WO1997018225A1 - Salmonella secreted proteins and uses thereof - Google Patents

Salmonella secreted proteins and uses thereof Download PDF

Info

Publication number
WO1997018225A1
WO1997018225A1 PCT/US1996/018504 US9618504W WO9718225A1 WO 1997018225 A1 WO1997018225 A1 WO 1997018225A1 US 9618504 W US9618504 W US 9618504W WO 9718225 A1 WO9718225 A1 WO 9718225A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
ssp
seq
cell
gene
Prior art date
Application number
PCT/US1996/018504
Other languages
French (fr)
Inventor
Samuel I. Miller
Original Assignee
The General Hospital Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The General Hospital Corporation filed Critical The General Hospital Corporation
Priority to AU77383/96A priority Critical patent/AU7738396A/en
Priority to EP96940523A priority patent/EP0939761A4/en
Priority to US09/068,804 priority patent/US6861247B1/en
Publication of WO1997018225A1 publication Critical patent/WO1997018225A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/255—Salmonella (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to virulence factors of Salmonella typhimurium .
  • Salmonella typhimurium enter epithelial cells by a process termed bacterial-mediated endocytosis. S . typhimurium stimulates these normally nonphagocytic cells to undergo significant cytoskeletal rearrangements that are visualized as localized membrane ruffling adjacent to the bacteria. Bacteria are then internalized via membrane-bound vacuoles formed from the membrane ruffles.
  • S . typhimuriujn loci that are required for the induction of bacterial-mediated endocytosis (BME) by epithelial cells. Many of these epithelial-cell signaling loci have a similar chromosomal location, clustered within a 40 kb "virulence island" located between 59 and 60 minutes on the S . typhimurium chromosome (Mills et al., Mol . Microbiol . 15:749-759, 1995) . InvJ is a S . tymphimurium gene which is thought to encode a secreted protein necessary for BME (Collazo et al., Mol . Microbiol . 15:25-38, 1995).
  • the invention features a substantially pure DNA encoding a Salmonella secreted protein (Ssp) .
  • Salmonella secreted protein is meant a Saljnonella-derived protein, the secretion of which is dependent on the expression of PrgH.
  • the invention features substantially pure DNA encoding a Salmonella typhimurium secreted protein.
  • Salmonella typhimurium secreted protein is meant as Salmonella typhimurium derived protein, the secretion of which is dependent on the expression of PrgH.
  • One aspect of the invention features a substantially pure DNA molecule which includes the SspB gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 1, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 5.
  • the invention features a substantially pure DNA molecule which includes the SspC gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 2, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 6.
  • the invention features a substantially pure DNA molecule which includes the SspD gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 3, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 7.
  • the invention features a substantially pure DNA molecule which included the SspA gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 4, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 8.
  • the invention also features a substantially pure DNA molecule which includes the SspB, SspC, SspD, and SspA genes; preferably, the DNA includes the DNA sequence of SEQ ID NO: 15.
  • the invention also features a substantially pure DNA molecule which includes the SspH gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 13, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 14.
  • the invention also features a substantially pure DNA molecule which includes the Salmonella tyrosine phosphatase A (stpA) gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 10, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO:12.
  • stpA Salmonella tyrosine phosphatase A
  • the invention also features a cell into which has been introduced substantially pure DNA encoding an Ssp (or a mutant variant thereof) .
  • the substantially pure DNA can be introduced as a portion of a plasmid or other autonomously replicating molecule.
  • the substantially pure DNA can be introduced by homologous recombination.
  • the bacterial' cell is a Salmonella cell; more preferably the bacterial cell is a Salmonella typhimurium cell.
  • Cells into which have been introduced substantially pure DNA encoding an Ssp (or mutant variant thereof) can be used as a source of purified Ssp.
  • the invention includes a substantially pure SspC polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 6 or an active fragment thereof and a substantially pure SspD polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 7 or an active fragment thereof.
  • a substantially pure SspC polypeptide e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 6 or an active fragment thereof
  • a substantially pure SspD polypeptide e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 7 or an active fragment thereof.
  • the invention includes a substantially pure SspB polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 5 (incomplete protein sequence) or an active fragment thereof and a substantially pure SspA polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 8 (incomplete protein sequence) or an active fragment thereof.
  • the invention includes a substantially pure full-length SspB polypeptide, e.g. , a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 5 (incomplete protein sequence) and the remainder of the SspB sequence.
  • Full-length SspA and SspB genes can be isolated by those skilled in the art using the partial DNA sequences disclosed herein.
  • the invention also includes a substantially pure full-length SspA polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 8 (incomplete protein sequence) and the remainder of the SspA sequence.
  • an active fragment of an Ssp B polypeptide or an SspC polypeptide or an SspD polypeptide is defined as an SspB, SspC, or an SspD polypeptide, respectively, at least 50 amino acids, preferably at least 25 amino acids, more preferably at least 10 amino acids in length having the ability to induce BME in the absence of the full-length version of the corresponding protein.
  • the SspB, SspC, SspD or SspA polypeptide is able to translocate into an epithelial cell, preferably a human epithelial cell. Translocation can be assayed using any suitable assay, e.g., the assay of Sogy et al.
  • the invention also includes a substantially pure SspH polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO:14, or a biologically active fragment thereof.
  • the invention also includes a substantially pure SspH polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO:14, or a biologically active fragment thereof.
  • the invention also includes a substantially pure
  • IagB polypeptide e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO:11, or a biologically active fragment thereof.
  • an antibody which binds to a Ssp e.g. , a polyclonal or monoclonal antibody which specifically binds to an epitope of Ssp.
  • Polyclonal and monoclonal antibodies produced against the polypeptides of the invention can be used as diagnostic or therapeutic agents.
  • the invention encompasses not only an intact monoclonal antibody, but also an immunologically-active antibody fragment, e.g., a Fab or (Fab) 2 fragment; an engineered single chain Fv molecule.
  • the antibody may be linked to a detectable label, e.g. a radioactive label, fluorescent label, paramagnetic label, or colorimetric label.
  • the invention also includes a method of detecting a Salmonella infection in a mammal which includes the steps of contacting a biological sample derived from the mammal, e.g., a human patient, with a Ssp-specific antibody and detecting the binding of the antibody to a Ssp in the sample. Antibody binding indicates that the mammal is infected with Salmonella .
  • the presence of Salmonella in a biological sample may also be detected using a method which includes the steps of contacting the sample with a Ssp-encoding DNA, or the complement thereof, under high stringency conditions and detecting the hybridization of the DNA to nucleic acid in the sample. Hybridization indicates the presence of Salmonella in the biological sample.
  • high stringency DNA hybridization and wash conditions characterized by high temperature and low salt concentration, e.g. , wash conditions of 65°C at a salt concentration of approximately 0.1 x SSC.
  • high stringency conditions may include hybridization at about 42°C in the presence of about 50% formamide; a first wash at about 65°C with about 2 x SSC containing 1% SDS; followed by a second wash at about 65°C with about 0.1 x SSC.
  • the invention also features a method for detecting the presence of antibodies to an Ssp using all or part of an Ssp protein. The method includes contacting a biological sample with the Ssp protein and measuring the binding of the Ssp protein to an antibody present in the sample.
  • the invention also features a method of targeting an antigen to an epithelial cell in a mammal which includes the steps of linking the antigen to an Ssp, e.g., SspC or SspD, or active fragment thereof, to produce a Ssp chimeric antigen and administering the chimeric antigen to the mammal.
  • Ssp e.g., SspC or SspD, or active fragment thereof
  • a method of inducing a cytotoxic T cell immune response in a mammal includes the steps of linking the antigen to an Ssp or active fragment thereof to produce a Ssp chimeric antigen and contacting an antigen-presenting cell, e.g., a Class I major histocompatibility complex (MHC) antigen- expressing cell, with the chimeric antigen.
  • an antigen-presenting cell e.g., a Class I major histocompatibility complex (MHC) antigen- expressing cell
  • MHC major histocompatibility complex
  • the invention also features a vaccine which includes a bacterial cell, the virulence of which is attenuated by decreased secretion of a Ssp, and a method of vaccinating an mammal, e.g. , a human patient, against a Salmonella infection by administering such a vaccine.
  • the bacterial cell is a Salmonella typhimurium cell, e.g., a Salmonella enteriditis cell, or a Salmonella typhi cell.
  • a live Salmonella cell in which a gene encoding a heterologous antigen is inserted into a Ssp-encoding gene is also included in the invention.
  • a substantially pure StpA polypeptide and a method of dephosphorylating a protein which includes the steps of contacting the protein, e.g., a protein at least one tyrosine of which is phosphorylated, with a StpA polypeptide or an active fragment thereof.
  • An active fragment of StpA is defined as a Salmonella-derived polypeptide at least 10 amino acids in length which is capable of removing a phosphate group from a tyrosine residue.
  • the invention feature live Salmonella (particularly Salmonella typhimurium) vaccines in which one or more gene required for BME is mutated so as reduce their activity.
  • genes which can be mutated are SspB , SspC, and SspD.
  • SspA appears not to be required for BME, it may be useful to mutate this gene as well (preferably in combination with mutation of one or more of the other Ssp genes) . Any mutation of these genes which decreases function, including complete or partial deletion and one or more point mutations may be useful.
  • function of Ssp gene may be impaired by altering its control region.
  • the invention provides a Salmonella vaccine which does not cause transient bacteremia.
  • the invention features a bacterial cell, preferably a Salmonella cell, e.g., a S . typhi , S . enteritidis typhimurium, or S . cholerae-suis cell, the virulence of which is attenuated by a first mutation in an Ssp gene.
  • the preferred mutations are loss of function mutations. However, functions causing partial loss of function may be useful if virulence is adequately reduced.
  • Such a bacterial cell can be used as a vaccine to immunize a mammal against salmonellosis.
  • the Salmonella cell may be of any serotype, e.g., S . typhimurium, S . paratyphi A, S . paratyphi B , S . paratyphi C, S . pylorum, S . dublin , S . heidelberg, S . newport , S . minnesota , S . i fant is , S . virchow , or S . panama .
  • serotype e.g., S . typhimurium, S . paratyphi A, S . paratyphi B , S . paratyphi C, S . pylorum, S . dublin , S . heidelberg, S . newport , S . minnesota , S . i fant is , S . virchow , or S . panama .
  • the first mutation may be a non-revertible null mutation in one or more of the following genes: SspB, SspC, or SspD .
  • the mutation is a deletion of at least 100 nucleotides; more preferably, the mutation is a deletion of at least 500 nucleotides; even more preferably, the mutation is a deletion of at least 750 nucleotides. Mutations in the prgH gene or the prgH operon can be used for the same purpose.
  • loss or function is due to decreased expression as a result of a change or mutation, e.g., a deletion, (preferably a non-revertible mutation) at the promoter or other regulatory element of SspB , SspC, or SspD (or some combination thereof) .
  • a change or mutation e.g., a deletion, (preferably a non-revertible mutation) at the promoter or other regulatory element of SspB , SspC, or SspD (or some combination thereof) .
  • the invention features a vaccine including a bacterial cell which is attenuated by decrease of expression of a Ssp virulence gene.
  • the invention also features a live Salmonella cell, or a substantially purified preparation thereof, e.g., a S . typhi , S . enteriditis typhimurium, or S . cholerae-suis cell, in which there is inserted into a virulence gene, e.g., an Ssp gene, a gene encoding a heterologous protein, or a regulatory element thereof.
  • the invention includes a method of vaccinating an animal, e.g., a mammal, e.g., a human, against a disease caused by a bacterium, e.g., Salmonella , including administering a vaccine of the invention.
  • vaccine is meant a preparation including materials that evoke a desired biological response, e.g., an immune response, in combination with a suitable carrier.
  • the vaccine may include live organism, in which case it is usually administered orally, or killed organisms or components thereof, in which case it is usually administered parenterally.
  • the cells used for the vaccine of the invention are preferably alive and thus capable of colonizing the intestines of the inoculated animal.
  • mutation is meant any change (in comparison with the appropriate parental strain) in the DNA sequence of an organism. These changes can arise e.g., spontaneously, by chemical, energy e.g., X-ray, or other forms of mutagenesis, by genetic engineering, or as a result of mating or other forms of exchange of genetic information.
  • Mutations include e.g., base changes, deletions, insertions, inversions, translocations or duplications.
  • a mutation attenuates virulence if, as a result of the mutation, the level of virulence of the mutant cell is decreased in comparison with the level in a cell of the parental strain, as measured by (a) a significant (e.g., at least 50%) decrease in virulence in the mutant strain compared to the parental strain, or (b) a significant (e.g., at least 50%) decrease in the amount of the polypeptide identified as the virulence factor in the mutant strain compared to the parental strain.
  • a non-revertible mutation is a mutation which cannot revert by a single base pair change, e.g. , deletion or insertion mutations and mutations that include more than one lesion, e.g., a mutation composed of two separate point mutations.
  • Heterologous protein is a protein that in wild type, is not expressed or is expressed from a different chromosomal site, e.g., a heterologous protein is one encoded by a gene that has been inserted into a second gene.
  • a substantially purified preparation of a bacterial cell is a preparation of cells wherein contaminating cells without the desired mutant genotype constitute less than 10%, preferably less than 1%, and more preferably less than 0.1% of the total number of cells in the preparation.
  • a substantially pure DNA refers to a nucleic acid sequence, segment, or fragment, which has been purified from the sequences which flank it in a naturally occurring state, e.g., a DNA which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in the genome in which it naturally occurs.
  • the term also applies to DNA which has been substantially purified from other components which naturally accompany the DNA, e.g., DNA which has been purified from proteins which naturally accompany it in a cell.
  • polypeptide any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation).
  • substantially identical is meant a polypeptide or nucleic acid exhibiting at least 50%, preferably 85%, more preferably 90%, and most preferably 95% sequence identity to a reference amino acid or nucleic acid sequence.
  • the length of comparison sequences will generally be at least 10 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably 35 amino acids.
  • the length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides.
  • Sequence identity is typically measured using sequence analysis software (e.g., Sequence analysis software package of the genetics computer group, university of Wisconsin biotechnology center, 1710 university avenue, Madison, WI 53705) . Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, substitutions, and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • sequence analysis software e.g., Sequence analysis software package of the genetics computer group, university of Wisconsin biotechnology center, 1710 university avenue, Madison, WI 53705
  • Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, substitutions, and other modifications.
  • Conservative substitutions typically include substitutions within the following groups: glycine, a
  • substantially pure polypeptide is meant a Ssp polypeptide which has been separated from components which naturally accompany it.
  • the polypeptide is substantially pure when it is at least 60% Ssp by weight.
  • the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, Ssp polypeptide.
  • a substantially pure Ssp polypeptide may be obtained, for example, by extraction from a natural source (e.g. , Salmonella bacterium) ; by expression of a recombinant nucleic acid encoding a Ssp polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, e.g., using column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.
  • substantially pure polypeptides include those derived from one type of prokaryotic organism, e.g., S . typhimurium, but synthesized in E. coli or another prokaryotic organism.
  • substantially pure DNA DNA that is free of the genes which, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence, e.g, a hybrid gene encoding a chimeric antigen.
  • Fig. 1 is a diagram of the a genetic map of the 59-60 min region of the S . typhimurium chromosome and partial physical map of the restriction endonuclease sites of the prgH chromosomal region within the hil locus and related plasmids.
  • the horizontal arrows indicate the direction of transcription of the orfl , prgH UK , and org genes and of the neomycin promoter of the Tn5B50 insertions within the hil locus.
  • the vertical arrows indicate and the location of the predicted start of transcription of the prgHIJK operon (small arrow) and the location of the two Tn5B50 insertions that define the hil locus (large arrows) .
  • the open triangle indicates the location of the prgHl::TnphoA insertion.
  • Restriction endonuclease sites are as follows: B, BamHI; E, EcoRI ; H, Hindlll; S, Sacl; Ss, Sspl; V, .EcoRV; X, Xhol.
  • Fig. 2 is a photograph of a Northern blot assay in which the prgHIJK and orgr transcripts are identified. Blot hybridization of a prgH (A) , prgl-J (B) prgK (C) , org (D) , and pagC (E) DNA probe to RNA purified from wild-type (Wt) and phoP constitutive (P c ) S. typhimurium strains were grown aerobically to 0.5 optical density units. The bars indicate the RNA markers and are 9488, 6255, 3911, 2800, 1898, and 872 nucleotides (NT) in size from top to bottom.
  • NT nucleotides
  • Fig. 3 is a photograph of a primer extension analysis of RNA isolated from wild-type and PhoP c S. typhimurium strains by using an oligonucleotide primer IB08 corresponding to nucleotides 1217 to 1199 of the prgH sequence.
  • Lanes labeled “AGCT” represent dideoxy DNA sequencing reactions.
  • the lane labeled "wt” represents the products of a primer extension reaction initiated with primer IB08 and wild-type RNA as a template
  • the lane labeled "p c " represents the products of a primer extension reaction initiated with the same primer and PhoP c RNA as a template.
  • Fig. 4A is a diagram showing the similarity and alignment of prgl, mxiH, and yscF predicted gene products.
  • Fig. 4B is a diagram showing the similarity and alignment of prgJ and mxil predicted gene products.
  • Fig. 4C is a diagram showing the similarity and alignment of prgK, mxiJ, and yscJ predicted gene products. For Figs. 4A-4C, residues conserved among each of the predicted gene products are indicated with a plus
  • Fig. 5 is a photograph of a SDS-PAGE gel.
  • Salmonella proteins found in the culture supernatant of stationary-phase S. typhimurium 14028s were compared to proteins isolated from lysed whole cells or cellular fractions (membranes or intracellular soluble proteins) .
  • the whole cell, membrane, and soluble lanes contained material from 0.10 ml, 0.35 ml, and 0.15 ml of cells, respectively.
  • Proteins were fractionated in a 12% polyacrylamide gel by SDS-PAGE and stained with Coomassie Brilliant Blue R-250. The molecular masses of protein standards are indicated on the side of the gel as kDa.
  • Fig. 6 is a photograph of a SDS-PAGE gel showing a comparison of culture supernatant proteins from
  • Fig. 7 is a photograph of a SDS-PAGE gel showing an analysis of prgH::TnphoA and complementation of the insertion mutation by pWKSH5.
  • TCA precipitable material from 2 ml of supernatant from stationary phase cultures was fractionated in a 10% polyacrylamide gel by SDS-PAGE. Protein was stained with Coomassie Brilliant Blue R-250. The molecular masses of protein standards are indicated on the side of the gel as kDa. wt, wild-type (14028s) ; IB040, prgHl : : nphoA; IB043, prgHl::TnphoA with plasmid pWKSH5 containing a 5.1 kb insert of S.
  • typhimurium DNA including prgHIJK.
  • Supernatant protein bands complemented by pWKSH5 are indicated by arrows (87 kDa and 65 kDa) and a bracket (three bands in the 35-40 kDa range) .
  • Fig. 8 is a photograph of a SDS-PAGE gel showing Salmonella secreted proteins (Ssp) concentrated from supematants of different strains. Each lane contains Ssp collected from 2 ml of culture supernatant. Lanes 1: wild-type S. typhimurium SL1344; 2: EE638 (lacZYll-6) ; 3: EE633 (lacZY4 ) ; 4: VB122 (hilA: :kan-112) ; 5: EE637 (invF: ⁇ lacZYll-5) ; 6: IB040 (prgHl : :TnphoA) St: molecular weight standard. Sizes of protein bands are given in kDa. * marks a protein band which was variably present in different preparations of Ssp from the same strains.
  • Fig. 9 is a diagram showing the chromosomal organization of the sspBCDA genes and phenotypes of mutants ⁇ spC: : lacZY4 (EE633) and sspA: : lacZYll-6 (EE638) .
  • the chromosomal location of ssp with respect to spaT and prgH is shown.
  • An asterisk (*) indicates partially sequenced genes. Restriction sites in parentheses have only been mapped in the left region of the 11 kb .EcoRI fragment. Abbreviations of restriction sites are: E: EcoRI, B: BamHI, P: Pvull, N: Wcol. Invasion of epithelial cells by different S.
  • typhimurium strains is given as the percentage of the bacterial inoculum surviving gentamicin treatment. Values represent means and standard errors of the means of three independent experiments, each performed in triplicate. Presence or absence of Salmonella secreted proteins SspA, SspC and SspD in culture supe atants of different strains is indicated by + or -, respectively. The molecular weights in kDa of these Ssp are shown in parentheses.
  • Fig. 10 is a diagram showing a complementation analysis of EE638. Complementing fragments of chromosomal DNA in a low-copy plasmid are shown according to the chromosomal map. Designations of the plasmids are given in brackets on the left. The positions of the lac promoter (P ⁇ ac ) are indicated. ⁇ indicates a deletion.
  • Fig. 11 is a photograph of an immunoblot analysis of various strains for expression and secretion of Ssp87.
  • Total cellular proteins from bacteria collected from 0.2 ml of cultures were loaded in lanes designated "C”
