WO1995003431A1 - Enriching and identifying fetal cells in maternal blood for in situ hybridization - Google Patents

Enriching and identifying fetal cells in maternal blood for in situ hybridization Download PDF

Info

Publication number
WO1995003431A1
WO1995003431A1 PCT/US1994/008342 US9408342W WO9503431A1 WO 1995003431 A1 WO1995003431 A1 WO 1995003431A1 US 9408342 W US9408342 W US 9408342W WO 9503431 A1 WO9503431 A1 WO 9503431A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
fetal
nucleated
chromosome
erythrocytes
Prior art date
Application number
PCT/US1994/008342
Other languages
French (fr)
Inventor
Joel Bresser
William Dugald Weber
Terry Ryusaki
Nagindra Prashad
Michael Lee Cubbage
Mark Blick
Morteza Asgari
Brian J. Poindexter
Original Assignee
Aprogenex, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aprogenex, Inc. filed Critical Aprogenex, Inc.
Priority to AU74743/94A priority Critical patent/AU7474394A/en
Publication of WO1995003431A1 publication Critical patent/WO1995003431A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804—Nucleic acid analysis using immunogens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • G01N33/56972—White blood cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • G01N33/56977—HLA or MHC typing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/689—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G01N2800/368—Pregnancy complicated by disease or abnormalities of pregnancy, e.g. preeclampsia, preterm labour

