WO1996012014A1 - Molecular tagging system - Google Patents

Abstract

The invention provides a method of tracking, identifying, and/or sorting classes or subpopulations of molecules by the use of oligonucleotide tags. Oligonucleotide tags of the invention each consist of a plurality of subunits 3 to 6 nucleotides in length selected from a minimally cross-hydridizing set. A subunit of a minimally cross-hybridizing set forms a duplex or triplex having two or more mismatches with the complement of any other subunit of the same set. The number of oligonucleotide tags available in a particular embodiment depends on the number of subunits per tag and on the length of the subunit. An important aspect of the invention is the use of the oligonucleotide tags for sorting polynucleotides by specifically hybridizing tags attached to the polynucleotides to their complements on solid phase supports. This embodiment provides a readily automated system for manipulating and sorting polynucleotides, particularly useful in large-scale parallel operations, such as large-scale DNA sequencing, mRNA fingerprinting, and the like, wherein many target polynucleotides or many segments of a single target polynucleotide are sequenced simultaneously.

Description

MOLECULAR TAGGING SYSTEM

Field of the Invention The invention relates generally to methods for identifying, sorting, and/or tracking molecules, especially polynucleotides, with oligonucleotide labels, and more particularly, to a method of sorting polynucleotides by specific hybridization to oligonucleotide tags.

BACKGROUND

Specific hybridization of oligonucleotides and their analogs is a fundamental process that is employed in a wide variety of research, medical, and industrial applications, including the identification of disease-related polynucleotides in diagnostic assays, screening for clones of novel target polynucleotides, identification of specific polynucleotides in blots of mixtures of polynucleotides, amplification of specific target polynucleotides, therapeutic blocking of inappropriately expressed genes, DNA sequencing, and the like, e.g. Sa brook et al, Molecular Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor

Laboratory, New York, 1989); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Milligan et al, J. Med. Chem., 36: 1923-1937 (1993); Drmanac et al, Science, 260: 1649- 1652 (1993); Bains, J. DNA Sequencing and Mapping, 4: 143-150 ( 1993). Specific hybridization has also been proposed as a method of tracking, retrieving, and identifying compounds labeled with oligonucleotide tags. For example, in multiplex DNA sequencing oligonucleotide tags are used to identify electrophoretically separated bands on a gel that consist of DNA fragments generated in the same sequencing reaction. In this way, DNA fragments from many sequencing reactions are separated on the same lane of a gel which is then blotted with separate solid phase materials on which the fragment bands from the separate sequencing reactions are visualized with oligonucleotide probes that specifically hybridize to complementary tags, Church et al. Science, 240: 185-188 (1988). Similar uses of oligonucleotide tags have also been proposed for identifying explosives, potential pollutants, such as crude oil, and currency for prevention and detection of counterfeiting, e.g. reviewed by Dollinger, pages 265-274 in Mullis el al, editors. The Polymerase Chain Reaction (Birkhauser, Boston, 1994). More recently, systems employing oligonucleotide tags have also been proposed as a means of manipulating and identifying individual molecules in complex combinatorial chemical libraries, for example, as an aid to screening such libraries for drug candidates, Brenner and Lerner, Proc. Natl. Acad. Sci., 89: 5381-5383 (1992); Alper, Science, 264: 1399-1401 (1994); and Needels et al, Proc. Naϋ. Acad. Sci.. 90: 10700- 10704 (1993).

The successful implementation of such tagging schemes depends in large part on the success in achieving specific hybridization between a tag and its complementary probe. That is, for an oligonucleotide tag to successfully identify a substance, the number of false positive and false negative signals must be minimized. Unfortunately, such spurious signals are not uncommon because base pairing and base stacking free energies vary widely among nucleotides in a duplex or triplex structure. For example, a duplex consisting of a repeated sequence of deoxyadenine (A) and thymidine (T) bound to its complement may have less stability than an equal-length duplex consisting of a repeated sequence of deoxyguanidine (G) and deoxycytidine (C) bound to a partially complementary target containing a mismatch. Thus, if a desired compound from a large combinatorial chemical library were tagged with the former oligonucleotide, a significant possibiUty would exist that, under hybridization conditions designed to detect perfectly matched AT-rich duplexes, undesired compounds labeled with the GC-rich oligonucleotide-even in a mismatched duplex— would be detected along with the perfectly matched duplexes consisting of the AT-rich tag. In the molecular tagging system proposed by Brenner et al (cited above), the related problem of mis-hybridizations of closely related tags was addressed by employing a so-called "comma-less" code, which ensures that a probe out of register (or frame shifted) with respect to its complementary tag would result in a duplex with one or more mismatches for each of its five or more three-base words, or "codons."

Even though reagents, such as tetramethylammonium chloride, are available to negate base-specific stability differences of obgonucleotide duplexes, the effect of such reagents is often limited and their presence can be incompatible with, or render more difficult, further manipulations of the selected compounds, e.g. amplification by polymerase chain reaction (PCR), or the like.

Such problems have made the simultaneous use of multiple hybridization probes in the analysis of multiple or complex genetic loci, e.g. via multiplex PCR, reverse dot blotting, or the like, very difficult. As a result, direct sequencing of certain loci, e.g. HLA genes, has been promoted as a reliable alternative to indirect methods employing specific hybridization for the identification of genotypes, e.g. Gyllensten et al, Proc. Natl. Acad. Sci., 85: 7652-7656 ( 1988). The ability to sort cloned and identically tagged DNA fragments onto distinct solid phase supports would facilitate such sequencing, particularly when coupled with a non gel-based sequencing methodology simultaneously applicable to many samples in parallel. In view of the above, it would be useful if there were available an oligonucleotide - based tagging system which provided a large repertoire of tags, but which also minimized the occurrence of false positive and false negative signals without the need to employ special reagents for altering natural base pairing and base stacking free energy differences. Such a tagging system would find applications in many areas, including construction and use of combinatorial chemical libraries, large-scale mapping and sequencing of DNA, genetic identification, medical diagnostics, and the like.

Summary of the Invention

An object of my invention is to provide a molecular tagging system for tracking, retrieving, and identifying compounds.

Another object of my invention is to provide a method for sorting identical molecules, or subclasses of molecules, especially polynucleotides, onto surfaces of solid phase materials by the specific hybridization of oligonucleotide tags and their complements.

A further object of my invention is to provide a combinatorial chemical library whose member compounds are identified by the specific hybridization of oligonucleoude tags and their complements. A still further object of my invention is to provide a system for tagging and sorting many thousands of fragments, especially randomly overlapping fragments, of a target polynucleotide for simultaneous analysis and/or sequencing.

Another object of my invention is to provide a rapid and reliable method for sequencing target polynucleotides having a length in the range of a few hundred basepairs to several tens of thousands of basepairs.

My invention achieves these and other objects by providing a method and materials for tracking, identifying, and/or sorting classes or subpopulations of molecules by the use of oligonucleotide tags. An oligonucleotide tag of the invention consists of a plurality of subunits, each subunit consisting of an oligonucleotide of 3 to 6 nucleotides in length. Subunits of an oligonucleotide tag are selected from a minimally cross-hybridizπing set. In such a set, a duplex or triplex consisting of a subunit of the set and the complement of any other subunit of the set contains at least two mismatches. In other words, a subunit of a minimally cross-hybridizing set at best forms a duplex or triplex having two mismatches with the complement of any other subunit of the same set. The number of oligonucleotide tags available in a particular embodiment depends on the number of subunits per tag and on the length of the subunit. The number is generally much less than the number of all possible sequences the length of the tag, which for a tag n nucleotides long would be 4ⁿ. More preferably, subunits are oligonucleotides from 4 to 5 nucleotides in length.

In one aspect of my invention, complements of oligonucleotide tags attached to a solid phase support are used to sort polynucleotides from a mixture of polynucleotides each containing a tag. In this embodiment, complements of the oligonucleotide tags are synthesized on the surface of a solid phase support, such as a microscopic bead or a specific location on an array of synthesis locations on a single support, such that populations of identical sequences are produced in specific regions. That is, the surface of each support, in the case of a bead, or of each region, in the case of an array, is derivatized by only one type of complement which has a particular sequence. The population of such beads or regions contains a repertoire of complements with distinct sequences, the size of the repertoire depending on the number of subunits per oligonucleotide tag and the length of the subunits employed. Similarly, the polynucleotides to be sorted each comprises an oligonucleotide tag in the repertoire, such that identical polynucleotides have the same tag and different polynucleotides have different tags. As explained more fully below, this condition is achieved by taking a sufficiently small sample of tagged polynucleotides from the full ensemble of tagged polynucleotides. Thus, when the populations of supports and polynucleotides are mixed under conditions which permit specific hybridization of the oligonucleotide tags with their respective complements, subpopulations of identical polynucleotides are sorted onto particular beads or regions. The subpopulations of polynucleotides can then be manipulated on the solid phase support by micro-biochemical techniques.

Generally, the method of my invention comprises the following steps: (a) attaching an oligonucleotide tag from a repertoire of tags to each molecule in a population of molecules (i) such that substantially all the same molecules or same subpopulation of molecules in the population have the same oligonucleotide tag attached and substantially all different molecules or different subpopulations of molecules in the population have different oligonucleotide tags attached and (ii) such that each oligonucleotide tag from the repertoire comprises a plurality of subunits and each subunit of the plurality consists of an oligonucleoude having a length from three to six nucleotides or from three to six basepairs, the subunits being selected from a minimally cross-hybridizing set; and (b) sorting the molecules or subpopulations of molecules of the population by specifically hybridizing the oligonucleoude tags with their respective complements.

An important aspect of my invention is the use of the oligonucleotide tags to sort polynucleotides for parallel sequence determination. Preferably, such sequencing is carried out by the following steps: (a) generating from the target polynucleotide a plurality of fragments that cover the target polynucleotide; (b) attaching an oligonucleotide tag from a repertoire of tags to each fragment of the plurality (i) such that substantially all the same fragments have the same oligonucleotide tag attached and substantially all different fragments have different oligonucleotide tags attached and (ii) such that each oligonucleotide tag from the repertoire comprises a plurality of subunits and each subunit of the plurality consists of an oligonucleotide having a length from three to six nucleotides or from three to six basepairs, the subunits being selected from a minimally cross-hybridizing set; O 96/12014 PC17US95/12791

sorting the fragments by specifically hybridizing the oligonucleotide tags with their respective complements; (c) determining the nucleotide sequence of a portion of each of the fragments of the plurality, preferably by a single-base sequencing methodology as described below; and (d) determining the nucleotide sequence of the target polynucleotide by collating the sequences of the fragments.

My invention overcomes a key deficiency of current methods of tagging or labeling molecules with oligonucleotides: By coding the sequences of the tags in accordance with the invention, the stability of any mismatched duplex or triplex between a tag and a complement to another tag is far lower than that of any perfectly matched duplex between the tag and its own complement. Thus, the problem of incorrect sorting because of mismatch duplexes of GC-rich tags being more stable than perfectly matched AT-rich tags is eliminated.

When used in combination with solid phase supports, such as microscopic beads, my invention provides a readily automated system for manipulating and sorting polynucleotides, particularly useful in large-scale parallel operations, such as large-scale DNA sequencing, wherein many target polynucleotides or many segments of a single target polynucleotide are sequenced and/or analyzed simultaneously.

Brief Description of the Drawings Figures la- lc illustrates structures of labeled probes employed in a preferred method of "single base" sequencing which may be used with the invention.

Figure 2 illustrates the relative positions of the nuclease recognition site, ligation site, and cleavage site in a ligated complex formed between a target polynucleotide and a probe used in a preferred "single base" sequencing method. Figure 3 is a flow chart illustrating a general algorithm for generating minimally cross-hybridizing sets.

Figure 4 illustrates a scheme for synthesizing and using a combinatorial chemical library in which member compounds are labeled with oligonucleotide tags in accordance with the invention. Figure 5 diagrammatically illustrates an apparatus for carrying out parallel operations, such as polynucleotide sequencing, in accordance with the invention.

Definitions "Complement" or "tag complement" as used herein in reference to oligonucleotide tags refers to an oligonucleotide to which a oligonucleotide tag specifically hybridizes to form a perfectly matched duplex or triplex. In embodiments where specific hybridization results in a triplex, the oligonucleotide tag may be selected to be either double stranded or single stranded. Thus, where triplexes are formed, the term "complement" is meant to encompass either a double stranded complement of a single stranded oligonucleoude tag or a single stranded complement of a double stranded oligonucleotide tag.