  • supematant proteins from 0.2 ml bacterial culture supematants were loaded in lanes designated "S”. 1: wild type S.
  • Fig. 12 is a diagram showing a comparison of the deduced partial amino acid sequence of SspB with the S. flexneri homologue IpaB. Bars indicate identical residues, dots indicate gaps introduced in order to maximize similarity according to the GAP program of the GCG package.
  • Fig. 13 is a diagram showing a comparison of the deduced amino acid sequences of SspC with the S. flexneri homologues IpaC. Bars indicate identical residues, dots indicate gaps introduced in order to maximize similarity according to the GAP program of the GCG package.
  • Fig. 14 is a diagram showing a comparison of the deduced amino acid sequences of SspD with the S. flexneri homologues IpaD. Bars indicate identical residues, dots indicate gaps introduced in order to maximize similarity according to the GAP program of the GCG package.
  • Fig. 15 is a diagram of the amino-terminal sequence derived from the 5'-region of sspA . Amino acids determined by amino-terminal sequencing of SspC and SspA are underlined.
  • Fig. 16 is a photograph of a SDS-PAGE gel showing total soluble Ssp collected from 2 ml of culture supematants of wild type S.
  • Lanes 8 and 9 contain soluble Ssp from SL1344 [pWSK29] and EE638 [pWSK29] , respectively.
  • the sizes of the protein bands are given in kDa.
  • An asterisk (*) indicates a protein band which was variably present in different preparations of Ssp from the same strains.
  • Fig. 17 is a photograph of an SDS-PAGE gel showing insoluble Ssp precipitates collected from 2 ml of culture supematants of wild type S. typhimurium SL1344 and EE638
  • Lanes 8 and 9 contain soluble Ssp from SL1344 [pWSK29] and EE638 [pWSK29] , respectively.
  • the sizes of the protein bands are given in kDa.
  • An asterisk (*) indicates a protein band which was variably present in different preparations of Ssp from the same strains.
  • Fig. 18 is a diagram showing the genetic organization of the invasion gene clusters from S. typhimurium and S. flexneri. The relative positions of each gene are indication and the directions of gene transcription are indicated by arrows. Arrows are not drawn to scale. Gene clusters conserved in sequence and gene order are indicated by stippling (inv-spa/mxi-spa) , crosshatching (prglJK/mxiHI] ) , and dark arrows ( ⁇ sp/ipa) . Genes with no homologues within the respective regions are shown as open arrows.
  • Fig. 19 is a depiction of the nucleic acid sequence of S ⁇ pB (missing part of the 5' end) (SEQ ID NO:
  • Fig. 20 is a depiction of the nucleic acid sequence of SspC (SEQ ID NO: 2) .
  • Fig. 21 is a depiction of the nucleic acid sequence of SspD (SEQ ID NO: 3) .
  • Fig. 22 is a depiction of the nucleic acid sequence of SspB (missing part of the 3' end) (SEQ ID NO: 4) and the predicted amino acid sequence SspB (partial c- terminal) (SEQ ID NO: 5).
  • Fig. 23 is a depiction of the predicted amino acid sequences of SspC (SEQ ID NO: 6), SspD (SEQ ID NO: 7), and SspA (partial animo terminal) (SEQ ID NO: 8) .
  • Fig. 24 is a depiction of the nucleic acid sequences of iagB (SEQ ID NO: 9) and stpA (SEQ ID NO: 10) .
  • Fig. 25 is a depiction of the predicted amino acid sequences of iagB (SEQ ID NO: 11) and stpA (SEQ ID NO: 12).
  • Fig. 26 is a depiction of the nucleic acid sequence of prgH (SEQ ID NO: 13) .
  • Fig. 27 is a depiction of the predicted amino acid sequences of prgB (SEQ ID NO: 14) .
  • Fig. 28 is a depiction of the nucleic acid sequence of SspBCDA (truncated at 3' and 5' ends) (SEQ ID NO: 15).
  • Fig. 29 is a depiction of the nucleic acid sequence of prgH and 5' and 3' flanking sequences (SEQ ID NO: 16) .
  • the Salmonella secreted proteins (Ssp) of the invention have a variety of uses. For example, they can be used as diagnostic reagents, therapeutic agents, and research products.
  • the genes encoding Ssp also have a variety of uses. For example, they can be used as diagnostic reagents. They can also be used to create vaccines including live attenuated vaccines.
  • Salmonella infection is a significant health problem and because Ssp proteins are soluble proteins that are found on the surface of Salmonella , various Ssp, DNA encoding various Ssp, and antibodies directed against various Ssp are useful in diagnostic assays. Because Ssp are required for optimal virulence, DNA encoding a mutant Ssp having decreased function can be used to create strains of Salmonella with reduced virulence. Such strains are useful as live vaccines.
  • An Ssp (or a portion thereof which can gain entry into the cytoplasm) can be used to translocate a second molecule, e.g. , a polypeptide, into the cytoplasm of a cell.
  • a second molecule e.g. , a polypeptide
  • This approach can be useful for the induction or priming of cytotoxic lymphocytes (CTL) directed against the second molecule.
  • CTL cytotoxic lymphocytes
  • An Ssp (or a portion thereof capable of translocating an attached second molecule) can be used to introduce a second molecule into the cell cytoplasm for the purpose of drug delivery.
  • the second molecule is a polypeptide which is covalently linked to an Ssp (or a portion thereof), e.g., by a peptide bond.
  • Such molecules can be readily produced first preparing a chimeric gene encoding the Ssp (or portion thereof) and the second molecule as a single polypeptide chain. This gene can be used to prepare the fusion protein for administration to a patient. Alternatively, the chimeric gene can be introduced into a strain of Salmonella which can then be used as either a live vaccine or drug delivery system. Ssp as Diagnostic Reagents
  • An Ssp can be used as a diagnostic tool for the detection of Salmonella infection in a patient or to evaluate status of an immune response to Salmonella .
  • one or more Ssp can be used an antigen in an ELISA assay to detect the presence of Salmonella-specific antibodies in a bodily fluid, e.g., blood or plasma, obtained from an infected patient or an individual suspected of being infected with Salmonella .
  • Ssp can also be used to test immune cell activation, e.g., T or B cell proliferation or cytokine production, in a sample of patient-derived cells, e.g., peripheral blood mononuclear cells, to detect the presence of a cellular immune response to Salmonella .
  • Polynucleic acids encoding all or part of an Ssp can be used in hybridization assays to detect the presence Salmonella infection, e.g., using a PCR assay or other probe or primer based assay designed to detect particular DNA sequences.
  • Antibodies capable of selectively binding a particular Ssp can be used to detect the presence of Salmonella in a biological sample. Such antibodies can be produced using standard methods. Therapeutic Applications of SSP Fusion Proteins
  • Fusion proteins comprising all or part of an Ssp and a second protein or polypeptide are useful for a variety of therapeutic applications such as vaccines (e.g., recombinant Salmonella vaccines or vaccines against heterologous pathogens) , cell targeting agents for delivery of drugs (e.g., cytotoxic agents), and adjuvants, (e.g., to boost an immune response to a co- administered antigen) .
  • vaccines e.g., recombinant Salmonella vaccines or vaccines against heterologous pathogens
  • cell targeting agents for delivery of drugs e.g., cytotoxic agents
  • adjuvants e.g., to boost an immune response to a co- administered antigen
  • the Ssp fusion protein will cause the second polypeptide or protein to be internalized by epithelial cells (or other cells to which the Ssp binds) of the individual to which the vaccine is administered.
  • This intemalization can trigger a Type I MHC-mediated response to the second protein or polypeptide.
  • the induction of this response will lead to the induction of CTL (or the priming of CTL) specific for the second protein or polypeptide.
  • the induction or priming of antigen-specific CTL can provide therapeutic or prophylactic benefits.
  • Purified fusion proteins can be used as recombinant vaccines.
  • Ssp fusion proteins are useful to generate an immune response to the antigen to which the Ssp is linked or to deliver a therapeutic compound, e.g. , a toxin for the treatment of cancer or autoimmune diseases in which the killing of specific cells, i.e., the cells to which a Ssp binds, is desired. Delivery of a toxin linked to a SspC or SspD polypeptide is especially useful in cancer therapy because man types of cancers are of epithelial cell origin.
  • Ssp fusion proteins which contain all or part of a Ssp linked to a heterologous protein can be made using methods known in the art.
  • Two or more polypeptides may be linked together via a covalent or non-covalent bond, or both.
  • Non-covalent interactions can be ionic, hydrophobic, or hydrophilic.
  • a covalent linkage may take the form of a disulfide bond.
  • the DNA encoding one of the polypeptides can be engineered to contain a unique cysteine codon.
  • the second polypeptide can be derivatized with a sulfhydryl group reactive with the cysteine of the first component.
  • a sulfhydryl group can be introduced using solid phase polypeptide techniques.
  • a number of other covalent crosslinking agents e.g., photoreactive crosslinkers, water-soluble crosslinkers, which are commercially available may be used to join a heterologous polypeptide to a Ssp to create a fusion protein. If the fusion protein is produced by expression of fused genes, a peptide bond serves as the link between the components of the fusion protein.
  • Such fusion proteins are produced by expression of a chimeric gene in which sequences encoding all or part of an Ssp are in frame with sequences encoding the second protein or polypeptide. In some circumstances it may be useful to include a linker polypeptide between the Ssp and second protein of polypeptide.
  • Intemalization of the fusion protein may not require the presence of a complete Ssp protein.
  • a internalization-competent portion of an Ssp will be adequate in many circumstances. Whether a particular portion of a selected Ssp is sufficient for intemalization can be tested as follows. The selected portion of an Ssp is fused to a calmodulin-dependent adenylate cyclase. If this test fusion protein ii internalized, it will be exposed to calmodulin and the cylcase will be activated. The presence of adenylate cyclase activity can then be used as a measure of intemalization. This general approach is described by Sorg et al. (Molecular Mcrobiol . 14:583-94, 1994). Ssp are virulence factors that alter the ability of bacteria to be internalized by specific populations of host cells and to induce an immune response. Salmonella with mutations in genes encoding Ssp are useful in the manufacture of live Salmonella vaccines with altered cell tropis
  • Deletion or overexpression of Ssp in Salmonella can be used to target strains or fusion proteins to various mammalian cell types. Invasion of epithelial cells or macrophages can be selected depending on the Ssp mutated. For example, use of Salmonella as an antigen or drug delivery vehicle can be optimized by deleting part or all of a gene encoding a Ssp involved in bacterial mediated endocytosis (or mutating such a gene to impair Ssp function) , thereby minimizing the ability of Salmonella to invade epithelial cells (and therefor maximizing antigen delivery to antigen presenting cells such as macrophages) . In this manner, strains with mutated Ssp genes can be used to modulate the host immune system. Deletion of Ssp genes in Salmonella can also be used to alter the ability of Salmonella to stimulate IL-8 secretion by epithelial cells.
  • Fusions of antigens to Ssp genes can be used to facilitate an immune response to the linked antigens for the purpose of generating an antigen-specific cytotoxic T cell response in a patient.
  • Ssp fusions to viral antigens are useful as therapeutic vaccines for diseases such as AIDS and Herpes genitalis in which the generation of a cytotoxic T cell (CTL) response is desired.
  • CTL cytotoxic T cell
  • Fusion proteins which include all or part of a Ssp linked to a cytotoxic molecule can be used to target a cytotoxic molecule to a specific cell type, e.g., an epithelial cell-derived cancer cell, which would then by killed by the cytotoxic agent.
  • Cytotoxic fusion proteins can be synthetically or recombinantly produced and administered directly to a patient.
  • live Salmonella expressing a cytotoxic Ssp fusion protein can be administered and allowed to produce and secrete the fusion protein in vivo .
  • Ssp are also useful as adjuvants to boost the immunogenicity of antigens with which they are delivered or to which they are chemically or recombinantly linked.
  • Ssp that have enzymatic effects, e.g., phosphatase activity, on certain types of eucaryotic cells can be used to promote specific types of immune responses such as TH2 or THI T cell responses. Since these proteins are secreted and are likely taken up in the cytoplasm of eucaryotic cells, gene fusions to these proteins are likely to be more immunogenic and more efficient in inducing the development of an immune response, particularly a class I MHC-restricted CTL response.
  • compositions of the invention can be formulated in a pharmaceutical excipient in the range of approximately 10 ⁇ g/kg and 10 mg/kg body weight..
  • compositions and methods of the invention provide the tools with which to construct better vaccines against Salmonella infection and for the prevention and treatment of other diseases, e.g., cancer and AIDS, by using Salmonella secreted proteins as carriers of heterologous antigens, e.g., tumor antigens or viral antigens, either as purified components or as hybrid proteins produced in live Salmonella vaccine strains.
  • Salmonella secreted proteins as carriers of heterologous antigens, e.g., tumor antigens or viral antigens, either as purified components or as hybrid proteins produced in live Salmonella vaccine strains.
  • heterologous antigens e.g., tumor antigens or viral antigens
  • Ssp genes can be used to attenuate vaccine strains. For instance deletion of Ssp genes leads to lack of neutrophil transmigration across epithelial cell monolayers (a model system that correlates well with the ability of certain strains to cause gastroenteritis) .
  • Vaccine strains are usually administered at doses of 1 x 10 5 to 1 x IO 10 cfu/single oral dose. Those skilled in the art can determine the correct dosage using standard techniques. Research products
  • Ssp with enzymatic activity e.g. , Salmonella tyrosine phosphatase (stpA)
  • StpA catalyzes the release of phosphate groups from tyrosine residues in proteins, and thus, is especially useful in the field of signal transduction. Since a number of eucaryotic and procaryotic signal transduction proteins are regulated by the phosphorylation and dephosphorylation of tyrosine residues, stp can be used to deactivate or activate these proteins, thereby altering intracellular signal transduction. Thus, Stp can be used as a research tool to study and evaluate phosphorylation-regulated signal transduction pathways. Modification of Ssp and Ssp Variants
  • Ssp When an Ssp is being used to translocate a second molecule into a eukaryotic cell, it may be useful increase expression of the Ssp (or Ssp fusion protein) so that BME is increased.
  • Increased expression of sspC, sspD and other s ⁇ p genes may be accomplished using methods known in the art, e.g., by introducing multiple copies of the gene(s) into the bacterial cell or cloning the Ssp-encoding DNA under the control of a strong promoter.
  • a bacterial strain e.g., a Salmonella strain
  • Ssp expression may be reduced using methods known in the art, e.g., insertion of a transposon (Tn) into the gene, deletion of some or all of the gene, mutating a gene upon which SspC and/or SspD expression depends, e.g., prgH, e . g . , a deletion or Tn insertion in the prgHIJK operon.
  • Tn transposon
  • the method may include the step of impairing the function of one or both of the gene products, e.g., by Tn insertion, deletion mutagenesis, or by impairing the secretory pathway by which the gene products are secreted such that the gene products are produced but not effectively transported to the extracellular environment.
  • the PhoP-repressed prgH locus of S. typhimurium may be important for signaling epithelial cells to endocytose S. typhimurium.
  • the following series of experiments demonstrate that the prgH locus is an operon of four genes encoding polypeptides of 392 amino acids (prgH) , 80 amino acids (prgl) , 101 amino acids (prgJ) , and 252 amino acids (prgK) . These experiments also demonstrate that expression of the 2.6-kb prgHIJK transcript is reduced when PhoP/PhoQ is activated, suggesting that PhoP/PhoQ regulates prgHIJK by transcriptional repression.
  • S. typhimurium strain ATCC 14028s (American Type Culture Collection, Bethesda, MD) is a virulent wild-type parent strain from which all other Salmonella strains described in Example 1 were derived. Bacterial strains and plasmids are described in Table 1. Luria-Bertani broth (LB) was used as rich bacterial growth medium. Antibiotics were added to LB broth or agar in the following concentrations: ampicillin, 25 ⁇ g/ml; chloramphenicol, 50 ⁇ g/ml; kanamycin, 45 ⁇ g/ml.
  • Double-strand templates were sequenced by the dideoxy-chain termination method known in the art as modified for use with SequenaseTM (US Biochemicals, Corp.) and [ ⁇ - 35 S]dATP. Computer analysis of the DNA sequence was accomplished with the GENEPRO (Riverside Scientific, Riverside, CA) and Wisconsin package (GCG, version 7) programs. The nucleotide sequence of the prgHIJK locus has been deposited in GeneBank under accession number U21676.
  • RNA extraction RNA blot analyses, and primer extension analyses
  • RNA was isolated from mid-log phase cultures (OD 600 0.5) of aerobically-grown (with shaking) and microaerophically-grown (without shaking) Salmonella strains using a standard hot phenol procedure (Pulkkinen et al., J . Bacteriol . 173:86-93, 1993).
  • OD 600 0.5
  • RNA blots 20 ⁇ g of RNA was diluted in H 2 0 and incubated for 15 minutes at 55°C in 50% formamide, 17.5% formaldehyde in 1 x Northern buffer (0.36 M Na 2 HP0 4 -7H 2 0, 0.04 M
  • the DNA probes for RNA-DNA and DNA-DNA blot hybridization were obtained from recombinant plasmid DNA by restriction endonuclease digestion or by polymerase chain reaction (PCR) using the GeneAmpTM PCR kit (Perkin-Elmer/Cetus) .
  • the following DNA probes were synthesized: a 841-bp prgH probe from the oligonucleotide primers IB07 (5'-CCAGGTGGATACGGA-3' ; SEQ ID NO: 17; nucleotides 1198 to 1212) and IB19
  • oligonucleotide primers (0.2 picomoles) were end-labelled with [ ⁇ - 32 P]dATP (NEN/Dupont) , annealed to S. typhimurium RNA (20 ⁇ g) and extended with reverse transcriptase (Gibco BRL, St. Louis, MO) . Reactions were electrophoresed in 6% polyacrylamide, 8 M urea gels adjacent to sequencing reactions initiated with primers used for cDNA synthesis. DNA blot hybridization analysis Chromosomal DNA was isolated, restriction endonuclease digested, size fractionated in agarose gels, and transferred to GeneScreen Plus membranes (NEN/Dupont) . For dot blot hybridization experiments, high stringency hybridization was performed according to standard methods at 65°C using radiolabelled probes. Protein isolation and analysis
  • Bacteria were grown in LB, with shaking at 37°C. Bacterial cultures were chilled to 4°C and centrifuged at 154,000 x g for 1.7 hours. The supematant was carefully removed and trichloroacetic acid (TCA) was added to a final concentration of 10%. The precipitates were collected by centrifugation at 69,000 x g for 1 hour, rinsed with cold acetone, dried and stored at 4°C. The bacterial cell pellet was fractionated to obtain periplasmic, cytoplasmic, and membrane fractions.
  • TCA trichloroacetic acid
  • Samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10-12% polyacrylamide (0.1 M Tris pH 8.45, 0.1% SDS) gel using a standard Tris-glycine buffer system or standard Tris-tricine buffer system.
  • TCA precipitates were mixed with sample buffer (250 mM Tris pH 6.8, 2% SDS, 0.0025% bromophenol blue, 5.0% ⁇ -mercaptoethanol, 10% glycerol) and heated to 100°C for 5 minutes. Proteins were visualized by staining with Coomassie Brilliant Blue R-250.
  • Enzyme assays SDS-PAGE
  • alkaline phosphatase periplasm
  • cytoplasm ⁇ -galactosidase
  • a plasmid, pPOS3, containing an arabinose-inducible phoA gene was inserted into wild-type strain 14028s by transformation and moved into other strains using P22 bacteriophage-mediated transduction. Addition of arabinose (0.02%) to the culture medium induced transcription of the phoA gene. Determination of alkaline phosphatase activity of strains containing pPOS3 was performed using the substrate p-Nitrophenyl phosphate according to standard methods.
  • 3-galactosidase wa ⁇ produced from a strain with a udJ-generated gene fusion of msg and lacZ .
  • the gene, msg is constitutively expressed and not PhoP regulated, ⁇ -galactosidase activity of strains carrying msg: :MudJ was measured using routine methods (Miller et al., supra) .
  • Table 1 Bacterial strains. plasmids and relevant properties
  • Plasmids pIBOl pUC19 (amp R ) containing a 10.7-kb EcoRV fragment with prgHl : : TnphoA (kan R ) pVB3 pUC19 containing a 5.9-kb Hindlll-EcoRI fragment of the prgH locus pWKSHS pWKS30 (amp R ) containing a 5.1-kb Hindlll fragment of prgH locus pWPL4 pUC19 containing a 5.0-kb .EcoRV fragment of the pagC locus pP0S5 pBR322 containing arabinose-inducible PhoA
  • E . coli Escherichia coli
  • Fig. 1 A recombinant plasmid containing a 10.7 kb EcoRV fragment was identified by selecting for kanamycin re ⁇ istance (TnphoA encoded) and wa ⁇ de ⁇ ignated pIBOl (Fig. 1) .
  • DNA hybridization analysis of strain IB040 with a radiolabelled 1.5-kb Hindlll-SacI-generated DNA fragment of pIBOl resulted in hybridization to an approximately 10.7-kb .EcoRV DNA fragment.
  • the DNA sequence of the 4,034-bp Hindlll-Sspl fragment (within which the TnphoA insertion in prgH was localized) was determined by sequencing plasmid pIBOl containing the cloned prgHl : :TnphoA allele. This sequence was confirmed by DNA sequencing of pWKSHS containing the wild-type prgH allele (Fig. 1) . Information from DNA sequence of the prgHl : : phoA fusion junction was used to determine the direction of transcription and correct reading frame of prgH. TnphoA was inserted after nucleotide 1548 within an open reading frame that extended from nucleotides 981 to 2156. prgH was predicted to encode a 392 amino acid polypeptide with a calculated M r of 44,459 dalton ⁇ and pi of 5.86.
  • N-terminal portion of prgH was found to have a stretch of nonpolar residues followed by the motif Leu-Xaa-Gly-Cys at residues 24 to 27 (corresponding to nucleotides 1050 to 1061) characteristic of the processing site of bacterial lipoproteins. There was a strong hydrophobic domain (amino-acid residue 144 to 154, corresponding to nucleotides 1410 to 1433) upstream of the TnphoA insertion.
  • orfl was predicted to encode a gene product of 148-amino-acid residues with a calculated M r of 17,186.
  • the start codon of orfl was preceded by a potential ribosome binding site at 7 to 11 nucleotides 5' to the predicted start of translation (5'-AAAGG-3' , nucleotides 676 to 672) sugge ⁇ ting that thi ⁇ open reading frame wa ⁇ translated.
  • the orfl predicted gene product had no signal sequence nor any strong hydrophobic domains. Identification of prgl . praJ. and pr ⁇ K
  • nucleotide sequence located downstream from prgH revealed four additional open reading frames that were predicted to be transcribed in the same direction and form an operon: (a) nucleotides 2184 to 2423; (b) nucleotides 2445 to 2747; (c) nucleotides 2747 to 3502; and (d) nucleotide 3476 to beyond the 3' Sspl site.
  • prgl The first three of these four open reading frames identified were designated prgl, prgJ, and prgJ respectively, prgl , prgJ, and prgK were predicted to encode gene products of 80 amino acids (M r , 8865 dalton ⁇ ) , 101 amino acid ⁇ (M r , 10,929 dalton ⁇ ) , and 252 amino acids (M r , 28,210 daltons).
  • the predicted gene products encoded by prgJ and prgJ " did not contain a signal sequence or strong hydrophobic domains.
  • the predicted gene product encoded by prgK contained a N-terminal hydrophobic region followed by a potential lipoprotein processing site from amino-acid residue 15 to 18 (corresponding to nucleotides 2788 to 2800) .
  • the fourth open reading frame corresponded in DNA sequence to the S. typhimurium oxygen-regulated gene (org) .
