WO1997010253A1 - A high throughput assay using fusion proteins - Google Patents
A high throughput assay using fusion proteins Download PDFInfo
- Publication number
- WO1997010253A1 WO1997010253A1 PCT/US1996/014567 US9614567W WO9710253A1 WO 1997010253 A1 WO1997010253 A1 WO 1997010253A1 US 9614567 W US9614567 W US 9614567W WO 9710253 A1 WO9710253 A1 WO 9710253A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fusion protein
- recited
- protein
- expression vector
- binding
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/94—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
- G01N33/9493—Immunosupressants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- Src homology 2 (SH2) domains are a family of homologous protein domains that share the common property of recognizing phosphorylated tyrosine residues in specific peptide contexts. They have routinely been expressed in E. coli as fusion proteins with glutathione-S-transferase (GST). This usually provides high level expression and straightforward affinity purification on glutathione- Sepharose. Ligand binding is then assayed by incubating the GST/SH2 with a radiolabeled phosphopeptide, precipitating the complex with glutathione-Sepharose, washing the beads, and then counting the beads to determine bound radioactivity [Isakov et al., J. Exp.
- the protocol requires separation of bound complex from free phosphopeptide by washing of the glutathione-Sepharose beads. This is a nonequilibrium procedure that risks dissociation of the bound ligand, particularly when off-rates are fast. Thus, there is the possibility of misleading results. Finally, due to the number of manipulations and centrifugations involved, the protocol is very tedious to conduct manually and is not readily adaptable to robotic automation to increase throughput.
- the instant invention covers a method of screening for compounds capable of binding to a fusion protein which comprises combining a test compound, a tagged ligand, a fusion protein (target protein, peptide linker and FK506-binding protein), and a radiolabeled ligand in a coated microscintillation plate, and then measuring the scintillation counts attributable to the binding of the tagged ligand to the fusion protein in the presence of the test compound relative to a control assay in the absence of the test compound, so as to determine the effect the test compound has on the binding of the tagged ligand.
- Also within die scope of this invention are the processes for preparing and expressing the recombinant DNA encoding a fusion protein.
- This invention further relates to the recombinant DNA expression vector capable of expressing the fusion protein.
- This invention further relates to a process for purifying the recombinant fusion protein.
- This invention provides an immediate means of making use of microscintillation plate technology for the functional assay of ligand binding to a single or multiple signal transduction domain(s), for example a phosphopeptide binding to an SH2 domain.
- the present invention does not require specialized radiochemical synthesis and is readily adaptable to robotic automation for high capacity screening for agonists, antagonists, and/or inhibitors. BRIEF DESCRIPTION OF THE FIGURES Figure 1.
- the present invention relates to a method of screening for compounds which preferentially bind to a target protein.
- An embodiment of this invention is a method of screening for compounds capable of binding to a fusion protein which comprises the steps of: a) mixing a test compound, a tagged ligand, the fusion protein, and a radiolabeled ligand; b) adding the mixture to a coated microscintillation plate; c) incubating the mixture for between about 1 hour and about 24 hours; d) measuring the plate-bound counts attributable to the binding of the tagged ligand to the fusion protein in the presence of the test compound using scintillation counting; and e) determining the binding of the tagged ligand to the fusion protein in the presence of the test compound relative to a control assay run in the absence of the test compound.
- a second embodiment of this invention is a process for preparing a recombinant DNA expression vector encoding for a fusion protein comprising the steps of: a) removing the stop codon on DNA encoding for an FK506- binding protein; b) synthesizing a modified DNA fragment on the DNA encoding for the FK506-binding protein which encodes for a peptide linker; c) digesting an expression vector at cloning sites; d) cloning the modified DNA fragment encoding for the FK506- binding protein with a peptide linker into the digested expression vector to generate a recombinant DNA expression vector encoding for FK506-binding protein with a peptide linker; and e) cloning DNA encoding for a target protein into a recombinant
- DNA expression vector encoding for FK506-binding protein with a peptide linker to produce the recombinant DNA expression vector encoding for the fusion protein.
- a third embodiment of this invention is a process for expressing recombinant DNA encoding for a fusion protein in an expression vector comprising the steps of: a) transforming a host cell with the fusion protein expression vector; b) inducing expression of the fusion protein in the host cell; c) recovering the fusion protein from the host cell; and d) purifying the fusion protein.
