-10-02 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
EP2792737A1 (en) 2011-05-20 2014-10-22 Ecolab USA Inc. Non-phosphate detergents and non-phosphoric acids in an alternating alkali/acid system for warewashing
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
EP2808372A1 (en) 2013-05-28 2014-12-03 The Procter and Gamble Company Surface treatment compositions comprising photochromic dyes
WO2014194117A2 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
WO2014194054A1 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
WO2014191170A1 (en) 2013-05-30 2014-12-04 Novozymes A/S Particulate enzyme composition
WO2014194034A2 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
WO2014194032A1 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
WO2014198840A1 (en) 2013-06-12 2014-12-18 Earth Alive Clean Technologies Inc. Dust suppressant
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
WO2015042209A1 (en) 2013-09-18 2015-03-26 The Procter & Gamble Company Laundry care compositions containing thiophene azo carboxylate dyes
WO2015042086A1 (en) 2013-09-18 2015-03-26 The Procter & Gamble Company Laundry care composition comprising carboxylate dye
WO2015042087A1 (en) 2013-09-18 2015-03-26 The Procter & Gamble Company Laundry care composition comprising carboxylate dye
WO2015041887A2 (en) 2013-09-18 2015-03-26 Milliken & Company Laundry care composition comprising carboxylate dye
EP2857515A2 (en) 2008-11-20 2015-04-08 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
EP2857486A1 (en) 2013-10-07 2015-04-08 WeylChem Switzerland AG Multi-compartment pouch comprising cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
EP2857485A1 (en) 2013-10-07 2015-04-08 WeylChem Switzerland AG Multi-compartment pouch comprising alkanolamine-free cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
EP2857487A1 (en) 2013-10-07 2015-04-08 WeylChem Switzerland AG Multi-compartment pouch comprising cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
WO2015089447A1 (en) 2013-12-13 2015-06-18 Danisco Us Inc. Serine proteases of the bacillus gibsonii-clade
WO2015089441A1 (en) 2013-12-13 2015-06-18 Danisco Us Inc. Serine proteases of bacillus species
WO2015095358A1 (en) 2013-12-18 2015-06-25 E. I. Du Pont De Nemours And Company Cationic poly alpha-1,3-glucan ethers
WO2015112341A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Fabric treatment composition
WO2015112338A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Method of treating textile fabrics
WO2015112340A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Method of treating textile fabrics
WO2015112339A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Fabric treatment composition
WO2015123323A1 (en) 2014-02-14 2015-08-20 E. I. Du Pont De Nemours And Company Poly-alpha-1,3-1,6-glucans for viscosity modification
WO2015130653A1 (en) 2014-02-25 2015-09-03 The Procter & Gamble Company A process for making renewable surfactant intermediates and surfactants from fats and oils and products thereof
WO2015130669A1 (en) 2014-02-25 2015-09-03 The Procter & Gamble Company A process for making renewable surfactant intermediates and surfactants from fats and oils and products thereof
WO2015134737A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase
WO2015134729A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of non-cellulosic textile materials with xyloglucan endotransglycosylase
WO2015138283A1 (en) 2014-03-11 2015-09-17 E. I. Du Pont De Nemours And Company Oxidized poly alpha-1,3-glucan as detergent builder
EP2924108A1 (en) 2014-03-28 2015-09-30 The Procter and Gamble Company Water soluble unit dose article
EP2924105A1 (en) 2014-03-28 2015-09-30 The Procter and Gamble Company Water soluble unit dose article
WO2015148360A1 (en) 2014-03-27 2015-10-01 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2015148361A1 (en) 2014-03-27 2015-10-01 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2015148890A1 (en) 2014-03-27 2015-10-01 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
WO2015171592A1 (en) 2014-05-06 2015-11-12 Milliken & Company Laundry care compositions
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015187757A1 (en) 2014-06-06 2015-12-10 The Procter & Gamble Company Detergent composition comprising polyalkyleneimine polymers
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2015189370A1 (en) * 2014-06-12 2015-12-17 Novozymes A/S Oxidation stable alpha-amylase variants
WO2015195777A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2015195960A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
WO2016044200A1 (en) 2014-09-15 2016-03-24 The Procter & Gamble Company Detergent compositions containing salts of polyetheramines and polymeric acid
WO2016049387A1 (en) 2014-09-26 2016-03-31 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2016048969A1 (en) 2014-09-25 2016-03-31 The Procter & Gamble Company Detergent compositions containing a polyetheramine and an anionic soil release polymer
WO2016048674A1 (en) 2014-09-25 2016-03-31 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2016061438A1 (en) 2014-10-17 2016-04-21 Danisco Us Inc. Serine proteases of bacillus species
WO2016069552A1 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016069557A1 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases of bacillus species
WO2016069548A2 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016069569A2 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016069544A1 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016081437A1 (en) 2014-11-17 2016-05-26 The Procter & Gamble Company Benefit agent delivery compositions
WO2016079110A2 (en) 2014-11-19 2016-05-26 Novozymes A/S Use of enzyme for cleaning
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
EP3034596A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034597A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034589A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034588A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034590A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Method of automatic dishwashing
EP3034592A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Method of automatic dishwashing
EP3034591A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Method of automatic dishwashing
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
WO2016106011A1 (en) 2014-12-23 2016-06-30 E. I. Du Pont De Nemours And Company Enzymatically produced cellulose
WO2016135351A1 (en) 2015-06-30 2016-09-01 Novozymes A/S Laundry detergent composition, method for washing and use of composition
US9434932B2 (en) 2011-06-30 2016-09-06 Novozymes A/S Alpha-amylase variants
EP3067410A2 (en) 2008-02-15 2016-09-14 The Procter and Gamble Company Cleaning compositions
EP3075832A1 (en) 2015-03-30 2016-10-05 Dalli-Werke GmbH & Co. KG Manganese-amino acid compounds in cleaning compositions
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
EP3088502A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
EP3088503A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
EP3088504A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
EP3088506A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Detergent composition
EP3088505A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
WO2016178668A1 (en) 2015-05-04 2016-11-10 Milliken & Company Leuco triphenylmethane colorants as bluing agents in laundry care compositions
WO2016184944A1 (en) 2015-05-19 2016-11-24 Novozymes A/S Odor reduction
EP3101109A1 (en) 2015-06-04 2016-12-07 The Procter and Gamble Company Hand dishwashing liquid detergent composition
EP3101108A1 (en) 2015-06-04 2016-12-07 The Procter and Gamble Company Hand dishwashing liquid detergent composition
EP3101103A1 (en) 2015-06-05 2016-12-07 The Procter and Gamble Company Compacted liquid laundry detergent composition
WO2016201069A1 (en) 2015-06-09 2016-12-15 Danisco Us Inc Low-density enzyme-containing particles
WO2016201044A1 (en) 2015-06-09 2016-12-15 Danisco Us Inc Osmotic burst encapsulates
WO2016201040A1 (en) 2015-06-09 2016-12-15 Danisco Us Inc. Water-triggered enzyme suspension
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2016202785A1 (en) 2015-06-17 2016-12-22 Novozymes A/S Container
WO2016205755A1 (en) 2015-06-17 2016-12-22 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
EP2660309B1 (en) 2008-03-14 2017-03-22 The Procter & Gamble Company Automatic dishwashing detergent composition
WO2017046260A1 (en) 2015-09-17 2017-03-23 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2017046232A1 (en) 2015-09-17 2017-03-23 Henkel Ag & Co. Kgaa Detergent compositions comprising polypeptides having xanthan degrading activity
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017079756A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus and bacillus spp. mannanases
WO2017079751A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus sp. mannanases
WO2017083228A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017083226A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
WO2017083229A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
EP3173467A1 (en) 2015-11-26 2017-05-31 The Procter & Gamble Company Cleaning compositions comprising enzymes
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
WO2017106676A1 (en) 2015-12-18 2017-06-22 Danisco Us Inc Polypeptides with endoglucanase activity and uses thereof
WO2017117089A1 (en) 2015-12-28 2017-07-06 Novozymes Bioag A/S Heat priming of bacterial spores
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
US9725685B2 (en) 2014-01-30 2017-08-08 The Procter & Gamble Company Unit dose article
WO2017174769A2 (en) 2016-04-08 2017-10-12 Novozymes A/S Detergent compositions and uses of the same
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
WO2017192300A1 (en) 2016-05-05 2017-11-09 Danisco Us Inc Protease variants and uses thereof
WO2017191160A1 (en) 2016-05-03 2017-11-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
WO2017192692A1 (en) 2016-05-03 2017-11-09 Danisco Us Inc Protease variants and uses thereof
WO2017194487A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
WO2017210295A1 (en) 2016-05-31 2017-12-07 Danisco Us Inc. Protease variants and uses thereof
WO2017207762A1 (en) 2016-06-03 2017-12-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2017210188A1 (en) 2016-05-31 2017-12-07 Novozymes A/S Stabilized liquid peroxide compositions
EP3257931A1 (en) 2016-06-17 2017-12-20 The Procter and Gamble Company Detergent composition
WO2017219011A1 (en) 2016-06-17 2017-12-21 Danisco Us Inc Protease variants and uses thereof
WO2017220422A1 (en) 2016-06-23 2017-12-28 Novozymes A/S Use of enzymes, composition and method for removing soil
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
WO2018007435A1 (en) 2016-07-05 2018-01-11 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018011277A1 (en) 2016-07-13 2018-01-18 Novozymes A/S Bacillus cibi dnase variants
WO2018011242A1 (en) 2016-07-14 2018-01-18 Basf Se Fermentation medium comprising chelating agent
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
EP3282004A1 (en) 2011-12-13 2018-02-14 Ecolab USA Inc. Warewashing method
EP3284805A1 (en) 2016-08-17 2018-02-21 The Procter & Gamble Company Cleaning composition comprising enzymes
WO2018037064A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants i
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2018037062A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018060216A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Use of enzyme for washing, method for washing and warewashing composition
WO2018060475A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Spore containing granule
EP3309249A1 (en) 2013-07-29 2018-04-18 Novozymes A/S Protease variants and polynucleotides encoding same
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
WO2018085524A2 (en) 2016-11-07 2018-05-11 Danisco Us Inc Laundry detergent composition
WO2018084930A1 (en) 2016-11-03 2018-05-11 Milliken & Company Leuco triphenylmethane colorants as bluing agents in laundry care compositions
WO2018085390A1 (en) 2016-11-01 2018-05-11 Milliken & Company Leuco colorants as bluing agents in laundry care compositions
WO2018085310A1 (en) 2016-11-01 2018-05-11 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care compositions
WO2018085315A1 (en) 2016-11-01 2018-05-11 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care compositions, packaging, kits and methods thereof
WO2018083093A1 (en) 2016-11-01 2018-05-11 Novozymes A/S Multi-core granules
EP3321360A2 (en) 2013-01-03 2018-05-16 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP3330348A1 (en) 2016-12-02 2018-06-06 The Procter & Gamble Company Cleaning compositions including enzymes
WO2018099762A1 (en) 2016-12-01 2018-06-07 Basf Se Stabilization of enzymes in compositions
WO2018102479A1 (en) 2016-12-02 2018-06-07 The Procter & Gamble Company Cleaning compositions including enzymes
WO2018108865A1 (en) 2016-12-12 2018-06-21 Novozymes A/S Use of polypeptides
WO2018118950A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
WO2018118917A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Protease variants and uses thereof
EP3357994A1 (en) 2017-02-01 2018-08-08 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2018156705A1 (en) 2017-02-24 2018-08-30 Danisco Us Inc. Compositions and methods for increased protein production in bacillus licheniformis
WO2018169750A1 (en) 2017-03-15 2018-09-20 Danisco Us Inc Trypsin-like serine proteases and uses thereof
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018177938A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018183662A1 (en) 2017-03-31 2018-10-04 Danisco Us Inc Delayed release enzyme formulations for bleach-containing detergents
WO2018178061A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having rnase activity
WO2018184004A1 (en) 2017-03-31 2018-10-04 Danisco Us Inc Alpha-amylase combinatorial variants
EP3385362A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising fungal mannanases
EP3385361A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising bacterial mannanases
WO2018184816A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185150A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptides
WO2018185152A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptide compositions and uses thereof
WO2018184873A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Detergent compositions and uses thereof
WO2018184817A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185048A1 (en) 2017-04-03 2018-10-11 Novozymes A/S Recovery process
WO2018185285A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018184818A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185269A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185280A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185181A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Glycosyl hydrolases
WO2018185267A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018202846A1 (en) 2017-05-05 2018-11-08 Novozymes A/S Compositions comprising lipase and sulfite
EP3401385A1 (en) 2017-05-08 2018-11-14 Henkel AG & Co. KGaA Detergent composition comprising polypeptide comprising carbohydrate-binding domain
WO2018206535A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Carbohydrate-binding domain and polynucleotides encoding the same
WO2018206300A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018206302A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018224544A1 (en) 2017-06-08 2018-12-13 Novozymes A/S Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions
EP3415592A1 (en) 2017-06-15 2018-12-19 The Procter & Gamble Company Water-soluble unit dose article comprising a solid laundry detergent composition
WO2019002356A1 (en) 2017-06-30 2019-01-03 Novozymes A/S Enzyme slurry composition
WO2019006077A1 (en) 2017-06-30 2019-01-03 Danisco Us Inc Low-agglomeration, enzyme-containing particles
WO2019030186A1 (en) 2017-08-07 2019-02-14 Novozymes A/S Use of fca control based on ph
WO2019036721A2 (en) 2017-08-18 2019-02-21 Danisco Us Inc Alpha-amylase variants
WO2019040412A1 (en) 2017-08-23 2019-02-28 Danisco Us Inc Methods and compositions for efficient genetic modifications of bacillus licheniformis strains
WO2019038058A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2019038059A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent compositions comprising gh9 endoglucanase variants ii
WO2019038057A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2019038060A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase variants ii
EP3453757A1 (en) 2013-12-20 2019-03-13 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2019055261A1 (en) 2017-09-13 2019-03-21 Danisco Us Inc Modified 5'-untranslated region (utr) sequences for increased protein production in bacillus
WO2019057902A1 (en) 2017-09-22 2019-03-28 Novozymes A/S Novel polypeptides
WO2019057758A1 (en) 2017-09-20 2019-03-28 Novozymes A/S Use of enzymes for improving water absorption and/or whiteness
EP3461881A1 (en) 2013-05-03 2019-04-03 Novozymes A/S Microencapsulation of detergent enzymes
WO2019067390A1 (en) 2017-09-27 2019-04-04 The Procter & Gamble Company Detergent compositions comprising lipases
WO2019063499A1 (en) 2017-09-27 2019-04-04 Novozymes A/S Lipase variants and microcapsule compositions comprising such lipase variants
WO2019068715A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019068713A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
EP3470516A1 (en) 2012-09-10 2019-04-17 Ecolab USA Inc. Stable liquid manual dishwashing compositions containing enzymes
WO2019075228A1 (en) 2017-10-12 2019-04-18 Milliken & Company Leuco colorants and compositions
WO2019075146A1 (en) 2017-10-12 2019-04-18 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care composition
WO2019075148A1 (en) 2017-10-12 2019-04-18 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care compositions
WO2019075144A1 (en) 2017-10-12 2019-04-18 The Procter & Gamble Company Leuco colorants in combination with a second whitening agent as bluing agents in laundry care compositions
WO2019076833A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Low dusting granules
WO2019076800A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Cleaning compositions and uses thereof
WO2019076834A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Low dusting granules
WO2019081721A1 (en) 2017-10-27 2019-05-02 Novozymes A/S Dnase variants
DE102017125558A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANING COMPOSITIONS CONTAINING DISPERSINE I
DE102017125560A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE III
WO2019084350A1 (en) 2017-10-27 2019-05-02 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
WO2019081515A1 (en) 2017-10-24 2019-05-02 Novozymes A/S Compositions comprising polypeptides having mannanase activity
DE102017125559A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE II
WO2019086532A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Methods for cleaning medical devices
WO2019086528A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Polypeptides and compositions comprising such polypeptides
WO2019086530A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Polypeptides and compositions comprising such polypeptides
WO2019089228A1 (en) 2017-11-01 2019-05-09 Milliken & Company Leuco compounds, colorant compounds, and compositions containing the same
WO2019089898A1 (en) 2017-11-02 2019-05-09 Danisco Us Inc Freezing point depressed solid matrix compositions for melt granulation of enzymes
WO2019091822A1 (en) 2017-11-09 2019-05-16 Basf Se Coatings of enzyme particles comprising organic white pigments
WO2019108599A1 (en) 2017-11-29 2019-06-06 Danisco Us Inc Subtilisin variants having improved stability
US10316275B2 (en) 2015-05-08 2019-06-11 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2019110462A1 (en) 2017-12-04 2019-06-13 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2019125683A1 (en) 2017-12-21 2019-06-27 Danisco Us Inc Enzyme-containing, hot-melt granules comprising a thermotolerant desiccant
WO2019135868A1 (en) 2018-01-03 2019-07-11 Danisco Us Inc Mutant and genetically modified bacillus cells and methods thereof for increased protein production
WO2019154951A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipases, lipase variants and compositions thereof
WO2019154954A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019156670A1 (en) 2018-02-08 2019-08-15 Danisco Us Inc. Thermally-resistant wax matrix particles for enzyme encapsulation
WO2019162000A1 (en) 2018-02-23 2019-08-29 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase and endoglucanase variants
WO2019168650A1 (en) 2018-02-28 2019-09-06 The Procter & Gamble Company Methods of cleaning
WO2019168649A1 (en) 2018-02-28 2019-09-06 The Procter & Gamble Company Cleaning compositions
WO2019175240A1 (en) 2018-03-13 2019-09-19 Novozymes A/S Microencapsulation using amino sugar oligomers
WO2019180111A1 (en) 2018-03-23 2019-09-26 Novozymes A/S Subtilase variants and compositions comprising same
US10428321B2 (en) 2014-06-12 2019-10-01 Novozymes A/S Alpha-amylase variants
WO2019185726A1 (en) 2018-03-29 2019-10-03 Novozymes A/S Mannanase variants and polynucleotides encoding same
EP3553172A1 (en) 2012-08-16 2019-10-16 Novozymes A/S Method for treating textile with endoglucanase
WO2019201785A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019201783A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019201793A1 (en) 2018-04-17 2019-10-24 Novozymes A/S Polypeptides comprising carbohydrate binding activity in detergent compositions and their use in reducing wrinkles in textile or fabric.
WO2019206994A1 (en) 2018-04-26 2019-10-31 Basf Se Lipase enzymes
WO2019211143A1 (en) 2018-05-03 2019-11-07 Basf Se Amylase enzymes
EP3569611A1 (en) 2013-04-23 2019-11-20 Novozymes A/S Liquid automatic dish washing detergent compositions with stabilised subtilisin
WO2019238761A1 (en) 2018-06-15 2019-12-19 Basf Se Water soluble multilayer films containing wash active chemicals and enzymes
WO2019245705A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2019245704A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
EP3587569A1 (en) 2014-03-21 2020-01-01 Danisco US Inc. Serine proteases of bacillus species
WO2020002255A1 (en) 2018-06-29 2020-01-02 Novozymes A/S Subtilase variants and compositions comprising same
WO2020002608A1 (en) 2018-06-29 2020-01-02 Novozymes A/S Detergent compositions and uses thereof
WO2020002604A1 (en) 2018-06-28 2020-01-02 Novozymes A/S Detergent compositions and uses thereof
WO2020007863A1 (en) 2018-07-02 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020007875A1 (en) 2018-07-03 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020008043A1 (en) 2018-07-06 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020008024A1 (en) 2018-07-06 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020028443A1 (en) 2018-07-31 2020-02-06 Danisco Us Inc Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid
EP3608403A2 (en) 2014-12-15 2020-02-12 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
EP3611260A1 (en) 2013-07-29 2020-02-19 Novozymes A/S Protease variants and polynucleotides encoding same
WO2020047215A1 (en) 2018-08-30 2020-03-05 Danisco Us Inc Enzyme-containing granules
WO2020068486A1 (en) 2018-09-27 2020-04-02 Danisco Us Inc Compositions for medical instrument cleaning
WO2020070014A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition comprising anionic surfactant and a polypeptide having rnase activity
WO2020069914A1 (en) 2018-10-05 2020-04-09 Basf Se Compounds stabilizing amylases in liquids
WO2020070009A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Endonuclease 1 ribonucleases for cleaning
WO2020070063A2 (en) 2018-10-01 2020-04-09 Novozymes A/S Detergent compositions and uses thereof
WO2020070209A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition
WO2020070011A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition
WO2020070249A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Cleaning compositions
WO2020070199A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same
WO2020077331A2 (en) 2018-10-12 2020-04-16 Danisco Us Inc Alpha-amylases with mutations that improve stability in the presence of chelants
WO2020074545A1 (en) 2018-10-11 2020-04-16 Novozymes A/S Cleaning compositions and uses thereof
EP3647398A1 (en) 2018-10-31 2020-05-06 Henkel AG & Co. KGaA Cleaning compositions containing dispersins v
EP3647397A1 (en) 2018-10-31 2020-05-06 Henkel AG & Co. KGaA Cleaning compositions containing dispersins iv
US10647946B2 (en) 2015-05-08 2020-05-12 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2020112599A1 (en) 2018-11-28 2020-06-04 Danisco Us Inc Subtilisin variants having improved stability
WO2020114968A1 (en) 2018-12-03 2020-06-11 Novozymes A/S Powder detergent compositions
WO2020114965A1 (en) 2018-12-03 2020-06-11 Novozymes A/S LOW pH POWDER DETERGENT COMPOSITION
WO2020127775A1 (en) 2018-12-21 2020-06-25 Novozymes A/S Detergent pouch comprising metalloproteases
WO2020127796A2 (en) 2018-12-21 2020-06-25 Novozymes A/S Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same
EP3677676A1 (en) 2019-01-03 2020-07-08 Basf Se Compounds stabilizing amylases in liquids
EP3690037A1 (en) 2014-12-04 2020-08-05 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2020169564A1 (en) 2019-02-20 2020-08-27 Basf Se Industrial fermentation process for bacillus using defined medium and trace element feed
WO2020169563A1 (en) 2019-02-20 2020-08-27 Basf Se Industrial fermentation process for bacillus using defined medium and magnesium feed
EP3702452A1 (en) 2019-03-01 2020-09-02 Novozymes A/S Detergent compositions comprising two proteases
WO2020188095A1 (en) 2019-03-21 2020-09-24 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP3715442A1 (en) 2016-03-23 2020-09-30 Novozymes A/S Use of polypeptide having dnase activity for treating fabrics
WO2020193535A2 (en) 2019-03-25 2020-10-01 Basf Se Amylase enzymes
WO2020193534A2 (en) 2019-03-25 2020-10-01 Basf Se Amylase enzymes
WO2020201403A1 (en) 2019-04-03 2020-10-08 Novozymes A/S Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions
EP3722406A1 (en) 2014-04-11 2020-10-14 Novozymes A/S Detergent composition
WO2020207944A1 (en) 2019-04-10 2020-10-15 Novozymes A/S Polypeptide variants
WO2020208056A1 (en) 2019-04-12 2020-10-15 Novozymes A/S Stabilized glycoside hydrolase variants
EP3739029A1 (en) 2014-07-04 2020-11-18 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2020229480A1 (en) 2019-05-14 2020-11-19 Basf Se Compounds stabilizing hydrolases in liquids
EP3741848A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
EP3741849A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
WO2020242858A1 (en) 2019-05-24 2020-12-03 Danisco Us Inc Subtilisin variants and methods of use
WO2020247582A1 (en) 2019-06-06 2020-12-10 Danisco Us Inc Methods and compositions for cleaning
WO2020249546A1 (en) 2019-06-13 2020-12-17 Basf Se Method of recovering a protein from fermentation broth using a divalent cation
WO2020264552A1 (en) 2019-06-24 2020-12-30 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2021001244A1 (en) 2019-07-01 2021-01-07 Basf Se Peptide acetals for stabilising enzymes
WO2021001400A1 (en) 2019-07-02 2021-01-07 Novozymes A/S Lipase variants and compositions thereof
WO2021004830A1 (en) 2019-07-05 2021-01-14 Basf Se Industrial fermentation process for microbial cells using a fed-batch pre-culture
WO2021009067A1 (en) 2019-07-12 2021-01-21 Novozymes A/S Enzymatic emulsions for detergents
WO2021022045A1 (en) 2019-07-31 2021-02-04 Ecolab Usa Inc. Personal protective equipment free delimer compositions
WO2021030267A1 (en) 2019-08-14 2021-02-18 Danisco Us Inc Compositions and methods for increased protein production in bacillus licheniformis
WO2021032881A1 (en) 2019-08-22 2021-02-25 Basf Se Amylase variants
EP3786269A1 (en) 2013-06-06 2021-03-03 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2021037895A1 (en) 2019-08-27 2021-03-04 Novozymes A/S Detergent composition
WO2021037878A1 (en) 2019-08-27 2021-03-04 Novozymes A/S Composition comprising a lipase
WO2021053127A1 (en) 2019-09-19 2021-03-25 Novozymes A/S Detergent composition
WO2021064068A1 (en) 2019-10-03 2021-04-08 Novozymes A/S Polypeptides comprising at least two carbohydrate binding domains
WO2021074430A1 (en) 2019-10-18 2021-04-22 Basf Se Storage-stable hydrolase containing liquids
WO2021080948A2 (en) 2019-10-24 2021-04-29 Danisco Us Inc Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2021096857A1 (en) 2019-11-11 2021-05-20 Danisco Us Inc Compositions and methods for enhanced protein production in bacillus cells
WO2021105336A1 (en) 2019-11-29 2021-06-03 Basf Se Compositions comprising polymer and enzyme
EP3835396A1 (en) 2019-12-09 2021-06-16 The Procter & Gamble Company A detergent composition comprising a polymer
WO2021115912A1 (en) 2019-12-09 2021-06-17 Basf Se Formulations comprising a hydrophobically modified polyethyleneimine and one or more enzymes
WO2021122118A1 (en) 2019-12-20 2021-06-24 Henkel Ag & Co. Kgaa Cleaning compositions comprising dispersins vi
WO2021122120A2 (en) 2019-12-20 2021-06-24 Henkel Ag & Co. Kgaa Cleaning compositions comprising dispersins viii
WO2021123307A2 (en) 2019-12-20 2021-06-24 Novozymes A/S Polypeptides having proteolytic activity and use thereof
WO2021121394A1 (en) 2019-12-20 2021-06-24 Novozymes A/S Stabilized liquid boron-free enzyme compositions
WO2021122117A1 (en) 2019-12-20 2021-06-24 Henkel Ag & Co. Kgaa Cleaning composition coprising a dispersin and a carbohydrase
WO2021146411A1 (en) 2020-01-15 2021-07-22 Danisco Us Inc Compositions and methods for enhanced protein production in bacillus licheniformis
WO2021152120A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021151536A1 (en) 2020-01-29 2021-08-05 Unilever Ip Holdings B.V. Laundry detergent product
WO2021152123A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
US11104497B2 (en) 2014-10-03 2021-08-31 Monosol, Llc Degradable materials and packaging made from same
EP3872174A1 (en) 2015-05-13 2021-09-01 Danisco US Inc. Aprl-clade protease variants and uses thereof
EP3872175A1 (en) 2015-06-18 2021-09-01 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3878960A1 (en) 2014-07-04 2021-09-15 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3878957A1 (en) 2014-05-27 2021-09-15 Novozymes A/S Methods for producing lipases
EP3892708A1 (en) 2020-04-06 2021-10-13 Henkel AG & Co. KGaA Cleaning compositions comprising dispersin variants
WO2021204838A1 (en) 2020-04-08 2021-10-14 Novozymes A/S Carbohydrate binding module variants
WO2021214059A1 (en) 2020-04-21 2021-10-28 Novozymes A/S Cleaning compositions comprising polypeptides having fructan degrading activity
EP3907271A1 (en) 2020-05-07 2021-11-10 Novozymes A/S Cleaning composition, use and method of cleaning
WO2021239818A1 (en) 2020-05-26 2021-12-02 Novozymes A/S Subtilase variants and compositions comprising same
EP3929285A2 (en) 2015-07-01 2021-12-29 Novozymes A/S Methods of reducing odor
WO2021259099A1 (en) 2020-06-24 2021-12-30 Novozymes A/S Use of cellulases for removing dust mite from textile
EP3936593A1 (en) 2020-07-08 2022-01-12 Henkel AG & Co. KGaA Cleaning compositions and uses thereof
WO2022008732A1 (en) 2020-07-10 2022-01-13 Basf Se Enhancing the activity of antimicrobial preservatives
WO2022023250A1 (en) 2020-07-27 2022-02-03 Unilever Ip Holdings B.V. Use of an enzyme and surfactant for inhibiting microorganisms
EP3950939A2 (en) 2015-07-06 2022-02-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2022043547A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Protease variants with improved solubility
WO2022043321A2 (en) 2020-08-25 2022-03-03 Novozymes A/S Variants of a family 44 xyloglucanase
WO2022047149A1 (en) 2020-08-27 2022-03-03 Danisco Us Inc Enzymes and enzyme compositions for cleaning
WO2022058322A1 (en) 2020-09-15 2022-03-24 Novozymes A/S Animal feed comprising insects or insect meal
WO2022063698A1 (en) 2020-09-22 2022-03-31 Basf Se Liquid composition comprising peptide aldehyde
WO2022063699A1 (en) 2020-09-22 2022-03-31 Basf Se Improved combination of protease and protease inhibitor with secondary enzyme
WO2022074037A2 (en) 2020-10-07 2022-04-14 Novozymes A/S Alpha-amylase variants
WO2022084303A2 (en) 2020-10-20 2022-04-28 Novozymes A/S Use of polypeptides having dnase activity
WO2022090320A1 (en) 2020-10-28 2022-05-05 Novozymes A/S Use of lipoxygenase
WO2022090361A2 (en) 2020-10-29 2022-05-05 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2022093189A1 (en) 2020-10-27 2022-05-05 Milliken & Company Compositions comprising leuco compounds and colorants
WO2022103725A1 (en) 2020-11-13 2022-05-19 Novozymes A/S Detergent composition comprising a lipase
WO2022106404A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of proteases
WO2022106400A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of immunochemically different proteases
EP4006131A1 (en) 2020-11-30 2022-06-01 The Procter & Gamble Company Method of laundering fabric
EP4015629A1 (en) 2020-12-18 2022-06-22 Basf Se Polymer mixtures for increasing stability and performance of hydrolase-containing detergents
EP4032966A1 (en) 2021-01-22 2022-07-27 Novozymes A/S Liquid enzyme composition with sulfite scavenger
WO2022165107A1 (en) 2021-01-29 2022-08-04 Danisco Us Inc Compositions for cleaning and methods related thereto
WO2022162043A1 (en) 2021-01-28 2022-08-04 Novozymes A/S Lipase with low malodor generation
EP4039806A1 (en) 2021-02-04 2022-08-10 Henkel AG & Co. KGaA Detergent composition comprising xanthan lyase and endoglucanase variants with im-proved stability
WO2022171780A2 (en) 2021-02-12 2022-08-18 Novozymes A/S Alpha-amylase variants
WO2022171872A1 (en) 2021-02-12 2022-08-18 Novozymes A/S Stabilized biological detergents
EP4047088A1 (en) 2021-02-22 2022-08-24 Basf Se Amylase variants
WO2022178432A1 (en) 2021-02-22 2022-08-25 Danisco Us Inc. Methods and compositions for producing proteins of interest in pigment deficient bacillus cells
WO2022175435A1 (en) 2021-02-22 2022-08-25 Basf Se Amylase variants
US11441140B2 (en) 2015-12-07 2022-09-13 Henkel Ag & Co. Kgaa Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof
WO2022189521A1 (en) 2021-03-12 2022-09-15 Novozymes A/S Polypeptide variants
EP4060036A1 (en) 2021-03-15 2022-09-21 Novozymes A/S Polypeptide variants
WO2022197634A1 (en) 2021-03-15 2022-09-22 Gen-Probe Incorporated Compositions and methods for biological sample processing
WO2022194673A1 (en) 2021-03-15 2022-09-22 Novozymes A/S Dnase variants
WO2022199418A1 (en) 2021-03-26 2022-09-29 Novozymes A/S Detergent composition with reduced polymer content
EP4086330A1 (en) 2021-05-06 2022-11-09 The Procter & Gamble Company Surface treatment
WO2022268885A1 (en) 2021-06-23 2022-12-29 Novozymes A/S Alpha-amylase polypeptides
WO2023278297A1 (en) 2021-06-30 2023-01-05 Danisco Us Inc Variant lipases and uses thereof
EP4123006A1 (en) 2021-07-19 2023-01-25 The Procter & Gamble Company Composition comprising spores and pro-perfume materials
EP4123007A1 (en) 2021-07-19 2023-01-25 The Procter & Gamble Company Fabric treatment using bacterial spores
WO2023023644A1 (en) 2021-08-20 2023-02-23 Danisco Us Inc. Polynucleotides encoding novel nucleases, compositions thereof and methods thereof for eliminating dna from protein preparations
WO2023034486A2 (en) 2021-09-03 2023-03-09 Danisco Us Inc. Laundry compositions for cleaning
WO2023039270A2 (en) 2021-09-13 2023-03-16 Danisco Us Inc. Bioactive-containing granules
EP4163305A1 (en) 2013-12-16 2023-04-12 Nutrition & Biosciences USA 4, Inc. Use of poly alpha-1,3-glucan ethers as viscosity modifiers
WO2023114988A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2023114936A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114939A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023118015A1 (en) 2021-12-21 2023-06-29 Basf Se Environmental attributes for care composition ingredients
WO2023116569A1 (en) 2021-12-21 2023-06-29 Novozymes A/S Composition comprising a lipase and a booster
EP4206309A1 (en) 2021-12-30 2023-07-05 Novozymes A/S Protein particles with improved whiteness
EP4219702A2 (en) 2015-12-30 2023-08-02 Novozymes A/S Enzyme variants and polynucleotides encoding the same
EP4218992A2 (en) 2015-12-09 2023-08-02 Basf Se Method of purifying a protein from fermentation solids under desorbing conditions
EP4234664A1 (en) 2022-02-24 2023-08-30 Evonik Operations GmbH Composition comprising glucolipids and enzymes
WO2023165507A1 (en) 2022-03-02 2023-09-07 Novozymes A/S Use of xyloglucanase for improvement of sustainability of detergents
WO2023165950A1 (en) 2022-03-04 2023-09-07 Novozymes A/S Dnase variants and compositions
WO2023187044A1 (en) 2022-03-30 2023-10-05 Basf Se Process for the production of a surfactant
WO2023187051A1 (en) 2022-03-30 2023-10-05 Basf Se Process for the production of a tertiary amine surfactant
WO2023194204A1 (en) 2022-04-08 2023-10-12 Novozymes A/S Hexosaminidase variants and compositions
EP4279571A1 (en) 2022-05-19 2023-11-22 The Procter & Gamble Company Laundry composition comprising spores
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
WO2023233028A1 (en) 2022-06-03 2023-12-07 Unilever Ip Holdings B.V. Laundry detergent product
WO2023247348A1 (en) 2022-06-21 2023-12-28 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2023250301A1 (en) 2022-06-21 2023-12-28 Danisco Us Inc. Methods and compositions for cleaning comprising a polypeptide having thermolysin activity
WO2023247664A2 (en) 2022-06-24 2023-12-28 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2024012894A1 (en) 2022-07-15 2024-01-18 Basf Se Alkanolamine formates for enzyme stabilization in liquid formulations
EP4321604A1 (en) 2022-08-08 2024-02-14 The Procter & Gamble Company A fabric and home care composition comprising surfactant and a polyester
WO2024033136A1 (en) 2022-08-11 2024-02-15 Basf Se Amylase variants
WO2024033135A2 (en) 2022-08-11 2024-02-15 Basf Se Amylase variants