  • praH-K transcription is negatively regulated bv PhoP/PhoQ
  • RNA isolated from wild-type (ATCC 14028s) and PhoP c (CS022) strains of S. typhimurium were analyzed.
  • the prgH-specific DNA probe hybridized with an approximately a 2600-nucleotide RNA from the wild-type strain (Fig. 2) .
  • RNA that hybridized to the prgH probe was similar to that of the prgH-K open reading frame predicted from the DNA sequence (i.e., 2600 vs. 2522 nucleotides) .
  • no transcript was seen when equal amounts and similar quality of RNA (as assessed by methylene blue staining) isolated from the PhoP c strain was probed with prgH-specific DNA (Fig. 3) .
  • a pagC-specific probe an approximately 1100-nucleotide pagC transcript was highly expre ⁇ sed in the PhoP c strain (Fig.
  • Primer extension analysis was performed to obtain information on the possible initiation site of prgH transcription. Based on this analysis, the start of prgH transcription was predicted to begin approximately 32 nucleotides upstream from the prgH translational start (Fig. 3) .
  • Several different primers were used that resulted in primer extension products of differing lengths, but all predicted that transcription initiated at this site.
  • the predicted -10 (5'-TAATCT-3' ) and -35 (5'-TTCATC-3') regions are similar to the consensus sequences for typical ⁇ 70 E. coli promoters. Similar to the result ⁇ of RNA blot hybridization analy ⁇ is, a primer extension product was detected only with RNA isolated from wild-type S.
  • RNA blot hybridization and primer extension analy ⁇ i ⁇ were performed using DNA probes and primers specific to the prgl, prgJ, and prgK open reading frames.
  • the prgl-J- and prg - ⁇ pecific DNA probes hybridized with an approximately 2600-nucleotide RNA isolated from wild-type S. typhimurium and not with RNA from the PhoP c strain (Fig. 2) .
  • No primer extension products le ⁇ than 350 nucleotide ⁇ were detected u ⁇ ing RNA isolated from either the wild-type or PhoP c strains using prgl , prgJ , and prgK primers.
  • the ⁇ e primers were from 1662 to 2332 nucleotides downstream from the predicted start of prgH transcription.
  • RNA from the PhoP c strain was hybridized with the org-specific DNA probe, ⁇ ugge ⁇ ting that the 3800-nucleotide RNA wa ⁇ PhoP repre ⁇ sed.
  • RNA of approximately 3800 nucleotides also was detected in long exposure of wild-type RNA blots that were hybridized with either the prgH, prgl-J , or prgK probes, suggesting possible cotranscription of prgHIJK and org .
  • both the major (1400 nucleotide) and minor (3800 nucleotide) transcripts were detected when RNA isolated from the prgHl : :TnphoA strain was hybridized with the org probe, indicating that the prgHl::TnphoA insertion was not polar on either of the org transcripts.
  • RNA from wild-type and PhoP c strains that were grown aerobically or microaerophically to an optical density at 260 nm of 0.5 were compared by blot hybridization with the org-specific DNA probe. No substantial difference was seen in the relative amounts of RNA transcript ⁇ detected in wild-type or PhoP c ⁇ train ⁇ grown under the ⁇ e conditions.
  • the prgl. prgJ, and prgK predicted polypeptides are similar to S. flexneri Mxi and Y. enter ocol it ica Y ⁇ c proteins
  • the prgJ and prgK predicted gene products were also similar to the YscF and YscJ proteins, respectively, of Y . enterocolitica , with 28% and 308 of position ⁇ occupied by identical residues.
  • the Poisson probabilities were highly significant for each of these comparison ⁇ .
  • the role of prgHIJK in S. typhimurium protein secretion was analyzed by examination of the proteins present in cell culture supernatant.
  • Culture media of wild-type bacteria was collected for protein analysis by centrifuging stationary phase cultures at 154,000 x g for 1.7 hours. From 6-8 ⁇ g/ml of protein was precipitated by addition of trichloroacetic acid (TCA) to ovemight culture supematants.
  • TCA trichloroacetic acid
  • the TCA-precipitable material in 2 ml of supernatant then was fractionated by sodium dodecyl ⁇ ulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 5) .
  • IB040 prgH ::TnphoA
  • CS451 containing a 10-kb deletion of hil locus ( hil ) DNA
  • IB043 and CS451 culture supematants contained 100% and 62%, respectively, of wild-type protein levels. At least 5 and 11 major protein bands seen in the wild-type supernatant were greatly reduced or undetectable by Coomas ⁇ ie blue ⁇ taining of the IB040 and CS451, re ⁇ pectively.
  • prgHl::TnphoA The defect in bacterial mediated endocytosis associated with prgHl::TnphoA was complemented by a low-copy number plasmid, pWKSHS, containing a 5.1-kb fragment including prgHIJK, org, and orfl . Consistent with this observation, the prgHl::TnphoA mutant carrying pWKSH5 (strain IB043) had a supernatant protein profile similar to that of wild type (Fig. 7) .
  • the orfl translational start is 884 nucleotides upstream from the TnphoA insertion and that orfl is predicted to be oppositely transcribed from the prgHIJK operon.
  • An approximately 2600 nucleotide PhoP-repressed transcript was detected when RNA was hybridized with prgH- , prgl-J- , or prgK-specific DNA probes.
  • the predominant transcript ⁇ detected with org wa ⁇ smaller (approximately 1400 nucleotides) was not altered in the prgHl : :TnphoA mutant, and was not repressed by PhoP.
  • Primer extension analysis of the potential start site of transcription, the size of the prgHIJK transcript, and the presence of a potential transcriptional terminator immediately downstream of prgK also were consi ⁇ tent with tran ⁇ cription terminating before org.
  • a minor PhoP-repressed transcript of approximately 3800 nucleotides also wa ⁇ detected in multiple RNA blot ⁇ hybridized with the org and prgH, prgl-J, or prgK DNA probes.
  • This minor RNA was similar in size to the combined prgHIJK and org open reading frames (i.e., 3731 nucleotide ⁇ ) and, thus, could represent cotranscription of prgHIJK and org.
  • PhoP constitutive mutation repressed the synthe ⁇ i ⁇ of approximately 20 prg-encoded cell-a ⁇ ociated protein species (Miller et al., J. Bacteriol . 172:2485- 2490, 1990, herein incorporated by reference) .
  • PhoP/PhoQ has been shown to transcriptionally activate pag (Miller et al. , Proc. Natl . Acad . Sci . USA 86:5054- 5058, 1989, herein incorporated by reference; Pulkkinen et al., supra , herein incorporated by reference), the mechanism of protein repres ⁇ ion by PhoP/PhoQ had not been characterized prior to the present studies.
  • PhoP/PhoQ can both activate and repress transcription of virulence genes.
  • a low-copy plasmid containing 5.1 kb of DNA (IB043) , including prgHIJK, org, and orfl , complemented both the bacterial mediated endocytosi ⁇ defect and the supematant protein profile defect of the prgHl:: nphoA mutant.
  • PrgH was predicted to be a membrane lipoprotein.
  • prgl-K which are similar to plasmid-encoded genes of Shigella and Yer ⁇ inia ⁇ pp.
  • a prgH DNA probe hybridized to chromosomal DNA but not virulence-plasmid DNA from Shigella spp.
  • the predicted gene products of the prgHIJK operon were found to be similar to gene products required for protein secretion in other bacterial species.
  • An analysis of proteins present in culture supematants of S. typhimurium was performed. These experiments revealed that the supematants of wild-type cultures contained a large number of protein bands, whereas strains with mutations affecting the prgH locu ⁇ , including prgHl::TnphoA, ⁇ hil and PhoP c were each defective in protein secretion as assessed by Ssp profiles.
  • PhoP/PhoQ could control protein secretion, at least in part, by repressing prgHIJK whose products could form part of a secretion machinery.
  • PhoP c and ⁇ hil mutants were associated with greater defects in their S ⁇ p profile compared with the prgHl: :TnphoA mutant suggested that more than one mechanism may be involved in protein secretion and that gene products encoded by the 10 kb region that is deleted in the hil mutant also contribute to secretion of Ssp. Since the strains with altered Ssp profiles were each impaired in signaling epithelial cells, these data suggest that Ssp are involved in signaling such cells to initiate BME.
  • Ssp and/or prgHIJK gene products may form a structure on the surface of S. typhimurium which induces bacterial mediated endocytosis.
  • S. typhimurium strains with transposons inserted between prgH and ⁇ pa that result in reduced bacterial mediated endocytosis were al ⁇ o i ⁇ ing a ⁇ ub ⁇ et of the Ssp mis ⁇ ing from the prgHIJK mutant.
  • Example 2 Salmonella typhimurium Secreted Inva ⁇ ion Determinants
  • Ssp Salmonella typhimurium secreted protein mutants with transposon insertion ⁇ located between spaT and prgH were identified.
  • One mutant lack ⁇ the 87 kDa S ⁇ p, while the other lacks Ssp of 87, 42, and 36 kDa.
  • the invasiveness of these mutant ⁇ implicate ⁇ the 42 and 36 kDa Ssp, but not the 87 kDa Ssp in invasion.
  • DNA sequencing of this region identified two complete and two partial open reading frames (designated sspB , sspC, ⁇ spD, and sspA) .
  • the deduced amino acid sequence ⁇ of sspBCDA are ho ologou ⁇ to Shigella flexneri secreted proteins IpaB, IpaC, IpaD, and IpaA.
  • Complementation analyses and amino-terminal sequencing showed that sspC and sspA encode the 42 kDa and the 87 kDa Ssp and that both protein ⁇ are secreted without amino-terminal processing.
  • SspA is abundantly secreted by wild type bacteria but is completely retained within the cellular fraction of a mutant in prgHIJK encoding part of the Ssp secretion apparatus.
  • pCH002 pW8-l was cut with EcoRI, the 11 kb fragment eluted from a 1% agaro ⁇ e gel and cloned into the EcoRI ⁇ ite of pWSK29.
  • pCH004 tran ⁇ cription of sspCDA i ⁇ driven from the lac promoter.
  • pCH004 was constructed by cloning the 3 kb BamHI fragment from pCH002 into the BamHI site of pWSK29.
  • pCH005 contains the 4 kb EcoRI-Pvull fragment from pCH002 cloned into EcoRI-Hindi restricted pWSK29.
  • pCH006 was constructed by restriction of pCH005 with Ncol and religation of the 1.7 kb and the 5 kb fragment. The correct orientations of the cloned insert ⁇ were confirmed by appropriate re ⁇ triction analyses.
  • PCR of a chromosomal fragment of EE638 comprising the 5'-region of Tn ⁇ lacZY and adjacent DNA was performed in three independent experiments by using primers OL 1 (5' CGCGGATCCATTATGGGATGTATCGG 3'; SEQ ID NO: 25) and OL2 (5' CCGGCAGCAAAATGTTGCAG 3'; SEQ ID NO: 26).
  • OL 1 5' CGCGGATCCATTATGGGATGTATCGG 3'; SEQ ID NO: 25
  • OL2 5' CCGGCAGCAAAATGTTGCAG 3'; SEQ ID NO: 26.
  • the 0.8 kb amplified DNA fragments were then restricted with BamHI and cloned into pWSK29 for sequencing. All three sequences were identical.
  • Strain VB122 (hi A: :/an-112) was constructed as follows: the mutation was originally constructed on a - 45 - pla ⁇ mid by in ⁇ erting a kan ca ⁇ ette (Pharmacia Biotech, Piscateway, NJ) in a Hindi site in the 5' region of the hilA coding sequence. The plasmid-encoded hilA: :kan-112 mutation was recombined into the chromosome, and the chromosomal mutation was confirmed by PCR analysi ⁇ .
  • Mutant EE633 (lacZY ) wa ⁇ i ⁇ olated by screening for oxygen regulated gene fusions created by random Tn ⁇ lacZY insertions in S. typhimurium W114 (hilA: :kan-114 ) and further selection for insertions linked to a hilA: :kan-114 by P22 transduction into S. typhimurium SL1344 and selection for Tet R and Kan R .
  • Immunoblotting Whole cell samples were prepared from overnight cultures using standard methods with the additional ⁇ tep of filtering the culture through a Whatman 1 qualitative paper filter (Whatman International, Maidstone, Kent, England) before centrifugation. The proteins were resolved by SDS-PAGE and transferred to nitrocellulose by electroblotting using a conventional transfer buffer. We ⁇ tern blots were incubated with polyclonal rabbit serum prepared against the 87 kDa Ssp. The immunogen was purified by SDS-PAGE and injected into New Zealand White rabbits (Charles River, Wilmington, MA) . Serum was collected after two booster injections and subsequently absorbed with an acetone powder prepared from S. typhimurium strain EE63.
  • N-terminal protein ⁇ equencing 100 ⁇ g/ml gentamicin, conditions which were shown to kill 99% of a bacterial culture of 2 x IO 8 cells/ml.
  • Protein ⁇ ⁇ eparated by SDS-PAGE were blotted on PVDF membranes (Bio-Rad, Hercules, CA) and stained with Ponceau-S. Blotted proteins were sequenced using an ABI 470A protein sequencer with 120A PTH-AA analyzer.
  • Table 7 Strain ⁇ and pla ⁇ mid ⁇ used in thi ⁇ example Bacterial ⁇ train Marker
  • typhimurium protein secretion see Example 1 .
  • all three mutants lack 5 major Ssp of 36, 38, 42, 63 and 87 kDa, while the hilA: :kan-112 insertion leads to loss of some lower molecular weight protein bands in addition to these 5 Ssp (Fig. 8, lanes 4, 5, 6).
  • Two other mutants exhibited detectable loss of only one and of three Ssp, respectively.
  • the supematants from the mutant strain EE633 containing the fusion lacZY4 were missing a protein of 87 kDa
  • supematants from the mutant strain EE638, containing fusion 2a ⁇ Z ⁇ ll-6 were missing protein specie ⁇ of 87, 42 and 36 kDa.
  • supematants from EE638 showed an increa ⁇ ed abundance of a 63 kDa S ⁇ p (Fig. 8, lane ⁇ 2, 3).
  • Tn ⁇ lacZY in EE638 maps approximately 2.5 kb downstream from ⁇ paT while in EE633 the transposon maps 5.5 kb downstream from spaT as determined by Southern hybridization and PCR analyses. Both transposons were inserted in the same orientation (Fig. 9) .
  • a degenerate pool of oligonucleotides synthe ⁇ ized according to the ⁇ equence of the 12 amino-terminal amino acids of the 87 kDa protein (VTSVRTQPPVIM; SEQ ID NO: 27) , hybridized specifically to a 5.5 kb BamHI fragment in pW71 which comprises sequence ⁇ between hil A and spaT (Fig. 9) .
  • VTSVRTQPPVIM SEQ ID NO: 27
  • Tn ⁇ lacZY in EE633 is likely to be directly within the gene encoding the 87 kDa S ⁇ p, while Tn51a ⁇ -7Y in EE638 i ⁇ likely to be in ⁇ erted within one of the genes encoding the 42 and the 36 kDa Ssp having a polar effect on the synthesis of the other two Ssp missing in supematants of this mutant.
  • the Tn51acZY Insertions in EE638 and EE633 Define a Chromosomal Region Encoding Ssp S. typhimurium Homologues of the Shigella ipaBCDA Operon To determine the gene(s) affected by the transposon insertions in EE638 and EE633, part of a 11 kb EcoRI subclone of pW8-l was sequenced. Two complete and two partial open reading frames (ORFs) , positioned in the same transcriptional direction, were identified (Fig. 9) .
  • the deduced gene products of the complete ORFs exhibit similarity to Shigella secreted proteins IpaC and IpaD (31% identity, 47% similarity; 37% identity, 56% similarity) respectively, and therefore were designated sspC and sspD (see Fig. 13 and Fig. 14) .
  • the gene products of the complete open reading frames were de ⁇ ignated ⁇ pC and sspD .
  • the amino acid ⁇ equence derived from the 5'-end of sspC was identical to the amino-terminal sequence of the 42 kDa Ssp (underlined in Fig. 13) .
  • the deduced gene product of the partial ORF located immediately upstream from sspC show ⁇ 47% identity
  • Fig. 12 The ORF starting immediately downstream of sspD was designated s ⁇ pA.
  • the amino acid sequence deduced from the 5' end of an ORF starting immediately downstream from sspD did not exhibit ⁇ imilarity to IpaA.
  • DNA sequencing of internal parts of the gene predicted that the protein encoded by this gene, designated s ⁇ pA, is similar to IpaA.
  • the sequence of amino acids 2-13 (underlined in Fig. 15) was identical to the amino-terminal ⁇ equence of the 87 kDa Ssp (see above) .
  • ⁇ pB , sspC , s ⁇ pD , and ⁇ spA are separated by 27, 70, and 15 bp, respectively, and putative ribosome binding site ⁇ precede ⁇ pC , sspD, and s ⁇ pA .
  • Tn51a ⁇ ZY in EE638 was determined by cloning and sequencing of a PCR product comprising the 5' region of the transposon and upstream chromosomal sequence ⁇ and was shown to be located 189 bp downstream from the ATG start codon of sspC.
  • the order of the s ⁇ p genes and the Ssp profile of EE638 indicate that the transposon insertion in ⁇ pC is polar on expression of ⁇ spD and sspA and that these genes are likely to be organized in a singly transcribed unit. Both sspC and sspD are Necessary for S . typhimurium Invasion of Epithelial Cells
  • a complementation analysi ⁇ wa ⁇ carried out to determine the minimal fragment necessary for complementation of the epithelial cell invasion defect of EE638 (sspC: : lacZYll-6) a ⁇ well as for reconstitution of Ssp. All analyzed fragments were cloned downstream from the lac promoter in the 6-8 copies/chromosome vector pWSK29. As shown in Fig. 10, a 3.9 kb EcoRI-PvuII fragment comprising sspC and sspD in pCH005 was sufficient to complement the invasion defect of EE638 to wild type levels.
  • EE638 [pCH005] When analyzed for Ssp, EE638 [pCH005] showed a pattern of Ssp similar to the wild type strain [pWSK29] except for the missing 87 kDa protein (SspA) (Fig. 16, lane 4) . EE638 transformed with pCH002 carrying an 11 kb EcoRI fragment was partially complemented for invasion as well as for all 3 mis ⁇ ing S ⁇ p (Fig. 10 and Fig. 16, lane 6) .
  • EE638 transformed with plasmids that contained either sspC or ⁇ pD alone were not complemented for invasion but showed reconstitution of the 42 kDa Ssp (SspC) or the 36 kDa Ssp (SspD) , respectively (Fig. 10 and Fig. 16, lanes 3 and 5) .
  • Supematants from S. typhimurium wild type cultures contained a precipitate that, when solubilized in reducing SDS sample buffer, separates into at least four highly abundant protein bands of 63, 59, 42 and 22 kDa on SDS-PAGE (see Fig. 17, lane 1). Protein precipitates were also found in culture supematants of EE638 and EE633, but not in supematants of S.
  • Amino-terminal sequencing of this 42 kDa Ssp identified it as encoded by S ⁇ pC.
  • the identity of the amino-terminal protein sequence (MLISNVGINPAAYLN; SEQ ID NO: 28) with the amino acid sequence derived from the 5'-region of SspC (Fig. 13) show ⁇ that no amino-terminal processing of SspC occurs prior to its release into the supematant.
  • [pWSK29] material (Fig. 17, lane 3 and 4), confirming that the respective plasmid ⁇ complemented the mutant for secretion of SspC.
  • Protein patterns of soluble Ssp and precipitates isolated from untransformed cultures of SL1344 or EE638 were identical to those shown in Fig. 16, 17, lane 1 and 2, respectively.
  • Precipitate of EE638 [pCH006 (S ⁇ pD) ] was found to be similar to precipitate from EE638 [pWSK29] except for reduced abundancy of a 63 kDa protein band (Fig. 17, lane 5).
  • SspC and SspA are secreted proteins of 42 and 87 kDa, a ⁇ demon ⁇ trated by amino-terminal ⁇ equencing and by complementation analyses. It is further likely that the 36 kDa protein encoded by SspD is secreted, since lack of a 36 kDa Ssp in supematants of EE638 (lacZYll-6) was complemented by tran ⁇ formation of this mutant with plasmids containing SspD. The 63 kDa Ssp is the protein likely to be encoded by SspB.
  • SspA, SspB, SspC, and SspD appear to be targets of the inv-spa-prgHIJK encoded secretion apparatus, since these Ssp are missing in supematants of mutants affecting expression or regulation of inv-spa and prgHIJK (Fig. 8) .
  • Typical for proteins secreted by type III secretion pathways no amino-terminal proces ⁇ ing of S ⁇ pA and SspC wa ⁇ ob ⁇ erved.
  • the dependency of S ⁇ p secretion on prgHIJK was further proven by demonstrating that SspA is abundantly secreted by wild type cells, while it is completely retained in the cellular fraction of the prgHl : :TnphoA mutant IB040 (Fig. 11).
  • the 38 kDa Ssp of the five major Ssp dependent on the inv-spa-prgHIJK secretion apparatus may be the product of the invJ invasion locus.
  • the immunoblot analysis of SspA secretion sugge ⁇ ts that expression of the gene encoding SspA is negatively controlled by the virulence two component regulatory system PhoP/PhoQ.
  • PhoP/Q has a global effect on protein secretion which is partially due to negative transcriptional regulation of prgHIJK (see Example 1) .
  • the SspBCDA genes are located between the large inv-spa gene cluster and prgHIJK at 59 minutes on the S. typhimurium chromosome.
  • Fig. 18 shows the relative positions of the invasion genes in S. typhimurium in comparison to their S. flexneri homologues, which are clustered in a 31 kb region of a large virulence plasmid.
  • the invasion genes cluster in three groups (inv-spa/mxi- ⁇ pa , S ⁇ p/ipa , and prglJK/mxiHIJ) which exhibit conserved gene structure and organization, sugge ⁇ ting that these genes were acquired by horizontal gene transfer. Acquisition by horizontal gene transfer is further supported by the fact that these S. typhimurium invasion genes are within a 40 kb "virulence island" which, despite the otherwise high overall genetic similarity between S. typhimurium and E. coli K-12, is unique to S. typhimurium.
  • the three invasion gene clu ⁇ ter ⁇ from S. flexneri and S. typhimurium are in different relative positions to each other and are interspersed between non-homologous genes, thus implying multi-recombinational events in the evolution of these genetic regions.
  • reagents derived from partial cDNA clones of an Ssp e.g., SspA
  • the isolation of a full-length cDNA encoding the Ssp is well within the skill of those skilled in the art of molecular biology.
  • a radiolabelled probe made from a known partial cDNA sequence can be used to identify and isolate from a library of recombinant plasmids cDNAs that contain regions with identical to the previously isolated cDNAs.
  • the ⁇ creening of cDNA libraries with radiolabelled cDNA probes is routine in the art of molecular biology (see Sambrook et al., 1989, Molecular Cloning: a Laboratory Manual , second edition., Cold Spring Harbor Pres ⁇ , Cold Spring Harbor, N.Y) .
  • the cDNA can be isolated and ⁇ ubcloned into a plasmid vector, and the plasmid DNA purified by standard techniques.
  • the cDNA insert is sequenced using the dideoxy chain termination method well known in the art (Sambrook et al, supra) .
  • Oligonucleotide primers corresponding to bordering vector regions as well as primers prepared from previously isolated cDNA clones can be employed to progressively determine the sequence of the entire gene.
  • Similar methods can be used to isolate Ssp which are related to SspA, SspB, SspC, or SspD.
  • a probe having a sequence derived from (or identical to) all or a portion of SspA, SspB, SspC, or SspD can be used to screen a library of Salmonella DNA (or cDNA) .
  • DNA encoding a related Ssp will generally hybridize at greater stringincy than DNA encoding other protein ⁇ .
  • Thi ⁇ approach can be u ⁇ ed to identify Salmonella typhimurium S ⁇ p a ⁇ well as Ssp of other Salmonella .
  • Monoclonal antibodies can be generated to purified native or recombinant gene products, e.g., S ⁇ p, by standard procedures, e.g., those described in Coligan et al., eds., Current Protocols in Immunology, 1992, Greene Publishing Associates and Wiley-Interscience) .
  • S ⁇ p native or recombinant gene products
  • To generate monoclonal antibodies a mouse is immunized with the recombinant protein, and antibody-secreting B cells isolated and immortalized with a non-secretory myeloma cell fusion partner. Hybridomas are then screened for production of specific antibodies and cloned to obtain a homogenous cell population which produces a monoclonal antibody.
  • hybridomas secreting the desired antibodies can be screened by ELISA.
  • Specificities of the monoclonal antibodies can be determined by the use of different protein or peptide antigens in the ELISA.
  • Useful quantities of antibodies can be produced by either the generation of ascite ⁇ fluid in mice or by large scale in vitro culture of the cloned antibody-producing hybridoma cell line.
  • Antibodies can be purified by various chromatographic procedure ⁇ known in the art, such as affinity chromatography on either immobilized Protein A or Protein G.
  • the invention also includes DNA encoding other Ssp (e.g., Ssp 54, Ssp 42, and Ssp 22) found in cell supematants.
  • Ssp 54 is MNNLTLSXFXKVG (SEQ ID NO: 29) .
  • Ssp42 is MLISNVGINPAAYLN (SEQ ID NO: 30) .
  • Ssp 22 is TKITLSPQNFFI (SEQ ID NO: 31) .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Substantially pure Salmonella secreted proteins (Ssp), the secretion of which is dependent upon the expression of PrgH; methods of diagnosing Salmonella infection; and live attenuated vaccine strains in which Ssp secretion is decreased.