- a fourth embodiment of this invention is a process for purifying an isolated FKBP-SH2 fusion protein, comprising the steps of: a) preparing an affinity matrix consisting of biotinylated phosphopeptide coupled to avidin or streptavidin immobilized on a solid support; b) preparing a freeze/thaw extract from cells expressing the fusion protein; c) loading the extract onto the affinity matrix and washing off unbound protein; and d) eluting the desired fusion protein with phenyl phosphate.
- fusion protein refers to a "target protein” fused to an "FK506-binding protein” (FKBP), the two proteins being separated by a "peptide linker".
- a “peptide linker” may consist of a sequence containing from about 1 to about 20 amino acids, which may or may not include the sequence for a protease cleavage site.
- An example of a peptide linker which is a protease cleavage site is represented by the amino acid sequence GLPRGS.
- target protein refers to any protein that has a defined ligand. Included within this definition of target protein are single and multiple signal transduction domains, such as, but not limited to, Src homology 1 (SHI), Src homology 2 (SH2), Src homology 3 (SH3), and pleckstrin homology (PH) domains [Hanks & Hunter,
- SHI domain refers to a family of homologous protein domains that bind ATP and catalyze tyrosine phosphorylation of peptide and protein substrates.
- SH2 domain refers to a family of homologous protein domains that share the common property of recognizing phosphorylated tyrosine residues in specific peptide contexts.
- SH3 domain refers to a family of homologous protein domains that share the common property of recognizing polyproline type II helices.
- PH domain refers to a family of homologous protein domains that mediate both protein-protein and protein-lipid interactions.
- SH2 domains which may be utilized in the method of the invention include, but are not limited to, the single and tandem SH2 domains present in the tyrosine kinases ZAP, SYK and LCK.
- the DNA sequences were obtained from GenBank, National Center for Biotechnology Information, National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894. The Accession Numbers for the sequences are: human ZAP (L05148); human SYK (L28824) and human LCK (X I 3529).
- tagged ligand refers to a biotinylated or epitope tagged ligand for the target protein.
- radiolabeled ligand refers to a H]-, [125j]_ [ 14 C ]., [35s]-, [32p]_, or [33 P ]_ labe led ligand which binds to the FKBP.
- An example of a radiolabeled ligand useful in the instant invention is [3H]-dihydroFK506.
- coated microscintillation plates refers to streptavidin-coated microscintillation plates when the tagged ligand is biotinylated, and to anti-epitope antibody bound to anti-antibody-coated or protein A-coated microscintillation plates when the tagged ligand is epitope-tagged.
- coated microscintillation plates useful in the instant invention are streptavidin-coated, sheep anti-rabbit-coated, and goat anti-mouse-coated FlashPlate Plus (DuPont-NEN). Additional coatings, including but not limited to protein A, may be applied to uncoated FlashPlates by methods known to those skilled in the art.
- control assay refers to the assay when performed in the presence of the tagged ligand, the fusion protein, the radiolabeled ligand and the coated microscintillation plates, but in the absence of the test compound.
- FK506-binding proteins may include, but are not limited to, the below listed FKBPs and FKBP homologues, which include a citation to the references which disclose them. This list is not intended to limit the scope of the invention.
- host cells include, but are not limited to, bacteria, yeast, bluegreen algae, plant cells, insect cells and animal cells.
- Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned copies of genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express genes in a variety of host cells, such as, bacteria, yeast, bluegreen algae, plant cells, insect cells and animal cells.
- An appropriately constructed expression vector may contain: an origin of replication for autonomous replication in host cells, selectable markers, a limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters.
- a promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis.
- a strong promoter is one which causes mRNAs to be initiated at high frequency.
- Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.
- vectors suitable for FKBP fusion protein expression include, but are not limited to pBR322 (Promega), pGEX (Amersham), pT7 (USB), pET (Novagen), pIBI (IB I), pProEX-1 (Gibco/BRL), pBluescript II (Stratagene), pTZ18R and pTZ19R (USB), pSE420 (Invitrogen), pVL1392 (Invitrogen), pBlueBac (Invitrogen), pBAcPAK (Clontech), pHIL (Invitrogen), pYES2 (Invitrogen), pCDNA (Invitrogen), pREP (Invitrogen) or the like.
- the expression vector may be introduced into host cells via any one of a number of techinques including but not limited to transformation, transfection, infection, protoplast fusion, and electroporation.