Definitions

  • TECHNICAL FIELD This invention generally pertains to a method of enriching fetal cells from maternal blood and to a method for identifying such fetal cells, and further to a process whereby such cells are specimens in an in situ hybridization to detect nucleic acid sequences of clinical interest, e.g. to identify the sex of a fetus, and to detect genetic abnormalities and/or viral infections in fetal cells.
  • BACKGROUND ART The sex of a human fetus and certain fetal chromosomal abnormalities are conventionally detected or confirmed by directly examining the chromosomes in fetal cells by cytogenetic analysis or by testing for specific sequences of DNA within the chromosomes using nucleic acid analysis. These tests require the collection and culturing of living cells obtained through an outpatient surgical procedure involving some risk to the mother or fetus. Cells, which have been shed from the fetus, may be obtained by amniocentesis. Amniocentesis involves inserting a needle through the abdominal wall into the uterus and withdrawing a small amount of amniotic fluid.
  • An alternative procedure involves sampling the tissue of chorionic villi from the surface of the placenta by inserting a catheter through the cervix or abdomen.
  • a catheter through the cervix or abdomen.
  • Fetal cells collected by amniocentesis or chorionic villi sampling are conventionally grown in culture for several days and then examined for abnormalities.
  • Various kinds of fetal cells have been characterized. Fetal cells include, but are not limited to, fetal erythrocytes, lymphocytes and trophoblasts.
  • Trophoblasts include cytotrophoblast and syncytiotrophoblast cells and cells which may be sampled from embryos produced by in vitro fertilization techniques.
  • erythrocytes includes erythroblasts, normoblasts and reticulocytes, as well as erythrocytes, unless the contrary is clear from the context.
  • fetal nucleated erythrocytes were flow sorted on the basis of four parameters: cell size, cell granularity, transferrin receptor, and glycophorin-A cell surface molecule); PCT Publication No. WO 91/07660 to Childrens Medical Center Corp.(a method for isolating fetal nucleated erythrocytes by means of an antigen present on the cell surface of the fetal erythrocytes); PCT Publication No. WO 91/16452 of Cellpro Incorporated; and United States Patent No. 5,153,117 (a method for selectively recovering fetal cells from a maternal blood sample where cells of the sample are combined with a first and second antibody labeled with different fluorochromes).
  • Nucleic acid hybridization techniques are based on the ability of single-stranded DNA or RNA to pair, i.e. hybridize, with a complementary nucleic acid strand. This hybridization reaction allows the development of specific probes, or populations of probes, that can identify the presence of specific genes (DNA) or polynucleotide sequences of the transcription of those genes (RNA).
  • RNA or DNA probes By the use of specific nucleic acid (RNA or DNA) probes, genetic markers for the gender or other genetic characteristic of the fetus and for infection and other disease states may be detected. Certain genetic diseases are characterized by the presence of genes absent in normal tissue. Other disease conditions are characterized by the expression of RNAs or RNA translation products (i.e. peptides or proteins) which are not expressed in normal cells. Some disease states are characterized by the absence of certain genes or portions of genes, or the absence or alteration of expression of gene products or proteins. Moreover, it is often desired to characterize the gender of animal fetuses, such as bovine fetuses, as well as human.
  • Solution hybridization methods that require the destruction of the cell and the isolation of the nucleic acids from the cell before carrying out the hybridization reaction sacrifice cellular integrity, spatial resolution and sensitivity of detection. Where relatively few cells are available for isolation, as with fetal cells circulating in maternal blood, solution hybridization is not feasible.
  • Amplification of nucleic acids such as by the polymerase chain reaction, is a known technique, but with certain known drawbacks preventing optimal speed and efficiency. For example, such techniques may cause lysis of cells, may produce false positives due to sensitivity of the technique, and may lead to loss of specificity where high levels of amplification are required to detect a target that is present in low copy number.
  • hybridization of the amplified target is required in any event, so that multiple time-consuming steps are performed when amplification is used.
  • In situ hybridization provides a technique for the determination and quantitation of nucleic acids (DNA and RNA) in tissues at the single-cell level. Such hybridization techniques can detect the presence or absence of specific genes therein and may also be utilized to detect the expression of gene products at the single-cell level.
  • the prior art remains deficient.
  • a truly rapid, sensitive, efficient and practical method of determining fetal gender and of detecting fetal abnormalities on a routine basis without invading the mother's womb is lacking.
  • the present invention fulfills a long-felt need and desire in this field.
  • cells may be obtained from maternal peripheral blood, umbilical cord blood, chorionic villus samples, etc. Cellular samples may be used directly or may be concentrated as stated elsewhere herein to enrich the population of fetal cells prior to analysis. Cells may be fixed in common precipitating fixatives or cross-linking fixatives or may be used in the following test without fixation. The procedure may be carried out with cells deposited on a solid support such as a glass microscope slide or used with the cells in suspension.
  • This method comprises the steps of obtaining a specimen that contains fetal cells and detecting a marker that distinguishes fetal cells from maternal cells also present in the sample.
  • the most preferred method of identifying a cell as a fetal erythrocyte in accordance with the present invention is to detect the presence of RNA for fetal hemoglobin (HbF) or embryonic hemoglobin.
  • RNA is generally messenger RNA (mRNA), but may alternatively or additionally include heteronuclear RNA (hnRNA).
  • hnRNA heteronuclear RNA
  • messenger RNA or mRNA herein includes ribosomal RNA (rRNA). The presence of such RNA indicates that the gene for the fetal protein is being transcribed and expressed.
  • Such detection is preferably performed within substantially intact cellular membranes using in situ hybridization, preferably with synthetic DNA probes complementary to the fetal protein RNA.
  • synthetic DNA probes are employed, to which chromofluors have been covalently attached.
  • the binding of such probes to fetal-cell-specific RNA within cells may be observed under the microscope as a bright fluorescence or may be detected by fluorimetric apparatus.
  • fluorescence we refer to any emission of detectable radiation as a result of excitement with radiation of a different wavelength than that emitted.
  • the exciting radiation is conventionally ultraviolet or visible light but may be infrared or other electromagnetic radiation.
  • Another preferred embodiment employs synthetic DNA probes which are directly labeled, or may be indirectly labeled with enzymes such as alkaline phosphatase.
  • enzymes such as alkaline phosphatase.
  • the binding of such probes to fetal RNA followed by subsequent reaction of the enzymes with substrates to produce a detectable product may be observed under the microscope.
  • the information resulting from such an assay may be used not only to identify the status of the fetus, as will be discussed more particularly below, but also to provide a fetal hemoglobin estimation based on the number of fetal erythrocytes detected, e.g. so as to assess the amount of fetal-maternal hemorrhage in case of Rh incompatibility.
  • the amount of specific gamma globulin, containing anti Rh(D) to be administered, is calculated from this estimation, to suppress maternal immune reaction to fetal red blood cells entering maternal circulation.
  • An alternative method for identifying fetal erythrocytes is to detect a substance that is present in fetal cells but not in the maternal blood cells which would be present in the sample.
  • a substance which is particularly effective for such detection is fetal hemoglobin, which may be detected by stain such as acid hematoxylin and eosin B (e.g. Sigma Diagnostics, P.O. 14508, St. Louis, MO 63178, cat. no. 285) or by an antibody to fetal hemoglobin.
  • Another such substance is the Y chromosome present in male fetal cells but absent from the cells of the mother.
  • RNA that is present in fetal cells and a peptide.
  • the RNA may be detected by nucleic acid hybridization, and the peptide may be detected as aforesaid, by the binding of an antibody thereto or by staining.
  • Another embodiment of the present invention detects the presence of at least two different RNAs in a cell.
  • Fetal cells contain unique mRNAs or mRNA species which are produced in cell types which do not normally contain the particular mRNA species.
  • the detection of these RNAs can serve to identify cells, or even subcellular fractions, as fetal or embryonic in origin.
  • knowledge of the tissue of origin, e.g. prostate or breast, of a metastatic cell may assist in the detection or treatment of cancers.
  • the present technique may be employed for such purposes by seeking to detect the particular population of RNAs known to distinguish one such tissue from another.
  • RNA populations are present in high abundance (e.g., fetal hemoglobin in fetal nucleated red blood cells)
  • other fetal- or embryonic-specific RNAs are present in low abundance, either alone or even when considered as a population of fetal-specific RNAs.
  • certain RNA species while produced in certain fetal cells, may also be produced in certain maternal cells.
  • fetal cells express two or more particular RNAs in the same cell while maternal cells from the same specimen source do not contain both RNA species in the same cell. The ability to detect multiple mRNA or hnRNA species simultaneously in the same cell thereby enhances the ability to distinguish fetal cells from non-fetal (e.g.
  • two or more RNA sequences are detected, using one or more probes for a first RNA sequence and one or more probes for a second RNA sequence.
  • the probes for the first sequence are labeled to provide a first signal, such as a greenish fluorescence
  • the probes for the second sequence are labeled to provide a signal that is different from the first signal, such as a reddish fluorescence.
  • DNA probes are prepared for fetal hemoglobin RNA, labeled with a first fluorescer, such as fluorescein.
  • DNA probes are also prepared for RNA of embryonic hemoglobin, ⁇ chain, labeled with a second fluorescer, such as Cy5.
  • DNA probes are also prepared for RNA of embryonic hemoglobin, ⁇ chain, labeled with a third fluorescer, such as Cy3.
  • a fetal-cell-specific RNA sequence is detected by hybridization as aforesaid, along with another marker for the cells of interest, such as staining of fetal hemoglobin by hematoxylin and eosin or such as binding of a labeled monoclonal antibody with an antigen present in the cells of interest.
  • a further set of embodiments of the present invention involve enriching the relative proportion of fetal cells in the specimen compared to other cells, e.g. maternal cells. Such enrichment may preferably take place by selectively removing maternal cells, e.g. by contacting the sample with a ligand to a cell surface component, the ligand being capable of being selectively separated from the sample.
  • the ligand is an antibody to an antigen generally present on maternal blood cells.
  • the ligand is bound to a solid matrix for separation from the liquid containing the sample.
  • the matrix is a magnetic bead.
  • the matrix may alternatively be in the form of a column through which the cell suspension is passed. Liquid electrophoresis in which cells are subjected to an electric field and separated on the basis of their intrinsic charge may be used as may passage through a filtration system that separates cells on the basis of their intrinsic charge.
  • the antibody comprises a monoclonal antibody to cluster- determinant-45 (hereinafter CD refers to cluster determinant as in, CD45).
  • CD refers to cluster determinant as in, CD45.
  • This antibody selectively binds to an epitope expressed on all isoforms of the human leukocyte common antigen (LCA) family, which are expressed on all leukocytes. Fetal erythrocytes are preferably enriched in such manner.
  • Additional antibodies which may be employed, along with or instead of anti-CD45 include anti-CD13, anti-CD34, anti-CD44 and anti-CD31.
  • the amount of antibody used is from about 2 to about 20 ⁇ g per million leukocytes in the sample.
  • fetal erythrocytes may be selectively enriched by density gradient centrifugation. Subsequently, the fetal cells are detected as generally stated hereinabove.
  • a novel method of identifying fetal cells in a specimen comprises the steps of obtaining a specimen that contains fetal cells and examining the cells by flow cytometry without any preliminarily labeling of the fetal cells through the use of a fluorescent label or any other label that may generate a fluorescent signal.
  • Fetal cells are identified solely on the basis of their intrinsic light scattering properties. Simultaneously the fetal cells are concentrated using flow cytometry. This method relies on the unique finding that fetal call have distinguishable intrinsic light scattering properties that allow them to be sorted from many other cells. Fetal nucleated erythrocytes scatter light in a manner similar to that of monocytic cells and are thus usefully enriched by sorting them away from numerous other cells types.
  • a novel method of identifying fetal cells in a specimen comprises the steps of obtaining a specimen that contains fetal cells and preliminarily labeling the fetal cells through the use of a fluorescent label or a label which may generate a fluorescent signal by enzymatic action or a label which may react antigenically to generate a fluorescent signal, which signal may be detected by instrumentation. Subsequently, the fetal cells are concentrated using flow cytometry.
  • kits for the enrichment of fetal erythrocytes within a blood specimen including means for creating a density gradient for enriching fetal cells of interest.
  • kits for the enrichment of fetal erythrocytes from a specimen, such as preferably maternal peripheral blood, and the detection of nucleic acid sequence in such fetal cells comprises an antibody to a cell surface antigen present on most or all adult white blood cells, which antibody may be bound to a matrix to facilitate separation.
  • the kit further comprises a hybridization solution comprising a denaturing agent, hybrid stabilizing agent, buffering agent, and a membrane pore-forming agent.
  • this kit contains a supply of an oligonucleotide probe capable of hybridizing with a target fetal RNA nucleotide sequence.
  • such a kit also includes another detectably different probe capable of hybridizing with a nucleic acid sequence of clinical interest.
  • Such kits typically include instructions for their use.
  • fetal cells are characterized by cell type.
  • this invention relates to fetal nucleated erythrocytes.
  • the fetal cells are preferably separated from maternal peripheral blood by ligand binding of maternal cells or density gradient centrifugation.
  • the procedures of the present invention may alternatively be applied to samples obtained by percutaneous sampling of umbilical cord blood, amniocentesis, chorionic villi sampling or other procedures, if the advantages obtained by maternal peripheral blood sampling are not required.
  • the cells may be distinguished or separated from maternal cells by recognition of a fetal cell antigen, e.g., by staining with a labeled antibody to fetal hemoglobin, by staining for fetal hemoglobin, or preferably by in situ hybridization using DNA probes to messenger RNA (mRNA) sequences that are present in such fetal cells but not in maternal blood cells.
  • a fetal cell antigen e.g., by staining with a labeled antibody to fetal hemoglobin, by staining for fetal hemoglobin, or preferably by in situ hybridization using DNA probes to messenger RNA (mRNA) sequences that are present in such fetal cells but not in maternal blood cells.
  • mRNA messenger RNA
  • An antibody to cytokeratin attached to a fluorescent label is especially desirable for use without interfering with the nucleic acid hybridization performed in accordance with the present invention.
  • a preferred method in accordance with this invention uses in situ hybridization performed on cells that are obtained from maternal peripheral blood using probes and conditions that select for messenger RNA (mRNA) bearing sequences that are transcribed in fetal cells but not in the maternal blood cells.
  • mRNA messenger RNA
  • HbF fetal hemoglobin
  • certain methods of the present invention may involve embryonic cells fertilized in vitro, or products of conception, which do not need to be separated or distinguished from maternal cells.
  • An advantage of the hybridization technique of a preferred embodiment of the present invention is that it is possible to perform the hybridization to detect fetal mRNA sequences under conditions similar to (or preferably the same as) those used to detect genetic or viral DNA. Moreover, in a most preferred embodiment, a single incubation step is performed in which probes for mRNA and probes for DNA are present in the hybridization cocktail.
  • the present invention employs in situ hybridization techniques that are capable of detecting even a single genetic abnormality in a single cell. Incubation in accordance with the present invention is desirably less than about 120 minutes, and preferably between about 5 and about 30 minutes. Fetal cells contain unique mRNAs or mRNA species which are produced in cell types which do not normally contain the particular mRNA species.
  • RNAs can serve to identify cells, or even subcellular fractions, as fetal or embryonic in origin. While certain RNA populations, such as fetal- hemoglobin mRNA in fetal nucleated erythrocytes, are present in relatively high abundance, other fetal- or embryo-specific mRNAs are present in low abundance, either alone or even when considered as part of a population of fetal-specific mRNAs. In addition, certain RNA species, although produced in certain fetal cells, may also be produced in certain maternal cells.
  • fetal cells express two or more particular mRNAs in the same cell whereas maternal cells from the same specimen do not contain both mRNA species in the same cell.
  • the ability to detect multiple mRNAs or hnRNA species simultaneously in the same cell thereby enhances the ability to distinguish fetal cells from non-fetal (e.g. maternal) cells and offers a means of combining the signals produced when only the unique set of RNAs is present, so that a more specific signal, which uniquely identifies fetal cells, is detected.
  • Figure 1 shows the use of in situ hybridization to determine the numerical status of chromosomes X, Y and 18 in normal male amniocytes.
  • Figure 2 shows the simultaneous detection of the X and Y chromosomes within amniocytes and white blood cells.
  • Figure 3 shows a schematic representation of the technique preferably used to enrich fetal erythrocytes from maternal blood in accordance with the present invention.
  • Figure 4 shows a schematic representation of the technique preferably used to enrich fetal trophoblasts from maternal blood in accordance with the present invention.
  • Figure 5 shows the use of probes for fetal hemoglobin messenger RNA to identify fetal erythrocytes.
  • Figure 6 shows the use of anti-cytokeratin antibodies to positively identify fetal cells in maternal blood.
  • Figure 7 shows the detection of the Y chromosome within a fetal trophoblast, positively identified using the anti-cytokeratin antibody, and isolated from maternal blood.
  • Figure 8 shows the use of in situ hybridization to determine the numerical status of chromosomes X, Y and 18 in placental trophoblasts that have been positively identified using the anti-cytokeratin antibody.
  • Figure 9 shows the use of in situ hybridization to fetal-cell-specific mRNA to positively identify amniocytes and trophoblasts.
  • Figure 10 shows the use of in situ hybridization to fetal-cell-specific mRNA and to chromosomes X and Y in fetal erythrocytes.
  • the methods of the present invention may be used to identify fetal cells in a wide variety of specimens.
  • Representative examples of such specimens include maternal peripheral blood, placental tissue, chorionic villi, amniotic fluid and embryonic tissue.
  • maternal peripheral blood is the preferable specimen.
  • the methods of the present invention are used to detect fetal nucleated red blood cells.
  • the methods of the present invention may be used to detect fetal-cell-specific polynucleotide sequences, that is, oligonucleotides, within a fetal cell.
  • the novel methods of the present invention may be used to detect a virus or a chromosome within a fetal cell.
  • viruses detectable by the present invention include a human immunodeficiency virus, hepatitis virus and herpes virus.
  • Representative examples of chromosomes detected by the present invention include the human X chromosome, the Y chromosome and Chromosomes 1, 13, 16, 18 and 21.
  • the sensitivity of the in situ hybridization techniques described herein permit the visual and photographic detection of a single copy of a genetic sequence present within a single cell.
  • the present invention allows for multiple targets to be tested simultaneously, using a single sample of cells. This permits the maximum amount of information to be obtained from a single sample, minimizing the need for multiple fetal cell samples and thereby decreasing the danger to both mother and fetus and minimizing need for cell purity and sorting.
  • fetal cells or detection of genetic abnormalities within fetal cells requires their separation and differentiation from maternal cells. This requirement is especially necessary when the sample of cells is obtained from maternal peripheral blood containing a low percentage of fetal cells.
  • negative separation by antibodies is particularly advantageous.
  • the antibodies may be coupled to numerous solid surfaces or supports (substrates, such as containers, columns, wells, beads, or particles) by physical or chemical bonding.
  • the antibodies may be coupled to a material which facilitates the selected separation step.
  • antibodies may be labeled with fluorescent markers and cells to which these labeled antibodies bind may thereby be separated with a cell sorter by standard procedures.
  • such antibodies are effective when employed in amounts of about 2 - 20 ⁇ g per million cells to which they are targeted. That is, antibodies which recognize and bind to leukocytes are added in the aforesaid amount, based on the expected number of leukocytes in the sample. Alternatively, antibodies which recognize and bind to trophoblasts are added in the aforesaid amount, based on the expected number of trophoblasts.
  • a particularly preferred separation is performed by using an antibody to anti-CD45 which selectively binds to white blood cells.
  • the anti-CD45 is desirably bonded to a solid support such as magnetic beads, which may be introduced into a test tube and shaken with the sample and then held in position at the side of the test tube by the application of a magnetic field, while liquid containing the un-bound sample is removed.
  • a solid support such as magnetic beads
  • Such beads are available as Anti-CD45 immunomagnetic beads, Catalog No. 1178, from Amac, Inc., 160B Larrabee Road, Westbrook, ME.
  • a preliminary step involving lysis of maternal erythrocytes involving, e.g. with ammonium chloride, can conveniently be used to remove a substantial proportion of these red cells.
  • immunomagnetic beads from Calbiochem, 10933 N. Torrey Pines Road, La Jolla, CA, uncoated as catalog no. 400995, or coated with streptavidin as catalog no. 400996.
  • Such beads may be coated by the user with antibodies to cell surface antigens found on cells which are desired to be removed from the fetal cells.
  • Another bead which may be coated with antibody is an aqueous suspension of iron oxide particles coated to provide carboxyl groups, permitting the covalent attachment of biologically active molecules.
  • Such beads, and a description of procedure for use are available as BioMag Carboxyl Terminated, catalog no. 8-4125, Advanced Magnetics, Inc., 735 Concord Ave., Cambridge, MA 02138.
  • white blood cells may be removed by using specific ligand/ligand-target interactions.
  • Cells may be effectively removed by a combination of antibodies to CD45, CD 13 and CD34.
  • Anti-CD44 can also be included in the mixture to remove contaminating maternal red blood cells. Addition of anti-CD31 can specifically remove the contaminating platelets.
  • Such antibodies are available from various sources such as Amac, Inc. (see above), Becton Dickinson, Franklin Lakes, NJ 07417-1884, and Zymed Laboratories, Inc., 458 Carlton Court, South San Francisco, CA. See Zymed' s 1992 catalog at pages 10-13 and 71- 72. See also W.
  • ligand/ligand- target interactions may usefully be used, e.g. transferrin may be used to bind cells bearing the transferrin receptor.
  • Fetal cells may alternatively be isolated from maternal peripheral blood by either density gradient centrifugation or by flow cytometry. Using flow cytometry, fetal cells may be identified and sorted, for example, by examination of their light scattering properties alone. Alternatively, the fetal origin of such cells may be confirmed by first using either a labeled antibody specific for a fetal cell antigen or by using a nucleic-acid-specific probe, e.g., a synthetic oligonucleotide probe hybridizable to fetal cell RNA. Additionally, hemoglobin A chain mRNA may be detected in maternal cells and its presence used as a distinguishing feature.
  • a nucleic-acid-specific probe e.g., a synthetic oligonucleotide probe hybridizable to fetal cell RNA.
  • hemoglobin A chain mRNA may be detected in maternal cells and its presence used as a distinguishing feature.
  • RNA or DNA probes may also be used as markers for the expression of genetic characteristics of a fetus which may be qualitatively or quantitatively distinct from those of the parent or normal adults.
  • Y chromosome encoded genes or gene products is a qualitative distinguishing feature of the cells of a male fetus.
  • Markers inherited by the fetus from the paternal genome also may be used to qualitatively distinguish fetus cells from maternal cells.
  • syndromes characterized by genetic abnomalities e.g. chromosomal trisomies
  • quantitative differences in in genetic constitution may be detected.
  • quantitative differences in genetic constitution may also be detected.
  • Quantitative differences in may also arise because of the expression of fetal forms of genes that are not expressed, or are only expressed at a low level, in normal adult cells and tissues.
  • Samples of peripheral blood (20 ml) are drawn from donors into Vacutainer tubes containing EDTA. Samples are stored and transported at temperatures not exceeding 4C and are not stored for more than 36 hours. Samples whose temperature exceed IOC upon receipt are rejected. Samples are collected from pregnant women of 10-24 weeks gestational age. In experiments that involved mixing blood from different donors the blood group of the samples is determined and only samples which have the same blood group are mixed.
  • CBA Cell Buffer A
  • slides are preferably made by the conventional cytospin technique. Alternatively they may be prepared as organosilanated slides.
  • cytospun slides 200 ⁇ l of the cell suspension, 114, from step 110 is cytospun onto each slide for five minutes at 500 rpm. Dip the cytospun slides in chilled 80% ethanol/water (v/v) for five minutes. Air dry.
  • the cytospun slides may be fixed by directly applying 30 ⁇ l of ethanol/methanol (3:1 v/v) onto each slide.
  • organosilanated slides To prepare organosilanated slides, immerse clean slides for 2 minutes in a freshly prepared 2% (v/v) solution of an organosilane such as 3-aminopropyltriethoxysilane (APTO) in acetone. Rinse the slides twice in water and air dry. For each 20 ml of maternal blood or 10 ml of umbilical cord blood used as the sample, resuspend the cell pellet in 50 ⁇ l of a fixative solution, e.g. 80% ethanol/water or 3: 1 ethanol/methanol. Spot 50 ⁇ l of this suspension on a slide and air dry the sample.
  • an organosilane such as 3-aminopropyltriethoxysilane (APTO) in acetone. Rinse the slides twice in water and air dry.
  • a fixative solution e.g. 80% ethanol/water or 3: 1 ethanol/methanol. Spot 50 ⁇ l of this suspension on a slide and
  • Cells are analyzed and sorted on a flow sorter based on the properties of the cells to scatter light forward and to the side.
  • parameters are empirically established regarding the forward and side scatter properties.
  • the gain on the photomultiplier tubes detecting the forward-scattered light and the side-scattered light is adjusted in each dimension to distribute the array of signals from the cells across the channels available for analysis in a manner well known to one skilled in the art. Under these circumstances a characteristic pattern, or scattergram, is observed.
  • Analysis of blood samples reveals three major cell types in the scattergram, namely, monocytic cells, lymphocytes and granulocytes, each of which has distinguishable light scattering characteristics.
  • the monocytic cell region, the granulocytic cell region and the lymphocytic region of the scattergram are gated so that cells which are classified as monocytes, granulocytes or lymphocytes can be analyzed further or collected by flow sorting.
  • Further analysis is carried out by staining the cells with fluorescent-coupled monoclonal antibodies or by subjecting the cells to in situ hybridization with fluorescent-coupled oligonucleotide probes. Under these conditions cells that have particular light scattering properties are also analyzed for the presence of fluorescence. When fluorescent-coupled antibodies are used control experiments are performed using isotypically matched control monoclonal antibodies. When fluorescent-coupled oligonucleotide probes are used controls consist of oligonucleotide sequences unrelated to mammalian sequences.
  • a Coulter, Profile II, flow cytometer may be used to detect nucleic acids within fetal cells, using a photo-multiplier-tube- 1 (PMT-1) setting of 1100 and a PMT-3 setting of 900. Color compensation, PMT-1 minus PMT-3, may be 15%.
  • An Epics, Elite, system may be used to sort fetal cells from a specimen, e.g., of maternal blood.
  • the present invention permits the use of flow cytometry for analysis and sorting of fetal cells based on the properties of the cells to scatter light in a forward direction and to the side.
  • flow sorting is used after maternal blood has been removed from the specimen to be analyzed.
  • a preferred amount of blood is collected.
  • twenty milliliters (20 ml) of peripheral blood from a pregnant women of 10-20 weeks gestational age is collected in Vacutainer tubes containing EDTA.
  • Vacutainer tubes containing EDTA are also illustrated in those examples, and the separate collection of 1-5 ml of an umbilical cord blood sample from the birth of a male child in Vacutainer tubes containing EDTA.
  • the blood-type of the maternal blood sample and the umbilical cord blood sample were determined. Only samples which had the same blood-type were used.
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • Magnetic bead method Magnetic beads coated with anti-CD45 antibodies are added to the cells and the cells allowed to react. The magnetic beads bind mono-nuclear cells, lymphocytes and granulocytes all of which bear CD45 on their surfaces. The magnetic beads are then removed with a magnet and the unreacted cells in the supernate recovered. Hoechst dye 33258 is added as a nuclear counterstain. Examination of these cells by flow cytometry shows that they scatter light in the characteristic manner expected of mono-nuclear cells.
  • Flow Cytometer Method The cells are analyzed and sorted on a flow sorter and the cells with light scatter properties of monocytes, granulocytes and lymphocytes are collected.
  • fetal cells are found to scatter light in characteristic ways.
  • trophoblasts are found to have characteristic comparable to adult granulocytes whereas the light scattering characteristics of nucleated fetal erythrocytes are comparable to adult monocytes.
  • Fetal leukocytes have light scattering characteristic similar to those of their adult counterparts. Cells with the light scattering properties of interest are collected and are deposited on one or more slides, so that deposited cells form a monolayer.
  • examples 22 through 28 the separation of fetal cells from mixed maternal and cord blood is illustrated.
  • Thes examples apply a fluorescence activated cell sorter to perform flow cytometry and identification of the fetal cells is achieved by using a system to test the fetal cells for the presence of HbF mRNA and X and Y chromosomes.
  • the examples describe a variety of separation systems and vary the timing and frequency of the use of the system to test and detect fetal cell markers and chromosomes.
  • fluorescein is the probe dye, the dye is excited with light having a wavelength
  • a 540 bp (40) filter is used for the emitted light (for PMT-1); a 540 bp (40) filter is used; i.e., only light with a wavelength between 520 nm and 560 nm is allowed to pass.
  • the filter for PMT-3 is a 635 long pass filter; i.e., it allows any light over 635 nm wavelength to pass.
  • a marker may be used to define the cell as a fetal erythrocyte.
  • antibodies to representative fetal cell markers may be used, such as: (1) cytokeratin, (2) ⁇ - subunit of chorionic gonadotrophin, (3) fetal hemoglobin protein, (4) chorionic somatomammotropin protein (placental lactogen), (5) pregnancy-specific ⁇ -glycoprotein, and (6) ⁇ -fetoprotein.
  • Various labeled antibodies to cytokeratin are available. These include CAM 5.2 from Becton Dickinson, Catalog No. 92-0005; and anti-cytokeratin 18-FITC from Sigma Chemical Company, Catalog No. F-4772 (antibody to cytokeratin 18). Most preferably, the antibody to cytokeratin is labeled with a fluorescent moiety.
  • fetal-cell-specific RNA sequences are used as fetal cell markers.
  • Such sequences are transcripts of, e.g., the fetal hemoglobin gene, the cytokeratin gene, the ⁇ -subunit of chorionic gonadotrophin gene, the chorionic somatomammotropin gene (placental lactogen), the pregnancy-specific ⁇ -glycoprotein genes, one or more embryonic hemoglobin genes or the ⁇ -fetoprotein gene.
  • the sequences of these genes and others may be obtained from the Genetic Sequence Data Bank, GenBank, version 69.0. The loci of these sequences are provided in Table 9.
  • a DNA probe, or population of probes, embodying any of these sequences is synthesized as an oligodeoxynucleotide using a commercial DNA synthesizer such as Model 380B from Applied Biosystems, Inc.. Foster City, CA, using reagents supplied by that company.
  • Probes may be comprised of the natural nucleotide bases or known analogues of the natural nucleotide bases, including those modified to bind labeling moieties.
  • the novel methods of identifying fetal cells in a specimen using density gradient centrifugation utilize density gradient medium.
  • the density gradient medium is colloidal polyvinylpyrrolidone-coated silica (e.g.
  • Percoll Percoll
  • Nycodenz a nonionic polysucrose (Ficoll) either alone or with sodium diatrizoate (e.g. Ficoll-Paque or Histopaque), or mixtures thereof.
  • the density of the reagent employed is selected to preferentially separate the fetal cells of interest from other blood components.
  • the present invention permits detection of genetic abnormalities using a minimum number of fetal cells.
  • Fetal cells may be obtained by amniocentesis, chorionic villi sampling or other standard methods known in the art.
  • fetal cells are isolated from maternal peripheral blood, avoiding the invasion of the uterine cavity and thus precluding injury to the mother or fetus.
  • fetal cells are isolated from a percutaneous sample of umbilical cord blood.
  • the sensitivity of the present method permits drawing a smaller sample of umbilical cord blood, i.e. preferably 1-2 ml, but optionally as little as 0.2 ml, than would need to be drawn using conventional fetal cell isolation and detection techniques.
  • FIG. 3 An example of a separation of fetal nucleated red blood cells is shown in Fig. 3, consisting of parts 3 A and 3B. Each step is schematically illustrated by a numbered box, and a component or container that appears in more than one step is identified by the same reference numeral.
  • step 10 draw twenty ml of maternal peripheral blood, 18, e.g. into two conventional ten-ml EDTA anti-coagulation blood collection tubes, 12 and 14, e.g. Vacutainer tubes. Alternatively, ten ml of umbilical cord blood is drawn. The blood is transferred into a fifty-ml centrifuge tube, 16.
  • step 20 the blood sample, 18, is mixed with fifteen ml of Cell Buffer A, 22, to form a buffered sample, 24. (See Exemplary Solutions, below.) Mix well.
  • a density-gradient separation reagent 32, having a density of about 1.083, e.g. Histopaque 1083, is placed in a fifty-ml conical tube, 34, and up to twenty ml of the buffered sample, 24, is carefully layered on the top of the density separation reagent.
  • the density separation reagent may have a density from about 1.075 to about 1.095, preferably between 1.08 and 1.09.
  • step 40 the conical tube, 34, is centrifuged in a swinging-bucket rotor, 36, at 700 x g for thirty minutes at room temperature.
  • Arrow, 38 shows the direction of centrifugal force being applied to tube, 34, as illustrated. If two containers of blood sample were provided initially, then prepare and process a second density separation tube for the remaining twenty ml of diluted blood, repeating steps 30 and 40 as to the second tube. If the sample is umbilical cord blood, there would be only one such tube.
  • step 50 aspirate off and discard the top serum/buffer layer, 54. Discard this waste.
  • the buffy-coat, 56 is the interface layer at the top of the density separation reagent 52, which contains both maternal and fetal white blood cells, nucleated red blood cells, and erythroblasts. Collect the buffy-coat, 56, by pipette, 58, and transfer to a fresh fifty-ml conical tube, 62. If more than one tube, 34, of density separation material were prepared for a single patient, combine all interface layers, 56, into a single fifty-ml conical tube, 62.
  • step 60 wash the collected cell layer with Cell Buffer A, 22, by adding Cell Buffer A to the cells to make the volume forty-five ml.
  • step 70 pellet the cells in tube, 62, by centrifugation at 1000 rpm for ten minutes at room temperature.
  • step 80 resuspend the cells, this time in one ml of Cell Buffer B, 82.
  • step 90 prepare one hundred ⁇ l of anti-CD45 magnetic beads, 94, in a 2-ml microcentrifuge tube, 92, using aseptic technique as follows. (This preparation of the beads is not shown diagrammatically.) Wash the beads by adding 1.4 ml of Cell Buffer A, 22, using a magnet to retain the beads on the side of the tube. Let the tube sit undisturbed for 5 minutes. Carefully remove the wash solution with a pipette. Remove the magnet. As shown in the diagram for step 90, add to the tube, 92, the resuspended cells in tube, 64, from step 70. Incubate at room temperature for ten minutes, mixing gently.
  • step 100 apply a magnet, such as a magnetic support block illustrated diagrammatically as magnet, 102, to retain the beads, 94, against the side of the tube, 92.
  • a magnet such as a magnetic support block illustrated diagrammatically as magnet, 102
  • step 110 remove and collect the liquid by pipette, 112.
  • the cell suspension, 114 in pipette, 112, contains the fetal cells.
  • the cellular material, 118 that remains with the beads, 94, primarily contains maternal leukocytes.
  • Step 120 diagrammatically represents the transfer of the cell suspension, 114, onto a microscope slide, 122, from pipette, 112. Such a transfer would generally be done by pipette.
  • the washed fetal cell suspension may be transferred to a fresh tube (not shown), if hybridization in suspension is to be performed.
  • a bead having, for example, anti-CD45 bonded thereto instead of using a bead having, for example, anti-CD45 bonded thereto
  • the specimen may react with anti-CD45 in solution and then remove the leucocytes, which have entered into an antigen-antibody ligand with the anti- CD45, by any means which separates such an antibody, and particularly by an antibody to an epitope of the CD45 molecule (indirect negative selection).
  • the anti-CD45 is a mouse antibody
  • such a ligand-forming antibody may be, for example a sheep-anti-mouse-IgG antibody bonded to substrate that is generally solid or otherwise able to facilitate removal of the ligand complex from solution, such as an antibody-coated magnetic bead, the coated well of a container, etc.
  • the genetic abnormalities detected by the present invention may be deletions, additions, amplifications, translocations or rearrangements.
  • a deletion may be identified by detecting the absence of hybridizable binding of the probe to a target sequence.
  • a population of probes are prepared that are complementary to the nucleic acid sequence that is present in a normal fetal cell but absent in an abnormal one. If the probes hybridize to the sequence in the cell being tested, then the sequence is detected and the cell is normal as to that sequence. If the probes fail to hybridize to cellular nucleic acid, then the sequence is not detected in that cell and the cell is designated as abnormal, provided that a control sequence, such as the X chromosome, is detected in that cell.
  • An addition may be identified by detecting binding of a labeled probe to a polynucleotide repeat segment of a chromosome.
  • a genetic sequence such as an insertion in a chromosome or a karyotypic abnormality such as the trisomy of Chromosome 21 which indicates Down's Syndrome
  • a population of probes are prepared that are complementary to the genetic sequence in question.
  • the probes complementary to Chromosome 21 hybridize to three appearances of the Chromosome 21 sequence in the cell, then three occurrences of the Chromosome 21 sequence will be detected and indicate the Down's Syndrome trisomic condition.
  • the detection means is a fluorescent dye, for example, then three distinct points of fluorescence visible in each cell will indicate the trisomy condition.
  • Example 14 when an amplification of a particular DNA fragment is present, there is an increase in the intensity of the signal from a labeled probe for the sequence which is subject to amplification. Using any of a number of image analysis systems, this signal is quantified and compared to normal controls to determine whether or not a particular amplification mutation is present.
  • a translocation or rearrangement may be identified by several methods. For example, a labeled first probe may be bound to a marker region of a chromosome that does not translocate. A labeled second probe is then bound to a second region of the same chromosome (for a rearrangement) or a second chromosome (for a translocation) and subsequently binding of the first and second probes is detected.
  • a translocation may be identified by first binding a labeled probe to a marker region of a polynucleotide section of a chromosome that translocates or rearranges. Subsequently, binding of the labeled probe is detected.
  • a marker for the chromosome in question is identified, and a population of probes are prepared that hybridize to it. They are marked with a detectable label, such as a dye that fluoresces at a particular wavelength.
  • the sequence that translocates or rearranges in the abnormality being tested for is also identified, and second population of probes are prepared that identify it.
  • the members of the second population of probes are marked with a distinguishably different label, such as a dye that fluoresces at a different wavelength from the first series of labeled probes.
  • In situ hybridization is performed using both populations of probes, and the results of hybridization by each of the probe populations are compared.
  • first and second labels are coincident on virtually all cell samples, no translocation has taken place. If the first label is found not to coincide with the second label on a significant fraction of samples, then a translocation or rearrangement has taken place. See, e.g., F. Speleman, Clinical Genetics 41(4): 169-174 (1992); J. W. Gray, Progress in Clinical & Biol. Res. 372:399-411 (1991).
  • Ethanol e.g. 80% ethanol/water (v/v)
  • Other useful precipitation fixatives include acetic acid, methanol, acetone, and combinations thereof, for example ethanol/methanol mixture 3:1.
  • Other useful fixatives will be obvious to one skilled in the art. Fixatives and hybridization of fixed cells, in general, are discussed in U.S. Patent No. 5,225,326. Fixatives should provide good preservation of cellular morphology, should preserve and maintain accessibility of antigens, and promote a high hybridization efficiency. Some salts and extreme temperatures, such as waving a slide over a flame, may also function as fixatives.
  • the fixative may contain a compound which fixes the cellular components by cross-linking these materials together, for example, paraformaldehyde, glutaraldehyde or formaldehyde.
  • Cross-linking agents while preserving ultrastructure, often reduce hybridization efficiency by forming networks trapping nucleic acids and antigens and rendering them inaccessible to probes and antibodies. Some cross-linking agents also covalently modify nucleic acids, preventing later hybrid formation.
  • the hybridization solution may typically comprise a chaotropic denaturing agent, a buffer, a pore-forming agent, a hybrid stabilizing agent.
  • the chaotropic denaturing agents include formamide, urea, thiocyanate, guanidine, trichloroacetate, tetramethylamine, perchlorate, and sodium iodide. Any buffer which maintains pH at least between about 6.0 and about 8.5 and preferably between 7.0 and 8.0 may be utilized.
  • the pore-forming agent is, for instance, a detergent such as Brij 35, Brij 58, sodium dodecyl sulfate, CHAPS, Tween, Sarkosyl or Triton X-100.
  • the pore-forming agent is chosen to facilitate probe entry through plasma, nuclear membranes or cellular compartmental structures. For instance, 0.05% Brij 35 or
  • Triton X-100 will permit probe entry through the plasma membrane but not the nuclear membrane.
  • sodium deoxycholate will allow probes to traverse the nuclear membrane.
  • nuclear membrane pore-forming agents are avoided. Such selective subcellular localization contributes to the specificity and sensitivity of the assay by eliminating probe hybridization to complementary nuclear sequences when the target nucleic acid is located in the cytoplasm. Agents other than detergents, such as fixatives or salts, may serve this function.
  • Hybrid stabilizing agents such as salts of mono- and divalent cations are included in the hybridization solution to promote formation of hydrogen bonds between the nucleotide sequences of the probe and the complementary nucleotide sequences of the target nucleic acid.
  • sodium chloride at a concentration from 0.15 M to 1 M is used.
  • nucleic acids unrelated to the target nucleic acids may desirably be added to the hybridization solution.
  • Supports which may be utilized include, but are not limited to, glass, Scotch tape (3M Corporation, St Paul MN), nylon, Gene Screen Plus (New England Nuclear, Boston MA) and nitrocellulose. Most preferably, glass microscope slides are used. The use of these supports and the procedures for depositing specimens thereon is obvious to those of skill in the art. The choice of support material will depend upon the procedure for visualization of cells and the quantitation procedure used. Some filter materials are not uniformly thick and, thus, shrinking and swelling during in situ hybridization procedures is not uniform. In addition, some supports which autofluoresce will interfere with the determination of low level fluorescence. Glass microscope slides are most preferable as a solid support since they have high signal-to-noise ratios and can be treated to better retain tissue.
  • the target cell is immobilized on a solid surface, preferably a glass slide.
  • the target cell is suspended in liquid during the entire process and not immobilized on a solid surface. Use of conventional flow cytometry instruments is especially facilitated with the present invention.
  • the process comprises contacting the cell with a solution containing a probe capable of binding to a target molecule in or on the cell so that the probe with a reporter group attached binds to the target molecule and becomes cell-bound.
  • a solution comprising a structural analogue of the reporter group.
  • Analysis is achieved by performing one or more steps that will detect the reporter group on the probe bound to the cell but that will not detect the analogue bound to the cell matrix.
  • the analogue of the reporter group may be added before, together with or after the probe bound reporter group.
  • the probe and the analogue are included in the same solution.
  • the reporter group is a cyclic compound.
  • the cyclic group contains an unsaturated bond.
  • the cyclic group is an aromatic compound. It is preferred that, on a molar basis, the analogue is in excess as regards the reporter group; it is highly preferred that there be at least ten times as much analogue as reporter group.
  • the analogue competes with the reporter group for non-specific binding sites.
  • aurintricarboxylic acid (ATA) used in conjunction with a nucleic acid probe
  • an additional mechanism may involve ATA binding to the active site of proteins that would bind the reporter group.
  • the analogue is selected so that it retains most or all of the structural features of the reporter group.
  • the analogue may additionally have structural features not present in the probe.
  • the analogue should be able to permeate a cell or virus.
  • analogues that are aurin derivatives (rosolic acid derivatives)
  • the analogues have, in addition to ATA, a polar functional group such as a -CO 2 , -NH 2 , -OH, or -SO 3 group, on an aromatic group; examples are chromoxane cyanine R and Chrome Azurol S.
  • a subgroup of preferred analogues are those that block the NH 2 groups on lysines.
  • probes for multiple target sequences are simultaneously hybridized.
  • probes for HbF mRNA and for human chromosome 21 are desirably included in the contacting step, and the reporter group on the probes for HbF mRNA is detectably different from the reporter group on the probes for chromosome 21.
  • Fluorescent reporter groups are detected by exciting the reporter group with a higher energy light and then detecting the emission of some of the absorbed energy as a lower energy light.
  • Chemiluminescent reporter groups are detected by allowing them to enter into a reaction, e.g., an enzymatic reaction, that results in energy in the form of light being emitted.
  • Other reporter groups e.g., biotin, are detected because they can bind to groups such as streptavidin which are bound, directly or indirectly, to enzymes, e.g., alkaline phosphatase or horseradish peroxidase that can catalyze a detectable reaction.
  • Fluorescent groups with which the process of this invention can be used include fluorescein, coumarin, rhodamine, rhodamine derivatives including Texas Red, and phycoerythrin.
  • Chemiluminescent groups with which the process of this invention can be used include isoluminol (or 4-aminophthalhydrazide; see catalogs of Aldrich Chemical Company or Molecular Probes, Inc.).
  • detection is achieved by measuring light emitted at wavelengths between about 520 nm and
  • a preferred embodiment of the fluorimetric process further comprises a wash step prior to the detection step.
  • a wash step can be performed by centrifuging the cell out of the solution in which it is suspended, then suspending it in a wash solution, and then centrifuging it out of the wash solution.
  • a wash solution is generally a probe-free solution.
  • the solution that is used comprises a probe (containing a reporter group), an analogue of the reporter group, a free radical scavenger and a fixative.
  • a fluorescent probe that binds to a target molecule is preferably one which binds to that target with high specificity.
  • a fluorescent probe is fluorescent dye covalently attached to a nucleic acid molecule, antibody or other molecule capable of binding specifically to a target molecule.
  • an analogue is added to the cocktail, its preferred concentration is from 0.01% to 0.5% w/v (especially about 0.05 to 0.01%).
  • the invention is a kit for the detection of nucleic acids within a fetal cell in a specimen.
  • a kit may include a solution containing a fixation/hybridization cocktail and one or more labeled probes.
  • this solution may contain 50 mM guanidinium isothiocyanate, 25-40% formamide, 31% PEG, 0.4 M DTT, 15% Ficoll/PVP, 50 2 mM EDTA, 1 mg/ml salmon sperm DNA, 50 mM Tris-acetate (pH 7-8), about 5% Triton X-100, and about 20 ⁇ g/ml of a synthetic oligonucleotide probe directly labeled with a reporter molecule.
  • This solution and the probes would have measurable predefined and identified characteristics and reactivities with cells and target sequences.
  • Such a kit would also provide means and instructions for performing the hybridization reaction of the invention.
  • the kit may include: a second detectable reporter system which would react with the probe or the probe-target hybrid.
  • Any mechanical components which may be necessary or useful to practice the invention such as a solid support (e.g., a microscope slide), an apparatus to fix cells to the support, or a device to assist with any incubation or washing of the specimens.
  • a kit could also include a photographic film or emulsion with which to the record results of assays carried out with the invention.
  • Another aspect of the present invention provides a kit for the detection of fetal hemoglobin within a specimen without the removal of maternal blood cells.
  • a preferred version of this kit contains means for detecting the HbF mRNA of fetal cells.
  • the kit would also provide media for mounting slides of capillary blood smears, e.g. Slide Mount A, Slide Mount B and Slide Mounting Solution. Further, Wash Concentrate A, Wash Concentrate B and Fetal Hemoglobin Assay Solution would be provided. The concentrates mentioned herein would be diluted in use to approximately the solution concentrations stated below in Exemplary Solutions.
  • Yet another aspect of the present invention would be a kit to enrich and detect fetal cells within a blood specimen, e.g. maternal or umbilical cord blood. Such a kit may contain one or more reagents to prepare a density gradient that concentrates fetal cells. Labeled antibodies to detect or separate fetal cells and/or probes specific for fetal cell mRNA (preferably fetal hemoglobin mRNA), and means and instructions for performing fetal cell enrichment.
  • an alternative kit may contain one or more antibodies, desirably bound to a solid support and preferably bound to magnetic beads, to positively or negatively concentrate fetal cells within the specimen, preferably including an anti-CD45 antibody for negative selection of fetal erythrocytes, probes specific for fetal cell mRNA, means and instructions for performing fetal cell enrichment using density gradient centrifugation or flow cytometry, and optionally one or more reagents to prepare a density gradient that concentrates fetal cells.
  • antibodies desirably bound to a solid support and preferably bound to magnetic beads, to positively or negatively concentrate fetal cells within the specimen, preferably including an anti-CD45 antibody for negative selection of fetal erythrocytes, probes specific for fetal cell mRNA, means and instructions for performing fetal cell enrichment using density gradient centrifugation or flow cytometry, and optionally one or more reagents to prepare a density gradient that concentrates fetal cells.
  • kits described immediately above may also be provided with means for detecting one or more target nucleic acid sequences within the fetal cells, by including a second detectable reporter system which would react with the probe or the probe-target hybrid, concentrated stock solution(s) to be used directly or to be diluted sufficiently to form wash solution(s), and, optionally, any mechanical components which may be necessary or useful to practice the present invention such as a solid support (e.g.. a microscope slide), an apparatus to affix cells to said support, or a device to assist with any incubations or washing of the specimens, and a photographic film or emulsion with which to record results of assays carried out with the present invention.
  • a solid support e.g. a microscope slide
  • an apparatus to affix cells to said support e.g. a device to assist with any incubations or washing of the specimens
  • a photographic film or emulsion with which to record results of assays carried out with the present invention.