Description

SALMONELLA SECRETED PROTEINS AND USES THEREOF Statement as to Federally Sponsored Research This invention was made with Government support under AI34504 and AI30479 awarded by the National
Institutes of Health. The Government has certain rights in the invention.
Background of the Invention The invention relates to virulence factors of Salmonella typhimurium .
Salmonella typhimurium (S . typhimurium) enter epithelial cells by a process termed bacterial-mediated endocytosis. S . typhimurium stimulates these normally nonphagocytic cells to undergo significant cytoskeletal rearrangements that are visualized as localized membrane ruffling adjacent to the bacteria. Bacteria are then internalized via membrane-bound vacuoles formed from the membrane ruffles.
Several S . typ ijnuriujn loci have been identified that are required for the induction of bacterial-mediated endocytosis (BME) by epithelial cells. Many of these epithelial-cell signaling loci have a similar chromosomal location, clustered within a 40 kb "virulence island" located between 59 and 60 minutes on the S . typhimurium chromosome (Mills et al., Mol . Microbiol . 15:749-759, 1995) . InvJ is a S . tymphimurium gene which is thought to encode a secreted protein necessary for BME (Collazo et al., Mol . Microbiol . 15:25-38, 1995).
Summary of the Invention The invention features proteins involved in
Salmonella typhimurium virulence and/or bacterial-mediated endocytosis. The genes encoding these proteins have now been cloned and their corresponding gene products characterized. Accordingly, the invention features a substantially pure DNA encoding a Salmonella secreted protein (Ssp) . By the term "Salmonella secreted protein" is meant a Saljnonella-derived protein, the secretion of which is dependent on the expression of PrgH. In preferred embodiments the invention features substantially pure DNA encoding a Salmonella typhimurium secreted protein. By Salmonella typhimurium secreted protein is meant as Salmonella typhimurium derived protein, the secretion of which is dependent on the expression of PrgH.
One aspect of the invention features a substantially pure DNA molecule which includes the SspB gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 1, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 5. In another aspect the invention features a substantially pure DNA molecule which includes the SspC gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 2, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 6. In another aspect the invention features a substantially pure DNA molecule which includes the SspD gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 3, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 7. In another aspect the invention features a substantially pure DNA molecule which included the SspA gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 4, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 8. The invention also features a substantially pure DNA molecule which includes the SspB, SspC, SspD, and SspA genes; preferably, the DNA includes the DNA sequence of SEQ ID NO: 15. The invention also features a substantially pure DNA molecule which includes the SspH gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 13, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 14. The invention also features a substantially pure DNA molecule which includes the Salmonella tyrosine phosphatase A (stpA) gene; preferably, the DNA includes the DNA sequence of SEQ ID NO: 10, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO:12.
The invention also features a cell into which has been introduced substantially pure DNA encoding an Ssp (or a mutant variant thereof) . The substantially pure DNA can be introduced as a portion of a plasmid or other autonomously replicating molecule. In addition the substantially pure DNA can be introduced by homologous recombination. Preferably, the bacterial' cell is a Salmonella cell; more preferably the bacterial cell is a Salmonella typhimurium cell. Cells into which have been introduced substantially pure DNA encoding an Ssp (or mutant variant thereof) can be used as a source of purified Ssp.
The invention includes a substantially pure SspC polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 6 or an active fragment thereof and a substantially pure SspD polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 7 or an active fragment thereof. The invention includes a substantially pure SspB polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 5 (incomplete protein sequence) or an active fragment thereof and a substantially pure SspA polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 8 (incomplete protein sequence) or an active fragment thereof. The invention includes a substantially pure full-length SspB polypeptide, e.g. , a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 5 (incomplete protein sequence) and the remainder of the SspB sequence. Full-length SspA and SspB genes can be isolated by those skilled in the art using the partial DNA sequences disclosed herein. The invention also includes a substantially pure full-length SspA polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 8 (incomplete protein sequence) and the remainder of the SspA sequence. The invention also features An active fragment of an Ssp B polypeptide or an SspC polypeptide or an SspD polypeptide is defined as an SspB, SspC, or an SspD polypeptide, respectively, at least 50 amino acids, preferably at least 25 amino acids, more preferably at least 10 amino acids in length having the ability to induce BME in the absence of the full-length version of the corresponding protein. In other preferred embodiments the SspB, SspC, SspD or SspA polypeptide is able to translocate into an epithelial cell, preferably a human epithelial cell. Translocation can be assayed using any suitable assay, e.g., the assay of Sogy et al. (Molecular Microbiol . 14:583:94, 1994). The invention also includes a substantially pure SspH polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO:14, or a biologically active fragment thereof. The invention also includes a substantially pure
IagB polypeptide, e.g., a polypeptide which includes an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO:11, or a biologically active fragment thereof. Also within the invention is an antibody which binds to a Ssp, e.g. , a polyclonal or monoclonal antibody which specifically binds to an epitope of Ssp. Polyclonal and monoclonal antibodies produced against the polypeptides of the invention can be used as diagnostic or therapeutic agents. The invention encompasses not only an intact monoclonal antibody, but also an immunologically-active antibody fragment, e.g., a Fab or (Fab)2 fragment; an engineered single chain Fv molecule. In preferred embodiments, the antibody may be linked to a detectable label, e.g. a radioactive label, fluorescent label, paramagnetic label, or colorimetric label.
The invention also includes a method of detecting a Salmonella infection in a mammal which includes the steps of contacting a biological sample derived from the mammal, e.g., a human patient, with a Ssp-specific antibody and detecting the binding of the antibody to a Ssp in the sample. Antibody binding indicates that the mammal is infected with Salmonella . The presence of Salmonella in a biological sample may also be detected using a method which includes the steps of contacting the sample with a Ssp-encoding DNA, or the complement thereof, under high stringency conditions and detecting the hybridization of the DNA to nucleic acid in the sample. Hybridization indicates the presence of Salmonella in the biological sample. By "high stringency" is meant DNA hybridization and wash conditions characterized by high temperature and low salt concentration, e.g. , wash conditions of 65°C at a salt concentration of approximately 0.1 x SSC. For example, high stringency conditions may include hybridization at about 42°C in the presence of about 50% formamide; a first wash at about 65°C with about 2 x SSC containing 1% SDS; followed by a second wash at about 65°C with about 0.1 x SSC. The invention also features a method for detecting the presence of antibodies to an Ssp using all or part of an Ssp protein. The method includes contacting a biological sample with the Ssp protein and measuring the binding of the Ssp protein to an antibody present in the sample.
The invention also features a method of targeting an antigen to an epithelial cell in a mammal which includes the steps of linking the antigen to an Ssp, e.g., SspC or SspD, or active fragment thereof, to produce a Ssp chimeric antigen and administering the chimeric antigen to the mammal.
A method of inducing a cytotoxic T cell immune response in a mammal is also within the invention. This method includes the steps of linking the antigen to an Ssp or active fragment thereof to produce a Ssp chimeric antigen and contacting an antigen-presenting cell, e.g., a Class I major histocompatibility complex (MHC) antigen- expressing cell, with the chimeric antigen. The invention also features a vaccine which includes a bacterial cell, the virulence of which is attenuated by decreased secretion of a Ssp, and a method of vaccinating an mammal, e.g. , a human patient, against a Salmonella infection by administering such a vaccine. Preferably, the bacterial cell is a Salmonella typhimurium cell, e.g., a Salmonella enteriditis cell, or a Salmonella typhi cell. A live Salmonella cell in which a gene encoding a heterologous antigen is inserted into a Ssp-encoding gene is also included in the invention. Also within the invention is a substantially pure StpA polypeptide and a method of dephosphorylating a protein which includes the steps of contacting the protein, e.g., a protein at least one tyrosine of which is phosphorylated, with a StpA polypeptide or an active fragment thereof. An active fragment of StpA is defined as a Salmonella-derived polypeptide at least 10 amino acids in length which is capable of removing a phosphate group from a tyrosine residue.
The invention feature live Salmonella (particularly Salmonella typhimurium) vaccines in which one or more gene required for BME is mutated so as reduce their activity. Among the genes which can be mutated are SspB , SspC, and SspD. Although SspA appears not to be required for BME, it may be useful to mutate this gene as well (preferably in combination with mutation of one or more of the other Ssp genes) . Any mutation of these genes which decreases function, including complete or partial deletion and one or more point mutations may be useful. In addition, function of Ssp gene may be impaired by altering its control region.
The invention provides a Salmonella vaccine which does not cause transient bacteremia. In general, the invention features a bacterial cell, preferably a Salmonella cell, e.g., a S . typhi , S . enteritidis typhimurium, or S . cholerae-suis cell, the virulence of which is attenuated by a first mutation in an Ssp gene. The preferred mutations are loss of function mutations. However, functions causing partial loss of function may be useful if virulence is adequately reduced. Such a bacterial cell can be used as a vaccine to immunize a mammal against salmonellosis.
The Salmonella cell may be of any serotype, e.g., S . typhimurium, S . paratyphi A, S . paratyphi B , S . paratyphi C, S . pylorum, S . dublin , S . heidelberg, S . newport , S . minnesota , S . i fant is , S . virchow , or S . panama .
The first mutation may be a non-revertible null mutation in one or more of the following genes: SspB, SspC, or SspD . Preferably, the mutation is a deletion of at least 100 nucleotides; more preferably, the mutation is a deletion of at least 500 nucleotides; even more preferably, the mutation is a deletion of at least 750 nucleotides. Mutations in the prgH gene or the prgH operon can be used for the same purpose. In preferred embodiments loss or function (partial or complete) is due to decreased expression as a result of a change or mutation, e.g., a deletion, (preferably a non-revertible mutation) at the promoter or other regulatory element of SspB , SspC, or SspD (or some combination thereof) .
In another aspect, the invention features a vaccine including a bacterial cell which is attenuated by decrease of expression of a Ssp virulence gene.
The invention also features a live Salmonella cell, or a substantially purified preparation thereof, e.g., a S . typhi , S . enteriditis typhimurium, or S . cholerae-suis cell, in which there is inserted into a virulence gene, e.g., an Ssp gene, a gene encoding a heterologous protein, or a regulatory element thereof. In another aspect the invention includes a method of vaccinating an animal, e.g., a mammal, e.g., a human, against a disease caused by a bacterium, e.g., Salmonella , including administering a vaccine of the invention. By "vaccine" is meant a preparation including materials that evoke a desired biological response, e.g., an immune response, in combination with a suitable carrier. The vaccine may include live organism, in which case it is usually administered orally, or killed organisms or components thereof, in which case it is usually administered parenterally. The cells used for the vaccine of the invention are preferably alive and thus capable of colonizing the intestines of the inoculated animal. By "mutation" is meant any change (in comparison with the appropriate parental strain) in the DNA sequence of an organism. These changes can arise e.g., spontaneously, by chemical, energy e.g., X-ray, or other forms of mutagenesis, by genetic engineering, or as a result of mating or other forms of exchange of genetic information. Mutations include e.g., base changes, deletions, insertions, inversions, translocations or duplications. A mutation attenuates virulence if, as a result of the mutation, the level of virulence of the mutant cell is decreased in comparison with the level in a cell of the parental strain, as measured by (a) a significant (e.g., at least 50%) decrease in virulence in the mutant strain compared to the parental strain, or (b) a significant (e.g., at least 50%) decrease in the amount of the polypeptide identified as the virulence factor in the mutant strain compared to the parental strain.
A non-revertible mutation, as used herein, is a mutation which cannot revert by a single base pair change, e.g. , deletion or insertion mutations and mutations that include more than one lesion, e.g., a mutation composed of two separate point mutations.
Heterologous protein, as used herein, is a protein that in wild type, is not expressed or is expressed from a different chromosomal site, e.g., a heterologous protein is one encoded by a gene that has been inserted into a second gene.
A substantially purified preparation of a bacterial cell is a preparation of cells wherein contaminating cells without the desired mutant genotype constitute less than 10%, preferably less than 1%, and more preferably less than 0.1% of the total number of cells in the preparation. A substantially pure DNA, as used herein, refers to a nucleic acid sequence, segment, or fragment, which has been purified from the sequences which flank it in a naturally occurring state, e.g., a DNA which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in the genome in which it naturally occurs. The term also applies to DNA which has been substantially purified from other components which naturally accompany the DNA, e.g., DNA which has been purified from proteins which naturally accompany it in a cell.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments and from the claims. By "polypeptide" is meant any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation).
By "substantially identical" is meant a polypeptide or nucleic acid exhibiting at least 50%, preferably 85%, more preferably 90%, and most preferably 95% sequence identity to a reference amino acid or nucleic acid sequence. For polypeptides, the length of comparison sequences will generally be at least 10 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably 35 amino acids. For nucleic acids, the length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides.
Sequence identity is typically measured using sequence analysis software (e.g., Sequence analysis software package of the genetics computer group, university of Wisconsin biotechnology center, 1710 university avenue, Madison, WI 53705) . Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, substitutions, and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
By a "substantially pure polypeptide" is meant a Ssp polypeptide which has been separated from components which naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60% Ssp by weight. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, Ssp polypeptide. A substantially pure Ssp polypeptide may be obtained, for example, by extraction from a natural source (e.g. , Salmonella bacterium) ; by expression of a recombinant nucleic acid encoding a Ssp polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, e.g., using column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.
A protein is substantially free of naturally associated components when it is separated from those contaminants which accompany it in its natural state. Thus, a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components. Accordingly, substantially pure polypeptides include those derived from one type of prokaryotic organism, e.g., S . typhimurium, but synthesized in E. coli or another prokaryotic organism.
By "substantially pure DNA" is meant DNA that is free of the genes which, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence, e.g, a hybrid gene encoding a chimeric antigen.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
Detailed Description Fig. 1 is a diagram of the a genetic map of the 59-60 min region of the S . typhimurium chromosome and partial physical map of the restriction endonuclease sites of the prgH chromosomal region within the hil locus and related plasmids. The horizontal arrows indicate the direction of transcription of the orfl , prgH UK , and org genes and of the neomycin promoter of the Tn5B50 insertions within the hil locus. The vertical arrows indicate and the location of the predicted start of transcription of the prgHIJK operon (small arrow) and the location of the two Tn5B50 insertions that define the hil locus (large arrows) . The open triangle indicates the location of the prgHl::TnphoA insertion. Restriction endonuclease sites are as follows: B, BamHI; E, EcoRI ; H, Hindlll; S, Sacl; Ss, Sspl; V, .EcoRV; X, Xhol.
Fig. 2 is a photograph of a Northern blot assay in which the prgHIJK and orgr transcripts are identified. Blot hybridization of a prgH (A) , prgl-J (B) prgK (C) , org (D) , and pagC (E) DNA probe to RNA purified from wild-type (Wt) and phoP constitutive (Pc) S. typhimurium strains were grown aerobically to 0.5 optical density units. The bars indicate the RNA markers and are 9488, 6255, 3911, 2800, 1898, and 872 nucleotides (NT) in size from top to bottom.
Fig. 3 is a photograph of a primer extension analysis of RNA isolated from wild-type and PhoPc S. typhimurium strains by using an oligonucleotide primer IB08 corresponding to nucleotides 1217 to 1199 of the prgH sequence. Lanes labeled "AGCT" represent dideoxy DNA sequencing reactions. The lane labeled "wt" represents the products of a primer extension reaction initiated with primer IB08 and wild-type RNA as a template, and the lane labeled "pc" represents the products of a primer extension reaction initiated with the same primer and PhoPc RNA as a template. Reverse transcription of wild-type RNA with primer IB08 resulted in an approximately 270-nucleotide product corresponding to a predicted transcriptional start at nucleotide 949 of the prgH sequence. Abbreviations: wt, wild type strain
14028s; Pc, PhoPc strain CS022.
Fig. 4A is a diagram showing the similarity and alignment of prgl, mxiH, and yscF predicted gene products. Fig. 4B is a diagram showing the similarity and alignment of prgJ and mxil predicted gene products.
Fig. 4C is a diagram showing the similarity and alignment of prgK, mxiJ, and yscJ predicted gene products. For Figs. 4A-4C, residues conserved among each of the predicted gene products are indicated with a plus
(+) ; residues conserved among the prgrJ and either the mxiH or yscF predicted gene products and between the prgK and either the mxiJ or yscJ predicted gene products are indicated with an asterisk (*) . The location of the lipoprotein processing sites (Leu-Xaa-Gly-Cys) of the prgK, mxiJ, and yscJ predicted gene products are indicated by underlining. Predicted protein sequences were compared using the GCG BLAST network service and ALIGN program (Feng et al. , J. Mol . Evol . 35:351-360, 1987; Higgins et al. , CABJOS 5:151-153, 1989).
Fig. 5 is a photograph of a SDS-PAGE gel. Salmonella proteins found in the culture supernatant of stationary-phase S. typhimurium 14028s were compared to proteins isolated from lysed whole cells or cellular fractions (membranes or intracellular soluble proteins) . TCA precipitable material from 2 ml of supernatant from cultures of OD600 = 2.2 was used. The whole cell, membrane, and soluble lanes contained material from 0.10 ml, 0.35 ml, and 0.15 ml of cells, respectively. Proteins were fractionated in a 12% polyacrylamide gel by SDS-PAGE and stained with Coomassie Brilliant Blue R-250. The molecular masses of protein standards are indicated on the side of the gel as kDa.
Fig. 6 is a photograph of a SDS-PAGE gel showing a comparison of culture supernatant proteins from
S. typhimurium 14028s and culture supematants from mutants which are defective in eucaryotic signaling. TCA precipitable material from 2 ml of bacterial culture supernatant was isolated at different times following inoculation: mid-log, OD600 = 0.6; late-log / early-stationary, OD600 = 1.1; stationary, OD600 = 2.2. Proteins were fractionated in a 12% polyacrylamide gel by SDS-PAGE and stained with Coomassie Brilliant Blue R-250. The molecular masses of protein standards are indicated on the side of the gel as kDa. wt, wild type (14028s) ; pc, PhoPc (CS022); P", PhoP" (CS015) ; Ahil (CS451) , deleted for the hil locus.
Fig. 7 is a photograph of a SDS-PAGE gel showing an analysis of prgH::TnphoA and complementation of the insertion mutation by pWKSH5. TCA precipitable material from 2 ml of supernatant from stationary phase cultures was fractionated in a 10% polyacrylamide gel by SDS-PAGE. Protein was stained with Coomassie Brilliant Blue R-250. The molecular masses of protein standards are indicated on the side of the gel as kDa. wt, wild-type (14028s) ; IB040, prgHl : : nphoA; IB043, prgHl::TnphoA with plasmid pWKSH5 containing a 5.1 kb insert of S. typhimurium DNA including prgHIJK. Supernatant protein bands complemented by pWKSH5 are indicated by arrows (87 kDa and 65 kDa) and a bracket (three bands in the 35-40 kDa range) .
Fig. 8 is a photograph of a SDS-PAGE gel showing Salmonella secreted proteins (Ssp) concentrated from supematants of different strains. Each lane contains Ssp collected from 2 ml of culture supernatant. Lanes 1: wild-type S. typhimurium SL1344; 2: EE638 (lacZYll-6) ; 3: EE633 (lacZY4 ) ; 4: VB122 (hilA: :kan-112) ; 5: EE637 (invF: ι lacZYll-5) ; 6: IB040 (prgHl : :TnphoA) St: molecular weight standard. Sizes of protein bands are given in kDa. * marks a protein band which was variably present in different preparations of Ssp from the same strains.
Fig. 9 is a diagram showing the chromosomal organization of the sspBCDA genes and phenotypes of mutants εspC: : lacZY4 (EE633) and sspA: : lacZYll-6 (EE638) . The chromosomal location of ssp with respect to spaT and prgH is shown. An asterisk (*) indicates partially sequenced genes. Restriction sites in parentheses have only been mapped in the left region of the 11 kb .EcoRI fragment. Abbreviations of restriction sites are: E: EcoRI, B: BamHI, P: Pvull, N: Wcol. Invasion of epithelial cells by different S. typhimurium strains is given as the percentage of the bacterial inoculum surviving gentamicin treatment. Values represent means and standard errors of the means of three independent experiments, each performed in triplicate. Presence or absence of Salmonella secreted proteins SspA, SspC and SspD in culture supe atants of different strains is indicated by + or -, respectively. The molecular weights in kDa of these Ssp are shown in parentheses. Fig. 10 is a diagram showing a complementation analysis of EE638. Complementing fragments of chromosomal DNA in a low-copy plasmid are shown according to the chromosomal map. Designations of the plasmids are given in brackets on the left. The positions of the lac promoter (Pιac) are indicated. Δ indicates a deletion.