- E. coli containing an expression plasmid with the target gene fused to FKBP are grown and appropriately induced. The cells are then pelleted and resuspended in a suitable buffer.
- FKBP- 12 lacks sequences that specifically direct it to the periplasm, FKBP fusions are primarily located there and can be released by a standard freeze/thaw treatment of the cell pellet. Following centrifugation, the resulting supernatant contains >80% pure FKBP fusion, which if desired can be purified further by conventional methods. Altematively, the assay is not dependent on pure protein and the initial periplasmic preparation may be used directly.
- a t-hrombin site located between FKBP and the target protein can be used as a means to cleave FKBP from the fusion; such cleaved material may be a suitable negative control for subsequent assays.
- a fusion protein which contains a single or multiple SH2 domain(s) may be purified by preparing an affinity matrix consisting of biotinylated phosphopeptide coupled to avidin or streptavidin immobilized on a solid support. A freeze/thaw extract is prepared from the cells which express the fusion protein and is loaded onto the affinity matrix. The desired fusion protein is then specifically eluted with phenyl phosphate.
- the tagged ligand is mixed with the FKBP fusion protein in a suitable buffer in the presence of the radiolabeled ligand. After a suitable incubation period to allow complex formation to occur, the mixture is transferred to a coated microscintillation plate to capture the tagged ligand and any bound fusion protein. The plate is sealed, incubated for a sufficient period to allow the capture to go to completion, then counted in a multiwell scintillation counter.
- Screening for agonists/antagonists/inhibitors is carried out by performing the initial incubation prior to the capture step in the microscintillation plate in the presence of a test compound(s) to determine whether they have an effect upon the binding of the tagged ligand to the fusion protein. This principle is illustrated in Figure 1.
- the PCR reaction contained the following primers :5'- GATCGCCATGGGAGTGCAGGTGGAAACCATCTCCCCA-3' and 5 - TACGAATTCTGGCGTGGATCCACGCGGAACCAGACCTTCCAGT TTTAG-3' and a plasmid containing human FKBP-12 as the template.
- the resulting 367 base pair amplification product was ligated into the vector pCRII (Invitrogen) and the ligation mixture transformed into competent Escherichia coli cells. Clones containing an insert were identified using PCR with flanking vector primers. Dideoxy DNA sequencing confirmed the nucleotide sequence of one positive isolate.
- the altered 338 base pair FKBP fragment was excised from the pCRII plasmid using Ncol and BamHI and ligated into Ncol and/f ⁇ mHI digested pET9d (Novagen) plasmid. Competent E. coli were transformed with the ligation mixture, and colonies containing the insert were identified using PCR with primers encoding for flanking vector sequences.
- the FKBP fusion cloning vector is called pET9dFKBPt.
- ZAP-70 was prepared by PCR to contain a BamHI site at the 5 '-end such that the reading frame was conserved with that of FKBP in the fusion vector. At the 3'-end, the fragment also inco ⁇ orated a stop codon followed by a BamHI site.
- the PCR reaction contained Molt-4 cDNA (Clontech) and the following primers:
- the expression vector for the tandem SH2 domains of Syk fused to FKBP was prepared as in Example 2 except that the PCR reaction contained Raji cell cDNA (Clontech) and the following primers: 5 -CAATAGGATCCATGGCCAGCAGCGGCATGGCTGA-3' and 5 -GACCTAGGATCCCTAATTAACATTTCCCTGTGTGCCGAT- 3 * .
- the expression vector for the SH2 domain of Lck fused to FKBP was prepared as in Example 2 except that the PCR reaction contained Molt-4 cDNA (Clontech) and the following primers:
- Step A Process for Expression of FK-ZAP
- E. coli BL21 (DE3) cells containing the pET9dFKBPt/ ZapSH2 plasmid were grown in Luria-Bertani (LB) media containing 50 microgram/ml kanamycin at about 37 degrees C until the optical density measured at 600 nm was about 0.5-1.0.
- Expression of the FK-ZAP fusion protein was induced with 0.1 mM isopropyl beta- thiogalactopyranoside and the cells were grown for another 3-5 hr at about 30 degrees C.