  • kit would optionally provide reagents and materials for use in an automated system for the performance of any of the methods of the present invention.
  • PEG 4000 polyethylene glycol (ca. 4000 Mol. Wt.) PBS phosphate-buffered saline solution
  • Histopaque 1083 aseptically filtered solution containing Ficoll nonionic polysucrose (type 400) and sodium diatrizoate, density 1.083
  • Brij 35 polyoxyethylene 23 lauryl ether [CAS # 9002-92-0] Brij 58 polyoxyethylene 20 cetyl ether [CAS # 9004-95-9] Tris tris(hydroxymethyl)aminomethane [CAS # 77-86-1] isoluminol 4-aminophthalhydrazide [CAS # 3682-14-2] APTO 3-aminopropyltriethoxysilane [CAS # 919-30-2] DAPI 4' ,6-diamidino-2-phenylindole hydrochloride
  • Cy5 FluoroLink Cy5 Fluorescent Dye a fluorescent cyanine dye (Biological Detection
  • Cell Buffer A (as diluted for use): 0.8% BSA, 0.1% dextrose, 0.1% sodium azide in PBS.
  • Cell Buffer B (as diluted for use): 2% BSA, 0.1% dextrose, 0.1% sodium azide in PBS.
  • Fixation solution 4 volumes ethanol, 5 volumes of PBS, 1 volume of glacial acetic acid.
  • Hybridization cocktail 5x SSC (0.75 M NaCl, 0.075 M sodium citrate); 30% formamide (v/v); 3% Triton X-100 (v/v); 0.4 M guanidinium isothiocyanate; 0.16 M sodium phosphate (pH 6); 15% Ficoll/PVP; 1 mg/ml sheared salmon or herring sperm DNA; 10 mM EDTA; 25 mM DTT; 31% PEG 4000.
  • Hybridization Temperature For hybridization cocktails used with a nucleic acid probe, the temperature for the hybridization reaction is within the range of about 20°C and about 90°C, preferably about 37°C and about 85°C, and most preferably about 40°C and about 46°C.
  • the time of the hybridization reaction is between 5 minutes and 16 hours, and preferably is less than 4 hours. More preferably, the time of the hybridization reaction is less than 120 minutes, even more preferably less than 60 minutes. Most preferably, the reaction time is less than 30
  • Wash Solution #1 has the following composition: 0.4 M guanidinium isothiocyanate; 0.1% Triton X-100 (v/v); and O.lx SSC in deionized water.
  • SSC has the following composition: 0.15 M NaCl, 0.15 M sodium citrate, pH 7.0. 2x SSC is composed so that upon a 1:1 dilution with water, SSC would be produced; lOx SSC is composed so that upon a 1:10 dilution with water, SSC would be produced.
  • Wash Solution #2 has the following composition: 0.1% Triton X-100 (v/v) and O.lx SSC in deionized water.
  • PBS has the formula, 0.136 M NaCl, 0.003 M KC1, 0.008 M Na 2 HPO 4 -7H 2 O, 0.001
  • Fluorescent-Coupled Antibodies If a dye-labeled antibody is used as the probe, then the probe may be dissolved in PBS, possibly supplemented with bovine serum albumin (BSA), while it is allowed to react with target cells, preferably at a temperature in the range 4°C to 34°C.
  • BSA bovine serum albumin
  • the cells need not be fixed (e.g., when the antibody target is a cell-surface antigen), or may be fixed after the probe-target incubation is completed, or may be fixed prior to or during the probe-target incubation.
  • Mounting Solution may be 50% PBS/50% glycerol (v/v), 0.1% 1 ,4-phenylenediamine (as an antifade) and 1 ⁇ g/ml of Hoechst 33258 or DAPI (dye).
  • the probes may be DNA or RNA or synthetic analogues to DNA or RNA.
  • the probe is capable of binding to a complementary target cellular genetic sequence through one or more types of chemical bonds, usually through hydrogen bond formation.
  • the DNA or RNA probes may be composed of the bases adenosine, uridine, thymidine, guanine, cytosine, or any natural or artificial chemical derivatives thereof.
  • the phosphate backbone is linked via ribose or deoxyribose, or an analog or derivative thereof.
  • Nucleic acid probes can be prepared by a variety of methods known to those of skill in the art.
  • the probes may be oligonucleotides synthesized with an Applied Biosystems (A.B.I.) DNA synthesizer Model 380 using the recommended A.B.I, reagents.
  • A.B.I. Applied Biosystems
  • an aminohexyl phosphate linker is desirably attached to the 5' end of the probes for the fetal-cell-specific marker, and preferably to both the 5' and 3' ends of the probes for the other sequences to be detected, e.g. chromosomal sequences.
  • the 5'- or 5', 3'- aminohexyl oligonucleotides are then respectively coupled to a selected dye and purified by HPLC. However, as illustrated in Examples below, even if only a single fluorescent label is attached to the probes, fluorescence may be detected by visual microscopy. Purified single-stranded DNA probes may alternatively be produced by the use of single-stranded phage Ml 3 or plasmid derivatives of this phage, or by reverse transcription of a purified RNA template.
  • Detectable labels may be any molecule which may be detected. Commonly used detectable labels are radioactive labels including, but not limited to, 32 P, 14 C, 125 1, 3 H and 3S S. Biotin labeled nucleotides can be incorporated into DNA or RNA by nick translation, enzymatic, or chemical means. The biotinylated probes are detected after hybridization using avidin/streptavidin, fluorescent, enzymatic or colloidal gold conjugates. Nucleic acids may also be labeled with other fluorescent compounds, with immunodetectable fluorescent derivatives or with biotin analogues.
  • Nucleic acid probes may also include any number of modified bases such as methylated bases, inosine and other naturally occurring or synthetic nucleotides. Nucleic acids may also be labeled by means of attaching a protein. Nucleic acids cross-linked to radioactive or fluorescent histone HI, enzymes (alkaline phosphatase and peroxidases), or single-stranded binding (ssB) protein may also be used. To increase the sensitivity of detecting the colloidal gold or peroxidase products, a number of enhancement or amplification procedures using silver solutions may be used.
  • RNA-DNA hybrids Poly(rA)-poly(dT).
  • DNA probes are hybridized to cells in situ and hybrids are detected by incubation with the antibody to RNA-DNA hybrids.
  • Probes may be detectably labeled prior to addition to the hybridization solution. Alternatively, a detectable label may be selected which binds to the hybridization product. Probes may be labeled with any detectable group for use in practicing the invention.
  • Such detectable group can be any material having a detectable physical or chemical property.
  • detectable labels have been well-developed in the field of immunoassays, and in general, most any label useful in such methods can be applied to the present invention.
  • Particularly useful are enzymatically active groups, such as enzymes (see Clin. Chem., 22:1243 (1976)), enzyme substrates (see British Patent Spec. 1,548,741), coenzymes (see U.S. Patents Nos. 4,230,797 and 4,238,565) and enzyme inhibitors (see U.S. Patent No. 4,134,792); fluorescers (see Clin.
  • Probe Size, Population and Concentration The length of a probe affects its diffusion rate, the rate of hybrid formation, and the stability of hybrids.
  • small probes (15-200 bases, and preferably 15-100, most preferably 15-30) yield the most sensitive, rapid and stable system.
  • a mixture of small probes as aforesaid which span the entire length of the target nucleic acid to be detected are desirably prepared. For example, if the target nucleic acid were 1000 bases long, up to about 40 "different" probes of 25 bases would be used in the hybrid solution to completely cover all regions of the target nucleic acid.
  • a particularly advantageous configuration of probes is to prepare a population of probes to a selected target sequence as follows: A first probe hybridizes to bases 1 to 25 of the sequence. A second probe hybridizes to bases 31 to 55 of the sequence. A third probe hybridizes to bases 61 to 85 of the sequence, and so on, wherein the beginning of each succeeding probe is spaced apart 5 bases from the end of the preceding probe. It has been found that such a configuration wherein 5 bases are omitted between each 25-mer probe provides optimal hybridization results and signal, when employed in hybridizations in accordance with the present invention. The concentration of the probe affects several parameters of the in situ hybridization reaction.
  • probe concentrations are used to increase diffusion, to reduce the time of the hybridization reaction, and to saturate the available cellular sequences.
  • probe concentrations of 0.005-100 ⁇ g/ml are preferable. Most preferable is use of probes at a concentration of about 0.01 ⁇ g/ml.
  • Among the genetic abnormalities that may be detected by the tests of the present invention are Down's Syndrome (trisomy 21), Turner's Syndrome (XO chromosomes), Klinefelter's Syndrome (XXY chromosomes), Edward's Syndrome (trisomy 18) and Patau Syndrome (trisomy 13).
  • the oligodeoxynucleotides were synthesized (Applied Biosystems, Inc. DNA Synthesizer Model 380B) using the recommended A.B.I, reagents, and in the last stage an aminohexyl phosphate linker was attached to the 5' end.
  • the 5 '-aminohexyl oligodeoxynucleotides were then coupled to a rhodamine dye from Molecular Probes, Inc. and purified by Waters HPLC using a baseline 810 chromatography work station.
  • the cells were deposited onto slides. Twenty to 25 ⁇ l of a hybridization cocktail consisting of 30% formamide, 5x SSC, 0.1 M sodium phosphate buffer, pH 7.4, 100 ⁇ g/ml low molecular weight, denatured, salmon or herring sperm DNA,
  • Denaturation and hybridization were carried out simultaneously by placing the slides in an incubator for 15 minutes at 85°C.
  • the first solution contained a probe for the X chromosome; the second, a probe for the Y chromosome; the third, a probe for chromosome 18.
  • Washing of the slides after the hybridization reaction is essential to eliminate background due to non-specific binding of the probe.
  • Post-hybridization the slides were placed in a Coplin jar to which was added 100 ml of the Wash Solution #1. The solution was agitated and held in this solution for 2 minutes. This wash solution was removed and Wash Solution #2 was added. This second wash solution was agitated for 5 seconds and poured off. The washing procedure with Wash Solution #2 was repeated six times. Then 15 ⁇ l of Mounting solution was added.
  • FIG. 1 A Fluorescence Detection Photomicrographs were taken on an Olympus BH10 microscope with fluorescence capabilities, using Kodak Ektachrome EES-135 (PS 800/1600) film, exposed, and push processed at 1600 ASA. A 30 to 60 second exposure time was consistently used, so that direct comparisons could be made between all photomicrographs taken. As shown in Fig. 1 A, a single point of fluorescence (a "dot") is visible in the nucleus of male amniocytes when the Y probe was used.
  • Figure 1A-1 is a photograph (40X magnification) of two Hoechst stained nuclei while Figure 1A-2 is a fluorescent photograph (100X magnification) of these same two cells.
  • Fig. 1A-1 is a photograph (40X magnification) of two Hoechst stained nuclei
  • Figure 1A-2 is a fluorescent photograph (100X magnification) of these same two cells.
  • IB shows a female amniocyte with 2 dots visible in the nuclei when the X probe was used.
  • Figure 1B-1 is a photograph of a Hoechst stained nuclei (40X magnification) while Figure 1B-2 is a photograph of this same cell viewed with fluorescence (100X magnification).
  • Figure 1C There are two dots in the nucleus when a probe for chromosome 18 was used ( Figure 1C).
  • Figure lC-1 is a photograph of a Hoechst stained nucleus, while Figure 1C-2 shows a fluorescent view.
  • the oligodeoxynucleotides were synthesized as aforesaid, and in the last stage, an aminohexyl phosphate linker was attached to the 5' end.
  • the 5 '-aminohexyl oligodeoxynucleotide probes for each of the above chromosomes were each coupled to a different fluorescent dye as indicated in Table 5 below.
  • the fluorescent dyes were obtained from Molecular Probes, Inc. and purified by a Waters HPLC using a baseline 810 chromatography work station.
  • FIG. 2A-1 is a photograph of the Hoechst stained nucleus of an amniocyte
  • Figure 2A-2 is a photograph of the fluorescence demonstrating one bright dot (X chromosome) and one bright dot (Y chromosome) in the nucleus.
  • Figures 2B-1 and 2B-2 are photographs of three additional amniocytes as photographed in Fig. 2A.
  • Fig. 2C demonstrates the results obtained using this same hybridization cocktail and normal male peripheral blood mononuclear cells when the photograph is taken through a triple band (DAPI-FTTC-rhodamine) filter set. This photograph again shows one bright dot and one bright dot for the X and Y chromosomes, respectively, on the Hoechst stained background.
  • Fig. 2D is a photograph of a pseudo color representation of the cells in Fig. 2C using an image analysis system (BioScan OptimasTM, Edmonds, Washington). EXAMPLE 3
  • Chromosomes in Embryos Prepared for In Vitro Fertilization or in Fetal Cells Obtained From Chorionic Villi
  • Cells from non-viable embryos prepared for in vitro fertilization, cells from products of conception, and cells from chorionic villi, are accessed in a standard fashion, and deposited onto glass slides.
  • the oligodeoxynucleotides are synthesized, and in the last stage an aminohexyl phosphate linker is attached to the 5' and 3' ends.
  • the 5 ',3 '-aminohexyl oligodeoxynucleotide probes for each of the above chromosomes are each coupled to a different fluorescent dye as indicated in Table 5 above.
  • the fluorescent dyes may be obtained from Molecular Probes, Inc. and purified by a Waters HPLC.
  • Brattleboro, VT; and from Omega, Inc., of Brattleboro, Vermont may be used to allow the operator to photograph two or three different colors simultaneously (as demonstrated in Example 2 above).
  • a color TV camera may optionally be used.
  • a single probe may be detected within a single cell as by the procedure used in Example 1.
  • Two probes may be detected and viewed and photographed by the procedure used in Example 2.
  • Three or more may be detected if reporter molecules fluorescing at differently detectable wavelengths are used.
  • As many different probes may be differentiated as the number of different fluorescent dyes can be distinguished by the available light filter systems.
  • Isolated white blood cells from a pregnant woman are used in the following example.
  • the cells are washed with nuclease-free PBS and placed in a single cell suspension at a concentration that results in clearly separated cells.
  • the cells are spun down to a pellet and the supernatant decanted.
  • the cells are resuspended in 0.5% paraformaldehyde and left for 12-16 hours at 4°C. After fixation, the cells are spun to remove the paraformaldehyde and then washed once in PBS and resuspended in 2x SSC. The cells are used immediately.
  • a 25-base sequence from the nitrogen reductase (NR) gene sequence is used (Table 6).
  • a 25-base sequence from the 28S gene is used (Table 6).
  • the genetic testing probes are oligodeoxynucleotides complementary to regions of human chromosomes X, Y, 1, 13, 16, 18 and 21. The details of selection, preparation and labeling of these probes are included in Table 7 below. b. Fetal cell identification probes.
  • the fetal cell identification probes (Table 8) are accessed via the Genetic Sequence Data Bank, GenBank, version 69.0 and prepared from the following gene sequences:
  • the aforesaid sequences are cut into 25-mer oligodeoxynucleotides and synthesized by a DNA synthesizer as aforesaid, and in the last stage an aminohexyl phosphate linker is attached to the 5'-end of each oligonucleotide.
  • the 5'-aminohexyl oligodeoxynucleotides are then coupled to the fluorescent dye FITC and purified by column chromatography and HPLC.
  • the Fragile X condition an amplification, is detected by the probe of SEQ ID NO:3:, which is further exemplified below in Example 14.
  • hybridization procedure For the hybridization procedure using the fetal cell identification probes, to pelleted cells is added 50 ⁇ l of a hybridization cocktail consisting of 30% formamide, 5x SSC, 0.16 M sodium phosphate buffer, pH 7.4, 1 ⁇ g/ ⁇ l sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4 M guanidinium isothiocyanate, 15% Ficoll/PVP, and the probe (a mixture of the fetal cell identification probes) added at a concentration of 2.5 ⁇ g/ml. Hybridizations are carried out in a humidified environment at 42 °C for 30 minutes. Table 8 Fetal Cell Identification Probes
  • the cells Post-hybridization, the cells are placed in a 15-ml conical tube to which is added 10 ml of Wash Solution #1. The solution is agitated until the cells are a single-cell suspension and then spun at 250xg for 5 minutes. The supernatant is removed and 10 ml of Wash
  • Solution #2 is added to the pellet.
  • the second wash solution is agitated until the cells are a single-cell suspension.
  • the cells are again spun at 250xg for 5 minutes.
  • the supernatant is removed and the cell pellet resuspended in 0.2 ml of a counterstain solution of PBS containing 0.0025% Evans Blue.
  • the cells are analyzed on a Epics Elite sorting flow cytometer (Coulter Instruments).
  • the instrument uses a 488 nm argon laser, a 525 nm band pass filter for selection of fluorescent light (FL1) and a 635 nm long pass filter for light emitted by the counterstain (FL3).
  • FL1 fluorescent light
  • FL3 counterstain
  • the sample containing the negative probe is analyzed first and the quad-stats are set so that less than 0.05% of the cells fall in the upper-right quadrant.
  • the sample hybridized with the positive probe is analyzed under the same parameters as the sample sorted with the negative probe. Cells that fall in the upper right quadrant are collected and are hybridized to determine fetal genetic characteristics.
  • NR is used as a negative control probe while the fetal cell identification probes are the positive probes, and would identify the fetal cells that circulate in maternal blood.
  • the fetal cells would, in turn, be "sorted” as described above then deposited onto glass slides. The fetal cells would then be analyzed with the genetic testing probes as described in Examples 1 and 2.
  • SEQ ID NO:4 is a 443-nucleotide sequence of three fragments taken from GenBank for the
  • HUMGLBN gene Bases 1 to 91 of SEQ ID NO:4: are from 2179 to 2269 of HUMGLBN. Bases 92 to 314 of SEQ ID NO:4: are from 2393 to 2615 of HUMGLBN. Bases 315 to 443 are from 3502 to 3630 of HUMGLBN.
  • the population of DNA probes complementary to the target mRNA that is transcribed in the cell from SEQ ID NO:4: is prepared in accordance with the teachings herein.
  • sequences of the members of the population of probes are provided as SEQ ID NO:5: through SEQ ID NO:21:, each of which is a 25-mer oligonucleotide of DNA which is complementary to the mRNA target, which is transcribed from the genetic locus named above and more specifically exemplified as SEQ ID NO:4:.
  • Each such probe is synthesized and labelled at 5' with FITC as described herein.
  • Fig. 5 is a photomicrograph showing fetal nucleated red blood cells enriched within a maternal peripheral blood sample prepared in accordance with the procedure of Fig. 3 and hybridized to the probe population described above.
  • Cells with gray nuclei and distinctive morphology are fetal nucleated red blood cells.
  • Cells lacking nuclei are fetal erythrocytes or fetal reticulocytes which still contain fetal hemoglobin mRNA.
  • RNAs to Increase Specificity of Fetal Cell Identification
  • fetal cells express two or more particular RNAs in the same cell while maternal cells from the same specimen source do not contain both RNA species in the same cell.
  • Multiple mRNA or hnRNA species are detected simultaneously in the same cell when only the unique set of RNAs is present, so that a specific signal is detected, which uniquely identifies fetal cells.
  • cells in suspension Prior to use, cells in suspension are washed with chilled PBS and mixed thoroughly to ensure a single-cell suspension.
  • RNAs which is targeted is human chorionic gonadotropin (HCG) and transferrin receptor (TR).
  • HCG human chorionic gonadotropin
  • TR transferrin receptor
  • One or more 25-mer oligonucleotide DNA probes for the sequences for HCG identified in Table 8 is prepared and labeled with fluorescein.
  • One or more 25-mer oligonucleotide DNA probes for the sequence for TR identified in Table 8 is prepared, labeled with rhodamine.
  • a sample of maternal peripheral blood is washed with chilled PBS and mixed thoroughly to ensure a single-cell suspension placed as a smear on a microscope slide.
  • a hybridization is performed as stated above, with probes for HCG and TR.
  • the signal produced in the fetal trophoblast cells is an additive combination of the green from fluorescein and the red from rhodamine, to yield a 2x signal, which appears yellow-orange.
  • Oligomers prepared to both strands of a DNA target produce about twice the signal when compared to the signal produced when probe is made to only one strand of the DNA.
  • the ability to hybridize to both DNA strands allows simultaneous quantitation of the amount of DNA and RNA within individual cells.
  • the H9 cell line (ATCC No. 8543) is used in the following experiment. Cultured cells are washed with nuclease-free PBS and placed in a single-cell suspension at a concentration that results in clearly separated cells. The cells are spun down to a pellet and the supernatant decanted. The cells are resuspended in 40% ethanol, 50% PBS, and 10% glacial acetic acid. The cells are used immediately.
  • the aforementioned HIV sequences are cut into 30-base oligonucleotides and synthesized as phosphorothioate oligonucleotides using DNA synthesizers (Applied Biosystem DNA Synthesizer, Model 380B) and using the recommended A.B.I, reagents.
  • the polysulfurized oligonucleotides are then coupled to a fluorescent dye and purified by column chromatography and HPLC.
  • a 30-base oligonucleotide from the nitrogen reductase gene serves as the negative control probe.
  • hybridization procedure to pelleted cells is added 50 ⁇ l of an hybridization cocktail consisting of 30% formamide, 5x SSC, O.16 M sodium phosphate buffer, pH 7.4, 1 ⁇ g/ ⁇ l sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4 M guanidinium isothiocyanate, 15x Ficoll/PVP, and the probe added at a concentration of 2.5 ⁇ g/ml.
  • Hybridizations are carried out in a humidified environment at 42°C for 30 minutes.
  • the cells are placed in a 15 ml conical tube to which is added 10 ml of a wash solution, consisting of O.lx SSC, 0.4 M guanidinium isothiocyanate, and 0.1% Triton X-100 (Wash Solution #1) at a temperature of 42°C.
  • a wash solution consisting of O.lx SSC, 0.4 M guanidinium isothiocyanate, and 0.1% Triton X-100 (Wash Solution #1) at a temperature of 42°C.
  • the solution is agitated until the cells are a single-cell suspension and then spun at 250xg for 5 minutes.
  • the supernatant is removed and to the pellet is added 10 ml of Wash Solution #2 at a temperature of 42°C.
  • the solution is agitated until the cells are a single cell suspension.
  • the cells are spun at 250xg for 5 minutes.
  • the supernatant is removed and the cell pellet resuspended in 0.2 ml countersta
  • the cells are analyzed on a FACSTAR instrument (Becton Dickinson).
  • the instrument uses a 5-watt argon laser coupled to a dye head, a 525 nm band pass filter for FL1 and a 584 nm band pass filter for the Rhodamine.
  • the sample containing the negative probe is analyzed first and the quad-stats are set so that less than 0.01% of the cells fall in the upper-right quadrant or lower-right quadrant.
  • the sample treated with the HIV probes is analyzed under the same parameters as the sample analyzed with the negative probe.
  • any number of cells (above 0.01%) recorded in the upper right quadrant are scored as positive for both strands and/or mRNA. Any number of cells (above 0.01%) that are recorded in the lower right quadrant are scored positive for DNA only.
  • Percoll stock and gradient solution was prepared in adherence to the manufacturer's (Pharmacia, Uppsala, Sweden) recommendations by mixing 9 parts of Percoll with 1 part 1.5 M NaCl.
  • the density gradient Percoll solutions were prepared according to Table 10.
  • maternal blood cells were desirably fractionated into several bands using a four-layer Percoll discontinuous density gradient (Tube A, B). Bands 1 and 2 from the top of Tube B were withdrawn and then added to PBS (Tube C) and centrifuged for 5 minutes at 500xg. The cells were resuspended in PBS and centrifuged as above twice more. The pellet was resuspended in chilled 75% ethanol at a concentration at 10 6 cells/ml and used the same day or stored at 20°C.
  • Tube A, B Percoll discontinuous density gradient
  • Figures 6A and 6B show a representation of these fetal cells stained with anti-human cytokeratin 18-FITC in maternal peripheral blood as described above.
  • an indirect immunofluorescence method can be used.
  • the procedure was the same as the direct method (described above), except the cells were first incubated in a 1:200 dilution of anti-human cytokeratin (CAM 5.2 from Becton Dickinson Catalogue No. 92-0005) in buffer A/FCS for 40 minutes and washed free of the primary antibody.
  • the cells were then labeled with the secondary antibody tagged with FITC (anti-mouse IgG + IgM from goat); (Boehringer Mannheim Biochemicals Catalog No. 605- 25) for 30 minutes and washed from the residual antibody as described above.
  • the cells were scored as above.
  • the Y chromosome probes were synthetic oligodeoxynucleotides complementary to regions of human chromosome Y. The details regarding the preparation and labeling of these probes are included in Example 1 and in Table 8.
  • a hybridization cocktail For the hybridization procedure, 20 ⁇ l of a hybridization cocktail was added to the slide.
  • the cocktail contained PEG, 25% formamide, 5x SSC, 1 mg/ml salmon sperm DNA, 15x Ficoll/PVP, 0.4M guanidinium isothiocyanate, 50 mM DTT, 5% Triton X-100, 50 mM EDTA, 50 mM Na 2 PO 4 , and the Y chromosome probe at a concentration of 20 ⁇ g/ml.
  • a coverslip was applied and the slide was incubated at 85°C for 15 minutes in an incubator.
  • Figure 7 shows a cytokeratin-stained fetal cell (brightly stained cytoplasm) within maternal peripheral blood.
  • the cell has one Y chromosome within its nucleus that has stained positive following hybridization with the rhodamine labeled Y chromosome probe.
  • Trophoblasts were isolated from term placental tissue by a modified procedure of Wang et. al., American Journal of Reproductive Immunology 16:8-14 (1988). The trophoblasts were then fixed with 75% chilled ethanol, stained with anti- cytokeratin antibodies as described above (Example 6) and subsequently hybridized to Y, X and 18 chromosome-specific probes also as described above in Example 6.
  • Example 1 The origin of the probes for chromosome X, Y and 18 was described in Example 1.
  • the DNA probes were all labeled with a rhodamine derivative as described in
  • Figure 8 A shows the results with the X-chromosome probe; 8B, the Y-chromosome probe; and 8C, the chromosome- 18-specific probe.
  • the cytoplasm is stained strongly with the FITC labeled anticytokeratin antibody.
  • the nuclei in 8 A and 8B contain strong single points of light indicating the presence of single X and Y chromosomes.
  • the nuclei in 8C contain two strong points of light indicating the presence of two chromosomes 18.
  • EXAMPLE 8 Use of Fetal-Cell-Specific DNA Probes to Detect Fetal-Cell-Specific mRNA in Cells Obtained from Amniotic Fluid and/or Placenta
  • the aforementioned sequences were cut into several 39-base-oligonucleotides and synthesized as phosphorothioate oligonucleotides using DNA synthesizers (Applied Biosystems DNA Synthesizer, Model 380B) and using the recommended A.B.I, reagents.
  • the polysulfurized oligonucleotides were then coupled to a FITC (Molecular Probes, Inc. Catalogue No. 1-2) or rhodamine (Catalogue No. T488) and purified by column chromatography and HPLC.
  • FITC Molecular Probes, Inc. Catalogue No. 1-2
  • rhodamine Catalogue No. T488
  • a hybridization cocktail was added to each slide.
  • the cocktail consisted of 31% PEG, 25% formamide, 5x SSC, 1 mg/ml salmon sperm DNA, 15% Ficoll/PVP, 0.4M guanidinium isothiocyanate, 50 mM DTT, 5% Triton X-100, 50 mM EDTA, 50 mM Na 2 PO 4 , and probe at a concentration of 20 ⁇ g/ml.
  • a coverslip was applied to each slide and was incubated for 30 minutes at 42°C.
  • Figure 9A shows the results when using the cytokeratin probes to analyze amniocytes ( Figure 9A-1) and trophoblasts ( Figure 9A-2).
  • Figure 9B shows the results when using the HCG probes to analyze amniocytes (Figure 9B-1) and trophoblasts ( Figure 9B-2).
  • Figure 9C shows the results when using the ⁇ -fetoprotein probes to analyze amniocytes ( Figure 9C-1) and trophoblasts ( Figure 9C-2).
  • Placental trophoblasts were isolated from term placenta and were fixed in 75% chilled ethanol as described in Example 2. The fixed cells were stained with anti-cytokeratin and isotope-control antibodies, both labeled with FITC as stated in Example 6 and analyzed by flow cytometry.
  • the cells were analyzed on a Profile II system (Coulter Instruments).
  • the instrument uses a 488 nm argon laser, a 525 nm band pass filter for FLl. For each sample tested, the
  • EXAMPLE 10 Use of HIV DNA Probes to Detect HTV mRNA in Placental Fetal Trophoblasts or Amniocytes
  • Trophoblasts are isolated from term placental tissue by a modified procedure as described in Example 7. Amniocytes are obtained through amniocentesis. The H9 HIV cell line and peripheral blood polymorphonuclear cells served as positive and negative controls, respectively. These cells are washed with nuclease-free PBS and are placed in a single-cell suspension at a concentration resulting in clearly separated cells. The cells are spun down to a pellet and the supernatant decanted. The cells are resuspended in 0.5 % paraformaldehyde and left for 12-16 hours at 4°C. After fixation, the cells are spun to remove the fixative and then washed once in PBS and resuspended in 2x SSC. The cells are used immediately.
  • HIV HUMBH102 Fluorescein Twenty separate HPV probes (10 for HPV type 16 and 10 for type HPV 18) and 180 HIV probes are synthesized by cutting the HIV sequences into several 39-base oligonucleotides and synthesized as phosphorothioate oligonucleotides using DNA synthesizers (Applied Biosystems DNA Synthesizer, Model 380B) and using the recommended A.B.I, reagents. The phosphorothioate oligonucleotides are then coupled to FITC and purified by column chromatography and HPLC.
  • hybridization procedure to pelleted cells was added 50 ⁇ l of an hybridization cocktail consisting of 30% formamide, 5x SSC, O.16M sodium phosphate buffer, pH 7.0, 1 ⁇ g/ ⁇ l sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4M guanidinium isothiocyanate, 15x Ficoll/PVP, and the probe added at a concentration of 2.5 ⁇ g/ml. Hybridizations were carried out in a humidified environment at 42°C for 30 minutes.
  • the cells were placed in a 15 ml conical tube to which was added 10 ml of Wash Solution #1 (heated to 42°C). The solution was agitated until the cells were a single-cell suspension and then spun at 250xg for 5 minutes. The supernatant was removed and to the pellet was added 10 ml of Wash Solution #2 (heated to 42°C). The second wash solution was agitated until the cells were a single-cell suspension. The cells were spun at
  • the cells were analyzed on a Profile II system as aforesaid.
  • the instrument uses a 488 nm argon laser, a 525 nm band pass filter for FLl and a 635 nm band pass filter for FL3.
  • a preferred embodiment of the present invention employs oligonucleotide probes that are labeled with multiple reporter moieties, such as fluorescent moieties. This Example describes the preparation of such probes.
  • Two hundred ⁇ g of dried oligonucleotide is dissolved in 100 ⁇ l of 250 mM Tris buffer pH 7.4, to form a first solution.
  • One mg of iodoacetamido-fluorescein is combined with 100 ⁇ l of dry DMF to create a 200- ⁇ l reaction mixture.
  • the two solutions are mixed together and shaken overnight. This results in an oligonucleotide to acetamido-fluorescein ratio of 1:5 in the reaction mixture.
  • One mg of iodoacetamido-fluorescein is again combined with 100 ⁇ l of DMF, and this 100 ⁇ l is combined with the 200 ⁇ l of reaction mixture.
  • each first strand probe will be complementary (in nucleotide sequence) to one-half of one second strand probe and the other half (15 nucleotides) of that first strand probe will be complementary to a portion of another second strand probe. Staggering of the probes means that, because of the shortness of the overlap (10 nucleotides), probes of the first strand will not hybridize significantly to probes of the second strand. On the other hand, about twice as much hybridization is detected as compared to the situation where only probes corresponding to one strand are used.
  • Probes are made as phosphorothioate oligonucleotides, each 30-mer having four sulfur atoms, using an Applied Biosystem (ABI) DNA Synthesizer, Model 380B and the recommended A.B.I, reagents.
  • the sulfur atoms are located as follows: one is at the extreme 5' end of the probe, a second is between the 7th and 8th nucleosides (counting from the 5' end), the third is between the 22nd and 23rd nucleosides, and the fourth is between the 29th and 30th nucleosides.
  • the sulfur atoms of the polysulfurized oligonucleotides are then coupled to a fluorescent dye, iodoacetamido-fluorescein, as follows (smaller amounts can be synthesized by adjusting the volumes): 200 ⁇ g of dried oligonucleotide is dissolved in 100 ⁇ l of 250 mM Tris buffer, pH 7.4 to form a first solution. Then 1 mg of iodoacetamido- fluorescein is combined with 100 ⁇ l of dry dimethylformamide (i.e., 100 percent DMF) in a second solution. The two solutions are mixed together and shaken overnight.
  • a fluorescent dye iodoacetamido-fluorescein
  • the labeled oligonucleotide is precipitated with ethanol and 3 M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye. The desired fractions are then collected. The liquid phase is then removed under vacuum. The crude material is then purified with HPLC (high performance liquid chromatography).
  • the hybridization cocktail is modified as follows: 1.5% PEG is used instead of 31% PEG, 30% formamide is used instead of 21% formamide, 10% DMSO (10% v/v) is included, and 5% (v/v) of vitamin E is included. Also instead of adding 50 ⁇ l of the hybridization cocktail to the slide, 40 ⁇ l of the cocktail is added to 5 ⁇ l of squalene plus 5 ⁇ l of pyrrolidinone and the combined 50 ⁇ l is added to the slide.
  • White blood cells from peripheral blood or bone marrow from patients with chronic myelogenous leukemia are deposited onto glass slide by the cytospin method.
  • the oligodeoxynucleotides are synthesized and labeled as described in Example 1.
  • the cells are deposited onto slides. 20 to 25 ⁇ l of a hybridization cocktail consisting of 31% PEG, 30% formamide, 5x SSC, 0.1 M sodium phosphate buffer, pH 7.4, 100 ⁇ g/ml low molecular weight, denatured, salmon or herring sperm DNA, 10% (v/v) Triton X-100, 10% DMSO, 15% Ficoll/PVP, 0.4 M guanidinium isothiocyanate, 10 mM DTT, and 0.025 M EDTA and the probe added at a concentration of 20 ⁇ g/ml is applied. A coverslip is applied and the slide is heated to 95 °C for 5 minutes, allowed to cool to 42°C. and incubated for 25 minutes at that temperature.
  • a hybridization cocktail consisting of 31% PEG, 30% formamide, 5x SSC, 0.1 M sodium phosphate buffer, pH 7.4, 100 ⁇ g/ml low molecular weight, denatured, salmon or herring sperm DNA, 10% (v
  • the probes for the bcr gene are prepared such that they span the break point cluster region to include both the 5' and the 3' ends of the gene, when a translocation occurs there are three points of light ("dots") within the cell.
  • dots three points of light
  • One bright dot would represent the unaffected chromosome and two less intense dots would represent the un-translocated 5' bcr gene while the second less intense dot would represent that 3' end of the bcr gene that translocated to Chromosome 9.
  • sequences from the c-abl gene that translocate to Chromosome 22 are accessed and prepared as described above. These sequences are labeled with a second fluorescent moiety and added to the hybridization solution. Now when a translocation occurs, one positive signal (representing the 5' end of the bcr gene still on Chromosome 22) would appear in one color (e.g., green) and adjacent to another positive signal (representing the c-abl gene that translocated to Chromosome 22) which would appear in a second color (e.g., red).
  • Two ml of Amniotic fluid is diluted to 10 ml with PBS and centrifuged at 1200 rpm for 10 minutes.
  • the resultant cell pellet is suspended in 800 ⁇ l of ethanol and methanol (v:v, 3:1). 200 ⁇ l of the sample is deposited on each slide by the cytospin method.
  • approximately 5,000 peripheral blood mononuclear cells obtained from a normal male are deposited onto a glass slide by the cytospin method.
  • Hybridization, Washing and Detection Hybridization, washing and detection are done as described in Examples 1 and 13.
  • the Fragile X syndrome is caused by mutations that increase the size of a specific DNA fragment (containing a lengthy CGG repeat) of the X chromosome (in Xq27.3). See, e.g., Francois Rousseau, M.D. et al., N EngI J Med, 325:1673-1681 (1991).
  • this signal is quantified and compared to normal controls to determine whether or not a Fragile X chromosome, i.e., an amplification of CGG, is present.
  • image analysis systems include, for example: ACAS 570 from Meridian Instruments, Okemos, MI; and instruments from Perseptive Systems, Inc., League City, TX; and Applied Imaging, Santa Clara, CA.
  • a sample consisting of 20 ml of maternal peripheral blood is diluted to 35 ml with buffer solution A and overlaid on top of 15 ml Histopaque- 1083 in a 50-ml conical tube.
  • the tube is centrifuged at 700 x g for 30 minutes, and the interphase layer is collected into a fresh 50-ml conical tube, the volume then being brought up to 40 ml with buffer A.
  • the conical tube is then centrifuged for 10 minutes at 1000 rpm (200 x g).
  • the cell pellet is re ⁇ suspended in 1 ml of buffer solution B and mixed with pre-washed immunomagnetic beads coated with anti-CD45.
  • the bead/cell mixture is allowed to react for 10 minutes, during which the unwanted leucocytes are reacted to the beads while nucleated red blood cells (NRBCs) stay in the solution.
  • a magnetic particle concentrator is applied to the side of the reaction tube. The magnetic beads and material complexed thereto collect on the side of the reaction tube adjacent the magnet. The supernatant fluid, containing NRBCs, is then poured off, cytospun, fixed for 5 minutes in 80% ethanol and used for in situ hybridization.
  • Example 15 The procedure of Example 15 is performed, but with the following modification: Instead of using immunomagnetic beads coated with anti-CD45, a cocktail containing immunomagnetic beads coated with monoclonal antibodies against various components of maternal blood (but not fetal erythrocytes) is used to effectively remove the non-fetal cells as well as platelets from the specimen, leaving behind the fetal target cells.
  • the following procedure may be performed: Perform a density separation on a sample of umbilical cord blood as in Example 4. Resuspend the buffy-coat in 1 ml of Buffer Solution B. Prepare a control slide by cytospinning 50 ⁇ l of this cell suspension and fixing by dipping slide in 3:1 ethanol/methanol. Prepare a test slide by removing a sample of 1 x 10 6 cells from the aforesaid buffy-coat resuspension and adding 20 ⁇ g of the antibody to be tested, coupled to magnetic beads. Prepare the cells as described in Example 6.
  • Example 6 Perform microscopic examination of slides as in Example 6 and determine the ratio of fetal nucleated red blood cells to total cells on each slide. If the ratio for the test slide is between 75% and 125% of the corresponding ratio for the control slide, the antibody is considered acceptable. For example, an acceptable result would be a control slide having 5 NRBCs per 10,000 cells and the corresponding test slide having 4 NRBCs per 10,000 cells.
  • a 20-ml sample of maternal peripheral blood is diluted to 36 ml with buffer solution
  • the tube is centrifuged at 700 x g for 30 minutes, and the interphase layer (buffy-coat) is collected into a fresh conical tube. The volume is then brought up to 40 ml with buffer solution A and the tube is centrifuged for 10 minutes at 200 x g. The cell pellet is re-suspended in a solution containing monoclonal antibody.
  • the monoclonal antibody is anti-CD45 or a mixture of monoclonal antibodies selected from the group consisting of anti-CD45, anti-CD34, anti- CD ⁇ , anti-CD31, and anti-CD44 in a 1-ml reaction volume.
  • the cells are allowed to react with the antibody for 30 minutes at 4°C.
  • the mixture is then microcentrifuged at 500 rpm for 5 minutes, and the supernatant is aspirated off.
  • the cell pellet is washed with 1400 ml of the reaction buffer (buffer solution A), and the pellet is re-suspended in 1 ml buffer solution B.
  • the cell suspension is then mixed with pre- washed bends coated with sheep anti-mouse IgG, and the mixture is allowed to react for 10 minutes during which most of the non- wanted cells (leucocytes and erthyrocytes) react with the beads, forming cell/bead complexes.
  • the complexes are then removed from the reaction by a magnetic particle concentrator, which collects the complexes on the side of the reaction tube.
  • the supernatant containing NRBCs is directly loaded on cytospin to make slides.
  • the slides are fixed with 80% ethanol and used for fluorescent in situ hybridization.
  • Slides prepared in accordance with Examples 15, 16 and 17 are hybridized on slides in a single step using probes for fetal hemoglobin mRNA as in Example 3 and probes for human chromosomes as in Example 4.
  • Fig. 10 shows a fetal nucleated red blood cell that was hybridized simultaneously to DNA probes specific to fetal hemoglobin mRNA as described in Example 4, part B and to probes for human chromosomes X and Y as described in Example 4, part A.
  • the greenish cytoplasm indicates that the cell is a fetal nucleated red blood cell, due to signal from fluorescein-labeled probe for HbF mRNA.
  • the green dot within the nucleus is a signal for X chromosome, from fluorescein-labeled probes for X.
  • the red dot within the nucleus is a signal for Y chromosome, from rhodamine-labeled probes for Y.
  • An alternative procedure for detecting fetal cells is to perform the procedure of Example 18, modified as follows: Instead of using DNA probes to fetal hemoglobin mRNA, monoclonal antibody against fetal hemoglobin protein (Accurate Chemical, cat. no. IRXG- 11149) is used. Enriched cells are fixed in 2% paraformaldehyde for two hours, washed free of fixative and reacted with a 1:100 dilution of anti-HbF antibody for 30 min. The amount of antibody added is 2-20 ⁇ g per million fetal erythrocyte cells in the sample. The excess antibody is removed by washing the cells twice with PBS. Next the cells are stained for 30 min.
  • monoclonal antibody against fetal hemoglobin protein (Accurate Chemical, cat. no. IRXG- 11149) is used. Enriched cells are fixed in 2% paraformaldehyde for two hours, washed free of fixative and reacted with a 1:100 dilution of anti-
  • Example 18 a monoclonal antibody that selectively binds to the anti- HbF antibody (Euro-Path, Ltd.) and that is tagged with alkaline phosphatase. Excess antibody is removed by washing with PBS, and Vector Red as a substrate (Vector Chemical Co.) is added to the cells. In a later step, excess substrate is washed off. The cells are cytospun on glass slides and used for in situ hybridization, as in Example 18.
  • a monoclonal antibody that selectively binds to the anti- HbF antibody (Euro-Path, Ltd.) and that is tagged with alkaline phosphatase. Excess antibody is removed by washing with PBS, and Vector Red as a substrate (Vector Chemical Co.) is added to the cells. In a later step, excess substrate is washed off. The cells are cytospun on glass slides and used for in situ hybridization, as in Example 18.
  • Maternal blood specimens are treated with 0.075 M KC1 for 15 min at 37°C. This treatment selectively lyses maternal erythrocytes, leaving intact all nucleated cells present in the sample.
  • the lysate is then contacted with beads coated with anti-CD45 or, more generally, with one or more antibodies against cell surface antigens of maternal blood cells.
  • the mixture is allowed to react.
  • the beads along with cells ligated thereto are then removed from the mixture with a magnetic particle collector.
  • the remaining liquid, containing primarily fetal nucleated erythrocytes, is used to make cytospun slides as described hereinabove. This procedure may be performed entirely in an automated device.
  • EXAMPLE 21 In Situ Amplification for Fetal Cell Detection
  • Fetal cells contain unique mRNAs, or mRNA species which are produced in cell types which do not normally contain the particular mRNA species.
  • the detection of these RNAs can serve to identify cells, or even subcellular fractions as fetal or embryonic in origin. While certain RNA populations are present in high abundance (e.g., fetal hemoglobin in fetal nucleated red blood cells), other fetal- or embryonic-specific RNAs are present in low abundance, either alone or even when considered as a population of fetal-specific RNAs.
  • the ability to detect rare mRNAs or hnRNA and thereby identify fetal cells may be enhanced by amplifying the rare RNA population using one of the available amplification techniques such as 3SR, LCR, Q-Beta Replicase, Strand Displacement Assay, PCR, and the like.
  • cells may be obtained from umbilical cord blood, maternal peripheral blood, amniotic fluid, chorionic villus samples, etc.
  • Cellular samples may be used directly or may be concentrated to enrich the population of fetal cells prior to analysis.
  • Cells may be fixed in common precipitating fixatives or cross-linking fixatives or may be used in the following test without fixation.
  • the procedure may be carried out with cells deposited onto a solid support such as a glass microscope slide or used with the cells in suspension. Prior to use, cells in suspension may be washed with chilled phosphate-buffered saline (PBS), and mixed thoroughly to insure a single-cell suspension.
  • PBS chilled phosphate-buffered saline
  • a "first strand mix" is freshly prepared, comprising 5 ⁇ l of 10 X first strand buffer (1.4 M KC1, 0.5 M Tris- HC1 pH 8.1 at 42°C, 80 mM MgCl 2 ), 5 ⁇ l dithiothreitol (DTT), 5 ⁇ l 5 mM deoxynucleoside triphosphates (dNTPs), 25 pmol of each forward primer, 80 units RNase inhibitor (RNasin, Promega Corporation, Madison, WI) and water to a total volume of 28 ⁇ l.
  • the dNTPs comprise an equimolar mixture of deoxy triphosphates of A, T, G and C.
  • the cells are heated to 65°C for 3 minutes then cooled on ice.
  • the "first strand mix” is added, followed by 40 units of reverse transcriptase (Super RT AMV Reverse Transcriptase, HT Biotechnology Ltd., Cambridge, United Kingdom).
  • the cells and reagents are mixed and incubated at 42°C for 1 hour, then for cells in suspension, the cells are spun down, washed in 200 ⁇ l PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1 M glycine) and resuspended in 20 ⁇ l of the same buffer for use immediately in PCR; for cells on slides, the slides are washed in PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1 M glycine) and left in the same buffer for use immediately in PCR.
  • Primers either consist of RNA-specific primers or random primers and oligothymine (dT).
  • Reactions are conducted either directly on glass microscope slides or in 50- ⁇ l volumes in 0.5 ml Sarstedt tubes containing 10 ⁇ l of the fixed template cells in PBS/0.1 M glycine buffer, 25 pmol back primer, 25 pmol forward primer, 200 ⁇ M dNTPs, 5 ⁇ l 10 X Taq polymerase buffer (Promega Corporation, Madison WI) and 2.5 units of Taq polymerase.
  • the slides/tubes are subjected to 10 to 40 cycles of PCR with denaturation at 95°C and extension at 72°C for 1 minute each. Annealing is for 1 minute at temperatures ranging from 60°C to 72°C.
  • a terminal cycling oven (M.J. Research, Watertown MA) is used for the cells in solution and an inverted heat block on a standard thermal cycler (Perkin Elmer, Norwalk, CT) is used for the slides, with the slides coverslipped with mineral oil sealing the edges of the coverslip.
  • cells are spun down, washed in 200 ⁇ l PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1M glycine) and resuspended in 20 ⁇ l of the same buffer for use immediately with in situ hybridization analysis; for cells on slides, the slides are washed in PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1 M glycine) and left in the same buffer for use immediately with in situ hybridization analysis.
  • PBS pH 7.2
  • PBS/0.1M glycine 0.1 M glycine
  • Cells which contain fetal-specific RNAs are either detected directly when using fluorescently labeled primers, are detected through a second-step detection process when primers are used which are labeled with biotin or digoxigenin, or are detected after hybridization to the amplified material, for example using the in situ hybridization system of U.S. Patent 5,225,326.
  • Twenty microliters (20 ⁇ l) of the cord sample is added to the 20 ml of the maternal sample.
  • Ten milliliters (10 ml) of the sample is thoroughly mixed and diluted to thirty milliliters (30 ml) with 2 volumes of Cell Buffer A (CBA).
  • CBA Cell Buffer A
  • the diluted sample is then layered on a density gradient material, at room temperature, consisting of 15 ml Histopaque-1107 (Ten Milliliters (10 ml) Histopaque-1119 plus Five Milliliters (5 ml) Histopaque 1083) which has a density of 1.086 g/ml.
  • Centrifugation for thirty 30 minutes at 700 g (1900 rpm) at 22 C without brake and separation are carried out according to the manufacturer's instructions.
  • the buffy-coat of cells is then collected and washed once with CBA. Magnetic beads containing anti-CD45 antibodies are added to the cells and allowed to react. Unreacted cells in the supernate are removed and Hoechst dye is added to the cells as a nuclear counterstain.
  • the cells are then analyzed and sorted on a flow sorter based on forward and side scatter properties of the cells.
  • Cells which are classified as monocytic or lymphocytes are collected by flow sorting. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that the cells did not overlap one another.
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • CBA Cell Buffer A
  • the diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) that has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with FITC are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and Hoechst dye.
  • CBA Cell Buffer A
  • the cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytes or lymphocytes, and (iii) the cells are NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another. Testing with Detection System
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • the cells are hybridized in solution with either of the detection HbF system to detect the HbF mRNA positive cells ("F+"); when the FCI-ID system is used, the presence of the X and Y chromosomes within the cells is also detected. Following hybridization the cells are washed. Flow Cytometer Use and Interpretation
  • the cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytic or lymphocytes, and (iii) the cells are POSITIVE to the HbF mRNA probe. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another.
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • CBA Cell Buffer A
  • the diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with PE are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and fixed with 0.5% paraformaldehyde overnight at 4 C.
  • CBA Cell Buffer A
  • the cells are hybridized in solution with either the detection HbF or system to detect the HbF mRNA positive cells ("F+"); when the FCID-ID system is used the presence of the X and Y chromosomes within the cells is also detected. Following hybridization the cells are washed.
  • the cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytes or lymphocytes, (iii) the cells are POSITIVE to the HbF mRNA probe, and (iv) the cells were NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another.
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • CBA Cell Buffer A
  • the diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with PE are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and fixed with 0.5% paraformaldehyde overnight at 4 C.
  • CBA Cell Buffer A
  • the cells are hybridized in solution with either the detection HbF/HbA or system to detect the HbF mRNA positive cells ("F+”) and the HbA positive cells ("A+"); when the FCI-ID system is used the presence of the X and Y chromosomes within the cells are also detected. Following hybridization the cells are washed.
  • the cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytic or lymphocytes, (iii) the cells are POSITIVE to the HbF mRNA probe, (iv) the cells are NEGATIVE to the HbA mRNA probe, and (v) the cells are
  • NEGATIVE to the CD45 antibody Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another.
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • CBA Cell Buffer A
  • the diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with PE (or FITC) are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and fixed with 0.5% paraformaldehyde overnight.
  • CBA Cell Buffer A
  • the cells are hybridized in solution with the detection HbA system to detect the HbA positive cells ("A+"). Following hybridization the cells are washed.
  • the cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytic or lymphocytes, (iii) the cells are NEGATIVE to the HbA mRNA probe, and (iv) the cells are NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
  • nRBC nucleated red blood cells
  • F+ fetal hemoglobin mRNA
  • CBA Cell Buffer A
  • the diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Percoll, etc.) which has a density of 1.086 gm/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with FITC are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and Hoechst is added to the cells as a nuclear counter-stain.
  • CBA Cell Buffer A
  • the cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as multi-nucleated or trophoblasts, and (iii) the cells are NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
  • TR+ trophoblast-specific mRNA positive cells
  • Vacutainer tubes containing EDTA Vacutainer tubes containing EDTA.
  • the diluted sample was then layered on a density gradient material (e.g.,
  • Ficoll-Hypaque, Percoll, etc. which has a density of 1.086 gm ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. A portion of the buffy-coat was then mixed with anti-CD45 antibodies labeled with PE (or FITC) are added to the cells and allowed to react.
  • PE or FITC
  • the cells treated with anti-CD45 were sorted to select cells that are positive with respect to staining by the antibody.
  • the cells are then analyzed and sorted on a flow sorter based on the fact that the cells have forward and side scatter properties of cells which would be classified as having monocytic, lymphocytic or granulocytic properties.
  • the proportion of cells in each light-scattering class staining positive with the anti-CD45 antibody was determined and the results are presented in the table below. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
  • a portion of the cord sample (1.5 ml) was added to 15 ml of the adult sample.
  • the sample was thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA).
  • CBA Cell Buffer A
  • the diluted sample was then layered on a density gradient material (e.g., Ficoll-Hypaque, Percoll, etc.) which has a density of 1.086 gm/ml. Centrifugation and separation are carried out according to the manufacturer's instructions.
  • the buffy-coat of cells is then collected and washed once with CBA.
  • a portion of the buffy-coat was then mixed with anti-CD45 antibodies labeled with PE (or FITC) and allowed to react.
  • Another portion of the buffy-coat cells was subjected to flow sorting without anti-CD45 treatment.
  • a final portion of the buffy-coat cells were reacted with magnetic beads coated with anti-CD45 antibodies which were then removed with reacted cells attached prior to flow sorting.
  • the cells were then analyzed and sorted on a flow sorter based on the fact that the cells have forward and side scatter properties of cells which would be classified as mono-nuclear.
  • the cells treated with anti-CD45 were also sorted to select cells that are negative with respect to staining by the anti-CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:5: TCAGTGGTAT CTGGAGGACA GGGCA 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • MOLECULE TYPE CDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:7: GCCAGGAAGC CTGCACCTCA GGGGT 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:8: GAATTCTTTG CCGAAATGGA TTGCC 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ATGCAGCTTG TCACAGTGCA GTTCA 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:12: CTCAGCTGGG CAAAGGTGCC CTTGA 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:14: TCCCAAGGAA GTCAGCACCT TCTTG 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:15: CCATGTGCCT TGACTTTGGG GTTGC 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:17: GTTGCCAAAG CTGTCAAAGA ACCTC 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:18: TGGGTCCATG GGTAGACAAC CAGGA 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:20: TCTTCCACAT TCACCTTGCC CCACA 25
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:21: GGCTTGTGAT AGTAGCCTTG TCCTC 25