Fig. 11 is a photograph of an immunoblot analysis of various strains for expression and secretion of Ssp87. Total cellular proteins from bacteria collected from 0.2 ml of cultures were loaded in lanes designated "C", supematant proteins from 0.2 ml bacterial culture supematants were loaded in lanes designated "S". 1: wild type S. typhimurium; 2: CS022 (PhoPc) ; 3: IB040 (prgHl z :TnphoA) ; 4: CS451 (Δhil: :Tn5-428) ; 5: EE638 (sεpC: ι lacZYll-6) ; 6: EE633 (sspA: : lacZY4) . Fig. 12 is a diagram showing a comparison of the deduced partial amino acid sequence of SspB with the S. flexneri homologue IpaB. Bars indicate identical residues, dots indicate gaps introduced in order to maximize similarity according to the GAP program of the GCG package.
Fig. 13 is a diagram showing a comparison of the deduced amino acid sequences of SspC with the S. flexneri homologues IpaC. Bars indicate identical residues, dots indicate gaps introduced in order to maximize similarity according to the GAP program of the GCG package.
Fig. 14 is a diagram showing a comparison of the deduced amino acid sequences of SspD with the S. flexneri homologues IpaD. Bars indicate identical residues, dots indicate gaps introduced in order to maximize similarity according to the GAP program of the GCG package. Fig. 15 is a diagram of the amino-terminal sequence derived from the 5'-region of sspA . Amino acids determined by amino-terminal sequencing of SspC and SspA are underlined. Fig. 16 is a photograph of a SDS-PAGE gel showing total soluble Ssp collected from 2 ml of culture supematants of wild type S. typhimurium SL1344 and EE638 (εεpC: '. lacZYll-6) transformed with various plasmids. Lanes 1: SL1344 [pWSK29] ; 2: EE638 [pWSK29] ; 3: EE638 [pCH004 (sεpC) ] ; 4: EE638 [pCH005 (εεpCD) ] ; 5: EE638 [pCH006 (sεpD) ; 6: EE638 [pCH002 (sspCDA) ] ; 7: SL1344 [pCH002 (sspCDA) ] . Lanes 8 and 9 contain soluble Ssp from SL1344 [pWSK29] and EE638 [pWSK29] , respectively. The sizes of the protein bands are given in kDa. An asterisk (*) indicates a protein band which was variably present in different preparations of Ssp from the same strains.
Fig. 17 is a photograph of an SDS-PAGE gel showing insoluble Ssp precipitates collected from 2 ml of culture supematants of wild type S. typhimurium SL1344 and EE638
(sspC: '. lacZYll-6) transformed with various plasmids. Lanes 1: SL1344 [pWSK29] ; 2: EE638 [pWSK29]; 3: EE638 [pCH004 (sspC) ] ; 4: EE638 [pCH005 (εεpCD) ] ; 5: EE638 [pCH006 (sspD) ] ; 6: EE638 [pCH002 (sspCDA) ] ; 7: SL1344 [pCH002 (sspCDA) ] . Lanes 8 and 9 contain soluble Ssp from SL1344 [pWSK29] and EE638 [pWSK29] , respectively. The sizes of the protein bands are given in kDa. An asterisk (*) indicates a protein band which was variably present in different preparations of Ssp from the same strains.
Fig. 18 is a diagram showing the genetic organization of the invasion gene clusters from S. typhimurium and S. flexneri. The relative positions of each gene are indication and the directions of gene transcription are indicated by arrows. Arrows are not drawn to scale. Gene clusters conserved in sequence and gene order are indicated by stippling (inv-spa/mxi-spa) , crosshatching (prglJK/mxiHI] ) , and dark arrows (εsp/ipa) . Genes with no homologues within the respective regions are shown as open arrows.
Fig. 19 is a depiction of the nucleic acid sequence of SεpB (missing part of the 5' end) (SEQ ID NO:
1).
Fig. 20 is a depiction of the nucleic acid sequence of SspC (SEQ ID NO: 2) .
Fig. 21 is a depiction of the nucleic acid sequence of SspD (SEQ ID NO: 3) .
Fig. 22 is a depiction of the nucleic acid sequence of SspB (missing part of the 3' end) (SEQ ID NO: 4) and the predicted amino acid sequence SspB (partial c- terminal) (SEQ ID NO: 5).
Fig. 23 is a depiction of the predicted amino acid sequences of SspC (SEQ ID NO: 6), SspD (SEQ ID NO: 7), and SspA (partial animo terminal) (SEQ ID NO: 8) . Fig. 24 is a depiction of the nucleic acid sequences of iagB (SEQ ID NO: 9) and stpA (SEQ ID NO: 10) .
Fig. 25 is a depiction of the predicted amino acid sequences of iagB (SEQ ID NO: 11) and stpA (SEQ ID NO: 12).
Fig. 26 is a depiction of the nucleic acid sequence of prgH (SEQ ID NO: 13) .
Fig. 27 is a depiction of the predicted amino acid sequences of prgB (SEQ ID NO: 14) . Fig. 28 is a depiction of the nucleic acid sequence of SspBCDA (truncated at 3' and 5' ends) (SEQ ID NO: 15).
Fig. 29 is a depiction of the nucleic acid sequence of prgH and 5' and 3' flanking sequences (SEQ ID NO: 16) . Ssp Proteins and Genes
The Salmonella secreted proteins (Ssp) of the invention have a variety of uses. For example, they can be used as diagnostic reagents, therapeutic agents, and research products. The genes encoding Ssp also have a variety of uses. For example, they can be used as diagnostic reagents. They can also be used to create vaccines including live attenuated vaccines.
Because Salmonella infection is a significant health problem and because Ssp proteins are soluble proteins that are found on the surface of Salmonella , various Ssp, DNA encoding various Ssp, and antibodies directed against various Ssp are useful in diagnostic assays. Because Ssp are required for optimal virulence, DNA encoding a mutant Ssp having decreased function can be used to create strains of Salmonella with reduced virulence. Such strains are useful as live vaccines.
An Ssp (or a portion thereof which can gain entry into the cytoplasm) can be used to translocate a second molecule, e.g. , a polypeptide, into the cytoplasm of a cell. This approach can be useful for the induction or priming of cytotoxic lymphocytes (CTL) directed against the second molecule. An Ssp (or a portion thereof capable of translocating an attached second molecule) can be used to introduce a second molecule into the cell cytoplasm for the purpose of drug delivery. Often the second molecule is a polypeptide which is covalently linked to an Ssp (or a portion thereof), e.g., by a peptide bond. Such molecules can be readily produced first preparing a chimeric gene encoding the Ssp (or portion thereof) and the second molecule as a single polypeptide chain. This gene can be used to prepare the fusion protein for administration to a patient. Alternatively, the chimeric gene can be introduced into a strain of Salmonella which can then be used as either a live vaccine or drug delivery system. Ssp as Diagnostic Reagents
An Ssp can be used as a diagnostic tool for the detection of Salmonella infection in a patient or to evaluate status of an immune response to Salmonella . For example, one or more Ssp can be used an antigen in an ELISA assay to detect the presence of Salmonella-specific antibodies in a bodily fluid, e.g., blood or plasma, obtained from an infected patient or an individual suspected of being infected with Salmonella . Ssp can also be used to test immune cell activation, e.g., T or B cell proliferation or cytokine production, in a sample of patient-derived cells, e.g., peripheral blood mononuclear cells, to detect the presence of a cellular immune response to Salmonella .
Polynucleic acids (e.g. , primers and probes) encoding all or part of an Ssp can be used in hybridization assays to detect the presence Salmonella infection, e.g., using a PCR assay or other probe or primer based assay designed to detect particular DNA sequences.
Antibodies capable of selectively binding a particular Ssp can be used to detect the presence of Salmonella in a biological sample. Such antibodies can be produced using standard methods. Therapeutic Applications of SSP Fusion Proteins
Fusion proteins comprising all or part of an Ssp and a second protein or polypeptide are useful for a variety of therapeutic applications such as vaccines (e.g., recombinant Salmonella vaccines or vaccines against heterologous pathogens) , cell targeting agents for delivery of drugs (e.g., cytotoxic agents), and adjuvants, (e.g., to boost an immune response to a co- administered antigen) . To produce a recombinant Salmonella -vaccine , a gene encoding an Ssp fusion protein can be introduced into a Salmonella vaccine. Because Ssp are involved in bacterial mediated endocytosis, the Ssp fusion protein will cause the second polypeptide or protein to be internalized by epithelial cells (or other cells to which the Ssp binds) of the individual to which the vaccine is administered. This intemalization can trigger a Type I MHC-mediated response to the second protein or polypeptide. The induction of this response will lead to the induction of CTL (or the priming of CTL) specific for the second protein or polypeptide. The induction or priming of antigen-specific CTL can provide therapeutic or prophylactic benefits. Purified fusion proteins can be used as recombinant vaccines. Proteins fused to Ssp are specifically targeted to epithelial cells or other cell types to which the Ssp bind; the fusion proteins are then internalized by the targeted cells. Thus, Ssp fusion proteins are useful to generate an immune response to the antigen to which the Ssp is linked or to deliver a therapeutic compound, e.g. , a toxin for the treatment of cancer or autoimmune diseases in which the killing of specific cells, i.e., the cells to which a Ssp binds, is desired. Delivery of a toxin linked to a SspC or SspD polypeptide is especially useful in cancer therapy because man types of cancers are of epithelial cell origin.
Ssp fusion proteins which contain all or part of a Ssp linked to a heterologous protein can be made using methods known in the art. Two or more polypeptides may be linked together via a covalent or non-covalent bond, or both. Non-covalent interactions can be ionic, hydrophobic, or hydrophilic. A covalent linkage may take the form of a disulfide bond. For example, the DNA encoding one of the polypeptides can be engineered to contain a unique cysteine codon. The second polypeptide can be derivatized with a sulfhydryl group reactive with the cysteine of the first component. Alternatively, a sulfhydryl group, either by itself or as part of a cysteine residue, can be introduced using solid phase polypeptide techniques. A number of other covalent crosslinking agents, e.g., photoreactive crosslinkers, water-soluble crosslinkers, which are commercially available may be used to join a heterologous polypeptide to a Ssp to create a fusion protein. If the fusion protein is produced by expression of fused genes, a peptide bond serves as the link between the components of the fusion protein. Such fusion proteins are produced by expression of a chimeric gene in which sequences encoding all or part of an Ssp are in frame with sequences encoding the second protein or polypeptide. In some circumstances it may be useful to include a linker polypeptide between the Ssp and second protein of polypeptide.
Intemalization of the fusion protein may not require the presence of a complete Ssp protein. A internalization-competent portion of an Ssp will be adequate in many circumstances. Whether a particular portion of a selected Ssp is sufficient for intemalization can be tested as follows. The selected portion of an Ssp is fused to a calmodulin-dependent adenylate cyclase. If this test fusion protein ii internalized, it will be exposed to calmodulin and the cylcase will be activated. The presence of adenylate cyclase activity can then be used as a measure of intemalization. This general approach is described by Sorg et al. (Molecular Mcrobiol . 14:583-94, 1994). Ssp are virulence factors that alter the ability of bacteria to be internalized by specific populations of host cells and to induce an immune response. Salmonella with mutations in genes encoding Ssp are useful in the manufacture of live Salmonella vaccines with altered cell tropism.
Deletion or overexpression of Ssp in Salmonella can be used to target strains or fusion proteins to various mammalian cell types. Invasion of epithelial cells or macrophages can be selected depending on the Ssp mutated. For example, use of Salmonella as an antigen or drug delivery vehicle can be optimized by deleting part or all of a gene encoding a Ssp involved in bacterial mediated endocytosis (or mutating such a gene to impair Ssp function) , thereby minimizing the ability of Salmonella to invade epithelial cells (and therefor maximizing antigen delivery to antigen presenting cells such as macrophages) . In this manner, strains with mutated Ssp genes can be used to modulate the host immune system. Deletion of Ssp genes in Salmonella can also be used to alter the ability of Salmonella to stimulate IL-8 secretion by epithelial cells.
Fusions of antigens to Ssp genes can be used to facilitate an immune response to the linked antigens for the purpose of generating an antigen-specific cytotoxic T cell response in a patient. For example, Ssp fusions to viral antigens are useful as therapeutic vaccines for diseases such as AIDS and Herpes genitalis in which the generation of a cytotoxic T cell (CTL) response is desired. Delivery of antigens in this manner favors the generation of an antigen-specific CTL response because the Ssp portion of Ssp fusion protein mediates translocation of the fusion protein across eucaryotic cell membranes into the intracellular compartments in the cytoplasm of cells which participate class I MHC-mediated antigen processing and presentation, i.e., the generation of class I MHC-restricted antigen-specific CTLs.
Fusion proteins which include all or part of a Ssp linked to a cytotoxic molecule can be used to target a cytotoxic molecule to a specific cell type, e.g., an epithelial cell-derived cancer cell, which would then by killed by the cytotoxic agent. Cytotoxic fusion proteins can be synthetically or recombinantly produced and administered directly to a patient. Alternatively, live Salmonella expressing a cytotoxic Ssp fusion protein can be administered and allowed to produce and secrete the fusion protein in vivo .
Ssp are also useful as adjuvants to boost the immunogenicity of antigens with which they are delivered or to which they are chemically or recombinantly linked. Ssp that have enzymatic effects, e.g., phosphatase activity, on certain types of eucaryotic cells can be used to promote specific types of immune responses such as TH2 or THI T cell responses. Since these proteins are secreted and are likely taken up in the cytoplasm of eucaryotic cells, gene fusions to these proteins are likely to be more immunogenic and more efficient in inducing the development of an immune response, particularly a class I MHC-restricted CTL response. Various oral and parenteral delivery systems are known in the art and can be used to deliver the Ssp polypeptides and/or chimeric antigens of the invention, such as encapsulation in liposomes, or controlled release devices. The compositions of the invention can be formulated in a pharmaceutical excipient in the range of approximately 10 μg/kg and 10 mg/kg body weight..
The compositions and methods of the invention provide the tools with which to construct better vaccines against Salmonella infection and for the prevention and treatment of other diseases, e.g., cancer and AIDS, by using Salmonella secreted proteins as carriers of heterologous antigens, e.g., tumor antigens or viral antigens, either as purified components or as hybrid proteins produced in live Salmonella vaccine strains. Ssp and Attenuated Bacterial Strains
Deletion or mutation of one or more Ssp genes can be used to attenuate vaccine strains. For instance deletion of Ssp genes leads to lack of neutrophil transmigration across epithelial cell monolayers (a model system that correlates well with the ability of certain strains to cause gastroenteritis) .
Vaccine strains are usually administered at doses of 1 x 105 to 1 x IO10 cfu/single oral dose. Those skilled in the art can determine the correct dosage using standard techniques. Research products
Ssp with enzymatic activity, e.g. , Salmonella tyrosine phosphatase (stpA) , can be used as reagents for protein modification. StpA catalyzes the release of phosphate groups from tyrosine residues in proteins, and thus, is especially useful in the field of signal transduction. Since a number of eucaryotic and procaryotic signal transduction proteins are regulated by the phosphorylation and dephosphorylation of tyrosine residues, stp can be used to deactivate or activate these proteins, thereby altering intracellular signal transduction. Thus, Stp can be used as a research tool to study and evaluate phosphorylation-regulated signal transduction pathways. Modification of Ssp and Ssp Variants
When an Ssp is being used to translocate a second molecule into a eukaryotic cell, it may be useful increase expression of the Ssp (or Ssp fusion protein) so that BME is increased. Increased expression of sspC, sspD and other sεp genes may be accomplished using methods known in the art, e.g., by introducing multiple copies of the gene(s) into the bacterial cell or cloning the Ssp-encoding DNA under the control of a strong promoter. Under other circumstances it may be desirable to increase uptake of a bacterial strain, e.g., a Salmonella strain, by a macrophage in a mammal by impairing the normal invasion mechanism of the strain. This can be accomplished by decreasing expression of the DNA encoding the SspC and/or SspD (and thereby decreasing secretion of Ssp and/or SspD polypeptides) and administering the cell to the mammal. Ssp expression may be reduced using methods known in the art, e.g., insertion of a transposon (Tn) into the gene, deletion of some or all of the gene, mutating a gene upon which SspC and/or SspD expression depends, e.g., prgH, e . g . , a deletion or Tn insertion in the prgHIJK operon. Instead of decreasing the expression of sspC and/or sspD, the method may include the step of impairing the function of one or both of the gene products, e.g., by Tn insertion, deletion mutagenesis, or by impairing the secretory pathway by which the gene products are secreted such that the gene products are produced but not effectively transported to the extracellular environment.
Example l: PhoP/PhoO Transcriptional Repression of
S. typhimurium Invasion Genes: Evidence for a Role in Protein Secretion
The PhoP-repressed prgH locus of S. typhimurium may be important for signaling epithelial cells to endocytose S. typhimurium. The following series of experiments demonstrate that the prgH locus is an operon of four genes encoding polypeptides of 392 amino acids (prgH) , 80 amino acids (prgl) , 101 amino acids (prgJ) , and 252 amino acids (prgK) . These experiments also demonstrate that expression of the 2.6-kb prgHIJK transcript is reduced when PhoP/PhoQ is activated, suggesting that PhoP/PhoQ regulates prgHIJK by transcriptional repression. Further, analysis of the culture supematants from wild-type S. typhimurium revealed the presence of at least 25 polypeptides larger than 14 kDa. Additional experiments demonstrated that prgHl : :TnphoA, phoP constitutive (PhoPc) , and hil deletion mutants have significantly defective supematant protein profiles. A further set of experiments described below demonstrate that both the invasion and supernatant protein profile defects of the prgHl : :TnphoA mutant can be complemented by a 5.1 kb plasmid that included prgHIJK. Taken together these results suggest that PhoP/PhoQ regulates extracellular transport of proteins by transcriptional repression of secretion determinants and that secreted proteins are likely involved in signaling epithelial cells to endocytose bacteria.
The following reagents and procedures were used to evaluate the prgH locus.
Bacterial Strains, Growth and Conditions
S. typhimurium strain ATCC 14028s (American Type Culture Collection, Bethesda, MD) is a virulent wild-type parent strain from which all other Salmonella strains described in Example 1 were derived. Bacterial strains and plasmids are described in Table 1. Luria-Bertani broth (LB) was used as rich bacterial growth medium. Antibiotics were added to LB broth or agar in the following concentrations: ampicillin, 25 μg/ml; chloramphenicol, 50 μg/ml; kanamycin, 45 μg/ml.
DNA sequencing and analysis
Double-strand templates were sequenced by the dideoxy-chain termination method known in the art as modified for use with Sequenase™ (US Biochemicals, Corp.) and [α-35S]dATP. Computer analysis of the DNA sequence was accomplished with the GENEPRO (Riverside Scientific, Riverside, CA) and Wisconsin package (GCG, version 7) programs. The nucleotide sequence of the prgHIJK locus has been deposited in GeneBank under accession number U21676.
RNA extraction. RNA blot analyses, and primer extension analyses
RNA was isolated from mid-log phase cultures (OD600 = 0.5) of aerobically-grown (with shaking) and microaerophically-grown (without shaking) Salmonella strains using a standard hot phenol procedure (Pulkkinen et al., J . Bacteriol . 173:86-93, 1993). For RNA blots, 20 μg of RNA was diluted in H20 and incubated for 15 minutes at 55°C in 50% formamide, 17.5% formaldehyde in 1 x Northern buffer (0.36 M Na2HP04-7H20, 0.04 M
NaH2P04-H 0) . Samples were run on 1% agarose gels containing 6% formaldehyde and 1 x Northern buffer and were transferred to Gene Screen Plus membranes (NEN/Dupont) . RNA was crosslinked to the membrane using a Stratalinker™ UV crosslinker (Stratagene, La Jolla, CA) . Membranes were hybridized and washed according to the manufacturer's protocol.
The DNA probes for RNA-DNA and DNA-DNA blot hybridization were obtained from recombinant plasmid DNA by restriction endonuclease digestion or by polymerase chain reaction (PCR) using the GeneAmp™ PCR kit (Perkin-Elmer/Cetus) . The following DNA probes were synthesized: a 841-bp prgH probe from the oligonucleotide primers IB07 (5'-CCAGGTGGATACGGA-3' ; SEQ ID NO: 17; nucleotides 1198 to 1212) and IB19
(5'-TAGCGTCCTCCCCATGTGCG-3' ; SEQ ID NO: 18; nucleotides 2039 to 2021) ; a 433-bp prgl-prgJ probe from the primers IB26 (5'-CCGGCGCTACTGGCGGCG-3' ; SEQ ID NO: 19), nucleotides 2304 to 2321) and DP04 (5ΑGCGTTTCAACAGCCCCG-3'; SEQ ID NO: 20), nucleotides 2737 to 2719) ; a 341-bp prgK probe from primers DP03 (5'-CGGGGCTGTTGAAACGC-3' ; SEQ ID NO: 21), nucleotides 2720 to 2736) and DP08 (5'-AACCTGGCCTTTTCAG-3' ; SEQ ID NO: 22), nucleotides 3060 to 3045); a 724-bp org probe from primers DP15 (5'-GGCAGGGAGCCTTGCTTGG-3' ; SEQ ID NO: 23), nucleotides 3774 to 3792) and DP17
(5'-GTGCCTGGCCAGTTCTCCA-3' ; SEQ ID NO: 24); and a 608-bp pagC probe from a Psi and StuI restriction-endonuclease digest of pWPL4 that contains the wild-type pagC gene. DNA probes were radiolabelled using a standard method of random priming with [α-32P]dCTP.
For primer extension analyses, oligonucleotide primers (0.2 picomoles) were end-labelled with [γ-32P]dATP (NEN/Dupont) , annealed to S. typhimurium RNA (20μg) and extended with reverse transcriptase (Gibco BRL, St. Louis, MO) . Reactions were electrophoresed in 6% polyacrylamide, 8 M urea gels adjacent to sequencing reactions initiated with primers used for cDNA synthesis. DNA blot hybridization analysis Chromosomal DNA was isolated, restriction endonuclease digested, size fractionated in agarose gels, and transferred to GeneScreen Plus membranes (NEN/Dupont) . For dot blot hybridization experiments, high stringency hybridization was performed according to standard methods at 65°C using radiolabelled probes. Protein isolation and analysis