- Step B Process for Purification of FK-ZAP
- the affinity matrix for purification of FK-ZAP was prepared by combining agarose-immobilized avidin with excess biotinylated phosphopeptide derived from the ⁇ l ITAM sequence of the human T-cell receptor, biotinyl-GSNQLpYNELNLGRREEpYDVLDK, and washing out unbound peptide. Frozen cells containing FK-ZAP were thawed in warm water, refrozen on dry ice for about 25 min., then thawed again.
- SykSH2 plasmid were grown, induced, and harvested as described in Example 5.
- FK-SYK was purified using the same affinity matrix and methodology described in Example 5.
- E. coli BL21 (DE3) cells containing the pET9dFKBPt/ LckSH2 plasmid were grown, induced, and harvested as described in Example 5.
- the affinity matrix for purification of FK-LCK was prepared by combining agarose-immobilized avidin with excess biotinyl- EPQpYEEIPIYL, and washing out unbound peptide. The remaining methodology for purification was the same as Example 5.
- Assays were conducted at ambient temperature in a buffer consisting of 25 mM HEPES, 10 mM DTT, 0.01 % TWEEN-20, pH 7.0. 300 ⁇ l of a mixture of buffer and varying amounts of biotinyl- phosphopeptide were combined with 25 ⁇ l of FK-ZAP protein and 50 ⁇ l of [3H]-dihydroFK506 (DuPont NEN) in microfuge tubes. A 150 ⁇ l portion of each assay was then transferred to the well of a streptavidin- coated FlashPlate Plus (DuPont-NEN) and an additional 50 ⁇ l of buffer was added. Final concentrations of the assay components were:
- Assays are conducted at ambient temperature in a buffer consisting of 25 mM HEPES, 10 mM DTT, 0.01 % TWEEN-20, pH 7.0. 10 ⁇ l of a DMSO solution of test compound(s) and 120 ⁇ l of biotinyl- phosphopeptide stock solution are dispensed into the wells of a standard 96-well plate. Next, 20 ⁇ l of a mixture of FK-ZAP protein and [ 3 H]-dihydroFK506 (DuPont NEN) are added to each test well. The assays are then transferred to the wells of a streptavidin-coated FlashPlate (DuPont NEN). Final concentrations of the assay components are: 25 nM biotinyl-GSNQLpYNELNLGRREEpYDVLDK
- the assays are conducted as set forth in Example 9, except that FK-SYK replaces FK-ZAP.
- the assays are conducted as set forth in Example 9, except that FK-LCK replaces FK-ZAP and the tagged ligand is 25 nM biotinyl-EPQpYEEIPIYL.
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- GAGCCCGAAC CCTGGTTCTT CAAGAACCTG AGCCGCAAGG ACGCGGAGCG GCAGCTCCTG 420
- ATCCGTAATC TGGACAACGG TGGCTTCTAC ATCTCCCCTC GAATCACTTT TCCCGGCCTG 600
Abstract
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP96935808A EP0871648A1 (en) | 1995-09-15 | 1996-09-11 | A high throughput assay using fusion proteins |
JP9512071A JPH11513246A (en) | 1995-09-15 | 1996-09-11 | High-throughput assays using fusion proteins |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US381995P | 1995-09-15 | 1995-09-15 | |
US60/003,819 | 1995-09-15 | ||
GB9605210.5 | 1996-03-12 | ||
GBGB9605210.5A GB9605210D0 (en) | 1996-03-12 | 1996-03-12 | A high throughput assay using fusion proteins |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1997010253A1 true WO1997010253A1 (en) | 1997-03-20 |
Family
ID=26308918
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1996/014567 WO1997010253A1 (en) | 1995-09-15 | 1996-09-11 | A high throughput assay using fusion proteins |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0871648A1 (en) |
JP (1) | JPH11513246A (en) |
CA (1) | CA2231330A1 (en) |
WO (1) | WO1997010253A1 (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997039326A2 (en) * | 1996-04-18 | 1997-10-23 | Ariad Pharmaceuticals, Inc. | In vitro fluorescence polarization assay |
EP1516928A1 (en) * | 2002-06-25 | 2005-03-23 | Sekisui Chemical Co., Ltd. | Expression vector, host, fused protein, process for producing fused protein and process for producing protein |
US6962982B2 (en) | 2001-06-22 | 2005-11-08 | Roche Diagnostics Corporation | Soluble complexes of target proteins and peptidyl prolyl isomerase chaperones and methods of making and using them |
US7094757B2 (en) | 2001-06-22 | 2006-08-22 | Roche Diagnostics Corporation | Complexes comprising a prion protein and a peptidyl prolyl isomerase chaperone, and method for producing and using them |
US7947494B2 (en) | 2006-01-03 | 2011-05-24 | Roche Diagnostics Operations, Inc. | Fusion protein comprising an E. coli chaperone protein and a human chaperone protein |
WO2021080427A1 (en) * | 2019-10-23 | 2021-04-29 | Stichting Het Nederlands Kanker Instituut-Antoni van Leeuwenhoek Ziekenhuis | Chimeric polypeptide for regulating immune cells |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5352660A (en) * | 1991-10-31 | 1994-10-04 | Mount Sinai Hospital Corporation | Method for assaying for a substance that affects a SH2-phosphorylated ligand regulatory system |
US5434064A (en) * | 1991-01-18 | 1995-07-18 | New York University | Expression-cloning method for identifying target proteins for eukaryotic tyrosine kinases and novel target proteins |
US5464745A (en) * | 1993-03-31 | 1995-11-07 | Novagen, Inc. | Protein ligand binding region mapping system |
US5498597A (en) * | 1992-01-17 | 1996-03-12 | Dana-Farber Cancer Institute, Inc. | FKBP-13, an FK506-binding immunophilin |
US5534424A (en) * | 1992-05-12 | 1996-07-09 | Cemu Bioteknik Ab | Chemical method for the analysis of DNA sequences |
US5580979A (en) * | 1994-03-15 | 1996-12-03 | Trustees Of Tufts University | Phosphotyrosine peptidomimetics for inhibiting SH2 domain interactions |
-
1996
- 1996-09-11 CA CA 2231330 patent/CA2231330A1/en not_active Abandoned
- 1996-09-11 JP JP9512071A patent/JPH11513246A/en active Pending
- 1996-09-11 EP EP96935808A patent/EP0871648A1/en not_active Withdrawn
- 1996-09-11 WO PCT/US1996/014567 patent/WO1997010253A1/en not_active Application Discontinuation
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5434064A (en) * | 1991-01-18 | 1995-07-18 | New York University | Expression-cloning method for identifying target proteins for eukaryotic tyrosine kinases and novel target proteins |
US5352660A (en) * | 1991-10-31 | 1994-10-04 | Mount Sinai Hospital Corporation | Method for assaying for a substance that affects a SH2-phosphorylated ligand regulatory system |
US5498597A (en) * | 1992-01-17 | 1996-03-12 | Dana-Farber Cancer Institute, Inc. | FKBP-13, an FK506-binding immunophilin |
US5534424A (en) * | 1992-05-12 | 1996-07-09 | Cemu Bioteknik Ab | Chemical method for the analysis of DNA sequences |
US5464745A (en) * | 1993-03-31 | 1995-11-07 | Novagen, Inc. | Protein ligand binding region mapping system |
US5580979A (en) * | 1994-03-15 | 1996-12-03 | Trustees Of Tufts University | Phosphotyrosine peptidomimetics for inhibiting SH2 domain interactions |
Non-Patent Citations (4)
Title |
---|
ANALYTICAL BIOCHEMISTRY, 05 September 1996, Vol. 240, No. 2, SONATORE et al., "The Utility of FK506-Binding Protein as a Fusion Partner in Scintillation Proximity Assays: Application to SH2 Domains", pages 289-297. * |
METHODS IN ENZYMOLOGY, 1990, Vol. 185, STUDIER et al., "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes", pages 60-89. * |
THE JOURNAL OF BIOLOGICAL CHEMISTRY, 12 July 1996, Vol. 271, No. 28, MULLER et al., "Rapid Identification of Phosphopeptide Ligands for SH2 Domains: Screening of Peptide Libraries by Fluorescence-Activated Bead Sorting", pages 16500-16505. * |
THE JOURNAL OF BIOLOGICAL CHEMISTRY, 16 December 1994, Vol. 269, No. 50, GILMER et al., "Peptide Inhibitors of Src SH3-SH2-Phosphoprotein Interactions", pages 31711-31719. * |
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997039326A2 (en) * | 1996-04-18 | 1997-10-23 | Ariad Pharmaceuticals, Inc. | In vitro fluorescence polarization assay |
WO1997039326A3 (en) * | 1996-04-18 | 1997-12-24 | Ariad Pharma Inc | In vitro fluorescence polarization assay |
US6962982B2 (en) | 2001-06-22 | 2005-11-08 | Roche Diagnostics Corporation | Soluble complexes of target proteins and peptidyl prolyl isomerase chaperones and methods of making and using them |
US7094757B2 (en) | 2001-06-22 | 2006-08-22 | Roche Diagnostics Corporation | Complexes comprising a prion protein and a peptidyl prolyl isomerase chaperone, and method for producing and using them |
US7244575B2 (en) | 2001-06-22 | 2007-07-17 | Roche Diagnostics Corporation | Soluble complex comprising a retroviral surface glycoprotein |
EP1516928A1 (en) * | 2002-06-25 | 2005-03-23 | Sekisui Chemical Co., Ltd. | Expression vector, host, fused protein, process for producing fused protein and process for producing protein |
EP1516928A4 (en) * | 2002-06-25 | 2006-11-08 | Sekisui Chemical Co Ltd | Expression vector, host, fused protein, process for producing fused protein and process for producing protein |
US7947494B2 (en) | 2006-01-03 | 2011-05-24 | Roche Diagnostics Operations, Inc. | Fusion protein comprising an E. coli chaperone protein and a human chaperone protein |
US8247206B2 (en) | 2006-01-03 | 2012-08-21 | Roche Diagnostics Operations, Inc. | Fusion protein comprising an Escherichia coli chaperone protein and a human chaperone protein |
WO2021080427A1 (en) * | 2019-10-23 | 2021-04-29 | Stichting Het Nederlands Kanker Instituut-Antoni van Leeuwenhoek Ziekenhuis | Chimeric polypeptide for regulating immune cells |
Also Published As
Publication number | Publication date |
---|---|
EP0871648A1 (en) | 1998-10-21 |
JPH11513246A (en) | 1999-11-16 |
CA2231330A1 (en) | 1997-03-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5783398A (en) | High throughput assay using fusion proteins | |
Schweitzer et al. | Microarrays to characterize protein interactions on a whole‐proteome scale | |
AU725477B2 (en) | IKK-beta proteins, nucleic acids and methods | |
US5776696A (en) | High throughput assay using fusion proteins | |
EP0711303B1 (en) | Biotinylation of proteins | |
US6911311B2 (en) | Method of detecting protein-protein interactions | |
CA2419490C (en) | Functional protein arrays | |
US7960312B2 (en) | Method and agent for immobilizing protein via protein bound to silicon oxide-containing substance | |
US6610504B1 (en) | Methods of determining SAM-dependent methyltransferase activity using a mutant SAH hydrolase | |
WO2001062968A2 (en) | Mutant nucleic binding enzymes and use thereof in diagnostic, detection and purification methods | |
US20080213760A1 (en) | Compositions and methods for protein isolation | |
AU726294B2 (en) | Ikk-alpha proteins, nucleic acids and methods | |
WO1997010502A1 (en) | A high throughput assay using fusion proteins | |
WO1997010253A1 (en) | A high throughput assay using fusion proteins | |
EP0940470A2 (en) | A fusion protein and its use for the simultaneous detection of autoantibodies related to insulin-dependent diabetes mellitus | |
US20060105407A1 (en) | Protein chip for analyzing interaction between protein and substrate peptide thereof | |
Biggs et al. | Activation of the mitogen-activated protein kinase pathway in U937 leukemic cells induces phosphorylation of the amino terminus of the TATA-binding protein | |
WO1998041866A1 (en) | A high throughput assay using fusion proteins | |
US5874230A (en) | Assays using TRAF2-associated protein kinase polypeptides | |
US6960457B1 (en) | Reversible immobilization of arginine-tagged moieties on a silicate surface | |
US20100029507A1 (en) | The biochip for the detection of phosphorylation and the detection method using the same | |
US7029905B1 (en) | Method for the cellular high-throughput-detection of receptor ligand interactions | |
WO2000009678A1 (en) | Irak3 polypeptides, polynucleotides and methods | |
WO2008140538A1 (en) | Dna display screen for expression product with desired binding properties | |
Sonatore et al. | The utility of FK506-binding protein as a fusion partner in scintillation proximity assays: application to SH2 domains |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2231330 Country of ref document: CA Ref country code: CA Ref document number: 2231330 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1997 512071 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1996935808 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1996935808 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1996935808 Country of ref document: EP |