Abstract

Fetal cells may be obtained from amniocentesis, chorionic villi sampling, percutaneous umbilical cord sampling or in vitro fertilization embryos or products of conception, but are preferably from maternal peripheral blood. Fetal cells may be enriched by density gradient centrifugation. Fetal cells may also be enriched by removing maternal cells with an antibody to a cell surface antigen, e.g., anti-CD45, either immobilized or by fluorescence-activated cell sorting. Fetal cells are also distinguishable from maternal cells by staining, e.g., with a labeled antibody to cytokeratin or to fetal hemoglobin, or for fetal hemoglobin by hematoxylin/eosin, or by in situ hybridization to detect one or more fetal mRNAs, e.g., of fetal hemoglobin or fetoprotein. Amplification may be used in conjunction with the in situ hybridization. Fetal cells circulating in maternal blood may be separated by flow cytometry, sorting on their intrinsic light scattering properties. Fetal nucleated erythrocytes may be identified by a label for fetal hemoglobin. Fetal cells may be treated to determine genetic characteristics or abnormalities, infectious agents or other properties by nucleic acid hybridization. Genetic abnormalities may include deletions, additions, amplifications, translocations or rearrangements. Multiple abnormalities may also be detected simultaneously, and they may be visually distinguished by color. Kits are provided for the disclosed procedures.