Bacteria were grown in LB, with shaking at 37°C. Bacterial cultures were chilled to 4°C and centrifuged at 154,000 x g for 1.7 hours. The supematant was carefully removed and trichloroacetic acid (TCA) was added to a final concentration of 10%. The precipitates were collected by centrifugation at 69,000 x g for 1 hour, rinsed with cold acetone, dried and stored at 4°C. The bacterial cell pellet was fractionated to obtain periplasmic, cytoplasmic, and membrane fractions. Samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10-12% polyacrylamide (0.1 M Tris pH 8.45, 0.1% SDS) gel using a standard Tris-glycine buffer system or standard Tris-tricine buffer system. TCA precipitates were mixed with sample buffer (250 mM Tris pH 6.8, 2% SDS, 0.0025% bromophenol blue, 5.0% β-mercaptoethanol, 10% glycerol) and heated to 100°C for 5 minutes. Proteins were visualized by staining with Coomassie Brilliant Blue R-250. Enzyme assays
Presence of the marker enzymes, alkaline phosphatase (periplasm) and ^-galactosidase (cytoplasm) were used to assess fraction purity. A plasmid, pPOS3, containing an arabinose-inducible phoA gene, was inserted into wild-type strain 14028s by transformation and moved into other strains using P22 bacteriophage-mediated transduction. Addition of arabinose (0.02%) to the culture medium induced transcription of the phoA gene. Determination of alkaline phosphatase activity of strains containing pPOS3 was performed using the substrate p-Nitrophenyl phosphate according to standard methods. The results were expressed in standard units for β-galactosidase (Miller, J.H., 1972, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp. 352-355) . 3-galactosidase waε produced from a strain with a udJ-generated gene fusion of msg and lacZ . The gene, msg, is constitutively expressed and not PhoP regulated, β-galactosidase activity of strains carrying msg: :MudJ was measured using routine methods (Miller et al., supra) . Table 1. Bacterial strains. plasmids and relevant properties
S. typhimurium Relevant genotype
ATCC 14028s Wild Type CS002 pho-24
CS019 phoN2zxx: : 6251Tnl0d-Cm
IB040 CSO19 with prgHl : : TnphoA
IB043 IBO40 with pWKSH5
CSO15 phoP-102 : : Tnl0d-Cm CS451 14028s derivative of EE451 with hil
Escherichia coli
DH5α F~ 8 dlacZΔM15Δ (lacZYA-argF)U169endAl recAlhsdR17deoRthi-lsupE44λgyrA96relAl
Plasmids pIBOl: pUC19 (ampR) containing a 10.7-kb EcoRV fragment with prgHl : : TnphoA (kanR) pVB3 pUC19 containing a 5.9-kb Hindlll-EcoRI fragment of the prgH locus pWKSHS pWKS30 (ampR) containing a 5.1-kb Hindlll fragment of prgH locus pWPL4 pUC19 containing a 5.0-kb .EcoRV fragment of the pagC locus pP0S5 pBR322 containing arabinose-inducible PhoA
Cloning and sequencing of prgH The DNA containing the prgHl : :TnphoA gene fusion was cloned based upon information derived from the physical map of restriction endonuclease sites surrounding the transposon insertion (Fig. 1) (Behlau et al., J. Bacteriol . 175:4475-4484, 1993, hereby incorporated by reference) . Chromosomal DNA from strain IB040 containing the prgHl::TnphoA insertion was digested with the restriction endonuclease EcoRV and ligated into Smal digested pUC19 to generate a library of recombinant plasmids. These recombinant plasmids were transformed into Escherichia coli (E . coli) DH5α. A recombinant plasmid containing a 10.7 kb EcoRV fragment was identified by selecting for kanamycin reεistance (TnphoA encoded) and waε deεignated pIBOl (Fig. 1) . DNA hybridization analysis of strain IB040 with a radiolabelled 1.5-kb Hindlll-SacI-generated DNA fragment of pIBOl resulted in hybridization to an approximately 10.7-kb .EcoRV DNA fragment. This was approximately 7.7 kb (the size of TnphoA) larger than the 3-kb fragment present in the wild-type strain ATCC 14028s. This probe also hybridized strongly to plasmid pVB3 that contained the 5.9 kb HindiII-EcoRI fragment of the hil locus (Fig. 1) , confirming the location of the prgH locus within this region. This data indicated DNA containing the prgHl::TnphoA insertion had been cloned.
The DNA sequence of the 4,034-bp Hindlll-Sspl fragment (within which the TnphoA insertion in prgH was localized) was determined by sequencing plasmid pIBOl containing the cloned prgHl : :TnphoA allele. This sequence was confirmed by DNA sequencing of pWKSHS containing the wild-type prgH allele (Fig. 1) . Information from DNA sequence of the prgHl : : phoA fusion junction was used to determine the direction of transcription and correct reading frame of prgH. TnphoA was inserted after nucleotide 1548 within an open reading frame that extended from nucleotides 981 to 2156. prgH was predicted to encode a 392 amino acid polypeptide with a calculated Mr of 44,459 daltonε and pi of 5.86. The
N-terminal portion of prgH was found to have a stretch of nonpolar residues followed by the motif Leu-Xaa-Gly-Cys at residues 24 to 27 (corresponding to nucleotides 1050 to 1061) characteristic of the processing site of bacterial lipoproteins. There was a strong hydrophobic domain (amino-acid residue 144 to 154, corresponding to nucleotides 1410 to 1433) upstream of the TnphoA insertion.
Analysis of the nucleotide sequence located upstream of prgH revealed an additional open reading frame from nucleotides 665 to 222, termed orfl , likely to be oppositely transcribed from prgH. The intergenic region between orfl and prgH was 216 nucleotides. orfl was predicted to encode a gene product of 148-amino-acid residues with a calculated Mr of 17,186. The start codon of orfl was preceded by a potential ribosome binding site at 7 to 11 nucleotides 5' to the predicted start of translation (5'-AAAGG-3' , nucleotides 676 to 672) suggeεting that thiε open reading frame waε translated. The orfl predicted gene product had no signal sequence nor any strong hydrophobic domains. Identification of prgl . praJ. and prσK
Analysis of the nucleotide sequence located downstream from prgH revealed four additional open reading frames that were predicted to be transcribed in the same direction and form an operon: (a) nucleotides 2184 to 2423; (b) nucleotides 2445 to 2747; (c) nucleotides 2747 to 3502; and (d) nucleotide 3476 to beyond the 3' Sspl site. The first three of these four open reading frames identified were designated prgl, prgJ, and prgJ respectively, prgl , prgJ, and prgK were predicted to encode gene products of 80 amino acids (Mr, 8865 daltonε) , 101 amino acidε (Mr, 10,929 daltonε) , and 252 amino acids (Mr, 28,210 daltons). The predicted gene products encoded by prgJ and prgJ" did not contain a signal sequence or strong hydrophobic domains. The predicted gene product encoded by prgK contained a N-terminal hydrophobic region followed by a potential lipoprotein processing site from amino-acid residue 15 to 18 (corresponding to nucleotides 2788 to 2800) . The fourth open reading frame corresponded in DNA sequence to the S. typhimurium oxygen-regulated gene (org) . praH-K transcription is negatively regulated bv PhoP/PhoQ To determine whether prgH was negatively regulated by PhoP/PhoQ, RNA isolated from wild-type (ATCC 14028s) and PhoPc (CS022) strains of S. typhimurium were analyzed. In numerous RNA blot analyses, the prgH-specific DNA probe hybridized with an approximately a 2600-nucleotide RNA from the wild-type strain (Fig. 2) . The size of the RNA that hybridized to the prgH probe was similar to that of the prgH-K open reading frame predicted from the DNA sequence (i.e., 2600 vs. 2522 nucleotides) . In contraεt, no transcript was seen when equal amounts and similar quality of RNA (as assessed by methylene blue staining) isolated from the PhoPc strain was probed with prgH-specific DNA (Fig. 3) . In comparison, when the same RNA preparations were hybridized with a pagC-specific probe, an approximately 1100-nucleotide pagC transcript was highly expreεsed in the PhoPc strain (Fig. 2) , consistent with the constitutive phenotype of pag gene expression in the PhoPc mutant (Pulkkinen et al., J. Bacteriol . 173:86-93, 1991, hereby incorporated by reference) . These results indicate that regulation of prgH occurs at the level of transcription.
Primer extension analysis was performed to obtain information on the possible initiation site of prgH transcription. Based on this analysis, the start of prgH transcription was predicted to begin approximately 32 nucleotides upstream from the prgH translational start (Fig. 3) . Several different primers were used that resulted in primer extension products of differing lengths, but all predicted that transcription initiated at this site. The predicted -10 (5'-TAATCT-3' ) and -35 (5'-TTCATC-3') regions are similar to the consensus sequences for typical α70 E. coli promoters. Similar to the resultε of RNA blot hybridization analyεis, a primer extension product was detected only with RNA isolated from wild-type S. typhimurium and not with RNA isolated from the PhoPc strain (Fig. 3) . The εize of the RNA that hybridized to the prgH-εpecific probe εuggeεted that prgH-K could form a tranεcriptional unit. Therefore, to determine whether prgl-K formed an operon that was regulated by PhoP/PhoQ, RNA blot hybridization and primer extension analyεiε were performed using DNA probes and primers specific to the prgl, prgJ, and prgK open reading frames. Similar to the resultε with prgH, the prgl-J- and prg -εpecific DNA probes hybridized with an approximately 2600-nucleotide RNA isolated from wild-type S. typhimurium and not with RNA from the PhoPc strain (Fig. 2) . No primer extension products leεε than 350 nucleotideε were detected uεing RNA isolated from either the wild-type or PhoPc strains using prgl , prgJ , and prgK primers. Theεe primers were from 1662 to 2332 nucleotides downstream from the predicted start of prgH transcription. These findings indicated that prgH-K were transcribed as an operon, heretofore referred to as prgHIJK. Furthermore, this operon was likely to be transcribed from the prgH promoter and was negatively regulated by PhoP at the level of transcription. org is not regulated by PhoP/PhoQ
Although the above reεults suggested that the prgHIJK transcriptional unit did not include org, experiments were performed to test this possibility. Blot hybridization analysis was performed with RNA isolated from wild-type S. typhimurium and an org-specific DNA probe. As shown in Fig. 2, two distinct transcriptε hybridized to the org probe: an approximately 1 00-nucleotide abundant RNA and a minor RNA of approximately 3800 nucleotideε. The size of the smaller RNA was εimilar to that of the org open reading frame (1400 vs. 1236 nucleotides). In comparison, only the major 1400-nucleotide RNA was seen when RNA from the PhoPc strain was hybridized with the org-specific DNA probe, εuggeεting that the 3800-nucleotide RNA waε PhoP repreεsed.
A minor RNA of approximately 3800 nucleotides also was detected in long exposure of wild-type RNA blots that were hybridized with either the prgH, prgl-J , or prgK probes, suggesting possible cotranscription of prgHIJK and org . However, both the major (1400 nucleotide) and minor (3800 nucleotide) transcripts were detected when RNA isolated from the prgHl : :TnphoA strain was hybridized with the org probe, indicating that the prgHl::TnphoA insertion was not polar on either of the org transcripts. Because expression of an org: : lacZY fusion was shown to be increased approximately fourteen fold in low-oxygen compared with high-oxygen tension, RNA from wild-type and PhoPc strains that were grown aerobically or microaerophically to an optical density at 260 nm of 0.5 were compared by blot hybridization with the org-specific DNA probe. No substantial difference was seen in the relative amounts of RNA transcriptε detected in wild-type or PhoPc εtrainε grown under theεe conditions. These data indicate that org did not form part of the prgHIJK operon and that it was not regulated by PhoP/PhoQ.
The prgl. prgJ, and prgK predicted polypeptides are similar to S. flexneri Mxi and Y. enter ocol it ica Yεc proteins
The sequences of the five predicted polypeptides (PrgH, Prgl, PrgJ, PrgK, and Orfl were compared with the protein sequences translated from the GeneBank library uεing BLAST network software. This comparison revealed similarity between the predicted products of prgl, prgJ , and prgK and the MxiH, Mxil, and MxiJ proteins of S. flexneri . Each of the these polypeptide sequences were similar over their entire length, with 65% (Prgl vs. MxiH), 38% (PrgJ vs. Mxil), and 46% (PrgK vs. MxiJ) of positions occupied by identical residues (Figs. 4A-4C) . The prgJ and prgK predicted gene products were also similar to the YscF and YscJ proteins, respectively, of Y . enterocolitica , with 28% and 308 of positionε occupied by identical residues. The Poisson probabilities were highly significant for each of these comparisonε. No protein εimilar to the prgH or orfl predicted polypeptideε waε detected in the protein sequence library. Isolation of proteins from S . typhimurium culture supematants
The role of prgHIJK in S. typhimurium protein secretion was analyzed by examination of the proteins present in cell culture supernatant. Culture media of wild-type bacteria was collected for protein analysis by centrifuging stationary phase cultures at 154,000 x g for 1.7 hours. From 6-8 μg/ml of protein was precipitated by addition of trichloroacetic acid (TCA) to ovemight culture supematants. The TCA-precipitable material in 2 ml of supernatant then was fractionated by sodium dodecyl εulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 5) . Approximately 25 protein bands, ranging in molecular mass from 18-87 kDa, were detected by Coomassie brilliant blue staining. To rule out the possibility that the supernatant protein bands represented proteins released from lysed cells, soluble and membrane fractions of whole cells and whole cell lysates were compared with proteins from the supematant by SDS-PAGE (Fig. 5) . Many of the major polypeptides in the supematant (e.g., the polypeptide with molecular mass of 87 kDa) were not the major proteins in the other cellular fractions. Conversely, major intracellular soluble proteins and membrane proteins (e.g., the 36 kDa OmpC porin) were not detected in the supernatant in this analysis. In addition, following centrifugation, the overnight culture media from bacteria expressing alkaline phosphatase (a periplasmic protein) and /3-galactosidase (a cytoplaεmic protein) alwayε contained less than 9% and 1%, respectively, of the whole-cell activity of these enzymes. Although some of the supematant protein bands may represent degradation products of larger protein species, theεe data indicate that S. typhimurium waε capable of significant protein secretion. To determine the timing of release of polypeptides in to the supernatant and to test for an effect of PhoP regulon mutations on εecretion, supematants from CS015, with a null mutation in PhoP (PhoP-) , CS022 (PhoPc) , and wild-type bacteria (ATCC 14208s) were compared. As shown in Fig. 6, the quantity of protein increased for each strain when supernatant samples taken from mid-log-phase (OD600 = 0.6), late-log/early-stationary-phase (OD600 = 1.1), and stationary-phaεe (OD600 = 2.2) were compared. However, the pattern of major protein bands detected for each strain was unchanged from mid-log to stationary phaεe (Fig. 6) .
Altered supernatant protein profiles of mutantε defective in εignaling epithelial cells
At each phase of growth examined, a similar pattern and quantity of protein was detected in the culture supematants of PhoP" εtrain CS015 and wild-type bacteria (Fig. 6) . In contrast, the protein level of 2 ml of PhoPc strain CS022 supernatant was 24% of wild type levels. At least 10 major protein bands seen in the wild-type supernatant were greatly reduced or undetectable by Coomassie blue staining of the CS022 supernatant, especially those of higher molecular weight (Fig. 6) . In addition, four major protein bands appeared to be increased in amount in CS022 compared with wild-type supernatant (31.5 kDa, 30 kDa, 23 kDa, and 20 kDa) (Fig. 6) . Although this result could be due to degradation of higher molecular weight polypeptides, these data suggest that the PhoPc mutant likely was defective in synthesiε or secretion of Ssp. The defect observed with the PhoPc mutant was consistent with prg gene products having a role in protein secretion. Therefore, the Ssp of strains having transposon insertion or deletion of prgHIJK were compared to wild-type bacteria (ATCC 14028s) by SDS-PAGE. As observed for the PhoPc mutant, IB040 (prgH ::TnphoA) and CS451, containing a 10-kb deletion of hil locus ( hil ) DNA, each had a pronounced defect in their Ssp profile compared with the wild-type strain (Fig. 6 and 7) . IB043 and CS451 culture supematants contained 100% and 62%, respectively, of wild-type protein levels. At least 5 and 11 major protein bands seen in the wild-type supernatant were greatly reduced or undetectable by Coomasεie blue εtaining of the IB040 and CS451, reεpectively. Five protein bandε [87 kDa, 65 kDa, and three in the 35-40 kDa range (Fig. 7) , two of which run as a doublet under different electrophoretic conditions (Fig. 6)] were undetectable in the supematants of CS022, IB040, and CS451. These findings indicated that the presence of at least εome of the productε of the prgHIJK operon were neceεεary for synthesis or secretion of Ssp. The defect in bacterial mediated endocytosis associated with prgHl::TnphoA was complemented by a low-copy number plasmid, pWKSHS, containing a 5.1-kb fragment including prgHIJK, org, and orfl . Consistent with this observation, the prgHl::TnphoA mutant carrying pWKSH5 (strain IB043) had a supernatant protein profile similar to that of wild type (Fig. 7) . Of the five protein bands undetectable or greatly reduced in culture supematants of prgHl : :TnphoA, each was detected in IB043 and three of them were increased in amount (87 kDa, 65 kDa, and 35 kDa) compared with wild-type supematants. This finding demonstrateε a correlation between the ability to secrete proteins and induction of epithelial cell bacterial mediated endocytosis. The prgH locus is important for S. typhimurium to induce endocytosiε by epithelial cellε
The defect in BME of the prgHl::TnphoA mutant iε complemented by a plaεmid containing 5.1 kb of DNA from this region, indicating that the gene or genes disrupted by the prgHl : :TnphoA insertion are important for BME. Analysis of the DNA sequence of this region identified six potential open reading frames that could be affected by this transpoεon insertion. As depicted in Fig. 1, five of these open reading frames, namely those designated prgH-K are either disrupted (i.e., prgH) or are 3' to the prgHl::TnphoA insertion. The orfl translational start is 884 nucleotides upstream from the TnphoA insertion and that orfl is predicted to be oppositely transcribed from the prgHIJK operon. An approximately 2600 nucleotide PhoP-repressed transcript was detected when RNA was hybridized with prgH- , prgl-J- , or prgK-specific DNA probes. In contrast, the predominant transcriptε detected with org waε smaller (approximately 1400 nucleotides) , was not altered in the prgHl : :TnphoA mutant, and was not repressed by PhoP. Primer extension analysis of the potential start site of transcription, the size of the prgHIJK transcript, and the presence of a potential transcriptional terminator immediately downstream of prgK also were consiεtent with tranεcription terminating before org.
In addition to the major transcripts of prgHIJK and org, a minor PhoP-repressed transcript of approximately 3800 nucleotides also waε detected in multiple RNA blotε hybridized with the org and prgH, prgl-J, or prgK DNA probes. This minor RNA was similar in size to the combined prgHIJK and org open reading frames (i.e., 3731 nucleotideε) and, thus, could represent cotranscription of prgHIJK and org. However, both the 3800- and 1400-nucleotide transcripts were detected in RNA from the prgHl::TnphoA mutant suggesting that the 3800-nucleotide RNA did not represent cotranεcription of prgHIJK and org. These data indicate that one or more genes in the prgHIJK operon are important to BME of epithelial cells.
A PhoP constitutive mutation repressed the syntheεiε of approximately 20 prg-encoded cell-aεεociated protein species (Miller et al., J. Bacteriol . 172:2485- 2490, 1990, herein incorporated by reference) . Although PhoP/PhoQ has been shown to transcriptionally activate pag (Miller et al. , Proc. Natl . Acad . Sci . USA 86:5054- 5058, 1989, herein incorporated by reference; Pulkkinen et al., supra , herein incorporated by reference), the mechanism of protein represεion by PhoP/PhoQ had not been characterized prior to the present studies. No transcript was detected when RNA from the PhoP constitutive mutant was probed with prgH- , prgl-J- , or prgX-specific DNA, indicating that the prgHIJK operon was negatively regulated by PhoP/PhoQ at the level of transcription. Thus, PhoP/PhoQ can both activate and repress transcription of virulence genes.
Consistent with the role of one or more of the products of prgHIJK in bacterial mediated endocytosiε and possibly in protein secretion, a low-copy plasmid containing 5.1 kb of DNA (IB043) , including prgHIJK, org, and orfl , complemented both the bacterial mediated endocytosiε defect and the supematant protein profile defect of the prgHl:: nphoA mutant. Based upon its similarity to MxiJ and YscJ, which are membrane-associated lipoproteins that are neceεεary for export and secretion of Ipa and Yops protein respectively, the prgK gene product is most likely to have such a role in bacterial mediated endocytosiε and protein secretion. Similar to PrgK, PrgH was predicted to be a membrane lipoprotein. However, in contrast to prgl-K, which are similar to plasmid-encoded genes of Shigella and Yerεinia εpp., a prgH DNA probe hybridized to chromosomal DNA but not virulence-plasmid DNA from Shigella spp. Neither they nor the prgJ or prgJ predicted gene products have signal sequences or long hydrophobic domains that εuggest their cellular localization. However, the location of these genes within operons that encode secretion determinants suggestε that they may have a role in thiε process.
The predicted gene products of the prgHIJK operon were found to be similar to gene products required for protein secretion in other bacterial species. An analysis of proteins present in culture supematants of S. typhimurium was performed. These experiments revealed that the supematants of wild-type cultures contained a large number of protein bands, whereas strains with mutations affecting the prgH locuε, including prgHl::TnphoA, Δhil and PhoPc were each defective in protein secretion as assessed by Ssp profiles. This analysis suggested that PhoP/PhoQ could control protein secretion, at least in part, by repressing prgHIJK whose products could form part of a secretion machinery. Furthermore, the finding that PhoPc and Δhil mutants were associated with greater defects in their Sεp profile compared with the prgHl: :TnphoA mutant suggested that more than one mechanism may be involved in protein secretion and that gene products encoded by the 10 kb region that is deleted in the hil mutant also contribute to secretion of Ssp. Since the strains with altered Ssp profiles were each impaired in signaling epithelial cells, these data suggest that Ssp are involved in signaling such cells to initiate BME. The finding that five Ssp were missing from culture supematants of the prgH mutant suggeεted that one or more of these proteinε were specifically involved in BME, e.g., Ssp and/or prgHIJK gene products may form a structure on the surface of S. typhimurium which induces bacterial mediated endocytosis. S. typhimurium strains with transposons inserted between prgH and εpa that result in reduced bacterial mediated endocytosis were alεo iεεing a εubεet of the Ssp misεing from the prgHIJK mutant. DNA sequence analysis of the regions flanking the transposon insertions revealed deduced protein sequences that were similar to IpaB and IpaD of S. flexneri . These data suggest that the transpoεon insertions define an operon in S. typhimurium that encodeε Ipa homologueε.
Example 2: Salmonella typhimurium Secreted Invaεion Determinants