The term "oligonucleotide" as used herein includes linear oligomers of natural or modified monomers or linkages, including deoxyribonucleosides. ribonucleosides, α- anomeric forms thereof, peptide nucleic acids (PNAs), and the like, capable of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like. Usually monomers are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g. 3-4, to several tens of monomeric units. Whenever an oligonucleotide is represented by a sequence of letters, such as "ATGCCTG," it will be understood that the nucleotides are in 5'—>3' order from left to right and that "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes thymidine. unless otherwise noted. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoranihdate, phosphoramidate, and the like. Usually oligonucleotides of the invention comprise the four natural nucleotides; however, they may also comprise non-natural nucleotide analogs. It is clear to those skilled in the art when oligonucleotides having natural or non-natural nucleotides may be employed, e.g. where processing by enzymes is called for, usually oligonucleotides consisting of natural nucleotides are required.

"Perfectly matched" in reference to a duplex means that the poly- or oligonucleotide strands making up the duplex form a double stranded structure with one other such that every nucleotide in each strand undergoes Watson-Crick basepairing with a nucleotide in the other strand. The term also comprehends the pairing of nucleoside analogs, such as deoxyinosine, nucleosides with 2-aminopurine bases, and the like, that may be employed. In reference to a triplex, the term means that the triplex consists of a perfectly matched duplex and a third strand in which every nucleotide undergoes Hoogsteen or reverse Hoogsteen association with a basepair of the perfectly matched duplex. Conversely, a "mismatch" in a duplex between a tag and an oligonucleotide means that a pair or triplet of nucleotides in the duplex or triplex fails to undergo Watson-Crick and/or Hoogsteen and/or reverse Hoogsteen bonding.

As used herein, "nucleoside" includes the natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e.g. as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). "Analogs" in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g. described by Scheit. Nucleotide Analogs (John Wiley, New York, 1980); Uhlman and Peyman. Chemical Reviews, 90: 543-584 ( 1990). or the like, with the only proviso that they are capable of specific hybridization. Such analogs include synthetic nucleosides designed to enhance binding properties, reduce degeneracy, increase specificity, and the like.

Detailed Description of the Invention The invention provides a method of labeling and sorting molecules, particularly polynucleotides, by the use of oligonucleotide tags. The oligonucleotide tags of the invention comprise a plurality of "words" or subunits selected from minimally cross- hybridizing sets of subunits. Subunits of such sets cannot form a duplex or triplex with the complement of another subunit of the same set with less than two mismatched nucleotides. Thus, the sequences of any two oligonucleotide tags of a repertoire that form duplexes will never be "closer" than differing by two nucleotides. In particular embodiments, sequences of any two oligonucleotide tags of a repertoire can be even "further" apart, e.g. by designing a minimally cross-hybridizing set such that subunits cannot form a duplex with the complement of another subunit of the same set with less than three mismatched nucleotides, and so on. In such embodiments, greater specificity is achieved, but the total repertoire of tags is smaller. Thus, for tags of a given length and word size, a trade off must be made between the degree of specificity desired and the size of repertoire desired. The invention is particularly useful in labeling and sorting polynucleotides for parallel operations, such as sequencing, fingerprinting or other types of analysis.

Constructing Oligonucleotide Tags from Minimally Cross-Hybridizing Sets of Subunits The nucleotide sequences of the subunits for any minimally cross-hybridizing set arc conveniently enumerated by simple computer programs following the general algorithm illustrated in Fig. 3, and as exemplified by program minhx whose source code is listed in Appendix I. Minhx computes all minimally cross-hybridizing sets having subunits composed of three kinds of nucleotides and having length of four.

The algorithm of Fig. 3 is implemented by first defining the characteristic of the subunits of the minimally cross-hybridizing set, i.e. length, number of base differences between members, and composition, e.g. do they consist of two, three, or four kinds of bases. A table M_n, n=l, is generated (100) that consists of all possible sequences of a given length and composition. An initial subunit S \ is selected and compared (120) with successive subunits S_j for i=n+ l to the end of the table. Whenever a successive subunit has the required number of mismatches to be a member of the minimally cross-hybridizing set, it is saved in a new table M_n+ι ( 125), that also contains subunits previously selected in prior passes through step 120. For example, in the first set of comparisons, M2 will contain S 1 : in the second sel of comparisons. M3 will contain S ] and S2; in the third set of comparisons. M4 will contain S \ , S2, and S3; and so on. Similarly, comparisons in table Mi will be between Sj and all successive subunits in M;. Note that each successive table M_n+ j is smaller than its predecessors as subunits are eliminated in successive passes through step 130. After every subunit of table M_n has been compared (140) the old table is replaced by the new table M_n+ι , and the next round of comparisons are begun. The process stops (160) when a table M_n is reached that contains no successive subunits to compare to the selected subunit Sj, i.e. M_n=M_n+ι .

Preferably, minimally cross-hybridizing sets comprise subunits that make approximately equivalent contributions to duplex stability as every other subunit in the set. In this way, the stability of perfectly matched duplexes between every subunit and its complement is approximately equal. Guidance for selecting such sets is provided by published techniques for selecting optimal PCR primers and calculating duplex stabilities, e.g. Rychlik et al, Nucleic Acids Research, 17: 8543-8551 ( 1989) and 18: 6409-6412 ( 1990): Breslauer et al, Proc. Natl. Acad. Sci., 83: 3746-3750 ( 1986): Wetmur, Crit. Rev. Biochem. Mol. Biol., 26: 227-259 (1991 ):and the like. For shorter tags, e.g. about 30 nucleotides or less, the algorithm described by Rychlik and Wetmur is preferred, and for longer tags. e.g. about 30-35 nucleotides or greater, an algorithm disclosed by Suggs et al. pages 683-693 in Brown, editor, ICN-UCLA Symp. Dev. Biol., Vol. 23 (Academic Press, New York, 1981) may be conveniently employed. Clearly, the are many approaches available to one skilled in the art for designing sets of minimally cross-hybridizing subunits within the scope of the invention. For example, to minimize the affects of different base- stacking energies of terminal nucleotides when subunits are assembled, subunits may be provided that have the same terminal nucleotides. In this way, when subunits are linked, the sum of the base-stacking energies of all the adjoining terminal nucleotides will be the same, thereby reducing or eliminating variability in tag melting temperatures. A preferred embodiment of minimally cross-hybridizing sets are those whose subunits are made up of three of the four natural nucleotides. As will be discussed more fully below, the absence of one type of nucleotide in the oligonucleotide tags permits target polynucleotides to be loaded onto solid phase supports by use of the 5'— ->3' exonuclease activity of a DNA polymerase. The following is an exemplary minimally cross-hybridizing set of subunits each comprising four nucleotides selected from the group consisting of A, G, and T:

Table I

Word: w- w₂ ^ ₄ Sequence: GATT TGAT TAGA TTTG Word: W5 _ή w₇ WR

Secjuence : GTAA AGTA ATGT AAAG

In this set, each member would form a duplex having three mismatched bases with the complement of every other member.

Further exemplary minimally cross-hybridizing sets are listed below in Table I. Clearly, additional sets can be generated by substituting different groups of nucleotides, or by using subsets of known minimally cross-hybridizing sets.

Table II Exemplary Minimally Cross-Hvhridizing Sets of 4-mer Subunits

Set 1 Set 2 Set 3 Set 4 Set 5 Set 6.

CATT ACCC AAAC AAAG AACA AACG

CTAA AGGG ACCA ACCA ACAC ACAA

TCAT CACG AGGG AGGC AGGG AGGC

ACTA CCGA CACG CACC CAAG CAAC

TACA CGAC CCGC CCGG CCGC CCGG

TTTC GAGC CGAA CGAA CGCA CGCA

ATCT GCAG GAGA GAGA GAGA GAGA

AAAC GGCA GCAG GCAC GCCG GCCC

AAAA GGCC GGCG GGAC GGAG

Set 7 Set a Set 9 Set 10. Set 11 Set 12

AAGA AAGC AAGG ACAG ACCG ACGA

ACAC ACAA ACAA AACA AAAA AAAC

AGCG AGCG AGCC AGGC AGGC AGCG

CAAG CAAG CAAC CAAC CACC CACA

CCCA CCCC CCCG CCGA CCGA CCAG

CGGC CGGA CGGA CGCG CGAG CGGC

GACC GACA GACA GAGG GAGG GAGG

GCGG GCGG GCGC GCCC GCAC GCCC

GGAA GGAC GGAG GGAA GGCA GGAA

The oligonucleotide tags of the invention and their complements are conveniently synthesized on an automated DNA synthesizer, e.g. an Applied Biosystems, Inc. (Foster City, California) model 392 or 394 DNA/RNA Synthesizer, using standard chemistries, such as phosphoramidite chemistry, e.g. disclosed in the following references: Beaucage and Iyer. Tetrahedron, 48: 2223-231 1 ( 1992); Molko et al, U.S. patent 4,980,460; Koster et al, U.S. patent 4,725,677; Caruthers et al, U.S. patents 4,415,732; 4,458,066; and 4,973.679: and the like. Alternative chemistries, e.g. resulting in non-natural backbone groups, such as phosphorothioate. phosphoramidate, and the like, may also be employed provided that the resulting oligonucleotides are capable of specific hybridization. In some embodiments, tags may comprise naturally occurring nucleotides that permit processing or manipulation by enzymes, while the corresponding tag complements may comprise non- natural nucleotide analogs, such as peptide nucleic acids, or like compounds, that promote the formation of more stable duplexes during sorting. When microparticles are used as supports, repertoires of oligonucleotide tags and tag complements are preferably generated by subunit-wise synthesis via "split and mix" techniques, e.g. as disclosed in Shortle et al, International patent application PCT/US93/03418. Briefly, the basic unit of the synthesis is a subunit of the oligonucleotide tag. Preferably, phosphoramidite chemistry is used and 3' phosphoramidite oligonucleotides are prepared for each subunit in a minimally cross- hybridizing set, e.g. for the set first listed above, there would be eight 4-mer 3'- phosphoramidites. Synthesis proceeds as disclosed by Shortle et al or in direct analogy with the techniques employed to generate diverse oligonucleotide libraries using nucleosidic monomers, e.g. as disclosed in Telenius et al, Genomics, 13: 718-725 (1992); Welsh et al, Nucleic Acids Research, 19: 5275-5279 (1991 ); Grothues et al, Nucleic Acids Research, 21 : 1321- 1322 ( 1993): Hartley, European patent application 90304496.4; Lam et al, Nature, 354: 82-84 ( 1991); Zuckerman et al, Int. J. Pept. Protein Research, 40: 498- 507 ( 1992); and the like. Generally, these techniques simply call for the application of mixtures of the activated monomers to the growing oligonucleotide during the coupling steps.

Double stranded forms of tags may be made by separately synthesizing the complementary strands followed by mixing under conditions that permit duplex formation. Alternatively, double stranded tags may be formed by first synthesizing a single stranded repertoire linked to a known oligonucleotide sequence that serves as a primer binding site. The second strand is then synthesized by combining the single stranded repertoire with a primer and extending with a polymerase. This latter approach is described in Oliphant et al, Gene. 44: 177- 183 ( 1986). Such duplex tags may then be inserted into cloning vectors along with target polynucleotides for sorting and manipulation of the target polynucleotide in accordance with the invention. In embodiments where specific hybridization occurs via triplex formation, coding of tag sequences follows the same principles as for duplex-forming tags; however, there are further constraints on the selection of subunit sequences. Generally, third strand association via Hoogsteen type of binding is most stable along homopyrimidine- homopurine tracks in a double stranded target. Usually, base triplets form in T-A*T or C- G*C motifs (where "-" indicates Watson-Crick pairing and "*" indicates Hoogsteen type of binding); however, other motifs are also possible. For example, Hoogsteen base pairing permits parallel and antiparallel orientations between the third strand (the Hoogsteen strand) and the purine-rich strand of the duplex to which the third strand binds, depending O 96/12014 P 1

on conditions and the composition of the strands. There is extensive guidance in the literature for selecting appropriate sequences, orientation, conditions, nucleoside type (e.g. whether ribose or deoxyribose nucleosides are employed), base modifications (e.g. methylated cytosine, and the like) in order to maximize, or otherwise regulate, triplex stability as desired in particular embodiments, e.g. Roberts et al, Proc. Natl. Acad. Sci., 88: 9397-9401 (1991); Roberts et al, Science, 258: 1463- 1466 ( 1992); Distefano et al, Proc. Natl. Acad. Sci., 90: 1 179- 1 183 (1993); Mergny et al, Biochemistry, 30: 9791-9798 (1991); Cheng et al, J. Am. Chem. Soc, 1 14: 4465-4474 ( 1992); Beal and Dervan, Nucleic Acids Research, 20: 2773-2776 (1992); Beal and Dervan, J. Am. Chem. Soc, 1 14: 4976-4982 ( 1992); Giovannangeli et al, Proc. Natl. Acad. Sci., 89: 8631-8635

(1992); Moser and Dervan, Science, 238: 645-650 (1987); McShan et al, J. Biol. Chem., 267:5712-5721 ( 1992): Yoon et al, Proc. Natl. Acad. Sci., 89: 3840-3844 (1992); Blume et al, Nucleic Acids Research, 20: 1777-1784 (1992); Thuong and Helene, Angew. Chem. Int. Ed. Engl. 32: 666-690 (1993); and the like. Conditions for annealing single-stranded or duplex tags to their single-stranded or duplex complements are well known, e.g. Ji et al, Anal. Chem. 65: 1323-1328 ( 1993).