Description

ENRICHING AND IDENTIFYING FETAL CELLS IN MATERNAL BLOOD FOR IN SITU HYBRIDIZATION
TECHNICAL FIELD This invention generally pertains to a method of enriching fetal cells from maternal blood and to a method for identifying such fetal cells, and further to a process whereby such cells are specimens in an in situ hybridization to detect nucleic acid sequences of clinical interest, e.g. to identify the sex of a fetus, and to detect genetic abnormalities and/or viral infections in fetal cells.
BACKGROUND ART The sex of a human fetus and certain fetal chromosomal abnormalities are conventionally detected or confirmed by directly examining the chromosomes in fetal cells by cytogenetic analysis or by testing for specific sequences of DNA within the chromosomes using nucleic acid analysis. These tests require the collection and culturing of living cells obtained through an outpatient surgical procedure involving some risk to the mother or fetus. Cells, which have been shed from the fetus, may be obtained by amniocentesis. Amniocentesis involves inserting a needle through the abdominal wall into the uterus and withdrawing a small amount of amniotic fluid. An alternative procedure involves sampling the tissue of chorionic villi from the surface of the placenta by inserting a catheter through the cervix or abdomen. However, spontaneous miscarriage or other serious complications may occur in about 0.5% of amniocentesis procedures and about 1% of chorionic villi procedures. Fetal cells collected by amniocentesis or chorionic villi sampling are conventionally grown in culture for several days and then examined for abnormalities. Various kinds of fetal cells have been characterized. Fetal cells include, but are not limited to, fetal erythrocytes, lymphocytes and trophoblasts. Trophoblasts include cytotrophoblast and syncytiotrophoblast cells and cells which may be sampled from embryos produced by in vitro fertilization techniques. As used herein, the term "erythrocytes" includes erythroblasts, normoblasts and reticulocytes, as well as erythrocytes, unless the contrary is clear from the context.
It is known that a small number of fetal cells circulate in the mother's blood. About one in 4,000 to 7,000 fetal erythrocytes in maternal blood circulation is a fetal nucleated red blood cell. Methods for detecting certain of the fetal cells and/or separating them from the mother's blood have been reported. See, e.g., S.C. Yeoh et al., Prenatal Diagnosis 11:117- 123 (1991); U.W. Mueller et al., Lancet 336:197-200 (1990) (isolation of fetal trophoblasts by murine monoclonal antibodies); J.O. Price et al., Am. J. Obstet. Gynecol. 165:1731-37 (1991) (fetal nucleated erythrocytes were flow sorted on the basis of four parameters: cell size, cell granularity, transferrin receptor, and glycophorin-A cell surface molecule); PCT Publication No. WO 91/07660 to Childrens Medical Center Corp.(a method for isolating fetal nucleated erythrocytes by means of an antigen present on the cell surface of the fetal erythrocytes); PCT Publication No. WO 91/16452 of Cellpro Incorporated; and United States Patent No. 5,153,117 (a method for selectively recovering fetal cells from a maternal blood sample where cells of the sample are combined with a first and second antibody labeled with different fluorochromes).
For background on nucleic acid genetic testing, see e.g., P.G. McDonough, Sem. Perinatal. 9:250-256 (1985), and W.G. Butler, et al, Fertility & Sterility 51:375-386.
Nucleic acid hybridization techniques are based on the ability of single-stranded DNA or RNA to pair, i.e. hybridize, with a complementary nucleic acid strand. This hybridization reaction allows the development of specific probes, or populations of probes, that can identify the presence of specific genes (DNA) or polynucleotide sequences of the transcription of those genes (RNA).
By the use of specific nucleic acid (RNA or DNA) probes, genetic markers for the gender or other genetic characteristic of the fetus and for infection and other disease states may be detected. Certain genetic diseases are characterized by the presence of genes absent in normal tissue. Other disease conditions are characterized by the expression of RNAs or RNA translation products (i.e. peptides or proteins) which are not expressed in normal cells. Some disease states are characterized by the absence of certain genes or portions of genes, or the absence or alteration of expression of gene products or proteins. Moreover, it is often desired to characterize the gender of animal fetuses, such as bovine fetuses, as well as human.
Solution hybridization methods that require the destruction of the cell and the isolation of the nucleic acids from the cell before carrying out the hybridization reaction sacrifice cellular integrity, spatial resolution and sensitivity of detection. Where relatively few cells are available for isolation, as with fetal cells circulating in maternal blood, solution hybridization is not feasible. Amplification of nucleic acids, such as by the polymerase chain reaction, is a known technique, but with certain known drawbacks preventing optimal speed and efficiency. For example, such techniques may cause lysis of cells, may produce false positives due to sensitivity of the technique, and may lead to loss of specificity where high levels of amplification are required to detect a target that is present in low copy number. Moreover, hybridization of the amplified target is required in any event, so that multiple time-consuming steps are performed when amplification is used.
In situ hybridization provides a technique for the determination and quantitation of nucleic acids (DNA and RNA) in tissues at the single-cell level. Such hybridization techniques can detect the presence or absence of specific genes therein and may also be utilized to detect the expression of gene products at the single-cell level.
In situ hybridization procedures are disclosed in U.S. Patent No. 5,225,326 and copending U.S. patent application serial no. 07/668,751. The disclosure of each patent, patent application and journal publication identified in this patent application is incorporated by reference.
Despite the aforementioned knowledge, the prior art remains deficient. A truly rapid, sensitive, efficient and practical method of determining fetal gender and of detecting fetal abnormalities on a routine basis without invading the mother's womb is lacking. Thus, the present invention fulfills a long-felt need and desire in this field.
DISCLOSURE OF INVENTION In one set of embodiments of the present invention, there is provided a method of identifying a fetal erythrocyte in a specimen. In these embodiments, cells may be obtained from maternal peripheral blood, umbilical cord blood, chorionic villus samples, etc. Cellular samples may be used directly or may be concentrated as stated elsewhere herein to enrich the population of fetal cells prior to analysis. Cells may be fixed in common precipitating fixatives or cross-linking fixatives or may be used in the following test without fixation. The procedure may be carried out with cells deposited on a solid support such as a glass microscope slide or used with the cells in suspension. This method comprises the steps of obtaining a specimen that contains fetal cells and detecting a marker that distinguishes fetal cells from maternal cells also present in the sample. The most preferred method of identifying a cell as a fetal erythrocyte in accordance with the present invention is to detect the presence of RNA for fetal hemoglobin (HbF) or embryonic hemoglobin. Such RNA is generally messenger RNA (mRNA), but may alternatively or additionally include heteronuclear RNA (hnRNA). Also, unless the context requires a contrary interpretation, the term messenger RNA or mRNA herein includes ribosomal RNA (rRNA). The presence of such RNA indicates that the gene for the fetal protein is being transcribed and expressed. Such detection is preferably performed within substantially intact cellular membranes using in situ hybridization, preferably with synthetic DNA probes complementary to the fetal protein RNA. In a preferred embodiment synthetic DNA probes are employed, to which chromofluors have been covalently attached. The binding of such probes to fetal-cell-specific RNA within cells may be observed under the microscope as a bright fluorescence or may be detected by fluorimetric apparatus. By "fluorescence" we refer to any emission of detectable radiation as a result of excitement with radiation of a different wavelength than that emitted. The exciting radiation is conventionally ultraviolet or visible light but may be infrared or other electromagnetic radiation.
Another preferred embodiment employs synthetic DNA probes which are directly labeled, or may be indirectly labeled with enzymes such as alkaline phosphatase. The binding of such probes to fetal RNA followed by subsequent reaction of the enzymes with substrates to produce a detectable product (e.g. blue or purple solid precipitated from the reaction of BCIP with NBT) may be observed under the microscope.
The information resulting from such an assay may be used not only to identify the status of the fetus, as will be discussed more particularly below, but also to provide a fetal hemoglobin estimation based on the number of fetal erythrocytes detected, e.g. so as to assess the amount of fetal-maternal hemorrhage in case of Rh incompatibility. The amount of specific gamma globulin, containing anti Rh(D) to be administered, is calculated from this estimation, to suppress maternal immune reaction to fetal red blood cells entering maternal circulation.
An alternative method for identifying fetal erythrocytes is to detect a substance that is present in fetal cells but not in the maternal blood cells which would be present in the sample. One such substance which is particularly effective for such detection is fetal hemoglobin, which may be detected by stain such as acid hematoxylin and eosin B (e.g. Sigma Diagnostics, P.O. 14508, St. Louis, MO 63178, cat. no. 285) or by an antibody to fetal hemoglobin. Another such substance is the Y chromosome present in male fetal cells but absent from the cells of the mother.
Yet a further alternative method for identifying fetal cells is to detect an RNA that is present in fetal cells and a peptide. The RNA may be detected by nucleic acid hybridization, and the peptide may be detected as aforesaid, by the binding of an antibody thereto or by staining.
Another embodiment of the present invention detects the presence of at least two different RNAs in a cell. Fetal cells contain unique mRNAs or mRNA species which are produced in cell types which do not normally contain the particular mRNA species. The detection of these RNAs, whether detected as mRNAs or hnRNAs can serve to identify cells, or even subcellular fractions, as fetal or embryonic in origin. Alternatively, one may wish to determine the tissue of origin of unknown cellular samples, such as may occur in crime scene investigations. Moreover, in clinical analyses of potential or actual oncologies, knowledge of the tissue of origin, e.g. prostate or breast, of a metastatic cell may assist in the detection or treatment of cancers. The present technique may be employed for such purposes by seeking to detect the particular population of RNAs known to distinguish one such tissue from another.
To continue the illustration for fetal cells, while certain RNA populations are present in high abundance (e.g., fetal hemoglobin in fetal nucleated red blood cells), other fetal- or embryonic-specific RNAs are present in low abundance, either alone or even when considered as a population of fetal-specific RNAs. In addition, certain RNA species, while produced in certain fetal cells, may also be produced in certain maternal cells. However, there are situations where fetal cells express two or more particular RNAs in the same cell while maternal cells from the same specimen source do not contain both RNA species in the same cell. The ability to detect multiple mRNA or hnRNA species simultaneously in the same cell thereby enhances the ability to distinguish fetal cells from non-fetal (e.g. maternal) cells and offers a means of combining the signal produced when only the unique set of RNAs is present so that a specific signal is detected, which uniquely identifies fetal erythrocytes. In one embodiment of the invention, two or more RNA sequences are detected, using one or more probes for a first RNA sequence and one or more probes for a second RNA sequence. The probes for the first sequence are labeled to provide a first signal, such as a greenish fluorescence, and the probes for the second sequence are labeled to provide a signal that is different from the first signal, such as a reddish fluorescence. When the combination of both signals are detected in a single cell, which in this illustration would appear as an orange fluorescence, then both RNAs are found and thus a fetal cell has been detected.
In a particular embodiment of the aforesaid process, DNA probes are prepared for fetal hemoglobin RNA, labeled with a first fluorescer, such as fluorescein. DNA probes are also prepared for RNA of embryonic hemoglobin, ε chain, labeled with a second fluorescer, such as Cy5. DNA probes are also prepared for RNA of embryonic hemoglobin, ξ chain, labeled with a third fluorescer, such as Cy3. When all three of these RNAs are detected in a single cell, the cell observed under a fluorescent microscope lights up with an intense orange fluorescence, being the addition of the yellow-green of fluorescein, yellow-orange of Cy3, and reddish of Cy5. Such a procedure also may be automated.
In another embodiment of the invention, a fetal-cell-specific RNA sequence is detected by hybridization as aforesaid, along with another marker for the cells of interest, such as staining of fetal hemoglobin by hematoxylin and eosin or such as binding of a labeled monoclonal antibody with an antigen present in the cells of interest. A further set of embodiments of the present invention involve enriching the relative proportion of fetal cells in the specimen compared to other cells, e.g. maternal cells. Such enrichment may preferably take place by selectively removing maternal cells, e.g. by contacting the sample with a ligand to a cell surface component, the ligand being capable of being selectively separated from the sample. Preferably the ligand is an antibody to an antigen generally present on maternal blood cells. Desirably the ligand is bound to a solid matrix for separation from the liquid containing the sample. Preferably the matrix is a magnetic bead. The matrix may alternatively be in the form of a column through which the cell suspension is passed. Liquid electrophoresis in which cells are subjected to an electric field and separated on the basis of their intrinsic charge may be used as may passage through a filtration system that separates cells on the basis of their intrinsic charge.
In a preferred embodiment, the antibody comprises a monoclonal antibody to cluster- determinant-45 (hereinafter CD refers to cluster determinant as in, CD45). This antibody selectively binds to an epitope expressed on all isoforms of the human leukocyte common antigen (LCA) family, which are expressed on all leukocytes. Fetal erythrocytes are preferably enriched in such manner. Additional antibodies which may be employed, along with or instead of anti-CD45, include anti-CD13, anti-CD34, anti-CD44 and anti-CD31. Preferably the amount of antibody used is from about 2 to about 20 μg per million leukocytes in the sample. Alternatively, or in addition to the aforesaid, fetal erythrocytes may be selectively enriched by density gradient centrifugation. Subsequently, the fetal cells are detected as generally stated hereinabove.
In another embodiment of the present invention, there is provided a novel method of identifying fetal cells in a specimen. This method comprises the steps of obtaining a specimen that contains fetal cells and examining the cells by flow cytometry without any preliminarily labeling of the fetal cells through the use of a fluorescent label or any other label that may generate a fluorescent signal. Fetal cells are identified solely on the basis of their intrinsic light scattering properties. Simultaneously the fetal cells are concentrated using flow cytometry. This method relies on the unique finding that fetal call have distinguishable intrinsic light scattering properties that allow them to be sorted from many other cells. Fetal nucleated erythrocytes scatter light in a manner similar to that of monocytic cells and are thus usefully enriched by sorting them away from numerous other cells types.
In yet another embodiment of the present invention, there is provided a novel method of identifying fetal cells in a specimen. This method comprises the steps of obtaining a specimen that contains fetal cells and preliminarily labeling the fetal cells through the use of a fluorescent label or a label which may generate a fluorescent signal by enzymatic action or a label which may react antigenically to generate a fluorescent signal, which signal may be detected by instrumentation. Subsequently, the fetal cells are concentrated using flow cytometry.
In yet another embodiment of the present invention, there is provided a kit for the enrichment of fetal erythrocytes within a blood specimen including means for creating a density gradient for enriching fetal cells of interest.
In still yet another embodiment of the present invention, there is provided a novel kit for the enrichment of fetal erythrocytes from a specimen, such as preferably maternal peripheral blood, and the detection of nucleic acid sequence in such fetal cells. This kit comprises an antibody to a cell surface antigen present on most or all adult white blood cells, which antibody may be bound to a matrix to facilitate separation. The kit further comprises a hybridization solution comprising a denaturing agent, hybrid stabilizing agent, buffering agent, and a membrane pore-forming agent. In addition, this kit contains a supply of an oligonucleotide probe capable of hybridizing with a target fetal RNA nucleotide sequence. Advantageously, such a kit also includes another detectably different probe capable of hybridizing with a nucleic acid sequence of clinical interest. Such kits typically include instructions for their use.
Various kinds of fetal cells are characterized by cell type. In a preferred embodiment, this invention relates to fetal nucleated erythrocytes. The fetal cells are preferably separated from maternal peripheral blood by ligand binding of maternal cells or density gradient centrifugation. However, the procedures of the present invention may alternatively be applied to samples obtained by percutaneous sampling of umbilical cord blood, amniocentesis, chorionic villi sampling or other procedures, if the advantages obtained by maternal peripheral blood sampling are not required. Following enrichment of the fetal erythrocytes as mentioned above, the cells may be distinguished or separated from maternal cells by recognition of a fetal cell antigen, e.g., by staining with a labeled antibody to fetal hemoglobin, by staining for fetal hemoglobin, or preferably by in situ hybridization using DNA probes to messenger RNA (mRNA) sequences that are present in such fetal cells but not in maternal blood cells. Various antibodies have been used to discriminate between fetal and maternal cells.
An antibody to cytokeratin attached to a fluorescent label is especially desirable for use without interfering with the nucleic acid hybridization performed in accordance with the present invention.
However, a preferred method in accordance with this invention, uses in situ hybridization performed on cells that are obtained from maternal peripheral blood using probes and conditions that select for messenger RNA (mRNA) bearing sequences that are transcribed in fetal cells but not in the maternal blood cells. In accordance with the present invention, it has been found that mRNA for fetal hemoglobin (HbF) is an especially good marker of such cells for detection by in situ hybridization. Alternatively, certain methods of the present invention may involve embryonic cells fertilized in vitro, or products of conception, which do not need to be separated or distinguished from maternal cells.
An advantage of the hybridization technique of a preferred embodiment of the present invention is that it is possible to perform the hybridization to detect fetal mRNA sequences under conditions similar to (or preferably the same as) those used to detect genetic or viral DNA. Moreover, in a most preferred embodiment, a single incubation step is performed in which probes for mRNA and probes for DNA are present in the hybridization cocktail. The present invention employs in situ hybridization techniques that are capable of detecting even a single genetic abnormality in a single cell. Incubation in accordance with the present invention is desirably less than about 120 minutes, and preferably between about 5 and about 30 minutes. Fetal cells contain unique mRNAs or mRNA species which are produced in cell types which do not normally contain the particular mRNA species. The detection of these RNAs, whether detected as mRNAs or hnRNAs, can serve to identify cells, or even subcellular fractions, as fetal or embryonic in origin. While certain RNA populations, such as fetal- hemoglobin mRNA in fetal nucleated erythrocytes, are present in relatively high abundance, other fetal- or embryo-specific mRNAs are present in low abundance, either alone or even when considered as part of a population of fetal-specific mRNAs. In addition, certain RNA species, although produced in certain fetal cells, may also be produced in certain maternal cells. However, there are situations where fetal cells express two or more particular mRNAs in the same cell whereas maternal cells from the same specimen do not contain both mRNA species in the same cell. The ability to detect multiple mRNAs or hnRNA species simultaneously in the same cell thereby enhances the ability to distinguish fetal cells from non-fetal (e.g. maternal) cells and offers a means of combining the signals produced when only the unique set of RNAs is present, so that a more specific signal, which uniquely identifies fetal cells, is detected.
BRIEF DESCRIPTION OF DRAWINGS Figure 1 shows the use of in situ hybridization to determine the numerical status of chromosomes X, Y and 18 in normal male amniocytes.
Figure 2 shows the simultaneous detection of the X and Y chromosomes within amniocytes and white blood cells.
Figure 3 shows a schematic representation of the technique preferably used to enrich fetal erythrocytes from maternal blood in accordance with the present invention.
Figure 4 shows a schematic representation of the technique preferably used to enrich fetal trophoblasts from maternal blood in accordance with the present invention. Figure 5 shows the use of probes for fetal hemoglobin messenger RNA to identify fetal erythrocytes.
Figure 6 shows the use of anti-cytokeratin antibodies to positively identify fetal cells in maternal blood. Figure 7 shows the detection of the Y chromosome within a fetal trophoblast, positively identified using the anti-cytokeratin antibody, and isolated from maternal blood.
Figure 8 shows the use of in situ hybridization to determine the numerical status of chromosomes X, Y and 18 in placental trophoblasts that have been positively identified using the anti-cytokeratin antibody.
Figure 9 shows the use of in situ hybridization to fetal-cell-specific mRNA to positively identify amniocytes and trophoblasts.
Figure 10 shows the use of in situ hybridization to fetal-cell-specific mRNA and to chromosomes X and Y in fetal erythrocytes.
MODES FOR CARRYING OUT THE INVENTION The methods of the present invention may be used to identify fetal cells in a wide variety of specimens. Representative examples of such specimens include maternal peripheral blood, placental tissue, chorionic villi, amniotic fluid and embryonic tissue. For the reasons stated above, maternal peripheral blood is the preferable specimen. However, in the past this has been the most difficult specimen with which to obtain reliable and consistent results with because of the high ratio between maternal cells (which interfere with any assay of fetal nucleic acid) and fetal cells. Preferably, the methods of the present invention are used to detect fetal nucleated red blood cells. The methods of the present invention may be used to detect fetal-cell-specific polynucleotide sequences, that is, oligonucleotides, within a fetal cell. Without limiting the present invention, the novel methods of the present invention may be used to detect a virus or a chromosome within a fetal cell. Representative examples of viruses detectable by the present invention include a human immunodeficiency virus, hepatitis virus and herpes virus. Representative examples of chromosomes detected by the present invention include the human X chromosome, the Y chromosome and Chromosomes 1, 13, 16, 18 and 21.
The sensitivity of the in situ hybridization techniques described herein permit the visual and photographic detection of a single copy of a genetic sequence present within a single cell. The present invention allows for multiple targets to be tested simultaneously, using a single sample of cells. This permits the maximum amount of information to be obtained from a single sample, minimizing the need for multiple fetal cell samples and thereby decreasing the danger to both mother and fetus and minimizing need for cell purity and sorting.
Differentiation of Maternal Cells from Fetal Cells Identification of fetal cells or detection of genetic abnormalities within fetal cells requires their separation and differentiation from maternal cells. This requirement is especially necessary when the sample of cells is obtained from maternal peripheral blood containing a low percentage of fetal cells. We have found, in accordance with the present invention, that negative separation by antibodies is particularly advantageous. We employ an antibody or antibodies binding specifically to maternal cell antigens and not significantly to fetal cell antigens. The antibodies may be coupled to numerous solid surfaces or supports (substrates, such as containers, columns, wells, beads, or particles) by physical or chemical bonding. Alternatively, the antibodies may be coupled to a material which facilitates the selected separation step. For example, antibodies may be labeled with fluorescent markers and cells to which these labeled antibodies bind may thereby be separated with a cell sorter by standard procedures.
In general, such antibodies are effective when employed in amounts of about 2 - 20 μg per million cells to which they are targeted. That is, antibodies which recognize and bind to leukocytes are added in the aforesaid amount, based on the expected number of leukocytes in the sample. Alternatively, antibodies which recognize and bind to trophoblasts are added in the aforesaid amount, based on the expected number of trophoblasts.
A particularly preferred separation is performed by using an antibody to anti-CD45 which selectively binds to white blood cells. The anti-CD45 is desirably bonded to a solid support such as magnetic beads, which may be introduced into a test tube and shaken with the sample and then held in position at the side of the test tube by the application of a magnetic field, while liquid containing the un-bound sample is removed. Such beads are available as Anti-CD45 immunomagnetic beads, Catalog No. 1178, from Amac, Inc., 160B Larrabee Road, Westbrook, ME. A preliminary step involving lysis of maternal erythrocytes involving, e.g. with ammonium chloride, can conveniently be used to remove a substantial proportion of these red cells.
Alternatively, one may obtain immunomagnetic beads from Calbiochem, 10933 N. Torrey Pines Road, La Jolla, CA, uncoated as catalog no. 400995, or coated with streptavidin as catalog no. 400996. Such beads may be coated by the user with antibodies to cell surface antigens found on cells which are desired to be removed from the fetal cells. Another bead which may be coated with antibody is an aqueous suspension of iron oxide particles coated to provide carboxyl groups, permitting the covalent attachment of biologically active molecules. Such beads, and a description of procedure for use, are available as BioMag Carboxyl Terminated, catalog no. 8-4125, Advanced Magnetics, Inc., 735 Concord Ave., Cambridge, MA 02138.
If desired, white blood cells may be removed by using specific ligand/ligand-target interactions. Cells may be effectively removed by a combination of antibodies to CD45, CD 13 and CD34. Anti-CD44 can also be included in the mixture to remove contaminating maternal red blood cells. Addition of anti-CD31 can specifically remove the contaminating platelets. Such antibodies are available from various sources such as Amac, Inc. (see above), Becton Dickinson, Franklin Lakes, NJ 07417-1884, and Zymed Laboratories, Inc., 458 Carlton Court, South San Francisco, CA. See Zymed' s 1992 catalog at pages 10-13 and 71- 72. See also W. Knapp, Fourth International Workshop and Conference on Human Leukocyte Differentiation Antigens, Oxford University Press, 1989; and D.F. Keren, Flow Cytometry in Clinical Diagnosis, pp. 41-87 ASCP Press, Chicago, 1989. Other ligand/ligand- target interactions may usefully be used, e.g. transferrin may be used to bind cells bearing the transferrin receptor.
Fetal cells may alternatively be isolated from maternal peripheral blood by either density gradient centrifugation or by flow cytometry. Using flow cytometry, fetal cells may be identified and sorted, for example, by examination of their light scattering properties alone. Alternatively, the fetal origin of such cells may be confirmed by first using either a labeled antibody specific for a fetal cell antigen or by using a nucleic-acid-specific probe, e.g., a synthetic oligonucleotide probe hybridizable to fetal cell RNA. Additionally, hemoglobin A chain mRNA may be detected in maternal cells and its presence used as a distinguishing feature.
Specific nucleic acid (RNA or DNA) probes may also be used as markers for the expression of genetic characteristics of a fetus which may be qualitatively or quantitatively distinct from those of the parent or normal adults. Thus, the presence of Y chromosome encoded genes or gene products is a qualitative distinguishing feature of the cells of a male fetus. Markers inherited by the fetus from the paternal genome also may be used to qualitatively distinguish fetus cells from maternal cells. In syndromes characterized by genetic abnomalities, e.g. chromosomal trisomies, quantitative differences in in genetic constitution may be detected. In other syndromes, characterized by decreases or increases in copy number of genetic repetitive elements, quantitative differences in genetic constitution may also be detected. Quantitative differences in may also arise because of the expression of fetal forms of genes that are not expressed, or are only expressed at a low level, in normal adult cells and tissues.
Preparation of Samples
Samples of peripheral blood (20 ml) are drawn from donors into Vacutainer tubes containing EDTA. Samples are stored and transported at temperatures not exceeding 4C and are not stored for more than 36 hours. Samples whose temperature exceed IOC upon receipt are rejected. Samples are collected from pregnant women of 10-24 weeks gestational age. In experiments that involved mixing blood from different donors the blood group of the samples is determined and only samples which have the same blood group are mixed.
Density Gradient Separation of Nucleated Cells from mixed Adult and Cord Blood
Twenty microliters (20 μl) of cord blood is added to 20 ml of the adult blood. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll-Hypaque, Histopaque, Percoll, etc.) which has a density of 1.107 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells at the interface is then collected and washed once with CBA.
Preparation of Slides
If slides are to be prepared, they are preferably made by the conventional cytospin technique. Alternatively they may be prepared as organosilanated slides.
For cytospun slides, 200 μl of the cell suspension, 114, from step 110 is cytospun onto each slide for five minutes at 500 rpm. Dip the cytospun slides in chilled 80% ethanol/water (v/v) for five minutes. Air dry.
Alternatively, the cytospun slides may be fixed by directly applying 30 μl of ethanol/methanol (3:1 v/v) onto each slide.
To prepare organosilanated slides, immerse clean slides for 2 minutes in a freshly prepared 2% (v/v) solution of an organosilane such as 3-aminopropyltriethoxysilane (APTO) in acetone. Rinse the slides twice in water and air dry. For each 20 ml of maternal blood or 10 ml of umbilical cord blood used as the sample, resuspend the cell pellet in 50 μl of a fixative solution, e.g. 80% ethanol/water or 3: 1 ethanol/methanol. Spot 50 μl of this suspension on a slide and air dry the sample.
Flow Cytometry
Cells are analyzed and sorted on a flow sorter based on the properties of the cells to scatter light forward and to the side. In each experiment parameters are empirically established regarding the forward and side scatter properties. In general, the gain on the photomultiplier tubes detecting the forward-scattered light and the side-scattered light is adjusted in each dimension to distribute the array of signals from the cells across the channels available for analysis in a manner well known to one skilled in the art. Under these circumstances a characteristic pattern, or scattergram, is observed. Analysis of blood samples reveals three major cell types in the scattergram, namely, monocytic cells, lymphocytes and granulocytes, each of which has distinguishable light scattering characteristics. The monocytic cell region, the granulocytic cell region and the lymphocytic region of the scattergram are gated so that cells which are classified as monocytes, granulocytes or lymphocytes can be analyzed further or collected by flow sorting.
Further analysis is carried out by staining the cells with fluorescent-coupled monoclonal antibodies or by subjecting the cells to in situ hybridization with fluorescent-coupled oligonucleotide probes. Under these conditions cells that have particular light scattering properties are also analyzed for the presence of fluorescence. When fluorescent-coupled antibodies are used control experiments are performed using isotypically matched control monoclonal antibodies. When fluorescent-coupled oligonucleotide probes are used controls consist of oligonucleotide sequences unrelated to mammalian sequences. Collected samples are deposited on one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that the cells do not overlap one another. At other times the cells are collected into microfuge tubes and fixed in suspension as described elsewhere. A Coulter, Profile II, flow cytometer (Coulter, Hialeah, FL) may be used to detect nucleic acids within fetal cells, using a photo-multiplier-tube- 1 (PMT-1) setting of 1100 and a PMT-3 setting of 900. Color compensation, PMT-1 minus PMT-3, may be 15%. An Epics, Elite, system may be used to sort fetal cells from a specimen, e.g., of maternal blood. The present invention permits the use of flow cytometry for analysis and sorting of fetal cells based on the properties of the cells to scatter light in a forward direction and to the side.
Preferably, flow sorting is used after maternal blood has been removed from the specimen to be analyzed. In the examples that follow a preferred amount of blood is collected. As illustrated in Examples 22 through 28 twenty milliliters (20 ml) of peripheral blood from a pregnant women of 10-20 weeks gestational age is collected in Vacutainer tubes containing EDTA. Also illustrated in those examples, is the separate collection of 1-5 ml of an umbilical cord blood sample from the birth of a male child in Vacutainer tubes containing EDTA. The blood-type of the maternal blood sample and the umbilical cord blood sample were determined. Only samples which had the same blood-type were used. The total number of nucleated red blood cells ("nRBC") and the number of nRBCs which contain the fetal hemoglobin mRNA ("F+") were determined, as illustrated in the examples, using the preferred amount of 20 μl of cord blood and the detection HbF system.
Separation of Fetal Nucleated Erythrocytes from mixed Adult and Cord Blood
1. Magnetic bead method: Magnetic beads coated with anti-CD45 antibodies are added to the cells and the cells allowed to react. The magnetic beads bind mono-nuclear cells, lymphocytes and granulocytes all of which bear CD45 on their surfaces. The magnetic beads are then removed with a magnet and the unreacted cells in the supernate recovered. Hoechst dye 33258 is added as a nuclear counterstain. Examination of these cells by flow cytometry shows that they scatter light in the characteristic manner expected of mono-nuclear cells.
2. Flow Cytometer Method: The cells are analyzed and sorted on a flow sorter and the cells with light scatter properties of monocytes, granulocytes and lymphocytes are collected.
Different types of fetal cells are found to scatter light in characteristic ways. E.g., trophoblasts are found to have characteristic comparable to adult granulocytes whereas the light scattering characteristics of nucleated fetal erythrocytes are comparable to adult monocytes. Fetal leukocytes have light scattering characteristic similar to those of their adult counterparts. Cells with the light scattering properties of interest are collected and are deposited on one or more slides, so that deposited cells form a monolayer.
In examples 22 through 28 the separation of fetal cells from mixed maternal and cord blood is illustrated. Thes examples apply a fluorescence activated cell sorter to perform flow cytometry and identification of the fetal cells is achieved by using a system to test the fetal cells for the presence of HbF mRNA and X and Y chromosomes. The examples describe a variety of separation systems and vary the timing and frequency of the use of the system to test and detect fetal cell markers and chromosomes. When fluorescein is the probe dye, the dye is excited with light having a wavelength
488 nm and the fluorescent emitted light is measured. For the emitted light (for PMT-1), a 540 bp (40) filter is used; i.e., only light with a wavelength between 520 nm and 560 nm is allowed to pass. The filter for PMT-3 is a 635 long pass filter; i.e., it allows any light over 635 nm wavelength to pass. A marker may be used to define the cell as a fetal erythrocyte. For example, antibodies to representative fetal cell markers may be used, such as: (1) cytokeratin, (2) β- subunit of chorionic gonadotrophin, (3) fetal hemoglobin protein, (4) chorionic somatomammotropin protein (placental lactogen), (5) pregnancy-specific β-glycoprotein, and (6) α-fetoprotein. Various labeled antibodies to cytokeratin are available. These include CAM 5.2 from Becton Dickinson, Catalog No. 92-0005; and anti-cytokeratin 18-FITC from Sigma Chemical Company, Catalog No. F-4772 (antibody to cytokeratin 18). Most preferably, the antibody to cytokeratin is labeled with a fluorescent moiety.
Even more preferably, fetal-cell-specific RNA sequences are used as fetal cell markers. Such sequences are transcripts of, e.g., the fetal hemoglobin gene, the cytokeratin gene, the β-subunit of chorionic gonadotrophin gene, the chorionic somatomammotropin gene (placental lactogen), the pregnancy-specific β-glycoprotein genes, one or more embryonic hemoglobin genes or the α-fetoprotein gene. The sequences of these genes and others may be obtained from the Genetic Sequence Data Bank, GenBank, version 69.0. The loci of these sequences are provided in Table 9. A DNA probe, or population of probes, embodying any of these sequences is synthesized as an oligodeoxynucleotide using a commercial DNA synthesizer such as Model 380B from Applied Biosystems, Inc.. Foster City, CA, using reagents supplied by that company. Probes may be comprised of the natural nucleotide bases or known analogues of the natural nucleotide bases, including those modified to bind labeling moieties. The novel methods of identifying fetal cells in a specimen using density gradient centrifugation utilize density gradient medium. Most preferably, the density gradient medium is colloidal polyvinylpyrrolidone-coated silica (e.g. Percoll), Nycodenz, a nonionic polysucrose (Ficoll) either alone or with sodium diatrizoate (e.g. Ficoll-Paque or Histopaque), or mixtures thereof. The density of the reagent employed is selected to preferentially separate the fetal cells of interest from other blood components.
The present invention permits detection of genetic abnormalities using a minimum number of fetal cells. Fetal cells may be obtained by amniocentesis, chorionic villi sampling or other standard methods known in the art. In one embodiment of the present invention, however, fetal cells are isolated from maternal peripheral blood, avoiding the invasion of the uterine cavity and thus precluding injury to the mother or fetus. In another embodiment of the present invention, fetal cells are isolated from a percutaneous sample of umbilical cord blood. The sensitivity of the present method permits drawing a smaller sample of umbilical cord blood, i.e. preferably 1-2 ml, but optionally as little as 0.2 ml, than would need to be drawn using conventional fetal cell isolation and detection techniques.
Concentration of Fetal Nucleated Red Blood Cells in Maternal Blood
An example of a separation of fetal nucleated red blood cells is shown in Fig. 3, consisting of parts 3 A and 3B. Each step is schematically illustrated by a numbered box, and a component or container that appears in more than one step is identified by the same reference numeral.
In step 10, draw twenty ml of maternal peripheral blood, 18, e.g. into two conventional ten-ml EDTA anti-coagulation blood collection tubes, 12 and 14, e.g. Vacutainer tubes. Alternatively, ten ml of umbilical cord blood is drawn. The blood is transferred into a fifty-ml centrifuge tube, 16.
In step 20, the blood sample, 18, is mixed with fifteen ml of Cell Buffer A, 22, to form a buffered sample, 24. (See Exemplary Solutions, below.) Mix well.
In step 30, fifteen ml of a density-gradient separation reagent, 32, having a density of about 1.083, e.g. Histopaque 1083, is placed in a fifty-ml conical tube, 34, and up to twenty ml of the buffered sample, 24, is carefully layered on the top of the density separation reagent. The density separation reagent may have a density from about 1.075 to about 1.095, preferably between 1.08 and 1.09.
In step 40, the conical tube, 34, is centrifuged in a swinging-bucket rotor, 36, at 700 x g for thirty minutes at room temperature. Arrow, 38, shows the direction of centrifugal force being applied to tube, 34, as illustrated. If two containers of blood sample were provided initially, then prepare and process a second density separation tube for the remaining twenty ml of diluted blood, repeating steps 30 and 40 as to the second tube. If the sample is umbilical cord blood, there would be only one such tube.
In step 50, aspirate off and discard the top serum/buffer layer, 54. Discard this waste. The buffy-coat, 56, is the interface layer at the top of the density separation reagent 52, which contains both maternal and fetal white blood cells, nucleated red blood cells, and erythroblasts. Collect the buffy-coat, 56, by pipette, 58, and transfer to a fresh fifty-ml conical tube, 62. If more than one tube, 34, of density separation material were prepared for a single patient, combine all interface layers, 56, into a single fifty-ml conical tube, 62.
In step 60, wash the collected cell layer with Cell Buffer A, 22, by adding Cell Buffer A to the cells to make the volume forty-five ml.
In step 70, pellet the cells in tube, 62, by centrifugation at 1000 rpm for ten minutes at room temperature.
In step 80, resuspend the cells, this time in one ml of Cell Buffer B, 82.
For step 90, prepare one hundred μl of anti-CD45 magnetic beads, 94, in a 2-ml microcentrifuge tube, 92, using aseptic technique as follows. (This preparation of the beads is not shown diagrammatically.) Wash the beads by adding 1.4 ml of Cell Buffer A, 22, using a magnet to retain the beads on the side of the tube. Let the tube sit undisturbed for 5 minutes. Carefully remove the wash solution with a pipette. Remove the magnet. As shown in the diagram for step 90, add to the tube, 92, the resuspended cells in tube, 64, from step 70. Incubate at room temperature for ten minutes, mixing gently.
In step 100, apply a magnet, such as a magnetic support block illustrated diagrammatically as magnet, 102, to retain the beads, 94, against the side of the tube, 92.
In step 110, remove and collect the liquid by pipette, 112. The cell suspension, 114, in pipette, 112, contains the fetal cells. The cellular material, 118, that remains with the beads, 94, primarily contains maternal leukocytes.
Step 120 diagrammatically represents the transfer of the cell suspension, 114, onto a microscope slide, 122, from pipette, 112. Such a transfer would generally be done by pipette. Alternatively, the washed fetal cell suspension may be transferred to a fresh tube (not shown), if hybridization in suspension is to be performed. Alternatively, instead of using a bead having, for example, anti-CD45 bonded thereto
(direct negative selection), one may react the specimen with anti-CD45 in solution and then remove the leucocytes, which have entered into an antigen-antibody ligand with the anti- CD45, by any means which separates such an antibody, and particularly by an antibody to an epitope of the CD45 molecule (indirect negative selection). Where the anti-CD45 is a mouse antibody, such a ligand-forming antibody may be, for example a sheep-anti-mouse-IgG antibody bonded to substrate that is generally solid or otherwise able to facilitate removal of the ligand complex from solution, such as an antibody-coated magnetic bead, the coated well of a container, etc.
Detection of Genetic Abnormalities
The genetic abnormalities detected by the present invention may be deletions, additions, amplifications, translocations or rearrangements. For example, a deletion may be identified by detecting the absence of hybridizable binding of the probe to a target sequence. To detect a deletion of a genetic sequence, a population of probes are prepared that are complementary to the nucleic acid sequence that is present in a normal fetal cell but absent in an abnormal one. If the probes hybridize to the sequence in the cell being tested, then the sequence is detected and the cell is normal as to that sequence. If the probes fail to hybridize to cellular nucleic acid, then the sequence is not detected in that cell and the cell is designated as abnormal, provided that a control sequence, such as the X chromosome, is detected in that cell.
An addition may be identified by detecting binding of a labeled probe to a polynucleotide repeat segment of a chromosome. To detect an addition of a genetic sequence, such as an insertion in a chromosome or a karyotypic abnormality such as the trisomy of Chromosome 21 which indicates Down's Syndrome, a population of probes are prepared that are complementary to the genetic sequence in question. Continuing with the Down's Syndrome example, if the probes complementary to Chromosome 21 hybridize to three appearances of the Chromosome 21 sequence in the cell, then three occurrences of the Chromosome 21 sequence will be detected and indicate the Down's Syndrome trisomic condition. If the detection means is a fluorescent dye, for example, then three distinct points of fluorescence visible in each cell will indicate the trisomy condition.
As illustrated in Example 14, when an amplification of a particular DNA fragment is present, there is an increase in the intensity of the signal from a labeled probe for the sequence which is subject to amplification. Using any of a number of image analysis systems, this signal is quantified and compared to normal controls to determine whether or not a particular amplification mutation is present. A translocation or rearrangement may be identified by several methods. For example, a labeled first probe may be bound to a marker region of a chromosome that does not translocate. A labeled second probe is then bound to a second region of the same chromosome (for a rearrangement) or a second chromosome (for a translocation) and subsequently binding of the first and second probes is detected. Alternatively, a translocation may be identified by first binding a labeled probe to a marker region of a polynucleotide section of a chromosome that translocates or rearranges. Subsequently, binding of the labeled probe is detected.
