Búsqueda Imágenes Maps Play YouTube Noticias Gmail Drive Más »
Iniciar sesión
Usuarios de lectores de pantalla: deben hacer clic en este enlace para utilizar el modo de accesibilidad. Este modo tiene las mismas funciones esenciales pero funciona mejor con el lector.

Patentes

  1. Búsqueda avanzada de patentes
Número de publicaciónWO1994024269 A1
Tipo de publicaciónSolicitud
Número de solicitudPCT/DK1994/000146
Fecha de publicación27 Oct 1994
Fecha de presentación11 Abr 1994
Fecha de prioridad16 Abr 1993
Número de publicaciónPCT/1994/146, PCT/DK/1994/000146, PCT/DK/1994/00146, PCT/DK/94/000146, PCT/DK/94/00146, PCT/DK1994/000146, PCT/DK1994/00146, PCT/DK1994000146, PCT/DK199400146, PCT/DK94/000146, PCT/DK94/00146, PCT/DK94000146, PCT/DK9400146, WO 1994/024269 A1, WO 1994024269 A1, WO 1994024269A1, WO 9424269 A1, WO 9424269A1, WO-A1-1994024269, WO-A1-9424269, WO1994/024269A1, WO1994024269 A1, WO1994024269A1, WO9424269 A1, WO9424269A1
InventoresAllan Ertmann Karlsen
SolicitanteNovo Nordisk A/S
Exportar citaBiBTeX, EndNote, RefMan
Enlaces externos:  Patentscope, Espacenet
A dna sequence encoding nitric oxide synthase
WO 1994024269 A1
Resumen
A DNA sequence encoding a pancreatic islet cell inducible nitric oxide synthase (iNOS) is used to prepare recombinant pancreatic islet iNOS. The iNOS may be used in an assay of identifying inhibitors of pancreatic iNOS in the presence of a substrate.
Reclamaciones  (El texto procesado por OCR puede contener errores)
1. A DNA construct comprising a DNA sequence encoding a pancreatic islet cell inducible nitric oxide synthase (iNOS).
2. A DNA construct according to claim 1, wherein the DNA sequence is of mammalian origin.
3. A DNA construct according to claim 2, wherein the DNA sequence is of rodent origin.
4. A DNA construct according to claim 3, wherein the DNA sequence is of rat or mouse origin.
5. A DNA construct according to claim 2, wherein the DNA sequence is of human origin.
6. A DNA construct according to any of claims 1-5, which comprises the following partial DNA sequence
TTTCCAAGCT TGCCGCCACC ATGGCTTGCC CTGGAAGTTT CTCTTCAGAG TCAAATCCTA CCAAGGTGAC CTGAAAGAGG AAAAGGACAT TAACAACAAC
GTGGAGAAAA CCCCAGGTGC TATTCCCAGC CCAACAACAC AGGATGACCC
TAAGAGTCAC AAGCATCAAA ATGGTTTCCC CCAGTTCTCA CTGGGACTGC
ACAGAATGTC CAGAGATCCC TGGACAAGTC TGCATGTGAC TCCATCGACC
CGCCCACAGC ACGTGAGGAT CAAAAACTGG GGCAATGGAG AGATTTTTCA CGACACCCTT CACCACAAGG CCACCTCGGA TATCTCTTGC AAGTCCAAAT
TATGCATGGG GTGCATCATG AACTCCAAGA GTTTGACCAG AGGACCCAGA
GACAAGCCCA CCCCAGTGAG GAGCTTCTGT GCCTCAAGCC AATTGAATTC
ATTAACCAGT ATTATGGCTC CTTCAAAGAG GCAAAAATAG AGGAACATCT
GGCCAGGCTG GAAGCCCGTA ACAAAGGAAA TAGAAACAAC AGGAACCTAC CAGCTCACTC TGGATGAGCT CATCTTTGCC ACCAAGATGG CCTGGAGGAA
actGCCCCTC GCTGCATCGG CAGGATTCAG TGGTCCAACC TGCAGGTCTT
CGATGCCCGG AGCTGTAGCA CTGCATCAGA AATGTTCCAG CATATCTGCA
GACACATACT TTACCGACTA ACAGTGGCAA CATCAGGTCG GCCATTACTG
TGTTCCCCCA GCGGAGCGAT GGGAAGCATG ACTTCCGGAT CTGGAATTCC CAGCTCATCC GGTACGCTGG CTACCAGATG CCCGATGGCA CCATCAGAGG
GGATCCTGCC ACCTTGGAGT TCACCCAGTT GTGCATCGAC CTGCTGGAAG CCCCGCTACG GCCGCTTCGA TGTGCTGCCT CTGGTCCTGC AGGCTCACGG TCAAGATCCA GAGGTCTTTG AAATCCCTCC TGATCTTGTG CTGGAGGTGA CCATGGAGCA CCCAAAGTAC GAATGGTTCC AAA (SEQ ID NO:1) or a homologue thereof encoding a protein with iNOS activity.
7. A DNA construct according to any of claims 1-5, which comprises the DNA sequence shown in the Sequence Listing as SEQ ID NO: 6, or a suitable modification thereof.
8. A DNA construct according to any of claims 1-5, which comprises either or both of the DNA sequences shown in the Sequence Listing as SEQ ID NO: 9 and SEQ ID NO: 10, or a suitable modification thereof.
9. A recombinant expression vector comprising a DNA construct according to any of claims 1-8.
10. A cell comprising a DNA construct according to any of claims 1-8 or a vector according to claim 9.
11. A cell according to claim 10, which is a eukaryotic cell.
12. A method of producing a pancreatic islet cell inducible nitric oxide synthase, the method comprising culturing a cell according to claim 10 or 11 under conditions permitting the production of the iNOS and recovering the resulting iNOS from the culture.
13. A method of isolating inhibitors of pancreatic islet cell inducible nitric oxide synthase, the method comprising incubating iNOS encoded by the DNA sequence according to any of claims 1-8 with a substance suspected of being an iNOS inhibitor in the presence of a suitable substrate for iNOS, and detecting any effect of said substance on the interaction of the iNOS with said substrate.
14. A method according to claim 13, wherein the substrate is L- arginine.
515. A method according to claim 14, wherein the formation of citrulline resulting from said incubation is determined, decreased citrulline formation indicating that said substance is an iNOS inhibitor.
16. A method according to claim 13, wherein the formation of 10 nitric oxide (NO) resulting from said incubation is determined, decreased NO formation indicating that said substance is an iNOS inhibitor.
17. A method according to claim 16, wherein an indicator of the presence of nitric oxide is added.
1518. A method according to claim 17, wherein the indicator is guanylate cyclase, and wherein the amount of cyclic GMP formed from GTP is indicative of the presence of NO.
19. A test kit for isolating inhibitors of pancreatic islet cell inducible nitric oxide synthase, the kit comprising in
20 separate containers
(a) iNOS encoded by the DNA sequence according to any of claims 1-8, and
(b) a suitable substrate therefor.
20. A test kit according to claim 19, wherein the substrate is 25 L-arginine.
21. A test kit according to claim 19, which further comprises, in a separate container, an indicator of the presence of nitric oxide.
22. A test kit according to claim 21, which comprises, in separate containers, GTP and guanylate cyclase.
Descripción  (El texto procesado por OCR puede contener errores)

A DNA SEQUENCE ENCODING NITRIC OXIDE SYNTHASE

FIELD OF INVENTION

The present invention relates to a DNA construct comprising a DNA sequence encoding a nitric oxide synthase, a method of producing the nitric oxide synthase, a method of using the nitric oxide synthase to screen for inhibitors of nitric oxide synthase, and a test kit for use in the method.