Oligonucleotide tags of the invention may range -in length from 12 to 60 nucleotides or basepairs. Preferably, oligonucleotide tags range in length from 18 to 40 nucleotides or basepairs. More preferably, oligonucleotide tags range in length from 25 to 40 nucleotides or basepairs. In terms of preferred and more preferred numbers of subunits, these ranges may be expressed as follows:

Table III

Numbers of Subunits in Tags in Preferred Embodiments

Monomers in Subunit Nucleotides in Oligonucleotide Tag

( 12-60) ( 18-40) (25-40)

3 4-20 subunits 6- 13 subunits 8- 13 subunits

4 3- 15 subunits 4- 10 subunits 6-10 subunits

5 2- 12 subunits 3-8 subunits 5-8 subunits

6 2- 10 subunits 3-6 subunits 4-6 subunits

Most preferably, oligonucleotide tags are single stranded and specific hybridization occurs via Watson-Crick pairing with a tag complement. Attaching Tags to Molecules Oligonucleotide tags may be attached to many different classes of molecules by a variety of reactive functionalities well known in the art, e.g. Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, 1992); hanna et al, U.S. patent 4,318,846; or the like. Table IV provides exemplary functionalities and counterpart reactive groups that may reside on oligonucleotide tags or the molecules of interest. When the functionalities and counterpart reactants are reacted together, after activation in some cases, a linking group is formed. Moreover, as described more fully below, tags may be synthesized simultaneously with the molecules undergoing selection to form combinatorial chemical libraries.

Table IV

Reactive Functionalities and Their Counterpart Reactants and Resulting Linking Groups

Reactive Counterpart Linking Functionality Functionality Group

-NH₂ -COOH -CO-NH-

-NH₂ -NCO -NHCONH- -NH₂ -NCS -NHCSNH-

-SH -C=C-CO- -S-C-C-CO-

-NH₂ -CHO -CH₂NH-

-NH₂ -SOiCl -SO NH- -OH -OP(NCH(CH₃)₂)2 -OP(=O)(O)O- -OP(=0)(0)S -NHC(=0)CH₇Br -NHC(=0)CHoSP(=O)(0)0- A class of molecules particularly convenient for the generation of combinatorial chemical libraries includes linear polymeric molecules of the form:

- (M-L)_n -

wherein L is a tinker moiety and M is a monomer that may selected from a wide range of chemical structures to provide a range of functions from serving as an inert non-sterically hindering spacer moiety to providing a reactive functionality which can serve as a branching point to attach other components, a site for attaching labels; a site for attaching oligonucleotides or other binding polymers for hybridizing or binding to a therapeutic target; or as a site for attaching other groups for affecting solubility, promotion of duplex and/or triplex formation, such as intercalators, alkylating agents, and the like. The sequence, and therefore composition, of such linear polymeric molecules may be encoded within a polynucleotide attached to the tag, as taught by Brenner and Lerner (cited above). However, after a selection event, instead of amplifying then sequencing the tag of the selected molecule, the tag itself or an additional coding segment can be sequenced directly— using a so-called "single base" approach described below— after releasing the molecule of interest, e.g. by restriction digestion of a site engineered into the tag. Clearly, any molecule produced by a sequence of chemical reaction steps compatible with the simultaneous synthesis of the tag moieties can be used in the generation of combinatorial libraries.

Conveniently there is a wide diversity of phosphate- linked monomers available for generating combinatorial libraries. The following references disclose several phosphoramidite and/or hydrogen phosphonate monomers suitable for use in the present invention and provide guidance for their synthesis and inclusion into oligonucleotides:

Newton et al. Nucleic Acids Research, 21 : 1 155- 1 162 (1993); Griffin et al, J. Am. Chem. Soc, 1 14: 7976-7982 ( 1992): Jaschke et al, Tetrahedron Letters, 34: 301-304 (1992): Ma et al. International application PCT/CA92/00423; Zon et al, International application PCT/US90/06630: Durand et al, Nucleic Acids Research, 18: 6353-6359 ( 1990); Salunkhe et al, J. Am. Chem. Soc, 1 14: 8768-8772 (1992); Urdea et al, U.S. patent 5,093,232: Ruth, U.S. patent 4,948,882; Cruickshank, U.S. patent 5,091,519; Haralambidis et al, Nucleic Acids Research, 15: 4857-4876 ( 1987); and the like. More particularly, M may be a straight chain, cyclic, or branched organic molecular structure containing from 1 to 20 carbon atoms and from 0 to 10 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur. Preferably, M is alkyl, alkoxy, alkenyl, or aryl containing from 1 to 16 carbon atoms: a heterocycle having from 3 to 8 carbon atoms and from 1 to 3 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur; glycosyl; or nucleosidyl. More preferably, M is alkyl, alkoxy, alkenyl, or aryl containing from 1 to 8 carbon atoms; glycosyl; or nucleosidyl.

Preferably, L is a phosphorus(V) Unking group which may be phosphodiester, phosphotriester, methyl or ethyl phosphonate, phosphorothioate phosphorodithioate, phosphoramidate, or the like. Generally, linkages derived from phosphoramidite or hydrogen phosphonate precursors are preferred so that the linear polymeric units of the invention can be conveniently synthesized with commercial automated DNA synthesizers, e.g. Applied Biosystems, Inc. (Foster City, CA) model 394, or the like. n may vary significantly depending on the nature of M and L. Usually, n varies from about 3 to about 100. When M is a nucleoside or analog thereof or a nucleoside- sized monomer and L is a phosphorus(V) linkage, then n varies from about 12 to about 100. Preferably, when M is a nucleoside or analog thereof or a nucleoside-sized monomer and L is a phosphorus(V) linkage, then n varies from about 12 to about 40.

Peptides are another preferred class of molecules to which tags of the invention are attached. Synthesis of peptide-oUgonucleotide conjugates which may be used in the invention is taught in Nielsen et al, J. Am. Chem. Soc, 1 15: 9812-9813 (1993); Haralambidis et al (cited above) and International patent application PCT/AU88/ 04417; Truffert et al, Tetrahedron Letters, 35: 2353-2356 (1994); de la Torre et al, Tetrahedron Letters, 35: 2733-2736 (1994); and like references. Preferably, peptide-oligonucleotide conjugates are synthesized as described below. Peptides synthesized in accordance with the invention may consist of the natural amino acid monomers or non-natural monomers, including the D isomers of the natural amino acids and the like.

Combinatorial Chemical Libraries Combinatorial chemical libraries employing tags of the invention are preferably prepared by the method disclosed in Nielsen et al (cited above) and illustrated in Figure 4 for a particular embodiment. Briefly, a solid phase support, such as CPG, is derivatized with a cleavable linker that is compatible with both the chemistry employed to synthesize the tags and the chemistry employed to synthesize the molecule that will undergo some selection process. Preferably, tags are synthesized using phosphoramidite chemistry as described above and with the modifications recommended by Nielsen et al (cited above); that is, DMT-5'-O-protected 3'-phosphoramidite-derivatized subunits having methyl- protected phosphite and phosphate moieties are added in each synthesis cycle. Library compounds are preferably monomers having Fmoc— or equivalent-protecting groups masking the functionaUty to which successive monomer wiU be coupled. A suitable linker for chemistries employing both DMT and Fmoc protecting groups (referred to herein as a sarcosine linker) is disclosed by Brown et al, J. Chem. Soc. Chem. Commun., 1989: 891 - 893, which reference is incorporated by reference. Figure 4 illustrates a scheme for generating a combinatorial chemical tibrary of peptides conjugated to oligonucleotide tags. Solid phase support 200 is derivatized by sarcosine tinker 205 (exemplified in the formula below) as taught by Nielsen et al (cited above), which has an extended Unking moiety to facilitate reagent access.

(CPG)-NHC(0)CN(CH₃)C(0)CH₂CH₂C(0)0(CH₂)₆NHC(0)CH₂(0-DMT)NC(0)-

CH₂0(CH₂CH₂0)₂OT₂OT₂NHC(0)CH₂0(CH₂CH₂0)₂CH₂CH₂NH-Fmoc

Here "CPG" represents a controlled-pore glass support, "DMT" represents dimethoxytrityl, and "Fmoc" represents 9-fluorenylmethoxycarbonyl. In a preferred embodiment, an oligonucleotide segment 214 is synthesized initially so that in double stranded form a restriction endonuclease site is provided for cleaving the library compound after sorting onto a microparticle, or like substrate. Synthesis proceeds by successive alternative additions of subunits S j, S2, S3, and the like, to form tag 212, and their corresponding library compound monomers A \ , A2, A3, and the like, to form library compound 216. A "split and mix" technique is employed to generate diversity.

The subunits in a minimally cross-hybridizing set code for the monomer added in the library compound. Thus, a nine word set can unambiguously encode library compounds constructed from nine monomers. If some ambiguity is acceptable, then a single subunit may encode more than one monomer.

After synthesis is completed, the product is cleaved and deprotected (220) to form tagged library compound 225, which then undergoes selection 230, e.g. binding to a predetermined target 235, such as a protein. The subset of library compounds recovered from selection process 230 is then sorted (240) onto a solid phase support 245 via their tag moieties (there complementary subunits and nucleotides are shown in italics). After Ugating oligonucleotide splint 242 to tag complement 250 to form restriction site 255, the conjugate is digested with the corresponding restriction endonuclease to cleave the tibrary compound, a peptide in the example of Figure 4, from the oligonucleotide moiety. The sequence of the tag, and hence the identity of the library compound, is then determined by the preferred single base sequencing technique of the invention, described below.

Solid Phase Supports Solid phase supports for use with the invention may have a wide variety of forms, including microparticles, beads, and membranes, slides, plates, micromachined chips, and the like. Likewise, solid phase supports of the invention may comprise a wide variety of compositions, including glass, plastic, silicon, alkanethiolate-derivatized gold, cellulose, low cross-Unked and high cross-linked polystyrene, silica gel, polyamide. and the like. Preferably, either a population of discrete particles are employed such that each has a uniform coating, or population, of complementary sequences of the same tag (and no other), or a single or a few supports are employed with spatially discrete regions each containing a uniform coating, or population, of complementary sequences to the same tag (and no other). In the latter embodiment, the area of the regions may vary according to particular applications; usually, the regions range in area from several μm-2, e.g. 3-5, to several hundred μm*^, e.g. 100-500. Preferably, such regions are spatially discrete so that signals generated by events, e.g. fluorescent emissions, at adjacent regions can be resolved by the detection system being employed. In some applications, it may be desirable to have regions with uniform coatings of more than one tag complement, e.g. for simultaneous sequence analysis, or for bringing separately tagged molecules into close proximity.

Tag complements may be used with the solid phase support that they are synthesized on, or they may be separately synthesized and attached to a solid phase support for use, e.g. as disclosed by Lund et al, Nucleic Acids Research, 16: 10861 -10880 (1988); Albretsen et al, Anal. Biochem., 189: 40-50 ( 1990); Wolf et al, Nucleic Acids Research. 15: 291 1-2926 (1987); or Ghosh et al, Nucleic Acids Research, 15: 5353-5372 (1987). Preferably, tag complements are synthesized on and used with the same solid phase support, which may comprise a variety of forms and include a variety of linking moieties. Such supports may comprise microparticles or arrays, or matrices, of regions where uniform populations of tag complements are synthesized. A wide variety of microparticle supports may be used with the invention, including microparticles made of controlled pore glass (CPG), highly cross-Unked polystyrene, acrylic copolymers, cellulose, nylon, dextran, latex, polyacrolein, and the like, disclosed in the following exemplary references: Meth. Enzymol., Section A, pages 1 1-147, vol. 44 (Academic Press, New York, 1976): U.S. patents 4,678,814: 4,413,070; and 4,046;720; and Pon. Chapter 19, in Agrawal, editor. Methods in Molecular Biology, Vol. 20, (Humana Press, Totowa, NJ, 1993). Microparticle supports further include commerciaUy available nucleoside-derivatized CPG and polystyrene beads (e.g. available from Applied Biosystems, Foster City, CA): derivatized magnetic beads; polystyrene grafted with polyethylene glycol (e.g., TentaGelTM, R_app Polymere, Tubingen Germany): and the tike. Selection of the support characteristics, such as material, porosity, size, shape, and the like, and the type of linking moiety employed depends on the conditions under which the tags are used. For example, in applications involving successive processing with enzymes, supports and linkers that minimize steric hindrance of the enzymes and that facilitate access to substrate are preferred. Other important factors to be considered in selecting the most appropriate microparticle support include size uniformity, efficiency as a synthesis support, degree to which surface area known, and optical properties, e.g. as explain more fully below, clear smooth beads provide instrumentational advantages when handUng large numbers of beads on a surface.