For example, to detect a translocation, a marker for the chromosome in question is identified, and a population of probes are prepared that hybridize to it. They are marked with a detectable label, such as a dye that fluoresces at a particular wavelength. The sequence that translocates or rearranges in the abnormality being tested for is also identified, and second population of probes are prepared that identify it. The members of the second population of probes are marked with a distinguishably different label, such as a dye that fluoresces at a different wavelength from the first series of labeled probes. In situ hybridization is performed using both populations of probes, and the results of hybridization by each of the probe populations are compared. If the first and second labels are coincident on virtually all cell samples, no translocation has taken place. If the first label is found not to coincide with the second label on a significant fraction of samples, then a translocation or rearrangement has taken place. See, e.g., F. Speleman, Clinical Genetics 41(4): 169-174 (1992); J. W. Gray, Progress in Clinical & Biol. Res. 372:399-411 (1991).
Hybridization Fixative
Ethanol, e.g. 80% ethanol/water (v/v), is desirably used as a fixative during preparation of the cells for in situ hybridization. Other useful precipitation fixatives include acetic acid, methanol, acetone, and combinations thereof, for example ethanol/methanol mixture 3:1. Other useful fixatives will be obvious to one skilled in the art. Fixatives and hybridization of fixed cells, in general, are discussed in U.S. Patent No. 5,225,326. Fixatives should provide good preservation of cellular morphology, should preserve and maintain accessibility of antigens, and promote a high hybridization efficiency. Some salts and extreme temperatures, such as waving a slide over a flame, may also function as fixatives.
The fixative may contain a compound which fixes the cellular components by cross-linking these materials together, for example, paraformaldehyde, glutaraldehyde or formaldehyde. Cross-linking agents, while preserving ultrastructure, often reduce hybridization efficiency by forming networks trapping nucleic acids and antigens and rendering them inaccessible to probes and antibodies. Some cross-linking agents also covalently modify nucleic acids, preventing later hybrid formation.
Hybridization Solution Components
The hybridization solution may typically comprise a chaotropic denaturing agent, a buffer, a pore-forming agent, a hybrid stabilizing agent. The chaotropic denaturing agents include formamide, urea, thiocyanate, guanidine, trichloroacetate, tetramethylamine, perchlorate, and sodium iodide. Any buffer which maintains pH at least between about 6.0 and about 8.5 and preferably between 7.0 and 8.0 may be utilized.
The pore-forming agent is, for instance, a detergent such as Brij 35, Brij 58, sodium dodecyl sulfate, CHAPS, Tween, Sarkosyl or Triton X-100. Depending on the location of the target nucleic acid, the pore-forming agent is chosen to facilitate probe entry through plasma, nuclear membranes or cellular compartmental structures. For instance, 0.05% Brij 35 or
0.1% Triton X-100 will permit probe entry through the plasma membrane but not the nuclear membrane. Alternatively, sodium deoxycholate will allow probes to traverse the nuclear membrane. Thus, in order to restrict hybridization to the cytoplasmic nucleic acid targets, nuclear membrane pore-forming agents are avoided. Such selective subcellular localization contributes to the specificity and sensitivity of the assay by eliminating probe hybridization to complementary nuclear sequences when the target nucleic acid is located in the cytoplasm. Agents other than detergents, such as fixatives or salts, may serve this function.
Hybrid stabilizing agents such as salts of mono- and divalent cations are included in the hybridization solution to promote formation of hydrogen bonds between the nucleotide sequences of the probe and the complementary nucleotide sequences of the target nucleic acid. Preferably, sodium chloride at a concentration from 0.15 M to 1 M is used. In order to prevent non-specific binding of nucleic acid probes, nucleic acids unrelated to the target nucleic acids may desirably be added to the hybridization solution.
Many types of solid supports may be utilized to practice the invention. Supports which may be utilized include, but are not limited to, glass, Scotch tape (3M Corporation, St Paul MN), nylon, Gene Screen Plus (New England Nuclear, Boston MA) and nitrocellulose. Most preferably, glass microscope slides are used. The use of these supports and the procedures for depositing specimens thereon is obvious to those of skill in the art. The choice of support material will depend upon the procedure for visualization of cells and the quantitation procedure used. Some filter materials are not uniformly thick and, thus, shrinking and swelling during in situ hybridization procedures is not uniform. In addition, some supports which autofluoresce will interfere with the determination of low level fluorescence. Glass microscope slides are most preferable as a solid support since they have high signal-to-noise ratios and can be treated to better retain tissue.
In one embodiment of the process, the target cell is immobilized on a solid surface, preferably a glass slide. In another embodiment, the target cell is suspended in liquid during the entire process and not immobilized on a solid surface. Use of conventional flow cytometry instruments is especially facilitated with the present invention.
Blocking Background Effects
The process comprises contacting the cell with a solution containing a probe capable of binding to a target molecule in or on the cell so that the probe with a reporter group attached binds to the target molecule and becomes cell-bound. To reduce the background the cell is treated with a solution comprising a structural analogue of the reporter group. Analysis is achieved by performing one or more steps that will detect the reporter group on the probe bound to the cell but that will not detect the analogue bound to the cell matrix.
In this process the analogue of the reporter group may be added before, together with or after the probe bound reporter group. Preferably, the probe and the analogue are included in the same solution.
In a subgeneric aspect of the invention, the reporter group is a cyclic compound. In a further subgeneric aspect of the invention, the cyclic group contains an unsaturated bond. In a still narrower subgeneric aspect of the invention, the cyclic group is an aromatic compound. It is preferred that, on a molar basis, the analogue is in excess as regards the reporter group; it is highly preferred that there be at least ten times as much analogue as reporter group.
The analogue competes with the reporter group for non-specific binding sites. In the case of aurintricarboxylic acid (ATA) used in conjunction with a nucleic acid probe, an additional mechanism may involve ATA binding to the active site of proteins that would bind the reporter group. It is preferred that the analogue is selected so that it retains most or all of the structural features of the reporter group. The analogue may additionally have structural features not present in the probe. Preferably, the analogue should be able to permeate a cell or virus. In the case of analogues that are aurin derivatives (rosolic acid derivatives), it is preferred that the analogues have, in addition to ATA, a polar functional group such as a -CO2, -NH2, -OH, or -SO3 group, on an aromatic group; examples are chromoxane cyanine R and Chrome Azurol S. A subgroup of preferred analogues are those that block the NH2 groups on lysines.
In the preferred embodiments, multiple probes for multiple target sequences are simultaneously hybridized. For example, probes for HbF mRNA and for human chromosome 21 are desirably included in the contacting step, and the reporter group on the probes for HbF mRNA is detectably different from the reporter group on the probes for chromosome 21.
Detection of Probe Moieties
Fluorescent reporter groups are detected by exciting the reporter group with a higher energy light and then detecting the emission of some of the absorbed energy as a lower energy light. Chemiluminescent reporter groups are detected by allowing them to enter into a reaction, e.g., an enzymatic reaction, that results in energy in the form of light being emitted. Other reporter groups, e.g., biotin, are detected because they can bind to groups such as streptavidin which are bound, directly or indirectly, to enzymes, e.g., alkaline phosphatase or horseradish peroxidase that can catalyze a detectable reaction. Fluorescent groups with which the process of this invention can be used include fluorescein, coumarin, rhodamine, rhodamine derivatives including Texas Red, and phycoerythrin.
Chemiluminescent groups with which the process of this invention can be used include isoluminol (or 4-aminophthalhydrazide; see catalogs of Aldrich Chemical Company or Molecular Probes, Inc.).
In one preferred embodiment of the process, when the reporter group is fluorescein, detection is achieved by measuring light emitted at wavelengths between about 520 nm and
560 nm (especially at about 520 nm), most preferably where the excitation wavelengths is about or less than 520 nm. A preferred embodiment of the fluorimetric process further comprises a wash step prior to the detection step. A wash step can be performed by centrifuging the cell out of the solution in which it is suspended, then suspending it in a wash solution, and then centrifuging it out of the wash solution. A wash solution is generally a probe-free solution. In a particular embodiment of the process, the solution that is used comprises a probe (containing a reporter group), an analogue of the reporter group, a free radical scavenger and a fixative.
A fluorescent probe that binds to a target molecule is preferably one which binds to that target with high specificity. Preferably, a fluorescent probe is fluorescent dye covalently attached to a nucleic acid molecule, antibody or other molecule capable of binding specifically to a target molecule.
If an analogue is added to the cocktail, its preferred concentration is from 0.01% to 0.5% w/v (especially about 0.05 to 0.01%).
Kit Embodiments of the Invention
In one aspect, the invention is a kit for the detection of nucleic acids within a fetal cell in a specimen. Such a kit may include a solution containing a fixation/hybridization cocktail and one or more labeled probes. For example and not by way of limitation, this solution may contain 50 mM guanidinium isothiocyanate, 25-40% formamide, 31% PEG, 0.4 M DTT, 15% Ficoll/PVP, 50 2 mM EDTA, 1 mg/ml salmon sperm DNA, 50 mM Tris-acetate (pH 7-8), about 5% Triton X-100, and about 20 μg/ml of a synthetic oligonucleotide probe directly labeled with a reporter molecule. This solution and the probes would have measurable predefined and identified characteristics and reactivities with cells and target sequences. Such a kit would also provide means and instructions for performing the hybridization reaction of the invention.
In an alternative embodiment, the kit may include: a second detectable reporter system which would react with the probe or the probe-target hybrid. Concentrated stock solution(s) to be used directly or to be diluted sufficiently to form wash solution(s). Any mechanical components which may be necessary or useful to practice the invention such as a solid support (e.g., a microscope slide), an apparatus to fix cells to the support, or a device to assist with any incubation or washing of the specimens. Such a kit could also include a photographic film or emulsion with which to the record results of assays carried out with the invention. Another aspect of the present invention provides a kit for the detection of fetal hemoglobin within a specimen without the removal of maternal blood cells. A preferred version of this kit contains means for detecting the HbF mRNA of fetal cells. The kit would also provide media for mounting slides of capillary blood smears, e.g. Slide Mount A, Slide Mount B and Slide Mounting Solution. Further, Wash Concentrate A, Wash Concentrate B and Fetal Hemoglobin Assay Solution would be provided. The concentrates mentioned herein would be diluted in use to approximately the solution concentrations stated below in Exemplary Solutions. Yet another aspect of the present invention would be a kit to enrich and detect fetal cells within a blood specimen, e.g. maternal or umbilical cord blood. Such a kit may contain one or more reagents to prepare a density gradient that concentrates fetal cells. Labeled antibodies to detect or separate fetal cells and/or probes specific for fetal cell mRNA (preferably fetal hemoglobin mRNA), and means and instructions for performing fetal cell enrichment.
Again, an alternative kit may contain one or more antibodies, desirably bound to a solid support and preferably bound to magnetic beads, to positively or negatively concentrate fetal cells within the specimen, preferably including an anti-CD45 antibody for negative selection of fetal erythrocytes, probes specific for fetal cell mRNA, means and instructions for performing fetal cell enrichment using density gradient centrifugation or flow cytometry, and optionally one or more reagents to prepare a density gradient that concentrates fetal cells. Advantageously either such of the two kits described immediately above may also be provided with means for detecting one or more target nucleic acid sequences within the fetal cells, by including a second detectable reporter system which would react with the probe or the probe-target hybrid, concentrated stock solution(s) to be used directly or to be diluted sufficiently to form wash solution(s), and, optionally, any mechanical components which may be necessary or useful to practice the present invention such as a solid support (e.g.. a microscope slide), an apparatus to affix cells to said support, or a device to assist with any incubations or washing of the specimens, and a photographic film or emulsion with which to record results of assays carried out with the present invention.
Such a kit would optionally provide reagents and materials for use in an automated system for the performance of any of the methods of the present invention.
Tables 1 and 2 contain the abbreviations and common names for various compounds and dyes mentioned herein. TABLE 1
Abbreviations and Common Names of Compounds and Dyes
Abbreviation
PI Common Name Compound
Tempo 2,2,6,6-tetramethylpiperidine-N-oxyl [CAS # 2564-83-2]
EDTA ethylene diamine tetraacetic acid DMF dimethyl formamide
DMSO dimethyl sulfoxide
DTT dithiothreitol
PVP polyvinylpyrrolidone
PEG 4000 polyethylene glycol (ca. 4000 Mol. Wt.) PBS phosphate-buffered saline solution
ATA aurintricarboxylic acid [CAS # 4431-00-9]
CHAPS 3-[(3-cholamidopropyl)-dimethylammonio]-l-propane-sulfonate [CAS # 75621-03-3] photobiotin N-(4-azido-2-nitrophenyl)-N'-(3-biotinylaminopropyl)-N'-methyl-l,3-propanediamine
[CAS # 96087-37-5] Ficoll nonionic polysucrose (Pharmacia)
Histopaque 1083 aseptically filtered solution containing Ficoll nonionic polysucrose (type 400) and sodium diatrizoate, density 1.083
Percoll colloidal PVP-coated silica [CAS # 65455-52-9] Nycodenz 5-(N-2,3-dihydroxypropylacetamido)-2,4,6-triiodo-N,N'-bis(2,3 dihydroxypropyl)isophthalamide [CAS # 66108-95-0]
T een polyoxyethylene sorbitan salts of fatty acids Sarkosyl N-lauroylsarcosine, sodium salt [CAS# 7631-98-3] Triton X-100 octyl phenoxy polyethylene glycol (a polyoxyethylene ether)
[CAS # 9002-93-1]
Brij 35 polyoxyethylene 23 lauryl ether [CAS # 9002-92-0] Brij 58 polyoxyethylene 20 cetyl ether [CAS # 9004-95-9] Tris tris(hydroxymethyl)aminomethane [CAS # 77-86-1] isoluminol 4-aminophthalhydrazide [CAS # 3682-14-2] APTO 3-aminopropyltriethoxysilane [CAS # 919-30-2] DAPI 4' ,6-diamidino-2-phenylindole hydrochloride
[CAS # 28718-90-3]
BCIP 5-bromo-4-chloro-3-indolyl phosphate [CAS # 102185-33-1] digoxigenin [CAS # 1672-46-4] TABLE 2
Dye abbreviations Dye Number Actual Dye Name Abbreviation
12 Naphthol Blue Black Naphthol Bl. Blk. 13 Palatine Fast Black WAN Palatine F-B WAN 20 Sulforhodamine 101 hydrate
[CAS # 60311-02-6] Sulforhodamine 101
Texas Red Sulforhodamine 101 acid chloride
[CAS# 82354-19-6]
Direct Blue 53 Evans Blue [CAS # 314-13-6]
Fluorescein isothiocyanate FΓΓC
Hoechst 33258 2'-[4-hydroxyphenyl]-5-[4-methyl-l-piperazinyl]-2-5'- bi-lH-benzimidazole trihydrochloride [CAS # 23491-45-4]
Natural Black 1 Hematoxylin [CAS # 517-28-2] Acid Red 91 Eosin B [CAS # 548-24-3] Sigma 840-10 Nitroblue Tetrazolium NBT PE Phycoerythrin Cy3 FluoroLink Cy3 Fluorescent Dye, a fluorescent cyanine dye (Biological Detection
Systems, Inc., 955 William Pitt Way, Pittsburgh, PA)
Cy5 FluoroLink Cy5 Fluorescent Dye, a fluorescent cyanine dye (Biological Detection
Systems)
Exemplary Solutions
The following solutions may be used in the performance of the present invention. Cell Buffer A: (as diluted for use): 0.8% BSA, 0.1% dextrose, 0.1% sodium azide in PBS.
Cell Buffer B: (as diluted for use): 2% BSA, 0.1% dextrose, 0.1% sodium azide in PBS.
Fixation solution: 4 volumes ethanol, 5 volumes of PBS, 1 volume of glacial acetic acid.
Hybridization cocktail: 5x SSC (0.75 M NaCl, 0.075 M sodium citrate); 30% formamide (v/v); 3% Triton X-100 (v/v); 0.4 M guanidinium isothiocyanate; 0.16 M sodium phosphate (pH 6); 15% Ficoll/PVP; 1 mg/ml sheared salmon or herring sperm DNA; 10 mM EDTA; 25 mM DTT; 31% PEG 4000. Hybridization Temperature: For hybridization cocktails used with a nucleic acid probe, the temperature for the hybridization reaction is within the range of about 20°C and about 90°C, preferably about 37°C and about 85°C, and most preferably about 40°C and about 46°C. The time of the hybridization reaction is between 5 minutes and 16 hours, and preferably is less than 4 hours. More preferably, the time of the hybridization reaction is less than 120 minutes, even more preferably less than 60 minutes. Most preferably, the reaction time is less than 30 minutes.
Wash Solution #1: has the following composition: 0.4 M guanidinium isothiocyanate; 0.1% Triton X-100 (v/v); and O.lx SSC in deionized water. (SSC has the following composition: 0.15 M NaCl, 0.15 M sodium citrate, pH 7.0. 2x SSC is composed so that upon a 1:1 dilution with water, SSC would be produced; lOx SSC is composed so that upon a 1:10 dilution with water, SSC would be produced.)
Wash Solution #2: has the following composition: 0.1% Triton X-100 (v/v) and O.lx SSC in deionized water. PBS: has the formula, 0.136 M NaCl, 0.003 M KC1, 0.008 M Na2HPO4-7H2O, 0.001
M KH2PO4.
Fluorescent-Coupled Antibodies: If a dye-labeled antibody is used as the probe, then the probe may be dissolved in PBS, possibly supplemented with bovine serum albumin (BSA), while it is allowed to react with target cells, preferably at a temperature in the range 4°C to 34°C. The cells need not be fixed (e.g., when the antibody target is a cell-surface antigen), or may be fixed after the probe-target incubation is completed, or may be fixed prior to or during the probe-target incubation.
Mounting Solution: may be 50% PBS/50% glycerol (v/v), 0.1% 1 ,4-phenylenediamine (as an antifade) and 1 μg/ml of Hoechst 33258 or DAPI (dye).
Nucleotide Probes: The probes may be DNA or RNA or synthetic analogues to DNA or RNA. The probe is capable of binding to a complementary target cellular genetic sequence through one or more types of chemical bonds, usually through hydrogen bond formation. In general, the DNA or RNA probes may be composed of the bases adenosine, uridine, thymidine, guanine, cytosine, or any natural or artificial chemical derivatives thereof. The phosphate backbone is linked via ribose or deoxyribose, or an analog or derivative thereof. Nucleic acid probes can be prepared by a variety of methods known to those of skill in the art. The probes may be oligonucleotides synthesized with an Applied Biosystems (A.B.I.) DNA synthesizer Model 380 using the recommended A.B.I, reagents.
In the last stage of the synthesis, an aminohexyl phosphate linker is desirably attached to the 5' end of the probes for the fetal-cell-specific marker, and preferably to both the 5' and 3' ends of the probes for the other sequences to be detected, e.g. chromosomal sequences. The 5'- or 5', 3'- aminohexyl oligonucleotides are then respectively coupled to a selected dye and purified by HPLC. However, as illustrated in Examples below, even if only a single fluorescent label is attached to the probes, fluorescence may be detected by visual microscopy. Purified single-stranded DNA probes may alternatively be produced by the use of single-stranded phage Ml 3 or plasmid derivatives of this phage, or by reverse transcription of a purified RNA template.
Detection Systems Detectable labels may be any molecule which may be detected. Commonly used detectable labels are radioactive labels including, but not limited to, 32P, 14C, 1251, 3H and 3SS. Biotin labeled nucleotides can be incorporated into DNA or RNA by nick translation, enzymatic, or chemical means. The biotinylated probes are detected after hybridization using avidin/streptavidin, fluorescent, enzymatic or colloidal gold conjugates. Nucleic acids may also be labeled with other fluorescent compounds, with immunodetectable fluorescent derivatives or with biotin analogues. Nucleic acid probes may also include any number of modified bases such as methylated bases, inosine and other naturally occurring or synthetic nucleotides. Nucleic acids may also be labeled by means of attaching a protein. Nucleic acids cross-linked to radioactive or fluorescent histone HI, enzymes (alkaline phosphatase and peroxidases), or single-stranded binding (ssB) protein may also be used. To increase the sensitivity of detecting the colloidal gold or peroxidase products, a number of enhancement or amplification procedures using silver solutions may be used.
An indirect fluorescent immunocytochemical procedure may also be utilized (Rudkin and Stollar (1977) Nature 265:472; Van Prooijen, et al (1982) Exp. Cell. Res. 141:397). Polyclonal antibodies are raised against RNA-DNA hybrids by injecting animals with poly(rA)-poly(dT). DNA probes are hybridized to cells in situ and hybrids are detected by incubation with the antibody to RNA-DNA hybrids. Probes may be detectably labeled prior to addition to the hybridization solution. Alternatively, a detectable label may be selected which binds to the hybridization product. Probes may be labeled with any detectable group for use in practicing the invention. Such detectable group can be any material having a detectable physical or chemical property. Such detectable labels have been well-developed in the field of immunoassays, and in general, most any label useful in such methods can be applied to the present invention. Particularly useful are enzymatically active groups, such as enzymes (see Clin. Chem., 22:1243 (1976)), enzyme substrates (see British Patent Spec. 1,548,741), coenzymes (see U.S. Patents Nos. 4,230,797 and 4,238,565) and enzyme inhibitors (see U.S. Patent No. 4,134,792); fluorescers (see Clin. Chem., 25:353 (1979); chromophores; luminescers such as chemiluminescers and bioluminescers (see Clin. Chem., 25:512 (1979)); specifically bindable ligands; proximal interacting pairs; and radioisotopes such as 3H, 35S, 2P, 125I and 14C.
Probe Size, Population and Concentration The length of a probe affects its diffusion rate, the rate of hybrid formation, and the stability of hybrids. According to the present invention, small probes (15-200 bases, and preferably 15-100, most preferably 15-30) yield the most sensitive, rapid and stable system. A mixture of small probes as aforesaid which span the entire length of the target nucleic acid to be detected are desirably prepared. For example, if the target nucleic acid were 1000 bases long, up to about 40 "different" probes of 25 bases would be used in the hybrid solution to completely cover all regions of the target nucleic acid.
A particularly advantageous configuration of probes is to prepare a population of probes to a selected target sequence as follows: A first probe hybridizes to bases 1 to 25 of the sequence. A second probe hybridizes to bases 31 to 55 of the sequence. A third probe hybridizes to bases 61 to 85 of the sequence, and so on, wherein the beginning of each succeeding probe is spaced apart 5 bases from the end of the preceding probe. It has been found that such a configuration wherein 5 bases are omitted between each 25-mer probe provides optimal hybridization results and signal, when employed in hybridizations in accordance with the present invention. The concentration of the probe affects several parameters of the in situ hybridization reaction. High concentrations are used to increase diffusion, to reduce the time of the hybridization reaction, and to saturate the available cellular sequences. To achieve rapid reaction rates while maintaining high signal-to-noise ratios, probe concentrations of 0.005-100 μg/ml are preferable. Most preferable is use of probes at a concentration of about 0.01 μg/ml.
Detection of Specific Genetic Abnormalities
Among the genetic abnormalities that may be detected by the tests of the present invention are Down's Syndrome (trisomy 21), Turner's Syndrome (XO chromosomes), Klinefelter's Syndrome (XXY chromosomes), Edward's Syndrome (trisomy 18) and Patau Syndrome (trisomy 13).
The following examples are offered by way of illustration and are not intended to limit the invention in any manner.
EXAMPLES
EXAMPLE 1 The Use of Chromosome-Specific Probes to Determine the Numerical Status of Specific Chromosomes in Amniocytes
Preparation of Cells
Two ml of amniotic fluid was diluted to 10 ml with PBS and centrifuged at 1200 rpm for 10 minutes. The resultant cell pellet was suspended in 1000 μl of ethanol and methanol (v:v, 3:1). Two hundred μl of sample was deposited on each slide by the cytospin method.
Preparation of Probes
Several 25-base synthetic oligonucleotide probes were prepared from each of the DNA sequences listed in Table 3.
Table 3
Probe Chromosome GenBank Designation Detected Locus Name
Alpha-centromeric repeat X HUMSATAX Alpha-centromeric repeat Y HUMSATB Alpha-centromeric repeat 18 HUMREPA84 Probe Synthesis & Labeling
The oligodeoxynucleotides were synthesized (Applied Biosystems, Inc. DNA Synthesizer Model 380B) using the recommended A.B.I, reagents, and in the last stage an aminohexyl phosphate linker was attached to the 5' end. The 5 '-aminohexyl oligodeoxynucleotides were then coupled to a rhodamine dye from Molecular Probes, Inc. and purified by Waters HPLC using a baseline 810 chromatography work station.
Hybridization
For the hybridization procedure, the cells were deposited onto slides. Twenty to 25 μl of a hybridization cocktail consisting of 30% formamide, 5x SSC, 0.1 M sodium phosphate buffer, pH 7.4, 100 μg/ml low molecular weight, denatured, salmon or herring sperm DNA,
10% (v/v) Triton X-100, 10% DMSO, 15% Ficoll/PVP, 0.4 M guanidinium isothiocyanate,
10 mM DTT, and 0.025 M EDTA and the probe, added at a concentration of 20 μg/ml.
Denaturation and hybridization were carried out simultaneously by placing the slides in an incubator for 15 minutes at 85°C.
Three separate hybridization solutions were prepared. The first solution contained a probe for the X chromosome; the second, a probe for the Y chromosome; the third, a probe for chromosome 18.
Washing
Washing of the slides after the hybridization reaction is essential to eliminate background due to non-specific binding of the probe. Post-hybridization, the slides were placed in a Coplin jar to which was added 100 ml of the Wash Solution #1. The solution was agitated and held in this solution for 2 minutes. This wash solution was removed and Wash Solution #2 was added. This second wash solution was agitated for 5 seconds and poured off. The washing procedure with Wash Solution #2 was repeated six times. Then 15 μl of Mounting solution was added.
Fluorescence Detection Photomicrographs were taken on an Olympus BH10 microscope with fluorescence capabilities, using Kodak Ektachrome EES-135 (PS 800/1600) film, exposed, and push processed at 1600 ASA. A 30 to 60 second exposure time was consistently used, so that direct comparisons could be made between all photomicrographs taken. As shown in Fig. 1 A, a single point of fluorescence (a "dot") is visible in the nucleus of male amniocytes when the Y probe was used. Figure 1A-1 is a photograph (40X magnification) of two Hoechst stained nuclei while Figure 1A-2 is a fluorescent photograph (100X magnification) of these same two cells. Fig. IB shows a female amniocyte with 2 dots visible in the nuclei when the X probe was used. Figure 1B-1 is a photograph of a Hoechst stained nuclei (40X magnification) while Figure 1B-2 is a photograph of this same cell viewed with fluorescence (100X magnification). There are two dots in the nucleus when a probe for chromosome 18 was used (Figure 1C). Figure lC-1 is a photograph of a Hoechst stained nucleus, while Figure 1C-2 shows a fluorescent view. Thus, there are the "normal" number of X, Y and 18 chromosomes present in these amniocytes.
EXAMPLE 2 Simultaneous Detection of Numerical Status of X and Y Chromosomes in Amniocytes and in Peripheral Blood Mononuclear Cells
Preparation of Cells
Two ml of amniotic fluid was diluted to 10 ml with PBS and centrifuged at 1200 rpm for 10 minutes. The resultant cell pellet was suspended in 800 μl of ethanol and methanol (v:v, 3:1). Two hundred μl of the sample was deposited on each slide by the cytospin method. In addition, approximately 5,000 peripheral blood mononuclear cells obtained from a normal male were deposited on a slide by the cytospin method.
Preparation of Probes Several 25-base synthetic oligonucleotide probes were prepared from each of the DNA sequences listed in Table 4.
Figure imgf000036_0001
Alpha-centromeric repeat X HUMSATAX Rhodamine Alpha-centromeric repeat Y HUMSATB Fluorescein
Probe Synthesis, & Labeling
The oligodeoxynucleotides were synthesized as aforesaid, and in the last stage, an aminohexyl phosphate linker was attached to the 5' end. The 5 '-aminohexyl oligodeoxynucleotide probes for each of the above chromosomes were each coupled to a different fluorescent dye as indicated in Table 5 below. The fluorescent dyes were obtained from Molecular Probes, Inc. and purified by a Waters HPLC using a baseline 810 chromatography work station.
Hybridization. Washing and Detection
These steps were performed as described in Example 1.
Results
In this experiment, the X chromosome probe was labeled with rhodamine while the Y chromosome probe was labeled with FTTC, and both probes were added to the same hybridization cocktail and taken through the above procedure. In Figure 2A-1 is a photograph of the Hoechst stained nucleus of an amniocyte and Figure 2A-2 is a photograph of the fluorescence demonstrating one bright dot (X chromosome) and one bright dot (Y chromosome) in the nucleus. Figures 2B-1 and 2B-2 are photographs of three additional amniocytes as photographed in Fig. 2A.
Fig. 2C demonstrates the results obtained using this same hybridization cocktail and normal male peripheral blood mononuclear cells when the photograph is taken through a triple band (DAPI-FTTC-rhodamine) filter set. This photograph again shows one bright dot and one bright dot for the X and Y chromosomes, respectively, on the Hoechst stained background. Fig. 2D is a photograph of a pseudo color representation of the cells in Fig. 2C using an image analysis system (BioScan Optimas™, Edmonds, Washington). EXAMPLE 3
Use of Chromosome-Specific Probes to Determine the Number of
Chromosomes in Embryos Prepared for In Vitro Fertilization or in Fetal Cells Obtained From Chorionic Villi
Preparation of Cells
Cells from non-viable embryos prepared for in vitro fertilization, cells from products of conception, and cells from chorionic villi, are accessed in a standard fashion, and deposited onto glass slides.
Preparation Of Probes
Several 25-base synthetic oligonucleotide probes are prepared from each of the DNA sequences listed below in Table 5.
Table 5
Figure imgf000037_0001
The oligodeoxynucleotides are synthesized, and in the last stage an aminohexyl phosphate linker is attached to the 5' and 3' ends. The 5 ',3 '-aminohexyl oligodeoxynucleotide probes for each of the above chromosomes are each coupled to a different fluorescent dye as indicated in Table 5 above. The fluorescent dyes may be obtained from Molecular Probes, Inc. and purified by a Waters HPLC.
Hybridization, Washing and Detection These steps are performed as in Example 1.
To photograph the four fluorochromes used to label four of the differently labeled probes, four different filter cubes, having the appropriate excitation and emission filters, are used on the microscope. Photographs are then taken sequentially following the change of each filter cube. Alternatively, dual- and triple-filter sets available from Chroma Tech, Inc., of
Brattleboro, VT; and from Omega, Inc., of Brattleboro, Vermont may be used to allow the operator to photograph two or three different colors simultaneously (as demonstrated in Example 2 above). A color TV camera may optionally be used.
A single probe may be detected within a single cell as by the procedure used in Example 1. Two probes may be detected and viewed and photographed by the procedure used in Example 2. Three or more may be detected if reporter molecules fluorescing at differently detectable wavelengths are used. As many different probes may be differentiated as the number of different fluorescent dyes can be distinguished by the available light filter systems. In the foregoing examples, when the fetal cell has a normal male karyotype, there is a single point of orange fluorescence (a "dot") in the nucleus of the fetal cell when the X probe is used; a single green dot when the Y probe is used; while there were two blue dots when a probe for chromosome 18 were used; two red dots when a probe for chromosome 16 is used; two orange dots when a probe for chromosome 21 is used; and 2 green dots when the probe for chromosome 13 is used, and two orange dots when a probe for chromosome 1 is used. These are the results for a male fetus with the "normal" number of chromosomes present. EXAMPLE 4 Detection of Fetal Cells by DNA Probes
A. Enrichment of Fetal Trophoblasts Circulating in Maternal Blood Using a Sorting Flow Cytometer and Fetal Cell Identification Probes
Preparation of Cells
Isolated white blood cells from a pregnant woman are used in the following example. The cells are washed with nuclease-free PBS and placed in a single cell suspension at a concentration that results in clearly separated cells. The cells are spun down to a pellet and the supernatant decanted. The cells are resuspended in 0.5% paraformaldehyde and left for 12-16 hours at 4°C. After fixation, the cells are spun to remove the paraformaldehyde and then washed once in PBS and resuspended in 2x SSC. The cells are used immediately.
Preparation of Probes a. Genetic Testing Probes
For a negative control probe, a 25-base sequence from the nitrogen reductase (NR) gene sequence is used (Table 6). For a positive control probe, a 25-base sequence from the 28S gene is used (Table 6). The genetic testing probes are oligodeoxynucleotides complementary to regions of human chromosomes X, Y, 1, 13, 16, 18 and 21. The details of selection, preparation and labeling of these probes are included in Table 7 below. b. Fetal cell identification probes.
The fetal cell identification probes (Table 8) are accessed via the Genetic Sequence Data Bank, GenBank, version 69.0 and prepared from the following gene sequences:
(1) fetal hemoglobin gene,
(2) cytokeratin gene,
(3) β-subunit of chorionic gonadotrophin,
(4) chorionic somatomammotropin gene (human placental lactogen), (5) α-fetoprotein gene, and
(6) pregnancy-specific glycoprotein genes. The aforesaid sequences are cut into 25-mer oligodeoxynucleotides and synthesized by a DNA synthesizer as aforesaid, and in the last stage an aminohexyl phosphate linker is attached to the 5'-end of each oligonucleotide. The 5'-aminohexyl oligodeoxynucleotides are then coupled to the fluorescent dye FITC and purified by column chromatography and HPLC.
Table 6 Control Probes
Probe Sequence Designation
28S ATCGAGTAGTGGTATTTCACCGGC SEQIDNO:1: NR TACGCTCGATCCAGCTATCAGCCGT SEQ IDNO:2:
Table 7 Genetic Testing Probes
Probe Chromosome GenBank Fluorescent Designation Detected Locus Label
Name
Alpha-centromeric repeat X HUMSATAX Rhodamine
Alpha-centromeric repeat Y HUMSATB Rhodamine
Alpha-centromeric repeat 18 HUMREPA84 Rhodamine
Collagen type IV 13 HUMCOL1A Rhodamine
Amyloid 21 HUMAMYB Rhodamine
Fragile X X mut. HUMFMR1 Fluorescein
The Fragile X condition, an amplification, is detected by the probe of SEQ ID NO:3:, which is further exemplified below in Example 14. Hybridization
For the hybridization procedure using the fetal cell identification probes, to pelleted cells is added 50 μl of a hybridization cocktail consisting of 30% formamide, 5x SSC, 0.16 M sodium phosphate buffer, pH 7.4, 1 μg/μl sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4 M guanidinium isothiocyanate, 15% Ficoll/PVP, and the probe (a mixture of the fetal cell identification probes) added at a concentration of 2.5 μg/ml. Hybridizations are carried out in a humidified environment at 42 °C for 30 minutes. Table 8 Fetal Cell Identification Probes
Probe GenBank Fluorescent Designation Locus Label
Name
Figure imgf000041_0001
Washing
Post-hybridization, the cells are placed in a 15-ml conical tube to which is added 10 ml of Wash Solution #1. The solution is agitated until the cells are a single-cell suspension and then spun at 250xg for 5 minutes. The supernatant is removed and 10 ml of Wash
Solution #2 is added to the pellet. The second wash solution is agitated until the cells are a single-cell suspension. The cells are again spun at 250xg for 5 minutes. The supernatant is removed and the cell pellet resuspended in 0.2 ml of a counterstain solution of PBS containing 0.0025% Evans Blue.
Flow Cytometer Use and Interpretation
The cells are analyzed on a Epics Elite sorting flow cytometer (Coulter Instruments).
The instrument uses a 488 nm argon laser, a 525 nm band pass filter for selection of fluorescent light (FL1) and a 635 nm long pass filter for light emitted by the counterstain (FL3). For each sample analyzed, the sample containing the negative probe is analyzed first and the quad-stats are set so that less than 0.05% of the cells fall in the upper-right quadrant. Next, the sample hybridized with the positive probe is analyzed under the same parameters as the sample sorted with the negative probe. Cells that fall in the upper right quadrant are collected and are hybridized to determine fetal genetic characteristics.
Results
In this experiment, NR is used as a negative control probe while the fetal cell identification probes are the positive probes, and would identify the fetal cells that circulate in maternal blood. The fetal cells would, in turn, be "sorted" as described above then deposited onto glass slides. The fetal cells would then be analyzed with the genetic testing probes as described in Examples 1 and 2.
B. Detection of mRNA to Fetal Hemoglobin
To further illustrate and exemplify a probe population prepared for use with the present invention, the following details are provided for the first entry in Table 8. SEQ ID NO:4: is a 443-nucleotide sequence of three fragments taken from GenBank for the
HUMGLBN gene. Bases 1 to 91 of SEQ ID NO:4: are from 2179 to 2269 of HUMGLBN. Bases 92 to 314 of SEQ ID NO:4: are from 2393 to 2615 of HUMGLBN. Bases 315 to 443 are from 3502 to 3630 of HUMGLBN. The population of DNA probes complementary to the target mRNA that is transcribed in the cell from SEQ ID NO:4: is prepared in accordance with the teachings herein.
More specifically, the sequences of the members of the population of probes are provided as SEQ ID NO:5: through SEQ ID NO:21:, each of which is a 25-mer oligonucleotide of DNA which is complementary to the mRNA target, which is transcribed from the genetic locus named above and more specifically exemplified as SEQ ID NO:4:. Each such probe is synthesized and labelled at 5' with FITC as described herein.
Fig. 5 is a photomicrograph showing fetal nucleated red blood cells enriched within a maternal peripheral blood sample prepared in accordance with the procedure of Fig. 3 and hybridized to the probe population described above. Cells with gray nuclei and distinctive morphology are fetal nucleated red blood cells. Cells lacking nuclei are fetal erythrocytes or fetal reticulocytes which still contain fetal hemoglobin mRNA.
C. Optional Detection of Multiple RNAs to Increase Specificity of Fetal Cell Identification As stated above, there are situations where fetal cells express two or more particular RNAs in the same cell while maternal cells from the same specimen source do not contain both RNA species in the same cell. Multiple mRNA or hnRNA species are detected simultaneously in the same cell when only the unique set of RNAs is present, so that a specific signal is detected, which uniquely identifies fetal cells.
Prior to use, cells in suspension are washed with chilled PBS and mixed thoroughly to ensure a single-cell suspension.
In the present Example, the combination of RNAs which is targeted is human chorionic gonadotropin (HCG) and transferrin receptor (TR). Although either of these genes is expressed in certain types of maternal cells, the cells which normally express these genes do not circulate in the bloodstream, and no single type of maternal cell expresses both of the genes. However, fetal trophoblasts express both of these genes simultaneously in the same cell.
One or more 25-mer oligonucleotide DNA probes for the sequences for HCG identified in Table 8 is prepared and labeled with fluorescein. One or more 25-mer oligonucleotide DNA probes for the sequence for TR identified in Table 8 is prepared, labeled with rhodamine.
A sample of maternal peripheral blood is washed with chilled PBS and mixed thoroughly to ensure a single-cell suspension placed as a smear on a microscope slide. A hybridization is performed as stated above, with probes for HCG and TR.
The signal produced in the fetal trophoblast cells is an additive combination of the green from fluorescein and the red from rhodamine, to yield a 2x signal, which appears yellow-orange.
EXAMPLE 5
The Use Of Synthetic Oligonucleotides As Probes For Both Strands Of DNA As Targets For Hybridization
Oligomers prepared to both strands of a DNA target produce about twice the signal when compared to the signal produced when probe is made to only one strand of the DNA. In addition, the ability to hybridize to both DNA strands allows simultaneous quantitation of the amount of DNA and RNA within individual cells. Preparation of Cells
The H9 cell line (ATCC No. 8543) is used in the following experiment. Cultured cells are washed with nuclease-free PBS and placed in a single-cell suspension at a concentration that results in clearly separated cells. The cells are spun down to a pellet and the supernatant decanted. The cells are resuspended in 40% ethanol, 50% PBS, and 10% glacial acetic acid. The cells are used immediately.
Figure imgf000044_0001
HIV - sense strand HUMHB102 FITC 1-3 HIV - antisense strand HUMHB102 rhodamine derivative T488
Probe Synthesis, & Labeling
The aforementioned HIV sequences are cut into 30-base oligonucleotides and synthesized as phosphorothioate oligonucleotides using DNA synthesizers (Applied Biosystem DNA Synthesizer, Model 380B) and using the recommended A.B.I, reagents. The polysulfurized oligonucleotides are then coupled to a fluorescent dye and purified by column chromatography and HPLC. A 30-base oligonucleotide from the nitrogen reductase gene serves as the negative control probe.
Hybridization
For the hybridization procedure, to pelleted cells is added 50 μl of an hybridization cocktail consisting of 30% formamide, 5x SSC, O.16 M sodium phosphate buffer, pH 7.4, 1 μg/μl sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4 M guanidinium isothiocyanate, 15x Ficoll/PVP, and the probe added at a concentration of 2.5 μg/ml. Hybridizations are carried out in a humidified environment at 42°C for 30 minutes.
Washing
Post-hybridization, the cells are placed in a 15 ml conical tube to which is added 10 ml of a wash solution, consisting of O.lx SSC, 0.4 M guanidinium isothiocyanate, and 0.1% Triton X-100 (Wash Solution #1) at a temperature of 42°C. The solution is agitated until the cells are a single-cell suspension and then spun at 250xg for 5 minutes. The supernatant is removed and to the pellet is added 10 ml of Wash Solution #2 at a temperature of 42°C. The solution is agitated until the cells are a single cell suspension. The cells are spun at 250xg for 5 minutes. The supernatant is removed and the cell pellet resuspended in 0.2 ml counterstain solution consisting of 0.0025% Evans Blue in PBS.
Flow Cytometer Use and Interpretation
The cells are analyzed on a FACSTAR instrument (Becton Dickinson). The instrument uses a 5-watt argon laser coupled to a dye head, a 525 nm band pass filter for FL1 and a 584 nm band pass filter for the Rhodamine. For each sample analyzed, the sample containing the negative probe is analyzed first and the quad-stats are set so that less than 0.01% of the cells fall in the upper-right quadrant or lower-right quadrant. Next, the sample treated with the HIV probes is analyzed under the same parameters as the sample analyzed with the negative probe. Since the quad-stats are set correctly and the two samples have been handled identically, any number of cells (above 0.01%) recorded in the upper right quadrant are scored as positive for both strands and/or mRNA. Any number of cells (above 0.01%) that are recorded in the lower right quadrant are scored positive for DNA only.
EXAMPLE 6
Separation of Fetal Cells from Maternal Blood and the
Use of Fetal-Cell-Specific Antibodies and DNA Probes to Positively Identify the Fetal Cells
Separation of Fetal Cells From Maternal Peripheral Blood
Percoll stock and gradient solution was prepared in adherence to the manufacturer's (Pharmacia, Uppsala, Sweden) recommendations by mixing 9 parts of Percoll with 1 part 1.5 M NaCl. The density gradient Percoll solutions were prepared according to Table 10.
Figure imgf000046_0001
To concentrate circulating fetal cells, 10 ml of maternal peripheral blood from a woman in the first trimester of pregnancy was overlaid in a 50 ml conical tube on a Percoll discontinuous density gradient consisting of 10 ml each of gradient solutions with densities of 1.100, 1.085, 1.075 and 1.065 g/ml from the bottom of the tube to the top, respectively. The gradient was centrifuged at 360xg for 30 minutes at room temperature. This procedure fractionated the blood in several layers. The first and second layers from the top of the gradient contained most of the circulating fetal trophoblasts. These layers were collected, diluted with PBS to a volume of 50 ml and centrifuged at 500xg for 5 minutes at room temperature. The pellet, enriched with fetal cells, was washed twice with PBS and centrifuged as above, fixed with 75% chilled ethanol and used for fetal cell identification and genetic disorder testing as described below.
As shown in Fig. 4, maternal blood cells were desirably fractionated into several bands using a four-layer Percoll discontinuous density gradient (Tube A, B). Bands 1 and 2 from the top of Tube B were withdrawn and then added to PBS (Tube C) and centrifuged for 5 minutes at 500xg. The cells were resuspended in PBS and centrifuged as above twice more. The pellet was resuspended in chilled 75% ethanol at a concentration at 106 cells/ml and used the same day or stored at 20°C.
Positive Identification of Fetal Cells . Bv Direct Immunofluorescence
About 106 ethanol-fixed maternal blood cells enriched with fetal cells were microcentrifuged at 1500 rpm for 5 minutes at room temperature. The pellet was resuspended in 1 ml of buffer A (8.01 g NaCl, 0.20 g KC1, 1.44 g Na2HPO4, 1000 ml distilled, deionized water) containing 5% fetal calf serum (buffer A FCS) and microcentrifuged as stated above.
This wash step was repeated. The final pellet was resuspended in 100 μl of buffer A/FCS containing 1 μl of anti-human cytokeratin 18-FITC (Sigma Chemical Company Catalog No. F-4772; mouse host, IgG class 1, clone CY-90) and incubated in the dark for 1-2 hours while mixing gently on an end-to-end mixer. The reaction mixture was then washed 3 times with 1 ml buffer A/FCS as above and the pellet was cytospun on glass slides at 700 rpm for 7 minutes. Fetal cells were scored using fluorescence microscopy .
Figures 6A and 6B show a representation of these fetal cells stained with anti-human cytokeratin 18-FITC in maternal peripheral blood as described above.
IL. By Indirect Immunofluorescence Labeling
As an alternative to the direct immunofluorescence described above, an indirect immunofluorescence method can be used. The procedure was the same as the direct method (described above), except the cells were first incubated in a 1:200 dilution of anti-human cytokeratin (CAM 5.2 from Becton Dickinson Catalogue No. 92-0005) in buffer A/FCS for 40 minutes and washed free of the primary antibody. The cells were then labeled with the secondary antibody tagged with FITC (anti-mouse IgG + IgM from goat); (Boehringer Mannheim Biochemicals Catalog No. 605- 25) for 30 minutes and washed from the residual antibody as described above. The cells were scored as above.
C. By Sequential Use of Y Chromosome DNA Probe on Fetal Cells Previously Stained with Anti-Cytokeratin Antibody to Detect Fetal Cells and Perform Genetic Testing in Maternal Blood
Preparation of Cells
An additional slide stained with the anti-cytokeratin antibody as described above was taken through the hybridization procedure as described below. Preparation of Probes
The Y chromosome probes were synthetic oligodeoxynucleotides complementary to regions of human chromosome Y. The details regarding the preparation and labeling of these probes are included in Example 1 and in Table 8.