Two Salmonella typhimurium secreted protein (Ssp) mutants with transposon insertionε located between spaT and prgH were identified. One mutant lackε the 87 kDa Sεp, while the other lacks Ssp of 87, 42, and 36 kDa. The invasiveness of these mutantε implicateε the 42 and 36 kDa Ssp, but not the 87 kDa Ssp in invasion. DNA sequencing of this region identified two complete and two partial open reading frames (designated sspB , sspC, εspD, and sspA) . The deduced amino acid sequenceε of sspBCDA are ho ologouε to Shigella flexneri secreted proteins IpaB, IpaC, IpaD, and IpaA. Complementation analyses and amino-terminal sequencing showed that sspC and sspA encode the 42 kDa and the 87 kDa Ssp and that both proteinε are secreted without amino-terminal processing. SspA is abundantly secreted by wild type bacteria but is completely retained within the cellular fraction of a mutant in prgHIJK encoding part of the Ssp secretion apparatus. A precipitate containing SspC and three major Ssp of 63, 59, and 22 kDa was isolated from culture supernatantε of wild type bacteria. These data indicate that major secreted invasion determinants of S. typhimurium are structurally and functionally homologous to S. flexneri Ipa proteins.
The following reagents and experimental procedures were used to characterize Ssp. Construction of plasmids and strains:
To construct pCH002, pW8-l was cut with EcoRI, the 11 kb fragment eluted from a 1% agaroεe gel and cloned into the EcoRI εite of pWSK29. In pCH002, tranεcription of sspCDA iε driven from the lac promoter. pCH004 was constructed by cloning the 3 kb BamHI fragment from pCH002 into the BamHI site of pWSK29. pCH005 contains the 4 kb EcoRI-Pvull fragment from pCH002 cloned into EcoRI-Hindi restricted pWSK29. pCH006 was constructed by restriction of pCH005 with Ncol and religation of the 1.7 kb and the 5 kb fragment. The correct orientations of the cloned insertε were confirmed by appropriate reεtriction analyses.
PCR of a chromosomal fragment of EE638 comprising the 5'-region of TnδlacZY and adjacent DNA was performed in three independent experiments by using primers OL 1 (5' CGCGGATCCATTATGGGATGTATCGG 3'; SEQ ID NO: 25) and OL2 (5' CCGGCAGCAAAATGTTGCAG 3'; SEQ ID NO: 26). The 0.8 kb amplified DNA fragments were then restricted with BamHI and cloned into pWSK29 for sequencing. All three sequences were identical.
Strain VB122 (hi A: :/an-112) was constructed as follows: the mutation was originally constructed on a - 45 - plaεmid by inεerting a kan caεεette (Pharmacia Biotech, Piscateway, NJ) in a Hindi site in the 5' region of the hilA coding sequence. The plasmid-encoded hilA: :kan-112 mutation was recombined into the chromosome, and the chromosomal mutation was confirmed by PCR analysiε.
Mutant EE633 (lacZY ) waε iεolated by screening for oxygen regulated gene fusions created by random TnδlacZY insertions in S. typhimurium W114 (hilA: :kan-114 ) and further selection for insertions linked to a hilA: :kan-114 by P22 transduction into S. typhimurium SL1344 and selection for TetR and KanR.
Media and growth conditions for bacterial cultureε:
Bacteria were grown in LB broth at 37°C. If necessary, selection was carried out using 50 μg/ml ampicillin, 10 μg/ml tetracycline, or 25 μg/ml kanamycin. Preparation and analysis of S. typhimurium supernatant proteins:
Bacterial cultures were grown for 16 to 17 hours in 12 ml LB in 1.5 x 14 cm glasε tubes at 37°C on a TC-7 roller (New Brunswick, Edison, NJ) at 50 rev. /min. Soluble proteins from culture supernatantε were obtained as described above. Precipitates in the culture were retrieved, rinsed 5 times with 1 ml H20, disεolved in sample buffer (4% SDS, 12% glycerol, 5% fl-mercaptoethanol, 0.05 M Tris-HCl pH 6.8, 0.01% bromphenol blue) , and resolved in 10% polyacrylamide gels uεing SDS-PAGE and a Triε-Tricine buffer. Immunoblotting: Whole cell samples were prepared from overnight cultures using standard methods with the additional εtep of filtering the culture through a Whatman 1 qualitative paper filter (Whatman International, Maidstone, Kent, England) before centrifugation. The proteins were resolved by SDS-PAGE and transferred to nitrocellulose by electroblotting using a conventional transfer buffer. Weεtern blots were incubated with polyclonal rabbit serum prepared against the 87 kDa Ssp. The immunogen was purified by SDS-PAGE and injected into New Zealand White rabbits (Charles River, Wilmington, MA) . Serum was collected after two booster injections and subsequently absorbed with an acetone powder prepared from S. typhimurium strain EE63. Horseradish peroxidase-labelled goat anti-rabbit antibodieε were uεed to label the primary antibodieε and were visualized using chemiluminescence (ECL, Amersham, International, Buckinghamshire, England) Invasion assays:
Invasion of HEp-2 epithelial cells was carried out according to the method of Behlau et al. ( J . Bacteriol . 175:4475-4484, 1993) . To minimize epithelial cell detachment from the bottom of the assay wells after bacterial uptake, the following modifications were introduced: invasion time was reduced from 90 to 60 min and gentamicin treatment was performed for 15 min with
100 μg/ml gentamicin, conditions which were shown to kill 99% of a bacterial culture of 2 x IO8 cells/ml. N-terminal protein εequencing:
Proteinε εeparated by SDS-PAGE were blotted on PVDF membranes (Bio-Rad, Hercules, CA) and stained with Ponceau-S. Blotted proteins were sequenced using an ABI 470A protein sequencer with 120A PTH-AA analyzer.
Table 7: Strainε and plaεmidε used in thiε example Bacterial εtrain Marker
E. coli DH5α F-Φ80dlaσZΔM15Δ (lacZYA-argF)U169endAl recAlhsdR17 (rκ~, mκ +) deoRthi -lsupE44λgyrA96relAl
S. typhimurium SL1344 wild type
W114 hil : :kan-114
VB122 KanR, hilA: :kan-112
EE637 Tet* invF: :lacZYll-5 EE633 Tet1 sspA: :lacZY4
EE638 Tet R sspC: : lacZYll-6
S. typhimurium wild type
(ATCC14028S)
CS451 14028SΔhil: :Tn5-428 CS022 pho-24 (PhoPc)
IB04 prgHl: :TnphoA
Plasmid Marker pWSK29 Amp* pW8-l Tet*" pW71 Amp* pCH002 Amp* sspCDA, hilA pCH004 AmpF sspC pCH005 AmpF sspCO pCH006 AmpF sspD Identification of S. typhimurium Mutantε with Tranεpoεon Insertions in Genes Encoding Ssp
To identify genes encoding Ssp, TnδlacZY mutants of S. typhimurium SL1344 with transposon insertionε located within the 40 kb "virulence island" (59-60 min. of the S. typhimurium chromosome) were analyzed for changed patternε in Sεp. An inεertion in invF (invF: : lacZYll-5) , the first gene of the inv-spa operon, and a hilA: :kan-122 insertion in VB122 led to major defects in the pattern of Ssp similar to a mutation in the prgHIJK operon (prgHl : :TnphoA) which has implicated in S. typhimurium protein secretion (see Example 1) . Specifically, all three mutants lack 5 major Ssp of 36, 38, 42, 63 and 87 kDa, while the hilA: :kan-112 insertion leads to loss of some lower molecular weight protein bands in addition to these 5 Ssp (Fig. 8, lanes 4, 5, 6). Two other mutants exhibited detectable loss of only one and of three Ssp, respectively. The supematants from the mutant strain EE633 containing the fusion lacZY4 were missing a protein of 87 kDa, while supematants from the mutant strain EE638, containing fusion 2aαZΥll-6, were missing protein specieε of 87, 42 and 36 kDa. In addition, supematants from EE638 showed an increaεed abundance of a 63 kDa Sεp (Fig. 8, laneε 2, 3). TnδlacZY in EE638 maps approximately 2.5 kb downstream from εpaT while in EE633 the transposon maps 5.5 kb downstream from spaT as determined by Southern hybridization and PCR analyses. Both transposons were inserted in the same orientation (Fig. 9) . A degenerate pool of oligonucleotides syntheεized according to the εequence of the 12 amino-terminal amino acids of the 87 kDa protein (VTSVRTQPPVIM; SEQ ID NO: 27) , hybridized specifically to a 5.5 kb BamHI fragment in pW71 which comprises sequenceε between hil A and spaT (Fig. 9) . These data indicate that the 87 kDa Ssp is encoded in the chromosomal region adjacent to the transposon insertions. TnδlacZY in EE633 is likely to be directly within the gene encoding the 87 kDa Sεp, while Tn51aσ-7Y in EE638 iε likely to be inεerted within one of the genes encoding the 42 and the 36 kDa Ssp having a polar effect on the synthesis of the other two Ssp missing in supematants of this mutant.
Secretion of the 87 Ssp kDa Ssp is Dependent on prgHIJK Since it was possible that the absence of the 87 kDa Ssp (Ssp87) in εupernatants of EE633 and EE638 was due to impaired secretion rather than expression, whole cell lysates and supematants of various strains were analyzed by immunoblotting with antiserum raised against partially purified Ssp87. Fig. 11 shows that Ssp87 of wild type S. typhimurium iε found mainly in the εupernatant, although εome of the protein is detected in the cellular fraction (Fig. 11, lane 1) . In contrast to wild type bacteria, all of the protein is found in the cellular fraction of the prgHl : :TnphoA mutant IB040 (lane 3) . Ssp87 could not be detected in the cellular fractions nor in supematants of various invasion and secretion mutantε: CS022 (PhoPc) , a mutant which conεtitutively repreεεeε PhoP regulated geneε (Miller et al., J. Bacteriol . 172:2485-2490, 1990, hereby incorporated by reference) (lane 2) , CS451 (Δhil : :Tn5-428) carrying a 10 kb chromosomal deletion of the hil locus between 59 and 60 min. (lane 4) , EE638 (lacZYll-6) (lane 5), and EE633 (lacZY ) (lane 6). The signal at 51 kDa in the supematant fraction of wild type bacteria might represent a degradation product of Ssp87, while the faint band at 34 kDa is likely nonεpecific hybridization εince it iε preεent in all bacteria analyzed. Theεe results demonstrate that lack of Ssp87 in supematants of EE633 and EE638 is due to impaired expression while lack of Ssp87 in supematants of IB040 (prgHl : :TnphoA) is caused by impaired secretion of the protein. These resultε further εhow that expreεεion of the gene encoding Sεp87 is affected by the hil deletion and that expresεion of Ssp87, either directly or indirectly, is represεed by PhoP. Strain EE638. but not EE633. Is Markedly Deficient in Invasion
To determine the function of the 87, 42, and 36 kDa Ssp in invasion of epithelial cells, the ability of strain EE638 and EE633 to invade HEp-2 cells was analyzed. EE638 showed more than a 100-fold reduction in invasiveness when compared to wild type bacteria, while EE633 exhibited invasion levels comparable to wild type bacteria (Fig. 9) . These results suggested that the 36 and/or the 42 kDa Ssp but not the 87 kDa Ssp are required for epithelial cell invasion. In addition, observation of interactions between these mutants and PtK2 cellε by time-lapse videomicroscopy indicated that the ability of EE638 to induce epithelial cell membrane ruffling iε also markedly reduced, while EE633 induced localized membrane ruffles at a frequency similar to wild type S. typhimurium .
The Tn51acZY Insertions in EE638 and EE633 Define a Chromosomal Region Encoding Ssp S. typhimurium Homologues of the Shigella ipaBCDA Operon To determine the gene(s) affected by the transposon insertions in EE638 and EE633, part of a 11 kb EcoRI subclone of pW8-l was sequenced. Two complete and two partial open reading frames (ORFs) , positioned in the same transcriptional direction, were identified (Fig. 9) . The deduced gene products of the complete ORFs exhibit similarity to Shigella secreted proteins IpaC and IpaD (31% identity, 47% similarity; 37% identity, 56% similarity) respectively, and therefore were designated sspC and sspD (see Fig. 13 and Fig. 14) . The gene products of the complete open reading frames were deεignated εεpC and sspD . The amino acid εequence derived from the 5'-end of sspC was identical to the amino-terminal sequence of the 42 kDa Ssp (underlined in Fig. 13) . The deduced gene product of the partial ORF located immediately upstream from sspC showε 47% identity
(67% εimilarity) to the carboxyterminal portion of S. flexneri εecreted protein IpaB and waε deεignated sspB
(Fig. 12) . The ORF starting immediately downstream of sspD was designated sεpA. The amino acid sequence deduced from the 5' end of an ORF starting immediately downstream from sspD did not exhibit εimilarity to IpaA. However, DNA sequencing of internal parts of the gene predicted that the protein encoded by this gene, designated sεpA, is similar to IpaA. Nevertheless, the sequence of amino acids 2-13 (underlined in Fig. 15) was identical to the amino-terminal εequence of the 87 kDa Ssp (see above) . εεpB , sspC , sεpD , and εspA are separated by 27, 70, and 15 bp, respectively, and putative ribosome binding siteε precede εεpC , sspD, and sεpA .
The amino acid εimilaritieε of Ssp to Ipas do not extend over the entire lengths of the proteins. The similarities between SspC/IpaC and SspD/IpaD are highest in the carboxy-terminal regions, while the central parts of SspB and IpaB are conserved (see Fig. 12, 13, and 14). These similarities could reflect conservation in regions of the proteins required for εecretion and/or invasion. Although both SspC and SspD appear to be secreted by the same mechanism, no obvious similarities or motifs common to these proteins were detected, thus implying conformational rather than sequential features in the secretion of proteins by type III secretion pathways.
The preciεe insertion of Tn51aσZY in EE638 was determined by cloning and sequencing of a PCR product comprising the 5' region of the transposon and upstream chromosomal sequenceε and was shown to be located 189 bp downstream from the ATG start codon of sspC. The order of the sεp genes and the Ssp profile of EE638 indicate that the transposon insertion in εεpC is polar on expression of εspD and sspA and that these genes are likely to be organized in a singly transcribed unit. Both sspC and sspD are Necessary for S . typhimurium Invasion of Epithelial Cells
A complementation analysiε waε carried out to determine the minimal fragment necessary for complementation of the epithelial cell invasion defect of EE638 (sspC: : lacZYll-6) aε well as for reconstitution of Ssp. All analyzed fragments were cloned downstream from the lac promoter in the 6-8 copies/chromosome vector pWSK29. As shown in Fig. 10, a 3.9 kb EcoRI-PvuII fragment comprising sspC and sspD in pCH005 was sufficient to complement the invasion defect of EE638 to wild type levels. When analyzed for Ssp, EE638 [pCH005] showed a pattern of Ssp similar to the wild type strain [pWSK29] except for the missing 87 kDa protein (SspA) (Fig. 16, lane 4) . EE638 transformed with pCH002 carrying an 11 kb EcoRI fragment was partially complemented for invasion as well as for all 3 misεing Sεp (Fig. 10 and Fig. 16, lane 6) . In contraεt, EE638 transformed with plasmids that contained either sspC or εεpD alone (pCH004 and pCH006, respectively) were not complemented for invasion but showed reconstitution of the 42 kDa Ssp (SspC) or the 36 kDa Ssp (SspD) , respectively (Fig. 10 and Fig. 16, lanes 3 and 5) . In addition, the abundancy of a 63 kDa Ssp, which was found to be more abundant in supernatantε of EE638, was reduced in supematants of strains EE638 [pCH005], EE638 [pCH006], and EE638 [pCH002] and of SL1344 [PCH002]. These results demonstrate that both SεpC and SεpD are necessary for invasion of epithelial cells and indicate that SspC encodes the 42 kDa Ssp while the 36 kDa Ssp is likely to be encoded by SspD. In addition, complementation of the invasion defect of EE638 with pCH005 indicates that invasiveness is not influenced by the observed changes in the abundancy of the 63 kDa Ssp. A Precipitate Found in S. typhimurium Culture Supematants Contains Highly Abundant SspC and Other Proteins
Supematants from S. typhimurium wild type cultures contained a precipitate that, when solubilized in reducing SDS sample buffer, separates into at least four highly abundant protein bands of 63, 59, 42 and 22 kDa on SDS-PAGE (see Fig. 17, lane 1). Protein precipitates were also found in culture supematants of EE638 and EE633, but not in supematants of S. typhimurium mutants with global defects in protein secretion [CS022 (PhoPc) , IB040 (prgH: :TnphoA) , CS451 (Δhil: :Tn5-428) and VB122 (hilA: :kan-112 ) . S . typhimurium 14028s, the wild type parent of CS022 and IB040, showed the same protein pattern of precipitated material as SL1344]. The precipitate from EE633 cultures showed a similar composition to that of wild type precipitate by SDS-PAGE analysis. In contrast, a major protein band of 42 kDa waε absent from the precipitate isolated from cultures of EE638 (Fig. 17, lane 2).
Amino-terminal sequencing of this 42 kDa Ssp identified it as encoded by SεpC. The identity of the amino-terminal protein sequence (MLISNVGINPAAYLN; SEQ ID NO: 28) with the amino acid sequence derived from the 5'-region of SspC (Fig. 13) showε that no amino-terminal processing of SspC occurs prior to its release into the supematant.
SDS-PAGE analyses of precipitated material from culture supematants of EE638 [pCH004 (SspC) ] and EE638 [pCH005 (SεpCD) ] showed a pattern similar to wild type
[pWSK29] material (Fig. 17, lane 3 and 4), confirming that the respective plasmidε complemented the mutant for secretion of SspC. Protein patterns of soluble Ssp and precipitates isolated from untransformed cultures of SL1344 or EE638 were identical to those shown in Fig. 16, 17, lane 1 and 2, respectively. Precipitate of EE638 [pCH006 (SεpD) ] was found to be similar to precipitate from EE638 [pWSK29] except for reduced abundancy of a 63 kDa protein band (Fig. 17, lane 5). The precipitate from EE638 [pCH002 (SεpCDA) ] contained an additional major protein band of approximately 51 kDa, which was also present in precipitate from SL1344 [pCH002] (Fig. 17, lanes 6, 7) . Comparison of precipitated proteins to soluble Ssp on SDS-PAGE (Fig. 17, lanes 8, 9) showed that SspC in the precipitate has the same electrophoretic mobility as the 42 kDa soluble Ssp. These data suggest that the 42 kDa soluble Ssp is identical to precipitated SspC.
SspC and SspA are secreted proteins of 42 and 87 kDa, aε demonεtrated by amino-terminal εequencing and by complementation analyses. It is further likely that the 36 kDa protein encoded by SspD is secreted, since lack of a 36 kDa Ssp in supematants of EE638 (lacZYll-6) was complemented by tranεformation of this mutant with plasmids containing SspD. The 63 kDa Ssp is the protein likely to be encoded by SspB.
SspA, SspB, SspC, and SspD appear to be targets of the inv-spa-prgHIJK encoded secretion apparatus, since these Ssp are missing in supematants of mutants affecting expression or regulation of inv-spa and prgHIJK (Fig. 8) . Typical for proteins secreted by type III secretion pathways, no amino-terminal procesεing of SεpA and SspC waε obεerved. The dependency of Sεp secretion on prgHIJK was further proven by demonstrating that SspA is abundantly secreted by wild type cells, while it is completely retained in the cellular fraction of the prgHl : :TnphoA mutant IB040 (Fig. 11). The 38 kDa Ssp of the five major Ssp dependent on the inv-spa-prgHIJK secretion apparatus may be the product of the invJ invasion locus. The immunoblot analysis of SspA secretion suggeεts that expression of the gene encoding SspA is negatively controlled by the virulence two component regulatory system PhoP/PhoQ. PhoP/Q has a global effect on protein secretion which is partially due to negative transcriptional regulation of prgHIJK (see Example 1) . The SspBCDA genes are located between the large inv-spa gene cluster and prgHIJK at 59 minutes on the S. typhimurium chromosome. Fig. 18 shows the relative positions of the invasion genes in S. typhimurium in comparison to their S. flexneri homologues, which are clustered in a 31 kb region of a large virulence plasmid. The invasion genes cluster in three groups (inv-spa/mxi-εpa , Sεp/ipa , and prglJK/mxiHIJ) which exhibit conserved gene structure and organization, suggeεting that these genes were acquired by horizontal gene transfer. Acquisition by horizontal gene transfer is further supported by the fact that these S. typhimurium invasion genes are within a 40 kb "virulence island" which, despite the otherwise high overall genetic similarity between S. typhimurium and E. coli K-12, is unique to S. typhimurium. However, the three invasion gene cluεterε from S. flexneri and S. typhimurium are in different relative positions to each other and are interspersed between non-homologous genes, thus implying multi-recombinational events in the evolution of these genetic regions.
In addition to soluble Ssp the supematants of S. typhimurium cultures contained a flocculent precipitate consisting of SspC and three other major protein species of 63 (Ssp 63), 59 (Ssp 59), and 22 (Ssp 22) kDa. The combination and abundancy of Ssp in the precipitate from S. typhimurium cultures is strikingly different from that in the soluble fraction (see Fig. 17) . Though Ssp, including SspC, are found in both the precipitate and the εoluble fraction, SspD, even when overproduced, was not detected in the precipitate. This emphasizes the difference in composition of precipitate and soluble fraction and supportε the possibility of specific protein-protein interactions between the four Ssp leading to precipitate formation.
OTHER EMBODIMENTS Using reagents derived from partial cDNA clones of an Ssp, e.g., SspA, the isolation of a full-length cDNA encoding the Ssp is well within the skill of those skilled in the art of molecular biology. For example, a radiolabelled probe made from a known partial cDNA sequence can be used to identify and isolate from a library of recombinant plasmids cDNAs that contain regions with identical to the previously isolated cDNAs. The εcreening of cDNA libraries with radiolabelled cDNA probes is routine in the art of molecular biology (see Sambrook et al., 1989, Molecular Cloning: a Laboratory Manual , second edition., Cold Spring Harbor Presε, Cold Spring Harbor, N.Y) . The cDNA can be isolated and εubcloned into a plasmid vector, and the plasmid DNA purified by standard techniques. The cDNA insert is sequenced using the dideoxy chain termination method well known in the art (Sambrook et al, supra) . Oligonucleotide primers corresponding to bordering vector regions as well as primers prepared from previously isolated cDNA clones can be employed to progressively determine the sequence of the entire gene.
Similar methods can be used to isolate Ssp which are related to SspA, SspB, SspC, or SspD. To isolate related Ssp, a probe having a sequence derived from (or identical to) all or a portion of SspA, SspB, SspC, or SspD can be used to screen a library of Salmonella DNA (or cDNA) . DNA encoding a related Ssp will generally hybridize at greater stringincy than DNA encoding other proteinε. Thiε approach can be uεed to identify Salmonella typhimurium Sεp aε well as Ssp of other Salmonella . Generation of Monoclonal Antibodies: Monoclonal antibodies can be generated to purified native or recombinant gene products, e.g., Sεp, by standard procedures, e.g., those described in Coligan et al., eds., Current Protocols in Immunology, 1992, Greene Publishing Associates and Wiley-Interscience) . To generate monoclonal antibodies, a mouse is immunized with the recombinant protein, and antibody-secreting B cells isolated and immortalized with a non-secretory myeloma cell fusion partner. Hybridomas are then screened for production of specific antibodies and cloned to obtain a homogenous cell population which produces a monoclonal antibody. For example, hybridomas secreting the desired antibodies can be screened by ELISA. Specificities of the monoclonal antibodies can be determined by the use of different protein or peptide antigens in the ELISA. Useful quantities of antibodies can be produced by either the generation of asciteε fluid in mice or by large scale in vitro culture of the cloned antibody-producing hybridoma cell line. Antibodies can be purified by various chromatographic procedureε known in the art, such as affinity chromatography on either immobilized Protein A or Protein G.
The invention also includes DNA encoding other Ssp (e.g., Ssp 54, Ssp 42, and Ssp 22) found in cell supematants. Those skilled in the art can readily clone the corresonding genes based on the amino terminal sequence or the corresponding protein. The amino terminal sequence of Ssp54 is MNNLTLSXFXKVG (SEQ ID NO: 29) . The amino terminal sequence of Ssp42 is MLISNVGINPAAYLN (SEQ ID NO: 30) . The amino terminal sequence of Ssp 22 is TKITLSPQNFFI (SEQ ID NO: 31) .