Exemplary Unking moieties for attaching and/or synthesizing tags on microparticle surfaces are disclosed in Pon et al, Biotechniques, 6:768-775 (1988); Webb, U.S. patent 4,659,774; Barany et al, International patent appUcation PCT/US91/06103; Brown et al, J. Chem. Soc. Commun., 1989: 891-893; Damha et al, Nucleic Acids Research, 18: 3813- 3821 (1990); Beattie et al, Clinical Chemistry, 39: 719-722 (1993); Maskos and Southern, Nucleic Acids Research, 20: 1679-1684 (1992); and the like.

As mentioned above, tag complements may also be synthesized on a single (or a few) solid phase support to form an array of regions uniformly coated with tag complements. That is, within each region in such an array the same tag complement is synthesized. Techniques for synthesizing such arrays are disclosed in McGall et al, International application PCT/US93/03767; Pease et al, Proc. Natl. Acad. Sci., 91 : 5022- 5026 (1994); Southern and Maskos, International application PCT/GB89/01 1 14; Maskos and Southern (cited above): Southern et al, Genomics, 13: 1008-1017 (1992); and Maskos and Southern, Nucleic Acids Research, 21 : 4663-4669 (1993).

Preferably, the invention is implemented with microparticles or beads uniformly coated with complements of the same tag sequence. Microparticle supports and methods of covalently or noncovalently Unking oligonucleotides to their surfaces are well known, as exemplified by the following references: Beaucage and Iyer (cited above); Gait, editor, OUgonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the references cited above. Generally, the size and shape of a microparticle is not critical; however, microparticles in the size range of a few, e.g. 1-2, to several hundred, e.g. 200- 1000 μm diameter are preferable, as they facilitate the construction and manipulation of large repertoires of oUgonucleotide tags with minimal reagent and sample usage.

In some preferred applications, commercially available controlled-pore glass (CPG) or polystyrene supports are employed as solid phase supports in the invention. Such supports come available with base-labile linkers and initial nucleosides attached, e.g. Applied Biosystems (Foster City, CA). Preferably, microparticles having pore size between 500 and 1000 angstroms are employed.

In other preferred applications, non-porous microparticles are employed for their optical properties, which may be advantageously used when tracking large numbers of microparticles on planar supports, such as a microscope slide. Particularly preferred non- porous microparticles are the glycidal methacrylate (GMA) beads available from Bangs Laboratories (Carmel, IN). Such microparticles are useful in a variety of sizes and derivatized with a variety of linkage groups for synthesizing tags or tag complements. Preferably, for massively parallel manipulations of tagged microparticles, 5 μm diameter GMA beads are employed. Attaching Target Polynucleotides to Microparticles An important aspect of the invention is the sorting of populations of identical polynucleotides, e.g. from a cDNA tibrary, and their attachment to microparticles or separate regions of a sotid phase support such that each microparticle or region has only a single kind of polynucleotide. This latter condition can be essentially met by Ugating a repertoire of tags to a population of polynucleotides. The ligation products are then cloned, amplified, and sampled. Provided that the sample is sufficiently small, as explained more fully below, substantially aU of the tag-polynucleotides conjugates of the resulting tibrary will be unique. That is, each polynucleotide will have a unique tag, and vice versa. The polynucleotides are then sorted by hybridizing the tags to their complements

A repertoire of oligonucleotide tags can be ligated to a population of polynucleotides in a number of ways, such as through direct enzymatic ligation, amplification, e.g. via PCR, using primers containing the tag sequences, and the like. The initial ligating step produces a very large population of tag-polynucleotide conjugates such that a single tag is generally attached to many different polynucleotides. However, by taking a sufficiently small sample of the conjugates, the probability of obtaining "doubles," i.e. the same tag on two different polynucleotides, can be made negligible. (Note that it is also possible to obtain different tags with the same polynucleotide in a sample. This case simply leads to a polynucleotide being processed, e.g. sequenced, twice, so is usually not problematic). As explain more fully below, the probability of obtaining a double in a sample can be estimated by a Poisson distribution since the number of conjugates in a sample will be large, e.g. on the order of thousands or more, and the probability of selecting a particular tag will be small because the tag repertoire is large, e.g. on the order of tens of thousand or more. Generally, the larger the sample the greater the probability of obtaining a double. Thus, a design trade-off exists between selecting a large sample of tag-polynucleotide conjugates— which, for example, ensures adequate coverage of a target polynucleotide in a shotgun sequencing operation, and selecting a small sample which ensures that a minimal number of doubles will be present. In most embodiments, the presence of doubles merely adds an additional source of noise or, in the case of sequencing, a minor comptication in scanning and signal processing, as microparticles giving multiple fluorescent signals can simply be ignored. As used herein, the term "substantially all" in reference to attaching tags to molecules, especially polynucleotides. is meant to reflect the statistical nature of the sampling procedure employed to obtain a population of tag-molecule conjugates essentially free of doubles. The meaning of substantially all in terms of actual percentages of tag-molecule conjugates depends on how the tags are being employed. Preferably, for nucleic acid sequencing, substantially all means that at least eighty percent of the tags have unique polynucleotides attached. More preferably, it means that at least ninety percent of the tags have unique polynucleotides attached. Still more preferably, it means that at least ninety-five percent of the tags have unique polynucleotides attached. And, most preferably, it means that at least ninety-nine percent of the tags have unique polynucleotides attached. Preferably, when the population of polynucleotides consists of messenger RNA

(mRNA), oUgonucleotides tags are attached by reverse transcribing the mRNA with a set of primers containing complements of tag sequences. An exemplary set of such primers could have the following sequence:

5 ' -mRNA- [A] _n -3 '

.TI_joGG.W.W.W.CIgACCAGCTGATC-S ^■ -biotin

where "[W,W,W,C]Q" represents the sequence of an oUgonucleotide tag of nine subunits of four nucleotides each and "[W,W,W,C]" represents the subunit sequences listed above, i.e. "W" represents T or A. The underlined sequences identify an optional restriction endonuclease site that can be used to release the polynucleotide from attachment to a solid phase support via the biotin, if one is employed. For the above primer, the complement attached to a microparticle could have the form:

5 ' - [G , W, W, W] 9TGG-linker-micrc.partic.le

After reverse transcription, the mRΝA is removed, e.g. by RΝase H digestion, and the second strand of the cDΝA is synthesized using, for example, a primer of the foUowing form:

5 ' -ΝRRGATCYΝΝΝ-3 '

where N is any one of A, T, G, or C; R is a purine-containing nucleotide, and Y is a pyrimidine-containing nucleotide. This particular primer creates a Bst Y I restriction site in the resulting double stranded DNA which, together with the Sal I site, facilitates cloning into a vector with, for example. Bam HI and Xho I sites. After Bst YI and Sal I digestion, the exemplary conjugate would have the form:

5 ' -RCGACCA[C,W.W,W]9GG[T] ₁₉- cDNA -NNNR

GGT[G,W,W, ]9CC[A]₁9- rDNA - NNYCTAG-5 ' Preferably, when the ligase-based method of sequencing is employed, the Bst YI and Sal I digested fragments are cloned into a Bam HI-/Xho I-digested vector having the following single-copy restriction sites

5 ' -GAGGATGCCTTTATGGATCCACTCGAGATC AAT CA-3 '

Fokl BamHI Xhol

This adds the Fok I site which will allow initiation of the sequencing process discussed more fully below A general method for exposing the single stranded tag after amplificauon involves digesting a target polynucleotide-containing conjugate with the 5'→3' exonuclease activity of T4 DNA polymerase, or a like enzyme When used in the presence of a single nucleoside triphosphate, such a polymerase will cleave nucleotides from 3' recessed ends present on the non-template strand of a double stranded fragment until a complement of the single nucleoside triphosphate is reached on the template strand When such a nucleotide is reached the 5'—>3' digesuon effectively ceases, as the polymerase's extension acuvity adds nucleotides at a higher rate than the excision activity removes nucleotides Consequently, tags constructed with three nucleotides are readily prepared for loading onto solid phase supports The technique may also be used to preferentiaUy methylate inteπor Fok I sites of a target polynucleotide while leaving a single Fok I site at the termuius of the polynucleotide unmethylated First, the terminal Fok I site is rendered single stranded using a polymerase with deoxycytidine triphosphate The double stranded portion of the fragment is then methylated, after which the single stranded terminus is fiUed in with a DNA polymerase in the presence of all four nucleoside tπphosphates, thereby regenerating the Fok I site Clearly, this procedure can be generalized to endonucleases other than Fok I

After the ohgonucleoude tags are prepared for specific hybridization, e g by rendering them single stranded as described above, the polynucleotides are mixed with microparticles containing the complementary sequences of the tags under conditions that favor the formauon of perfectly matched duplexes between the tags and their complements There is extensive guidance in the literature for creating these conditions Exemplary references providing such guidance include Wetmur, Cπucal Reviews in Biochemistry and Molecular Biology, 26. 227-259 (1991 ). Sambrook et al, Molecular Cloning A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory, New York, 1989): and the like Preferably, the hybπdizauon condiuons are sufficiently stπngent so that only perfectly matched sequences form stable duplexes Under such conditions the polynucleotides specifically hybπdized through their tags are hgated to the complementary Exemplary references providing such guidance include Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26: 227-259 (1991), Sambrook et al, Molecular Cloning A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory, New York, 1989), and the like Preferably, the hybridization conditions are sufficiently stringent so that only perfectly matched sequences form stable duplexes Under such conditions the polynucleotides specifically hybridized through their tags are ligated to the complementary sequences attached to the microparticles. Finally, the microparticles are washed to remove unligated polynucleotides

When CPG microparticles conventionally employed as synthesis supports are used, the density of tag complements on the microparticle surface is typically greater than that necessary for some sequencing operations That is, in sequencing approaches that require successive treatment of the attached polynucleotides with a variety of enzymes, densely spaced polynucleotides may tend to inhibit access of the relatively bulky enzymes to the polynucleotides In such cases, the polynucleotides are preferably mixed with the microparticles so that tag complements are present in significant excess, e.g from 10 1 to 100.1, or greater, over the polynucleotides This ensures that the density of polynucleotides on the microparticle surface will not be so high as to inhibit enzyme access Preferably, the average inter-polynucleotide spacing on the microparticle surface is on the order of 30-100 nm Guidance in selecting ratios for standard CPG supports and Ballotini beads (a type of solid glass support) is found in Maskos and Southern, Nucleic Acids Research, 20 1679-1684 (1992) Preferably, for sequencing applications, standard CPG beads of diameter in the range of 20-50 μm are loaded with about 10-5 polynucleotides, and GMA beads of diameter in the range of 5-10 μm are loaded with a few tens of thousand polynucleotide, e g 4 x 10^ to 6 x 10^ The above method may be used to fingerprint mRNA populations when coupled with the parallel sequencing methodology described below Partial sequence information is obtained simultaneously from a large sample, e.g ten to a hundred thousand, of cDNAs attached to separate microparticles as described in the above method The frequency distribution of partial sequences can identify mRNA populations from different cell or tissue types, as well as from diseased tissues, such as cancers Such mRNA fingeφrints are useful in monitoring and diagnosing disease states, e g International application PCT US95/21944, which describes the use of express sequence tags (ESTs) for the same purpose

Single Base DNA Sequencing

The present invention can be employed with conventional methods of DNA sequencing, e g as disclosed by Hultman et al. Nucleic Acids Research, 17 4937-4946 ( 1 89) However, for parallel, or simultaneous, sequencing of multiple polynucleotides, a following references: Cheeseman, U.S. patent 5,302,509; Tsien et al, International application WO 91/06678; Rosenthal et al, International application WO 93/21340; Canard et al, Gene, 148: 1-6 (1994); and Metzker et al. Nucleic Acids Research, 22: 4259-4267 ( 1994). A "single base" method of DNA sequencing which is suitable for use with the present invention and which requires no electrophoretic separation of DNA fragments is described in International application PCT/US95/03678. The method comprises the following steps: (a) ligating a probe to an end of the polynucleotide having a protruding strand to form a ligated complex, the probe having a complementary protruding strand to that of the polynucleotide and the probe having a nuclease recognition site; (b) removing unligated probe from the ligated complex; (c) identifying one or more nucleotides in the protruding strand of the polynucleotide by the identity of the ligated probe; (d) cleaving the ligated complex with a nuclease; and (e) repeating steps (a) through (d) until the nucleotide sequence of the polynucleotide is determined. As is described more fully below, identifying the one or more nucleotides can be carried out either before or after cleavage of the tigated complex from the target polynucleotide. Preferably, whenever natural protein endonucleases are employed, the method further includes a step of methylating the target polynucleotide at the start of a sequencing operation. An important feature of the method is the probe ligated to the target polynucleotide. A preferred form of the probes is illustrated in Figure la. Generally, the probes are double stranded DNA with a protruding strand at one end 10. The probes contain at least one nuclease recognition site 12 and a spacer region 14 between the recognition site and the protruding end 10. Preferably, probes also include a label 16, which in this particular embodiment is illustrated at the end opposite of the protruding strand. The probes may be labeled by a variety of means and at a variety of locations, the only restriction being that the labeling means selected does not interfere with the ligation step or with the recognition of the probe by the nuclease.

It is not critical whether protruding strand 10 of the probe is a 5' or 3' end. However, it is important that the protruding strands of the target polynucleotide and probes be capable of forming perfectly matched duplexes to allow for specific ligation. If the protruding strands of the target polynucleotide and probe are different lengths the resulting gap can be filled in by a polymerase prior to ligation, e.g. as in "gap LCR" disclosed in Backman et al. European patent application 91 100959.5. Preferably, the number of nucleotides in the respective protruding strands are the same so that both strands of the probe and target polynucleotide are capable of being ligated without a filting step. Preferably, the protruding strand of the probe is from 2 to 6 nucleotides long. As indicated below, the greater the length of the protruding strand, the greater the complexity of the probe mixture that is applied to the target polynucleotide during each ligation and cleavage cycle.

The complementary strands of the probes are conveniently synthesized on an automated DNA synthesizer, e.g. an Applied Biosystems, Inc. (Foster City, California) model 392 or 394 DNA/RNA Synthesizer, using standard chemistries. After synthesis, the complementary strands are combined to form a double stranded probe. Generally, the protruding strand of a probe is synthesized as a mixture, so that every possible sequence is represented in the protruding portion. For example, if the protruding portion consisted of four nucleotides, in one embodiment four mixtures are prepared as follows:

XχX₂ . . . Xi NNA,

X1.X2 ^• .. XiNNNC, x_λx₂ . .. XiNNNG, and x_λx₂ . . X^NNNT

where the "NNNs" represent every possible 3-mer and the "Xs" represent the duplex forming portion of the strand. Thus, each of the four probes listed above contains 4- or 64 distinct sequences; or, in other words, each of the four probes has a degeneracy of 64. For example, X jX2 ••• XjNNNA contains the following sequences:

x_λx₂ . . XiAAAA ^xl^x2 .. X^AACA x_±x₂ .. XiAAGA x_±x₂ .. X^AATA x_λx₂ .. XiACAA

x_λx₂ . . X^TGTA x_λx₂ . . XiTTAA

XχX₂ . . X-j_TTCA

XχX₂ . . X.j_TTGA

XχX-2 . . XiTTT Such mixtures are readily synthesized using well known techniques, e.g. as disclosed in Telenius et al (cited above). GeneraUy, these techniques simply call for the application of mixtures of the activated monomers to the growing oligonucleotide during the coupling steps where one desires to introduce the degeneracy. In some embodiments it may be desirable to reduce the degeneracy of the probes. This can be accomplished using degeneracy reducing analogs, such as deoxyinosine, 2-aminopurine, or the like, e.g. as taught in Kong Thoo Lin et al, Nucleic Acids Research, 20: 5149-5152, or by U.S. patent 5,002,867.

Preferably, for oUgonucleotides with phosphodiester linkages, the duplex forming region of a probe is between about 12 to about 30 basepairs in length; more preferably, its length is between about 15 to about 25 basepairs.

When conventional ligases are employed in the invention, as described more fuUy below, the 5' end of the probe may be phosphorylated in some embodiments. A 5' monophosphate can be attached to a second oligonucleotide either chemicaUy or enzymatically with a kinase, e.g. Sambrook et al (cited above). Chemical phosphorylation is described by Horn and Urdea, Tetrahedron Lett., 27: 4705 (1986), and reagents for carrying out the disclosed protocols are commercially available, e.g. 5' Phosphate-ON^M from Clontech Laboratories (Palo Alto, California). Thus, in some embodiments, probes may have the form:

5 ' ~X X ■ ■ ■ XiTTGA Y!Y₂ ... Y_iP

where the Y's are the complementary nucleotides of the X's and "p" is a monophosphate group.

The above probes can be labeled in a variety of ways, including the direct or indirect attachment of radioactive moieties, fluorescent moieties, colorimetric moieties, chemiluminescent markers, and the tike. Many comprehensive reviews of methodologies for labeling DNA and constructing DNA probes provide guidance applicable to constructing probes of the present invention. Such reviews include Kricka, editor, Nonisotopic DNA Probe Techniques (Academic Press, San Diego, 1992); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, 1992); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993): and Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press. Oxford, 1991 ): Kessler, editor, Nonradioactive Labeling and Detection of Biomolecules (Springer- Verlag, Berlin, 1992); Wetmur (cited above); and the like. Preferably, the probes are labeled with one or more fluorescent dyes, e.g. as disclosed by Menchen et al, U.S. patent 5, 188,934; Begot et al International application PCT/US90/05565. In accordance with the method, a probe is ligated to an end of a target polynucleotide to form a ligated complex in each cycle of Ugation and cleavage. The ligated complex is the double stranded structure formed after the protruding strands of the target polynucleotide and probe anneal and at least one pair of the identically oriented strands of the probe and target are ligated, i.e. are caused to be covalently linked to one another. Ligation can be accomplished either enzymatically or chemically. Chemical Ugation methods are well known in the art, e.g. Ferris et al, Nucleosides & Nucleotides, 8: 407-414 (1989); Shabarova et al, Nucleic Acids Research, 19: 4247-4251 (1991); and ώe like. Preferably, however, ligation is carried out enzymatically using a Ugase in a standard protocol. Many ligases are known and are suitable for use in the invention, e.g. Lehman, Science, 186: 790-797 (1974); Engler et al, DNA Ligases, pages 3-30 in Boyer, editor, The Enzymes, Vol. 15B (Academic Press, New York, 1982); and the tike. Preferred ligases include T4 DNA Ugase, T7 DNA Ugase, E. coli DNA Ugase, Taq ligase, Pfu ligase, and Tth ligase. Protocols for their use are weU known, e.g. Sambrook et al (cited above); Barany, PCR Methods and Applications, 1 : 5- 16 ( 1991 ); Marsh et al, Strategies, 5: 73-76 (1992); and the like. Generally, ligases require that a 5' phosphate group be present for Ugation to the 3' hydroxyl of an abutting strand. This is conveniently provided for at least one strand of the target polynucleotide by selecting a nuclease which leaves a 5' phosphate, e.g. as Fok I. In an embodiment of the sequencing method employing unphosphorylated probes, the step of ligating includes (i) ligating the probe to the target polynucleotide with a ligase so that a ligated complex is formed having a nick on one strand, (ii) phosphorylating the 5' hydroxyl at the nick with a kinase using conventional protocols, e.g. Sambrook et al (cited above), and (iii) ligating again to covalently join the strands at the nick, i.e. to remove the nick.

Apparatus for Observing Enzvmatic Processes and/or Binding Events at Microparticle Surfaces An objective of the invention is to sort identical molecules, particularly polynucleotides, onto the surfaces of microparticles by the specific hybridization of tags and their complements. Once such sorting has taken place, the presence of the molecules or operations performed on them can be detected in a number of ways depending on the nature of the tagged molecule, whether microparticles are detected separately or in "batches," whether repeated measurements are desired, and the like. TypicaUy, the sorted molecules are exposed to ligands for binding, e.g. in drug development, or are subjected chemical or enzymatic processes, e.g. in polynucleotide sequencing. In both of these uses it is often desirable to simultaneously observe signals corresponding to such events or processes on large numbers of microparticles. Microparticles carrying sorted molecules (referred to herein as "loaded" microparticles) lend themselves to such large scale paraUel operations, e.g. as demonstrated by Lam et al (cited above).

Preferably, whenever tight-generating signals, e.g. chemiluminescent, fluorescent, or the like, are employed to detect events or processes, loaded microparticles are spread on a planar substrate, e.g. a glass slide, for examination with a scanning system, such as described in International patent applications PCT/US91/09217, PCT/NL90/00081 , and PCT/US95/01886. The scanning system should be able to reproducibly scan the substrate and to define the positions of each microparticle in a predetermined region by way of a coordinate system. In polynucleotide sequencing applications, it is important that the positional identification of microparticles be repeatable in successive scan steps. Such scanning systems may be constructed from commercially available components, e.g. x-y translation table controlled by a digital computer used with a detection system comprising one or more photomultiplier tubes, or alternatively, a CCD array, and appropriate optics, e.g. for exciting, coUecting, and sorting fluorescent signals. In some embodiments a confocal optical system may be desirable. An exemplary scanning system suitable for use in four-color sequencing is iUustrated diagrammatically in Figure 5. Substrate 300, e.g. a microscope slide with fixed microparticles, is placed on x-y translation table 302, which is connected to and controlled by an appropriately programmed digital computer 304 which may be any of a variety of commercially available personal computers, e.g. 486-based machines or PowerPC model 7100 or 8100 available form Apple Computer (Cupertino, CA). Computer software for table translation and data collection functions can be provided by commercially available laboratory software, such as Lab Windows, available from National Instruments.

Substrate 300 and table 302 are operationally associated with microscope 306 having one or more objective lenses 308 which are capable of collecting and deUvering light to microparticles fixed to substrate 300. Excitation beam 310 from light source 312, which is preferably a laser, is directed to beam splitter 314, e.g. a dichroic mirror, which re-directs the beam through microscope 306 and objective lens 308 which, in turn, focuses the beam onto substrate 300. Lens 308 collects fluorescence 316 emitted from the microparticles and directs it through beam splitter 314 to signal distribution optics 318 which, in turn, directs fluorescence to one or more suitable opto-electronic devices for converting some fluorescence characteristic, e.g. intensity, lifetime, or the like, to an electrical signal. Signal distribution optics 318 may comprise a variety of components standard in the art. such as bandpass filters, fiber optics, rotating mirrors, fixed position mirrors and lenses, diffraction gratings, and the like. As illustrated in Figure 5, signal distribution optics 318 directs fluorescence 316 to four separate photomultiplier tubes, 330, 332. 334, and 336. whose output is then directed to pre-amps and photon counters 350, 352, 354, and 356. The output of the photon counters is collected by computer 304, where it can be stored, analyzed, and viewed on video 360. Alternatively, signal distribution optics 318 could be a diffraction grating which directs fluorescent signal 318 onto a CCD array.

The stability and reproducibiUty of the positional localization in scanning will determine, to a large extent, the resolution for separating closely spaced microparticles. Preferably, the scanning systems should be capable of resolving closely spaced microparticles, e.g. separated by a particle diameter or less. Thus, for most applications, e.g. using CPG microparticles, the scanning system should at least have the capabitity of resolving objects on the order of 10-100 μm. Even higher resolution may be desirable in some embodiments, but with increase resolution, the time required to fully scan a substrate will increase; thus, in some embodiments a compromise may have to be made between speed and resolution. Increases in scanning time can be achieved by a system which only scans positions where microparticles are known to be located, e.g from an initial full scan. Preferably, microparticle size and scanning system resolution are selected to permit resolution of fluorescently labeled microparticles randomly disposed on a plane at a density between about ten thousand to one hundred thousand microparticles per cm-2.

In sequencing applications, loaded microparticles can be fixed to the surface of a substrate in variety of ways. The fixation should be strong enough to allow the microparticles to undergo successive cycles of reagent exposure and washing without significant loss. When the substrate is glass, its surface may be derivatized with an alkylamino linker using commercially available reagents, e.g. Pierce Chemical, which in turn may be cross-Unked to avidin, again using conventional chemistries, to form an avidinated surface. Biotin moieties can be introduced to the loaded microparticles in a number of ways. For example, a fraction, e.g. 10- 15 percent, of the cloning vectors used to attach tags to polynucleotides are engineered to contain a unique restriction site

(providing sticky ends on digestion) immediately adjacent to the polynucleotide insert at an end of the polynucleotide opposite of the tag. The site is excised with the polynucleotide and tag for loading onto microparticles. After loading, about 10-15 percent of the loaded polynucleotides will possess the unique restriction site distal from the microparticle surface. After digestion with the associated restriction endonuclease, an appropriate double stranded adaptor containing a biotin moiety is ligated to the sticky end. The resulting microparticles are then spread on the avidinated glass surface where they become fixed via the biotin-avidin linkages.

Alternatively and preferably when sequencing by ligation is employed, in the initial Ugation step a mixture of probes is applied to the loaded microparticle: a fraction of the probes contain a type IIs restriction recognition site, as required by the sequencing method, and a fraction of the probes have no such recognition site, but instead contain a biotin moiety at its non-ligating end. Preferably, the mixture comprises about 10- 15 percent of the biotinylated probe.

In stiU another alternative, when DNA-loaded microparticles are apptied to a glass substrate, the DNA may nonspecifically adsorb to the glass surface upon several hours, e.g. 24 hours, incubation to create a bond sufficiently strong to permit repeated exposures to reagents and washes without significant loss of microparticles. Preferably, such a glass substrate is a flow ceU, which may comprise a channel etched in a glass sUde. Preferably, such a channel is closed so that fluids may be pumped through it and has a depth sufficiently close to the diameter of the microparticles so that a monolayer of microparticles is trapped within a defined observation region.

Parallel Sequencing The tagging system of the invention can be used with single base sequencing methods to sequence polynucleotides up to several kilobases in length. The tagging system permits many thousands of fragments of a target polynucleotide to be sorted onto one or more solid phase supports and sequenced simultaneously. In accordance with a preferred implementation of the method, a portion of each sorted fragment is sequenced in a stepwise fashion on each of the many thousands of loaded microparticles which are fixed to a common substrate— such as a microscope slide— associated with a scanning system or an image analysis system, such as described above. The size of the portion of the fragments sequenced depends of several factors, such as the number of fragments generated and sorted, the length of the target polynucleotide, the speed and accuracy of the single base method employed, the number of microparticles and/or discrete regions that may be monitored simultaneously; and the like. Preferably, from 12-50 bases are identified at each microparticle or region; and more preferably. 18-30 bases are identified at each microparticle or region. With this information, the sequence of the target polynucleotide is determined by collating the 12-50 base fragments via their overlapping regions, e.g. as described in U.S. patent 5,002,867. The following references provide additional guidance in determining the portion of the fragments that must be sequenced for successful reconstruction of a target polynucleotide of a given length: Lander and

Waterman, Genomics, 2: 231-239 (1988); Drmanac et al, Genomics, 4: 1 14- 128 (1989); Bains, DNA Sequencing and Mapping, 4: 143- 150 ( 1993); Bains, Genomics, 1 1 : 294-301 (1991): Drmanac et al, J. Biomolecular Structure and Dynamics. 8: 1085-1 102 (1991); and Pevzner. J. Biomolecular Structure and Dynamics, 7: 63-73 ( 1989). Preferably, the length of the target polynucleotide is between 1 kilobase and 50 kilobases. More preferably, the length is between 10 kilobases and 40 kilobases. Lander and Waterman (cited above) provide guidance concerning the relationship among the number of fragments that are sequenced (i.e. the sample size), the amount of sequence information obtained from each fragment, and the probabitity that the target polynucleotide can be reconstructed from the partial sequences without gaps, or "islands." For the present invention, maximal polynucleotide sizes that can be obtained for given sample sizes and sizes of fragment sequences are shown below:

Size of Sample Approx. maximal target polynucleotide length

30 bases/fragment 50 bases/fragment

1,000 3 kilobases 4 kilobases

10,000 22 kilobases 32 kilobases

20.000 40 kilobases 65 kilobases

30,000 60 kilobases 85 kilobases

100.000 180 kilobases 300 kilobases

Fragments may be generated from a target polynucleotide in a variety of ways, including so-called "directed" approaches where one attempts to generate sets of fragments covering the target polynucleotide with minimal overlap, and so-caUed

"shotgun" approaches where randomly overlapping fragments are generated. Preferably, "shotgun" approaches to fragment generation are employed because of their simpticity and inherent redundancy. For example, randomly overlapping fragments that cover a target polynucleotide are generated in the following conventional "shotgun" sequencing protocol, e.g. as disclosed in Sambrook et al (cited above). As used herein, "cover" in this context means that every portion of the target polynucleotide sequence is represented in each size range, e.g. all fragments between 100 and 200 basepairs in length, of the generated fragments. Briefly, starting with a target polynucleotide as an insert in an appropriate cloning vector, e.g. λ phage, the vector is expanded, purified and digested with the appropriate restriction enzymes to yield about 10- 15 μg of purified insert. TypicaUy, the protocol results in about 500-1000 subclones per microgram of starting DNA. The insert is separated from the vector fragments by preparative gel electrophoresis, removed from the gel by conventional methods, and resuspended in a standard buffer, such as TE (Tris-EDTA). The restriction enzymes selected to excise the insert from the vector preferably leave compatible sticky ends on the insert, so that the insert can be self-ligated in preparation for generating randomly overlapping fragments. As explained in Sambrook et al (cited above), the circularized DNA yields a better random distribution of fragments than linear DNA in the fragmentation methods employed below. After self-Ugating the insert, e.g. with T4 ligase using conventional protocols, the purified ligated insert is fragmented by a standard protocol, e.g. sonication or DNase I digestion in the presence of Mn⁺⁺ After fragmentation the ends of the fragments are repair, e.g. as described in Sambrook et al (cited above), and the repaired fragments are separated by size using gel electrophoresis. Fragments in the 300-500 basepair range are selected and eluted from the gel by conventional means, and ligated into a tag-carrying vector as descπbed above to form a library of tag-fragment conjugates

As described above, a sample containing several thousand tag-fragment conjugates are taken from the library and expanded, after which the tag-fragment inserts are excised from the vector and prepared for specific hybridization to the tag complements on microparticles, as described above Depending of the size of the target polynucleotide, multiple samples may be taken from the tag-fragment library and separately expanded, loaded onto microparticles and sequenced. The number of doubles selected will depend on the fraction of the tag repertoire represented in a sample (The probability of obtaining triples— three different polynucleotides with the same tag- or above can safely be ignored) As mentioned above, the probability of doubles in a sample can be estimated from the Poisson distribution p(double)=m2e^~m/2, where m is the fraction of the tag repertoire in the sample Table V below lists probabiUties of obtaining doubles in a sample for given tag size, sample size, and repertoire diversity

Table V

Number of Fraction of words in tag from Size of tag Size of repertoire Probability of

8 word set repertoire sample sampled double 2 1 x 10⁶ 3000 1 4 x 10- ^"* U ⁵

1 68 x 10⁷ 3 x 10⁴ 1 78 x 10" 1 6 x 10^"6 3000 1 78 x 10"⁴ 1 6 x 10'⁸

1 34 x 108 χ 10⁵ 2 24 x 10-^ 2 5 x 10^"6 3 x 10⁴ 2 24 x 10-⁴ 2 5 x 10"⁸

10 1 07 x 10⁹ x 10⁶ 2 8 x 10^ 3 9 x 10^"6 3 x 10⁵ 2 8 x 10^"4 3 9 x 10^"8

In any case, the loaded microparticles are then dispersed and fixed onto a glass microscope slide, preferably via an avidin-biotin coupling Preferably, at least 15-20 nucleotides of each of the random fragments are simultaneously sequenced with a single base method The sequence of the target polynucleotide is then reconstructed by collating the partial sequences of the random fragments by way of their overlapping portions, using algorithms similar to those used for assembling contigs, or as developed for sequencing by hybridization, disclosed in the above references Kits for Implementing the Method of the Invention The invention includes kits for carrying out the various embodiments of the invention. Preferably, kits of the invention include a repertoire of tag complements attached to a solid phase support. AdditionaUy, kits of the invention may include the corresponding repertoire of tags, e.g. as primers for amptifying the polynucleotides to be sorted or as elements of cloning vectors which can also be used to amplify the polynucleotides to be sorted. Preferably, the repertoire of tag complements are attached to microparticles. Kits may also contain appropriate buffers for enzymatic processing, detection chemistries, e.g. fluorescent or chemiluminescent tags, and the tike, instructions for use, processing enzymes, such as ligases, polymerases, transferases, and so on. In an important embodiment for sequencing, kits may also include substrates, such as a avidinated microscope slides, for fixing loaded microparticles for processing.

Identification of Novel Polynucleotides in cDNA Libraries

Novel polynucleotides in a cDNA library can be identified by constructing a library of cDNA molecules attached to microparticles, as described above. A large fraction of the tibrary, or even the entire library, can then be partially sequenced in paraUel. After isolation of mRNA, and perhaps normalization of the population as taught by Soares et al, Proc. Natl. Acad. Sci., 91 : 9228-9232 (1994), or like references, the following primer may by hybridized to the polyA tails for first strand synthesis with a reverse transcriptase using conventional protocols:

5 ' -mRNA- [A] _n -3 ' [T] i9- [primer site ] -GG [W, W, W, C] ₉ACCAGCTGATC-5 '

where [W,W,W,C]Q represents a tag as described above, "ACCAGCTGATC" is an optional sequence forming a restriction site in double stranded form, and "primer site" is a sequence common to all members of the tibrary that is later used as a primer binding site for amplifying polynucleotides of interest by PCR.

After reverse transcription and second strand synthesis by conventional techniques, the double stranded fragments are inserted into a cloning vector as described above and amplified. The amplified library is then sampled and the sample amplified. The cloning vectors from the amplified sample are isolated, and the tagged cDNA fragments excised and purified. After rendering the tag single stranded with a polymerase as described above, the fragments are methylated and sorted onto microparticles in accordance with the invention. Preferably, as described above, the cloning vector is constructed so that the tagged cDNAs can be excised with an endonuclease, such as Fok I. that will allow immediate sequencing by the preferred single base method after sorting and ligation to microparticles.

Stepwise sequencing is then carried out simultaneously on the whole library, or one or more large fractions of the library, in accordance with the invention until a sufficient number of nucleotides are identified on each cDNA for unique representation in the genome of the organism from which the library is derived. For example, if the tibrary is derived from mammatian mRNA then a randomly selected sequence 14-15 nucleotides long is expected to have unique representation among the 2-3 thousand megabases of the typical mammalian genome. Of course identification of far fewer nucleotides would be sufficient for unique representation in a library derived from bacteria, or other lower organisms. Preferably, at least 20-30 nucleotides are identified to ensure unique representation and to permit construction of a suitable primer as described below. The tabulated sequences may then be compared to known sequences to identify unique cDNAs. Unique cDNAs are then isolated by conventional techniques, e.g. constructing a probe from the PCR amplicon produced with primers directed to the prime site and the portion of the cDNA whose sequence was determined. The probe may then be used to identify the cDNA in a tibrary using a conventional screening protocol.

Example I

Sorting Multiple Target Polynucleotides Derived from pUC19 A mixture of three target polynucleotide-tag conjugates are obtained as follows: First, the following six oligonucleotides are synthesized and combined pairwise to form tag 1, tag 2. and tag 3:

5 ' -pTCGACC(wι) ( ) ( 3 ) (W4) (W5) (wg) (W7) (wg) ( -j_)A

GG(**) (**} (**) (**) (**) (**) (**) (**) (**)TTCGAp-5' Tag 1

5 ' -pTCGACC(ws) (W7) (wg) (w-j_. (w ) (wg) (W4) ( ₂) ( *j_)A

GG(**) (**) (**) (**) (**) (**) (**) (**) (**)TTCGAp-5'

Tag 2

5 ' -pTCGACC( 3 ) (w ) ( -j_) (w-j ( 5) (wg) (wg) (W4) (W4.A GG (**) (**) (**) (**) (**) (**) (**) (**) (**) TTCGAp- 5 '

Tag 3 where "p" indicates a monophosphate, the WJ'S represent the subunits define in Table I, and the terms "(**)" represent their respective complements. A pUC19 is digested with Sal I and Hind ID, the large fragment is purified, and separately tigated with tags 1, 2, and 3, to form pUC19- l, pUC19-2, and pUC19-3, respectively. The three recombinants are separately amplified and isolated, after which pUC 19- 1 is digested with Hind III and Aat I, pUC19-2 is digested with Hind III and Ssp I, and pUC19-3 is digested with Hind HI and Xmn I. The small fragments are isolated using conventional protocols to give three double stranded fragments about 250, 375, and 575 basepairs in length, respectively, and each having a recessed 3' strand adjacent to the tag and a blunt or 3' protruding strand at the opposite end. Approximately 12 nmoles of each fragment are mixed with 5 units T4 DNA polymerase in the manufacturer's recommended reaction buffer containing 33 μM deoxycytosine triphosphate. The reaction mixture is allowed to incubate at 37°C for 30 minutes, after which the reaction is stopped by placing on ice. The fragments are then purified by conventional means. CPG microparticles (37-74 mm particle size, 500 angstrom pore size, Pierce

Chemical) are derivatized with the linker disclosed by Maskos and Southern, Nucleic Acids Research, 20: 1679-1684 (1992). After separating into three aliquots, the complements of tags 1, 2, and 3 are synthesized on the microparticles using a conventional automated DNA synthesizer, e.g. a model 392 DNA synthesizer (Applied Biosystems, Foster City, CA). Approximately 1 mg of each of the differently derivatized microparticles are placed in separate vessels.