BACKGROUND OF THE INVENTION

Insulin dependent diabetes mellitus (IDDM) is caused by immune-mediated destruction of β-cells in the islets of Langerhans. Morphological studies of islets at the time of diagnosis reveal infiltration by chronic inflammatory cells (W. Gepts, Diabetes 14, 1965, pp. 619-633) and β-cell destruction (insulitis). Chronic inflammatory cells and endothelial cells are the major producers of cytokines. The cytokines interleukin-1 (IL-1) a and β affect β-cell function and morphology in rat islets in organ culture in a time and dose dependent manner, stimulation being followed by inhibition of insulin release (T. Mandrup-Poulsen et al., Diabetologica 29, 1986, pp. 63-67; G.A. Spinas et al., Acta Endocrinol. (Copenhagen) 113, 1986, pp. 551-558; W.S. Zawalich and V.A. Diaz, Diabetes 35, 1986, pp. 1119-1123; P.G. Comens et al., Diabetes 36, 1987, pp. 963-970; S. Sandier et al., Endocrinology 121, 1987, pp. 1424-1431) with associated loss of islet DNA and selective β-cell cytotoxicity (T. Mandrup-Poulsen et al., Acta Path. Microbiol. Immunol. Scand. 95, 1987, pp. 55-63; S. Sandier et al., Endocrinology 124, 1989, pp. 1492-1501; D.L. Eizirik et al., Endocrinology 128, 1991, pp. 1611-1616; S. Helquist et al., Autoimmunity 10, 1991, pp. 311-318). IL-1β acts on β-cells via IL-1 receptors, but the signal transduction mechanism is unknown. Important post-receptor events associated with the inhibitory action of IL-1/3 on β-cells include a rapid increase in cytosolic Na+, protease activation, de novo protein synthesis, impaired mithochondrial glucose oxidation and the induction of intracellular free oxygen and nitric oxide radicals (T. Mandrup-Poulsen et al.,

Autoimmunity 4, 1989, pp. 191-218; C. Southern et al., FEBS Lett. 276, 1990, pp. 42-44). Nitric oxide (NO) is synthesized by the enzyme nitric oxide synthase (NOS) which converts L-arginine to citrulline and NO. Initial chracterization of NO synthases from different cell types suggests that two distinct forms exist: a constitutively expressed Ca2+/calmodulin-dependent form and a cytokine-inducible, calmodulin-independent form. Constitutive production of nanomolar amounts of NO by endothelial cells appears to be vital to the regulation of homeostasis. Additionally, constitutive production of NO is critical for signal transduction in the central nervous system. The inducible form of NOS (iNOS) found in macrophages, monocytes, liver etc., produces micromolar amounts of NO which are likely to contribute to local tissue damage and systemic hypertension which accompanies septic shock as well as other inflammatory disorders. These two forms exhibit differences in regulation of expression, cofactor dependence, tissue distribution and subcellular localization.

More specifically, synthesis of NO has been found to be induced by IL-1 in islet β-cells purified by fluorescence activated cell sorting, but not in non-β-cells (J.A. Corbett et al., J. Clin. Invest. 90, 1992, pp. 2384-2391), probably by activation of the cytokine-inducible form of NO synthase. NO is toxic to the β-cell either in itself or through the hydroxyl radical from peroxynitrite formed by reaction with O2.

Recent data suggest that the constitutive and inducible forms of NOS exist in a number of isoforms. Furthermore, studies indicate that NO production by macrophages and endothelial cells may also be distinguished on the basis of the specificity of the arginine binding site for different inhibitors. The combination of enzyme diversity and substrate specificity suggests the possibility of developing specific inhibitors of NOS for therapeutic purposes.

SUMMARY OF THE INVENTION

The observation that pancreatic islet cells can be induced by cytokines to produce nitric oxide synthase suggest that a specific form of nitric oxide synthase involved in β-cell destruction is found in islets. The inhibition of this nitric oxide synthase may therefore be desirable to prevent or at least delay the onset of IDDM. It is the object of the present invention to prepare a pancreatic islet cell cytokine inducible nitric oxide synthase to be used in the screening for substances which act as inhibitors of the nitric oxide synthase.

The present invention relates to a DNA construct comprising a DNA sequence encoding a pancreatic islet cell inducible nitric oxide synthase (iNOS).

In another aspect, the present invention relates to a method of isolating inhibitors of pancreatic islet cell inducible nitric oxide synthase, the method comprising incubating the iNOS encoded by said DNA sequence with a substance suspected of being an iNOS inhibitor in the presence of a suitable substrate for iNOS, and detecting any effect of said substance on the interaction of the iNOS with said substrate.

In the present context, the term "inhibitor" is intended to indicate a substance which inhibits the catalytic activity of the enzyme to convert L-arginine to citrulline and nitric oxide. It is the object of the present invention to isolate an inhibitor which is capable of specifically inhibiting the iNOS produced by pancreatic islets so that on administration, it will not interfere with the various essential functions of NO synthase elsewhere in the body. In a further aspect, the present invention relates to a test kit for isolating inhibitors of pancreatic islet cell inducible nitric oxide synthase, the kit comprising in separate containers (a) iNOS encoded by the DNA sequence according to any of claims 1-6, and

(b) a suitable substrate therefor.

DETAILED DESCRIPTION OF THE INVENTION

The DNA construct of the invention encoding the iNOS may suitably be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the iNOS by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989). For the present purpose, the DNA sequence encoding the iNOS is preferably of mammalian origin, i.e. derived from a mammalian pancreatic islet genomic DNA or cDNA library. In particular, the DNA sequence may be of rodent origin, e.g. rat or mouse origin, or of human origin.

The DNA construct of the invention encoding the iNOS may also be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 - 1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.

Finally, the DNA construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire DNA construct, in accordance with standard techniques. The DNA construct may also be prepared by polymerase chain reaction using specific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491.

In a currently preferred embodiment, the DNA construct of the invention comprises the following partial DNA sequence

TTTCCAAGCT TGCCGCCACC ATGGCTTGCC CTGGAAGTTT CTCTTCAGAG TCAAATCCTA CCAAGGTGAC CTGAAAGAGG AAAAGGACAT TAACAACAAC

GTGGAGAAAA CCCCAGGTGC TATTCCCAGC CCAACAACAC AGGATGACCC

TAAGAGTCAC AAGCATCAAA ATGGTTTCCC CCAGTTCTCA CTGGGACTGC

ACAGAATGTC CAGAGATCCC TGGACAAGTC TGCATGTGAC TCCATCGACC

CGCCCACAGC ACGTGAGGAT CAAAAACTGG GGCAATGGAG AGATTTTTCA CGACACCCTT CACCACAAGG CCACCTCGGA TATCTCTTGC AAGTCCAAAT

TATGCATGGG GTGCATCATG AACTCCAAGA GTTTGACCAG AGGACCCAGA

GACAAGCCCA CCCCAGTGAG GAGCTTCTGT GCCTCAAGCC AATTGAATTC

ATTAACCAGT ATTATGGCTC CTTCAAAGAG GCAAAAATAG AGGAACATCT

GGCCAGGCTG GAAGCCCGTA ACAAAGGAAA TAGAAACAAC AGGAACCTAC CAGCTCACTC TGGATGAGCT CATCTTTGCC ACCAAGATGG CCTGGAGGAA

actGCCCCTC GCTGCATCGG CAGGATTCAG TGGTCCAACC TGCAGGTCTT

CGATGCCCGG AGCTGTAGCA CTGCATCAGA AATGTTCCAG CATATCTGCA

GACACATACT TTACCGACTA ACAGTGGCAA CATCAGGTCG GCCATTACTG

TGTTCCCCCA GCGGAGCGAT GGGAAGCATG ACTTCCGGAT CTGGAATTCC CAGCTCATCC GGTACGCTGG CTACCAGATG CCCGATGGCA CCATCAGAGG

GGATCCTGCC ACCTTGGAGT TCACCCAGTT GTGCATCGAC CTGCTGGAAG

CCCCGCTACG GCCGCTTCGA TGTGCTGCCT CTGGTCCTGC AGGCTCACGG

TCAAGATCCA GAGGTCTTTG AAATCCCTCC TGATCTTGTG CTGGAGGTGA

CCATGGAGCA CCCAAAGTAC GAATGGTTCC AAA (SEQ ID NO:1) or a homologue thereof encoding a protein with iNOS activity.