Claims

1. Substantially pure DNA encoding a Salmonella secreted protein (Ssp) .
2. The DNA of claim 1, wherein said DNA comprises the SspB gene.
3. The DNA of claim 2, wherein said DNA compriseε the DNA sequence of SEQ ID NO: 1 or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 5.
4. The DNA of claim 1, wherein said DNA comprises the SspC gene.
5. The DNA of claim 4, wherein said DNA comprises the DNA sequence of SEQ ID NO: 2 or degenerate variants thereof encoding the amino acid εequence of SEQ ID NO: 6.
6. The DNA of claim 1, wherein said DNA comprises the SspD gene.
7. The DNA of claim 6, wherein said DNA compriseε the DNA εequence of SEQ ID NO: 3 or degenerate variantε thereof encoding the amino acid εequence of SEQ ID NO: 7.
8. The DNA of claim 1, wherein εaid DNA comprises the SspA gene.
9. The DNA of claim 8, wherein said DNA compriseε the DNA εequence of SEQ ID NO: 4, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 8.
10. The DNA of claim 1, wherein said DNA compriseε the SεpB gene, the SεpC gene, the SεpD gene and the SεpA gene. - 59 -
11. The DNA of claim 10, wherein said DNA compriεes the DNA εequence of SEQ ID NO: 15.
12. The DNA of claim 1, wherein εaid DNA compriεeε the SspH gene.
13. The DNA of claim 12, wherein said DNA comprises the DNA sequence of SEQ ID NO: 13, or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 14.
14. The DNA of claim 1, wherein said DNA comprises the stpA gene.
15. The DNA of claim 14, wherein said DNA comprises the DNA sequence of SEQ ID NO: 10 or degenerate variants thereof encoding the amino acid sequence of SEQ ID NO: 12.
16. A cell which contains the DNA of claim 1.
17. A method of inducing uptake of a bacterial cell by an epithelial cell in a mammal, compriεing increaεing expreεεion of the DNA of claim 4 or 6 in εaid cell and administering said cell to said mammal.
18. The method of claim 17, wherein said bacterial cell is a Salmonella cell.
19. A method of inducing uptake of a bacterial cell by a macrophage in a mammal, comprising decreasing expression of the DNA of claim 4 or 6 and administering said cell to said mammal.
20. A substantially pure SspC polypeptide.
21. The polypeptide of claim 20, comprising an amino acid sequence εubεtantially identical to the amino acid sequence of SEQ ID NO: 6.
22. An active fragment of the polypeptide of claim 21.
23. A substantially pure SspD polypeptide.
24. The polypeptide of claim 23, comprising an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 7.
25. An active fragment of the polypeptide of claim 24.
26. A substantially pure SspH polypeptide.
27. The polypeptide of claim 26, comprising an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 14.
28. An active fragment of the polypeptide of claim 27.
29. A substantially pure IagB polypeptide.
30. The polypeptide of claim 29, comprising an amino acid sequence subεtantially identical to the amino acid sequence of SEQ ID NO: 11.
31. An active fragment of the polypeptide of claim 40.
32. An antibody which binds to a Ssp.
33. A method of detecting a Salmonella infection in a mammal compriεing contacting a biological εample derived from εaid mammal with the antibody of claim 32 and detecting the binding of said antibody to a Ssp in said sample, wherein said binding indicates that said mammal is infected with Salmonella .
34. A method of detecting the preεence of Salmonella in a biological sample comprising contacting said sample with a Ssp-encoding DNA under high stringency conditions and detecting the hybridization of said DNA to nucleic acid in said sample, wherein hybridization indicates the presence of Salmonella in said biological sample.
35. A method of targeting an antigen to an epithelial cell in a mammal, comprising linking said antigen to an Ssp or active fragment thereof to produce a Ssp chimeric antigen and administering said chimeric antigen to said mammal.
36. The method of claim 35, wherein said Ssp is SspC or SspD.
37. A method of inducing a cytotoxic T cell immune response in a mammal, comprising linking said antigen to an Ssp or active fragment thereof to produce a Sεp chimeric antigen and contacting an antigen-preεenting cell with said chimeric antigen.
38. A vaccine comprising a bacterial cell the virulence of which is attenuated by decreaεed εecretion of a Ssp.
39. The vaccine of claim 38, wherein said bacterial cell is a Salmonella typhimurium cell.
40. The vaccine of claim 39, wherein said bacterial cell is a Salmonella enteriditiε cell.
41. The vaccine of claim 38, wherein said bacterial cell is a Salmonella typhi cell.
42. A live Salmonella cell in which a gene encoding a heterologous antigen is inserted into a Ssp- encoding gene.
43. A method of vaccinating an animal against a Salmonella infection comprising administering the vaccine of claim 38.
44. A substantially pure StpA polypeptide.
45. A method of dephosphorylating a protein, comprising contacting said protein with the polypeptide of claim 44 or an active fragment thereof.
PCT/US1996/018504 1995-11-14 1996-11-14 Salmonella secreted proteins and uses thereof WO1997018225A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU77383/96A AU7738396A (en) 1995-11-14 1996-11-14 Salmonella secreted proteins and uses thereof
EP96940523A EP0939761A4 (en) 1995-11-14 1996-11-14 Salmonella secreted proteins and uses thereof
US09/068,804 US6861247B1 (en) 1995-11-14 1996-11-14 Salmonella secreted proteins and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US673395P 1995-11-14 1995-11-14
US60/006,733 1995-11-14

Publications (1)

Publication Number Publication Date
WO1997018225A1 true WO1997018225A1 (en) 1997-05-22

Family

ID=21722306

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/018504 WO1997018225A1 (en) 1995-11-14 1996-11-14 Salmonella secreted proteins and uses thereof

Country Status (4)

Country Link
EP (1) EP0939761A4 (en)
AU (1) AU7738396A (en)
CA (1) CA2237581A1 (en)
WO (1) WO1997018225A1 (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6605285B2 (en) 2000-03-29 2003-08-12 G.B. Pant University Of Agriculture & Technology Vaccine for protection of poultry against salmonellosis and a process for preparing the same
US6962696B1 (en) 1999-10-04 2005-11-08 Vion Pharmaceuticals Inc. Compositions and methods for tumor-targeted delivery of effector molecules
WO2007016912A1 (en) * 2005-08-07 2007-02-15 Tgc Biomics Gmbh Test system for detecting salmonella
US7354592B2 (en) 1997-09-10 2008-04-08 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
US7514089B2 (en) 1997-09-10 2009-04-07 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
US7700104B2 (en) 1998-09-04 2010-04-20 Emergent Product Development Uk Limited Attenuated Salmonella SP12 mutants as antigen carriers
US7833740B2 (en) 2005-08-07 2010-11-16 Tgc Biomics Gmbh Test system for detecting salmonella
US7842290B2 (en) 1994-12-09 2010-11-30 Emergent Product Development Uk Limited Identification of genes
US7887816B2 (en) 1999-05-10 2011-02-15 Emergent Product Development Uk Limited Attenuated microorganisms for the treatment of infection
WO2011131178A3 (en) * 2010-04-23 2012-05-18 Bioserv Analytik Und Medizinprodukte Gmbh Method for detecting a salmonella infection
US8703153B2 (en) 2008-06-16 2014-04-22 Prokarium Ltd. Salmonella vectored vaccines against Chlamydia and methods of use
WO2014066341A1 (en) * 2012-10-22 2014-05-01 The Board Of Regents For Oklahoma State University Use of the salmonella spp type iii secretion proteins as a protective vaccination
US9950053B2 (en) 2012-10-22 2018-04-24 The Board Of Regents For Oklahoma State University Use of the Salmonella SPP type III secretion proteins as a protective vaccination
US10548962B2 (en) 2012-10-22 2020-02-04 The Board Of Regents For Oklahoma State University Use of the salmonella SPP type III secretion proteins as a protective vaccination
US10857233B1 (en) 2010-02-09 2020-12-08 David Gordon Bermudes Protease inhibitor combination with therapeutic proteins including antibodies
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2662174A1 (en) * 2006-08-31 2008-03-06 The University Of British Columbia Vaccines and methods for treatment or prevention of salmonella spp. bacterial infection in a vertebrate subject

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995002048A1 (en) * 1993-07-09 1995-01-19 The General Hospital Corporation Salmonella vaccines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995002048A1 (en) * 1993-07-09 1995-01-19 The General Hospital Corporation Salmonella vaccines

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ABSTRACTS OF THE 95TH GENERAL MEETING OF THE AMERICAN SOCIETY OF MICROBIOLOGY, 21-25 May 1995, HANTMAN et al., "Defective Extracellular Protein Secretion by Salmonella Typhimurium Mutants Impaired in Induction of Eucaryotic Cell Membrane Ruffling and Macrophinocytosis", page 184, Abstract B-109. *
MICROBIAL PATHOGENESIS, 1988, Vol. 4, BAUDRY et al., "Nucleotide Sequence of the Invasion Plasmid Antigen B and C Genes (IpaB and IpaC) of Shigella Flexneri", pages 345-357. *
MOLECULAR MICROBIOLOGY, 1995, Vol. 18, No. 3, HUECK et al., "Salmonella Typhimurium Secreted Invasion Determinants are Homologous to Shigella lpa Proteins", pages 479-490. *
See also references of EP0939761A4 *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7842290B2 (en) 1994-12-09 2010-11-30 Emergent Product Development Uk Limited Identification of genes
US7354592B2 (en) 1997-09-10 2008-04-08 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
US7514089B2 (en) 1997-09-10 2009-04-07 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
US7700104B2 (en) 1998-09-04 2010-04-20 Emergent Product Development Uk Limited Attenuated Salmonella SP12 mutants as antigen carriers
US7955600B2 (en) 1998-09-04 2011-06-07 Emergent Product Development Uk Limited Attenuated salmonella SP12 mutants as antigen carriers
US7887816B2 (en) 1999-05-10 2011-02-15 Emergent Product Development Uk Limited Attenuated microorganisms for the treatment of infection
US7452531B2 (en) 1999-10-04 2008-11-18 Vion Pharmaceuticals, Inc. Compositions and methods for tumor-targeted delivery of effector molecules
US6962696B1 (en) 1999-10-04 2005-11-08 Vion Pharmaceuticals Inc. Compositions and methods for tumor-targeted delivery of effector molecules
US6605285B2 (en) 2000-03-29 2003-08-12 G.B. Pant University Of Agriculture & Technology Vaccine for protection of poultry against salmonellosis and a process for preparing the same
US7833740B2 (en) 2005-08-07 2010-11-16 Tgc Biomics Gmbh Test system for detecting salmonella
WO2007016912A1 (en) * 2005-08-07 2007-02-15 Tgc Biomics Gmbh Test system for detecting salmonella
US8703153B2 (en) 2008-06-16 2014-04-22 Prokarium Ltd. Salmonella vectored vaccines against Chlamydia and methods of use
US10857233B1 (en) 2010-02-09 2020-12-08 David Gordon Bermudes Protease inhibitor combination with therapeutic proteins including antibodies
WO2011131178A3 (en) * 2010-04-23 2012-05-18 Bioserv Analytik Und Medizinprodukte Gmbh Method for detecting a salmonella infection
WO2014066341A1 (en) * 2012-10-22 2014-05-01 The Board Of Regents For Oklahoma State University Use of the salmonella spp type iii secretion proteins as a protective vaccination
US9950053B2 (en) 2012-10-22 2018-04-24 The Board Of Regents For Oklahoma State University Use of the Salmonella SPP type III secretion proteins as a protective vaccination
US10548962B2 (en) 2012-10-22 2020-02-04 The Board Of Regents For Oklahoma State University Use of the salmonella SPP type III secretion proteins as a protective vaccination
US11464843B2 (en) 2012-10-22 2022-10-11 The Board Of Regents For Oklahoma State University Use of the salmonella SPP type III secretion proteins as a protective vaccination
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria

Also Published As

Publication number Publication date
CA2237581A1 (en) 1997-05-22
AU7738396A (en) 1997-06-05
EP0939761A4 (en) 2002-07-31
EP0939761A1 (en) 1999-09-08

Similar Documents

Publication Publication Date Title
Nassif et al. Mucoid phenotype of Klebsiella pneumoniae is a plasmid-encoded virulence factor
Antoine et al. Roles of the disulfide bond and the carboxy-terminal region of the S1 subunit in the assembly and biosynthesis of pertussis toxin
Strockbine et al. Cloning and sequencing of the genes for Shiga toxin from Shigella dysenteriae type 1
WO1997018225A1 (en) Salmonella secreted proteins and uses thereof
Olson et al. Identification and characterization of dppA, an Escherichia coli gene encoding a periplasmic dipeptide transport protein
Leimeister-Wächter et al. Detection of listeriolysin, the thiol-dependent hemolysin in Listeria monocytogenes, Listeria ivanovii, and Listeria seeligeri
KR101242445B1 (en) Bacterial virulence factors and uses thereof
JP2007289194A (en) Vacuolating toxin-deficient h. pylori and related method
Allaoui et al. MxiG, a membrane protein required for secretion of Shigella spp. Ipa invasins: involvement in entry into epithelial cells and in intercellular dissemination
CA2146862A1 (en) The taga gene and methods for detecting predisposition to peptic ulceration
JPH06505383A (en) improved vaccine
US5804190A (en) Recombinant vaccine for porcine pleuropneumonia
CA2167691A1 (en) Campylobacter jejuni antigens, and methods for their production and use
JP2009022299A (en) MUTANT SHIGELLA FLEXNERI 2a
EP0432220B1 (en) Vaccines and diagnostic assays for haemophilus influenzae
EP0409895B1 (en) A pasteurella vaccine
US6861247B1 (en) Salmonella secreted proteins and uses thereof
Moeck et al. Topological analysis of the Escherichia coli ferrichrome-iron receptor by using monoclonal antibodies
EP1029054B1 (en) Hp90: host membrane receptor for pathogenic bacteria, encoded by the bacterial tir gene
EP0614973A1 (en) Polypeptide useful in diagnosis of coccidia infection and recombinant-DNA methods for manufacturing same
WO2000069903A1 (en) LAWSONIA DERIVED GENE AND RELATED SodC POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES
US7208574B1 (en) Host receptor for pathogenic bacteria
CA2078131A1 (en) Polypeptides useful in diagnosis of and treatment against mycoplasma infections in animals
WO2000037493A2 (en) Type iii secretion system antigens from bordetella pertussis
NZ244437A (en) Enzymatically inactive phospholipase d analogues from corynebacterium pseudotuberculosis, their use and production

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP MX US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2237581

Country of ref document: CA

Ref country code: CA

Ref document number: 2237581

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09068804

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 1996940523

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97519148

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1996940523

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1996940523

Country of ref document: EP