The T4 DNA polymerase-treated fragments excised from pUC19-l, -2, and -3 are resuspended in 50 μL of the manufacturer's recommended buffer for Taq DNA ligase (New England Biolabs). The mixture is then equally divided among the three vessels containing the 1 mg each of derivatized CPG microparticles. 5 units of Taq DNA ligase is added to each vessel, after which they are incubated at 55°C for 15 minutes. The reaction is stopped by placing on ice and the microparticles are washed several times by repeated centrifugation and resuspension in TE. Finally, the microparticles are resuspended in Nde I reaction buffer (New England Biolabs) where the attached polynucleotides are digested. After separation from the microparticles the polynucleotide fragments released by Nde I digestion are fluorescently labeled by incubating with Sequenase DNA polymerase and fluorescein labeled thymidine triphosphate (Applied Biosystems, Foster City, CA). The fragments are then separately analyzed on a nondenaturing polyacrylamide gel using an Applied Biosystems model 373 DNA sequencer. Example II

Parallel Sequencing of SV40 Fragments A repertoire of 36-mer tags consisting of nine 4-nucleotide subunits selected from Table I is prepared by separately synthesizing tags and tag complements by a spht and mix approach, as descπbed above The repertoire is synthesized so as to permit Ugation into a Sma I/Hind in digested M13mpl9 Thus, as in Example I, one set of otigonucleotides beguis with the addition of A fotiowed by nine rounds of split and mix synthesis wherein the oligonucleotide is extended subunit-wise by 3'-phosphoramιdιte deπvatived 4-mers corresponding to the subunits of Table I The synthesis is then completed with the nucleotide-by-nucleotide addition of one half of the Sma I recognition site (GGG), two C's, and a 5'-monophosphate, e.g via the Phosphate-ON reagent available from Clontech Laboratories (Palo Alto, CA) The other set of oligonucleotides begins with the addition of three C's (portion of the Sma I recognition site) and two G's, followed by nine rounds of split and mix synthesis wherein the oligonucleotide is extended by 3'-phosphoramιdιte derivatized 4-mers corresponding to the complements of the subunits of Table I Synthesis is completed by the nucleotide-by-nucleotide add on of the Hind III recognition site and a 5 '-monophosphate After separation from the synthesis supports the oligonucleotides are mixed under conditions that permit formation of the foUowing duplexes'

5 ' -pGGGCC tw-_L ) (w ) ( W-_L ) ( W ) ( W_X ) (w_x ) ( W- (w-j_ ) ( W-J A

CCCGG ( * * ) ( * * ) ( * * ) ( * * ) ( * * ) ( * * ) ( * * ) ( * * ) ( * * ) TTCGAp-5 '

The mixture of duplexes is then ligated into a Sma I/Hind Ill-digested M 13mp 19 A repertoire of tag complements are synthesized on CPG microparticles as descπbed above Next the following adaptor is prepared which contains a Fok I site and portions of Eco Rl and Sma I sites

5 ' -pAATTCGGATGATGCATGCATCGACCC GCCTACTACGTACGTAGCTGGGD-5 '

Eco Rl Fok I Sma I

The adaptor is ligated into the Eco Rl/Sma I digested M 13 described above Separately, SV40 DNA is fragmented by sonication following the protocol set forth in Sambrook et al (cited above) The resulting fragments are repaired using standard protocols and separated by size Fragments in the range of 300-500 basepairs are selected and ligated into the Sma I digested M 13 descπbed above to form a library of fragment-tag conjugates, which is then amplified A sample containing several thousand different fragment-tag conjugates is taken from the library, further ampUfied, and the fragment-tag inserts are excised by digesting with Eco Rl and Hind III. The excised fragment-tag conjugates are treated with T4 DNA polymerase in the presence of deoxycytidine triphosphate, as described in Example I, to expose the oUgonucleotide tags for specific hybridization to the CPG microparticles.

After hybridization and ligation, as described in Example I, the loaded microparticles are treated with Fok I to produce a 4-nucleotide protruding strand of a predetermined sequence. A 10: 1 mixture (probe 1 :probe 2) of the foUowing probes are ligated to the polynucleotides on microparticles.

Probe 1 FAM- ATCGGATGAC

TAGCCTACTGAGCT

Probe 2 biotin- ATCGGATGAC TAGCCTACTGAGCT

FAM represents a fluorescein dye attached to the 5'-hydroxyl of the top strand of Probe 1 through an aminophosphate tinker available from Applied Biosystems (Aminolinker). The biotin may also be attached through an Aminolinker moiety and optionally may be further extended via polyethylene oxide linkers, e.g. Jaschke et al (cited above).

The loaded microparticles are then deposited on the surface of an avidinated glass slide to which and from which reagents and wash solutions can be delivered and removed. The avidinated slide with the attached microparticles is examined with a scanning fluorescent microscope (e.g. .Zeiss Axioskop equipped with a Newport Model PM500-C motion controller, a Spectra-Physics Model 2020 argon ion laser producing a 488 nm excitation beam, and a 520 nm long-pass emission filter, or like apparatus). The excitation beam and fluorescent emissions are deUvered and collected, respectively, through the same objective lens. The excitation beam and collected fluorescence are separated by a dichroic mirror which directs the collected fluorescence through a series of bandpass filters and to photon-counting devices corresponding to the fluorophors being monitored, e.g. comprising Hamamatsu model 9403-02 photomultipliers, a Stanford Research Systems model SR445 amplifier and model SR430 multichannel sealer, and digital computer, e.g. a 486-based computer. The computer generates a two dimensional map of the slide which registers the positions of the microparticles. After cleavage with Fok I to remove the initial probe, the polynucleotides on the attached microparticles undergo 20 cycles of probe ligation, washing, detection, cleavage, and washing, in accordance with the preferred single base sequencing methodology described below. Within each detection step, the scanning system records the fluorescent emission corresponding the base identified at each microparticle. Reactions and washes below are generaUy carried out with manufacturer's (New England Biolabs') recommended buffers for the enzymes employed, unless otherwise indicated. Standard buffers are also described in Sambrook et al (cited above).

The following four sets of mixed probes are provided for addition to the target polynucleotides:

TAMRA- ATCGGATGACATCAAC

TAGCCTACTGTAGTTGANNN FAM- ATCGGATGACATCAAC

TAGCCTACTGTAGTTGCNNN

ROX- ATCGGATGACATCAAC

TAGCCTACTGTAGTTGGNNN

JOE- ATCGGATGACATCAAC

TAGCCTACTGTAGTTGTNNN

where TAMRA, FAM, ROX, and JOE are spectrally resolvable fluorescent labels attached by way of Aminolinker II (all being available from AppUed Biosystems, Inc., Foster City, California); the bold faced nucleotides are the recognition site for Fok I endonuclease, and "N" represents any one of the four nucleotides, A, C, G, T. TAMRA (tetramethyhhodamine), FAM (fluorescein), ROX (rhodamine X), and JOE (2',7'- dimethoxy-4',5'-dichlorofluorescein) and their attachment to oligonucleotides is also described in Fung et al, U.S. patent 4,855,225.

The above probes are incubated in approximately 5 molar excess of the target polynucleotide ends as follows: the probes are incubated for 60 minutes at 16°C with 200 units of T4 DNA ligase and the anchored target polynucleotide in T4 DNA Ugase buffer; after washing, the target polynucleotide is then incubated with 100 units T4 polynucleotide kinase in the manufacturer's recommended buffer for 30 minutes at 37°C. washed, and again incubated for 30 minutes at 16°C with 200 units of T4 DNA ligase and the anchored target polynucleotide in T4 DNA ligase buffer. Washing is accomplished by successively flowing volumes of wash buffer over the slide, e.g. TE, disclosed in Sambrook et al (cited above). After the cycle of ligation-phosphorylation-ligation and a final washing, the attached microparticles are scanned for the presence of fluorescent label, the positions and characteristics of which are recorded by the scanning system. The labeled target polynucleotide. i.e. the ligated complex, is then incubated with 10 units of Fok I in the manufacturer's recommended buffer for 30 minutes at 37°C, followed by washing in TE. As a result the target polynucleotide is shortened by one nucleotide on each strand and is ready for the next cycle of ligation and cleavage. The process is continued until twenty nucleotides are identified. APPENDIX I

Exemplary computer program for generating minimally cross hybridizing sets

Program minxh c c c integer*2 subl (6) ,msetl (1000, 6) ,mset2 (1000,6) dimension nbase(6) c c write (*, *) 'ENTER SUBUNIT LENGTH' read(*, 100)nsub 100 forma (il) open ( 1 , file= ' sub4.dat ' , form= ' formatted' , status= 'new' )

nset=0 do 7000 ml=1,3 do 7000 m2=l,3 do 7000 m3=l,3 do 7000 m4=l,: subl(l)=ml subl (2) =m2 subl(3)=m3 subl (4) =m4 c c ndiff=3 c c c Generate set of subunits differing from c subl by at least ndiff nucleotides. c Save in msetl . c c jj=l do 900 j=1 ,nsub 900 msetl (l,j)=subl(j) c c do 1000 kl=l,3 do 1000 k2=l,3 do 1000 k3=l,3 do 1000 k4=l,3 c c nbase (1) =kl nbase(2) =k2 nbase(3 ) =k3 nbase (4) =k4 n=0 do 1200 j =l , nsub if ( subl (j ) . eq . l .and. nbase("j) .ne.1 .or. 1 subl (j ) . eq .2 .and. nbase(j ) .ne.2 .or.

3 subl ( j ) . eq . 3 .and. nbase(3 ) .ne.3) then n=n+l endi f

1200 continue c c if (n.ge.ndiff) then c c c If number of mismatches c is greater than or equal c to ndiff then record c subunit in matrix mset c c do 1100 ι=l,nsub

1100 msetl (j j , 1)=nbase(1) endif c c

1000 continue c c

mset2 (1, j2)=msetl (1, j2)

1325 mset2 (2, j 2 )=msetl (2,32) c c c Compare subunit 2 from c msetl with each successive c subunit in msetl, i.e. 3, c 4,5, ... etc. Save those c with mismatches .ge. ndiff c in matrix mset2 starting at c position 2. c Next transfer contents c of mset2 into msetl and c start c comparisons again this time c starting with subunit 3. c Continue until all subunits c undergo the comparisons . c c npass=0 c c 1700 continue kk=npass+2 npass=npass+l

do 1500 m=npass+2, ^**; n=0 do 1600 j=l,nsub if (msetl (npass+1, j ) .eq.1.and.msetl (m, ) .ne.l.or. 2 msetl (npass+1, j ) .eq.2.and.msetl (m, ) .ne.2.or.

2 msetl (npass+1 , j ) .eq.3.and.msetl (m, j ) .ne.3 ) then n=n+l endif 1600 continue if (n.ge.ndiff) then kk=kk+l do 1625 i=l,nsub 1625 mset2 (kk, i)=msetl(m, i) endif 1500 continue c c kk is the number of subunits c stored in mset2 c c Transfer contents of mset2 c into msetl for next pass. c c do 2000 k=l,kk do 2000 m=l,nsub 2000 msetl (k,m)=mset2(k,m) if (kk.lt.jj ) then jj=kk goto 1700 endif c c nset=nset+l write(l,7009)

7009 format (/) do 7008 k=l,kk 7008 write(l,7010) (msetl(k,m) ,m=l,nsub)

7010 format(4il) write(*, *) write(*,120) kk,nset

120 ormat ( lx, ' Subunits in set= ' , i5, 2x, ' Set No=' ,i5) 7000 continue close(1) c c end SEQUENCE LISTING

(1) GENERAL INFORMATION.

(l) APPLICANT Sydney Brenner

(ii) TITLE OF INVENTION Molecular Tagging System

(ill) NUMBER OF SEQUENCES. 5

(IV) CORRESPONDENCE ADDRESS

(A) ADDRESSEE Stephen C Macevicz, Lynx Therapeutics, Inc

(B) STREET 3832 Bay Center Place

(C) CITY Hayward

(D) STATE California

(E) COUNTRY USA

(F) ZIP 94545

(v) COMPUTER READABLE FORM

(A) MEDIUM TYPE 3 5 inch diskette

(B) COMPUTER IBM compatible

(C) OPERATING SYSTEM Windows 3 1/DOS 5 0

(D) SOFTWARE Microsoft Word for Windows, vers 2 0

(VI) CURRENT APPLICATION DATA

(A) APPLICATION NUMBER.

(B) FILING DATE

(C) CLASSIFICATION

(VII) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER 08/322,348

(B) FILING DATE 13-OCT-94

(Vll) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER 08/358,810

(B) FILING DATE 19-DEC-94

(viii) ATTORNEY/AGENT INFORMATION

(A) NAME Stephen C Macevicz

(B) REGISTRATION NUMBER 30,285

(C) REFERENCE/DOCKET NUMBER cbd3wo

(IX) TELECOMMUNICATION INFORMATION

(A) TELEPHONE (510) 670-9365

(B) TELEFAX (510) 670-9302

(2) INFORMATION FOR SEQ ID NO 1

(1) SEQUENCE CHARACTERISTICS

(A) LENGTH 38 nucleotides

(B) TYPE nucleic acid

(C) STRANDEDNESS single

(D) TOPOLOGY linear (XI) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

GAGGATGCCT TTATGGATCC ACTCGAGATC CCAATCCA 38

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

AATTCGGATG ATGCATGCAT CGACCC 26

(2) INFORMATION FOR SEQ ID NO: 3:

(1) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

TAGCCTACTG AGCT 14

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 4:

ATCGGATGAC ATCAAC 16

(2) INFORMATION FOR SEQ ID NO : 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 nucleotides

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear (Xi) SEQUENCE DESCRIPTION: SEQ ID NO : 5:

ACCAGCTGAT C 11

Claims

I claim:

1. A method of sorting a molecule or subpopulation of molecules from a population of molecules, the method comprising the steps of: (a) attaching an oligonucleotide tag from a repertoire of tags to each molecule in a population of molecules (i) such that substantially all the same molecules or same subpopulation of molecules in the population have the same oligonucleotide tag attached and substantially all different molecules or different subpopulations of molecules in the population have different oligonucleotide tags attached and (ii) such that each oligonucleotide tag from the repertoire comprises a plurality of subunits and each subunit of the plurality consists of an oligonucleotide having a length from three to six nucleotides or from three to six basepairs, the subunits being selected from a minimally cross- hybridizing set; and

(b) sorting the molecules or subpopulations of molecules from the population by speciflcally hybridizing the oligonucleotide tags with their respective complements.

2. The method of claim 1 wherein said molecule or said subpopulation of molecules is a polynucleotide or a subpopulation of polynucleotides.

3. The method of claim 2 wherein said complements of said oligonucleotide tags are attached to a solid phase support.

4. The method of claim 3 wherein said solid phase support is a microparticle having attached thereto a uniform population of said complements.

5. The method of claim 4 wherein said oligonucleotide tag and said complement are single stranded oligonucleotides.

6. The method of claim 5 wherein said polynucleotide or subpopulation of polynucleotides have a length in the range of from 50 to 5000 nucleotides.

7. The method of claim 5 wherein said microparticle is selected from the group consisting of glass microparticles, magnetic beads, glycidal methacrylate microparticles, and polystyrene microparticles.

8. The method of claim 7 wherein said microparticle diameter of between 1 and 100 μm.

9. The method of claim 3 wherein said solid phase support is a planar substrate having a plurality of spatially discrete surface regions having attached thereto uniform populations of said complements.

10. The method of claim 9 wherein different said spatially discrete surface regions of said plurality have uniform populations of different said complements.

11. The method of claim 10 wherein said planar substrate is selected from the group consisting of glass, silicon, and plastic.

12. The method of clai 1 wherein said molecule or said subpopulation of molecules is a polypeptide or a subpopulation of polypeptides.

13. The method of claim 12 wherein said complements of said oligonucleotide tags are attached to a solid phase support.

14. The method of claim 13 wherein said oligonucleotide and said complement are single stranded oligonucleotides.

15. The method of claim 14 wherein said solid phase support is a microparticle having attached thereto a uniform population of said complements.

16. The method of claim 15 wherein said microparticle is selected from the group consisting ol glass microparticles, magnetic beads, and polystyrene microparticles.

17. The method of claim 16 wherein said solid phase support is a planar substrate having a plurality of spatially discrete surface regions having uniform populations of said complements attached thereto.

18. The method o claim 17 wherein different said spatially discrete surface regions of said plurality have uniform populations of different said complements.

19. The method of claim 18 wherein said planar substrate is selected from the group consisting of glass, silicon, and plastic.

20. The method of claim 1 wherein said molecule or said subpopulation of molecules is a linear polymer of the form: (M-L)_n-

wherein:

L is a phosphorus (V) linking moiety; M is a a straight chain, cyclic, or branched organic molecular structure containing from 1 to

20 carbon atoms and from 0 to 10 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur; and n is in the range of from 3 to 100.

21. The method of claim 20 wherein M is alkyl, alkoxy, alkenyl, or aryl containing from 1 to 16 carbon atoms, or a heterocycle having from 3 to 8 carbon atoms and from 1 to 3 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur.

22. The method of claim 21 wherein said complements of said oligonucleotide tags are attached to a solid phase support.

23. The method of claim 22 wherein said solid phase support is a microparticle having attached thereto a uniform population of said complements.

24. The method of claim 23 wherein said microparticle is selected from the group consisting of glass microparticles, magnetic beads, and polystyrene microparticles.

25. The method of claim 22 wherein said solid phase support is a planar substrate having a plurality of discrete non -overlapping surface regions that have attached therein uniform populations of said complements of said oligonucleotide tags.

26. The method of claim 25 wherein different said spatially discrete surface regions of said plurality have uniform populations of different said complements.

27. A method for determining the nucleotide sequence of a target polynucleotide, the method comprising the steps of: generating from the target polynucleotide a plurality of fragments that cover the target polynucleotide: attaching an oligonucleotide tag from a repertoire of tags to each fragment of the plurality (i) such that substantially all the same fragments have the same oligonucleotide tag attached and substantially all different fragments have different oligonucleotide tags attached and (ii) such that each oligonucleotide tag from the repertoire comprises a plurality of subunits and each subunit of the plurality consists of an oligonucleotide having a length from three to six nucleotides or from three to six basepairs, the subunits being selected from a minimally cross-hybridizing set; sorting the fragments by specifically hybridizing the oligonucleotide tags with their respective complements; determining the nucleotide sequence of a portion of each of the fragments of the plurality; and determining the nucleotide sequence of the target polynucleotide by collating the sequences of the fragments.

28. The method of claim 27 wherein said complements of said oligonucleotide tags are attached to a solid phase support.

29. The method of claim 28 wherein said oligonucleotide tags and said complements are single stranded oligonucleotides.

30. The method of claim 29 wherein said step of generating produces randomly overlapping fragments of said target pol nucleotide.

31. The method of claim 30 wherein said step of determining said nucleotide sequence of said fragments are carried out simultaneously for said plurality of fragments by a single base sequencing method.

32. The method of claim 31 wherein said portions of each of said fragments includes from 12 to 50 nucleotides.

33. The method of claim 32 wherein said portion of each of said fragments includes from 12 to 25 nucleotides.

34. The method of claim 33 wherein said target polynucleotide is between one and fifty kilobases in length.

35. The method of claim 28 wherein said solid phase support is a plurality of microparticles each having attached thereto a uniform population of said complements.

36. The method of claim 35 wherein after said step of sorting said plurality of microparticles are fixed lo a planar substrate.

37. The method of claim 36 wherein said plurality of microparticles are disposed randomly on the surface of said planar substrate at a density of between about 1000 microparticles to about 100 thousand microparticles per square centimeter.

38. A composition of matter comprising: a solid phase support having one or more spatially discrete regions; and a uniform population of oligonucleotide tag complements covalently attached to the solid phase support in at least one of the one or more spatially discrete regions, the oligonucleotide tag complements comprising a plurality of subunits, each subunit consisting of an oligonucleotide having a length from three to six nucleotides and each subunit being selected from a minimally cross- hybridizing set.

39. The composition of matter of claim 38 wherein said plurality of said subunits is in the range of from 4 to 10.

40. The composition of matter of claim 39 wherein said solid phase support is a microparticle having a single spatially discrete region.

41. The composition of matter of claim 40 wherein said microparticle is selected from the group consisting of glass microparticles, magnetic beads, and polystyrene microparticles.

42. A method of classifying a population of polynucleotides, the method comprising the steps of: attaching an oligonucleotide tag to each polynucleotide of the population, (i) such that substantially all of the same polynucleotides have the same oligonucleotide tag attached and substantially all different polynucleotides have different oligonucleotide tags attached and (ii) such that each oligonucleotide tag comprises a plurality of subunits and each subunit of the plurality consists of an oligonucleotide having a length from three to six nucleotides, the subunits being selected from a minimally cross-hybridizing set; sorting the polynucleotides by specifically hybridizing the oligonucleotide tags with their respective complements; determining the nucleotide sequence of a portion of each of the sorted polynucleotides; and classifying the population of polynucleotides by the frequency distribution of the portions of sequences of the polynucleotides.

43. The method of claim 42 wherein said complements of said oligonucleotide tags are covalently attached to a solid phase support.

44. The method of claim 43 wherein said solid phase support is a microparticle and wherein a uniform population of said complements is attached to each said microparticle.

45. The method of claim 44 wherein said population of polynucleotides is a cDN A library.

46. The method of claim 45 wherein said portion of said polynucleotides is in the range of from 12 to 50 nucleotides.

47. The method of claim 46 wherein said portion of said polynucleotides is in the range of from 12 to 25 nucleotides.

48. A repertoire of oligonucleotide tags, the repertoire being selected from the group consisting of oligonucleotides of the form:

^S1^S2^S3 - ^sn

wherein each of S i through S_n are subunits consisting of an oligonucleotide having a length from three to six nucleotides and being selected from a minimally cross-hybridizing set; and n is in the range of from 4 to 10.

49. The repertoire of claim 48 wherein said subunits consist of an oligonucleotide having a length from four to five nucleotides and wherein n is in the range of from 6 to 9.

50. A repertoire of cloning vectors for attaching oligonucleotide tags to polynucleotides, the repertoire having a double stranded element of the form:

S1S2S ... S_n wherein each of S 1 through S_n are subunits consisting of an oligonucleotide having a length from three to six nucleotides and being selected from a minimally cross-hybridizing set; and n is in the range of from 4 to 10.

51. The repertoire of claim 50 wherein said double stranded element is adjacent to a polylinker region containing one or more restriction endonuclease cleavage sites for inserting said polynucleotides into said cloning vector.

52. A method of sorting a mixture of polynucleotides, the method comprising the steps of: providing a solution containing a mixture of polynucleotides, each polynucleotide of the mixture having attached an oligonucleotide tag from a repertoire of tags, each oligonucleotide tag from the repertoire comprising a plurality of subunits and each subunit of the plurality consisting of an oligonucleotide having a length from three to six nucleotides, the subunits being selected from a minimally cross-hybridizing set; sampling the mixture of polynucleotides to form a subpopulation of polynucleotides where substantially all polynucleotides of the same sequence have the same oligonucleotide tag attached and substantially all polynucleotides of different sequences have different oligonucleotide tags attached; and contacting the subpopulation with one or more solid phase supports having attached thereto the complements of the oligonucleotide tags under conditions that promote the formation of perfectly matched duplexes between the oligonucleotide tags and their respective complements.

53. The method of claim 52 wherein said solid phase support is a microparticle having attached thereto a uniform population of said complements.

54. The method of claim 53 wherein said oligonucleotide tag and said complement are single stranded oligonucleotides.

5 . The method of claim 54 wherein said polynucleotides have lengths in the range of from 50 to 5000 nucleotides.

56. The method of claim 55 wherein said microparticle is selected from the group consisting of glass microparticles, magnetic beads, glycidal methacrylate microparticles, and polystyrene microparticles.

57. The method of claim 56 wherein said solid phase support is a planar substrate having a plurality of spatially discrete surface regions having uniform populations of said complements attached thereto.

58. The method of claim 57 wherein different said spatially discrete surface regions of said plurality have uniform populations of different said complements.

59. A method of generating a single stranded segment of a predetermined length on an end of a double stranded DNA, the method comprising the steps of: providing a 5' strand of an end of the double stranded DNA such that the 5' strand is composed of nucleotides selected from a first group consisting of three or fewer kinds of nucleotide and such tiiat the predetermined length of the 5' strand is defined by the presence at its 3' end of a second nucleotide of a kind not present in the first group; and exposing the end of the double stranded DNA to T4 DNA polymerase in the presence of nucleoside triphosphates of the second nucleotide. 60 A method of detecting novel cDNA molecules in a cDNA tibrary, the method comprising the steps of forming a cDNA tibrary from a population of mRNA molecules, each cDNA molecule in the cDNA tibrary having an oligonucleotide tag attached, (i) such that substantially all of ϋie same cDNA molecules have ϋie same oUgonucleotide tag attached and substantially all different cDNA molecules have different oligonucleotide tags attached and (u) such that each oUgonucleotide tag compnses a plurality of subunits and each subunit of ϋie plurality consists of an oligonucleotide having a length from three to six nucleoudes, the subunits being selected from a minimally cross- hybridizing set, sorting the cDNA molecules by specifically hybridizing ϋie oligonucleotide tags with their respective complements, determining the nucleotide sequence of a portion of each of the sorted cDNA molecules, and identifying novel cDNA molecules by comparing ϋie nucleotide sequences of the portions ol the sorted cDN A molecules with ϋie sequences of known cDN A molecules

61 The method of claim 60 wherein said complements of said oligonucleotide tags are covalently attached to a solid phase support

62 The method of claim 61 wherein said sobd phase support is a microparticle and wherein a uniform populaϋon of said complements is attached to each said microparticle

63 The method of claim 62 wherein said portion of said cDN A molecules is in the range of from 12 to 50 nucleoudes

64 The method of claim 63 wherein said portion of said cDN A molecules is in the range oi from 12 to 25 nucleotides