The partial DNA sequence shown above has been isolated from a rat islet cDNA library as described below. The sequence has been found to be significantly homologous to the previously published (C.R. Lyons et al., J. Biol. Chem. 267, 1992, pp. 6370-6374) mouse macrophage sequence (cf. Fig. 1A and 1B). However, the gene encoding mouse macrophage iNOS is inducible by lipopolysaccharide and interferon-γ, whereas the iNOS produced in pancreatic islets is inducible by interleukin-1 (IL-1) (rat) or a mixture of IL-1, tumour necrosis factor α (TNF-α) and interferon-γ (IFN-γ) (human), indicating that significant differences may exist between the mouse macrophage iNOS and the rat islet iNOS. In the present context, the term "homologue" is intended to indicate a natural variant of the DNA sequence encoding rat islet iNOS, such as a variant produced in pancreatic islets of another species, in particular in human pancreatic islets, or a variant produced by modification of the DNA sequence shown above. Examples of suitable modifications of the DNA sequence are nucleotide substitutions which do not give rise to another amino acid sequence of the iNOS but which may correspond to the codon usage of the host organism into which the DNA construct is introduced or nucleotide substitutions which do give rise to a different amino acid sequence and therefore, possibly, a different protein structure. Other examples of possible modifications are insertion of one or several nucleotides into the sequence, addition of one or several nucleotides at either end of the sequence, or deletion of one or several nucleotides at either end or within the sequence. However, any protein produced from such a homologous DNA sequence should exhibit an iNOS activity (e.g. with respect to substrate specificity) similar to that of the native iNOS.

In a particularly preferred embodiment, the invention relates to the full-length rat islet iNOS shown in the Sequence Listing as SEQ ID NO: 6, or a suitable modification thereof, as defined above.

In another preferred embodiment, the present invention relates to a DNA sequence encoding human islet iNOS, comprising the partial DNA sequences shown in the Sequence Listing as SEQ ID NO: 9 and SEQ ID NO: 10, or a suitable modification thereof, as defined above.

In a further aspect, the present invention relates to a recombinant expression vector comprising a DNA construct of the invention. The recombinant expression vector into which the DNA construct of the invention is inserted may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome (s) into which it has been integrated.

In the vector, the DNA sequence encoding the iNOS should be operably connected to a suitable promoter sequence. The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of the DNA encoding the iNOS in mammalian cells are the SV40 promoter (Subramani et al., Mol. Cell Biol. 1 (1981), 854 -864), the MT-1 (metallothionein gene) promoter (Palmiter et al . , Science 222 ( 1983 ) , 809 - 814 ) or the adeno-virus 2 major late promoter. A suitable promoter for use in insect cells is the polyhedrin promoter (Vasuvedan et al., FEBS Lett. 311, (1992) 7 - 11) . Suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073 - 12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652 - 654) promoters. Suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter

(McKnight et al., The EMBO J. 4 (1985), 2093 - 2099) or the tpiA promoter.

The DNA sequence encoding the iNOS may also be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., op. cit.) or (for fungal hosts) the TPI1 (Alber and Kawasaki, op. cit.) or ADH3 (McKnight et al., op. cit.) terminators. The vector may further comprise elements such as polyadenylation signals (e.g. from SV40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV40 enhancer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs). The recombinant expression vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. An example of such a sequence (when the host cell is a mammalian cell) is the SV40 origin of replication. The vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or one which confers resistance to a drug, e.g. neomycin, hygromycin or methotrexate.

The procedures used to ligate the DNA sequences coding for the iNOS, the promoter and the terminator, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., op. cit.).

The host cell into which the expression vector of the invention is introduced may be any cell which is capable of producing the iNOS and is preferably a eukaryotic cell, such as invertebrate (insect) cells or vertebrate cells, e.g. Xenopus laevis oocytes or mammalian cells, in particular insect and mammalian cells. Examples of suitable mammalian cell lines are the COS (ATCC CRL 1650), BHK (ATCC CRL 1632, ATCC CCL 10), CHL (ATCC CCL39) or CHO (ATCC CCL 61) cell lines. Methods of transfecting mammalian cells and expressing DNA sequences introduced in the cells are described in e.g. Kaufman and Sharp, J. Mol. Biol. 159 (1982), 601 - 621; Southern and Berg, J. Mol. Appl. Genet. 1 (1982), 327 - 341; Loyter et al., Proc. Natl. Acad. Sci. USA 79 (1982), 422 - 426; Wigler et al., Cell 14 (1978), 725; Corsaro and Pearson, Somatic Cell Genetics 7 (1981), 603, Graham and van der Eb, Virology 52 (1973), 456; and Neumann et al., EMBO J. 1 (1982), 841 - 845.

Alternatively, fungal cells (including yeast cells) may be used as host cells of the invention. Examples of suitable yeasts cells include cells of Saccharomyces spp. or Schizo-saccharomyces spp., in particular strains of Saccharomyces cerevisiae. Examples of other fungal cells are cells of filamentous fungi, e.g. Aspergillus spp. or Neurospora spp., in particular strains of Aspergillus oryzae or Aspergillus niger. The use of Aspergillus spp. for the expression of proteins is described in, e.g., EP 272 277.

The iNOS may then be produced by a method which comprises culturing a cell as described above in a suitable nutrient medium under conditions which are conducive to the expression of the iNOS and recovering the resulting iNOS from the culture. The medium used to culture the cells may be any conventional medium suitable for growing mammalian cells, such as a serum-containing or serum-free medium containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection). The iNOS produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, affinity chromatography, or the like. In the method of the invention of isolating inhibitors of iNOS, the preferred substrate is L-arginine, though other substrates for the enzyme may also be used. Using L-arginine as the substrate is preferred because it is attempted to achieve the closest possible approximation to the native system. When using L-arginine as the substrate, the inhibitory activity of a suspected iNOS inhibitor may be determined by measuring the amount of L-arginine or citrulline after incubation, compared to a control which does not contain any suspected iNOS inhibitor. A substatially unchanged amount of L-arginine in the incubation mixture is indicative of the presence of an inhibitor, as is a decreased amount or absence of citrulline.

Alternatively, the formation of nitric oxide (NO) resulting from the incubation may be determined, decreased NO formation indicating the presence of an iNOS inhibitor. In a preferred embodiment, the formation of NO may be measured indirectly by adding an indicator. Such an indicator may, for instance, be guanylate cyclase which is strongly activated by NO to produce cyclic GMP from GTP. In this system, the formation of NO is determined by measuring the amount of cyclic GMP formed on incubation (formation of cyclic GMP may for instance be measured as described in J.A. Corbett et al., Biochem. J. 287, 1992, pp. 229-235). NO formation may also be determined by measuring the amount of nitrite formed on incubation (NO is converted to nitrite in the presence of free oxygen) (e.g. as described by L.C. Green et al., Anal. Biochem. 126, 1982, pp. 131-138).

The present invention is further illustrated in the following Example which should not be regarded as limiting, in any way, the scope of the invention as claimed. EXAMPLE 1

Cloning of rat islet iNOS

Rat islets were isolated from newborn rats after collagenase digestion of rat pancreases (as described by J. Brunstedt et al., in Methods in Diabetes Research, vol. 1 (Laboratory Methods, Part C), J. Lamer and S.J. Pohl (eds.), Wiley & Sons, New York, 1984, pp. 254-288). After isolation, the islets were precultured for 3-7 days in RPMI 1640 + 10% fetal calf serum at 37°C. The islets were then incubated with 150 U/ml recombinant IL-1 β (prepared by Novo Nordisk A/S) for 48 hours in a medium containing 150 islets/300 μl of RPMI 1640 + 0.5% normal human serum. Control islets were cultured similarly in a medium which did not contain any IL-1. The culture media were collected and analysed for nitrite production by mixing 150 ml of medium with an equal volume of Griess reagent (1 part of 0.1% naphthylethylene diamine dihydrochloride, 1 part of 1% sulfanilamide in 5% H3PO4) and incubated for 10 minutes at room temperature (L.C. Green et al., Anal. Biochem. 126, 1982, pp. 131-138). The absorbance at 550 nm was determined on an immuno reader (NIPPON InterMed KK, Tokyo, Japan) against a sodium nitrite standard curve.

The islet were harvested, and total RNA from IL-1 induced and non-induced islets was prepared by CsCl gradient centrifugation (as described by J.M. Chrigwin et al., Biochemistry 18, 1979, 5294-5299). 3 μg of the isolated RNA was subjected to RT-PCR in accordance with the manufacturer's instructions (RT-PCR kit available from Invitrogen, San Diego, CA). Briefly, the RNA was reverse transcribed and the resulting single-stranded DNA was used directly for the PCR reaction. In the PCR reaction, the following oligonucleotides based on the previously published mouse macrophage iNOS sequence (Lyons et al., supra, were used as primers #290: 5'-TCC AAG CTT GCC GCC ACC ATG GCT TGC CCC TGG-3'

(SEQ ID NO:2)

#294: 5'-TG (GA)AA CCA (CT)TC (GA)TA (CT)TT (AGCT)GG (GA)TG

(CT)TC CAT-3' A standard PCR reaction was run, and a 1 kb fragment was detected in the PCR reaction based on RNA from IL-1 induced islets, whereas no such fragment appeared from the PCR reaction based on RNA from non-induced islets.

The amplified transcript was purified on a 1% agarose gel and subsequently cut out of the gel and purified by centrifugation through a filter. The purified transcript was then re-amplified with the same primers to obtain enough material for cloning. The DNA resulting from this re-amplification was then cloned into the TA vector (Invitrogen) in accordance with the manufacturer's instructions.

The resulting clones were sequenced by the method described by Tabor and Richardson, Proc. Natl. Acad. Sci. USA 84, 1987, pp. 4767-4771 by means of the Sequenase kit (available from US Biochemical Corp.). The resulting sequence showed a high degree of homology to the previously published mouse macrophage iNOS sequence (cf. Fig. 1A and IB, wherein RATBCL indicates the partial rat islet iNOS sequence of the invention, and MUSMAC indicates the corresponding mouse macrophage iNOS sequence).

EXAMPLE 2 cloning of full-length rat islet iNOS

Islets were isolated from 3-6 days old Wistar rats (Møllegaard, Lille Skensved, Denmark) following collagenase digestion of the pancreas as described by Brunstedt J, Nielsen JH, Lernmark A, and The Hagedorn Study Group (1984) Isolation of islets from mice and rats. In: Lamer J, Pohl SL, ed. Methods in diabetes research, (Laboratory methods, part C). New York: Wiley & Sons, 254-288. vol 1). Following isolation the islets were kept in culture for 3-7 days at 37° C in RPMI 1640 (Gibco, Paisley, Scotland) + 10% fetal calf serum (FCS) 100,000 IU/l penicillin, 100 mg/l streptomycin and 20 mM HEPES buffer. Exposure to cytokines for 20-48 hours was performed in the same buffer, however, with 0.5% normal human serum added in stead of FCS. Rat insulinoma (RIN-5AH-T 2B) cells (Karlsen AE, Fujimoto WY, Rabinovitch P, Dube S, Lemmark A (1991) Effects of sodium butyrate on proliferation-dependent insulin gene expression and insulin release in glucose-sensitive RIN-5AH cells. J. Biol. Chem. 266:7542-7548) and MSL cells (Madsen OD, Andersen LC, Michelsen B, Owerbach D, Larsson L-I, Lernmark A, Steiner DF (1988) Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat lines induced during passage in vivo. Proc. Natl. Acad. Sci. (USA). 85:6652-6656) were cultured as previously described and exposed to cytokines for different lengths of time (1 or 3 days) . Every day cells were collected for mRNA isolation, the proliferation rate determined by counting and media collected for insulin measurement. The cytokine used was human recombinant IL-1b with a specific activity of 400 U/ng (produced at Novo-Nordisk A/S, Bagsvaerd, Denmark ), TNFα obtained from Sigma and rat IFNγ is from Sigma. The IL-1 used for the RIN cell experiments was obtained from Immunex. Insulin accumulated in the culture media was measured by RIA as previously described (Karlsen, 1991, supra).

RNA was extracted from the islets and cells by a modification of the 8M guanidine method as previously described (Karlsen AE, Hagopian WA, Grubin CE, Dube S, Disteshe CM, Adler DA, Barmeier H, Mathewes S, Grant FJ, Foster D, Lernmark A (1991) Cloning and primary structure of a human islet isoform of glutamic acid decarboxylase from chromosome 10. Proc. Natl. Acad. Sci. USA. 88:8337-8341) and cDNA was prepared (Invitrogen) according the manufacturer's description using oligo-(dT) as primer. A partial (1 kb) rat islet cDNA was first cloned by standard RT-PCR using the primer 5'CCAAGCTTGCCGCCACCATGGCTTGCCCCTGG (SEQ ID NO: 3) in conjunction with degenerate primers 3'TG(GA)AACCA(CT)TC(GA)TA(CT)T(TG) (GT)GG(GA)TG(CT)TCCAT spanning the bases 256-1254 of the mouse macrophage iNOS cDNA (Xie Q, Cho HJ, Calaycay J, Mumford RA, Swiderek KM, Lee TD, Ding A, Troso T, Nathan C (1992) Cloning and characterization of inducible nitric oxide synthase from mouse macrophages. Science. 256:225-228). A cDNA clone (3.5 kb) spanning the entire coding region was later isolated using the primers 5'AGAAGCACAAAGTCACAGA (SEQ ID NO: 4) and 3'ACTTCTGTCTCTCCAAACCC (SEQ ID NO: 5) spanning the bases 1-3530 of the subsequently published rat smooth muscle iNOS cDNA sequence (Nunokawa Y, Ishida N, Tanaka S (1993) Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem. Biophys. Res. Com. 191(1):89-94). The RT-PCR fragments were ligated into the pCRII vector (Invitrogen) following separation by agarose electrophoresis. The product was transfected into E.coli (One-shot, Invitrogen). To diminish potential sequencing artefacts resulting from AmpliTaq-polymerase (Cetus, Perkin Elmer) misincoorporated nucleotides, the full length rat islet iNOS cDNA was also cloned and sequenced following pfu polymerase RT-PCR. Despite the exonuclease activity of this polymerase, the amplified products were also cloned into the pCRII vector, however with lower efficiency than following AmpliTaq PCR. The cloned cDNA were sequenced using the automatic laser fluorescence DNA sequencer (ALF ##) and the sequences were analyzed using the software package from the University of Wisconsin Genetic Computer Group (Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12:387-396). For expression of the cloned iNOS the coding region was subcloned into the Hindlll and Notl sites of the pcDNA3 vector (Invitrogen) and expressed under control of the CMV promoter in the human embryonic kidney cell line 293 (publicly available from the American Type Culture collection as ATCC CRL 1573) following standard calciumphosphate transfection. Expression of the iNOS enzyme and resulting NO production of the transfectants after 3 days of culture as well as from the cytokine exposed β-cell- and islet cultures were estimated from accumulated nitrite in the culture media as described by Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR (1982) Analysis of nitrate, nitritye and [12N]nitrtte in biological fluids. Anal. Biochem. 126:131-138. Analysis of iNOS mRNA expression in the rat insulinoma cells was done by Northern hybridization as previously described (Karlsen et al., 1991, supra) using the cloned iNOS cDNA as a probe. The same amount of mRNA (5 μg) was loaded to each lane and the integrity and amount was verified by ethidium bromide staining before blotting to nitrocellulose filter. iNOS mRNA expression in islets was determined by RT-PCR using the above described primers (and PCR cycle-conditions). The IL-1 induced iNOS mRNA expression was reflected by an induced NO production, measured as nitrite accumulation into the media (14.3 pmol/islet) in contrast to the non-exposed islets where no nitrite above the detection limit of 2 pmol/islet could be detected. Analysis of rat islet β-cell lines, the rat insulinoma (RIN) cells and an insulin producing pluripotent (MSL) cell-line revealed a similar induced NO production following exposure to IL-1 alone or in combination with other cytokines which could not be detected in the non-exposed cells. The full sequence of the cloned rat islet iNOS was found to be