Hybridization
For the hybridization procedure, 20 μl of a hybridization cocktail was added to the slide. The cocktail contained PEG, 25% formamide, 5x SSC, 1 mg/ml salmon sperm DNA, 15x Ficoll/PVP, 0.4M guanidinium isothiocyanate, 50 mM DTT, 5% Triton X-100, 50 mM EDTA, 50 mM Na2PO4 , and the Y chromosome probe at a concentration of 20 μg/ml. A coverslip was applied and the slide was incubated at 85°C for 15 minutes in an incubator.
Washing
After hybridization, the slides were placed in a Coplin jar to which was added 100 ml of Wash Solution #1. The jar was agitated until the coverslip fell off, and the slide was held in this solution for 2 minutes. This wash solution was removed and Wash Solution #2 was added. This second wash solution was agitated for 1 minute and poured off, and this last wash was repeated 6 times. Following the washes, 8 μl of Mounting solution was added. The slide was coverslipped and viewed under the fluorescence microscope.
Fluorescence Detection
Slides were screened under 40x objectives using an Olympus BH10 microscope with fluorescence capabilities.
Figure 7 shows a cytokeratin-stained fetal cell (brightly stained cytoplasm) within maternal peripheral blood. The cell has one Y chromosome within its nucleus that has stained positive following hybridization with the rhodamine labeled Y chromosome probe.
EXAMPLE 7 Isolation of Trophoblasts from Placenta and Detection of Chromosomes X, Y and 18 Within Their Nuclei
Trophoblasts were isolated from term placental tissue by a modified procedure of Wang et. al., American Journal of Reproductive Immunology 16:8-14 (1988). The trophoblasts were then fixed with 75% chilled ethanol, stained with anti- cytokeratin antibodies as described above (Example 6) and subsequently hybridized to Y, X and 18 chromosome-specific probes also as described above in Example 6.
The origin of the probes for chromosome X, Y and 18 was described in Example 1. The DNA probes were all labeled with a rhodamine derivative as described in
Example 1.
Hybridization, washing and detection was carried out as described in Example 1.
Figure 8 A shows the results with the X-chromosome probe; 8B, the Y-chromosome probe; and 8C, the chromosome- 18-specific probe. The cytoplasm is stained strongly with the FITC labeled anticytokeratin antibody. The nuclei in 8 A and 8B contain strong single points of light indicating the presence of single X and Y chromosomes. The nuclei in 8C contain two strong points of light indicating the presence of two chromosomes 18.
EXAMPLE 8 Use of Fetal-Cell-Specific DNA Probes to Detect Fetal-Cell-Specific mRNA in Cells Obtained from Amniotic Fluid and/or Placenta
Preparation of Cells
Cells from amniotic fluid were prepared as described above (Example 1) and cells from placenta were prepared as described above (Example 7).
Slides containing normal peripheral mononuclear blood cells were also prepared as described in Example 2
Preparation of Probes The fetal cell identification probes were accessed via the Genetic Sequence Data
Bank, GenBank, version 69.0 and prepared from the following gene sequences, Table 11 :
Figure imgf000050_0001
The aforementioned sequences were cut into several 39-base-oligonucleotides and synthesized as phosphorothioate oligonucleotides using DNA synthesizers (Applied Biosystems DNA Synthesizer, Model 380B) and using the recommended A.B.I, reagents. The polysulfurized oligonucleotides were then coupled to a FITC (Molecular Probes, Inc. Catalogue No. 1-2) or rhodamine (Catalogue No. T488) and purified by column chromatography and HPLC. As a negative control probe, the HIV probes described in Example 10 were used.
Hybridization
For the hybridization procedure, 20 μl of a hybridization cocktail was added to each slide. The cocktail consisted of 31% PEG, 25% formamide, 5x SSC, 1 mg/ml salmon sperm DNA, 15% Ficoll/PVP, 0.4M guanidinium isothiocyanate, 50 mM DTT, 5% Triton X-100, 50 mM EDTA, 50 mM Na2PO4, and probe at a concentration of 20 μg/ml. A coverslip was applied to each slide and was incubated for 30 minutes at 42°C.
Washing
After hybridization, the slides were placed in a Coplin jar to which was added 100 ml of Wash Solution #1. The jar was agitated until the coverslip fell off, and the slide was held in this solution for 2 minutes. This wash solution was removed, and Wash Solution #2 was added. This second wash solution was agitated for 1 minute and poured off, and this last wash was repeated 6 times. Following the washes, 8 μl of mounting solution was added. The slide was coverslipped and viewed under a fluorescent microscope.
Fluorescence Detection Photomicrographs were taken on an Olympus BH10 microscope with fluorescence capabilities, using Kodak Ektachrome EES-135 (PS 800/1600) film, exposed, and push processed at 1600 ASA. A 20-second exposure time was consistently used, so that direct comparisons could be made between all photomicrographs taken. In each of the cells in the figures below, the bright light (in color photographs, it is orange) from both the nuclei and cytoplasm represent a positive signal. The unstained cells in the photos (in color photographs, it is a red color due to the counterstain) represent maternal cells that are negative for the presence of the fetal cell identification probes. As a negative control, the HTV probes were hybridized to these amniocytes and trophoblasts and there was no bright hybridization signal.
All of the fetal cell identification probes as well as the HIV probes were used in separate hybridization experiments using normal white blood cells and these cells had no bright hybridization signal indicating that they were all appropriately negative.
Figure 9A shows the results when using the cytokeratin probes to analyze amniocytes (Figure 9A-1) and trophoblasts (Figure 9A-2).
Figure 9B shows the results when using the HCG probes to analyze amniocytes (Figure 9B-1) and trophoblasts (Figure 9B-2).
Figure 9C shows the results when using the α-fetoprotein probes to analyze amniocytes (Figure 9C-1) and trophoblasts (Figure 9C-2).
EXAMPLE 9
Use of Anti-Cytokeratin Antibodies and Flow Cytometry to Detect Fetal Trophoblasts Obtained from Placental Tissue
Preparation of Cells
Placental trophoblasts were isolated from term placenta and were fixed in 75% chilled ethanol as described in Example 2. The fixed cells were stained with anti-cytokeratin and isotope-control antibodies, both labeled with FITC as stated in Example 6 and analyzed by flow cytometry.
Flow Cytometer Use and Interpretation
The cells were analyzed on a Profile II system (Coulter Instruments). The instrument uses a 488 nm argon laser, a 525 nm band pass filter for FLl. For each sample tested, the
- 49 - SUBSFITUTE SHEET (RULE 26) sample containing the isotope control antibody was analyzed first and the controls of the instrument (quad-stats) set so that less than 0.2% of the cells fell in the upper-right quadrant. Next, the sample challenged with the anti-cytokeratin antibody was analyzed under the same parameters as the sample challenged with the isotope-control antibody. Since the quad-stats had been set correctly and the two samples had been handled identically, the amount of cells above 0.2% that were recorded in the upper right quadrant were scored as positive.
EXAMPLE 10 Use of HIV DNA Probes to Detect HTV mRNA in Placental Fetal Trophoblasts or Amniocytes
Preparation of Cells
Trophoblasts are isolated from term placental tissue by a modified procedure as described in Example 7. Amniocytes are obtained through amniocentesis. The H9 HIV cell line and peripheral blood polymorphonuclear cells served as positive and negative controls, respectively. These cells are washed with nuclease-free PBS and are placed in a single-cell suspension at a concentration resulting in clearly separated cells. The cells are spun down to a pellet and the supernatant decanted. The cells are resuspended in 0.5 % paraformaldehyde and left for 12-16 hours at 4°C. After fixation, the cells are spun to remove the fixative and then washed once in PBS and resuspended in 2x SSC. The cells are used immediately.
Preparation of Probes
A negative control probe, sequences for human papillomavirus (HPV) type 16 and HPV type 18 (Table 12) were obtained from the published sequences and were accessed via the Genetic Sequence Data Bank, GenBank, version 69.0.
Table 12
Probe GenBank Fluorescent
Designation Locus Name Label
HPV 16 PPH16 Fluorescein
HPV 18 PPH18 Fluorescein
HIV HUMBH102 Fluorescein Twenty separate HPV probes (10 for HPV type 16 and 10 for type HPV 18) and 180 HIV probes are synthesized by cutting the HIV sequences into several 39-base oligonucleotides and synthesized as phosphorothioate oligonucleotides using DNA synthesizers (Applied Biosystems DNA Synthesizer, Model 380B) and using the recommended A.B.I, reagents. The phosphorothioate oligonucleotides are then coupled to FITC and purified by column chromatography and HPLC.
Hybridization
For the hybridization procedure, to pelleted cells was added 50 μl of an hybridization cocktail consisting of 30% formamide, 5x SSC, O.16M sodium phosphate buffer, pH 7.0, 1 μg/μl sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4M guanidinium isothiocyanate, 15x Ficoll/PVP, and the probe added at a concentration of 2.5 μg/ml. Hybridizations were carried out in a humidified environment at 42°C for 30 minutes.
Washing
Post-hybridization, the cells were placed in a 15 ml conical tube to which was added 10 ml of Wash Solution #1 (heated to 42°C). The solution was agitated until the cells were a single-cell suspension and then spun at 250xg for 5 minutes. The supernatant was removed and to the pellet was added 10 ml of Wash Solution #2 (heated to 42°C). The second wash solution was agitated until the cells were a single-cell suspension. The cells were spun at
250xg for 5 minutes. The supernatant was removed and the cell pellet resuspended in 0.2 ml of a PBS counterstain solution containing 0.0025% Evans Blue.
Flow Cytometer Use and Interpretation The cells were analyzed on a Profile II system as aforesaid. The instrument uses a 488 nm argon laser, a 525 nm band pass filter for FLl and a 635 nm band pass filter for FL3.
For each sample analyzed, the sample containing the negative probe was analyzed first and the quad-stats set so that less than 0.01% of the cells fell in the upper-right quadrant. Next, the sample analyzed with the positive probe was analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats had been set correctly and the two samples had been handled identically, cells (above 0.01%) recorded in the upper right quadrant were scored as positive. EXAMPLE 11 Synthesis of Multiple-Reporter Labeled Oligonucleotides
To obtain maximum sensitivity, a preferred embodiment of the present invention employs oligonucleotide probes that are labeled with multiple reporter moieties, such as fluorescent moieties. This Example describes the preparation of such probes.
Two hundred μg of dried oligonucleotide is dissolved in 100 μl of 250 mM Tris buffer pH 7.4, to form a first solution. One mg of iodoacetamido-fluorescein is combined with 100 μl of dry DMF to create a 200-μl reaction mixture. The two solutions are mixed together and shaken overnight. This results in an oligonucleotide to acetamido-fluorescein ratio of 1:5 in the reaction mixture. One mg of iodoacetamido-fluorescein is again combined with 100 μl of DMF, and this 100 μl is combined with the 200 μl of reaction mixture. Another 100 μl of 250 mM Tris buffer is added to the 400 μl of reaction mixture and the reaction is allowed to continue for another 6 hours. The labeled oligonucleotide is precipitated with ethanol and 3 M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye. The desired fractions are collected. The liquid phase is then removed under vacuum. The crude material is then purified by high performance liquid chromatography (HPLC).
EXAMPLE 12
Probes for Both Strands of a DNA Target
The procedure of the Examples above may be modified as follows:
(1) Four hundred sixteen (416) separate probes (208 for type 16 and 208 for type 18) each designed as 30-bases in length, are synthesized. However, in addition to making probes corresponding to those 416 separate oligonucleotides that together comprise probes for one strand of each of the two HPV targets, one also makes 416 additional oligonucleotide probes for the second strand of both of the two HPV targets. The probes for the first strand will be "out of phase" relative to the second strand probes as regards how they map on a map of the HPV genome. As a result, one-half (15 nucleotides) of each first strand probe will be complementary (in nucleotide sequence) to one-half of one second strand probe and the other half (15 nucleotides) of that first strand probe will be complementary to a portion of another second strand probe. Staggering of the probes means that, because of the shortness of the overlap (10 nucleotides), probes of the first strand will not hybridize significantly to probes of the second strand. On the other hand, about twice as much hybridization is detected as compared to the situation where only probes corresponding to one strand are used.
(2) Probes are made as phosphorothioate oligonucleotides, each 30-mer having four sulfur atoms, using an Applied Biosystem (ABI) DNA Synthesizer, Model 380B and the recommended A.B.I, reagents. The sulfur atoms are located as follows: one is at the extreme 5' end of the probe, a second is between the 7th and 8th nucleosides (counting from the 5' end), the third is between the 22nd and 23rd nucleosides, and the fourth is between the 29th and 30th nucleosides. The sulfur atoms of the polysulfurized oligonucleotides are then coupled to a fluorescent dye, iodoacetamido-fluorescein, as follows (smaller amounts can be synthesized by adjusting the volumes): 200 μg of dried oligonucleotide is dissolved in 100 μl of 250 mM Tris buffer, pH 7.4 to form a first solution. Then 1 mg of iodoacetamido- fluorescein is combined with 100 μl of dry dimethylformamide (i.e., 100 percent DMF) in a second solution. The two solutions are mixed together and shaken overnight. After the overnight incubation, the labeled oligonucleotide is precipitated with ethanol and 3 M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye. The desired fractions are then collected. The liquid phase is then removed under vacuum. The crude material is then purified with HPLC (high performance liquid chromatography).
(3) Negative control probes are constructed in analogy to steps (1) and (2).
(4) The hybridization cocktail is modified as follows: 1.5% PEG is used instead of 31% PEG, 30% formamide is used instead of 21% formamide, 10% DMSO (10% v/v) is included, and 5% (v/v) of vitamin E is included. Also instead of adding 50 μl of the hybridization cocktail to the slide, 40 μl of the cocktail is added to 5 μl of squalene plus 5 μl of pyrrolidinone and the combined 50 μl is added to the slide. It can be useful to add 5 μl of 1 M (1 molar) DTT and 5 μl of Proteinase K (1 mg/ml) solution per 100 μl of hybridization cocktail and run the hybridization reaction at, for example, 42°C for 5 minutes, then at 95°C for 5 minutes, and then at 42°C for 2 minutes. It can also be useful to add about 0.05% or 0.10% aurintricarboxylic acid (ATA) in the hybridization cocktail.
(5) Instead of adding 8 μl of antifade/Hoechst to the slide, 8 μl of the following solution is added: 9 volumes of solution A plus 1 volume of solution B where solution A is 0.01% 1,4 diphenylamine (antifade) plus nuclear stain Hoechst (#33258; 1 μg/ml) plus
0.0025% Evans Blue in 50% (v/v) glycerol plus 50% (v/v) 1 x PBS (0.136 M NaCl, 0.003 M KC1, 0.008 M Na2HPO4, 0.001 M KH2PO4) and solution B is dodecyl alcohol. EXAMPLE 13
The Use of DNA Probes and In Situ Hybridization to Determine the Presence of the Philadelphia Chromosome
Preparation of Cells
White blood cells from peripheral blood or bone marrow from patients with chronic myelogenous leukemia are deposited onto glass slide by the cytospin method.
Preparation of Probes Several 25-base synthetic oligonucleotide probes are prepared from the DNA sequence listed in the table below.
Table 13 Probe Chromosome GenBank Designation Detected LocusName
BCR 22 HUMBCR
Probe Synthesis and Labeling
The oligodeoxynucleotides are synthesized and labeled as described in Example 1.
Hybridization
For the hybridization procedure, the cells are deposited onto slides. 20 to 25 μl of a hybridization cocktail consisting of 31% PEG, 30% formamide, 5x SSC, 0.1 M sodium phosphate buffer, pH 7.4, 100 μg/ml low molecular weight, denatured, salmon or herring sperm DNA, 10% (v/v) Triton X-100, 10% DMSO, 15% Ficoll/PVP, 0.4 M guanidinium isothiocyanate, 10 mM DTT, and 0.025 M EDTA and the probe added at a concentration of 20 μg/ml is applied. A coverslip is applied and the slide is heated to 95 °C for 5 minutes, allowed to cool to 42°C. and incubated for 25 minutes at that temperature.
Washing and Detection
Washing and detection are done as described in Example 1. Chronic myelogenous leukemia is associated with a characteristic chromosomal translocation between chromosomes 9 and 22, resulting in the so-called Philadelphia Chromosome, 22q+. [See: Rowley, J. D.: A new consistent chromosomal abnormality in myelogenous leukemia identified by quinacrine fluorescence and Giemsa staining. Nature 243:290 (1973); Heisterkamp N, et al.: Structural organization of the bcr gene and its role in the Ph translocation. Nature 315:758 (1985)]
Because the probes for the bcr gene are prepared such that they span the break point cluster region to include both the 5' and the 3' ends of the gene, when a translocation occurs there are three points of light ("dots") within the cell. One bright dot would represent the unaffected chromosome and two less intense dots would represent the un-translocated 5' bcr gene while the second less intense dot would represent that 3' end of the bcr gene that translocated to Chromosome 9.
In an alternative format, sequences from the c-abl gene that translocate to Chromosome 22 are accessed and prepared as described above. These sequences are labeled with a second fluorescent moiety and added to the hybridization solution. Now when a translocation occurs, one positive signal (representing the 5' end of the bcr gene still on Chromosome 22) would appear in one color (e.g., green) and adjacent to another positive signal (representing the c-abl gene that translocated to Chromosome 22) which would appear in a second color (e.g., red).
EXAMPLE 14
Detection of the Fragile X Chromosome in Amniocytes and in
Peripheral Blood Mononuclear Cells
Preparation of Cells
Two ml of Amniotic fluid is diluted to 10 ml with PBS and centrifuged at 1200 rpm for 10 minutes. The resultant cell pellet is suspended in 800 μl of ethanol and methanol (v:v, 3:1). 200 μl of the sample is deposited on each slide by the cytospin method. In addition, approximately 5,000 peripheral blood mononuclear cells obtained from a normal male are deposited onto a glass slide by the cytospin method.
Preparation of Probes A 25-base synthetic oligonucleotide consisting of SEQ ID NO:3: is synthesized and labeled as described in Example 1.
Hybridization, Washing and Detection Hybridization, washing and detection are done as described in Examples 1 and 13.
The Fragile X syndrome is caused by mutations that increase the size of a specific DNA fragment (containing a lengthy CGG repeat) of the X chromosome (in Xq27.3). See, e.g., Francois Rousseau, M.D. et al., N EngI J Med, 325:1673-1681 (1991).
Following the aforesaid procedure, when an amplification of the CGG DNA fragment is present, there is an increase in the intensity of the signal. Using any of a number of image analysis systems, this signal is quantified and compared to normal controls to determine whether or not a Fragile X chromosome, i.e., an amplification of CGG, is present. Such image analysis systems include, for example: ACAS 570 from Meridian Instruments, Okemos, MI; and instruments from Perseptive Systems, Inc., League City, TX; and Applied Imaging, Santa Clara, CA.
EXAMPLE 15
Concentration of Fetal Nucleated Red Blood Cells Within Maternal
Blood Using Direct Negative Selection Method
A sample consisting of 20 ml of maternal peripheral blood is diluted to 35 ml with buffer solution A and overlaid on top of 15 ml Histopaque- 1083 in a 50-ml conical tube. The tube is centrifuged at 700 x g for 30 minutes, and the interphase layer is collected into a fresh 50-ml conical tube, the volume then being brought up to 40 ml with buffer A. The conical tube is then centrifuged for 10 minutes at 1000 rpm (200 x g). The cell pellet is re¬ suspended in 1 ml of buffer solution B and mixed with pre-washed immunomagnetic beads coated with anti-CD45. The bead/cell mixture is allowed to react for 10 minutes, during which the unwanted leucocytes are reacted to the beads while nucleated red blood cells (NRBCs) stay in the solution. A magnetic particle concentrator is applied to the side of the reaction tube. The magnetic beads and material complexed thereto collect on the side of the reaction tube adjacent the magnet. The supernatant fluid, containing NRBCs, is then poured off, cytospun, fixed for 5 minutes in 80% ethanol and used for in situ hybridization. EXAMPLE 16
Concentration of Fetal Nucleated Red Blood Cells Within Maternal
Blood Using Alternate Direct Negative Selection Method
The procedure of Example 15 is performed, but with the following modification: Instead of using immunomagnetic beads coated with anti-CD45, a cocktail containing immunomagnetic beads coated with monoclonal antibodies against various components of maternal blood (but not fetal erythrocytes) is used to effectively remove the non-fetal cells as well as platelets from the specimen, leaving behind the fetal target cells.
Antibody Selection
To determine whether a particular antibody or mixture of antibodies would be suitable for use in accordance with the present invention, the following procedure may be performed: Perform a density separation on a sample of umbilical cord blood as in Example 4. Resuspend the buffy-coat in 1 ml of Buffer Solution B. Prepare a control slide by cytospinning 50 μl of this cell suspension and fixing by dipping slide in 3:1 ethanol/methanol. Prepare a test slide by removing a sample of 1 x 106 cells from the aforesaid buffy-coat resuspension and adding 20 μg of the antibody to be tested, coupled to magnetic beads. Prepare the cells as described in Example 6. Perform microscopic examination of slides as in Example 6 and determine the ratio of fetal nucleated red blood cells to total cells on each slide. If the ratio for the test slide is between 75% and 125% of the corresponding ratio for the control slide, the antibody is considered acceptable. For example, an acceptable result would be a control slide having 5 NRBCs per 10,000 cells and the corresponding test slide having 4 NRBCs per 10,000 cells.
EXAMPLE 17
Concentration of Fetal Nucleated Red Blood Cells Within Maternal
Blood Using Indirect Negative Selection Method
A 20-ml sample of maternal peripheral blood is diluted to 36 ml with buffer solution
A and overlaid on the top of 15 ml of Histopaque 1083 in a 50-ml conical tube. The tube is centrifuged at 700 x g for 30 minutes, and the interphase layer (buffy-coat) is collected into a fresh conical tube. The volume is then brought up to 40 ml with buffer solution A and the tube is centrifuged for 10 minutes at 200 x g. The cell pellet is re-suspended in a solution containing monoclonal antibody. The monoclonal antibody is anti-CD45 or a mixture of monoclonal antibodies selected from the group consisting of anti-CD45, anti-CD34, anti- CD^, anti-CD31, and anti-CD44 in a 1-ml reaction volume. The cells are allowed to react with the antibody for 30 minutes at 4°C. The mixture is then microcentrifuged at 500 rpm for 5 minutes, and the supernatant is aspirated off. The cell pellet is washed with 1400 ml of the reaction buffer (buffer solution A), and the pellet is re-suspended in 1 ml buffer solution B. The cell suspension is then mixed with pre- washed bends coated with sheep anti-mouse IgG, and the mixture is allowed to react for 10 minutes during which most of the non- wanted cells (leucocytes and erthyrocytes) react with the beads, forming cell/bead complexes. The complexes are then removed from the reaction by a magnetic particle concentrator, which collects the complexes on the side of the reaction tube. The supernatant containing NRBCs is directly loaded on cytospin to make slides. The slides are fixed with 80% ethanol and used for fluorescent in situ hybridization.
EXAMPLE 18
Detection of Fetal Nucleated Red Blood Cells
Enriched from Maternal Blood and Simultaneous
Detection of Chromosome Abnormalities
Slides prepared in accordance with Examples 15, 16 and 17 are hybridized on slides in a single step using probes for fetal hemoglobin mRNA as in Example 3 and probes for human chromosomes as in Example 4.
Fig. 10 shows a fetal nucleated red blood cell that was hybridized simultaneously to DNA probes specific to fetal hemoglobin mRNA as described in Example 4, part B and to probes for human chromosomes X and Y as described in Example 4, part A. The greenish cytoplasm indicates that the cell is a fetal nucleated red blood cell, due to signal from fluorescein-labeled probe for HbF mRNA. The green dot within the nucleus is a signal for X chromosome, from fluorescein-labeled probes for X. The red dot within the nucleus is a signal for Y chromosome, from rhodamine-labeled probes for Y.
EXAMPLE 19 Detection of Fetal Nucleated Red Blood Cells Enriched From Maternal Blood Using Indirect Immunofluorescence Techniques
An alternative procedure for detecting fetal cells is to perform the procedure of Example 18, modified as follows: Instead of using DNA probes to fetal hemoglobin mRNA, monoclonal antibody against fetal hemoglobin protein (Accurate Chemical, cat. no. IRXG- 11149) is used. Enriched cells are fixed in 2% paraformaldehyde for two hours, washed free of fixative and reacted with a 1:100 dilution of anti-HbF antibody for 30 min. The amount of antibody added is 2-20 μg per million fetal erythrocyte cells in the sample. The excess antibody is removed by washing the cells twice with PBS. Next the cells are stained for 30 min. with a 1:100 dilution of a monoclonal antibody that selectively binds to the anti- HbF antibody (Euro-Path, Ltd.) and that is tagged with alkaline phosphatase. Excess antibody is removed by washing with PBS, and Vector Red as a substrate (Vector Chemical Co.) is added to the cells. In a later step, excess substrate is washed off. The cells are cytospun on glass slides and used for in situ hybridization, as in Example 18.
EXAMPLE 20
Enrichment of Fetal Cells Within Maternal Blood
By Lysing Maternal Erythrocytes
Maternal blood specimens are treated with 0.075 M KC1 for 15 min at 37°C. This treatment selectively lyses maternal erythrocytes, leaving intact all nucleated cells present in the sample. The lysate is then contacted with beads coated with anti-CD45 or, more generally, with one or more antibodies against cell surface antigens of maternal blood cells. The mixture is allowed to react. The beads along with cells ligated thereto are then removed from the mixture with a magnetic particle collector. The remaining liquid, containing primarily fetal nucleated erythrocytes, is used to make cytospun slides as described hereinabove. This procedure may be performed entirely in an automated device. EXAMPLE 21 In Situ Amplification for Fetal Cell Detection
Fetal cells contain unique mRNAs, or mRNA species which are produced in cell types which do not normally contain the particular mRNA species. The detection of these RNAs, whether detected as messenger RNAs (mRNAs) or heteronuclear RNAs (hnRAs) can serve to identify cells, or even subcellular fractions as fetal or embryonic in origin. While certain RNA populations are present in high abundance (e.g., fetal hemoglobin in fetal nucleated red blood cells), other fetal- or embryonic-specific RNAs are present in low abundance, either alone or even when considered as a population of fetal-specific RNAs. The ability to detect rare mRNAs or hnRNA and thereby identify fetal cells may be enhanced by amplifying the rare RNA population using one of the available amplification techniques such as 3SR, LCR, Q-Beta Replicase, Strand Displacement Assay, PCR, and the like.
In the present invention, cells may be obtained from umbilical cord blood, maternal peripheral blood, amniotic fluid, chorionic villus samples, etc. Cellular samples may be used directly or may be concentrated to enrich the population of fetal cells prior to analysis. Cells may be fixed in common precipitating fixatives or cross-linking fixatives or may be used in the following test without fixation. The procedure may be carried out with cells deposited onto a solid support such as a glass microscope slide or used with the cells in suspension. Prior to use, cells in suspension may be washed with chilled phosphate-buffered saline (PBS), and mixed thoroughly to insure a single-cell suspension.
For in situ cDNA synthesis of the DNA copy of the rare RNA species, a "first strand mix" is freshly prepared, comprising 5 μl of 10 X first strand buffer (1.4 M KC1, 0.5 M Tris- HC1 pH 8.1 at 42°C, 80 mM MgCl2), 5 μl dithiothreitol (DTT), 5 μl 5 mM deoxynucleoside triphosphates (dNTPs), 25 pmol of each forward primer, 80 units RNase inhibitor (RNasin, Promega Corporation, Madison, WI) and water to a total volume of 28 μl. The dNTPs comprise an equimolar mixture of deoxy triphosphates of A, T, G and C. The cells are heated to 65°C for 3 minutes then cooled on ice. The "first strand mix" is added, followed by 40 units of reverse transcriptase (Super RT AMV Reverse Transcriptase, HT Biotechnology Ltd., Cambridge, United Kingdom). The cells and reagents are mixed and incubated at 42°C for 1 hour, then for cells in suspension, the cells are spun down, washed in 200 μl PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1 M glycine) and resuspended in 20 μl of the same buffer for use immediately in PCR; for cells on slides, the slides are washed in PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1 M glycine) and left in the same buffer for use immediately in PCR. Primers either consist of RNA-specific primers or random primers and oligothymine (dT).
Reactions are conducted either directly on glass microscope slides or in 50-μl volumes in 0.5 ml Sarstedt tubes containing 10 μl of the fixed template cells in PBS/0.1 M glycine buffer, 25 pmol back primer, 25 pmol forward primer, 200 μM dNTPs, 5 μl 10 X Taq polymerase buffer (Promega Corporation, Madison WI) and 2.5 units of Taq polymerase. The slides/tubes are subjected to 10 to 40 cycles of PCR with denaturation at 95°C and extension at 72°C for 1 minute each. Annealing is for 1 minute at temperatures ranging from 60°C to 72°C. A terminal cycling oven (M.J. Research, Watertown MA) is used for the cells in solution and an inverted heat block on a standard thermal cycler (Perkin Elmer, Norwalk, CT) is used for the slides, with the slides coverslipped with mineral oil sealing the edges of the coverslip.
Following PCR amplification, cells are spun down, washed in 200 μl PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1M glycine) and resuspended in 20 μl of the same buffer for use immediately with in situ hybridization analysis; for cells on slides, the slides are washed in PBS (pH 7.2) containing 0.1 M glycine (PBS/0.1 M glycine) and left in the same buffer for use immediately with in situ hybridization analysis.
Cells which contain fetal-specific RNAs are either detected directly when using fluorescently labeled primers, are detected through a second-step detection process when primers are used which are labeled with biotin or digoxigenin, or are detected after hybridization to the amplified material, for example using the in situ hybridization system of U.S. Patent 5,225,326.
EXAMPLE 22
Use of Anti-CD45 Antibodies and Flow Cytometry to Detect HbF mRNA and X and Y Chromosomes
Preparation of Cells Twenty milliliters (20 ml) of peripheral blood from pregnant women of 10-20 weeks gestational age are collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system. The HbF system protocol is disclosed below.
Separation of Fetal Cells from Maternal and Cord Blood
Twenty microliters (20 μl) of the cord sample is added to the 20 ml of the maternal sample. Ten milliliters (10 ml) of the sample is thoroughly mixed and diluted to thirty milliliters (30 ml) with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material, at room temperature, consisting of 15 ml Histopaque-1107 (Ten Milliliters (10 ml) Histopaque-1119 plus Five Milliliters (5 ml) Histopaque 1083) which has a density of 1.086 g/ml. Centrifugation for thirty 30 minutes at 700 g (1900 rpm) at 22 C without brake and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Magnetic beads containing anti-CD45 antibodies are added to the cells and allowed to react. Unreacted cells in the supernate are removed and Hoechst dye is added to the cells as a nuclear counterstain.
Flow Cytometer Use and Interpretation
The cells are then analyzed and sorted on a flow sorter based on forward and side scatter properties of the cells. Cells which are classified as monocytic or lymphocytes are collected by flow sorting. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that the cells did not overlap one another.
Testing with Detection System
Slides are then tested with the detection system to detect HbF mRNA positive cells ("F+") and the presence of the X and Y chromosomes within the cells. EXAMPLE 23 Use of Anti-CD45 Antibodies Labeled with FITC and Flow Cytometry to Detect HbF mRNA and X and Y Chromosomes
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from pregnant women of 10-20 weeks gestational age is collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system.
Separation of Fetal Cells from Maternal and Cord Blood
Twenty microliters (20 μl) of the cord sample is added to the 20 ml of the maternal sample. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) that has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with FITC are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and Hoechst dye.
Flow Cytometer Use and Interpretation
The cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytes or lymphocytes, and (iii) the cells are NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another. Testing with Detection System
Slides are then tested with the detection system to detect the HbF mRNA positive cells ("F+") and the presence of the X and Y chromosomes within the cells.
EXAMPLE 24
Use of Anti-CD45 Antibodies and Flow Cytometry to Detect HbF mRNA and X and Y
Chromosomes
Preparation of Cells Twenty milliliters (20 ml) of peripheral blood from pregnant women of 10-20 weeks gestational age is collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system.
Separation of Fetal Cells from Maternal and Cord Blood Twenty microliters (20 μl) of the cord sample are added to the 20 ml of the maternal sample. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Magnetic beads containing anti-CD45 antibodies are added to the cells and allowed to react. Unreacted cells in the supernate are removed and fixed with 0.5% paraformaldehyde overnight at 4 C.
Testing with Detection System The next day, the cells are hybridized in solution with either of the detection HbF system to detect the HbF mRNA positive cells ("F+"); when the FCI-ID system is used, the presence of the X and Y chromosomes within the cells is also detected. Following hybridization the cells are washed. Flow Cytometer Use and Interpretation
The cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytic or lymphocytes, and (iii) the cells are POSITIVE to the HbF mRNA probe. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another.
Testing with Detection System
Slides are then tested with the detection system to detect the HbF mRNA positive cells ("F+") and the presence of the X and Y chromosomes within the cells.
EXAMPLE 25 Use of Anti-CD45 Antibodies Labeled with PE to Detect HbF mRNA and X and Y
Chromosomes
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from pregnant women of 10-20 weeks gestational age are collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system.
Separation of Fetal Cells from Maternal and Cord Blood
Twenty microliters (20 μl) of the cord sample are added to the 20 ml of the maternal sample. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with PE are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and fixed with 0.5% paraformaldehyde overnight at 4 C.
Testing with Detection System
The next day, the cells are hybridized in solution with either the detection HbF or system to detect the HbF mRNA positive cells ("F+"); when the FCID-ID system is used the presence of the X and Y chromosomes within the cells is also detected. Following hybridization the cells are washed.
Flow Cytometer Use and Interpretation
The cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytes or lymphocytes, (iii) the cells are POSITIVE to the HbF mRNA probe, and (iv) the cells were NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another.
Testing with Detection System
Slides are then tested with the detection system to detect the HbF mRNA positive cells ("F+") and the presence of the X and Y chromosomes within the cells.
EXAMPLE 26 Use of Anti-CD45 Antibodies Labeled with PE to Detect HbF mRNA and X and Y
Chromosomes
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from pregnant women of 10-20 weeks gestational age are collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system.
Separation of Fetal Cells from Maternal and Cord Blood
Twenty microliters (20 μl) of the cord sample are added to the 20 ml of the maternal sample. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Histopaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with PE are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and fixed with 0.5% paraformaldehyde overnight at 4 C.
Testing with Detection System
The next day, the cells are hybridized in solution with either the detection HbF/HbA or system to detect the HbF mRNA positive cells ("F+") and the HbA positive cells ("A+"); when the FCI-ID system is used the presence of the X and Y chromosomes within the cells are also detected. Following hybridization the cells are washed.
Flow Cytometer Use and Interpretation
The cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytic or lymphocytes, (iii) the cells are POSITIVE to the HbF mRNA probe, (iv) the cells are NEGATIVE to the HbA mRNA probe, and (v) the cells are
NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells formed a monolayer such that the concentration of cells on the slide is low enough so that cells did not overlap one another.
Testing with Detection System
Slides are then tested with the detection system to detect the HbF mRNA positive cells ("F+") and the presence of the X and Y chromosomes with the cells. EXAMPLE 27 Use of Anti-CD45 Antibodies Labeled with PE (or FITC) to Detect HbF mRNA and X and Y Chromosomes
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from pregnant women of 10-20 weeks gestational age are collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system.
Separation of Fetal Cells from Maternal and Cord Blood
Twenty microliters (20 μl) of the cord sample are added to the 20 ml of the maternal sample. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Percoll, etc.) which has a density of 1.086 g/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with PE (or FITC) are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and fixed with 0.5% paraformaldehyde overnight.
Testing with Detection HbA-System
The next day, the cells are hybridized in solution with the detection HbA system to detect the HbA positive cells ("A+"). Following hybridization the cells are washed.
Flow Cytometer Use and Interpretation The cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as monocytic or lymphocytes, (iii) the cells are NEGATIVE to the HbA mRNA probe, and (iv) the cells are NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
Testing with Detection System
Slides are then tested with the detection system to detect the HbF mRNA positive cells ("F+") and the presence of the X and Y chromosomes within the cells.
EXAMPLE 28 Use of Anti-CD45 Antibodies Labeled with FITC and Flow Cytometry to Detect
Trophoblast mRNA and X and Y Chromosomes
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from a pregnant women of 10-20 weeks gestational age are collected in blood collection tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a male child is collected in blood collection tubes containing EDTA. Both the maternal blood sample ("maternal") and the umbilical cord blood ("cord") blood sample are typed. Only samples which have the same type are used. The total number of nucleated red blood cells ("nRBC") and the number of nucleated red blood cells which contain the fetal hemoglobin mRNA ("F+") are determined using 20 μl of cord blood and the detection HbF system.
Separation of Fetal Cells from Maternal and Cord Blood
Twenty microliter (20 μl) of the cord sample are added to the 20 ml of the maternal sample. The sample is thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample is then layered on a density gradient material (e.g., Ficoll- Hypaque, Percoll, etc.) which has a density of 1.086 gm/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. Anti-CD45 antibodies labeled with FITC are added to the cells and allowed to react. The cells are washed to remove unreacted antibody and Hoechst is added to the cells as a nuclear counter-stain.
Flow Cytometer Use and Interpretation The cells are then analyzed and sorted on a flow sorter based on (i) the fact that the cells are nucleated, (ii) the cells have forward and side scatter properties of cells which would be classified as multi-nucleated or trophoblasts, and (iii) the cells are NEGATIVE to the CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
Testing with Detection System Slides are then tested with the detection system to detect the trophoblast-specific mRNA positive cells ("TR+") and the presence of the X and Y chromosomes within the cells.
EXAMPLE 29 Identification of fetal cells by light scatter properties
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from a male donor was collected in
Vacutainer tubes containing EDTA.
Separation of Fetal Cells from an Adult Donor Blood
The sample was thoroughly mixed and diluted with 2 volumes of Cell Buffer A
(CBA). The diluted sample was then layered on a density gradient material (e.g.,
Ficoll-Hypaque, Percoll, etc.) which has a density of 1.086 gm ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. A portion of the buffy-coat was then mixed with anti-CD45 antibodies labeled with PE (or FITC) are added to the cells and allowed to react.
Flow Cytometer Use and Interpretation
The cells treated with anti-CD45 were sorted to select cells that are positive with respect to staining by the antibody. The cells are then analyzed and sorted on a flow sorter based on the fact that the cells have forward and side scatter properties of cells which would be classified as having monocytic, lymphocytic or granulocytic properties. The proportion of cells in each light-scattering class staining positive with the anti-CD45 antibody was determined and the results are presented in the table below. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
Table 14
Figure imgf000073_0001
Identification of leukocyte cell class by CD45 binding scatter properties
Preparation of Cells
Twenty milliliters (20 ml) of peripheral blood from a male donor was collected in Vacutainer tubes containing EDTA. Separately, 1-5 ml of an umbilical cord blood sample from the birth of a female child was collected in Vacutainer tubes containing EDTA. Both the male blood sample and the umbilical cord blood ("cord") blood sample were typed. Only samples which had the same blood-type were used.
Separation of Fetal Cells from Adult Donor Blood
A portion of the cord sample (1.5 ml) was added to 15 ml of the adult sample. The sample was thoroughly mixed and diluted with 2 volumes of Cell Buffer A (CBA). The diluted sample was then layered on a density gradient material (e.g., Ficoll-Hypaque, Percoll, etc.) which has a density of 1.086 gm/ml. Centrifugation and separation are carried out according to the manufacturer's instructions. The buffy-coat of cells is then collected and washed once with CBA. A portion of the buffy-coat was then mixed with anti-CD45 antibodies labeled with PE (or FITC) and allowed to react. Another portion of the buffy-coat cells was subjected to flow sorting without anti-CD45 treatment. A final portion of the buffy-coat cells were reacted with magnetic beads coated with anti-CD45 antibodies which were then removed with reacted cells attached prior to flow sorting.
Flow Cytometer Use and Interpretation
The cells were then analyzed and sorted on a flow sorter based on the fact that the cells have forward and side scatter properties of cells which would be classified as mono-nuclear. The cells treated with anti-CD45 were also sorted to select cells that are negative with respect to staining by the anti-CD45 antibody. Collected samples are deposited onto one or more slides, with no more than 10,000 cells deposited on any single slide; care is taken that deposited cells form a monolayer such that the concentration of cells on the slide is low enough so that cells do not overlap one another.
Testing with Detection System Slides were then tested with the detection system to detect presence of the X and Y chromosomes within the cells and the results are shown in the Table below.
Table 15
Cell Treatment Cell Number Female cells Male cells Female (%)
Density Gradient 4.1xl05 50 51 49.5
Density gradient
+ Sorting on scatter 2.7x104 41 68 37.6
Density Gradient
+ Depletion of CD45+
+ Sorting on scatter 0.2x104 32 100
Density Gradient
+ Sorting on CD45
+ Sorting on scatter 0.1 xlO4 19 90.4 The foregoing description of the preferred embodiments of the invention has been presented for purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims appended hereto.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Aprogenex, Inc. (ii) TITLE OF INVENTION: Enriching and Identifying Fetal Cells In Maternal Blood For In Situ Hybridization
(iii) NUMBER OF SEQUENCES: 21 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Elman ilf & Fried
(B) STREET: 20 West Third Street, P.O. Box 703
(C) CITY: Media
(D) STATE: PA
(E) COUNTRY: USA
(F) ZIP: 19063-0703 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 inch 720K diskette
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: WordPerfect 5.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: 19 July 1994 (19.07.94)
(C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Gerry J. Elman
(B) REGISTRATION NUMBER: 24,404
(C) REFERENCE/DOCKET NUMBER: M19-083-WO (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 610-892-9580
(B) TELEFAX: 610-892-9577
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: ATCGAGTAGT GGTATTTCAC CGGC 24
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: TACGCTCGAT CCAGCTATCA GCCGT 25
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CGGCGGCGGC GGCGGCGGCG GCGGC 25
(2) INFORMATION FOR SEQ ID NO: :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 443 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: : ATGGGTCATT TCACAGAGGA GGACAAGGCT ACTATCACAA GCCTGTGGGG CAAGGTGAAT 60
GTGGAAGATG CTGGAGGAGA AACCCTGGGA AGCTCCTGGT TGTCTACCCA TGGACCCAGA 120
GGTTCTTTGA CAGCTTTGGC AACCTGTCCT CTGCCTCTGC CATCATGGGC AACCCCAAAG 180
TCAAGGCACA TGGCAAGAAG GTGCTGACTT CCTTGGGAGA TGCCATAAAG CACCTGGATG 240
ATCTCAAGGG CACCTTTGCC CAGCTGAGTG AACTGCACTG TGACAAGCTG CATGTGGATC 300
CTGAGAACTT CAAGCTCCTG GGAAATGTGC TGGTGACCGT TTTGGCAATC CATTTCGGCA 360
AAGAATTCAC CCCTGAGGTG CAGGCTTCCT GGCAGAAGAT GGTGACTGGA GTGGCCAGTG 420
CCCTGTCCTC CAGATACCAC TGA 443
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: TCAGTGGTAT CTGGAGGACA GGGCA 25
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CTGGCCACTC CAGTCACCAT CTTCT 25
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: CDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GCCAGGAAGC CTGCACCTCA GGGGT 25
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GAATTCTTTG CCGAAATGGA TTGCC 25
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: AAAACGGTCA CCAGCACATT TCCCA 25
(2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GGAGCTTGAA GTTCTCAGGA TCCAC 25
(2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ATGCAGCTTG TCACAGTGCA GTTCA 25
(2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CTCAGCTGGG CAAAGGTGCC CTTGA 25
(2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GATCATCCAG GTGCTTTATG GCATC 25
(2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: TCCCAAGGAA GTCAGCACCT TCTTG 25
(2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: CCATGTGCCT TGACTTTGGG GTTGC 25
(2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: CCATGATGGC AGAGGCAGAG GACAG 25
(2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: GTTGCCAAAG CTGTCAAAGA ACCTC 25
(2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: TGGGTCCATG GGTAGACAAC CAGGA 25
(2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: GCTTCCCAGG GTTTCTCCTC CAGCA 25
(2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: TCTTCCACAT TCACCTTGCC CCACA 25
(2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: N (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: GGCTTGTGAT AGTAGCCTTG TCCTC 25