Families Citing this family (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6211134B1 (en) * 1996-05-14 2001-04-03 Genecor International, Inc. Mutant α-amylase
US7659102B2 (en) 2001-02-21 2010-02-09 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
CA2438205C (en) 2001-02-21 2015-11-03 Diversa Corporation Enzymes having alpha amylase activity and methods of use thereof
US20030134396A1 (en) * 2001-12-19 2003-07-17 Shetty Jayarama K. Process for hydrolyzing starch without pH adjustment
US7741092B2 (en) 2002-10-31 2010-06-22 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
MXPA05009353A (en) 2003-03-10 2005-11-04 Genencor Int Grain compositions containing pre-biotic isomalto-oligosaccharides and methods of making and using same.
MXPA05009553A (en) * 2003-03-10 2006-03-17 Broin And Associates Inc Method for producing ethanol using raw starch.
US20050233030A1 (en) 2004-03-10 2005-10-20 Broin And Associates, Inc. Methods and systems for producing ethanol using raw starch and fractionation
US20050239181A1 (en) * 2004-03-10 2005-10-27 Broin And Associates, Inc. Continuous process for producing ethanol using raw starch
WO2006017294A1 (en) * 2004-07-13 2006-02-16 Novozymes North America, Inc Liquefaction process
US20070037267A1 (en) * 2005-05-02 2007-02-15 Broin And Associates, Inc. Methods and systems for producing ethanol using raw starch and fractionation
US7919289B2 (en) 2005-10-10 2011-04-05 Poet Research, Inc. Methods and systems for producing ethanol using raw starch and selecting plant material
US7968318B2 (en) * 2006-06-06 2011-06-28 Genencor International, Inc. Process for conversion of granular starch to ethanol
US20080019956A1 (en) * 2006-07-24 2008-01-24 Manoj Kumar Enzymatic prevention and control of biofilm
US8541236B2 (en) * 2006-12-08 2013-09-24 University Of Washington Mutant apolipoprotein A-1 polypeptide with increased resistance to oxidation and reactive carbonyls
US20080299622A1 (en) * 2007-02-07 2008-12-04 Paulson Bradley A Starch Hydrolysis Using Phytase with an Alpha Amylase
WO2008112459A2 (en) 2007-03-09 2008-09-18 Danisco Us Inc., Genencor Division Alkaliphilic bacillus species a-amylase variants, compositions comprising a-amylase variants, and methods of use
US8399224B2 (en) 2007-03-14 2013-03-19 Danisco Us Inc. Production of ethanol from barley and DDGS containing reduced beta-glucan and phytic acid
EP2147116B1 (en) * 2007-04-20 2016-03-02 Sigma-Tau Rare Disease Ltd Stable recombinant adenosine deaminase
NZ585453A (en) * 2007-12-20 2011-12-22 Danisco Us Inc A composition comprising a perhydrolase enzyme an a removal enzyme mixture
BRPI0907709A2 (en) * 2008-02-06 2017-08-22 Danisco Us Inc PH ADJUSTMENT FREE SYSTEM FOR THE PRODUCTION OF FERMENTABLE SUGARS AND ALCOHOL
US20090217463A1 (en) * 2008-02-29 2009-09-03 Philip Frank Souter Detergent composition comprising lipase
US20090217464A1 (en) * 2008-02-29 2009-09-03 Philip Frank Souter Detergent composition comprising lipase
MX2010009652A (en) 2008-03-11 2010-09-30 Danisco Us Inc Glucoamylase and buttiauxiella phytase during saccharification.
US20090233830A1 (en) * 2008-03-14 2009-09-17 Penny Sue Dirr Automatic detergent dishwashing composition
US9090887B2 (en) * 2008-06-06 2015-07-28 Danisco Us Inc. Variant alpha-amylases from Bacillus subtilis and methods of use, thereof
US20100125046A1 (en) 2008-11-20 2010-05-20 Denome Frank William Cleaning products
US9068206B1 (en) 2009-03-03 2015-06-30 Poet Research, Inc. System for treatment of biomass to facilitate the production of ethanol
US8450094B1 (en) 2009-03-03 2013-05-28 Poet Research, Inc. System for management of yeast to facilitate the production of ethanol
EP2403954B1 (en) 2009-03-03 2015-04-22 POET Research, Inc. Method for fermentation of biomass for the production of ethanol
US20100233771A1 (en) * 2009-03-03 2010-09-16 Mcdonald William F System for pre-treatment of biomass for the production of ethanol
EP2380478A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Automatic dishwashing product
DK2566960T3 (en) 2010-05-06 2017-05-22 Procter & Gamble CONSUMER PRODUCTS WITH PROTEASE VARIETIES
MX2011008654A (en) 2010-08-24 2012-02-23 Corn Products Int Inc Production of isomaltooligosaccharides and uses therefor.
CN103068264A (en) 2010-08-24 2013-04-24 丹尼斯科美国公司 A food product comprising a low temperature rice protein concentrate
EP2761013A1 (en) 2011-09-29 2014-08-06 Danisco US Inc. Liquefaction and saccharification of granular starch at high concentration
WO2013148663A1 (en) 2012-03-28 2013-10-03 Danisco Us Inc. Low temperature method for making high glucose syrup
EP2831259A1 (en) 2012-03-28 2015-02-04 Danisco US Inc. Method for making high maltose syrup
US20150152457A1 (en) 2012-03-30 2015-06-04 Danisco Us Inc. Direct starch to fermentable sugar
US9315831B2 (en) 2012-03-30 2016-04-19 Danisco Us Inc. Direct starch to fermentable sugar as feedstock for the production of isoprene, isoprenoid precursor molecules, and/or isoprenoids
CA2893270C (en) 2012-12-11 2024-01-02 Danisco Us Inc. Trichoderma reesei host cells expressing a glucoamylase from aspergillus fumigatus and methods of use thereof
CN102965359B (en) * 2012-12-12 2014-07-09 江南大学 Acid-resistant amylase mutant, and preparation method and application thereof
CN103834606A (en) * 2014-01-16 2014-06-04 北京中科星冠生物技术有限责任公司 Engineering strain expressing acid-resistant high-temperature alpha-amylase gene mutants
EP3101102B2 (en) 2015-06-05 2023-12-13 The Procter & Gamble Company Compacted liquid laundry detergent composition
EP3101100B1 (en) 2015-06-05 2018-02-07 The Procter and Gamble Company Compacted liquid laundry detergent composition
EP3101107B1 (en) 2015-06-05 2019-04-24 The Procter and Gamble Company Compacted liquid laundry detergent composition
WO2017205337A1 (en) 2016-05-23 2017-11-30 Dupont Nutrition Biosciences Aps Baking process and a method thereof
US10550443B2 (en) 2016-12-02 2020-02-04 The Procter & Gamble Company Cleaning compositions including enzymes
CN112680433B (en) * 2019-10-18 2022-08-02 清华大学 Method for producing and secreting protein by using halophilic bacteria

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0410498A2 (en) * 1989-06-29 1991-01-30 Gist-Brocades N.V. Mutant microbial alpha-amylases with increased thermal, acid and/or alkaline stability
WO1991016423A1 (en) * 1990-04-19 1991-10-31 Novo Nordisk A/S Oxidation stable detergent enzymes
FR2676456A1 (en) * 1991-05-13 1992-11-20 Agronomique Inst Nat Rech Thermostable variants of Bacillus licheniformis alpha -amylase, process for preparing them and their use
WO1994002597A1 (en) * 1992-07-23 1994-02-03 Novo Nordisk A/S MUTANT α-AMYLASE, DETERGENT, DISH WASHING AGENT, AND LIQUEFACTION AGENT

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR676456A (en) * 1929-06-10 1930-02-24 Raw materials for obtaining plastics, coatings, binders, etc., and processes for the manufacture of these materials
US4284722A (en) 1978-08-16 1981-08-18 Cpc International Inc. Heat and acid-stable alpha-amylase enzymes and processes for producing the same
US4261868A (en) 1979-08-08 1981-04-14 Lever Brothers Company Stabilized enzymatic liquid detergent composition containing a polyalkanolamine and a boron compound
US4493893A (en) 1981-01-15 1985-01-15 Cpc International Inc. Process for cloning the gene coding for a thermostable alpha-amylase into Escherichia coli and Bacillus subtilis
IE81141B1 (en) 1983-06-24 2000-04-05 Genencor Int Procaryotic carbonyl hydrolases
US4760025A (en) 1984-05-29 1988-07-26 Genencor, Inc. Modified enzymes and methods for making same
GB8321923D0 (en) 1983-08-15 1983-09-14 Unilever Plc Machine-dishwashing compositions
US5346823A (en) * 1984-05-29 1994-09-13 Genencor, Inc. Subtilisin modifications to enhance oxidative stability
US4732973A (en) * 1984-06-14 1988-03-22 Chiron Corporation Active site modified protease α-1-antitrypsin inhibitors
US4634551A (en) 1985-06-03 1987-01-06 Procter & Gamble Company Bleaching compounds and compositions comprising fatty peroxyacids salts thereof and precursors therefor having amide moieties in the fatty chain
US4752585A (en) * 1985-12-17 1988-06-21 Cetus Corporation Oxidation-resistant muteins
US4863626A (en) * 1985-08-21 1989-09-05 The Clorox Company Encapsulated enzyme in dry bleach composition
EP0285123A3 (en) * 1987-04-03 1989-02-01 Stabra AG A method for complete mutagenesis of nucleic acids
US5118623A (en) * 1988-05-27 1992-06-02 Solvay Enzymes, Inc. Bleach stable enzymes
GB8900496D0 (en) 1989-01-10 1989-03-08 Procter & Gamble Liquid detergent composition containing enzyme and enzyme stabilization system
DE69028010T2 (en) 1989-06-29 1996-12-05 Gist Brocades Nv Mutated enzyme with reduced stability under industrial conditions
DK271490D0 (en) 1990-11-14 1990-11-14 Novo Nordisk As detergent composition
WO1992011286A1 (en) * 1990-12-21 1992-07-09 Allelix Biopharmaceuticals Inc. Oxidation resistant variants of parathyroid hormone
US5322778A (en) * 1991-10-31 1994-06-21 Genencor International, Inc. Liquefaction of granular starch slurries using an antioxidant with alpha amylase

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0410498A2 (en) * 1989-06-29 1991-01-30 Gist-Brocades N.V. Mutant microbial alpha-amylases with increased thermal, acid and/or alkaline stability
WO1991016423A1 (en) * 1990-04-19 1991-10-31 Novo Nordisk A/S Oxidation stable detergent enzymes
FR2676456A1 (en) * 1991-05-13 1992-11-20 Agronomique Inst Nat Rech Thermostable variants of Bacillus licheniformis alpha -amylase, process for preparing them and their use
WO1994002597A1 (en) * 1992-07-23 1994-02-03 Novo Nordisk A/S MUTANT α-AMYLASE, DETERGENT, DISH WASHING AGENT, AND LIQUEFACTION AGENT

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DAVID A ESTELL ET AL: "Engineering an Enzyme by Sitedirected Mutagenesis to Be Resistant to Chemical Oxidation", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 260, no. 11, June 1985 (1985-06-01) *
Dialog Information Services, File 34, SciSearch Dialog accession no.11267001, Bealinkelly F et al "Studies on the thermostability of the alpha-amylase of bacillus-caldovelox". Applied microbiology and biotechnology, 1991, V36, N3 (DEC), p 332-336 *
Dialog Information Services, File 34, SciSearch, Dialog accession no. 11331456, Brosnan MP et al, "Investigation of the mechanisms of irreversible thermoinactivation of bacillus-stearothermophilus alpha-amylase". European journal of biochemistry, 1992, V203, N1-2 (Jan 15), p 225-231 *
PHILIPPE JOYET ET AL: "Hyperthermostable variants of a highly thermostable alpha-amylase", BIOTECHNOLOGY, vol. 10, 1992, XP001318098 *

Cited By (941)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995010603A1 (en) * 1993-10-08 1995-04-20 Novo Nordisk A/S Amylase variants
US5753460A (en) * 1993-10-08 1998-05-19 Novo Nordisk A/S Amylase variants
US5801043A (en) * 1993-10-08 1998-09-01 Novo Nordisk A/S Amylase variants
EP2199386A1 (en) 1993-10-08 2010-06-23 Novozymes A/S Amylase variants
US5928381A (en) * 1994-02-02 1999-07-27 Novo Nordisk A/S Use of an α-amylase modified to improve oxidation stability in a combined desizing and bleaching process
WO1995021247A1 (en) * 1994-02-02 1995-08-10 Novo Nordisk A/S The use of an alpha-amylase modified to improve oxidation stability in a combined desizing and bleaching process
US5904161A (en) * 1994-05-25 1999-05-18 The Procter & Gamble Company Cleaning compositions containing bleach and stability-enhanced enzymes
WO1995035382A3 (en) * 1994-06-17 1996-02-01 Gist Brocades Bv NOVEL AMYLOLYTIC ENZYMES DERIVED FROM THE B. LICHENIFORMIS α-AMYLASE, HAVING IMPROVED CHARACTERISTICS
US6939703B2 (en) * 1994-06-17 2005-09-06 Genencor International, Inc. Amylolytic enzymes derived from the B.licheniformis α-amylase, having improved characteristics
AU685638B2 (en) * 1994-06-17 1998-01-22 Genencor International, Inc. Novel amylolytic enzymes derived from the b. licheniformis alpha-amylase, having improved characteristics
WO1995035382A2 (en) * 1994-06-17 1995-12-28 Genecor International Inc. NOVEL AMYLOLYTIC ENZYMES DERIVED FROM THE B. LICHENIFORMIS α-AMYLASE, HAVING IMPROVED CHARACTERISTICS
WO1996005295A3 (en) * 1994-08-11 1996-03-28 Genencor Int An improved cleaning composition
WO1996005295A2 (en) * 1994-08-11 1996-02-22 Genencor International, Inc. An improved cleaning composition
US5830837A (en) * 1994-11-22 1998-11-03 Novo Nordisk A/S Amylase variants
US8323946B2 (en) 1995-02-03 2012-12-04 Novozymes A/S Alpha-amylase mutants
US6297038B1 (en) 1995-02-03 2001-10-02 Novozymes A/S Amylase variants
EP2199378A1 (en) * 1995-02-03 2010-06-23 Novozymes A/S A method of designing alpha-amylase mutants with predetermined properties
EP2455468A2 (en) 1995-02-03 2012-05-23 Novozymes A/S Amylase variants
EP2455465A2 (en) 1995-02-03 2012-05-23 Novozymes A/S Amylase Variants
WO1996023873A1 (en) * 1995-02-03 1996-08-08 Novo Nordisk A/S Amylase variants
US6867031B2 (en) 1995-02-03 2005-03-15 Novozymes A/S Amylase variants
EP2465930A2 (en) 1995-02-03 2012-06-20 Novozymes A/S Amylase variants
CN101117629B (en) * 1995-02-03 2014-06-11 诺维信公司 Amylase variants
US7115409B1 (en) 1995-02-03 2006-10-03 Novozymes A/S α-amylase mutants
US6440716B1 (en) 1995-02-03 2002-08-27 Novozymes A/S α-amylase mutants
EP2455465A3 (en) * 1995-02-03 2012-08-22 Novozymes A/S Amylase Variants
CN100419076C (en) * 1995-02-03 2008-09-17 诺沃奇梅兹有限公司 Method for disigning alpha-amylase mutants with predetermined properties
EP1752525A1 (en) * 1995-02-03 2007-02-14 Novozymes A/S Amylase variants
JP2008178412A (en) * 1995-02-03 2008-08-07 Novozyme As Amylase variant
US6022724A (en) * 1995-02-03 2000-02-08 Novo Nordisk A/S α-amylase mutants
EP2455468A3 (en) * 1995-02-03 2013-01-23 Novozymes A/S Amylase variants
US7378264B2 (en) 1995-02-03 2008-05-27 Novozymes A/S α-amylase mutants
US7993897B2 (en) 1995-02-03 2011-08-09 Novozymes As α-amylase mutants
WO1996023874A1 (en) * 1995-02-03 1996-08-08 Novo Nordisk A/S A method of designing alpha-amylase mutants with predetermined properties
WO1996030481A1 (en) * 1995-03-24 1996-10-03 Genencor International, Inc. An improved laundry detergent composition comprising amylase
AU718509B2 (en) * 1995-03-24 2000-04-13 Genencor International, Inc. An improved laundry detergent composition comprising amylase
US5922083A (en) * 1995-04-03 1999-07-13 Procter & Gamble Company Detergent composition comprising a mutant amylase enzyme and oxygen bleaching agent
EP0736597A1 (en) * 1995-04-03 1996-10-09 The Procter & Gamble Company Soaker compositions
WO1996031583A1 (en) * 1995-04-03 1996-10-10 The Procter & Gamble Company Detergent composition comprising a mutant amylase enzyme and oxygen bleaching agent
WO1996039528A3 (en) * 1995-06-06 1997-02-13 Genencor Int MUTANT α-AMYLASE
WO1996039528A2 (en) * 1995-06-06 1996-12-12 Genencor International, Inc. MUTANT α-AMYLASE
US5736499A (en) * 1995-06-06 1998-04-07 Genencor International, Inc. Mutant A-amylase
EP0756000A1 (en) * 1995-07-24 1997-01-29 The Procter & Gamble Company Detergent compositions comprising specific amylase and linear alkyl benzene sulfonate surfactant
EP0755999A1 (en) * 1995-07-24 1997-01-29 The Procter & Gamble Company Detergent compositions comprising a specific amylase and a protease
EP0756001A1 (en) * 1995-07-24 1997-01-29 The Procter & Gamble Company Detergent compositions comprising specific amylase and a specific surfactant system
WO1997004066A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Detergent compositions comprising specific amylase and a specific surfactant system
WO1997004054A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Detergent compositions comprising a specific amylase and a protease
US6147045A (en) * 1995-07-24 2000-11-14 The Procter & Gamble Co. Detergent compositions comprising specific amylase and a specific surfactant system
WO1997004053A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Detergent compositions comprising specific amylase and linear alkyl benzene sulfonate surfactant
WO1997004067A1 (en) * 1995-07-24 1997-02-06 The Procter & Gamble Company Dingy fabric clean-up with amylase enzyme in detergent compositions
US6093562A (en) * 1996-02-05 2000-07-25 Novo Nordisk A/S Amylase variants
US6153576A (en) * 1996-02-16 2000-11-28 Henkel Kommanditgesellschaft Auf Aktien Transition-metal complexes used as activators for peroxy compounds
WO1997032961A2 (en) * 1996-03-07 1997-09-12 The Procter & Gamble Company Detergent compositions comprising improved amylases
WO1997032961A3 (en) * 1996-03-07 1997-10-30 Procter & Gamble Detergent compositions comprising improved amylases
EP0798371A1 (en) * 1996-03-29 1997-10-01 The Procter & Gamble Company Detergent compositions comprising specific amylase and alkyl poly glucoside surfactants
WO1997036977A1 (en) * 1996-03-29 1997-10-09 The Procter & Gamble Company Detergent compositions comprising specific amylase and alkyl poly glucoside surfactants
US6046149A (en) * 1996-04-17 2000-04-04 Procter & Gamble Company Detergent compositions
WO1997041213A1 (en) 1996-04-30 1997-11-06 Novo Nordisk A/S α-AMYLASE MUTANTS
WO1997042282A1 (en) 1996-05-03 1997-11-13 The Procter & Gamble Company Detergent compositions comprising polyamine polymers with improved soil dispersancy
US5763385A (en) * 1996-05-14 1998-06-09 Genencor International, Inc. Modified α-amylases having altered calcium binding properties
US6197070B1 (en) 1996-05-15 2001-03-06 The Procter & Gamble Company Detergent compositions comprising alpha combination of α-amylases for malodor stripping
US5958739A (en) * 1996-06-06 1999-09-28 Genencor International Inc. Mutant α-amylase
US6140293A (en) * 1996-06-19 2000-10-31 The Procter & Gamble Company Detergent compositions comprising a specific amylase and a protease
WO1998005748A1 (en) * 1996-08-01 1998-02-12 The Procter & Gamble Company Detergent compositions comprising improved amylase for dingy fabric clean-up
US6225274B1 (en) 1996-11-29 2001-05-01 Henkel Kommandigesellschaft Auf Aktien Acetonitrile derivatives as bleaching activators in detergents
US6221825B1 (en) 1996-12-31 2001-04-24 The Procter & Gamble Company Thickened, highly aqueous liquid detergent compositions
US6194370B1 (en) 1996-12-31 2001-02-27 The Procter & Gamble Company Cost effective stain and soil removal aqueous heavy duty liquid laundry detergent compositions
WO1998030669A1 (en) * 1997-01-08 1998-07-16 Henkel Kommanditgesellschaft Auf Aktien Protease and amylase-containing detergent
US6486113B1 (en) 1997-03-31 2002-11-26 Kao Corporation Mutant α-amylases
US6703357B1 (en) 1997-07-30 2004-03-09 Henkel Kommanditgesellschaft Auf Aktien Cleaning agent for hard surfaces, containing glucanase
US6541233B1 (en) 1997-07-30 2003-04-01 Henkel Kommanditgesellschaft Auf Aktien β-glucanase from a bacillus
US6417152B1 (en) 1997-07-30 2002-07-09 Henkel Kommanditgesellshaft Auf Aktien Detergent containing glucanase
US6080568A (en) * 1997-08-19 2000-06-27 Genencor International, Inc. Mutant α-amylase comprising modification at residues corresponding to A210, H405 and/or T412 in Bacillus licheniformis
EP2302027A2 (en) 1997-10-13 2011-03-30 Novozymes A/S Alpha-amylase mutants
EP2386568A1 (en) 1997-10-30 2011-11-16 Novozymes A/S Alpha-amylase mutants
EP2386569A1 (en) 1997-10-30 2011-11-16 Novozymes A/S Alpha-amylase mutants
EP2388267A1 (en) 1997-10-30 2011-11-23 Novozymes A/S Alpha-amylase mutants
US6462006B1 (en) * 1998-04-30 2002-10-08 Henkel Kommanditgesellschaft Auf Aktien Solid machine dishwashing detergent with phosphate and crystalline lamellar silicates
WO1999063038A1 (en) * 1998-06-03 1999-12-09 Henkel Kommanditgesellschaft Auf Aktien Detergents containing amylase and acetonitrile
US6380147B1 (en) 1998-06-03 2002-04-30 Henkel Kommanditgesellschaft Auf Aktien Detergents containing amylase and protease
EP2261359A1 (en) 1998-06-10 2010-12-15 Novozymes A/S Mannanases
EP2284272A1 (en) 1998-06-10 2011-02-16 Novozymes A/S Mannanases
EP2287318A1 (en) 1998-06-10 2011-02-23 Novozymes A/S Mannanases
US6841614B1 (en) 1998-10-29 2005-01-11 Henkel Kommanditgesellschaft Auf Aktien Polymer granules produced by fluidized bed granulation
EP1803817A1 (en) 1998-12-18 2007-07-04 Novozymes A/S Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region
US6221824B1 (en) 1999-02-25 2001-04-24 Henkel Kommanditgesellschaft Auf Aktien Process for the production of compounded acetonitrile derivatives
EP1818396A3 (en) * 1999-03-30 2007-12-19 Novozymes A/S Alpha-Amylase variants
US9464279B2 (en) 1999-03-30 2016-10-11 Novozymes A/S Alpha-amylase variants
US10113157B2 (en) 1999-03-30 2018-10-30 Novozymes A/S Alpha-amylase variants
US8124395B2 (en) 1999-03-30 2012-02-28 Novozymes A/S Alpha-amylase variants
WO2000060059A3 (en) * 1999-03-30 2001-05-10 Novo Nordisk As Alpha-amylase variants
US7867746B2 (en) 1999-03-30 2011-01-11 Novozymes A/S Alpha-amylase variants
US7306936B2 (en) 1999-03-30 2007-12-11 Novozymes A/S Alpha-amylase variants
WO2000060059A2 (en) * 1999-03-30 2000-10-12 NovozymesA/S Alpha-amylase variants
EP1818396A2 (en) 1999-03-30 2007-08-15 Novozymes A/S Alpha-Amylase variants
US8420370B2 (en) 1999-03-30 2013-04-16 Novozymes A/S Alpha-amylase variants
US6410295B1 (en) 1999-03-30 2002-06-25 Novozymes A/S Alpha-amylase variants
EP2290060A1 (en) 1999-03-30 2011-03-02 Novozymes A/S Alpha-amylase variants
US8859255B2 (en) 1999-03-30 2014-10-14 Novozymes A/S Alpha-amylase variants
EP2889375A1 (en) 1999-03-31 2015-07-01 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
WO2000060058A2 (en) 1999-03-31 2000-10-12 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
EP2011864A1 (en) 1999-03-31 2009-01-07 Novozymes A/S Polypeptides having alkaline alpha-amylase activity and nucleic acids encoding same
WO2000071687A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 129 and 130
WO2000071689A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 127 and 128
WO2000071685A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 132 and 133
WO2000071688A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 126 and 127
WO2000071690A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 128 and 129
WO2000071691A1 (en) 1999-05-20 2000-11-30 Novozymes A/S Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 125 and 126
EP1067181A1 (en) * 1999-06-10 2001-01-10 Rijksuniversiteit te Groningen Enzyme selection
WO2000077193A1 (en) * 1999-06-10 2000-12-21 Rijksuniversiteit Groningen Enzyme selection
EP2336331A1 (en) 1999-08-31 2011-06-22 Novozymes A/S Novel proteases and variants thereof
WO2001023274A1 (en) 1999-09-30 2001-04-05 The Procter & Gamble Company Detergent package with means to mask amine malodours
WO2001029166A1 (en) * 1999-10-15 2001-04-26 The Procter & Gamble Company Enzymatic liquid cleaning composition
WO2001047956A2 (en) * 1999-12-23 2001-07-05 Genencor International, Inc. Method for obtaining proteins having improved functional characteristics
WO2001047956A3 (en) * 1999-12-23 2002-02-14 Genencor Int Method for obtaining proteins having improved functional characteristics
EP2184350A2 (en) 1999-12-23 2010-05-12 Genencor International, Inc. Method for obtaining cellulases having improved thermostability
EP2302048A1 (en) 2000-03-08 2011-03-30 Novozymes A/S Variants with altered properties
EP2298875A2 (en) 2000-03-08 2011-03-23 Novozymes A/S Variants with altered properties
EP3594334A2 (en) 2000-03-08 2020-01-15 Novozymes A/S Variants with altered properties
EP2221365A1 (en) 2000-03-08 2010-08-25 Novozymes A/S Variants with altered properties
WO2001066712A2 (en) 2000-03-08 2001-09-13 Novozymes A/S Variants with altered properties
WO2001096537A3 (en) * 2000-06-14 2002-06-13 Novozymes As Pre-oxidized alpha-amylase
WO2001096537A2 (en) * 2000-06-14 2001-12-20 Novozymes A/S Pre-oxidized alpha-amylase
US7803604B2 (en) 2000-07-28 2010-09-28 Henkel Ag & Co. Kgaa Amylolytic enzyme extracted from Bacillus sp. A 7-7 (DSM 12368) and washing and cleaning agents containing this novel amylolytic enzyme
EP2298903A2 (en) 2000-08-01 2011-03-23 Novozymes A/S Alpha-amylase mutants with altered properties
EP2308980A2 (en) 2000-08-01 2011-04-13 Novozymes A/S Alpha-amylase mutants with altered properties
EP2308979A2 (en) 2000-08-01 2011-04-13 Novozymes A/S Alpha-amylase mutants with altered properties
US7713723B1 (en) 2000-08-01 2010-05-11 Novozymes A/S Alpha-amylase mutants with altered properties
EP2204446A1 (en) 2000-08-01 2010-07-07 Novozymes A/S Alpha-amylase mutants with altered properties
WO2002016547A2 (en) 2000-08-21 2002-02-28 Novozymes A/S Subtilase enzymes
EP2333055A1 (en) 2000-10-13 2011-06-15 Novozymes A/S Subtilase variants
EP1975229A2 (en) 2000-10-13 2008-10-01 Novozymes A/S Alpha-amylase variant with altered properties
EP2360247A1 (en) 2000-10-13 2011-08-24 Novozymes A/S Subtilase variants
US6649085B2 (en) 2000-11-25 2003-11-18 Clariant Gmbh Cyclic sugar ketones as catalysts for peroxygen compounds
US7888104B2 (en) 2000-11-28 2011-02-15 Henkel Ag & Co. Kgaa Cyclodextrin glucanotransferase (CGTase), obtained from<I>Bacillus agaradherens<λ>(DSM 9948) and detergents and cleaning agents containing said novel cyclodextrin glucanotransferase
US6746996B2 (en) 2001-01-19 2004-06-08 Clariant Gmbh Use of transition metal complexes having oxime ligands as bleach catalysts
EP3000881A2 (en) 2001-05-15 2016-03-30 Novozymes A/S Alpha-amylase variant with altered properties
US8486681B2 (en) 2001-05-15 2013-07-16 Novozymes A/S Alpha-amylase variant with altered properties
US8252573B2 (en) 2001-05-15 2012-08-28 Novozymes A/S Alpha-amylase variant with altered properties
US8617837B2 (en) 2001-05-15 2013-12-31 Novozymes A/S Method of hydrolyzing soluble starch with an alpha-amylase variant
US9080137B2 (en) 2001-05-15 2015-07-14 Novozymes A/S Alpha-amylase variant with altered properties
EP2264160A2 (en) 2001-05-15 2010-12-22 Novozymes A/S Alpha-amylase variant with altered properties
EP2159279A2 (en) 2001-05-15 2010-03-03 Novozymes A/S Alpha-amylase variant with altered properties
US9796968B2 (en) 2001-05-15 2017-10-24 Novozymes A/S Alpha-amylase variant with altered properties
WO2002092797A2 (en) 2001-05-15 2002-11-21 Novozymes A/S Alpha-amylase variant with altered properties
US9670471B2 (en) 2001-05-15 2017-06-06 Novozymes A/S Alpha-amylase variant with altered properties
US10612012B2 (en) 2001-05-15 2020-04-07 Novozymes A/S Alpha-amylase variant with altered properties
WO2003000941A2 (en) 2001-06-26 2003-01-03 Novozymes A/S Polypeptides having cellobiohydrolase i activity and polynucleotides encoding same
EP2277997A2 (en) 2001-06-26 2011-01-26 Novozymes A/S Polypeptides having cellobiohydrolase I activity and polynucleotides encoding same
EP2295544A2 (en) 2001-06-26 2011-03-16 Novozymes A/S Polypeptides having cellobiohydrolase I activity and polynucleotides encoding same
EP2298868A2 (en) 2001-06-26 2011-03-23 Novozymes A/S Polypeptides having cellobiohydrolase I activity and polynucleotides encoding same
WO2003006602A2 (en) 2001-07-12 2003-01-23 Novozymes A/S Subtilase variants
US7153820B2 (en) 2001-08-13 2006-12-26 Ecolab Inc. Solid detergent composition and method for solidifying a detergent composition
US7300782B2 (en) 2001-12-21 2007-11-27 B.R.A.I.N. Biotechnology Research And Information Network Ag Glycosyl hydrolases
WO2003080827A2 (en) 2002-03-27 2003-10-02 Novozymes A/S Granules with filamentous coatings
WO2004003187A2 (en) 2002-07-01 2004-01-08 Novozymes A/S Mpg added to fermentation
EP2302046A1 (en) 2002-10-01 2011-03-30 Novozymes A/S Family GH 61 polypeptides
EP2399992A2 (en) 2002-11-06 2011-12-28 Novozymes A/S Subtilase Variants
EP2138574A2 (en) 2002-11-06 2009-12-30 Novozymes A/S Subtilase variants
EP2284258A2 (en) 2002-11-06 2011-02-16 Novozymes A/S Subtilase variants
EP2128247A1 (en) 2002-12-20 2009-12-02 Novozymes A/S Polypeptides having cellobiohydrolase II activity and polynucleotides encoding same
WO2004067739A2 (en) 2003-01-27 2004-08-12 Novozymes A/S Stabilization of granules
EP1923455A2 (en) 2003-02-18 2008-05-21 Novozymes A/S Detergent compositions
EP2500423A3 (en) * 2003-02-26 2012-12-12 Genencor International, Inc. Amylases producing an altered immunogenic response and methods of making and using the same
EP1597363A4 (en) * 2003-02-26 2007-01-03 Genencor Int Amylases producing an altered immunogenic response and methods of making and using the same
EP1597363A1 (en) * 2003-02-26 2005-11-23 Genencor International, Inc. Amylases producing an altered immunogenic response and methods of making and using the same
EP1826261A2 (en) 2003-02-28 2007-08-29 The Procter & Gamble Company Foam-generating kit containing a foam-generating dispenser and a composition containing a high level of surfactant
EP2228440A1 (en) 2003-05-02 2010-09-15 Novozymes Inc. Variants of beta-glucosidases
WO2005001064A2 (en) 2003-06-25 2005-01-06 Novozymes A/S Polypeptides having alpha-amylase activity and polypeptides encoding same
EP2987857A1 (en) 2003-08-25 2016-02-24 Novozymes, Inc. Variants of glycoside hydrolases
EP2308966A1 (en) 2003-10-10 2011-04-13 Novozymes A/S Protease variants
EP2284259A2 (en) 2003-10-10 2011-02-16 Novozymes A/S Protease variants
WO2005040372A1 (en) 2003-10-23 2005-05-06 Novozymes A/S Protease with improved stability in detergents
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
EP2088186A1 (en) 2003-12-13 2009-08-12 Henkel AG & Co. KGaA Multi-component thin-to-thick system
US7737103B2 (en) 2003-12-13 2010-06-15 Henkel Ag & Co. Kgaa Multicomponent thin-to-thick system
WO2005066339A2 (en) 2004-01-06 2005-07-21 Novozymes A/S Polypeptides of alicyclobacillus sp.
EP2301958A1 (en) 2004-01-30 2011-03-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305702A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2305703A1 (en) 2004-01-30 2011-04-06 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2314605A1 (en) 2004-01-30 2011-04-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2308890A1 (en) 2004-01-30 2011-04-13 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2325318A1 (en) 2004-02-13 2011-05-25 Novozymes A/S Protease variants
EP2305821A2 (en) 2004-02-13 2011-04-06 Novozymes A/S Protease variants
EP2267001A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
EP2267002A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
EP2267000A2 (en) 2004-05-04 2010-12-29 Novozymes Adenium Biotech A/S Antimicrobial polypeptides
WO2005123911A2 (en) 2004-06-21 2005-12-29 Novozymes A/S Proteases
EP2258839A1 (en) 2004-06-21 2010-12-08 Novozymes A/S Nocardiopsis proteases
EP2258838A1 (en) 2004-06-21 2010-12-08 Novozymes A/S Nocardiopsis proteases
WO2006002643A2 (en) 2004-07-05 2006-01-12 Novozymes A/S Alpha-amylase variants with altered properties
EP3620523A2 (en) 2004-07-05 2020-03-11 Novozymes A/S Alpha-amylase variants with altered properties
EP4269684A2 (en) 2004-07-05 2023-11-01 Novozymes A/S Alpha-amylase variants with altered properties
WO2006032278A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
EP2261329A2 (en) 2004-09-21 2010-12-15 Novozymes A/S Subtilases
WO2006032279A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
WO2006032277A1 (en) 2004-09-21 2006-03-30 Novozymes A/S Subtilases
EP2302042A2 (en) 2004-09-30 2011-03-30 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP2295555A2 (en) 2004-09-30 2011-03-16 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encodig same
WO2006039541A2 (en) 2004-09-30 2006-04-13 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2298872A2 (en) 2004-09-30 2011-03-23 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
DE102004047776B4 (en) 2004-10-01 2018-05-09 Basf Se Stabilized against di- and / or multimerization alpha-amylase variants, processes for their preparation and their use
US9353361B2 (en) 2004-10-01 2016-05-31 Basf Se Alpha-amylase variants stabilized against dimerization and/or multimerization, method for the production thereof, and detergents and cleansers containing these alpha-amylase variants
US8080401B2 (en) 2004-10-01 2011-12-20 Henkel Ag & Co. Kgaa Alpha-amylase variants having an elevated solvent stability, method for the production thereof and detergents and cleansers containing these alpha-amylase variants
US8785365B2 (en) 2004-10-01 2014-07-22 Basf Se Alpha-amylase variants stabilized against dimerization and/or multimerization, method for the production thereof, and detergents and cleansers containing these alpha-amylase variants
DE102004047777B4 (en) 2004-10-01 2018-05-09 Basf Se Alpha-amylase variants with increased solvent stability, process for their preparation and their use
EP1700907A1 (en) 2005-03-11 2006-09-13 Unilever N.V. Liquid bleaching composition
EP1700904A1 (en) 2005-03-11 2006-09-13 Unilever N.V. Liquid detergent composition
WO2006116682A2 (en) 2005-04-27 2006-11-02 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2007006305A1 (en) 2005-07-08 2007-01-18 Novozymes A/S Subtilase variants
EP2385112A2 (en) 2005-07-08 2011-11-09 Novozymes A/S Subtilase variants
EP2385111A2 (en) 2005-07-08 2011-11-09 Novozymes A/S Subtilase variants
EP2290061A2 (en) 2005-07-08 2011-03-02 Novozymes A/S Subtilase variants
EP1967584A1 (en) 2005-08-16 2008-09-10 Novozymes A/S Polypeptides of strain bacillus SP. P203
WO2007019858A2 (en) 2005-08-16 2007-02-22 Novozymes A/S Subtilases
EP2360246A1 (en) 2005-08-16 2011-08-24 Novozymes A/S Polypeptides of strain bacillus SP. P203
EP2385110A2 (en) 2005-09-30 2011-11-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2007036235A1 (en) 2005-09-30 2007-04-05 Novozymes A/S Immobilization of enzymes
WO2007098756A1 (en) 2006-03-02 2007-09-07 Novozymes A/S High capacity encapsulation process
WO2007107573A1 (en) 2006-03-22 2007-09-27 Novozymes A/S Use of polypeptides having antimicrobial activity
WO2007113241A1 (en) 2006-03-31 2007-10-11 Novozymes A/S A stabilized liquid enzyme composition
EP2383330A1 (en) 2006-03-31 2011-11-02 Novozymes A/S A stabilized liquid enzyme composition
WO2008057637A2 (en) 2006-07-21 2008-05-15 Novozymes, Inc. Methods of increasing secretion of polypeptides having biological activity
WO2008021761A2 (en) 2006-08-11 2008-02-21 Novozymes Biologicals, Inc. Bacteria cultures and compositions comprising bacteria cultures
WO2008040818A1 (en) 2006-10-06 2008-04-10 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
EP2272943A1 (en) 2006-10-06 2011-01-12 Novozymes A/S Detergent compositions and the use of enzyme combinations therein
EP2617804A1 (en) 2007-02-15 2013-07-24 Ecolab Inc. Fast dissolving solid detergent
US9267097B2 (en) 2007-02-15 2016-02-23 Ecolab Usa Inc. Fast dissolving solid detergent
US10577565B2 (en) 2007-02-15 2020-03-03 Ecolab Usa Inc. Fast dissolving solid detergent
EP3339412A1 (en) 2007-02-15 2018-06-27 Ecolab Usa Inc. Fast dissolving solid detergent
US11261406B2 (en) 2007-02-15 2022-03-01 Ecolab Usa Inc. Fast dissolving solid detergent
US10005986B2 (en) 2007-02-15 2018-06-26 Ecolab Usa Inc. Fast dissolving solid detergent
US8809031B2 (en) 2007-03-23 2014-08-19 Danisco Us Inc. Enhanced amylase production by N-terminal addition to mature amylase protein
WO2008118749A2 (en) 2007-03-23 2008-10-02 Novozymes Biologicals, Inc. Preventing and reducing biofilm formation and planktonic proliferation
EP2500325A1 (en) 2007-03-23 2012-09-19 Novozymes Biologicals, Inc. Preventing and Reducing Biofilm Formation and Planktonic Proliferation
CN101668855B (en) * 2007-03-23 2013-07-03 丹尼斯科美国公司 Enhanced amylase production by n-terminal addition to mature amylase protein
WO2008118377A3 (en) * 2007-03-23 2009-03-19 Danisco Us Inc Genencor Div Enhanced amylase production by n-terminal addition to mature amylase protein
WO2008118377A2 (en) * 2007-03-23 2008-10-02 Danisco Us, Inc., Genencor Division Enhanced amylase production by n-terminal addition to mature amylase protein
EP2484764A1 (en) * 2007-03-23 2012-08-08 Danisco US, Inc., Genencor Division Enhanced amylase production by N-terminal addition to mature amylase protein
EP2468852A1 (en) 2007-03-30 2012-06-27 Novozymes A/S Fungal peroxygenases and methods of application
EP2471911A2 (en) 2007-03-30 2012-07-04 Novozymes A/S Fungal peroxygenases and methods of application
EP3438235A1 (en) 2007-10-18 2019-02-06 Ecolab USA Inc. Pressed, waxy, solid cleaning compositions and methods of making them
EP2677023A2 (en) 2007-10-18 2013-12-25 Ecolab Inc. Pressed, waxy, solid cleaning compositions and methods of making them
WO2009050684A2 (en) 2007-10-18 2009-04-23 Ecolab Inc. Pressed, waxy, solid cleaning compositions and methods of making them
US7879788B2 (en) 2007-10-30 2011-02-01 Danisco Us Inc. Methods of cleaning using a streptomyces 1AG3 serine protease
US7618801B2 (en) 2007-10-30 2009-11-17 Danison US Inc. Streptomyces protease
EP2215202B1 (en) 2007-11-05 2017-09-06 Danisco US Inc. VARIANTS OF BACILLUS sp. TS-23 ALPHA-AMYLASE WITH ALTERED PROPERTIES
US8206966B2 (en) 2007-11-05 2012-06-26 Danisco Us Inc. Alpha-amylase variants with altered properties
US8153412B2 (en) 2007-11-05 2012-04-10 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
DE102007053615A1 (en) 2007-11-08 2009-05-14 Henkel Ag & Co. Kgaa Improvement of the fragrance effect of fragrance esters
US8460916B2 (en) 2008-02-04 2013-06-11 Danisco Us Inc. TS-23 alpha-amylase variants with altered properties
US8962283B2 (en) 2008-02-04 2015-02-24 Danisco Us Inc. TS-23 alpha-amylase variants with altered properties
US8507244B2 (en) 2008-02-04 2013-08-13 Danisco Us Inc. Variants of bacillus sp. TS-23 alpha-amylase with altered properties
US8236545B2 (en) 2008-02-04 2012-08-07 Danisco Us Inc., Genencor Division TS23 alpha-amylase variants with altered properties
EP2345599A1 (en) 2008-02-08 2011-07-20 The Procter & Gamble Company Water-soluble pouch
US8066818B2 (en) 2008-02-08 2011-11-29 The Procter & Gamble Company Water-soluble pouch
EP3067410A2 (en) 2008-02-15 2016-09-14 The Procter and Gamble Company Cleaning compositions
EP2660309B1 (en) 2008-03-14 2017-03-22 The Procter & Gamble Company Automatic dishwashing detergent composition
EP2660308B1 (en) 2008-03-14 2017-04-05 The Procter & Gamble Company Automatic dishwashing detergent composition
EP2447361A2 (en) 2008-06-06 2012-05-02 Danisco US Inc. Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties
EP2623591A2 (en) 2008-06-06 2013-08-07 Danisco US Inc. Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties
US8084240B2 (en) 2008-06-06 2011-12-27 Danisco Us Inc. Geobacillus stearothermophilus α-amylase (AmyS) variants with improved properties
EP2149786A1 (en) 2008-08-01 2010-02-03 Unilever PLC Improvements relating to detergent analysis
DE212009000119U1 (en) 2008-09-12 2011-12-30 Unilever N.V. Dispenser and pretreatment agent for viscous liquids
EP2166073A1 (en) 2008-09-23 2010-03-24 The Procter & Gamble Company Cleaning composition
EP2166075A1 (en) 2008-09-23 2010-03-24 The Procter and Gamble Company Cleaning composition
EP2166076A1 (en) 2008-09-23 2010-03-24 The Procter & Gamble Company Cleaning composition
US8507243B2 (en) 2008-09-25 2013-08-13 Danisco Us Inc. Alpha-amylase blends and methods for using said blends
EP2857515A2 (en) 2008-11-20 2015-04-08 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010068650A1 (en) 2008-12-12 2010-06-17 Novozymes, Inc. Polypeptides having lipase activity and polynucleotides encoding same
EP2202290A1 (en) 2008-12-23 2010-06-30 Unilever PLC A flowable laundry composition and packaging therefor
EP2213723A1 (en) 2009-01-30 2010-08-04 Novozymes A/S Isomaltose for fungus fermentation
WO2010090915A1 (en) 2009-02-09 2010-08-12 The Procter & Gamble Company Detergent composition
EP3998328A1 (en) 2009-02-09 2022-05-18 The Procter & Gamble Company Detergent composition
EP2216393A1 (en) 2009-02-09 2010-08-11 The Procter & Gamble Company Detergent composition
WO2010097436A1 (en) 2009-02-27 2010-09-02 Novozymes A/S Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production
WO2010115021A2 (en) 2009-04-01 2010-10-07 Danisco Us Inc. Compositions and methods comprising alpha-amylase variants with altered properties
EP2902487A2 (en) 2009-04-01 2015-08-05 Danisco US Inc. Compositions and methods comprising alpha-amylase variants with altered properties
WO2010115028A2 (en) 2009-04-01 2010-10-07 Danisco Us Inc. Cleaning system comprising an alpha-amylase and a protease
US8852912B2 (en) 2009-04-01 2014-10-07 Danisco Us Inc. Compositions and methods comprising alpha-amylase variants with altered properties
WO2011005913A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company A catalytic laundry detergent composition comprising relatively low levels of water-soluble electrolyte
WO2011005730A1 (en) 2009-07-09 2011-01-13 The Procter & Gamble Company A catalytic laundry detergent composition comprising relatively low levels of water-soluble electrolyte
EP2292725A1 (en) 2009-08-13 2011-03-09 The Procter & Gamble Company Method of laundering fabrics at low temperature
WO2011025615A2 (en) 2009-08-13 2011-03-03 The Procter & Gamble Company Method of laundering fabrics at low temperature
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3805348A2 (en) 2009-09-17 2021-04-14 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3269804A1 (en) 2009-09-17 2018-01-17 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011036264A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Use of protease variants
WO2011036263A1 (en) 2009-09-25 2011-03-31 Novozymes A/S Subtilase variants
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2977382A2 (en) 2009-09-30 2016-01-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
EP4159833A2 (en) 2009-12-09 2023-04-05 The Procter & Gamble Company Fabric and home care products
EP3434764A2 (en) 2009-12-09 2019-01-30 The Procter & Gamble Company Fabric and home care products
WO2011072117A1 (en) 2009-12-09 2011-06-16 The Procter & Gamble Company Fabric and home care products
WO2011084319A1 (en) 2009-12-10 2011-07-14 The Procter & Gamble Company Detergent composition
WO2011071994A2 (en) 2009-12-10 2011-06-16 The Procter & Gamble Company Detergent composition
WO2011071997A1 (en) 2009-12-10 2011-06-16 The Procter & Gamble Company Automatic dishwashing product and use thereof
WO2011072017A2 (en) 2009-12-10 2011-06-16 The Procter & Gamble Company Detergent composition
WO2011076897A1 (en) 2009-12-22 2011-06-30 Novozymes A/S Use of amylase variants at low temperature
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
WO2011080353A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Stabilization of alpha-amylases towards calcium depletion and acidic ph
WO2011082429A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011080352A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011080354A1 (en) 2010-01-04 2011-07-07 Novozymes A/S Alpha-amylases
WO2011098531A1 (en) 2010-02-10 2011-08-18 Novozymes A/S Variants and compositions comprising variants with high stability in presence of a chelating agent
WO2011100410A2 (en) 2010-02-10 2011-08-18 The Procter & Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
EP3404087A1 (en) 2010-02-10 2018-11-21 Novozymes A/S Alpha-amylase variants with high stability in presence of a chelating agent
EP3428260A2 (en) 2010-02-10 2019-01-16 The Procter & Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
EP2357220A1 (en) 2010-02-10 2011-08-17 The Procter & Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
EP3892709A2 (en) 2010-02-10 2021-10-13 Novozymes A/S Variants and compositions comprising variants with high stability in presence of a chelating agent
EP3730595A2 (en) 2010-02-10 2020-10-28 The Procter & Gamble Company Cleaning composition comprising amylase variants with high stability in the presence of a chelating agent
WO2011100667A1 (en) 2010-02-14 2011-08-18 Ls9, Inc. Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols
EP2361964A1 (en) 2010-02-25 2011-08-31 The Procter & Gamble Company Detergent composition
WO2011104339A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Variants of a lysozyme and polynucleotides encoding same
WO2011120882A1 (en) 2010-03-30 2011-10-06 Novozymes A/S Crystal metabolite recovery
EP2380961A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Detergent composition
EP2380962A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Particle
EP2383329A1 (en) 2010-04-23 2011-11-02 The Procter & Gamble Company Particle
WO2011133462A1 (en) 2010-04-23 2011-10-27 The Procter & Gamble Company Particle
WO2011133483A1 (en) 2010-04-23 2011-10-27 The Procter & Gamble Company Particle
WO2011133484A1 (en) 2010-04-23 2011-10-27 The Procter & Gamble Company Detergent composition
EP2380481A2 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Automatic dishwashing product
EP2380963A1 (en) 2010-04-23 2011-10-26 The Procter & Gamble Company Method of perfuming
EP2840134A1 (en) 2010-04-26 2015-02-25 Novozymes A/S Enzyme granules
WO2011134809A1 (en) 2010-04-26 2011-11-03 Novozymes A/S Enzyme granules
EP2420558A1 (en) 2010-08-17 2012-02-22 The Procter & Gamble Company Stable sustainable hand dish-washing detergents
EP2420557A1 (en) 2010-08-17 2012-02-22 The Procter & Gamble Company A method for hand washing dishes having long lasting suds
WO2012022008A1 (en) 2010-08-17 2012-02-23 The Procter & Gamble Commpany Method for hand washing dishes having long lasting suds
WO2012024076A1 (en) 2010-08-17 2012-02-23 The Procter & Gamble Company Stable sustainable hand dish-washing detergents
WO2012028483A1 (en) 2010-08-30 2012-03-08 Novozymes A/S A concentrated soak wash
WO2012028482A1 (en) 2010-08-30 2012-03-08 Novozymes A/S A two-soak wash
WO2012035103A1 (en) 2010-09-16 2012-03-22 Novozymes A/S Lysozymes
WO2012038144A1 (en) 2010-09-20 2012-03-29 Unilever Plc Fabric treatment compositions comprising target benefit agents
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2450427A2 (en) 2010-11-05 2012-05-09 Respekt Danmark A/S Dishwasher detergent
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012104176A1 (en) 2011-01-31 2012-08-09 Novozymes A/S Use of browned glucose as a feed substrate
WO2012112718A1 (en) 2011-02-15 2012-08-23 Novozymes Biologicals, Inc. Mitigation of odor in cleaning machines and cleaning processes
EP3431581A2 (en) 2011-02-15 2019-01-23 Novozymes Biologicals, Inc. Mitigation of odor in cleaning machines and cleaning processes
WO2012110562A2 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012110564A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising m7 or m35 metalloproteases
WO2012110563A1 (en) 2011-02-16 2012-08-23 Novozymes A/S Detergent compositions comprising metalloproteases
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
EP4230735A1 (en) 2011-05-05 2023-08-23 Danisco US Inc. Compositions and methods comprising serine protease variants
WO2012151534A1 (en) 2011-05-05 2012-11-08 Danisco Us Inc. Compositions and methods comprising serine protease variants
WO2012151480A2 (en) 2011-05-05 2012-11-08 The Procter & Gamble Company Compositions and methods comprising serine protease variants
EP3486319A2 (en) 2011-05-05 2019-05-22 Danisco US Inc. Compositions and methods comprising serine protease variants
EP2792737A1 (en) 2011-05-20 2014-10-22 Ecolab USA Inc. Non-phosphate detergents and non-phosphoric acids in an alternating alkali/acid system for warewashing
EP2902471A1 (en) 2011-05-20 2015-08-05 Ecolab USA Inc. Non-phosphate detergents and non-phosphoric acids in an alternating alkali/acid system for warewashing
WO2012160498A2 (en) 2011-05-20 2012-11-29 Ecolab Usa Inc. Acid formulations for use in a system for warewashing
WO2013003025A1 (en) 2011-06-20 2013-01-03 The Procter & Gamble Company Consumer products with lipase comprising coated particles
EP2537918A1 (en) 2011-06-20 2012-12-26 The Procter & Gamble Company Consumer products with lipase comprising coated particles
WO2012175401A2 (en) 2011-06-20 2012-12-27 Novozymes A/S Particulate composition
WO2012175708A2 (en) 2011-06-24 2012-12-27 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013001087A2 (en) 2011-06-30 2013-01-03 Novozymes A/S Method for screening alpha-amylases
EP4026901A2 (en) 2011-06-30 2022-07-13 Novozymes A/S Method for screening alpha-amylases
US9434932B2 (en) 2011-06-30 2016-09-06 Novozymes A/S Alpha-amylase variants
US10752889B2 (en) 2011-06-30 2020-08-25 Novozymes A/S Alpha-amylase variants
EP3543333A2 (en) 2011-06-30 2019-09-25 Novozymes A/S Method for screening alpha-amylases
US11091748B2 (en) 2011-06-30 2021-08-17 Novozymes A/S Alpha-amylase variants
US11718840B2 (en) 2011-06-30 2023-08-08 Novozymes A/S Method for screening alpha-amylases
US10167458B2 (en) 2011-06-30 2019-01-01 Novozymes A/S Alpha-amylase variants
EP4026901A3 (en) * 2011-06-30 2022-11-23 Novozymes A/S Method for screening alpha-amylases
WO2013004636A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Stabilized subtilisin composition
WO2013004635A1 (en) 2011-07-01 2013-01-10 Novozymes A/S Liquid detergent composition
WO2013007594A1 (en) 2011-07-12 2013-01-17 Novozymes A/S Storage-stable enzyme granules
EP2551335A1 (en) 2011-07-25 2013-01-30 The Procter & Gamble Company Enzyme stabilized liquid detergent composition
WO2013016368A1 (en) 2011-07-25 2013-01-31 The Procter & Gamble Company Detergent compositions
EP2551336A1 (en) 2011-07-25 2013-01-30 The Procter & Gamble Company Detergent compositions
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
WO2013026796A1 (en) 2011-08-19 2013-02-28 Novozymes A/S Polypeptides having protease activity
WO2013041689A1 (en) 2011-09-22 2013-03-28 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2013059422A1 (en) 2011-10-19 2013-04-25 The Procter & Gamble Company Particle
EP2584028A1 (en) 2011-10-19 2013-04-24 The Procter & Gamble Company Particle
EP3597736A1 (en) 2011-11-21 2020-01-22 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP3219794A1 (en) 2011-11-21 2017-09-20 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013076269A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2013076253A1 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
WO2013076259A2 (en) 2011-11-25 2013-05-30 Novozymes A/S Polypeptides having lysozyme activity and polynucleotides encoding same
EP3282004A1 (en) 2011-12-13 2018-02-14 Ecolab USA Inc. Warewashing method
EP3272862A1 (en) 2011-12-16 2018-01-24 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
EP3323875A1 (en) 2011-12-20 2018-05-23 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013092635A1 (en) 2011-12-20 2013-06-27 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP2607468A1 (en) 2011-12-20 2013-06-26 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013098185A1 (en) 2011-12-28 2013-07-04 Novozymes A/S Polypeptides having protease activity
EP3382003A1 (en) 2011-12-29 2018-10-03 Novozymes A/S Detergent compositions with lipase variants
WO2013098205A2 (en) 2011-12-29 2013-07-04 Novozymes A/S Detergent compositions
WO2013110766A1 (en) 2012-01-26 2013-08-01 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
EP2623586A2 (en) 2012-02-03 2013-08-07 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
WO2013116261A2 (en) 2012-02-03 2013-08-08 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
WO2013006871A2 (en) 2012-02-13 2013-01-10 Milliken & Company Laundry care compositions containing dyes
WO2013120952A2 (en) 2012-02-17 2013-08-22 Henkel Ag & Co. Kgaa Detergent compositions comprising subtilase variants
EP2628785A1 (en) 2012-02-17 2013-08-21 Henkel AG & Co. KGaA Detergent compositions comprising subtilase variants
WO2013120948A1 (en) 2012-02-17 2013-08-22 Novozymes A/S Subtilisin variants and polynucleotides encoding same
WO2013131964A1 (en) 2012-03-07 2013-09-12 Novozymes A/S Detergent composition and substitution of optical brighteners in detergent compositions
EP3354716A1 (en) 2012-03-16 2018-08-01 Monosol, LLC Water soluble compositions incorporating enzymes, and method of making same
WO2013138288A1 (en) 2012-03-16 2013-09-19 Monosol, Llc. Water soluble compositions incorporating enzymes, and method of making same
US10087401B2 (en) 2012-03-16 2018-10-02 Monosol, Llc Water soluble compositions incorporating enzymes, and method of making same
WO2013142486A1 (en) 2012-03-19 2013-09-26 The Procter & Gamble Company Laundry care compositions containing dyes
WO2013142495A1 (en) 2012-03-19 2013-09-26 Milliken & Company Carboxylate dyes
WO2013148492A1 (en) 2012-03-29 2013-10-03 Novozymes A/S Use of enzymes for preparing water soluble films
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2013158364A1 (en) 2012-04-16 2013-10-24 Monosol, Llc Powdered pouch and method of making same
US9908675B2 (en) 2012-04-16 2018-03-06 Monosol, Llc Powdered pouch and method of making same
US9394092B2 (en) 2012-04-16 2016-07-19 Monosol, Llc Powdered pouch and method of making same
US11753222B2 (en) 2012-04-16 2023-09-12 Monosol, Llc Powdered pouch and method of making same
US10696460B2 (en) 2012-04-16 2020-06-30 Monosol, Llc Powdered pouch and method of making same
EP3279320A2 (en) 2012-04-27 2018-02-07 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013167581A1 (en) 2012-05-07 2013-11-14 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2013171241A1 (en) 2012-05-16 2013-11-21 Novozymes A/S Compositions comprising lipase and methods of use thereof
EP2674476A1 (en) 2012-06-11 2013-12-18 The Procter & Gamble Company Detergent composition
EP2674475A1 (en) 2012-06-11 2013-12-18 The Procter & Gamble Company Detergent composition
WO2013188331A1 (en) 2012-06-11 2013-12-19 The Procter & Gamble Company Detergent composition
WO2013189802A1 (en) 2012-06-19 2013-12-27 Novozymes A/S Enzymatic reduction of hydroperoxides
WO2013189972A2 (en) 2012-06-20 2013-12-27 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
WO2014009473A1 (en) 2012-07-12 2014-01-16 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
EP3553172A1 (en) 2012-08-16 2019-10-16 Novozymes A/S Method for treating textile with endoglucanase
WO2014029820A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Detergent compositions comprising metalloproteases
WO2014029819A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloprotease from exiguobacterium
WO2014029821A1 (en) 2012-08-22 2014-02-27 Novozymes A/S Metalloproteases from alicyclobacillus sp.
EP3470516A1 (en) 2012-09-10 2019-04-17 Ecolab USA Inc. Stable liquid manual dishwashing compositions containing enzymes
EP3556836A1 (en) 2012-12-07 2019-10-23 Novozymes A/S Preventing adhesion of bacteria
WO2014087011A1 (en) 2012-12-07 2014-06-12 Novozymes A/S Preventing adhesion of bacteria
WO2014090940A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Removal of skin-derived body soils
WO2014100100A1 (en) 2012-12-20 2014-06-26 The Procter & Gamble Company Detergent composition with silicate coated bleach
WO2014096259A1 (en) 2012-12-21 2014-06-26 Novozymes A/S Polypeptides having protease activiy and polynucleotides encoding same
EP3321360A2 (en) 2013-01-03 2018-05-16 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2014138141A1 (en) 2013-03-05 2014-09-12 The Procter & Gamble Company Mixed sugar compositions
WO2014152674A1 (en) 2013-03-14 2014-09-25 Novozymes A/S Enzyme and inhibitor containing water-soluble films
WO2014147127A1 (en) 2013-03-21 2014-09-25 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2014160820A1 (en) 2013-03-28 2014-10-02 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2014160821A1 (en) 2013-03-28 2014-10-02 The Procter & Gamble Company Cleaning compositions containing a polyetheramine, a soil release polymer, and a carboxymethylcellulose
EP3569611A1 (en) 2013-04-23 2019-11-20 Novozymes A/S Liquid automatic dish washing detergent compositions with stabilised subtilisin
EP3461881A1 (en) 2013-05-03 2019-04-03 Novozymes A/S Microencapsulation of detergent enzymes
WO2014184164A1 (en) 2013-05-14 2014-11-20 Novozymes A/S Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
EP2808372A1 (en) 2013-05-28 2014-12-03 The Procter and Gamble Company Surface treatment compositions comprising photochromic dyes
WO2014193859A1 (en) 2013-05-28 2014-12-04 The Procter & Gamble Company Surface treatment compositions comprising photochromic dyes
EP3699256A1 (en) 2013-05-28 2020-08-26 The Procter & Gamble Company Surface treatment compositions comprising photochromic dyes
EP3882346A1 (en) 2013-05-29 2021-09-22 Danisco US Inc. Novel metalloproteases
EP4159854A1 (en) 2013-05-29 2023-04-05 Danisco US Inc Novel metalloproteases
WO2014194032A1 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
EP3260538A1 (en) 2013-05-29 2017-12-27 Danisco US Inc. Novel metalloproteases
WO2014194117A2 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
WO2014194054A1 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
EP3636662A1 (en) 2013-05-29 2020-04-15 Danisco US Inc. Novel metalloproteases
WO2014194034A2 (en) 2013-05-29 2014-12-04 Danisco Us Inc. Novel metalloproteases
WO2014191170A1 (en) 2013-05-30 2014-12-04 Novozymes A/S Particulate enzyme composition
EP3786269A1 (en) 2013-06-06 2021-03-03 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2014198840A1 (en) 2013-06-12 2014-12-18 Earth Alive Clean Technologies Inc. Dust suppressant
WO2014207224A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2014207227A1 (en) 2013-06-27 2014-12-31 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2015001017A2 (en) 2013-07-04 2015-01-08 Novozymes A/S Polypeptides having anti-redeposition effect and polynucleotides encoding same
EP3339436A1 (en) 2013-07-29 2018-06-27 Henkel AG & Co. KGaA Detergent composition comprising protease variants
EP2832853A1 (en) 2013-07-29 2015-02-04 Henkel AG&Co. KGAA Detergent composition comprising protease variants
EP3309249A1 (en) 2013-07-29 2018-04-18 Novozymes A/S Protease variants and polynucleotides encoding same
EP3613853A1 (en) 2013-07-29 2020-02-26 Novozymes A/S Protease variants and polynucleotides encoding same
EP3611260A1 (en) 2013-07-29 2020-02-19 Novozymes A/S Protease variants and polynucleotides encoding same
EP4047058A1 (en) 2013-09-18 2022-08-24 Milliken & Company Laundry care composition comprising a carboxylate dye
WO2015041887A2 (en) 2013-09-18 2015-03-26 Milliken & Company Laundry care composition comprising carboxylate dye
WO2015042087A1 (en) 2013-09-18 2015-03-26 The Procter & Gamble Company Laundry care composition comprising carboxylate dye
WO2015042086A1 (en) 2013-09-18 2015-03-26 The Procter & Gamble Company Laundry care composition comprising carboxylate dye
WO2015042209A1 (en) 2013-09-18 2015-03-26 The Procter & Gamble Company Laundry care compositions containing thiophene azo carboxylate dyes
EP3339377A1 (en) 2013-09-18 2018-06-27 Milliken & Company Laundry care composition comprising carboxylate dye
WO2015049370A1 (en) 2013-10-03 2015-04-09 Novozymes A/S Detergent composition and use of detergent composition
EP2857487A1 (en) 2013-10-07 2015-04-08 WeylChem Switzerland AG Multi-compartment pouch comprising cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
WO2015051901A1 (en) 2013-10-07 2015-04-16 Weylchem Wiesbaden Gmbh Multi-compartment pouch comprising alkanolamine-free cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
EP2857486A1 (en) 2013-10-07 2015-04-08 WeylChem Switzerland AG Multi-compartment pouch comprising cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
EP2857485A1 (en) 2013-10-07 2015-04-08 WeylChem Switzerland AG Multi-compartment pouch comprising alkanolamine-free cleaning compositions, washing process and use for washing and cleaning of textiles and dishes
EP3910057A1 (en) 2013-12-13 2021-11-17 Danisco US Inc. Serine proteases of the bacillus gibsonii-clade
EP3553173A1 (en) 2013-12-13 2019-10-16 Danisco US Inc. Serine proteases of the bacillus gibsonii-clade
WO2015089447A1 (en) 2013-12-13 2015-06-18 Danisco Us Inc. Serine proteases of the bacillus gibsonii-clade
WO2015089441A1 (en) 2013-12-13 2015-06-18 Danisco Us Inc. Serine proteases of bacillus species
EP3514230A1 (en) 2013-12-13 2019-07-24 Danisco US Inc. Serine proteases of bacillus species
EP4163305A1 (en) 2013-12-16 2023-04-12 Nutrition & Biosciences USA 4, Inc. Use of poly alpha-1,3-glucan ethers as viscosity modifiers
WO2015095358A1 (en) 2013-12-18 2015-06-25 E. I. Du Pont De Nemours And Company Cationic poly alpha-1,3-glucan ethers
EP3789407A1 (en) 2013-12-18 2021-03-10 Nutrition & Biosciences USA 4, Inc. Cationic poly alpha-1,3-glucan ethers
EP3453757A1 (en) 2013-12-20 2019-03-13 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2015112338A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Method of treating textile fabrics
WO2015112340A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Method of treating textile fabrics
WO2015112341A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Fabric treatment composition
WO2015112339A1 (en) 2014-01-22 2015-07-30 The Procter & Gamble Company Fabric treatment composition
US9725685B2 (en) 2014-01-30 2017-08-08 The Procter & Gamble Company Unit dose article
WO2015123323A1 (en) 2014-02-14 2015-08-20 E. I. Du Pont De Nemours And Company Poly-alpha-1,3-1,6-glucans for viscosity modification
WO2015130653A1 (en) 2014-02-25 2015-09-03 The Procter & Gamble Company A process for making renewable surfactant intermediates and surfactants from fats and oils and products thereof
WO2015130669A1 (en) 2014-02-25 2015-09-03 The Procter & Gamble Company A process for making renewable surfactant intermediates and surfactants from fats and oils and products thereof
WO2015134737A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase
WO2015134729A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for improving properties of non-cellulosic textile materials with xyloglucan endotransglycosylase
WO2015138283A1 (en) 2014-03-11 2015-09-17 E. I. Du Pont De Nemours And Company Oxidized poly alpha-1,3-glucan as detergent builder
EP3587569A1 (en) 2014-03-21 2020-01-01 Danisco US Inc. Serine proteases of bacillus species
EP4155398A1 (en) 2014-03-21 2023-03-29 Danisco US Inc. Serine proteases of bacillus species
WO2015148360A1 (en) 2014-03-27 2015-10-01 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2015148890A1 (en) 2014-03-27 2015-10-01 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2015148361A1 (en) 2014-03-27 2015-10-01 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
EP2924108A1 (en) 2014-03-28 2015-09-30 The Procter and Gamble Company Water soluble unit dose article
WO2015148777A1 (en) 2014-03-28 2015-10-01 The Procter & Gamble Company Water soluble unit dose article
EP2924105A1 (en) 2014-03-28 2015-09-30 The Procter and Gamble Company Water soluble unit dose article
EP2924107A1 (en) 2014-03-28 2015-09-30 The Procter and Gamble Company Water soluble unit dose article
EP2924106A1 (en) 2014-03-28 2015-09-30 The Procter and Gamble Company Water soluble unit dose article
WO2015148780A1 (en) 2014-03-28 2015-10-01 The Procter & Gamble Company Water soluble unit dose article
WO2015150457A1 (en) 2014-04-01 2015-10-08 Novozymes A/S Polypeptides having alpha amylase activity
EP3722406A1 (en) 2014-04-11 2020-10-14 Novozymes A/S Detergent composition
WO2015171592A1 (en) 2014-05-06 2015-11-12 Milliken & Company Laundry care compositions
EP3878957A1 (en) 2014-05-27 2021-09-15 Novozymes A/S Methods for producing lipases
EP3760713A2 (en) 2014-05-27 2021-01-06 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015187757A1 (en) 2014-06-06 2015-12-10 The Procter & Gamble Company Detergent composition comprising polyalkyleneimine polymers
WO2015189371A1 (en) 2014-06-12 2015-12-17 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
US10428321B2 (en) 2014-06-12 2019-10-01 Novozymes A/S Alpha-amylase variants
WO2015189370A1 (en) * 2014-06-12 2015-12-17 Novozymes A/S Oxidation stable alpha-amylase variants
WO2015195777A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
EP3919599A1 (en) 2014-06-19 2021-12-08 Nutrition & Biosciences USA 4, Inc. Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2015195960A1 (en) 2014-06-19 2015-12-23 E. I. Du Pont De Nemours And Company Compositions containing one or more poly alpha-1,3-glucan ether compounds
WO2016001319A1 (en) 2014-07-03 2016-01-07 Novozymes A/S Improved stabilization of non-protease enzyme
EP3878960A1 (en) 2014-07-04 2021-09-15 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3739029A1 (en) 2014-07-04 2020-11-18 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2016044200A1 (en) 2014-09-15 2016-03-24 The Procter & Gamble Company Detergent compositions containing salts of polyetheramines and polymeric acid
WO2016048969A1 (en) 2014-09-25 2016-03-31 The Procter & Gamble Company Detergent compositions containing a polyetheramine and an anionic soil release polymer
WO2016048674A1 (en) 2014-09-25 2016-03-31 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
WO2016049387A1 (en) 2014-09-26 2016-03-31 The Procter & Gamble Company Cleaning compositions containing a polyetheramine
US11104497B2 (en) 2014-10-03 2021-08-31 Monosol, Llc Degradable materials and packaging made from same
US11884467B2 (en) 2014-10-03 2024-01-30 Monosol, Llc Degradable materials and packaging made from same
WO2016061438A1 (en) 2014-10-17 2016-04-21 Danisco Us Inc. Serine proteases of bacillus species
WO2016069552A1 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016069557A1 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases of bacillus species
WO2016069548A2 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016069569A2 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
EP3550017A1 (en) 2014-10-27 2019-10-09 Danisco US Inc. Serine proteases
WO2016069544A1 (en) 2014-10-27 2016-05-06 Danisco Us Inc. Serine proteases
WO2016081437A1 (en) 2014-11-17 2016-05-26 The Procter & Gamble Company Benefit agent delivery compositions
WO2016079110A2 (en) 2014-11-19 2016-05-26 Novozymes A/S Use of enzyme for cleaning
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
EP3690037A1 (en) 2014-12-04 2020-08-05 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2016087401A1 (en) 2014-12-05 2016-06-09 Novozymes A/S Lipase variants and polynucleotides encoding same
EP4067485A2 (en) 2014-12-05 2022-10-05 Novozymes A/S Lipase variants and polynucleotides encoding same
EP3608403A2 (en) 2014-12-15 2020-02-12 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
US10760036B2 (en) 2014-12-15 2020-09-01 Henkel Ag & Co. Kgaa Detergent composition comprising subtilase variants
WO2016096996A1 (en) 2014-12-16 2016-06-23 Novozymes A/S Polypeptides having n-acetyl glucosamine oxidase activity
EP3034590A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Method of automatic dishwashing
US10662398B2 (en) 2014-12-17 2020-05-26 The Procter & Gamble Company Detergent composition
EP3034597A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034589A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034588A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
WO2016100324A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Method of automatic dishwashing
EP3034596A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Detergent composition
EP3034592A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Method of automatic dishwashing
US10081782B2 (en) 2014-12-17 2018-09-25 The Procter & Gamble Company Detergent composition
EP3034591A1 (en) 2014-12-17 2016-06-22 The Procter and Gamble Company Method of automatic dishwashing
WO2016099859A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Detergent composition
US10266796B2 (en) 2014-12-17 2019-04-23 The Procter & Gamble Company Detergent composition
WO2016099860A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Method of automatic dishwashing
WO2016099858A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Detergent composition
WO2016100323A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Detergent composition
WO2016100320A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Detergent composition
WO2016099861A1 (en) 2014-12-17 2016-06-23 The Procter & Gamble Company Method of automatic dishwashing
EP3741849A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
EP3741848A2 (en) 2014-12-19 2020-11-25 Novozymes A/S Protease variants and polynucleotides encoding same
WO2016106011A1 (en) 2014-12-23 2016-06-30 E. I. Du Pont De Nemours And Company Enzymatically produced cellulose
EP3075832A1 (en) 2015-03-30 2016-10-05 Dalli-Werke GmbH & Co. KG Manganese-amino acid compounds in cleaning compositions
WO2016162556A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Laundry method, use of dnase and detergent composition
WO2016162558A1 (en) 2015-04-10 2016-10-13 Novozymes A/S Detergent composition
EP3088505A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
WO2016176240A1 (en) 2015-04-29 2016-11-03 The Procter & Gamble Company Method of treating a fabric
EP3088502A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
EP3088504A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
EP3088503A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Method of treating a fabric
EP3674387A1 (en) 2015-04-29 2020-07-01 The Procter & Gamble Company Method of treating a fabric
WO2016176280A1 (en) 2015-04-29 2016-11-03 The Procter & Gamble Company Method of treating a fabric
WO2016176282A1 (en) 2015-04-29 2016-11-03 The Procter & Gamble Company Method of treating a fabric
WO2016176241A1 (en) 2015-04-29 2016-11-03 The Procter & Gamble Company Detergent composition
WO2016176296A1 (en) 2015-04-29 2016-11-03 The Procter & Gamble Company Method of laundering a fabric
EP3088506A1 (en) 2015-04-29 2016-11-02 The Procter and Gamble Company Detergent composition
WO2016178668A1 (en) 2015-05-04 2016-11-10 Milliken & Company Leuco triphenylmethane colorants as bluing agents in laundry care compositions
US10647946B2 (en) 2015-05-08 2020-05-12 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
US11365375B2 (en) 2015-05-08 2022-06-21 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
US11952557B2 (en) 2015-05-08 2024-04-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
US10316275B2 (en) 2015-05-08 2019-06-11 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
US11319509B2 (en) 2015-05-08 2022-05-03 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
EP4219704A2 (en) 2015-05-13 2023-08-02 Danisco US Inc Aprl-clade protease variants and uses thereof
EP3872174A1 (en) 2015-05-13 2021-09-01 Danisco US Inc. Aprl-clade protease variants and uses thereof
WO2016184944A1 (en) 2015-05-19 2016-11-24 Novozymes A/S Odor reduction
WO2016196872A1 (en) 2015-06-04 2016-12-08 The Procter & Gamble Company Hand dishwashing liquid detergent composition
US10377973B2 (en) 2015-06-04 2019-08-13 The Procter & Gamble Company Hand dishwashing liquid detergent composition
EP3287513A1 (en) 2015-06-04 2018-02-28 The Procter & Gamble Company Hand dishwashing liquid detergent composition
EP3101108A1 (en) 2015-06-04 2016-12-07 The Procter and Gamble Company Hand dishwashing liquid detergent composition
US10377974B2 (en) 2015-06-04 2019-08-13 The Procter & Gamble Company Hand dishwashing liquid detergent composition
WO2016196874A1 (en) 2015-06-04 2016-12-08 The Procter & Gamble Company Hand dishwashing liquid detergent composition
EP3101109A1 (en) 2015-06-04 2016-12-07 The Procter and Gamble Company Hand dishwashing liquid detergent composition
EP3284811A1 (en) 2015-06-04 2018-02-21 The Procter & Gamble Company Hand dishwashing liquid detergent composition
WO2016196705A1 (en) 2015-06-05 2016-12-08 The Procter & Gamble Company Compacted liquid laundry detergent composition
EP3101103A1 (en) 2015-06-05 2016-12-07 The Procter and Gamble Company Compacted liquid laundry detergent composition
WO2016201040A1 (en) 2015-06-09 2016-12-15 Danisco Us Inc. Water-triggered enzyme suspension
WO2016201044A1 (en) 2015-06-09 2016-12-15 Danisco Us Inc Osmotic burst encapsulates
WO2016201069A1 (en) 2015-06-09 2016-12-15 Danisco Us Inc Low-density enzyme-containing particles
WO2016202739A1 (en) 2015-06-16 2016-12-22 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2016202785A1 (en) 2015-06-17 2016-12-22 Novozymes A/S Container
WO2016205755A1 (en) 2015-06-17 2016-12-22 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
EP3106508A1 (en) 2015-06-18 2016-12-21 Henkel AG & Co. KGaA Detergent composition comprising subtilase variants
EP4071244A1 (en) 2015-06-18 2022-10-12 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3872175A1 (en) 2015-06-18 2021-09-01 Novozymes A/S Subtilase variants and polynucleotides encoding same
WO2016135351A1 (en) 2015-06-30 2016-09-01 Novozymes A/S Laundry detergent composition, method for washing and use of composition
EP3929285A2 (en) 2015-07-01 2021-12-29 Novozymes A/S Methods of reducing odor
EP3950939A2 (en) 2015-07-06 2022-02-09 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2017046260A1 (en) 2015-09-17 2017-03-23 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2017046232A1 (en) 2015-09-17 2017-03-23 Henkel Ag & Co. Kgaa Detergent compositions comprising polypeptides having xanthan degrading activity
EP3708660A2 (en) 2015-10-07 2020-09-16 Novozymes A/S Polypeptides
WO2017060505A1 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
WO2017064269A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptide variants
WO2017066510A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Cleaning of water filtration membranes
EP4324919A2 (en) 2015-10-14 2024-02-21 Novozymes A/S Polypeptide variants
WO2017064253A1 (en) 2015-10-14 2017-04-20 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017079751A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus sp. mannanases
WO2017079756A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus and bacillus spp. mannanases
WO2017083229A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
US10876074B2 (en) 2015-11-13 2020-12-29 Dupont Industrial Biosciences Usa, Llc Glucan fiber compositions for use in laundry care and fabric care
WO2017083228A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
US10844324B2 (en) 2015-11-13 2020-11-24 Dupont Industrial Biosciences Usa, Llc Glucan fiber compositions for use in laundry care and fabric care
WO2017083226A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
US10822574B2 (en) 2015-11-13 2020-11-03 Dupont Industrial Biosciences Usa, Llc Glucan fiber compositions for use in laundry care and fabric care
WO2017089366A1 (en) 2015-11-24 2017-06-01 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017091674A1 (en) 2015-11-26 2017-06-01 The Procter & Gamble Company Liquid detergent compositions comprising protease and encapsulated lipase
EP3173467A1 (en) 2015-11-26 2017-05-31 The Procter & Gamble Company Cleaning compositions comprising enzymes
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
US11441140B2 (en) 2015-12-07 2022-09-13 Henkel Ag & Co. Kgaa Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof
EP4218992A2 (en) 2015-12-09 2023-08-02 Basf Se Method of purifying a protein from fermentation solids under desorbing conditions
WO2017106676A1 (en) 2015-12-18 2017-06-22 Danisco Us Inc Polypeptides with endoglucanase activity and uses thereof
WO2017117089A1 (en) 2015-12-28 2017-07-06 Novozymes Bioag A/S Heat priming of bacterial spores
EP4219702A2 (en) 2015-12-30 2023-08-02 Novozymes A/S Enzyme variants and polynucleotides encoding the same
WO2017129754A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
EP3715442A1 (en) 2016-03-23 2020-09-30 Novozymes A/S Use of polypeptide having dnase activity for treating fabrics
WO2017174769A2 (en) 2016-04-08 2017-10-12 Novozymes A/S Detergent compositions and uses of the same
WO2017186943A1 (en) 2016-04-29 2017-11-02 Novozymes A/S Detergent compositions and uses thereof
EP3693449A1 (en) 2016-04-29 2020-08-12 Novozymes A/S Detergent compositions and uses thereof
WO2017191160A1 (en) 2016-05-03 2017-11-09 Novozymes A/S Alpha-amylase variants and polynucleotides encoding the same
WO2017192692A1 (en) 2016-05-03 2017-11-09 Danisco Us Inc Protease variants and uses thereof
WO2017192300A1 (en) 2016-05-05 2017-11-09 Danisco Us Inc Protease variants and uses thereof
EP3845642A1 (en) 2016-05-05 2021-07-07 Danisco US Inc. Protease variants and uses thereof
WO2017194487A1 (en) 2016-05-09 2017-11-16 Novozymes A/S Variant polypeptides with improved performance and use of the same
WO2017210295A1 (en) 2016-05-31 2017-12-07 Danisco Us Inc. Protease variants and uses thereof
WO2017210188A1 (en) 2016-05-31 2017-12-07 Novozymes A/S Stabilized liquid peroxide compositions
WO2017207762A1 (en) 2016-06-03 2017-12-07 Novozymes A/S Subtilase variants and polynucleotides encoding same
EP3257931A1 (en) 2016-06-17 2017-12-20 The Procter and Gamble Company Detergent composition
WO2017218861A1 (en) 2016-06-17 2017-12-21 The Procter & Gamble Company Detergent composition
WO2017219011A1 (en) 2016-06-17 2017-12-21 Danisco Us Inc Protease variants and uses thereof
EP4151726A1 (en) 2016-06-17 2023-03-22 Danisco US Inc Protease variants and uses thereof
WO2017220422A1 (en) 2016-06-23 2017-12-28 Novozymes A/S Use of enzymes, composition and method for removing soil
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
WO2018007435A1 (en) 2016-07-05 2018-01-11 Novozymes A/S Pectate lyase variants and polynucleotides encoding same
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
EP3950941A2 (en) 2016-07-13 2022-02-09 Novozymes A/S Dnase polypeptide variants
WO2018011276A1 (en) 2016-07-13 2018-01-18 The Procter & Gamble Company Bacillus cibi dnase variants and uses thereof
WO2018011277A1 (en) 2016-07-13 2018-01-18 Novozymes A/S Bacillus cibi dnase variants
WO2018011242A1 (en) 2016-07-14 2018-01-18 Basf Se Fermentation medium comprising chelating agent
EP4357453A2 (en) 2016-07-18 2024-04-24 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
WO2018034842A1 (en) 2016-08-17 2018-02-22 The Procter & Gamble Company Cleaning composition comprising enzymes
EP3284805A1 (en) 2016-08-17 2018-02-21 The Procter & Gamble Company Cleaning composition comprising enzymes
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2018037062A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018037064A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants i
WO2018060216A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Use of enzyme for washing, method for washing and warewashing composition
WO2018060475A1 (en) 2016-09-29 2018-04-05 Novozymes A/S Spore containing granule
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
WO2018085315A1 (en) 2016-11-01 2018-05-11 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care compositions, packaging, kits and methods thereof
WO2018085310A1 (en) 2016-11-01 2018-05-11 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care compositions
WO2018083093A1 (en) 2016-11-01 2018-05-11 Novozymes A/S Multi-core granules
WO2018085390A1 (en) 2016-11-01 2018-05-11 Milliken & Company Leuco colorants as bluing agents in laundry care compositions
WO2018084930A1 (en) 2016-11-03 2018-05-11 Milliken & Company Leuco triphenylmethane colorants as bluing agents in laundry care compositions
WO2018085524A2 (en) 2016-11-07 2018-05-11 Danisco Us Inc Laundry detergent composition
WO2018099762A1 (en) 2016-12-01 2018-06-07 Basf Se Stabilization of enzymes in compositions
WO2018102478A1 (en) 2016-12-02 2018-06-07 The Procter & Gamble Company Cleaning compositions including enzymes
WO2018102479A1 (en) 2016-12-02 2018-06-07 The Procter & Gamble Company Cleaning compositions including enzymes
EP3330348A1 (en) 2016-12-02 2018-06-06 The Procter & Gamble Company Cleaning compositions including enzymes
WO2018108865A1 (en) 2016-12-12 2018-06-21 Novozymes A/S Use of polypeptides
WO2018112123A1 (en) 2016-12-15 2018-06-21 Danisco Us Inc. Polypeptides with endoglucanase activity and uses thereof
EP4212622A2 (en) 2016-12-21 2023-07-19 Danisco US Inc. Bacillus gibsonii-clade serine proteases
WO2018118950A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
WO2018118917A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Protease variants and uses thereof
EP3357994A1 (en) 2017-02-01 2018-08-08 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2018144399A1 (en) 2017-02-01 2018-08-09 The Procter & Gamble Company Cleaning compositions comprising amylase variants
EP4353828A2 (en) 2017-02-24 2024-04-17 Danisco US Inc. Compositions and methods for increased protein production in bacillus licheniformis
WO2018156705A1 (en) 2017-02-24 2018-08-30 Danisco Us Inc. Compositions and methods for increased protein production in bacillus licheniformis
WO2018169750A1 (en) 2017-03-15 2018-09-20 Danisco Us Inc Trypsin-like serine proteases and uses thereof
WO2018184004A1 (en) 2017-03-31 2018-10-04 Danisco Us Inc Alpha-amylase combinatorial variants
WO2018183662A1 (en) 2017-03-31 2018-10-04 Danisco Us Inc Delayed release enzyme formulations for bleach-containing detergents
WO2018178061A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having rnase activity
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018177938A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018185048A1 (en) 2017-04-03 2018-10-11 Novozymes A/S Recovery process
WO2018185150A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptides
WO2018185181A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Glycosyl hydrolases
WO2018185152A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptide compositions and uses thereof
EP3385362A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising fungal mannanases
EP3385361A1 (en) 2017-04-05 2018-10-10 Henkel AG & Co. KGaA Detergent compositions comprising bacterial mannanases
WO2018184767A1 (en) 2017-04-05 2018-10-11 Henkel Ag & Co. Kgaa Detergent compositions comprising bacterial mannanases
WO2018184873A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Detergent compositions and uses thereof
EP3626809A1 (en) 2017-04-06 2020-03-25 Novozymes A/S Cleaning compositions and uses thereof
WO2018184817A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185285A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018184818A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185269A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185280A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
EP3967756A1 (en) 2017-04-06 2022-03-16 Novozymes A/S Detergent compositions and uses thereof
WO2018184816A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018185267A1 (en) 2017-04-06 2018-10-11 Novozymes A/S Cleaning compositions and uses thereof
WO2018202846A1 (en) 2017-05-05 2018-11-08 Novozymes A/S Compositions comprising lipase and sulfite
WO2018206178A1 (en) 2017-05-08 2018-11-15 Henkel Ag & Co. Kgaa Detergent composition comprising polypeptide comprising carbohydrate-binding domain
EP3401385A1 (en) 2017-05-08 2018-11-14 Henkel AG & Co. KGaA Detergent composition comprising polypeptide comprising carbohydrate-binding domain
WO2018206535A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Carbohydrate-binding domain and polynucleotides encoding the same
WO2018206300A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018206302A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2018224544A1 (en) 2017-06-08 2018-12-13 Novozymes A/S Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions
EP3415592A1 (en) 2017-06-15 2018-12-19 The Procter & Gamble Company Water-soluble unit dose article comprising a solid laundry detergent composition
WO2018231798A1 (en) 2017-06-15 2018-12-20 The Procter & Gamble Company Water-soluble unit dose article comprising a solid laundry detergent composition
WO2019002356A1 (en) 2017-06-30 2019-01-03 Novozymes A/S Enzyme slurry composition
WO2019006077A1 (en) 2017-06-30 2019-01-03 Danisco Us Inc Low-agglomeration, enzyme-containing particles
WO2019030186A1 (en) 2017-08-07 2019-02-14 Novozymes A/S Use of fca control based on ph
WO2019036721A2 (en) 2017-08-18 2019-02-21 Danisco Us Inc Alpha-amylase variants
WO2019040412A1 (en) 2017-08-23 2019-02-28 Danisco Us Inc Methods and compositions for efficient genetic modifications of bacillus licheniformis strains
WO2019038058A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
WO2019038059A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent compositions comprising gh9 endoglucanase variants ii
WO2019038057A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2019038060A1 (en) 2017-08-24 2019-02-28 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase variants ii
WO2019055261A1 (en) 2017-09-13 2019-03-21 Danisco Us Inc Modified 5'-untranslated region (utr) sequences for increased protein production in bacillus
WO2019057758A1 (en) 2017-09-20 2019-03-28 Novozymes A/S Use of enzymes for improving water absorption and/or whiteness
WO2019057902A1 (en) 2017-09-22 2019-03-28 Novozymes A/S Novel polypeptides
WO2019067390A1 (en) 2017-09-27 2019-04-04 The Procter & Gamble Company Detergent compositions comprising lipases
WO2019063499A1 (en) 2017-09-27 2019-04-04 Novozymes A/S Lipase variants and microcapsule compositions comprising such lipase variants
WO2019068715A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019068713A1 (en) 2017-10-02 2019-04-11 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
WO2019075148A1 (en) 2017-10-12 2019-04-18 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care compositions
WO2019075146A1 (en) 2017-10-12 2019-04-18 The Procter & Gamble Company Leuco colorants as bluing agents in laundry care composition
WO2019075228A1 (en) 2017-10-12 2019-04-18 Milliken & Company Leuco colorants and compositions
WO2019075144A1 (en) 2017-10-12 2019-04-18 The Procter & Gamble Company Leuco colorants in combination with a second whitening agent as bluing agents in laundry care compositions
WO2019076833A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Low dusting granules
WO2019076800A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Cleaning compositions and uses thereof
WO2019076834A1 (en) 2017-10-16 2019-04-25 Novozymes A/S Low dusting granules
WO2019081515A1 (en) 2017-10-24 2019-05-02 Novozymes A/S Compositions comprising polypeptides having mannanase activity
WO2019081721A1 (en) 2017-10-27 2019-05-02 Novozymes A/S Dnase variants
WO2019084350A1 (en) 2017-10-27 2019-05-02 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
WO2019084349A1 (en) 2017-10-27 2019-05-02 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
WO2019081724A1 (en) 2017-10-27 2019-05-02 Novozymes A/S Dnase variants
DE102017125558A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANING COMPOSITIONS CONTAINING DISPERSINE I
WO2019086530A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Polypeptides and compositions comprising such polypeptides
DE102017125560A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE III
DE102017125559A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE II
WO2019086526A1 (en) 2017-11-01 2019-05-09 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins iii
WO2019086532A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Methods for cleaning medical devices
WO2019086528A1 (en) 2017-11-01 2019-05-09 Novozymes A/S Polypeptides and compositions comprising such polypeptides
WO2019086521A1 (en) 2017-11-01 2019-05-09 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins ii
WO2019089228A1 (en) 2017-11-01 2019-05-09 Milliken & Company Leuco compounds, colorant compounds, and compositions containing the same
WO2019086520A1 (en) 2017-11-01 2019-05-09 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins i
WO2019089898A1 (en) 2017-11-02 2019-05-09 Danisco Us Inc Freezing point depressed solid matrix compositions for melt granulation of enzymes
WO2019091822A1 (en) 2017-11-09 2019-05-16 Basf Se Coatings of enzyme particles comprising organic white pigments
WO2019108599A1 (en) 2017-11-29 2019-06-06 Danisco Us Inc Subtilisin variants having improved stability
WO2019110462A1 (en) 2017-12-04 2019-06-13 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2019125683A1 (en) 2017-12-21 2019-06-27 Danisco Us Inc Enzyme-containing, hot-melt granules comprising a thermotolerant desiccant
WO2019135868A1 (en) 2018-01-03 2019-07-11 Danisco Us Inc Mutant and genetically modified bacillus cells and methods thereof for increased protein production
WO2019154951A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipases, lipase variants and compositions thereof
WO2019154954A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019156670A1 (en) 2018-02-08 2019-08-15 Danisco Us Inc. Thermally-resistant wax matrix particles for enzyme encapsulation
WO2019154955A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019154952A1 (en) 2018-02-08 2019-08-15 Novozymes A/S Lipase variants and compositions thereof
WO2019162000A1 (en) 2018-02-23 2019-08-29 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase and endoglucanase variants
WO2019168649A1 (en) 2018-02-28 2019-09-06 The Procter & Gamble Company Cleaning compositions
WO2019168650A1 (en) 2018-02-28 2019-09-06 The Procter & Gamble Company Methods of cleaning
WO2019175240A1 (en) 2018-03-13 2019-09-19 Novozymes A/S Microencapsulation using amino sugar oligomers
WO2019180111A1 (en) 2018-03-23 2019-09-26 Novozymes A/S Subtilase variants and compositions comprising same
WO2019185726A1 (en) 2018-03-29 2019-10-03 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2019201793A1 (en) 2018-04-17 2019-10-24 Novozymes A/S Polypeptides comprising carbohydrate binding activity in detergent compositions and their use in reducing wrinkles in textile or fabric.
WO2019201785A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019201783A1 (en) 2018-04-19 2019-10-24 Novozymes A/S Stabilized cellulase variants
WO2019206994A1 (en) 2018-04-26 2019-10-31 Basf Se Lipase enzymes
WO2019211143A1 (en) 2018-05-03 2019-11-07 Basf Se Amylase enzymes
WO2019238761A1 (en) 2018-06-15 2019-12-19 Basf Se Water soluble multilayer films containing wash active chemicals and enzymes
WO2019245704A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2019245705A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2020002604A1 (en) 2018-06-28 2020-01-02 Novozymes A/S Detergent compositions and uses thereof
WO2020002255A1 (en) 2018-06-29 2020-01-02 Novozymes A/S Subtilase variants and compositions comprising same
WO2020002608A1 (en) 2018-06-29 2020-01-02 Novozymes A/S Detergent compositions and uses thereof
WO2020007863A1 (en) 2018-07-02 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020007875A1 (en) 2018-07-03 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020008024A1 (en) 2018-07-06 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020008043A1 (en) 2018-07-06 2020-01-09 Novozymes A/S Cleaning compositions and uses thereof
WO2020028443A1 (en) 2018-07-31 2020-02-06 Danisco Us Inc Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid
WO2020047215A1 (en) 2018-08-30 2020-03-05 Danisco Us Inc Enzyme-containing granules
WO2020068486A1 (en) 2018-09-27 2020-04-02 Danisco Us Inc Compositions for medical instrument cleaning
WO2020070063A2 (en) 2018-10-01 2020-04-09 Novozymes A/S Detergent compositions and uses thereof
WO2020070011A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition
WO2020070014A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition comprising anionic surfactant and a polypeptide having rnase activity
WO2020070009A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Endonuclease 1 ribonucleases for cleaning
WO2020070209A1 (en) 2018-10-02 2020-04-09 Novozymes A/S Cleaning composition
WO2020070249A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Cleaning compositions
WO2020070199A1 (en) 2018-10-03 2020-04-09 Novozymes A/S Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same
WO2020069914A1 (en) 2018-10-05 2020-04-09 Basf Se Compounds stabilizing amylases in liquids
WO2020074545A1 (en) 2018-10-11 2020-04-16 Novozymes A/S Cleaning compositions and uses thereof
WO2020077331A2 (en) 2018-10-12 2020-04-16 Danisco Us Inc Alpha-amylases with mutations that improve stability in the presence of chelants
WO2020088958A1 (en) 2018-10-31 2020-05-07 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins v
EP3647397A1 (en) 2018-10-31 2020-05-06 Henkel AG & Co. KGaA Cleaning compositions containing dispersins iv
WO2020088957A1 (en) 2018-10-31 2020-05-07 Henkel Ag & Co. Kgaa Cleaning compositions containing dispersins iv
EP3647398A1 (en) 2018-10-31 2020-05-06 Henkel AG & Co. KGaA Cleaning compositions containing dispersins v
WO2020112599A1 (en) 2018-11-28 2020-06-04 Danisco Us Inc Subtilisin variants having improved stability
WO2020114968A1 (en) 2018-12-03 2020-06-11 Novozymes A/S Powder detergent compositions
WO2020114965A1 (en) 2018-12-03 2020-06-11 Novozymes A/S LOW pH POWDER DETERGENT COMPOSITION
WO2020127775A1 (en) 2018-12-21 2020-06-25 Novozymes A/S Detergent pouch comprising metalloproteases
WO2020127796A2 (en) 2018-12-21 2020-06-25 Novozymes A/S Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same
EP3677676A1 (en) 2019-01-03 2020-07-08 Basf Se Compounds stabilizing amylases in liquids
WO2020169564A1 (en) 2019-02-20 2020-08-27 Basf Se Industrial fermentation process for bacillus using defined medium and trace element feed
WO2020169563A1 (en) 2019-02-20 2020-08-27 Basf Se Industrial fermentation process for bacillus using defined medium and magnesium feed
WO2020178102A1 (en) 2019-03-01 2020-09-10 Novozymes A/S Detergent compositions comprising two proteases
EP3702452A1 (en) 2019-03-01 2020-09-02 Novozymes A/S Detergent compositions comprising two proteases
WO2020188095A1 (en) 2019-03-21 2020-09-24 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2020193535A2 (en) 2019-03-25 2020-10-01 Basf Se Amylase enzymes
WO2020193534A2 (en) 2019-03-25 2020-10-01 Basf Se Amylase enzymes
WO2020201403A1 (en) 2019-04-03 2020-10-08 Novozymes A/S Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions
WO2020207944A1 (en) 2019-04-10 2020-10-15 Novozymes A/S Polypeptide variants
WO2020208056A1 (en) 2019-04-12 2020-10-15 Novozymes A/S Stabilized glycoside hydrolase variants
WO2020229480A1 (en) 2019-05-14 2020-11-19 Basf Se Compounds stabilizing hydrolases in liquids
WO2020242858A1 (en) 2019-05-24 2020-12-03 Danisco Us Inc Subtilisin variants and methods of use
WO2020247582A1 (en) 2019-06-06 2020-12-10 Danisco Us Inc Methods and compositions for cleaning
WO2020249546A1 (en) 2019-06-13 2020-12-17 Basf Se Method of recovering a protein from fermentation broth using a divalent cation
WO2020264552A1 (en) 2019-06-24 2020-12-30 The Procter & Gamble Company Cleaning compositions comprising amylase variants
WO2021001244A1 (en) 2019-07-01 2021-01-07 Basf Se Peptide acetals for stabilising enzymes
WO2021001400A1 (en) 2019-07-02 2021-01-07 Novozymes A/S Lipase variants and compositions thereof
WO2021004830A1 (en) 2019-07-05 2021-01-14 Basf Se Industrial fermentation process for microbial cells using a fed-batch pre-culture
WO2021009067A1 (en) 2019-07-12 2021-01-21 Novozymes A/S Enzymatic emulsions for detergents
WO2021022045A1 (en) 2019-07-31 2021-02-04 Ecolab Usa Inc. Personal protective equipment free delimer compositions
WO2021030267A1 (en) 2019-08-14 2021-02-18 Danisco Us Inc Compositions and methods for increased protein production in bacillus licheniformis
WO2021032881A1 (en) 2019-08-22 2021-02-25 Basf Se Amylase variants
WO2021037895A1 (en) 2019-08-27 2021-03-04 Novozymes A/S Detergent composition
WO2021037878A1 (en) 2019-08-27 2021-03-04 Novozymes A/S Composition comprising a lipase
WO2021053127A1 (en) 2019-09-19 2021-03-25 Novozymes A/S Detergent composition
WO2021064068A1 (en) 2019-10-03 2021-04-08 Novozymes A/S Polypeptides comprising at least two carbohydrate binding domains
WO2021074430A1 (en) 2019-10-18 2021-04-22 Basf Se Storage-stable hydrolase containing liquids
WO2021080948A2 (en) 2019-10-24 2021-04-29 Danisco Us Inc Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2021096857A1 (en) 2019-11-11 2021-05-20 Danisco Us Inc Compositions and methods for enhanced protein production in bacillus cells
WO2021105336A1 (en) 2019-11-29 2021-06-03 Basf Se Compositions comprising polymer and enzyme
WO2021115912A1 (en) 2019-12-09 2021-06-17 Basf Se Formulations comprising a hydrophobically modified polyethyleneimine and one or more enzymes
EP3835396A1 (en) 2019-12-09 2021-06-16 The Procter & Gamble Company A detergent composition comprising a polymer
WO2021118814A1 (en) 2019-12-09 2021-06-17 The Procter & Gamble Company A detergent composition comprising a polymer
WO2021122118A1 (en) 2019-12-20 2021-06-24 Henkel Ag & Co. Kgaa Cleaning compositions comprising dispersins vi
WO2021122120A2 (en) 2019-12-20 2021-06-24 Henkel Ag & Co. Kgaa Cleaning compositions comprising dispersins viii
WO2021123307A2 (en) 2019-12-20 2021-06-24 Novozymes A/S Polypeptides having proteolytic activity and use thereof
WO2021121394A1 (en) 2019-12-20 2021-06-24 Novozymes A/S Stabilized liquid boron-free enzyme compositions
WO2021122117A1 (en) 2019-12-20 2021-06-24 Henkel Ag & Co. Kgaa Cleaning composition coprising a dispersin and a carbohydrase
WO2021146411A1 (en) 2020-01-15 2021-07-22 Danisco Us Inc Compositions and methods for enhanced protein production in bacillus licheniformis
WO2021151536A1 (en) 2020-01-29 2021-08-05 Unilever Ip Holdings B.V. Laundry detergent product
WO2021152120A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021152123A1 (en) 2020-01-31 2021-08-05 Novozymes A/S Mannanase variants and polynucleotides encoding same
EP3892708A1 (en) 2020-04-06 2021-10-13 Henkel AG & Co. KGaA Cleaning compositions comprising dispersin variants
WO2021204838A1 (en) 2020-04-08 2021-10-14 Novozymes A/S Carbohydrate binding module variants
WO2021214059A1 (en) 2020-04-21 2021-10-28 Novozymes A/S Cleaning compositions comprising polypeptides having fructan degrading activity
WO2021224389A1 (en) 2020-05-07 2021-11-11 Novozymes A/S Medical cleaning composition, use and method of cleaning
EP3907271A1 (en) 2020-05-07 2021-11-10 Novozymes A/S Cleaning composition, use and method of cleaning
WO2021239818A1 (en) 2020-05-26 2021-12-02 Novozymes A/S Subtilase variants and compositions comprising same
WO2021259099A1 (en) 2020-06-24 2021-12-30 Novozymes A/S Use of cellulases for removing dust mite from textile
WO2022008387A1 (en) 2020-07-08 2022-01-13 Henkel Ag & Co. Kgaa Cleaning compositions and uses thereof
EP3936593A1 (en) 2020-07-08 2022-01-12 Henkel AG & Co. KGaA Cleaning compositions and uses thereof
WO2022008732A1 (en) 2020-07-10 2022-01-13 Basf Se Enhancing the activity of antimicrobial preservatives
WO2022023250A1 (en) 2020-07-27 2022-02-03 Unilever Ip Holdings B.V. Use of an enzyme and surfactant for inhibiting microorganisms
WO2022043321A2 (en) 2020-08-25 2022-03-03 Novozymes A/S Variants of a family 44 xyloglucanase
WO2022047149A1 (en) 2020-08-27 2022-03-03 Danisco Us Inc Enzymes and enzyme compositions for cleaning
WO2022043547A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Protease variants with improved solubility
WO2022043563A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Polyester degrading protease variants
WO2022058322A1 (en) 2020-09-15 2022-03-24 Novozymes A/S Animal feed comprising insects or insect meal
WO2022063699A1 (en) 2020-09-22 2022-03-31 Basf Se Improved combination of protease and protease inhibitor with secondary enzyme
WO2022063698A1 (en) 2020-09-22 2022-03-31 Basf Se Liquid composition comprising peptide aldehyde
WO2022074037A2 (en) 2020-10-07 2022-04-14 Novozymes A/S Alpha-amylase variants
WO2022084303A2 (en) 2020-10-20 2022-04-28 Novozymes A/S Use of polypeptides having dnase activity
WO2022093189A1 (en) 2020-10-27 2022-05-05 Milliken & Company Compositions comprising leuco compounds and colorants
WO2022090320A1 (en) 2020-10-28 2022-05-05 Novozymes A/S Use of lipoxygenase
WO2022090361A2 (en) 2020-10-29 2022-05-05 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2022103725A1 (en) 2020-11-13 2022-05-19 Novozymes A/S Detergent composition comprising a lipase
WO2022106400A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of immunochemically different proteases
WO2022106404A1 (en) 2020-11-18 2022-05-27 Novozymes A/S Combination of proteases
EP4006131A1 (en) 2020-11-30 2022-06-01 The Procter & Gamble Company Method of laundering fabric
EP4015629A1 (en) 2020-12-18 2022-06-22 Basf Se Polymer mixtures for increasing stability and performance of hydrolase-containing detergents
EP4032966A1 (en) 2021-01-22 2022-07-27 Novozymes A/S Liquid enzyme composition with sulfite scavenger
WO2022157311A1 (en) 2021-01-22 2022-07-28 Novozymes A/S Liquid enzyme composition with sulfite scavenger
WO2022162043A1 (en) 2021-01-28 2022-08-04 Novozymes A/S Lipase with low malodor generation
WO2022165107A1 (en) 2021-01-29 2022-08-04 Danisco Us Inc Compositions for cleaning and methods related thereto
WO2022167251A1 (en) 2021-02-04 2022-08-11 Henkel Ag & Co. Kgaa Detergent composition comprising xanthan lyase and endoglucanase variants with improved stability
EP4039806A1 (en) 2021-02-04 2022-08-10 Henkel AG & Co. KGaA Detergent composition comprising xanthan lyase and endoglucanase variants with im-proved stability
WO2022171872A1 (en) 2021-02-12 2022-08-18 Novozymes A/S Stabilized biological detergents
WO2022171780A2 (en) 2021-02-12 2022-08-18 Novozymes A/S Alpha-amylase variants
EP4047088A1 (en) 2021-02-22 2022-08-24 Basf Se Amylase variants
WO2022178432A1 (en) 2021-02-22 2022-08-25 Danisco Us Inc. Methods and compositions for producing proteins of interest in pigment deficient bacillus cells
WO2022175435A1 (en) 2021-02-22 2022-08-25 Basf Se Amylase variants
WO2022189521A1 (en) 2021-03-12 2022-09-15 Novozymes A/S Polypeptide variants
WO2022194673A1 (en) 2021-03-15 2022-09-22 Novozymes A/S Dnase variants
WO2022197634A1 (en) 2021-03-15 2022-09-22 Gen-Probe Incorporated Compositions and methods for biological sample processing
WO2022194668A1 (en) 2021-03-15 2022-09-22 Novozymes A/S Polypeptide variants
EP4060036A1 (en) 2021-03-15 2022-09-21 Novozymes A/S Polypeptide variants
WO2022199418A1 (en) 2021-03-26 2022-09-29 Novozymes A/S Detergent composition with reduced polymer content
WO2022236297A1 (en) 2021-05-06 2022-11-10 The Procter & Gamble Company Surface treatment
EP4086330A1 (en) 2021-05-06 2022-11-09 The Procter & Gamble Company Surface treatment
WO2022268885A1 (en) 2021-06-23 2022-12-29 Novozymes A/S Alpha-amylase polypeptides
WO2023278297A1 (en) 2021-06-30 2023-01-05 Danisco Us Inc Variant lipases and uses thereof
EP4123006A1 (en) 2021-07-19 2023-01-25 The Procter & Gamble Company Composition comprising spores and pro-perfume materials
WO2023003633A1 (en) 2021-07-19 2023-01-26 The Procter & Gamble Company Fabric treatment using bacterial spores
EP4123007A1 (en) 2021-07-19 2023-01-25 The Procter & Gamble Company Fabric treatment using bacterial spores
WO2023004215A1 (en) 2021-07-19 2023-01-26 The Procter & Gamble Company Composition comprising spores and pro-perfume materials
WO2023023644A1 (en) 2021-08-20 2023-02-23 Danisco Us Inc. Polynucleotides encoding novel nucleases, compositions thereof and methods thereof for eliminating dna from protein preparations
WO2023034486A2 (en) 2021-09-03 2023-03-09 Danisco Us Inc. Laundry compositions for cleaning
WO2023039270A2 (en) 2021-09-13 2023-03-16 Danisco Us Inc. Bioactive-containing granules
WO2023114939A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114936A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114988A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2023116569A1 (en) 2021-12-21 2023-06-29 Novozymes A/S Composition comprising a lipase and a booster
WO2023118015A1 (en) 2021-12-21 2023-06-29 Basf Se Environmental attributes for care composition ingredients
WO2023126254A1 (en) 2021-12-30 2023-07-06 Novozymes A/S Protein particles with improved whiteness
EP4206309A1 (en) 2021-12-30 2023-07-05 Novozymes A/S Protein particles with improved whiteness
EP4234664A1 (en) 2022-02-24 2023-08-30 Evonik Operations GmbH Composition comprising glucolipids and enzymes
WO2023165507A1 (en) 2022-03-02 2023-09-07 Novozymes A/S Use of xyloglucanase for improvement of sustainability of detergents
WO2023165950A1 (en) 2022-03-04 2023-09-07 Novozymes A/S Dnase variants and compositions
WO2023187044A1 (en) 2022-03-30 2023-10-05 Basf Se Process for the production of a surfactant
WO2023187051A1 (en) 2022-03-30 2023-10-05 Basf Se Process for the production of a tertiary amine surfactant
WO2023194204A1 (en) 2022-04-08 2023-10-12 Novozymes A/S Hexosaminidase variants and compositions
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
WO2023224754A1 (en) 2022-05-19 2023-11-23 The Procter & Gamble Company Laundry composition comprising spores
EP4279571A1 (en) 2022-05-19 2023-11-22 The Procter & Gamble Company Laundry composition comprising spores
WO2023233028A1 (en) 2022-06-03 2023-12-07 Unilever Ip Holdings B.V. Laundry detergent product
WO2023250301A1 (en) 2022-06-21 2023-12-28 Danisco Us Inc. Methods and compositions for cleaning comprising a polypeptide having thermolysin activity
WO2023247348A1 (en) 2022-06-21 2023-12-28 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2023247664A2 (en) 2022-06-24 2023-12-28 Novozymes A/S Lipase variants and compositions comprising such lipase variants
WO2024012894A1 (en) 2022-07-15 2024-01-18 Basf Se Alkanolamine formates for enzyme stabilization in liquid formulations
WO2024036126A1 (en) 2022-08-08 2024-02-15 The Procter & Gamble Company A fabric and home care composition comprising surfactant and a polyester
EP4321604A1 (en) 2022-08-08 2024-02-14 The Procter & Gamble Company A fabric and home care composition comprising surfactant and a polyester
WO2024033135A2 (en) 2022-08-11 2024-02-15 Basf Se Amylase variants
WO2024033136A1 (en) 2022-08-11 2024-02-15 Basf Se Amylase variants

Also Published As

Publication number Publication date
FI20080005A (en) 2008-01-07
AU6239294A (en) 1994-08-29
DE69415659T3 (en) 2010-05-12
EP0689589A1 (en) 1996-01-03
KR960701197A (en) 1996-02-24
CN1118172A (en) 1996-03-06
CA2155831A1 (en) 1994-08-18
EP0867504A1 (en) 1998-09-30
US5824532A (en) 1998-10-20
NO953147D0 (en) 1995-08-10
EP0867504B1 (en) 2003-05-02
ES2198617T5 (en) 2011-11-03
DE69432610T2 (en) 2004-04-01
ES2126743T5 (en) 2010-02-05
ATE239075T1 (en) 2003-05-15
DE69415659T2 (en) 1999-06-17
BR9405720A (en) 1995-11-28
HUT72920A (en) 1996-06-28
DK0867504T4 (en) 2011-08-29
PT867504E (en) 2003-08-29
US6297037B1 (en) 2001-10-02
FI953797A0 (en) 1995-08-10
FI953797A (en) 1995-08-10
NO953147L (en) 1995-09-28
NO307187B1 (en) 2000-02-21
CA2155831C (en) 2009-11-10
AU682863C (en) 2003-05-08
ES2126743T3 (en) 1999-04-01
HU9502364D0 (en) 1995-10-30
DK0867504T3 (en) 2003-08-25
ES2198617T3 (en) 2004-02-01
JPH08506491A (en) 1996-07-16
PL310326A1 (en) 1995-12-11
KR100322793B1 (en) 2002-06-20
CZ205795A3 (en) 1995-12-13
AU682863B2 (en) 1997-10-23
US5849549A (en) 1998-12-15
DK0689589T3 (en) 1999-08-30
EP0689589B1 (en) 1998-12-30
DE69432610T3 (en) 2012-04-12
HU219675B (en) 2001-06-28
DE69415659D1 (en) 1999-02-11
FI119694B (en) 2009-02-13
CN1104499C (en) 2003-04-02
ATE175235T1 (en) 1999-01-15
FI122574B (en) 2012-03-30
CZ293163B6 (en) 2004-02-18
EP0689589B2 (en) 2009-09-02
EP0867504B2 (en) 2011-05-18
DE69432610D1 (en) 2003-06-05
NZ262623A (en) 1998-03-25
DK0689589T4 (en) 2010-01-04

Similar Documents

Publication Publication Date Title
AU682863C (en) Oxidatively stable alpha-amylase
AU718509B2 (en) An improved laundry detergent composition comprising amylase
AU686007B2 (en) An improved cleaning composition
CA2295693C (en) Mutant .alpha.-amylase having introduced therein a disulfide bond
US6080568A (en) Mutant α-amylase comprising modification at residues corresponding to A210, H405 and/or T412 in Bacillus licheniformis
MXPA97009472A (en) Alfa amilasa muta
MXPA99003634A (en) MUTANT&amp;agr;-AMYLASE COMPRISING MODIFICATION AT RESIDUES CORRESPONDING TO A210, H405 AND/OR T412 IN BACILLUS LICHENIFORMIS

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 94191138.1

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB HU JP KP KR KZ LK LU LV MG MN MW NL NO NZ PL PT RO RU SD SE SK UA UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1994909609

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: PV1995-2057

Country of ref document: CZ

Ref document number: 2155831

Country of ref document: CA

Ref document number: 953797

Country of ref document: FI

Ref document number: 262623

Country of ref document: NZ

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: PV1995-2057

Country of ref document: CZ

WWP Wipo information: published in national office

Ref document number: 1994909609

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1994909609

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: PV1995-2057

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 20080005

Country of ref document: FI