1 AGAAGCACAA AGTCACAGAC ATGGCTTGCC CCTGGAAGTT TCTCTTCAGA 51 GTCAAATCCT ACCAAGGTGA CCTGAAAGAG GAAAAGGACA TTAACAACAA 101 CGTGGAGAAA ACCCCAGGTG CTATTCCCAG CCCAACAACA CAGGATGACC 151 CTAAGAGTCA CAAGCATCAA AATGGTTTCC CCCAGTTCCT CACTGGGACT 201 GCACAGAATG TTCCAGAATC CCTGGACAAG CTGCATGTGA CTCCATCGAC 251 CCGCCCACAG CACGTGAGGA TCAAAAACTG GGGCAATGGA GAGATTTTtC

301 ACGACACCCT TCACCACAAG GCCACCTCGG ATATCTCTTG CAAGTCCAAA 351 TTATGCATGG GGTCCATCAT GAACTCCAAG AGTTTGACCA GAGGACCCAG

401 AGACAAGCCC ACCCCAGTGG AGGAGCTTCT GCCTCAAGCC ATTGAATTCA 451 TTAACCAGTA TTATGGCTCC TTCAAAGAGG CAAAAATAGA GGAACATCTG

501 GCCAGGCTGG AAGCcGTAAC AAAGGAAATA GAAACAACAG GAACCTACCA

551 GCTCACTCTG GATGAGCTCA TCTTTGCCAC CAAGATGGCC TGGAGGAACG

601 CCCCTCGCTG CATCGGCAGG ATTCAGTGGT CCAACCTGCA GGTCTTCGAT 651 GCCCGGaGCT GTAGCACTGC ATCAGAAATG TTCCAGCATA TCTGCAGACA

701 CATACTTTAC GCCACTAACA GTGgcAACAT CAGGTCGGCC ATTACTGTGT

751 TCCCCCAGCG GAgcgATGGG AAGCATGACT TCCGGATCTG GAATTCCCAG

801 CTCATCCGGT ACGCTGGCTA CCAGATGCCC GATGGCACCA TCAGAGGgGA

851 TCCTGCCACC TTGGAGTTCA CCCAGTTGTG CATCGACCTG GGCTGGAAgc 901 CccGCTATGG CCGCTTCGAT GTGCTGCCTC TGGTCCTGCA GGCTCACGGT

951 CAAGATCCAG AGGTCTTTGA AATCCCTCCT GATCTTGTGC TGGAGGtGAC

1001 CATGGAGCAT CCCAAGTACG AGTGGTTCCA GGAGCTCGGG CTGAAGTGGT

1051 ATGCGCTGCC TGCCGTGGCC AACATGCTCC TGGAGGTGGG TGGCCTCGAG

1101 TTCCCAGCCT GCCCCTTCAA TGGTTGGTAC ATGGGCACCG AGATTGGAGT 1151 CCGAGACCTC TGTGACACAC AGCGCTACAA CATCCTGGAG GAAGTgGGcA

1201 GGAGGATGGG CCTGGAGACC CACACACTGG cCTCCctctg gAAAGACCGG

1251 GCTGTCACCG AGATCAATGC AGCTGTGCTC CATAGTTTTC AGAAGCAGAA

1301 TGTGACCATC ATGGACCACC ACACAGCCTC AGAGTCCTTC ATGAAGCACA

1351 TGCAGAATGA GTACCGgGCC CGAGGAGGCT GCCCTGCAGA CTGGATTTGG 1401 CTGGTCCCTC CGGTGTCCGG GAGCATCACC CCTGTGTTCC ACCAGGAGAT

1451 GTTGAACTAC GTCCTATCTC CATTCTACTA CTACCAGATC GAGCCCTGGA

1501 AGACCCACAT CTGGCAGGAT GAGAAGCTGA GGCCCAGGAG GAGAGAGATC

1551 CGGTTCACAG TCTTGGTGAA AGCGGTGTTC TTTGCTTCTG TGCTAATGCG

1601 GAAGGTCATG GCTTCCCGCG TCAGAGCCAC AGTCCTCTTT GCTACTGAGA 1651 CAGGAAAGTC GGAAGCGCTA gCCAGGGACC TGGCTgCCTT GTTCAGCTAC

1701 GCCTTCAACA CCAAGGTTGT CTGCATGGAA CAGTATAAGG CAAACACCTT

1751 GGAAGAGGAA CAACTACTGC TGGTGGtGAC AAGCACATTT GGCAATGGAG

1801 ACTGCCCCAG CAATGGGCAG ACTCTGAAGA AATCTCTGTT CATGATGAAA

1851 GAACTCGGGC ATACCTTCAG GTATCgGGTA TTTGGCCTGG GCTCCAGCAT 1901 GTACCCTCAG TTCTGTGCCT TTGCTCATGA CATCGACCAG AAACTGTCTC

1951 ACCTGGGaGC CTCCCAGCTT GcCCCAACCG GAGAAGGGGA CGAACTCAGC

2001 GGGCAGGAGG ACGCCTTCCG CAGCTGGGcT GTGCAAaCCT TCCGGGCAGC

2051 CTGTGAGACG TTCGAtgttc gaaGCAAACA TTGCATTCAG ATCCCGAAAC

2101 GCTACACTTC CAACGCAACA TGGGAGCCAG AGCAGTACaA GCTCaCCCAG 2151 AGCCCAGAGC CTCTAGACCT CAAcAAAGCT CTCAGCAGCA TCCACGCCAA

2201 GAACGTGTTC ACCATGAGGC TGAAATCCCT CCAGAATCTG CAGAGTGAGA

2251 AGTCCAGCCG CACCACCCTC CTTGTtcAAC TCACCTTCGA GGGCAGCCGA 2301 GGcCCCAGCT ACCTACCTGG GGaACaCCTG GGGATTTTCC CAGGCAACcA

2351 GACGGCCCTG GTGCAAGGGA TCTTggagcg aGTTGTGGAT TGTTCTTCGC

2401 CAGACCAAAC TGTGTGCCTG GAGGTTCTAG ATGAGAGTGG CAGCTACTGG

2451 GTCAAAGACA AGAGGCTTCC CCCCTGCTCA CTCAGGCAAG CCCTCACCTA 2501 CTTCCTGGAC ATCACTACCC CTCCCACCCA gCTGCAGCTC CACAAGCTGG

2551 CCCGCTTTGC CACGGAAGAG ACGCACAGGC AGAGGTTGGA GGCCTTGTGT

2601 CAGCCCTCAG AGTACAACGA TTGGAAGTTC AGCAACAACC CCACGTTCCT

2651 GGAGGTGCTG GAAGAGTTCC CATCATTGCG TGTGCCTGCT GCCTTCCTGC

2701 TGTCGCAGCT CCCCATTCTG AAGCCCCGCT ACTACTCCAT CAGCTCCTCC 2751 CAGGACCACA CCCCCTCGGA GGTCCACCTC ACTGTGGCTG TGGTCACCTA

2801 TCGCACCCGA GATGGTCAGG GTCCCCTGCA CCATGGCGTC TGCAGCACTT

2851 GGATCAATAA CCTGAAGCCC GAAGACCCAG TGCCCTGCTT TGTGCGGAGT

2901 GTCAGTGGCT TCCAGCTCCC TGAGGACCCC TCCCAGCCCT GCATCCTCAT

2951 TGGGCCCGGT ACAGGCATTG cCCCCTTCCG AAGTTTCTGG CAGCAGCGGC 3001 TCCATGACTC TCAGCGCAGA GGGCTCAAAG GAGGCCGCAT GACCTTGGTG

3051 TTTGGGTGCA GGCACCCAGA GGAGGACCAC CTCTATCAGG AAGAAATGCA

3101 GGAGATGGTC CGCAAGGGAG TGTTGTTCCA GGTGCACACA GGCTACTCCC

3151 GGCTGCCCGG AAAACCCAAG GTCTACGTTC AAGACATCCT GCAGAAAGAG

3201 CTGGCCGACG AGGTGTTCAG CGTGCTCCAC GGGGAGCAGG GCCACCTCTA 3251 TGTTTGTGGC GATGTGCGCA TGGCTCGGGA TGTGGCTACC ACTTTGAAGA

3301 AGCTGGTGGC CGCCAAGCTG AACTTGAGTG AGGAGCAGGT TGAGGATTAC

3351 TTCTTCCAGC TCAAGAGCCA GAAACgTTAT CATGAGGATA TCTTCGGTGC

3401 GGTCTTTTCC TATGGAGTGA AAAAGGGCAA CGCTTTGGAG GAGCCCAAAG

3451 GCACAAGACT CTGACACCCA GAAGAGTTAC AGCATCTGGC CCTAAATAAA 3501 ATGACAGTGA gGGTTTGGAG AGACAGAAGT (SEQ ID NO: 6)

Sequence analyses revealed identity among the different rat islet iNOS clones obtained and demonstrated more than 99% identity at both nucleotide and amino acid level to the published rat hepatocyte and smooth muscle iNOS sequences, 93% identity to the mouse macrophage iNOS, and 80% identity to the published human iNOS'es. That the cloned rat islet iNOS transcript was indeed expressed in β-cells was envisaged by cloning an identical 1 Kb cDNA from IL-1 stimulated RIN cells that was not amplified/detectable from the non-stimulated cells (data not shown). Furthermore Northern blot analysis with the cloned iNOS cDNA as probe, detected a 4.5kb transcript exclusively in the IL-1 exposed RIN cells. Exposure of the RIN cells to a low (0,2ng/ml) or high (2ng/ml) IL-1 concentration for one or three days illustrated a dose- and time dependent expression of the iNOS transcript. Transient expression of the cloned iNOS gene under the CMV promoter in the mammalian embryonic kidney cell line 293 demonstrated enzymatic activity of the recombinant iNOS which was dose-dependently inhibited by 1.1 and 2.2 mM of the arginine analogue NAME and aminoguanidine, whereas 25mM of nicotinamide, a concentration previously shown to reduce IL-1 induced nitrite production in rat islets by 50% did not influence the enzymatic activity. The results appear from Table 1.

Table 1

Control 3.3

iNOS 45.87

iNOS + 1.1 mM NAME 25.23

iNOS + 2.2 mM NAME 16.8

iNOS + 1.1 mM aminoguanidine 8.4

iNOS + 25 mM nicotine amide 44.97

EXAMPLE 3 Cloning of human islet iNOS

Human islets were incubated in a mixture of IL-1, TNF-α and IFN-γ for 6 hours before they were harvested and mRNA was isolated as described in Example 2. Expression of iNOS was detected as described in Example 2. iNOS expression could not be detected in unstimulated human islets. The human islet iNOS was cloned by RT-PCR as described in Example 2 on the isolated mRNA with primers based on the human hepatocyte sequence (Geller et al. Proc. Natl. Acad. Sci. USA 90, 1993, pp. 3491-3495). The sequence of the primers was as follows:

#12 5'-AGT TCT CAA GGC ACA GGT CTC-3' (SEQ ID NO:7) #2696 5'-GCT CCA TCC TTA AGT TCT-3' (SEQ ID NO: 8) The cloned human islet iNOS was sequenced as described in Example 2. The sequence of 5' untranslated and translated human islet iNOS was determined to be

1 AGTTCTCAAG GCACAGGTCT CTTCCTGGTT TGACTGTCCT TACCCCGGGG 51 AGGCAGTGCA GCCAGCTGCA ASCCCACAGT GAAGAACATC TGAGCTCAAA 101 TCCAGATAAG TGACATAAGT GACCTGCTTT GTAAAGCCAT AGAGATGGCC 151 TGTCCTTGAA AATTTCTGTT CAAGACCAAA TTCCACCAGT ATGCAATGAA

201 TGGGGRAAAA GACATCAACA ACAATGTGGA GAAAGCCCCC TGTGCCACCT

251 CCAGTCCAGT GACACAGGAT GACCTTCAGT ATCACAACCT CAGCAAGCAG

301 CAGAATGAGT CCCCGCAGCC CCTCGTGGAG ACgGGAAAGA AGTCTCCAGA 351 ATCTCTGGTC AAGCTGGATG CAACCCcATT GTCCTCCCCA CCGCATGTGA

401 GGATCaAAAA CTGGGGCAGC GGGATGACTT TCCAAGACAC ACCTCACCAT 451 AAGGCCAAAG GGATTTTAAC TTGCAGGTCC AAAWYTTGCC TGGGGTCCAT 501 T (SEQ ID NO:9)

(initiation codon at position 145 shown bold and underlined) The 3'-end of human islet iNOS has the following sequence

1 AGACGACTCA CTATAGGGCG AATTGGGCCC TCTAGATGCA TGCTCGAGCG

51 GCCGCCAGTG TGATGGATAT CTGCAGAATT CGGCTTTATC CCGGGCTCCA 101 TCCTTAAGTT CTGTGCCGGC AGCTTTAACC CCTCCTGTAG GCCCTCAGAG 151 CGCTGACATC TCCAGGCTGC TGGGCTGCAC CGCCACCCTG TCCTTCTTCG 201 CCTCGTAAGG AAATACAGCA CCAAAGATAT CTTCGTGATA GCGCTTCTGG 251 CTCTTGAGCT GAAAGAAATA GTCCTCGACC TGCTCCTCAT TCAATTTCAG 301 CTTGGCAGCC ACCAGCTGCT TCAGGGTGTG GGCCACGTCC CGGGCCATGC

351 GCACATCCCC GCAAACATAG AGGTGGCCTG GCTCCTTGTG GAGCACACSG

401 AGCACCTCGC TGGCCAGCTG CTGCCSCAGG ATGTCCTGAA CATAGACCTT 451 GG (SEQ ID NO: 10) SEQUENCE LISTING

(1) GENERAL INFOEMATION:

(i) APPLICANT:

(A) NAME: Novo Nordisk A/S

(B) STREET: Novo Alle

(C) CITY: Bagsvaerd

(E) COUNTRY: Denmark

(F) POSTAL CODE (ZIP) : 2880

(G) TETEPHONE: +45 4444 8888

(H) TEIEFAX: +45 4449 3256

(ii) TITLE OF INVENTION: A CNA Sequence Encoding Nitric Oxide Synthase

(iii) NUMBER OF SEQUENCES: 10

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) CCMEUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFIWARE: PatentIn Release #1.0, Version #1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1033 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOIOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iii) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: rat

(XI) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

TTTCCAAGCT TGCCGCCACC ATGGCTTGCC CTGGAAGTTT CTCTTCAGAG TCAAATCCTA 60

CCAAGGTGAC CTGAAAGAGG AAAAGGACAT TAACAACAAC GTGGAGAAAA CCCCAGGTGC 120

TATTCCCAGC CCAACAACAC AGGATGACCC TAAGAGTCAC AAGCATCAAA ATGGTTTCCC 180CCAGTTCTCA CTGGGACΓGC ACAGAATGTC CAGAGATCCC TGGACAAGTC TGCATCTGAC 240

TCCMCGACC CGCCCACAGC ACGTGAGGAT CAAAAACTGG GGCAATGGAG AGATTTTTCA 300

CGACACCCTT CACCACAAGG CCACCTCGGA TATCTCTTGC AAGTCCAAAT TATGCATGGG 360 GTGCATCATG AACTCCAAGA GTTTGACCAG AGGACCCAGA GACAAGCCCA CCCCAGTGAG 420

GAGCTTCTGT GCCTCAAGCC AATTGAATTC ATTAACCAGT ATTATGGCTC CTTCAAAGAG 480

GCAAAAATAG AGGAACATCT GGCCAGGCTG GAAGCCCGTA ACAAAGGAAA TAGAAACAAC 540

AGGAACCEAC CAGCTCACTC TGGATGAGCT CATCTTTGCC ACCAAGATGG CCTGGAGGAA 600

ACTGCCCCTC GCTGCATCGG CAGGATTCAG TGGTCCAACC TGCAGGTCTT CGATGCCCGG 660

AGCTGTAGCA CTGCATCAGA AATGTTCCAG CATATCTGCA GACACATACT TTACCGACTA 720

ACAGTGGCAA CATCAGGTCG GCCATTACTG TGTTTCCCCCA GCGGAGCGAT GGGAAGCATG 780

ACTTCCGGAT CTGGAATTCC CΑGCTCATCC GGTACGCTGG CTACCAGATG CCCGATGGCA 840

CCATCAGAGG GGATCCTGCC ACCTTGGAGT TCACCCAGTT GTGCATOGAC CTGCTGGAAG 900

CCCCGCTACG GCCGCTTCGA TGTGCTGCCT CTGGTCCTGC AGGCTCACGG TCAAGATCCA 960

GAGGTCTTTG AAATCCCTCC TGATCTTGTG CTGGAGGTGA CCATGGAGCA CCCAAAGTAC 1020

GAATGGTTCC AAA 1033 (2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:

(A) ORGANISM: synthetic

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

TCCAAGCTTG CCGCCACCAT GGCTTGCCCC TGG 33

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 32 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOLOGY: linear

(ii) MDLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:

(A) ORGANISM: synthetic (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 :

CCAAGCTTGC CGCCACCATC GCTTCCCCCT GG 32 (2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:

(A) ORGANISM: synthetic

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

AGAAGCACAA AGTCACAGA 19 (2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:

(A) ORGANISM: synthetic

(XI) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

ACTTCTGTCT CTCCAAACCC 20 (2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3530 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iii) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: rat (XI) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

AGAAGCACAA AGTCACAGAC ATGGCTTGCC CCTGGAAGTT TCTCTTCAGA GTCAAATCCT 60

ACCAAGGTGA CCTGAAAGAG GAAAAGGACA TTAACAACAA CGTGGAGAAA ACCCCAGGTG 120

CTATTCCCAG CCCAACAACA CAGGATGACC CTAAGAGTCA CAAGCATCAA AATGGTTTCC 180

CCCΑGTTCCT CACTGGGACT GCACAGAATG TTCCAGAATC CCTGGACAAG CTGCATGTGA 240

CTCCATCGAC CCGCCCACAG CAOGTGAGGA TCAAAAACTG GGGCAAIGGA GAGATTTTC 300

ACGACACCCT TCACCACAAG GCCACCTCGG ATATCTCTTG CAAGTCCAAA TTATGCATGG 360

GGTCCATCAT GAACTCCAAG AGTTTGACCA GAGGACCCAG AGACAAGCCC ACCCCAGTGG 420

AGGAGCTTCT GCCTCAAGCC ATTGAATTCA TTAACCAGTA TTATGGCTCC TTCAAAGAGG 480

CAAAAATAGA GGAACATCTG GCCAGGCTGG AAGCCGTAAC AAAGGAAATA GAAACAACAG 540

GAACCTACCA GCTCACTCTG GATGAGCTCA TCTTTGCCAC CAAGATGGCC TGGAGGAACG 600

CCCCTCGCTG CATCGGCAGG ATTCAGTGGT CCAACCTGCA GGTCTTCGAT GCCCGGAGCT 660

GTAGCACTGC ATCAGAAATG TTCCAGCATA TCTGCAGACA CATACTTTAC GCCACTAACA 720

GTGGCAACAT CAGGTCGGCC ATTACTGTGT TCCCCCAGCG GAGCGATGGG AAGCATGACT 780

TCCGGATCTG GAATTCCCAG CTCATCCGGT ACGCTGGCTA CCAGATGCCC GATGGCACCA 840

TCAGAGGGGA TCCTGCCACC TTGGAGTTCA CCCAGTTGTG CATCGACCTG GGCTGGAAGC 900

CCCGCTATGG CCGCTTCGAT GTGCTGCCTC TGGTCCTGCA GGCTCACGGT CAAGATCCAG 960

AGGTCTTTGA AATCCCTCCT GATCTTGTGC TGGAGGTGAC CATGGAGCAT CCCAAGTACG 1020

AGTGGTTCCA GGAGCTCGGG CTGAAGTGGT ATGCGCTGCC TGCCGTGGCC AACATGCTCC 1080

TGGAGGTGGG TGGCCTCGAG TTCCCAGCCT GCCCCTTCAA TGGTTGGTAC ATGGGCACCG 1140

AGATTGGAGT CCGAGACCTC TGTGACACAC AGCGCTACAA CATCCTGGAG GAAGTGGGCA 1200

GGAGGATGGG CCTGGAGACC CACACACTGG CCTCCCTCTG GAAAGACCGG GCTGTCACCG 1260

AGATCAATGC AGCTGTGCTC CATAGTTTTC AGAAGCAGAA TGTGACCATC ATGGACCACC 1320

ACACAGGCTC AGAGTCCTTC ATGAAGCACA TGCAGAATGA GTACCGGGCC CGAGGAGGCT 1380

GCCCTGCAGA CTGGATTTGGCTGGTCCCTC CGGTGTCCGG GAGCATCACC CCTGTGTTCC 1440

ACCAGGAGAT GTTGAACTAC GTCCTATCTCCATTCTACTA CTACCAGATC GAGCCCTGGA 1500

AGACCCACAT CTGGCAGGAT GAGAAGCTGA GGCCCAGGAG GAGAGAGATC CGGTTCACAG 1560

TCTTGGTGAA AGCGGTGTTC TTTGCTTCTG TGCTAATGCG GAAGGTCATG GCTTCCCGCG 1620 TCAGAGCCAC AGTCCTCTTT GCTACTGAGA CAGGAAAGTC GGAAGCGCTA GCCAGGGACC 1680

TGGCTGCCTT GTTCAGCTAC GCCTTCAACA CCAAGGTTGT CTGCATGGAA CAGTATAAGG 1740

CAAACACCTT GGAAGAGGAA CAACTACTGC TGGTGGTGAC AAGCACATTT GGCAATGGAG 1800

ACTGCCCCAG CAATGGGCAG ACTCTGAAGA AATCTCTGTT CATGATGAAA GAACTCGGGC 1860

ATACCTTCAG GTATCGGGTA TTTGGCCTGG GCTCCAGCAT GTACCCTCAG TTCTGTGCCT 1920

TTGCTCATGA CATCGACCAG AAACTGTCTC ACCTGGGAGC CTCCCAGCTT GCCCCAACCG 1980

GAGAAGGGGA CGAACTCAGC GGGCAGGAGG ACGCCTTCCG CAGCTGGGCT GTGCAAACCT 2040

TCCGGGCAGC CTGTGAGACG TTCGATGTTC GAAGCAAACA TTGCATTCAG ATCCCGAAAC 2100

GCTACACTTC CAACGCAACA TGGGAGCCAG AGCAGTACAA GCTCACCCAG AGCCCAGAGC 2160

CTCTAGACCT CAACAAAGCT CTCAGCAGCA TCCACGCCAA GAACGTGTTC ACCATGAGGC 2220

TGAAATCCCT CCAGAATCTG CAGAGTGAGA AGTCCAGCCG CACCACCCTC CTTGTTCAAC 2280

TCACCTTCGA GGGCAGCCGA GGCCCCAGCT ACCTACCTGG GGAACACCTG GGGATTTTCC 2340

CAGGCAACCA GACGGCCCTG GTGCAAGGGA TCTTGGAGCG AGTTGTGGAT TGTTCTTCGC 2400

CAGACCAAAC TGTGTGCCTG GAGGTTCTAG ATGAGAGTGG CAGCTACTGG GTCAAAGACA 2460

AGAGGCTTCC CCCCTGCTCA CTCAGGCAAG CCCTCACCTA CTTCCTGGAC ATCACTACCC 2520 CTCCCACCCA GCTGCAGCTC CACAAGCTGG CCCGCTTTGC CACGGAAGAG ACGCACAGGC 2580

AGAGGTTGGA GGCCCTTGTGT CAGCCCTCAG AGTACAACGA TTGGAAGTTC AGCAACAACC 2640

CCACGTTCCT GGAGGTGCTG GAAGAGTTCC CATCATTGCG TGTGCCTGCT GCCTTCCTGC 2700

TGTCGCAGCT CCCCATTCTG AAGCCCCGCT ACTACTCCAT CAGCTCCTCC CAGGACCACA 2760

CCCCCTCGGA GGTCCACCTC ACTGTGGCTG TGGTCACCTA TCGCACCCGA GATGGTCAGG 2820

GTCCCCTGCA CCATGGCGTC TGCAGCACTT GGATCAATAA CCTGAAGCCC GAAGACCCAG 2880

TGCCCTGCTT TGTGCGGAGT GTCAGTGGCT TCCAGCTCCC TGAGGACCCC TCCCAGCCCT 2940

GCATCCTCAT TGGGCCCGGT ACAGGCATTG CCCCCTTCCG AAGTTTCTGG CAGCAGCGGC 3000

TCCATGACTC TCAGCGCAGA GGGCTCAAAG GAGGCCGCAT GACCTTGGTG TTTGGGTGCA 3060

GGCACCCAGA GGAGGACCAC CTCTATCAGG AAGAAATGCA GGAGATGGTC OGCAAGGGAG 3120

TCTTGTTCCA GGTGCACACA GGCTACTCCC GGCTGCCCGG AAAACCCAAG GTCTACGTTC 3180

AAGACATCCT GCAGAAAGAG CTGGCCGACG AGGTGTTCAG CGTGCTCCAC GGGGAGCAGG 3240

GCCACCTCTA TGTTTGTGGC GATGTGCGCA TGGCTCGGGA TGTGGCTACC ACTTTGAAGA 3300 AGCTGGTGGC CGCCAAGCTG AACTTGAGTG AGGAGCAGGT TGAGGATTAC TTCTTCCAGC 3360

TCAAGAGCCA GAAACGTTAT CATGAGGATA TCTTCGGTGC GGTCTTTTCC TATGGAGTGA 3420

AAAAGGGCAA CGCTTTGGAG GAGCCCAAAG GCACAAGACT CTGACACCCA GAAGACTTAC 3480

AGCATCTGGC CCTAAAIAAA ATGACAGTGA GGGTTTGGAG AGACAGAAGT 3530 (2) INFORMATION FOR SEQ ID NO: 7 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:

(A) ORGANISM: synthetic

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

AGTTCTCAAG GCACAGGTCT C 21

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(vi) ORIGINAL SOURCE:

(A) ORGANISM: synthetic

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

GCTCCATCCT TAAGTTCT IS

(2) INFORMATION FOR SEQ ID NO: 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 497 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOIOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: human

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

AGTTCTCAAG GCACAGGTCT CTTCCTGGTT TGACTGTCCT TACCCCGGGG AGGCAGTGCA 60

GCCAGCTGCA ACCCACAGTG AAGAACATCT GAGCTCAAAT CCAGATAAGT GACATAACTG 120

ACCTGCTTTG TAAAGCCATA GAGATGGCCT GTCCTTGAAA ATTTCTGΓTC AAGACCAAAT 180

TCCACCAGTA TGCAATGAAT GGGGAAAAGA CATCAACAAC AATGTGGAGA AAGCCCCCTG 240

TGCCACCTCC AGTCCAGTGA CACAGGATGA CCTTCAGTAT CACAACCTCA GCAAGCAGCA 300

GAATGAGTCC CCGCAGCCCC TOGTGGAGAC GGGAAAGAAG TCTCCAGAAT CTCTGGTCAA 360

GCTGGATGCA ACCCCA3TGT CCTCCCCACC GCATGTGAGG ATCAAAAACT GGGGCAGCGG 420

GATGACTTTC CAAGACACAC CTCACCATAA GGCCAAAGGG ATTTTAACTT GCAGGTCCAA 480

ATTGCCTGGG GTCCATT 497 (2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 450 base pairs

(B) TYPE: nucleic acid

(C) STRANDEENESS: single

(D) TOPOIOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iii) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: human

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

AGACGACTCA CTATAGGGCG AATTGGGCCC TCTAGATGCA TGCTCGAGCG GCCGCCAGTG 60

TGATGGATAT CTGCAGAATT CGGCTTTATC CCGGGCTCCA TCCTTAAGTT CTGTGCCGGC 120

AGCTTTAACC CCTCCTGTAG GCCCTCAGAG CGCTGACATC TCCAGGCTGC TGGGCTGCAC 180

CGCCACCCTG TCCTTCTTCG C CTCGTAAGG AAATACAGCA CCAAAGATAT CTTTCGTGATA 240

GCGCTTCTGG CTCTTGAGCT GAAAGAAATA GTCCTCGACC TGCTCCTCAT TCAATTTCAG 300 CTTGGCAGCC ACCAGCTGCT TCAGGGTGTG GGCCACGTCC CGGGCCATGC GCACATCCCC 360

GCAAACATAG AGGTGGCCTG GCTCCTTGTG GAGCACACGA GCACCTCGCT GGCCAGCTGC 420

TGCCCAGGAT GTCCTGAACA TAGACCTTGG 450

Otras citas
Referencia
1 *DIALOG INFORMATION SERVICES, File 154, Dialog Accession No. 08193824, CORBETT JA et al., "Does Nitric Oxide Mediate Autoimmune Destruction of Beta-Cells? Possible Therapeutic Interventions in IDDM"; & DIABETES (UNITED STATES), Aug 1992, 41 (8), p. 897-903.
2 *DIALOG INFORMATION SERVICES, File 154, Medline, Dialog Accession No. 08072618, Medline Accession No. 92210618, LYONS CR et al., "Molecular Cloning and Functional Expression of an Inducible Nitric Oxide Synthase from a Murine Macrophage Cell Line"; & J BIOL CHEM (UNITED STATES), 25-03-1992, 267 (9), p. 6370-4.
3 *DIALOG INFORMATION SERVICES, File 154, Medline, Dialog Accession No. 08481721, Medline Accession No. 93191721, NUNOKAWA Y et al.: "Cloning of Inducible Nitric Oxide Synthase in Rat Vascular Smooth Muscle Cells"; & BIOCHEM BIOPHYS RES COMMUN (UNITED STATES), 26 feb 1993, 191 (1), p 89-94.
4 *PROC. NATL. ACAD. SCI., Volume 86, July 1989, RICHARD G. KNOWLES et al., "Formation of Nitric Oxide from L-Arginine in the Central Nervous System: A Transduction Mechanism for Stimulation of the Soluble Guanylate Cyclase", page 5159 - page 5162.
5 *SCIENCE, Volume 255, 1992, HARALD H.H.W. SCHMIDT et al., "Insulin Secretion from Pancreatic B Cells Caused by L-Arginine-Derived Nitrogen Oxides", page 721 - page 723.
Citada por
Patente citante Fecha de presentación Fecha de publicación Solicitante Título
WO1995027070A1 *31 Mar 199512 Oct 1995Schrader JuergenDna expression vectors for use in the treatment of vascular diseases by gene therapy
WO1996040715A1 *6 Jun 199619 Dic 1996University Of Nebraska Board Of RegentsTherapeutic oligonucleotides targeting the human mdr1 and mrp genes
DE4411402A1 *31 Mar 19945 Oct 1995Juergen SchraderDNA-Expressionsvektoren zur Verwendung in der gentherapeutischen Behandlung von Gefäßerkrankungen
US5744340 *9 Jun 199528 Abr 1998Schering CorporationExpression of human inducible nitric oxide synthase
US5830461 *8 Nov 19963 Nov 1998University Of Pittsburgh Of The Commonwealth System Of Higher EducationMethods for promoting wound healing and treating transplant-associated vasculopathy
US6103230 *2 Oct 199815 Ago 2000University Of Pittsburgh Of The Commonwealth System Of Higher EducationMethods for promoting wound healing and treating transplant-associated vasculopathy
US6146887 *28 Jul 199814 Nov 2000Jurgen SchraderDNA expression vectors for use in the gene therapeutic treatment of vascular disorders
US6149936 *28 Jul 199821 Nov 2000Joseph SchraderDNA expression vectors for the use in the gene therapeutic treatment of vascular disorders
Clasificaciones
Clasificación internacionalC12N15/53, C12N9/02
Clasificación cooperativaC12Y114/13039, C12N9/0075
Clasificación europeaC12Y114/13039, C12N9/00P30C39
Eventos legales
FechaCódigoEventoDescripción
27 Oct 1994AKDesignated states
Kind code of ref document: A1
Designated state(s): JP US
27 Oct 1994ALDesignated countries for regional patents
Kind code of ref document: A1
Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE
5 Ene 1995DFPERequest for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
18 Ene 1995121Ep: the epo has been informed by wipo that ep was designated in this application
14 May 1997122Ep: pct application non-entry in european phase