Claims

CLAIMSHaving thus described the invention, what is claimed is:
1. A method of identifying fetal nucleated erythrocytes in a specimen which includes maternal cells, wherein said method comprises the steps of:
(a) performing an in situ hybridization on said specimen, using a nucleic acid probe for fetal hemoglobin RNA or embryonic hemoglobin RNA;
(b) removing unhybridized probe from the specimen, and
(c) detecting said probe remaining with said specimen; whereby a cell in which the probe is detected is identified as a fetal nucleated erythrocyte.
2. The method of claim 1, wherein said specimen is selected from the group consisting of maternal peripheral blood, percutaneous and post-delivery umbilical cord blood, placental tissue, chorionic villi, and amniotic fluid.
3. The method of claim 1, wherein said specimen is maternal peripheral blood.
4. The method of claim 1, wherein said in situ hybridization comprises the steps of:
(a) fixing said specimen with a medium consisting of at least one agent selected from the group consisting of a precipitating agent and a cross- linking agent;
(b) contacting said fixed specimen wrath a hybridization solution consisting of a denaturing agent, hybrid stabilizing agent, buffering agent, selective membrane pore-forming agent, and at least one synthetic oligonucleotide probe having a nucleotide sequence at least substantially complementary to a target nucleotide sequence to be detected, said contacting being under hybridizing conditions in the presence of at least one detectable label; and
(c) detecting hybrid formation by means of said label; whereby a nucleic acid is detected in a fetal nucleated erythrocyte having substantially intact cellular membranes.
5. The method of claim 4, wherein said label is selected from the group consisting of radioactive labels, fluorescers, chemiluminescers, enzyme labels, biotin, and antigenically detectable groups.
6. The method of claim 5, wherein said fluorescer is selected from the group consisting of fluorescein, coumarin, rhodamine, rhodamine derivatives, cyanine dyes and phycoerythrin.
7. The method of claim 1, further comprising the steps of
(a) contacting said specimen with an antibody to a fetal cell antigen, and
(b) detecting binding of said antibody to a cell within said specimen, while detecting said probe remaining with said specimen; whereby said cell of said specimen in which said probe is detected and to which said antibody is bound is identified as a fetal nucleated erythrocyte.
8. The method of claim 7, wherein said fetal cell antigen is selected from the group of peptides consisting of fetal hemoglobin and embryonic hemoglobin.
9. The method of claim 7, wherein said fetal cell antigen is cytokeratin and said antibody is fluorescently labeled.
10. The method of claim 1, further comprising a preliminary step of amplifying a fetal-cell-specific nucleic acid before performing said hybridization.
11. The method of claim 1, further comprising the steps of:
(a) performing said in situ hybridization with an additional probe for a second target nucleic acid which is present in said fetal cells but absent from adult cells normally present in said specimen.
12. The method of claim 11, wherein said second target nucleic acid is selected from the group consisting of embryonic hemoglobin mRNA, fetal hemoglobin mRNA, cytokeratin mRNA, β-subunit of chorionic gonadotropin mRNA, chorionic somatomammotropin mRNA, pregnancy-specific glycoprotein mRNA, α-fetoprotein mRNA, and transferrin receptor mRNA.
13. The method of claim 11, wherein a second target nucleic acid in said sample is selected from the group consisting of a virus and a chromosome and is simultaneously detected by said in situ hybridization.
14. The method of claim 13, wherein said virus is selected from the group consisting of: human immunodeficiency virus, hepatitis virus and herpes virus.
15. The method of claim 13, wherein said chromosome is selected from the group of human chromosomes consisting of X chromosome, Y chromosome, chromosome 1, chromosome 13, chromosome 16, chromosome 18 and chromosome 21.
16. The method of claim 13, wherein said nucleic acid is characteristic of a genetic abnormality.
17. The method of claim 16, wherein said genetic abnormality is a deletion.
18. The method of claim 17, wherein said deletion is identified by detecting the absence or the decrease of hybridizable binding of the probe to a target sequence.
19. The method of claim 16, wherein said genetic abnormality is an addition or amplification.
20. The method of claim 19, wherein said addition is identified by detecting binding of a labeled probe to a polynucleotide repeat segment of a chromosome.
21. The method of claim 16, wherein said genetic abnormality is a translocation or rearrangement.
22. The method of claim 21, wherein said translocation is identified by the steps of: (a) binding a labeled probe to a marker region of a polynucleotide section of a chromosome that translocates, and
(b) detecting binding of said labeled probe.
23. The method of claim 21, wherein said translocation is identified by the steps of:
(a) binding a labeled first probe to a marker region of a chromosome that does not translocate;
(b) binding a labeled second probe to a region of a second chromosome that translocates, and
(c) detecting binding of said first probe and said second probe.
24. A method of identifying fetal cell in a specimen which includes maternal cells wherein said method comprises:
(a) treating said specimen to yield a suspension of said fetal and said maternal cells;
(b) performing in situ hybridization in said suspension, wherein a labeled oligonucleotide probe is introduced in said hybridization, and
(c) passing said hybridized cells through a flow cytometer wherein said flow cytometer is a fluorescence activated cell sorter, and recording the quantity of labels that are detected.
25. The method of claim 24, further comprising the step of sorting said hybridized cells that are identified as fetal nucleated erythrocytes.
26. The method of claim 24, wherein said specimen is selected from the group consisting of maternal peripheral blood and percutaneous or post-delivery umbilical cord blood.
27. The method of claim 24, wherein the label of said labeled oligonucleotide probe is selected from the group consisting of fluorescers, chemiluminescers, enzyme labels, biotin, and antigenically detectable groups.
28. The method of claim 26, wherein said fluorescer is selected from the group consisting of: fluorescein, coumarin, rhodamine, rhodamine derivatives, cyanine dyes and phycoerythrin.
29. A method for the identification of fetal nucleated erythrocytes of an unborn fetus wherein said method comprises:
(a) depleting maternal erythrocytes from a sample of peripheral blood of the mother bearing said unborn fetus wherein said depleting of said nucleated erythrocytes comprises;
(1) collecting a blood sample from said peripheral blood of said mother;
(2) treating said blood sample to prevent coagulation of said blood sample to yield an uncoagulated blood sample, and
(3) recovering from said uncoagulated blood sample nucleated cells;
(b) fractionating said recovered nucleated cells to yield said fetal nucleated erythrocytes, and
(c) detecting within said fetal nucleated erythrocytes the presence of a marker characteristic of fetal erythrocytes.
30. The method of claim 29, wherein said step of recovering from said uncoagulated blood sample comprises the step of contacting said uncoagulated blood sample with an agent which induces lysis of non-nucleated blood cells.
31. The method of claim 29, wherein said step of removing maternal erythrocytes comprises:
(a) placing in a centrifuge tube a first layer of a density gradient material;
(b) layering a second layer of said uncoagulated blood sample into said centrifuge tube;
(c) treating said centrifuge tube containing said first and second layers in a manner whereby erythrocytes pass to the bottom of said centrifuge tube and nucleated cells do not, and
(d) recovering said nucleated cells from said centrifuge tube.
32. The method of claim 31, wherein said density gradient material is selected from the group consisting of colloidal polyvinylpyrrolidone-coated silica, nonionic polysucrose and Nycodenz and where said treating of said centrifuge tube comprises centrifugation.
33. The method of claim 29, wherein said step of fractionating said recovered nucleated cells to yield said fetal nucleated erythrocytes comprises:
(a) placing a sample of said nucleated cells in a liquid medium;
(b) contacting said liquid medium with a ligand to a ligand-target normally present on leukocytes, and
(c) separating from said liquid medium the cells that bind to said ligand.
34. The method of claim 33, wherein said ligand is an antibody bound to a matrix when it is contacted with said liquid medium, and wherein the separating of cells that bind to said antibody is performed by separating the matrix from the liquid medium.
35. The method of claim 34, wherein said antibody is not bound to a matrix when it is contacted with said liquid medium.
36. The method of claim 35, wherein said cells that bind to said antibody are removed from said liquid medium by contacting said liquid medium with a ligand that binds to said antibody, and removing said ligand from said liquid medium.
37. The method of claim 32, wherein the means for said detection of said marker characteristic of fetal erythrocytes is selected from the group consisting of labeled antibodies to fetal hemoglobin or embryonic hemoglobin, labeled oligonucleotide probes specific for fetal hemoglobin mRNA or embryonic hemoglobin mRNA and stains for fetal hemoglobin and the dyes fluorescein, coumarin, rhodamine, rhodamine derivatives, cyanine dyes and phycoerythrin.
38. The method of claim 33, wherein said matrix comprises magnetic beads and said fractionating of said recovered nucleated cells to yield said fetal nucleated erythrocytes is achieved by magnetic means.
39. The method of claim 29, wherein said fractionating of said recovered nucleated cells to yield said fetal nucleated erythrocytes comprises:
(a) detecting said marker characteristic of fetal erythrocytes by means selected from the group consisting of labeled antibodies to fetal hemoglobin or embryonic hemoglobin, labeled oligonucleotide probes specific for fetal hemoglobin mRNA or embryonic hemoglobin mRNA and stains for fetal hemoglobin wherein said label is a fluorescent or non-fluorescent dye label;
(b) analyzing said nucleated cells wherein said analyzing comprising:
(1) passing said nucleated cells through a fluorescence activated cell sorter;
(2) detecting forward-scattered light, side-scattered light and fluorescent fight in said fluorescence activated cell sorter, and
(3) measuring said forward-scattered light, said side-scattered light and said fluorescent fight from said nucleated cells;
(c) deflecting said nucleated cells that scatter said forward-scattered light and said side-scattered light and that emit said fluorescent light in a manner characteristic of monocytic cells, and
(d) collecting said monocytic cells.
40. A method of confirming a suspected tissue of origin of a human biological cell sample wherein said method comprises:
(a) contacting said sample for a period of time to effect nucleic acid hybridization with a hybridization cocktail comprising a plurality of oligonucleotide probes, one of said probes being for a first RNA sequence that is characteristic of said suspected tissue though not unique thereto and being labeled with a first distinctive label, another of said probes being for a second RNA sequence that is characteristic of said suspected tissue though not unique thereto and being labeled with a second distinctive label;
(b) removing unhybridized probe therefrom, and (c) detecting the presence or absence of each of said first and second distinctive labels in individual cells of said sample, whereby the presence of said first and said second distinctive labels in an individual cell of said sample is confirmatory of the suspected origin of said cell.
41. The method of Claim 40, wherein said suspected tissue origin of said sample is fetal erythrocyte.
42. The method of Claim 40, wherein said one of said probes is for fetal hemoglobin RNA and said another of said probes is for embryonic hemoglobin RNA.
43. The method of Claim 40, wherein said another of said probes is for the embryonic hemoglobin, ε chain RNA, and wherein said plurality of oligonucleotide probes further comprises a probe for the embryonic hemoglobin, ζ chain, which is labeled with a third distinctive label, whereby the presence of said first and said second and said third distinctive labels in a single cell is confirmatory that said cell is a fetal erythrocyte.
44. A method to determine the genetic constitution of an unborn fetus wherein said method comprises:
(a) Isolating nucleated erythrocytes from the peripheral blood of the mother bearing said unborn fetus;
(b) detecting the presence of messenger ribonucleic acids characteristic of fetal erythrocytes within said nucleated erythrocytes, and
(c) detecting the presence of deoxyribonucleic acids different from those of said mother within said nucleated erythrocytes.
45. The method of claim 44, wherein said isolating of said nucleated erythrocytes comprises: (a) collecting a blood sample from said peripheral blood of said mother; (b) treating said blood sample to prevent coagulation of said blood sample to yield an uncoagulated blood sample; (c) separating from said uncoagulated blood sample a nucleated cell population wherein said separating comprises;
(1) placing in a centrifuge tube a first layer of a density gradient material;
(2) layering a second layer of said uncoagulated blood sample into said centrifuge tube;
(3) treating said centrifuge tube containing said first and second layers in a manner whereby erythrocytes pass to the bottom of said centrifuge tube and nucleated cells do not, and
(4) recovering said nucleated cell population from said centrifuge tube, and
(d) fractionating said nucleated cell population into maternal nucleated cells and fetal nucleated erythrocytes.
46. The method of claim 45, wherein said messenger ribonucleic acid characteristic of fetal eiythrocytes is a hemoglobin messenger ribonucleic acid expressed during gestation and wherein said deoxyribonucleic acid different from those of said mother is a deoxyribonucleic acid sequence of chromosome Y.
47. The method of claim 45, wherein said fractionating of said nucleated cell population comprises:
(a) reacting said nucleated cells together with agents selected from the group consisting of: fluorescent-labeled antibodies that specifically bind to epitopes of moieties expressed on the surfaces of maternal cells, fluorescent- labeled antibodies specific for fetal hemoglobin of embryonic hemoglobin, fluorescent-labeled oligonucleotide probes specific for nucleic acid sequences expressed in fetal cells and stains for fetal hemoglobin
(b) staining said suspended nucleated cells with a nuclear stain, and
(c) analyzing said reacted and stained suspended nucleated cells wherein said analyzing comprises:
(1) passing said reacted and stained suspended non-maternal nucleated cells through a fluorescence activated cell sorter; (2) detecting forward-scattered light, side-scattered light and fluorescent light in said fluorescence activated cell sorter;
(3) measuring said forward-scattered light, said side-scattered light and said fluorescent light from said reacted and stained suspended nucleated cells;
(4) deflecting said stained suspended nucleated cells that scatter said forward-scattered light and said side-scattered light and that emit fluorescent light in a manner characteristic of monocytic cells, and
(5) collecting said monocytic cells.
48. A kit for the identification of fetal cells in a maternal blood specimen, comprising:
(a) a hybridization cocktail containing probes specific for nucleotide sequences specifically present in fetal cells;
(b) wash solutions necessary for carrying out in situ hybridizations on said fetal cells, and
(c) media for mounting said hybridized fetal cells.
49. The kit of claim 48 wherein said probes specific for nucleotide sequences specifically present in fetal cells are selected from the group consisting of: synthetic oligonucleotide probes specific for fetal hemoglobin mRNA, and synthetic oligonucleotide probes specific for embryonic hemoglobin mRNA.
50. A kit for the separation of fetal cells wherein said kit comprises:
(a) means for removing maternal blood cells selected from the group consisting of: the materials necessary for density gradient centrifugation, ligand coupled magnetic beads, fluorescent-coupled ligands for use in a fluorescence activated cells sorter, stains for proteins found specifically in fetal cells;
(b) buffers for said separation of fetal cells, and
(c) fixatives and mounting reagents.
51. The kit of claim 50, wherein said means for removing maternal blood cells is an antibody with a binding specificity for leukocytes.
52. A kit for the analysis of fetal cells in a maternal blood specimen, comprising:
(a) a hybridization cocktail containing probes specific for nucleotide sequences selected from group the consisting of: fetal hemoglobin mRNA, embryonic hemoglobin mRNA, human immunodeficiency virus, hepatitis virus, herpes virus, human X chromosome, Y chromosome, chromosome 1, chromosome 13, chromosome 16, chromosome 18 and chromosome 21;
(b) wash solutions necessary for carrying out in situ hybridizations on said fetal cells, and
(c) media for mounting said hybridized fetal cells.
53. A method of characterizing fetal nucleated erythrocytes of an unborn fetus in a specimen of peripheral blood from the mother bearing said unborn fetus which includes maternal cells, wherein said method comprises:
(a) concentrating said nucleated fetal erythrocytes from said specimen;
(b) detecting said nucleated fetal erythrocytes, and
(c) analyzing said nucleated fetal erythrocytes.
54. The method of claim 53 wherein said concentrating comprises:
(a) passing said specimen through a fluorescence activated cell sorter;
(b) detecting with said fluorescence activated cell sorter forward-scattered light and side-scattered light;
(c) measuring with said fluorescence activated cell sorter said forward- scattered fight, and said side-scattered light scattered from the cells of said specimen;
(d) deflecting said nucleated cells that scatter said forward-scattered light and said side-scattered light in a manner characteristic of monocytic cells, and
(e) collecting said nucleated cells that scatter said forward-scattered light and said side-scattered light in a manner characteristic of monocytic cells.
55. The method of claim 53 wherein said detecting comprises:
(a) performing in situ hybridization on said nucleated fetal erythrocytes using an oligonucleotide probe complementary to the nucleotide sequence selected from the group consisting of: the nucleotide sequence of embryonic hemoglobin RNA and the nucleotide sequence of fetal hemoglobin RNA;
(b) detecting said probe remaining within said hybridized cells; thereby establishing the fetal origin of said fetal nucleated erythrocytes.
56. The method of claim 55 wherein said oligonucleotide probe is distinguishably fluorescent labeled and said detecting is achieved with means capable of detecting fluorescence from said distinguishably labeled oligonucleotide probe.
57. The method of claim 56 wherein said means is chosen from a group consisting of a fluorescence activated cell sorter and a fluorescence microscope.
58. The method of claim 53 wherein said unborn fetus is a human unborn fetus and said analyzing comprises in situ hybridization using one or more oligonucleotide probes complementary to nucleotide sequences selected from the group consisting of, a nucleotide sequence which uniquely identifies human chromosome 1, a nucleotide sequence which uniquely identifies human chromosome 13, a nucleotide sequence which uniquely identifies human chromosome 16, a nucleotide sequence which uniquely identifies human chromosome 18, a nucleotide sequence which uniquely identifies human chromosome 21, a nucleotide sequence which uniquely identifies human chromosome X and a nucleotide sequence which uniquely identifies human chromosome Y.
59. The method of claim 58 wherein each of said nucleotide probes is distinguishably fluorescent labeled.
60. A method of characterizing fetal nucleated erythrocytes of an unborn fetus in a specimen of peripheral blood from the mother bearing said unborn fetus which includes maternal cells, wherein said method comprises: (a) enriching nucleated cells from said specimen;
(b) treating said nucleated cells with antibodies specific for antigens not present on nucleated fetal erythrocytes;
(c) separating nucleated fetal erythrocytes from said treated isolated nucleated cells;
(d) analyzing said nucleated fetal eiythrocytes.
61. The method of claim 60 wherein said enriching step comprises a method chosen from the group consisting of: density gradient centrifugation, osmotic lysis of erythrocytes, liquid electrophoresis, filtration through a filter which separates on the basis of charge.
62. The method of claim 60 wherein said treating step is chosen from the group consisting of: antibodies bound onto the surfaces of solid particles and, fluorescent labeled antibodies.
63. The method of claim 62 wherein said solid particles comprise magnetic particles.
64. The method of claim 63 wherein said separating comprises magnetic means.
65. The method of claim 62 wherein said fluorescent labeled antibodies are distinguishably labeled and further wherein said separating is achieved by use of a fluorescence activated cell sorter.
66. The method of claim 60 wherein said antibodies specific for antigens not present on nucleated fetal erythrocytes is selected from the group consisting of: an antibody specific for cluster-determinant-45; an antibody specific for cluster- determinant-65; an antibody specific for cluster-determinant-34; an antibody specific for cluster-determinant-44; an antibody specific for cluster-determinant- 31.
67. The method of claim 60 wherein said unborn fetus is a human unborn fetus and said analyzing comprises in situ hybridization using one or more oligonucleotide probes complementary to nucleotide sequences selected from the group consisting of, a nucleotide sequence which uniquely identifies human chromosome 1, a nucleotide sequence which uniquely identifies human chromosome 13, a nucleotide sequence which uniquely identifies human chromosome 16, a nucleotide sequence which uniquely identifies human chromosome 18, a nucleotide sequence which uniquely identifies human chromosome 21, a nucleotide sequence which uniquely identifies human chromosome X and, a nucleotide sequence which uniquely identifies human chromosome Y.
68. A method of characterizing fetal nucleated erythrocytes of an unborn fetus in a specimen of peripheral blood from the mother bearing said unborn fetus which includes maternal cells, wherein said method comprises:
(a) isolating nucleated cells from said specimen;
(b) performing upon said nucleated cells in situ hybridization with a fluorescent labeled oligonucleotide probe complementary to a nucleotide sequence expressed in fetal nucleated erythrocytes;
(c) separating nucleated fetal erythrocytes from said treated isolated nucleated cells;
(d) analyzing said nucleated fetal erythrocytes.
69. The method of claim 68 wherein said isolating comprises a method chosen from the group consisting of: density gradient centrifugation, osmotic lysis of erythrocytes, liquid electrophoresis, filtration through a filter which separates on the basis of charge.
70. The method of claim 68 wherein said fluorescent oligonucleotide probe comprises a fluorescent oligonucleotide probe chosen from the group consisting of: the nucleotide sequence of embryonic hemoglobin RNA and the nucleotide sequence of fetal hemoglobin RNA.
71. The method of claim 68 wherein said separating is achieved by use of a fluorescence activated cell sorter.
72. The method of claim 68 wherein said unborn fetus is a human unborn fetus and said analyzing comprises in situ hybridization using one or more oligonucleotide probes complementary to nucleotide sequences selected from the group consisting of, a nucleotide sequence which uniquely identifies chromosome 1, a nucleotide sequence which uniquely identifies human chromosome 13, a nucleotide sequence which uniquely identifies human chromosome 16, a nucleotide sequence which uniquely identifies human chromosome 18, a nucleotide sequence which uniquely identifies human chromosome 21, a nucleotide sequence which uniquely identifies human chromosome X and, a nucleotide sequence which uniquely identifies human chromosome Y.
73. A method of establishing the genetic constitution of an unborn fetus by characterizing fetal nucleated erythrocytes in a specimen of peripheral blood from the mother bearing said unborn fetus which includes maternal cells, wherein said method comprises:
(a) isolating nucleated cells from said specimen;
(b) removing cells bearing antigens not present on said fetal nucleated erythrocytes from said nucleated cells;
(c) detecting said nucleated fetal erythrocytes not bearing said antigens, and
(d) analyzing said nucleated fetal erythrocytes not bearing said antigens.
74. The method of claim 73 wherein said removing of said cells bearing antigens not present on said fetal nucleated erythrocytes from said nucleated cells is achieved with said antibody specific for antigens present on monocytic cells to yield said nucleated fetal eiythrocytes comprises:
(a) incubating said nucleated cells with a fluorescent labeled antibody specific for antigens present on monocytic cells;
(b) removing said fluorescent labeled antibody that is unbound to said nucleated cells, and (c) detecting said fluorescent labeled antibody remaining with said nucleated cells bound to surfaces of said nucleated cells, and
(d) isolating said nucleated fetal erythrocytes as non-fluorescent cells.
75. The method of claim 73 wherein said antibody specific for antigens present on monocytic cells is selected from the group consisting of: an antibody specific for cluster-determinant-45; an antibody specific for cluster-determinant-65; an antibody specific for cluster-determinant-34; an antibody specific for cluster- determinant-44; an antibody specific for cluster-determinant-31.
76. The method of claim 74 wherein said detecting and said isolating is achieved with a fluorescence activated cell sorter and wherein said detecting comprises:
(a) analyzing said nucleated cells said analyzing comprising;
(1) passing said nucleated cells through said fluorescence activated cell sorter;
(2) detecting with said fluorescence activated cell sorter forward- scattered light, side-scattered light and fluorescent light;
(3) measuring wrath said fluorescence activated cell sorter said forward-scattered light, said side-scattered light and said fluorescent light from said hybridized cells;
(b) deflecting said nucleated cells that scatter said forward-scattered light and said side-scattered light in a manner characteristic of monocytic cells and that emit said fluorescent light characteristic of the fluorescence emission spectra of said fluorescent labeled antibody; and wherein said isolating comprises collecting said nucleated cells that are undeflected and that scatter said forward-scattered light and said side-scattered light in a manner characteristic of monocytic cells.
77. The method of claim 73 wherein said analyzing comprises in situ hybridization wherein said in situ hybridization comprises the steps of:
(a) fixing said specimen with a medium comprising at least one agent selected from the group consisting of a precipitating agent and a cross- linking agent; (b) contacting said fixed specimen with a hybridization solution consisting of a denaturing agent, hybrid stabilizing agent, buffering agent, selective membrane pore-forming agent, and at least one synthetic oligonucleotide probe having a nucleotide sequence at least substantially complementary to a target nucleotide sequence to be detected, said contacting being under hybridizing conditions in the presence of at least one detectable label; and
(c) detecting hybrid formation by means of said label; whereby a nucleic acid is detected in a fetal nucleated erythrocyte having substantially intact cellular membranes.
78. The method of claim 77 wherein said synthetic oligonucleotide probe comprises a synthetic oligonucleotide probe selected from the group consisting of: a nucleotide sequence which uniquely identifies chromosome 1, a nucleotide sequence which uniquely identifies human chromosome 13, a nucleotide sequence which uniquely identifies human chromosome 16, a nucleotide sequence which uniquely identifies human chromosome 18, a nucleotide sequence which uniquely identifies human chromosome 21, a nucleotide sequence which uniquely identifies human chromosome X and, a nucleotide sequence which uniquely identifies human chromosome Y.
79. The method of claim 78 wherein each of said synthetic oligonucleotide probes is distinguishably fluorescent labeled and wherein said analyzing is achieved by use of a fluorescent activated cell sorter and further wherein said fluorescence activated cell sorter is used to quantitate the fluorescence of each of said synthetic oligonucleotide probes thereby achieving a determination of the ploidy of said fetal nucleated erythrocyte.
80. The method of claim 45, wherein said deoxyribonucleic acids different from those of said mother comprise deoxyribonucleic acids selected from the group consisting of: chromosome X, chromosome Y, chromosome 1, chromosome 13, chromosome 16, chromosome 18, chromosome 21, human Immunodeficiency virus, hepatitis virus and herpes virus.
81. The method of claim 29, wherein said fractionating of said recovered nucleated cells to yield said fetal cells comprises:
(a) analyzing said nucleated cells wherein said analyzing comprising:
(1) passing said nucleated cells through a fluorescence activated cell sorter;
(2) detecting forward-scattered light, side-scattered fight in said fluorescence activated cell sorter, and
(3) measuring said forward-scattered fight, said side-scattered light from said nucleated cells;
(c) deflecting said nucleated cells that scatter said forward-scattered light and said side-scattered light in a manner characteristic of fetal cells, and
(d) collecting said fetal cells.
82. The method of claim 81 wherein said nucleated cells that scatter said forward- scattered light and said side-scattered light in a manner characteristic of fetal cells scatter said fights in a manner characteristic of fetal cells selected from the group consisting of: trophoblasts, cytotrophoblasts and syncytiotrophoblasts.
PCT/US1994/008342 1993-07-19 1994-07-19 Enriching and identifying fetal cells in maternal blood for in situ hybridization WO1995003431A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU74743/94A AU7474394A (en) 1993-07-19 1994-07-19 Enriching and identifying fetal cells in maternal blood for in situ hybridization

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9471093A 1993-07-19 1993-07-19
US08/094,710 1993-07-19

Publications (1)

Publication Number Publication Date
WO1995003431A1 true WO1995003431A1 (en) 1995-02-02

Family

ID=22246713

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/008342 WO1995003431A1 (en) 1993-07-19 1994-07-19 Enriching and identifying fetal cells in maternal blood for in situ hybridization

Country Status (3)

Country Link
AU (1) AU7474394A (en)
IL (1) IL110364A0 (en)
WO (1) WO1995003431A1 (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996036691A1 (en) * 1995-05-16 1996-11-21 Ramot-Univ. Authority For Applied Research And Industrial Development Ltd. Ataxia-telangiectasia gene and its genomic organization
WO1997038313A1 (en) * 1996-04-05 1997-10-16 The Johns Hopkins University A method of enriching rare cells
EP0813594A1 (en) * 1995-02-14 1997-12-29 New England Medical Center Hospitals, Inc. Methods for labeling intracytoplasmic molecules
US5728807A (en) * 1995-05-16 1998-03-17 Ramot-University Authority For Applied Research And Industrial Development, Ltd. Mutated proteins associated with ataxia-telangiectasia
US5731156A (en) * 1996-10-21 1998-03-24 Applied Imaging, Inc. Use of anti-embryonic hemoglobin antibodies to identify fetal cells
US5750340A (en) * 1995-04-07 1998-05-12 University Of New Mexico In situ hybridization solution and process
US5756288A (en) * 1995-05-16 1998-05-26 Ramot-University Of Authority For Applied Research And Industrial Dev. Ltd. Ataxia-telangiectasai gene
US5777093A (en) * 1995-05-16 1998-07-07 Ramot-University Authority For Applied Research & Industrial Development Ltd. cDNAs associated with ataxia-telangiectasia
WO1998056955A1 (en) * 1997-06-13 1998-12-17 Bioseparations, Inc. Method of in situ hybridization
US5962234A (en) * 1997-10-20 1999-10-05 Applied Imaging Corporation Use of anti-embryonic epsilon hemoglobin antibodies to identify fetal cells
US6022689A (en) * 1995-04-07 2000-02-08 University Of New Mexico Situ hybridization slide processes
US6194146B1 (en) 1997-06-13 2001-02-27 Bioseparations, Inc. Situ and in vitro hybridization method and buffer
EP1106683A2 (en) * 1999-09-10 2001-06-13 Becton, Dickinson and Company A method for providing long term stability to cells for diagnostic testing
EP1172445A1 (en) * 2000-07-14 2002-01-16 Praenadia GmbH A method for direct genetic analysis of target cells by using fluorescence probes
US6355174B1 (en) 1994-11-08 2002-03-12 Phoenix Medical Limited Method of separating foetal trophoblasts from maternal blood
US6461813B2 (en) * 1998-09-21 2002-10-08 Rigel Pharmaceuticals, Inc. Multiparameter FACS assays to detect alterations in cell cycle regulation
WO2003008639A2 (en) * 2001-07-12 2003-01-30 Praenadia Gmbh Method for detecting a nucleic acid
EP1368369A2 (en) * 2000-11-15 2003-12-10 F. Hoffmann-La Roche Ag Methods and reagents for identifying rare fetal cells in the material circulation
WO2007065438A3 (en) * 2005-12-08 2007-07-26 Fcmb Aps Detection of foetal cells from maternal blood
WO2007130826A2 (en) * 2006-05-04 2007-11-15 Ge Healthcare Bio-Sciences Ab Separation of cells
EP1947463A1 (en) * 2007-01-16 2008-07-23 Roche Diagnostics GmbH Collection of liquid analytical samples for clinical analytical purpose
WO2011075774A1 (en) 2009-12-23 2011-06-30 Genetic Technologies Limited Methods of enriching and detecting fetal nucleic acids
US20160122704A1 (en) * 2013-06-14 2016-05-05 Metacell, S.R.O. Method for separation of sporadic cells from body fluids, and apparatus for carrying out said method
US9447467B2 (en) 2009-04-21 2016-09-20 Genetic Technologies Limited Methods for obtaining fetal genetic material
WO2019060687A1 (en) * 2017-09-21 2019-03-28 Beckman Coulter, Inc. Method of determining fetal red blood cells in maternal circulation using flow cytometry
EP3564389A4 (en) * 2016-12-27 2020-11-25 TL Genomics Inc. Method of obtaining fetal cell nucleic acids
US11573229B2 (en) 2019-06-07 2023-02-07 Arcedi Biotech Aps Isolation of fetal cells using FACS

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991007660A1 (en) * 1989-11-13 1991-05-30 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal dna

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991007660A1 (en) * 1989-11-13 1991-05-30 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal dna

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANALYTICAL BIOCHEMISTRY, Volume 169, issued 1988, MATTHEWS et al., "Analytical Strategies for the Use of DNA Probes", pages 1-25. *
HISTOCHEMISTRY, Volume 85, issued 1986, HOPMAN et al., "Bicolor Detection of Two Target DNAs by Non-Radioactive in Situ Hybridization", pages 1-4. *

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6355174B1 (en) 1994-11-08 2002-03-12 Phoenix Medical Limited Method of separating foetal trophoblasts from maternal blood
EP0992578A1 (en) * 1995-02-14 2000-04-12 New England Medical Center Hospitals, Inc. Methods for labeling intracytoplasmic molecules
EP0813594A1 (en) * 1995-02-14 1997-12-29 New England Medical Center Hospitals, Inc. Methods for labeling intracytoplasmic molecules
EP0813594A4 (en) * 1995-02-14 1997-12-29
US5750340A (en) * 1995-04-07 1998-05-12 University Of New Mexico In situ hybridization solution and process
US6022689A (en) * 1995-04-07 2000-02-08 University Of New Mexico Situ hybridization slide processes
US5777093A (en) * 1995-05-16 1998-07-07 Ramot-University Authority For Applied Research & Industrial Development Ltd. cDNAs associated with ataxia-telangiectasia
US5756288A (en) * 1995-05-16 1998-05-26 Ramot-University Of Authority For Applied Research And Industrial Dev. Ltd. Ataxia-telangiectasai gene
US6200749B1 (en) 1995-05-16 2001-03-13 Ramot-University Authority For Applied Research And Industrial Development Ltd. Mutated forms of the ataxia-telangiectasia gene and method to screen for a partial A-T phenotype
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
WO1996036691A1 (en) * 1995-05-16 1996-11-21 Ramot-Univ. Authority For Applied Research And Industrial Development Ltd. Ataxia-telangiectasia gene and its genomic organization
US6265158B1 (en) 1995-05-16 2001-07-24 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5728807A (en) * 1995-05-16 1998-03-17 Ramot-University Authority For Applied Research And Industrial Development, Ltd. Mutated proteins associated with ataxia-telangiectasia
US5962237A (en) * 1996-04-05 1999-10-05 The Johns Hopkins University School Of Medicine Method of enriching rare cells
WO1997038313A1 (en) * 1996-04-05 1997-10-16 The Johns Hopkins University A method of enriching rare cells
US5731156A (en) * 1996-10-21 1998-03-24 Applied Imaging, Inc. Use of anti-embryonic hemoglobin antibodies to identify fetal cells
EP1007965A4 (en) * 1996-10-21 2000-06-14 Applied Imaging Inc Use of anti-embryonic hemoglobin antibodies to identify fetal cells
EP1007965A1 (en) * 1996-10-21 2000-06-14 Applied Imaging, Inc. Use of anti-embryonic hemoglobin antibodies to identify fetal cells
US6194146B1 (en) 1997-06-13 2001-02-27 Bioseparations, Inc. Situ and in vitro hybridization method and buffer
US5948617A (en) * 1997-06-13 1999-09-07 Biospeparations, Inc. Methods of in situ hybridization
WO1998056955A1 (en) * 1997-06-13 1998-12-17 Bioseparations, Inc. Method of in situ hybridization
US5962234A (en) * 1997-10-20 1999-10-05 Applied Imaging Corporation Use of anti-embryonic epsilon hemoglobin antibodies to identify fetal cells
US6461813B2 (en) * 1998-09-21 2002-10-08 Rigel Pharmaceuticals, Inc. Multiparameter FACS assays to detect alterations in cell cycle regulation
EP1106683A2 (en) * 1999-09-10 2001-06-13 Becton, Dickinson and Company A method for providing long term stability to cells for diagnostic testing
EP1106683A3 (en) * 1999-09-13 2004-02-04 Becton, Dickinson and Company A method for providing long term stability to cells for diagnostic testing
EP1172445A1 (en) * 2000-07-14 2002-01-16 Praenadia GmbH A method for direct genetic analysis of target cells by using fluorescence probes
WO2002006524A3 (en) * 2000-07-14 2002-06-27 Praenadia Gmbh A method for direct genetic analysis of target cells by using flourescence probes
WO2002006524A2 (en) * 2000-07-14 2002-01-24 Praenadia Gmbh A method for direct genetic analysis of target cells by using flourescence probes
EP1368369A2 (en) * 2000-11-15 2003-12-10 F. Hoffmann-La Roche Ag Methods and reagents for identifying rare fetal cells in the material circulation
EP1368369A4 (en) * 2000-11-15 2006-02-22 Hoffmann La Roche Methods and reagents for identifying rare fetal cells in the material circulation
WO2003008639A2 (en) * 2001-07-12 2003-01-30 Praenadia Gmbh Method for detecting a nucleic acid
WO2003008639A3 (en) * 2001-07-12 2003-09-18 Praenadia Gmbh Method for detecting a nucleic acid
US8945828B2 (en) 2005-12-08 2015-02-03 Aarhus Universitet Method of identifying fetal antigens or cell surface markers using phage display technology
WO2007065438A3 (en) * 2005-12-08 2007-07-26 Fcmb Aps Detection of foetal cells from maternal blood
WO2007130826A2 (en) * 2006-05-04 2007-11-15 Ge Healthcare Bio-Sciences Ab Separation of cells
WO2007130826A3 (en) * 2006-05-04 2008-01-03 Ge Healthcare Bio Sciences Ab Separation of cells
EP1947463A1 (en) * 2007-01-16 2008-07-23 Roche Diagnostics GmbH Collection of liquid analytical samples for clinical analytical purpose
WO2008087138A1 (en) * 2007-01-16 2008-07-24 Roche Diagnostics Gmbh Collection of liquid analytical samples for clinical analytical purpose
US9447467B2 (en) 2009-04-21 2016-09-20 Genetic Technologies Limited Methods for obtaining fetal genetic material
WO2011075774A1 (en) 2009-12-23 2011-06-30 Genetic Technologies Limited Methods of enriching and detecting fetal nucleic acids
US20160122704A1 (en) * 2013-06-14 2016-05-05 Metacell, S.R.O. Method for separation of sporadic cells from body fluids, and apparatus for carrying out said method
EP3564389A4 (en) * 2016-12-27 2020-11-25 TL Genomics Inc. Method of obtaining fetal cell nucleic acids
US11365404B2 (en) 2016-12-27 2022-06-21 Tl Genomics Inc. Method for obtaining nucleic acid derived from fetal cell
WO2019060687A1 (en) * 2017-09-21 2019-03-28 Beckman Coulter, Inc. Method of determining fetal red blood cells in maternal circulation using flow cytometry
US11573229B2 (en) 2019-06-07 2023-02-07 Arcedi Biotech Aps Isolation of fetal cells using FACS

Also Published As

Publication number Publication date
IL110364A0 (en) 1994-10-21
AU7474394A (en) 1995-02-20

Similar Documents

Publication Publication Date Title
US5629147A (en) Enriching and identifying fetal cells in maternal blood for in situ hybridization
CA2140278C (en) Enriching and identyfing fetal cells in maternal blood for in situ hybridization
WO1995003431A1 (en) Enriching and identifying fetal cells in maternal blood for in situ hybridization
US7651838B2 (en) Prenatal diagnosis method on isolated foetal cell of maternal blood
KR100523381B1 (en) Use of anti-embryonic hemoglobin antibodies to identify fetal cells
Bianchi et al. Erythroid‐specific antibodies enhance detection of fetal nucleated erythrocytes in maternal blood
US5153117A (en) Fetal cell recovery method
US5714325A (en) Prenatal diagnosis by isolation of fetal granulocytes from maternal blood
JP2004504036A (en) Method for direct genetic analysis of target cells by using fluorescent probes
US20090081689A1 (en) Reagents and methods to enrich rare cells from body fluids
EP2638176B1 (en) Enrichment and identification of fetal cells in maternal blood and ligands for such use
JP2008283989A (en) Method and composition for chromosome-specific staining
US6524798B1 (en) High efficiency methods for combined immunocytochemistry and in-situ hybridization
WO1995009245A1 (en) Methods for detecting and analyzing individual rare cells in a population
Hamada et al. Mid‐trimester fetal sex determination from maternal peripheral blood by fluorescence in situ hybridization without enrichment of fetal cells
CA2243197A1 (en) Solid phase enrichment of intact cells using intracellular constituents
CA2413835A1 (en) Isolation and culturing of fetal cells
Faguet Hematologic malignancies: methods and techniques
WO1999015892A1 (en) Enrichment and identification of trophoblast cells in maternal peripheral blood
Krabchi et al. Identification of all fetal nucleated cells in maternal blood using PRINS technique
Bischoff et al. Prenatal Diagnosis of Chromosomal Abnormalities Using Maternal Blood
Sekizawa et al. Noninvasive Prenatal Diagnosis Using a Single Fetal Nucleated Erythrocyte Isolated by Micromanipulation from Maternal Blood

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB GE HU JP KE KG KP KR KZ LK LT LU LV MD MG MN MW NL NO NZ PL PT RO RU SD SE SI SK TJ TT UA UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA