WO1998005785A1 - Plant phytases and biotechnological applications - Google Patents

Plant phytases and biotechnological applications Download PDF

Info

Publication number
WO1998005785A1
WO1998005785A1 PCT/FR1997/001443 FR9701443W WO9805785A1 WO 1998005785 A1 WO1998005785 A1 WO 1998005785A1 FR 9701443 W FR9701443 W FR 9701443W WO 9805785 A1 WO9805785 A1 WO 9805785A1
Authority
WO
WIPO (PCT)
Prior art keywords
phytase
plant
sequence
fragment
expression
Prior art date
Application number
PCT/FR1997/001443
Other languages
French (fr)
Inventor
Sébastien MAUGENEST
Anne-Marie Lescure
Pascual Perez
Original Assignee
Biocem
Institut National De La Recherche Agronomique
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biocem, Institut National De La Recherche Agronomique filed Critical Biocem
Priority to AU39446/97A priority Critical patent/AU3944697A/en
Priority to EP97936730A priority patent/EP0938568A1/en
Publication of WO1998005785A1 publication Critical patent/WO1998005785A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Definitions

  • the present invention relates to plant phytases, as well as their biotechnological applications.
  • the present invention also relates to one or more nucleic acid fragment (s) coding for a cereal phytase, more particularly for corn phytase and one or more fragment (s) characterized in that it is cDNA or genomic DNA fragments.
  • the present invention relates to a nucleic acid fragment characterized in that it comprises all or part of the nucleotide sequence as shown in the sequence identifier (SEQ ED) n ° 1 coding for a phytase activity or all or part of the Phyt I or Phyt II genomic sequences as defined below.
  • SEQ ED sequence identifier
  • the present invention relates to a fragment characterized in that it comprises all or part of the coding sequence ranging from nucleotide n ° 32 to 1192 of SEQ ED n.
  • Phytin a complex salt of myo-inositol-hexaphosphoric acid (phytic acid).
  • Phytin is a store of phosphorus, carbohydrates and various cations. In corn kernels, phytate phosphorus represents up to 88% of total phosphorus (O'Dell et al., 1972). The mobilization of phytin is due to phytases, a special type of phosphatases, capable of hydrolyzing phosphate from phytic acid as well as from other phosphorylated substrates (Gibson and Ullah, 1990). Phytase activities have been reported in a wide range of seeds.
  • Extracellular phytases produced by the fungus Aspergillus niger can be obtained in large quantities and have been found to be well suited for use as a feed additive for animals (Nair and Duvnjak, 1990, Simons et al., 1990) .
  • We have sequenced van Hartingsveldt et al., 1993; Ehrlich et al., 1993) cDNAs encoding two different phytases, Phy A and Phy B ⁇ 'Aspergillus niger.
  • transgenic tobacco plants have been obtained ectopically expressing the fungal phytase Phy A (Pen et al, 1993, Ver oerd et al, 1995)
  • a cDNA encoding the subunit of this corn seed phytase has been isolated and characterized. This constitutes the first nucleotide sequence obtained for a plant phytase.
  • a rabbit polyserum directed against the phytase of maize purified until homogenization was used to screen a cDNA expression library of young corn plants.
  • Several positive clones containing an insert of approximately 1400 bp were able to be isolated.
  • the insert sequence of one of these clones was established.
  • This cDNA, called phy SU contains 1335 bp with an open reading frame for 387 aa.
  • the N-terminal residues (23 aa) of the purified phytase were established. These residues are found in positions 19 - 41 of the sequence of aa for which code phy SI 1. This confirms that this cDNA codes for the phytase of corn.
  • the present invention therefore provides the first sequence coding for a plant phytase.
  • Ehrlich and Montalban (1992) and Gellatly and Lefebvre (1990) reported attempts to clone and sequence phytase cDNAs from soybean seeds and potato tubers respectively, but the corresponding sequences have never been published , so comparison of maize cDNA with other plant phytase cDNAs is not possible.
  • nucleotide sequences available correspond to phytases originating from Aspergillus niger (van Hartingsveldt et al., 1993; Ehrlich et al., 1993).
  • the phytases' of microorganisms belong to class 3 phytases which start by removing orthophosphate from position 3 of phytic acid, while plant phytases belong to class 6 phytases which catalyze the removal of! Orthophosphate of position 6.
  • Previous comparisons between the purified phytases of Aspergillus ficuum and soybeans due to Gibson and Ullah (1990) show that few physical characteristics at the protein level (molecular size, amino acid composition, AA sequences partial) appear to be common to both enzymes.
  • EcAP E.coli periplasmic acid phosphatase
  • the consensus motif is generally located at the N-terminus of the microorganism acid phosphatases (position 81 - 87 in Phy A to "Aspergillus), while it is located between positions 204 and 210 in the sequence of These comparisons confirm that the plant phytases are very different from the well characterized ergspergillus phytases.Also: a) the two Aspergillus phytases are excreted in the external environment during a phosphate deficiency, they have a signal peptide and are highly glycosylated. However, plant phytases are intended to hydrolyze the phytin contained in the plant.
  • the present invention therefore relates to the fragments isolated nucleic acid encoding a plant phytase enzyme
  • the enzyme is cereal phytase, such as, but, wheat, barley, rye, triticale
  • the present invention relates to an isolated nucleic acid fragment coding for a phytase activity, characterized in that it comprises all or part of a nucleotide sequence as shown in the identifier of sequence no.1, or all or part of a sequence homologous to that shown in sequence identifier no.1, or all or part of a sequence complementary to said sequence of sequence identifier No. 1 or of a homologous sequence.
  • nucleic acid fragment is meant here a nucleotide sequence which may be of DNA or RNA type. These terms are defined in all basic molecular biology works.
  • a nucleic acid fragment according to the invention is a double stranded DNA fragment.
  • the term “part” designates in particular a fragment of at least 20 nucleotides, in particular of at least 100 nucleotides, for example of at least 500 nucleotides and advantageously of at least 1000 nucleotides identical to a portion of equivalent length of the nucleotide sequence concerned.
  • the term “homologous” refers to any nucleic acid exhibiting one or more sequence modification (s) with respect to all or part of the sequence shown in SEQ ID No. 1, and coding for an enzyme having the activity mentioned above. above.
  • nucleotide (s) can be introduced in particular to improve the activity of the enzyme.
  • a degree of homology of at least 70% with respect to the native sequence will be preferred, advantageously at least 80%, preferably at least 90% and even more preferably at least 95%.
  • the invention relates to two phytases with different amino acid sequences, in particular in the part
  • sequence of SEQ ED No. 1 is a cDNA sequence, that is to say devoid of the introns of the corn phytase.
  • the subject of the invention is in particular a DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 1.
  • the fragment according to the invention comprises the complete sequence of 1335 nucleotides as shown in SEQ ID No. 1, a homologous sequence, a complementary sequence, or a sequence homologous to said complementary sequence.
  • the fragment comprises in particular the leader sequence going from nucleotide n ° 1 to 31 of SEQ ID n ° 1, as well as the termination sequence ranging from nucleotide 1 193 to 1335 of SEQ ID No. 1.
  • it may comprise said termination sequence augmented by a poly A tail at its 3 ′ end.
  • the fragment according to the invention comprises all or part of the coding sequence ranging from nucleotide No. 32 to 1,192 of SEQ ID No. 1, or its complement, or of a sequence homologous or complementary to said homologous sequence.
  • the invention also includes any sequence capable of hybridizing under stringent conditions with one of the above sequences. From a fragment originating from a particular plant, it is thus possible to isolate homologous fragments from other plants. On the other hand, using the cDNA, the corresponding genomic DNAs were isolated.
  • the present invention therefore also relates to the genomic DNA coding for the plant phytase.
  • the present invention also relates to a fragment consisting of cDNA and further comprising only part of the intronic fragments of genomic DNA. Introns allow in certain cases to improve the conformational structure of messenger RNA and its expression levels.
  • the invention also relates to any equivalent DNA sequence, that is to say that differs from the sequences mentioned above only by one or more neutral mutations, that is to say whose change or substitution of nucleotides involved does not affect the primary sequence of the resulting protein.
  • the DNA fragment according to the invention will be associated with a regulatory sequence suitable for its transcription, its translation and its addressing, such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • a regulatory sequence suitable for its transcription, its translation and its addressing such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • the means and methods for identifying and selecting these different regulatory signals are well known to those skilled in the art.
  • the present invention also relates to a DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 2 or SEQ ID No. 3.
  • SEQ ID No. 2 represents the nucleotide sequence corresponding to the PHYT I gene (also shown in Figure 4);
  • SEQ ID No. 3 represents the nucleotide sequence corresponding to the PHYT II gene (also represented in FIG. 5).
  • the fragment according to the invention comprises the promoter of the genomic DNA of the plant.
  • the subject of the invention is also a DNA sequence characterized in that it comprises all or part of a sequence complementary or complementary to the homolog of a sequence as defined in SEQ ID N ° 1, SEQ ID N ° 2 or SEQ DD N ° 3. It also relates to the use of one of these sequences as a molecular probe.
  • the present invention therefore also relates to the promoter of a plant phytase gene as well as the promoter of a cereal phytase gene and the promoter of a corn phytase gene.
  • the promoter of a plant phytase gene contains all or part of the fragment ranging from nucleotide No. 1 to nucleotide No. 2096 of the sequence as defined by SEQ ID No. 2, or all or part of the fragment ranging from nucleotide n ° 1 to nucleotide n ° 1328 of the sequence defined by SEQ ED N ° 3.
  • promoters of a plant phytase gene comprising a sequence identical or homologous to more than 70% of the sequence of the fragments as defined above, as well as the promoters comprising all or part of a sequence complementary or complementary to the homolog of such a sequence.
  • the invention also includes the use of the above promoters in molecular constructions intended to improve the agronomic food or industrial quality of a plant, in particular resistance to pathogens or the availability of nutrients.
  • the present invention also relates to an expression cassette characterized in that it comprises a nucleic acid fragment according to the present invention, placed under the control of regulatory sequences capable of controlling the expression of said phytase.
  • regulatory sequences include a promoter as defined above.
  • said regulatory sequences are capable of controlling expression specifically in a particular type of tissue, in particular in the albumen.
  • chloroplastic addressing signals mention may be made of the sequence coding for the transit peptide of the precursor of the small subunit of ribulose 1, 5-biphosphate carboxylase from Pisum sativum.
  • addressing signals mitochondrial we can cite the sequence coding for the transit peptide of the precursor of the beta subunit of the mitochondrial ATP-aseFl of Nicotiana plumbaginifolia.
  • the addressing sequences can be sequences coding for an N-terminal signal peptide ("prepeptide"), possibly in association with a signal responsible for the retention of the protein in the endoplasmic reticulum (signal of the KDEL type ), or a vacuolar or "propeptide” addressing signal.
  • prepeptide an N-terminal signal peptide
  • the presence of the N-terminal signal peptide or prepeptide allows the penetration of the nascent protein into the endoplasmic reticulum where a certain number of post-translational maturations take place, in particular the cleavage of the signal peptide, the N-glycosylations, if the protein in question presents N-glycosylation sites, and the formation of disulfide bridges.
  • the prepeptide responsible for addressing the protein in the endoplasmic reticulum, is very useful. It is normally a hydrophobic N-terminal signal peptide having between 10 and 40 amino acids and being of animal or vegetable origin. Preferably, it is a prepeptide of plant origin, for example that of sporamine, barley lectin, plant extensin, ⁇ -mating factor, pathogenesis protein 1 or 2.
  • the signal peptide is cleaved by a signal peptidase upon the co-translational introduction of the nascent polypeptide into the lumen of the RER (Granular Endoplasmic Reticulum).
  • the mature protein no longer has this N-terminal extension.
  • the addressing sequences can, in addition to the prepeptide, also include an endoplasmic retention signal, consisting of the peptides KDEL, SEKDEL or HEKDEL. These signals are normally found at the C-terminus of the protein and remain on the mature protein. The presence of this signal tends to increase the yields of recombinant proteins.
  • the addressing signals may, in addition to the prepeptide, also include a vacuolar or "propeptide" addressing signal.
  • a vacuolar or "propeptide” addressing signal In the presence of such a signal, after passing through the RER, the protein is addressed to the vacuoles of the aqueous tissues, for example the leaves, as well as to the protein bodies of the reserve tissues, for example the seeds, tubers and roots.
  • the targeting of the protein to the protein bodies of the seed is particularly interesting because of the capacity of the seed to accumulate proteins, up to 40% of the proteins relative to the dry matter, in cellular organelles derived from vacuoles. , called protein bodies and because of the possibility of storing for several years the seeds containing the recombinant proteins in the dehydrated state.
  • propeptide a signal of animal or vegetable origin can be used, the plant signals being particularly preferred, for example pro-sporamine.
  • the propeptide can be N-terminal ("N-terminal targeting peptide" or
  • NTTP NTTP
  • C-terminal C-terminal
  • the use of the signal peptide or prepeptide can lead to the glycosylation of the protein.
  • the protein In the absence of any addressing signal, the protein is expressed in the cytoplasm.
  • the accumulation of phytase is carried out in the endosperm.
  • a cloning or expression vector comprising the fragment mention may be made of vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses etc.
  • plasmids will be used.
  • the present invention therefore also relates to a method for increasing the phytase content in a plant, characterized in that an overexpression of the phytase enzyme is induced in the plant using an expression cassette according to the present invention.
  • an overexpression of phytase activity is induced in the plant.
  • the term “phytase” is understood here to mean a functional definition which includes any plant phytase capable of functioning as a selection marker by conferring phytase activity on a host cell deficient in phytase or having an enzymatic activity as measured for example according to Example 1. 13. This definition also includes any plant phytase capable of functioning in a given plant to increase the phytase activity of said plant. This term therefore includes not only the specific enzyme of the specific plant to be treated, but any other phytase enzyme from other plants if this phytase is capable of functioning in the plants to be treated.
  • overexpression is understood here both to mean an increase in the level of phytase activity relative to the level expressed in a normal plant, as well as a deregulation of the expression leading to the expression of the phytase activity in a tissue or a compartment and / or at a stage of development where this is not normally expressed.
  • Obtaining plants expressing the phytase in a deregulated manner is obtained by introducing, by the methods of genetic engineering, a plant phytase gene possibly modified in an appropriate manner to obtain the modification of the expression, and preferably the overexpression of the phytase in the plant to be improved.
  • plants may be modified by the methods of genetic engineering described in the literature, by transformation of cells followed by their regeneration, or by transformation of tissues or gametes.
  • a functional coding sequence is introduced into the plant genome under conditions allowing its expression.
  • the term "functional coding sequence” means a DNA sequence coding for a polypeptide as defined above as “phytase”, said sequence can therefore be shorter or longer than the total coding sequence of the complete gene of the enzyme .
  • the “functional coding sequence” will include the coding sequence for a 5 'and / or 3' signal peptide.
  • the foreign gene can be a heterologous gene, that is to say which comes from a different plant than the host cell, the gene coding for a polypeptide ordinarily not produced by the plant in the genome of which it is introduced.
  • the foreign gene introduced into the genome of the plant can also be a gene homologous to the endogenous gene, that is to say the expression of which produces the phytase naturally produced by the plant.
  • condition allowing its expression is meant that the gene encoding phytase is placed under the control of elements ensuring its expression.
  • DNA sequence coding for phytase is associated with a regulatory sequence suitable for its transcription, translation and addressing, such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • a regulatory sequence suitable for its transcription, translation and addressing such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • Said functional gene coding for phytase can be introduced into plant cells according to known techniques. We can use for example in this case, but not necessarily, the phytase gene regulation system.
  • the bacterial strain will contain the gene coding for phytase under the control of elements ensuring the expression of said gene.
  • the strain can be transformed by a vector into which is inserted the gene encoding phytase under the control of elements ensuring the expression of said gene. This gene will be inserted for example in a binary vector such as pBIN19 (Bevan, 1984) or pMON 505 (Horsch and Klee, 1986) or any other binary vector derived from the plasmids Ti and Ri.
  • a functional phytase gene for example, we will transform monocotyledonous species, notably rice, wheat and corn, using Agrobacterium tumefaciens.
  • an expression vector comprising the functional phytase gene according to the invention mention may be made of vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses , etc.
  • plasmids will be used.
  • a functional gene coding for a phytase according to the invention is introduced into the genome of the plant, this will preferably be under the control of a heterologous promoter.
  • the present invention also relates to plants or plant organs with increased phytase content which can be obtained by the process according to the invention.
  • the phytase content can be increased globally or only locally, i.e. in a part of the plant or in a particular cell compartment.
  • Cereals in particular corn, wheat, barley, sorghum, rye, as well as peas, soybeans and potatoes, are cited as transgenic plants according to the invention.
  • the present invention more particularly relates to a plant, in particular transgenic, according to the invention, characterized in that it produces transgenic seeds expressing an increased amount of phytase.
  • a subject of the present invention is also dried seeds of transgenic plants according to the invention and in particular seeds comprising an increased phytase content obtained by specific expression of the nucleic acid fragment or of the DNA sequence according to the present invention, in the seed.
  • the subject of the present invention is in fact also a plant host consisting of a plant or plant organ, in particular transgenic, in which the plant phytase can be expressed in a part of the plant or in a cell compartment where this enzyme is not produced naturally, characterized in that an expression cassette according to the invention has been introduced comprising regulatory sequences which induce specific expression in said part of the plant or said cell compartment.
  • the plant or the plant organ in question is advantageously a cereal and more advantageously still corn or their corresponding organs.
  • the present invention also relates to a flour obtained from a seed according to the invention.
  • the subject of the present invention is a composition for human or animal consumption comprising seeds, a seed meal or a phytase according to the present invention.
  • the plant or a part thereof can be used in the food ration of monogastric animals, on the one hand to reduce the level of phytate in the manure or slurry and on the other hand to improve the digestibility of the phytate .
  • the expressed phytase will act on the plant during its development.
  • Phytase will also be used in food preparation processes or in starch extraction processes (soaking process).
  • the phytase activity generated can also be used to recover recovered soaking water or brewing water.
  • the increased availability of phosphorus makes these waters very useful as additives for culture media or fermentation supports.
  • the phytase activity generated allows better recovery of innositol and its derivatives from soaking or brewing water.
  • the invention also relates to the use of the phytase according to the invention for obtaining better availability of calcium, for example for food purposes.
  • the activity of the phytase is exerted on phytates of another plant origin present in the ration.
  • the DNA fragments according to the invention can also be used to transform microorganisms or eukaryotic cells to clone and produce the phytase enzyme.
  • the present invention therefore also relates to a method for the production of phytase, characterized in that it comprises the steps of: a) transformation of a eukaryotic or prokaryotic host, in particular of a plant or of a microorganism with a expression cassette according to the present invention, comprising regulatory sequences capable of controlling the expression of an increased quantity of phytase in the plant host or the microorganism respectively; b) culture of the transformed microorganism or growth of the transformed plant, and c) extraction of the phytase from the culture of microorganisms or transgenic plant tissues.
  • the present invention also relates to a recombinant phytase obtained by the process according to the invention, preferably in the form of a dimer or a heterodimer, and antibodies directed against the plant phytase according to the invention.
  • the present invention also relates to the use of phytase to increase the extractability of the starches of the grains where it is expressed.
  • Phytate precipitates proteins with starch so that if you reduce the phytate level, the extraction of starch is easier.
  • the addition of a phytase to the grains of plants from which it is desired to extract the starch makes it possible to alleviate the precipitation of proteins by phytates.
  • the subject of the present invention is therefore the use of a phytase according to the invention and / or of seeds containing a phytase according to the invention for extracting starch from grains of plants
  • DNA fragments according to the invention can be used as a marker for a phenotype linked to the expression of phytase.
  • the invention also relates to the use of a phytase according to the invention or the use of all or part of plants containing a phytase according to the invention, for the production of myo-inositol for therapeutic or dietetic purposes.
  • Myo-inositol the active nutritional form of inositol, is a constituent of the phospholipid phosphatidylinositol
  • Myo-inositol is known for its virtues in the health field. It has often been attributed to effects on the decrease in the concentration of triglycerides and cholesterol in the blood, and more generally for protection against cardiovascular diseases.
  • myo-inositol have beneficial effects on insomnia and anxiety.
  • the peripheral neuropathy of the diabetic is one of the most paralyzing complications of diabetes.
  • myo-inositol it has already been assumed for several years that a reduction in the level of myo-inositol is associated with damage to the nerve fibers of diabetics suffering from such a complication.
  • Figure 1 represents the nucleotide sequence and the deduced amino acid sequence of the phy SI cDNA 1.
  • the underlined amino acids correspond to two N-terminal sequences obtained from purified corn phytase.
  • the sequence of aa which has a homology with 33 aa of phytase to Aspergillus Phy A (van Hartingsveldt et al., 1993) is underlined in dotted lines.
  • the Ncol (CCATGG) and Asel (ATTAAT) sites used for cloning into the expression vector pET 14 (b) are framed
  • FIG. 2 represents the comparison of the 33 aa overlap regions of the protein sequence deduced from the phy S I 1 cDNA and the phytase sequences Phy A and Phy B of Aspergillus.
  • FIG. 3 represents the restriction maps deduced from the genomic clones isolated from the EMBL3 library
  • FIG. 4 represents the nucleotide sequence of the class I clone (I 9. 14 HindIII / Sal I fragment of 4.7 Kb) coding for a class I phytase protein corresponding to the PHYT I gene (this sequence corresponds to SEQ ID No. 2).
  • FIG. 5 represents the nucleotide sequence of the class II clone (P23 7 HindIII fragment of 3 Kb) coding for a class II phytase protein corresponding to the PHYT II gene (this sequence corresponds to SEQ ID No. 3) 5
  • the lower case letters correspond to the non-coding sequence
  • the upper case letters correspond to the transcribed sequence
  • the deduced protein sequence is indicated using the three-letter code of the representation of amino acids.
  • Figure 6 shows the comparison of protein sequences of phytase of the phy SU cDNA, class I and class II. The alignment was carried out with the "Clustal V multiple alignment" program. The protein sequence is indicated using the letter code of the amino acid representation.
  • the cDNA library is constructed with RNAs extracted from Zea mays c.v. MO 17 (Maisadour).
  • the RNA used for Northern blot analyzes is extracted from Zea mays c.v. AM0406 (Maisadour).
  • Corn seeds are soaked for twelve hours in distilled water aerated at room temperature and then transferred to wet sand at 26 ° C, with an eight-hour photo-period (50 ⁇ E / s per vr) .
  • Germination of corn kernels of line B73 is carried out on vermiculite in the dark at 28 ° C.
  • the B73 line was chosen for the analysis of the transcription starts since the genomic sequences were determined from this genetic material. Thus, the possible differences noted between the sequences of the transcripts and those of genomic fragments cannot be attributed to intervenarietal polymorphism.
  • RNA is purified from frozen embryos (scutellum and embryonic axis) of young corn plants three to four days old, using guanidine hydrochloride (Logemann et al., 1987). We select the fraction poly (A) + on oligo dT columns (Pharmacia). Two-stranded cDNA was synthesized using a cDNA kit (Promega) and an oligo primer adapter (dT) -Notl. After ligation of the Eco RI adapters (Pharmacia), the cDNA is digested with NotI and it is cloned directionally in ⁇ gtl 1 (Promega).
  • E. coli extracts About 1 x 10 ° independent recombinants are obtained after packaging (Stratagene) and infection of E. coli strain L ⁇ 392 (Promega).
  • the cDNA library of ⁇ gtl 1 is amplified in E. coli strain RY1090.
  • the phage plaques are immunologically screened using the Promega ProtoBlot immuno-screening system according to the supplier's protocol. The screening is carried out with a crude rabbit antiserum directed against the purified corn phytase (Labouré et al., 1993). After dilutions (1: 1000 for the first screening and 1: 5000 for the subsequent screening steps), the antiserum is treated with E. coli extracts as indicated in the Promega guidelines.
  • the phage inserts of interest are then subcloned into the Eco RI - Notl sites of a pBS-SK + vector (Stratagene).
  • the nucleotide sequences are determined on a double-stranded DNA using the PRISM Ready Reaction Kit (Applied Biosystems). ), following the manufacturer's instructions and using a Perking Elmer Cetus PEC480 DNA thermal cycling device and an ABI 373A sequencer (Applied Biosystems).
  • Phage plaques are hybridized with partial phy AM10 cDNA as a probe, in order to isolate full-length cDNAs, on 360,000 plaques according to the technique of Benton and Davis (Sambrook et al., 1989): the filter is immersed, DNA side up, in the denaturing solution for ten minutes, then for six minutes in the neutralizing solution.
  • the Mac Vector program (Kaufman et al. 1994, Eastman KODAK company New Haven, CT, USA) was also used for processing the genomic sequences.
  • the phytase phy SI 1 cDNA (Eco RI / Not I fragment containing the phy SU sequence of 1335 bp) is used as a probe for the screening of a lambda corn genomic library.
  • the bank is a commercial bank (Clontech, Palo
  • Alto, CA, USA constructed from DNA fragments extracted from seedlings of the B73 line.
  • the DNA is partially digested with the enzyme Mbo I.
  • the genomic fragments thus obtained are cloned at the Bam HI site of the phage EMBL-3 (Frischholz et al. 1983, J. Mol Biol. 170: 827) and can be excised by an enzyme digestion Sal I.
  • the screening of the genomic library was carried out according to the indications of Sambrook et al. (1989, Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, New York). 10 ° recombinant phages by genomic DNA library (ie six corn genome equivalents in total) are spread at different concentrations on petri dishes in the presence of the host bacterium. Replicates of the lysis ranges are produced on a nitrocellulose filter. Recombinant phages containing genomic fragments homologous to cDNA phytase are identified after hybridization of the filters with the phytase probe. By superimposing the filter presenting positive signals with the corresponding box, the interesting lysis range is removed and the phages resuspended. The phages are then rediluted, re-spread on a petri dish to undergo an additional screen. Three successive screens were carried out in order to obtain isolated positive clones. After the third round of screening, thirteen clones were positive.
  • RNAs are extracted using guanidine hydrochloride (Logeman et al., 1987) from frozen embryos at various stages of germination. The size of equal amounts of RNA is fractionated on an agarose gel to
  • Proteins are extracted and analyzed according to the
  • the purified corn phytase is electrophoresed on SDS-PAG ⁇ at 12.5% and an electro-transfer is carried out on a PVDF "Problott" membrane (Applied Biosystems).
  • the region corresponding to the 38 kDa subunit is revealed by staining with amido black.
  • Automated ⁇ dman degradation of the protein is carried out using an Applied Biosystems 473 A sequencer with the reagents and
  • RNAgents Total RNA Isolation System The embryos (embryonic axis and scutellum) aged one day and one and a half days were ground separately in liquid nitrogen. The total RNA and the messenger RNA were extracted and purified from a gram of ground material according to the indications of the kits used. "RNAgents Total RNA Isolation System" and
  • JD Southern method (1975, J. Mol Biol. 98: 503-517) makes it possible to demonstrate individual differences in the size of the restriction fragments obtained with a given enzyme and a given probe, which correspond to defined locations on the genome i.e. at genetic loci
  • the phy SU probe - Eco RI / Not I fragment of 1361 bp - was hybridized on a transfer of an electrophoresis gel containing the DNA digested with Eco RI and Hind III from different lines of maize for which segregated progeny were available and used for genetic mapping of maize.
  • the Al 88 x HD7 crossover was chosen because a polymorphism of the size of the restriction fragments homologous to the probe was demonstrated between the two parental lines.
  • Al 88 is an American line (University of Minnesota) and HD7 is a doubled haploid line (Murigneux et al. 1993, Theor. Appl. Genêt. 87: 278-287) from a synthetic population including material of Chinese origin essentially.
  • the phy SU probe was then hybridized on membranes containing the DNA of 58 SSD ("Single Seed Descent") recombinant lines from this cross. On the membranes containing the DNA digested with Hind III, two bands of different sizes were observed for each of the parents.
  • the plasmid pBIOS 255 was obtained by inserting the 1.3 kb fragment from PI 9.14 restricted to Sac I (position + 749) / Nco I (Nco I is located at the level of the first methionine of the gene carried by this genomic fragment), in the plasmid pRPA-RD-100 cut with Sac I / Nco I.
  • Sac I position + 749
  • Nco I is located at the level of the first methionine of the gene carried by this genomic fragment
  • the latter contains the GUS gene and the terminator Nos (Bevan et al., 1983, Nature 304: 184-187).
  • a second construct with a larger promoter fragment (2, 1 kb) was developed.
  • the P19.14 fragment restricted to Eco RI / Sph I was inserted into the plasmid pBIOS 255 cut to Eco RI / Sph I.
  • the resulting plasmid is called pBIOS 261.
  • the plasmid pBIOS 262 was obtained by inserting the 1.3 kb fragment from P23.7 cut at Eco RI / Nco I (Eco RI, site of the polylinker of the vector and
  • pBIOS 256 containing the phytase cDNA attached to the terminator of the nopaline synthetase gene (ter Nos) which brings about a functional polyadenylation signal in many plant species.
  • This plasmid was obtained by cloning the 300 bp Sma I / Eco RV fragment comprising the Nos terminator (Bevan et al. 1983, Nature 304: 184-187) from the plasmid pBIOS 250 at the Bst XI site (made "blunt ends" thanks to to the action of T4 DNA polymerase) of the plasmid phy SU.
  • the vector pBIOS 2500 had been generated by deletion of the Sma I fragment from the plasmid pDM 302 (Cao et al. 1992, Plant Cell Reports 1 1: 586-591).
  • pBIOS 250 comprising the Actin promoter - Actin intron (pAct) (Me Elroy et al. 1991, M.G.G. 231: 150-160), in pBIOS 256 restricted to Hind III.
  • the vector obtained is called pBIOS 259 carrying the pAct - PHYT I - ter Nos gene;
  • the plasmid pBIOS 220 is a construct comprising the 35S promoter of CaMV and the Nos terminator .
  • the vector obtained is called pBIOS 264 carrying the p35S - PHYT I - ter Nos gene. ⁇ blbis) Constructed carrying the PHYT I genes (class I phytase expressed in the cycloplasm of the corn grain albumin)
  • the constructions allowing the expression of the phytase in the cytoplasm of the endosperm were carried out as follows: - cloning of the Bam HI / Nsi I fragment from pBIOS 256 into the BamHI / Nsi I sites of pDV 03000, plasmid containing the HMWG promoter (promoter of the gene for a wheat storage protein, the "High Molecular Weight Glutenin”; Robert et al. 1989, The Plant Cell 1: 569-578) and the terminator Nos.
  • the vector obtained is called pBIOS 258, carrying the pHMWG - PHYT I - ter Nos gene;
  • PHYT I - ter Nos is called pBIOS 263;
  • cloning under the control of the ⁇ -zeine promoter can be obtained by cloning the Hind III / Sma I fragment of the plasmid p ⁇ 63 comprising the ⁇ -zeine promoter, in pBIOS 259 digested to Hind III and Eco RV, substituting thus the actin promoter and the rice actin intron by the ⁇ -zeine promoter
  • the vector obtained, carrying the p ⁇ zeine -PHYT I - ter Nos gene, is called pBIOS 263bis.
  • the plasmid pBIOS 256 serves as the basic construction.
  • the oligonucleotides used for the amplification are the following:
  • - ol MUP1 5 'CAT GAA CTT CCT CAA AAG TTT CCC CTT TTA TGC CTT CCT TTGTTT TGG CCA ATA CTT TGT AGC TGT TAC TCA TGC TGA CTC
  • clone M2 # 61 had the perfect addition of 60 of 76 nucleotides, thus defining only part of the shedding signal.
  • the sequence of the rest of this plasmid revealed a basic substitution in the coding part (adenine in place of guanine at position 853 of phySl 1) not altering the amino acid coded by the affected nucleic acid triplet.
  • the plasmid M2 n ° 61 was selected as the base matrix, to add the entire PR-S signal by a second series of site-directed mutagenesis experiments.
  • the oligonucleotides used for the amplification were the following:
  • the entire amplification product was deposited on 1% agarose gel.
  • the band corresponding to the mutagenized plasmid was cut and then eluted (Micropure 0.22 + Microcon 50 System from Amicon, Ma USA).
  • the purified product was ligated for 16 h at 12 ° C. with 3 units of T4 DNA Ligase
  • a plasmid was retained and the structure of the Sec-PHYT I gene was confirmed by sequencing using three oligonucleotides: - Ml 3-20 primer, - phy5 (position 718/737 of phyS l 1),
  • pBIOS 265 bis The plasmid resulting from the addition of the excretion signal and containing the coding part of the fused class I phytase is called pBIOS 265 bis.
  • a study of the promoter activity can advantageously be carried out by introducing, by the particle gun method, into cells originating from the tissue where this activity is sought, the promoter zone to be evaluated fused to a reporter gene whose activity is easily detectable
  • the GUS gene E coli ⁇ -glucuronidase
  • the cells then produce a blue pigment which allows their observation If the promoter is active in the bombarded tissue and at the stage considered, several tens of cells has the surface of the explant will acquire this blue color No spot will be visible if the promoter is inactive under the conditions used corn grains are sterilized by immersion of 20 'in a saturated solution of calcium hypochlorite, then put to germinate in sté ⁇ le condition between two sheets of blotting paper soaked
  • the bombardment medium can for example be composed of 0.2 M of Mannitol and 0.2 M of Sorbitol solidified with 8 g / l of Agar.
  • the fabrics are then bombarded.
  • the plasmids containing the promoter to be studied fused to the GUS gene are purified on a Qiagen® column according to the manufacturer's instructions. They are then precipitated on tungsten particles (M10) according to the protocol described by Klein (1987, Nature 327: 70- 73). The particles thus coated are projected towards the target cells using the cannon. Optimization of the bombardment conditions may depend on the type of aircraft used and is one of the techniques normally mastered by those skilled in the art. Forty-eight hours after the bombing, the fabrics are stained as described by Jefferson and then observed
  • Plantlets are regenerated from these calluses by modifying the hormonal and osmotic balance of the cells according to the method described by Vain et al (1989, Plant Cell Tissue and Organ Culture 18: 143-151). These plants are then acclimatized in the greenhouse where they can be crossed or self-fertilized
  • the target cells are callus fragments with a surface of 10 to 20 mm 2 They are placed, 4 h before bombardment, at the rate of 16 fragments per dish, in the center of a petri dish containing a culture medium identical to the initiation medium, supplemented with 0.2 M mannitol + 0.2 M sorbitol The tissues are then bombarded as described above The boxes of calluses thus bombarded are then sealed using
  • Scellofrais® then grown in the dark at 27 ° C. The first subculturing takes place 24 hours later, then every two weeks for 3 months on medium identical to the initiation medium supplemented with a selective agent, the nature and concentration of which may vary depending on the gene used.
  • the selective agents which can be used are generally active compounds of certain herbicides (Basta®, Round up®) or certain antibiotics (Hygromycin,
  • calluses whose growth is not inhibited by the selective agent are usually and mainly composed of cells resulting from the division of a cell having integrated into its genetic heritage one or more copies of the selection gene.
  • the frequency of obtaining such calluses is approximately 0.8 calluses per bombarded box.
  • calluses are identified, individualized, amplified and then cultivated so as to regenerate the plants. In order to avoid any interference with untransformed cells, all of these operations are carried out on culture media containing the selective agent.
  • the plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized.
  • the Bar gene from Streptomyces hygroscopicus codes for a phosphinothricin acyl transferase (PAT) which inactivates acetylation of phosphinotricin - the active molecule of the herbicide Basta®.
  • PAT phosphinothricin acyl transferase
  • the coding sequence of the Bar gene is under the control of a regulatory region allowing a strong and constitutive expression in plant cells.
  • a regulatory region can advantageously consist of the promoter and the first intron of the rice Actin gene as described by Mc Elroy (1991, Mol. Gen. Genêt. 231: 150-160).
  • This chimeric gene is cloned on a plasmid allowing its amplification by Escherichia coli.
  • a so-called cotransformation technique can advantageously be used.
  • the two plasmids (the plasmid carrying the selection gene and one of the different "phytase" plasmids) are coprecipitated on the tungsten particles, the total amount of DNA precipitated on the particles remaining identical to what it is in the standard protocol (5 ⁇ g of DNA for 2.5 mg of particles) each plasmid will represent approximately half of the total DNA used.
  • cointegration of plasmids in plant cells is the most frequent event (of the order of
  • RT-PCR is carried out on 10 mg of total RNAs previously treated for 1 hour at 37 ° C. with DNase-RNase free (Boehringer) in the presence of
  • RNAsin Boehringer
  • RNAs are then deproteinized by treatment with phenol-chloroform and precipitated.
  • oligonucleotide "D” complementary to a sequence common to the two genes hybridizing 546 bp downstream of ATG for gene I and 552 bp downstream of ATG for gene II.
  • the sequence of oligo "D” is as follows: CTGGGAGTAGGCGCGGGAGTG (SEQ ID No. 15).
  • the amplifications are carried out on a fraction of the reverse transcription, in the presence of an oligonucleotide "C”: GCTGTAGCAGTCGCTCACCG (SEQ ID N ° 14), common to both genes and hybridizing 214 bp downstream of ATG for gene I and 220 bp downstream for gene II.
  • the second oligonucleotides used start at the initiating ATG and are specific for each gene.
  • PCR conditions are as follows: 94 ° C, 1 min; 60 ° C, 1 min; 72 ° C, 1 min, repeated 30 times. PCR products are analyzed on agarose gel at 2
  • transgenic maize were cultivated in the field, and quantities of the order of 16 kg per batch were harvested.
  • the technical study consists in studying the availability of phosphorus from these corn in broiler chickens. Two biological measurement criteria are retained for this: phosphorus retention or digestive balance and bone mineralization.
  • Each diet is made up of 3 parts: a base, the phosphorus source to be tested and an adjustment part.
  • the base is common to all diets, it ensures a minimum and constant intake of phosphorus and proteins, as well as the trace elements and vitamins necessary to cover the needs of the animals.
  • the phosphorus source to be tested consists of the different lots of corn according to the invention or else the reference monocalcium phosphate
  • the batches to be tested are introduced at the rate of approximately 50%, so that the quantity of phosphorus to be tested is identical for all the regimes, and the monocalcic phosphorus at 3 rates: 0; 0.45 and 0.90%)
  • the adjustment part is made up of raw materials which do not provide phosphorus (corn starch, amino acids, oil, calcium, cellulose) and helps to balance the amino acid, energy and calcium regimes Only the phosphorus of experimental diets are far below the recommendations for chicken of this age (otherwise release of P in the urine which is mixed with the feces, and impossibility of measuring the digestibility of P)
  • the bunches were steam granulated (La Meccanica press, type CLM 200, 2.5 mm x 35 mm die)
  • the experimental batches consist of - one but only control, one but control supplemented with 500 Units (UP) of microbial phytase, one but adds 1000 Units (UP) of microbial phytase, the batches of transgenic corn according to the invention Food are distributed at will from D14 to D25
  • the collection of droppings is carried out every 24 hours for three days from D22 to D25
  • the excreta are grouped by cage They are then frozen at - 20 ° C, then lyophilized for 72 hours before d '' to be ground
  • a sample per cage is then taken for the determination of the total phosphorus content
  • the chickens are sacrificed and the two central phalanges of the middle finger of each leg are taken for the determination of the ash rate
  • the in vivo availability of P is assessed according to two criteria, either by measuring the P retained by the animal (digestive assessment), or by the bone mineralization test (Sauveur, 1983)
  • the phosphorus retention coefficient (CR P) is measured on each of the regimes.
  • the CR P of the different but experimental ones is then calculated by difference with the CR P of the base measured on the regime consisting solely of the base and the part of adjustment
  • the availability of phosphorus from experimental maize measured by the bone mineralization test is calculated by the ratio between the amount of ash obtained with the diet containing the raw material, and the amount of ash obtained with the plans containing monocalcium phosphorus (calculated by regression using the 3 diets of this standard range for the same amount of phosphorus ingested) 1.13) Determination of phytase activity
  • test extract is added, 50 ml in 50 mM sodium acetate, pH 4.8; after 1 h of incubation at 55 ° C., the released inorganic phosphate is measured as follows: 750 ml of the mixture are added to each tupe: acetone: 5N SO 4: 10 mM ammonium molybdate (2: 1: 1) and 50 ml citric acid 1M. After homogenization with a vortex, the tubes are centrifuged for 3 min at 3000XG to remove any precipitate due to acetone.
  • the activity is expressed in nmoles of phosphate released in 1 hour at 55 ° C, per mg of protein.
  • the proteins are dosed on the extracts by the classic Bradford method.
  • a cDNA library is constructed in the expression vector ⁇ gtl 1 using cDNAs synthesized with polyadenylated mRNAs isolated from young corn plants three to four days old.
  • the library is screened with crude rabbit antiserum directed against the phytase subunit purified from young corn plants. The initial screening results in the isolation of twelve positive clones. When tested with affinity purified antiserum on the phytase subunit, a single clone gives a strong positive response.
  • the corresponding insert is subcloned into the vector pBS-SK and sequenced. It contains 930 bp with an open reading frame coding for 139 aa.
  • cDNA phy AM10 This labeled cDNA, called phy AM10, is used as a probe to screen the same library in order to search for corresponding full-length clones.
  • Several positive clones containing an insert of approximately 1400 bp are isolated.
  • the insert of one of these clones, called cDNA phy SI 1 is completely sequenced.
  • the nucleotide sequence of cDNA phy SI 1 contains 1335 bp with a high GC content (65%) and presents an open reading frame for a 387 aa polypeptide ( Figure 1).
  • the size of the encoded protein deduced from the amino acid sequence is 41 kDa, corresponding to the size of the phytase subunit detected by analysis.
  • FIG. 2 shows the alignment of this maize sequence with the corresponding sequences of the Phy A and Phy B phytases of Aspergillus this sequence of maize presents 84% of similarity (27% identity) with the corresponding Phy A phytase sequence from Aspergillus and 79% similarity with that of Phy B phytase.
  • Aspergillus phytase sequences contain the RHGxRxP consensus motif (underlined in FIG. 2) characteristic of the acid phosphatases of yeast, E. coli and certain mammals, and which it is believed to be acts from the phosphatase acceptor region (Piddington et al., 1993).
  • RNA is extracted from dry seeds, the seeds are hydrated for twelve hours in aerated water, the seeds are transferred to wet sand for 1, 2, 3, 5 and 6 days.
  • RNA is subjected to a Northern blot analysis, using the phy SU cDNA as a probe. No Phy S 11 transcripts were detected in total RNA from dry seeds or from seeds soaked for twelve hours in aerated water.
  • the phy SU cDNA is found to hybridize to a single mRNA of about 1400 bp, which appears during the first day of germination at 26 ° C, reaches its highest level on day 2, then gradually decreases from day 3 on day 6. Only a very slight hybridization is observed with the mRNA originating from mature leaves. This kinetics of mRNA accumulation is compatible with what has been described previously for phytase accumulation, but the maximum level of RNA is obtained two days before the maximum level reported for protein accumulation.
  • the coloring of the gel with Coomassie blue reveals a weak band at 40 kDa, which is only present after induction by IPTG
  • the procedure is as follows. the total proteins are separated (10 ⁇ g per lane) extracted from E. coli BL21 on SDS / PAGE at 12.5% and an electrostatic analysis is carried out on a nitrocellulose membrane. The protein is identified with the purified antibody for: 1) unprocessed BL21, 2) transformed BL21 with recombinant pET14, without induction by IPTG,
  • the phytase antibody cross-reacts with a polypeptide from induced E. coli extracts which migrate at exactly the same levels
  • the immuno-screening of a cDNA library of young maize plants allowed the isolation of a cDNA called phy SU, coding for a polypeptide at 41 kDa which in fact corresponds to the phytase subunit detected through
  • the target protein is produced in small quantities, and no accumulation is observed after one hour of induction.
  • the assembled form migrates to the same size as the native purified phytase, but the resulting protein shows no phosphatase activity. This suggests either that the assembly that occurs in the bacteria is not correct and results in a non-functional protein, or that a post-translational modification of the necessary protein that does not occur in E. coli is necessary for the activity.
  • Sequence reactions were also carried out on phage clones P3, P19 and P22 using oligonucleotides specific for the cDNA phytase phy SI 1.
  • P3, P22 and PI 9 could thus be positioned in relation to each other ( Figure 3).
  • the restriction and hybridization analyzes of the P5 clone reveal that the latter is also chimeric.
  • the genomic fragment P19 14 (class I)
  • the comparison of the sequence drawn from the genomic fragment and of the sequence of the cDNA phy SU reveals a single intron of 131 bp in the region 5 'leader not translated
  • the splicing of the intron would take place after the 13 th nucleotide base of the phy SU cDNA
  • S 1 1 These differences could correspond to intervenarietal polymorphism (phy SU comes from the Mol 7 line and P19 14 of the B73 line)
  • the phy SU sequence is entirely found in the genomic sequence From the Nco I site located at the triplet coding for the first methionine, to the Hind III cloning site, 2, 1Kb allow to determine the promoter region of this gene.
  • the open reading frame determined is the same as that of phy SU, the termination codon is also TAA This gene would therefore code for
  • Phy 1 is approximately 4.6 cm from the umcOlO locus on the side of the short arm of the chromosome and phy II, positioned in the same location as bnl 06.06, is 4.2 cm from the marker umc026.
  • Complementary hybridization was carried out on the membranes containing the digested DNA of the recombinant lines in order to establish the correspondence between these two loci and the genes of classes I and II characterized from the genomic fragments. To do this, the Eco RI / Sph I fragment specific for the sequence upstream of the class I gene (P19.14) was used as probe. The hybridization results demonstrate that the class I gene corresponds to the phy I locus.
  • oligonucleotides were tested: AP I and AP2 (Kit Marathon) / phy 20 (position + 95 / + 75 of phy SU); API and AP2 / phy 18 (position + 294 / + 273 of phy S U).
  • Their demonstration was carried out by hybridization with the phy SU cDNA probe (EcoR I / Not I).
  • the positive products were then cloned into the plasmid vector pGEM-T (Promega) according to the recommendations of the supplier, then sequenced. Different products, which can be classified into two groups, have proved to be informative:
  • each phytase gene (2.1 kb upstream from the start codon for class I and 1.3 kb upstream from the start codon for class II) can confer transcriptional expression in certain tissues. of the corn seedling.
  • These promoter fragments of the two phytase genes (also containing the leaders with their unique intron) can be used for all biotechnological modifications of various plants.
  • the data on the regulation of phytase genes suggest that they are only transcriptionally active at the time of germinative phase We therefore have promoters who are likely to be specific to this key stage in the development of the plant and its yield
  • telomeres in corn, for example, they can be useful for directing the production of an antifungal peptide in order to increase the resistance of the plant to fungi, particularly during the germination stage.
  • Other applications such as increasing the vigor of germination can be preferentially envisaged via the increase in the production of certain hormones such as by for example cytokinins and gibberellines. This can be achieved by the expression of biosynthetic enzymes from these hormones.
  • H.6a Constitutive expression in the cytoplasm The first consists in directly reducing the quantity of phytic acid produced in the corn embryo. It is known that certain mutants of corn, low phytic acid I and 2 can have a reduction in their phytic acid content of up to 33% of the total amount without seeing a reduction in their total phosphorus content (Raboy et al., 37 * "Annual Maize Genetics Conference 1995, Asilomar: Asbstract p. 6). We have also chosen to produce class I phytase throughout the plant via the use of constitutive promoters and this so that it hydrolyzes phytic acid into during production in the embryo as it seems that phytic acid is required during development of the embryo.
  • strategy aims to optimize the growth of plants according to the invention. The goal is to proceed in such a way that the phytase is not in the same compartment as the phytin, and therefore will not exercise its activity until the grains are crushed and ingested by the animal or during the 'dipping operation, the first industrial stage of starch extraction.
  • strategy we use two different approaches which can be combined to make a third.
  • Cytoplasmic expression in the albumen The first consists in taking advantage of the morphology of the grain of corn by expressing the phytase of class I of cytoplasmic type (PHYT I) in the compartment which does not contain phytic acid, c is to say in the albumen.
  • This tissue compartment is very large and can allow the expression of a large amount of phytase. Promoters of specific expression of this tissue are known and we have chosen to use 2 promoters of genes coding for cereal reserve proteins: the first comes from the ⁇ -zein gene of corn (Reina et al. 1990, NAR 18: 6425-6426) the second comes from the gene for a wheat storage protein, "High Molecular Weight Glutenin” (Robert et al. 1989, The Plant Cell 1: 569-578).
  • H.6b2 Constitutive expression in the extracellular space
  • the second approach is similar to the realization using a fungal phytase (Pen et al. 1993, Biotechnology 1 1: 81 1-814 and patent of invention of Pen et al. N ° EP-0 449 375) in tobacco and rapeseed via expression in a cell compartment different from that in which phytic acid is found.
  • the compartment chosen is the extracellular space.
  • an extracellular addressing signal is added at the start of the class I phytase protein via a phase fusion, to give a new protein (Sec-PHYT I).
  • H.6b3 Extracellular expression in endosperm Taking into account the opportunity that corn and cereals in general have a deep endosperm, we can combine the two previous approaches, namely: using specific endosperm promoters to express the excreted phytase (Sec-PHYT I). The same promoters as those used for the expression of the cytoplasmic phytase were chosen. This third approach guarantees a high level of phytase expression in the corn kernel ensuring its absence of expression in the germ rich in phytic acid.
  • a first analysis was carried out by Northern blots on total RNAs extracted at various stages of development (1, 2, 4 and 7 days) from different parts of the young seedling (coleoptile, leaf, scutellum, coleorrhize and root).
  • the results of the Northerns show a significant accumulation of mRNA phytase at 1 day in the coleorhize, the root and the coleoptile.
  • the hybridization signal then decreases in the root during the following stages (2, 4 and 7 days). It continues to increase in the coleoptile at least until the 4-day stage.
  • RNA phytase originating from roots were also carried out on total RNAs extracted from leaves or roots of adult plants (1 month). While no hybridization with phytase cDNA is observed in the case of leaf RNAs, a weak signal but significant is observed with RNAs originating from roots: the presence of RNA phytase is therefore detected in transcripts originating from adult roots, at a stage very after germination.
  • M situ hybridizations carried out on embryos at 1 day, also demonstrate a significant accumulation of mRNA phytase at the level of the coleoptile and the root.
  • immunolocation on sections at the same stage it was possible to locate the protein phytase in the same place as its mRNA.
  • Hybridizations /// situated on transverse sections (4, 8 or 14 days) have shown that phytase transcripts are located essentially at the level of two cellular layers surrounding the central cylinder, the endoderm and the pericycle. We also detect them at the level of l epidermis The phytase revealed by immunolocation is located at the same cellular base All of these data therefore show a very localized expression of the phytase at the level of the roots bearing at the same time on the messenger, the protein and the enzymatic activity
  • the endoderm is known to constitute an important physiological barrier it is at the level of this cellular base that occurs the regulation of the selective transport of minerals to the central cylinder and subsequently to the aerial parts of the plant.
  • Oligo D located approximately 300 bp downstream of C Oligo D allows in the presence of reverse transcriptase and a population of RNAs total to synthesize by reverse transcription the cDNA strands complementary to the mR As phytase
  • These cDNAs are then used to carry out amplifications by PCR in the presence of either the oligo A + C pair or the B + C pair.
  • Controls have shown that the combination A + C specifically amplified the a corresponding region of the plasmid containing the gene I, while the combination B + C specifically amplified the cDNA corresponding to the class II plasmid
  • RNAs extracted from the different parts of the seedling at different stages were thus tested by RT-PCR.
  • the first results carried out on RNAs extracted at 4 days show that in the coleoptile only the class I gene is abundantly expressed.
  • the two genes I and II are expressed more or less identically.
  • the promoter of gene I controls the expression of phytase in the embryonic organs (coleoptile, coleorhize, embryonic root) and regulates the mobilization of the phytin stored in the embryo.
  • the promoter of gene II is specific to the root cell bases involved in the control of homeostasis of minerals in the plant.
  • Extractions and westerns were carried out as described in labouré et al., Biochem. J., 1993, 295, 413-419 with the following modification: before electrophoresis, the proteins were precipitated with 10% TCA, washed twice with 80% acetone before being taken up in the deposition buffer; non-protein products reacting with the antibody have indeed been found in particular in leaf extracts. These products were eliminated by this precipitation.
  • GTCTGTTTGT CATGCCTGGC GTGGCCATAA TTATTCTTAG GGTATGTTAG ATTACTTTAG 900
  • TCTCCCGCGA CAACGGAAAT AAATAAGGGG CAACCATGAA ATTGACATGT TTTAGGGGTT 1080
  • AAG ATT GCA GCC ACG ACG TGG GCG CAG GCG GTG AGC GTC TTC ATC ATG 2912 Lys Ile Ala Ala Thr Trp Ala Gin Ala Val Ser Val Phe Ile Met 260 265 270
  • GAG GCC ATC CTC AAG GGC AGC CTC AAC CTC CTG GCG GGG CTA GGG GGC 3008 Glu Ala Ile Leu Lys Gly Ser Leu Asn Leu Leu Ala Gly Leu Gly Gly 290 295 300
  • TCCCCTTCCC TATCAACAAC GGAGGGACGA TGATATATTA TTTAGGTCTT GTTCGGATAC 960
  • AAGCTACTAC TAGTTACAAG CTGGTTTATA TTTAACTACA AGTAGCAACG ATTTGTCTTA 1260
  • a tobacco osaic virus-induced tobacco protein is homologous to the sweet-tasting protein thaumatin. Nature 321: 531-532.
  • MAPMAKER an interactive computer package for constructing p ⁇ mary genetic linkage maps of experimental and natural populations Genomics 1, 174-181

Abstract

The invention concerns plant phytases, in particular maize phytases, the genome DNA and complementary DNA sequences, as well as the transgenic plants or plant organs obtained from theses sequences.

Description

PHYTASES DE PLANTES ET APPLICATIONS BIOTECHNOLOGIQUES PLANT PHYTASES AND BIOTECHNOLOGICAL APPLICATIONS
La présente invention concerne les phytases de plantes, ainsi que leurs applications biotechnologiques.The present invention relates to plant phytases, as well as their biotechnological applications.
La présente invention concerne également un ou plusieurs fragment(s) d'acide nucléique codant pour une phytase de céréales, plus particulièrement pour la phytase du maïs et un ou plusieurs fragment(s) caractérisé(s) en ce qu'il s'agit de fragments d'ADNc ou d'ADN génomique.The present invention also relates to one or more nucleic acid fragment (s) coding for a cereal phytase, more particularly for corn phytase and one or more fragment (s) characterized in that it is cDNA or genomic DNA fragments.
En outre, la présente invention concerne un fragment d'acide nucléique caractérisé en ce qu'il comprend tout ou partie de la séquence de nucléotides telle que montrée dans l'identificateur de séquences (SEQ ED) n° 1 codant pour une activité phytase ou tout ou partie des séquences génomiques Phyt I ou Phyt II telles que définies ci-après.Furthermore, the present invention relates to a nucleic acid fragment characterized in that it comprises all or part of the nucleotide sequence as shown in the sequence identifier (SEQ ED) n ° 1 coding for a phytase activity or all or part of the Phyt I or Phyt II genomic sequences as defined below.
Enfin, la présente invention concerne un fragment caractérisé en ce qu'il comprend tout ou partie de la séquence codante allant du nucléotide n° 32 à 1192 de SEQ ED n .Finally, the present invention relates to a fragment characterized in that it comprises all or part of the coding sequence ranging from nucleotide n ° 32 to 1192 of SEQ ED n.
La plus grande partie du phosphate présent dans les plantes, notamment dans les semences, est sous la forme de phytine, sel complexe de myo-inositol-acide hexaphosphorique (acide phytique). La phytine constitue une réserve de phosphore, d'hydrates de carbone et de divers cations. Ainsi dans les grains de maïs, le phosphore du phytate représente jusqu'à 88 % du phosphore total (O'Dell et al., 1972). La mobilisation de la phytine est due aux phytases, type spécial de phosphatases, capables d'hydrolyser le phosphate à partir de l'acide phytique ainsi qu'à partir d'autres substrats phosphorylés (Gibson et Ullah, 1990). On a signalé des activités de phytase dans une large gamme de semences. Généralement, on peut détecter de très faibles quantités d'activité endogène dans les semences non germées, sauf pour le blé, le seigle et leur hybride triticale (Pointillard, 1994). Une forte augmentation d'activité concomitante avec une diminution de la phytine apparaît au début de la germination. On ne dispose que de peu d'informations sur les mécanismes qui régulent le niveau d'activité de la phytase dans les semences L'intérêt qui existe pour la phytase vient de l'industrie alimentaire. La phytine, ou acide phytique, provenant des farines de semences sèches, n'est pas digérée par les animaux monogastriques en l'absence de phytase exogène et est donc excrétée telle quelle, contribuant ainsi à la pollution par le phosphate des zones d'élevages intensifs. De plus, elle est considérée comme un facteur antinutritionnel car elle chélate les minéraux essentiels tels que Ca, Fe et Zn lesquels, de ce fait, ne sont pas absorbés par les animaux monograstriques (Graf, 1986). Des recherches poussées ont été entreprises afin de permettre la digestion du phytate par addition de phytases exogènes à de telles farines. Les phytases végétales sont normalement produites en quantités insuffisantes pour leur utilisation dans les processus industriels.Most of the phosphate present in plants, especially in seeds, is in the form of phytin, a complex salt of myo-inositol-hexaphosphoric acid (phytic acid). Phytin is a store of phosphorus, carbohydrates and various cations. In corn kernels, phytate phosphorus represents up to 88% of total phosphorus (O'Dell et al., 1972). The mobilization of phytin is due to phytases, a special type of phosphatases, capable of hydrolyzing phosphate from phytic acid as well as from other phosphorylated substrates (Gibson and Ullah, 1990). Phytase activities have been reported in a wide range of seeds. Generally, very small amounts of endogenous activity can be detected in non-germinated seeds, except for wheat, rye and their tritical hybrid (Pointillard, 1994). A strong increase in concomitant activity with a decrease in phytin appears at the beginning of germination. Little information is available on the mechanisms that regulate the level of phytase activity in seeds. Interest in phytase comes from the food industry. Phytin, or phytic acid, from dry seed meal, is not digested by monogastric animals in the absence of exogenous phytase and is therefore excreted as it is, thus contributing to pollution by phosphate in the areas intensive farming. In addition, it is considered an anti-nutritional factor because it chelates essential minerals such as Ca, Fe and Zn which, therefore, are not absorbed by monograstric animals (Graf, 1986). Extensive research has been undertaken to allow the digestion of phytate by the addition of exogenous phytases to such flours. Plant phytases are normally produced in quantities insufficient for their use in industrial processes.
On peut obtenir les phytases extracellulaires produites par le champignon Aspergillus niger en grandes quantités et on a trouvé qu'elles conviennent bien pour une utilisation en tant qu'additif alimentaire pour les animaux (Nair et Duvnjak, 1990 , Simons et al., 1990). On a séquence (van Hartingsveldt et al., 1993 ; Ehrlich et al., 1993) des ADNc codant pour deux phytases différentes, Phy A et Phy B ά'Aspergillus niger. Récemment, on a obtenu des plants de tabac transgéniques exprimant de façon ectopique la phytase fongique Phy A (Pen et al , 1993 , Ver oerd et al , 1995)Extracellular phytases produced by the fungus Aspergillus niger can be obtained in large quantities and have been found to be well suited for use as a feed additive for animals (Nair and Duvnjak, 1990, Simons et al., 1990) . We have sequenced (van Hartingsveldt et al., 1993; Ehrlich et al., 1993) cDNAs encoding two different phytases, Phy A and Phy B ά'Aspergillus niger. Recently, transgenic tobacco plants have been obtained ectopically expressing the fungal phytase Phy A (Pen et al, 1993, Ver oerd et al, 1995)
Avant la présente invention, on n'avait pas pu obtenir d'ADNc codant pour une phytase végétale et les mécanismes moléculaires qui commandent la régulation de l'expression de la phytase au cours de la formation des semences ou de la germination n'étaient pas connus. Etant donné l'importance de l'acide phytique comme forme de stockage du phosphate dans les grains de mais, le clonage d'un gène de phytase végétal et une meilleure connaissance de ces mécanismes étaient donc très recherchés Au cours de la germination, les plants de semis de mais expriment une phytase capable d'hydrolyser la grande quantité de phytine emmagasinée dans le grain sec Des études antérieures ont permis de purifier et de caractériser cette enzyme (Labouré et al , Biochem J., 1993, 295, 413 - 419)Prior to the present invention, it was not possible to obtain cDNA encoding a plant phytase and the molecular mechanisms which control the regulation of phytase expression during seed formation or germination were not known. Given the importance of phytic acid as a form of storage of phosphate in maize grains, the cloning of a plant phytase gene and a better understanding of these mechanisms were therefore highly sought after During germination, plants maize seedlings express a phytase capable of hydrolyzing the large quantity of phytin stored in the dry grain Previous studies have made it possible to purify and characterize this enzyme (Labouré et al, Biochem J., 1993, 295, 413 - 419)
Dans ce travail antérieur (Labouré et al., 1993), on a décrit la caractérisation d'une phytase qui s'accumule dans les jeunes plants de mais au cours des premiers jours de la germination La protéine native apparaît sous la forme d'un homodimère constitué de deux sous-unités à 38kDa Cette enzyme présente la plupart des caractéristiques enzymatiques d'autres phytases acides végétalesIn this previous work (Labouré et al., 1993), the characterization of a phytase which accumulates in young maize plants has been described during the first days of germination. The native protein appears in the form of a homodimer consisting of two 38kDa subunits This enzyme has most of the enzymatic characteristics of other plant acid phytases
Selon la présente invention on a isolé et caractérisé un ADNc codant pour la sous-unité de cette phytase de semence de mais Ceci constitue la première séquence nucléotidique obtenue pour une phytase végétaleAccording to the present invention, a cDNA encoding the subunit of this corn seed phytase has been isolated and characterized. This constitutes the first nucleotide sequence obtained for a plant phytase.
Selon la présente invention, on a utilisé un polysérum de lapin dirigé contre la phytase de maïs purifiée jusqu'à homogénéisation pour cribler une bibliothèque d'expression d'ADNc de jeunes plants de maïs. On a pu isoler plusieurs clones positifs contenant un insert d'environ 1400 pb. On a établi la séquence nucléotidique de l'insert d'un de ces clones. Cet ADNc, appelé phy SU, contient 1335 pb avec un cadre ouvert de lecture pour 387 aa. On a établi les résidus N- terminaux (23 aa) de la phytase purifiée. On trouve ces résidus dans les positions 19 - 41 de la séquence d'aa pour laquelle code phy SI 1. Ceci confirme que cet ADNc code pour la phytase du maïs.According to the present invention, a rabbit polyserum directed against the phytase of maize purified until homogenization was used to screen a cDNA expression library of young corn plants. Several positive clones containing an insert of approximately 1400 bp were able to be isolated. The insert sequence of one of these clones was established. This cDNA, called phy SU, contains 1335 bp with an open reading frame for 387 aa. The N-terminal residues (23 aa) of the purified phytase were established. These residues are found in positions 19 - 41 of the sequence of aa for which code phy SI 1. This confirms that this cDNA codes for the phytase of corn.
La présente invention fournit donc la première séquence codant pour une phytase végétale. Ehrlich et Montalban (1992) et Gellatly et Lefebvre (1990) ont mentionné des essais de clonage et séquençage d'ADNc de phytase respectivement provenant de semences de soja et de tubercules de pommes de terre, mais les séquences correspondantes n'ont jamais été publiées, de sorte que la comparaison de l'ADNc du maïs avec d'autres ADNc de phytase végétale n'est pas possible.The present invention therefore provides the first sequence coding for a plant phytase. Ehrlich and Montalban (1992) and Gellatly and Lefebvre (1990) reported attempts to clone and sequence phytase cDNAs from soybean seeds and potato tubers respectively, but the corresponding sequences have never been published , so comparison of maize cDNA with other plant phytase cDNAs is not possible.
Les seules séquences nucléotidiques disponibles correspondent aux phytases provenant ά'Aspergillus niger (van Hartingsveldt et al., 1993 ; Ehrlich et al., 1993). Les phytases' de microorganismes appartiennent aux phytases de classe 3 qui commencent par retirer l' orthophosphate de la position 3 de l'acide phytique, tandis que les phytases végétales appartiennent aux phytases de classe 6 qui catalysent l'enlèvement de ! Orthophosphate de la position 6. Des comparaisons antérieures entre les phytases purifiées d' Aspergillus ficuum et de soja dues à Gibson et Ullah ( 1990) montrent que peu de caractéristiques physiques au niveau protéique (taille moléculaire, composition en acides aminés, séquences d'aa partielles) semblent être communes aux deux enzymes. En accord avec ces comptes-rendus antérieurs, la comparaison entre la séquence d'aa totale pour laquelle code l'ADNc phy S i 1 et celle de phy A cYAspergillus niger ne montre pas beaucoup de similitudes significatives. On trouve un recouvrement de 33 aa avec une homologie de 84 %. Cette région à 33 aa des deux phytases dî Aspergillus Phy A et Phy B contient le motif consensus RHGxRxP trouvé dans plusieurs phosphatases acides et dont on pense qu'il s'agit de la région accepteur de phosphate (Piddington et al., 1993). Les deux Arg et les résidus His du consensus sont conservés dans la séquence du mais. Une mutagénèse dirigée sur la phosphatase acide périplasmique de E.coli (EcAP) a montré que le remplacement de ces résidus Arg et His dans le motif conservé aboutit à une forte réduction de l'activité enzymatique (Ostanin et al., 1992). Par conséquent, la présence de ces résidus dans la séquence de la phytase du maïs peut être en relation avec l'activité de phosphatase. On remarque que le motif consensus est généralement localisé à l'extrémité N-terminale des phosphatases acides de microorganisme (position 81 - 87 dans Phy A à" Aspergillus), tandis qu'il est situé entre les positions 204 et 210 dans la séquence du maïs. Ces comparaisons confirment que les phytases végétales sont très différentes des phytases άΑspergillus bien caractérisées. En outre : a) les deux phytases à' Aspergillus sont excrétées dans le milieu extérieur lors d'une carence en phosphate. Elles possèdent un peptide signal et sont fortement glycosylées. Or, les phytases de plantes sont destinées à hydrolyser la phytine contenue dans la plante. L'analyse de la séquence de la phytase de mais ne révèle pas de peptide signal évident. Aucun résidu glycosylé n'a été détecté par réaction avec le réactif de Schiff ni avec la phytase de maïs, ni avec la phytase de soja purifiée antérieurement par Gibson et Ullah (1990) Aucun motif consensus d'attachement de résidu glycosylé n'est observé sur la séquence protéique de la phytase de maïs ; b) le profil d'hydropathie de Phy S U révèle la présence dans la région COOH-terminate d'une séquence de 65 aa fortement hydrophobe. Cette séquence peut servir d'ancrage de l'enzyme aux corps protéiques, organites pourvus d'une membrane et dans lesquels la phytine est localisée sous forme de globoïdes Des expériences déjà anciennes, réalisées sur le pollen (Baldi et al , 1988, Plant Science, 56, 137- 147), ont montré que les phytases acides étaient attachées à la membrane des corps protéiques dont elles constituent "un composant externe"The only nucleotide sequences available correspond to phytases originating from Aspergillus niger (van Hartingsveldt et al., 1993; Ehrlich et al., 1993). The phytases' of microorganisms belong to class 3 phytases which start by removing orthophosphate from position 3 of phytic acid, while plant phytases belong to class 6 phytases which catalyze the removal of! Orthophosphate of position 6. Previous comparisons between the purified phytases of Aspergillus ficuum and soybeans due to Gibson and Ullah (1990) show that few physical characteristics at the protein level (molecular size, amino acid composition, AA sequences partial) appear to be common to both enzymes. In agreement with these previous reports, the comparison between the total aa sequence for which the phy S i 1 cDNA codes and that of phy A cYAspergillus niger does not show many significant similarities. There is an overlap of 33 aa with a homology of 84%. This region at 33 aa of the two phytases of Aspergillus Phy A and Phy B contains the consensus motif RHGxRxP found in several acid phosphatases and which is believed to be the phosphate acceptor region (Piddington et al., 1993). Both Arg and His consensus residues are conserved in the maize sequence. A mutagenesis directed on the E.coli periplasmic acid phosphatase (EcAP) has shown that the replacement of these Arg and His residues in the conserved motif results in a strong reduction in the enzymatic activity (Ostanin et al., 1992). Therefore, the presence of these residues in the phytase sequence of corn may be related to phosphatase activity. Note that the consensus motif is generally located at the N-terminus of the microorganism acid phosphatases (position 81 - 87 in Phy A to "Aspergillus), while it is located between positions 204 and 210 in the sequence of These comparisons confirm that the plant phytases are very different from the well characterized ergspergillus phytases.Also: a) the two Aspergillus phytases are excreted in the external environment during a phosphate deficiency, they have a signal peptide and are highly glycosylated. However, plant phytases are intended to hydrolyze the phytin contained in the plant. Analysis of the phytase sequence of but does not reveal an obvious signal peptide. No glycosylated residue was detected by reaction with Schiff's reagent neither with corn phytase nor with soy phytase previously purified by Gibson and Ullah (1990) No consensus reason for attachment ent of glycosylated residue is not observed on the protein sequence of corn phytase; b) the hydropathy profile of Phy SU reveals the presence in the COOH-terminate region of a sequence of 65 aa highly hydrophobic. This sequence can be used to anchor the enzyme to protein bodies, organelles provided with a membrane and in which phytin is localized in the form of globoids. Already old experiments carried out on pollen (Baldi et al, 1988, Plant Science , 56, 137-147), have shown that acid phytases are attached to the membrane of protein bodies of which they constitute "an external component"
L'analyse de la séquence protéique de Phy S U indique donc que cette phytase de plante est très différente des phytases de champignons seules caractérisées jusqu'ici, et vraisemblablement mieux adaptée à digérer le phytate endogène des graines La présente invention a donc pour objet les fragments d'acide nucléique isolé codant pour une enzyme phytase de planteAnalysis of the protein sequence of Phy SU therefore indicates that this plant phytase is very different from the phytases of only fungi characterized so far, and probably better suited to digest the endogenous phytate of the seeds. The present invention therefore relates to the fragments isolated nucleic acid encoding a plant phytase enzyme
Plus particulièrement, l'enzyme est la phytase de céréale, telle que, mais, blé, orge, seigle, triticaleMore particularly, the enzyme is cereal phytase, such as, but, wheat, barley, rye, triticale
Dans un mode de réalisation préféré, la présente invention a pour objet un fragment d'acide nucléique isolé codant pour une activité phytase, caractérisé en ce qu'il comprend tout ou partie d'une séquence de nucléotides telle que montrée dans l'identificateur de séquence n° 1, ou tout ou partie d'une séquence homologue à celle montrée dans l'identificateur de séquence n° 1, ou tout ou partie d'une séquence complémentaire de ladite séquence de l'identificateur de séquence n° 1 ou d'une séquence homologue.In a preferred embodiment, the present invention relates to an isolated nucleic acid fragment coding for a phytase activity, characterized in that it comprises all or part of a nucleotide sequence as shown in the identifier of sequence no.1, or all or part of a sequence homologous to that shown in sequence identifier no.1, or all or part of a sequence complementary to said sequence of sequence identifier No. 1 or of a homologous sequence.
Par "fragment d'acide nucléique", on entend ici une séquence nucléotidique pouvant être de type ADN ou ARN. Ces termes sont définis dans tous les ouvrages de base de biologie moléculaire. Préférentiellement, un fragment d'acide nucléique selon l'invention est un fragment d'ADN double brin.By "nucleic acid fragment" is meant here a nucleotide sequence which may be of DNA or RNA type. These terms are defined in all basic molecular biology works. Preferably, a nucleic acid fragment according to the invention is a double stranded DNA fragment.
Le terme "partie" désigne notamment un fragment d'au moins 20 nucléotides, en particulier d'au moins 100 nucléotides, par exemple d'au moins 500 nucléotides et avantageusement d'au moins 1000 nucléotides identiques à une portion d'une longueur équivalente de la séquence nucléotidique concernée. Le terme "homologue" fait référence à tout acide nucléique présentant une ou plusieurs modification(s) de séquence par rapport à tout ou partie de la séquence montrée dans SEQ ID n°l, et codant pour un enzyme ayant l'activité mentionnée ci- dessus.The term "part" designates in particular a fragment of at least 20 nucleotides, in particular of at least 100 nucleotides, for example of at least 500 nucleotides and advantageously of at least 1000 nucleotides identical to a portion of equivalent length of the nucleotide sequence concerned. The term "homologous" refers to any nucleic acid exhibiting one or more sequence modification (s) with respect to all or part of the sequence shown in SEQ ID No. 1, and coding for an enzyme having the activity mentioned above. above.
Ces modifications peuvent être obtenues par mutation, délétion et/ou addition d'un ou plusieurs nucléotide(s) par rapport à la séquence native. Elles peuvent être introduites notamment pour améliorer l'activité de l'enzyme. Dans ce contexte, on préférera un degré d'homologie d'au moins 70 % par rapport à la séquence native, avantageusement d'au moins 80 %, de préférence d'au moins 90 % et plus préférentiellement encore d'au moins 95 %. Par exemple, l'invention concerne deux phytases aux séquences d'acides aminés différentes, notamment dans la partieThese modifications can be obtained by mutation, deletion and / or addition of one or more nucleotide (s) relative to the native sequence. They can be introduced in particular to improve the activity of the enzyme. In this context, a degree of homology of at least 70% with respect to the native sequence will be preferred, advantageously at least 80%, preferably at least 90% and even more preferably at least 95%. . For example, the invention relates to two phytases with different amino acid sequences, in particular in the part
N-terminale. L'homme du métier connaît les techniques permettant d'évaluer si l'homologue généré présente une activité modifiée par production de l'enzyme mutagénisée dans un hôte hétérologue.N-terminal. Those skilled in the art know the techniques for evaluating whether the generated homolog has activity modified by production of the mutagenized enzyme in a heterologous host.
La séquence de SEQ ED n° 1 est une séquence d'ADNc, c'est-à-dire dépourvue des introns de la phytase de maïs.The sequence of SEQ ED No. 1 is a cDNA sequence, that is to say devoid of the introns of the corn phytase.
L'invention a notamment pour objet une séquence d'ADN identique ou homologue à plus de 70 % de tout ou partie de la séquence telle que définie dans SEQ ID N° 1.The subject of the invention is in particular a DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 1.
De préférence, le fragment selon l'invention comprend la séquence complète de 1335 nucléotides telle que montrée sur SEQ ID n° 1 , une séquence homologue, une séquence complémentaire, ou une séquence homologue à ladite séquence complémentaire. Le fragment comporte en particulier la séquence leader allant du nucléotide n° 1 à 31 de SEQ ID n° 1 , ainsi que la séquence de terminaison allant du nucléotide 1 193 à 1335 de SEQ ID n° 1. En outre, de façon classique, il peut comporter ladite séquence de terminaison augmentée d'une queue poly A à son extrémité 3'.Preferably, the fragment according to the invention comprises the complete sequence of 1335 nucleotides as shown in SEQ ID No. 1, a homologous sequence, a complementary sequence, or a sequence homologous to said complementary sequence. The fragment comprises in particular the leader sequence going from nucleotide n ° 1 to 31 of SEQ ID n ° 1, as well as the termination sequence ranging from nucleotide 1 193 to 1335 of SEQ ID No. 1. In addition, conventionally, it may comprise said termination sequence augmented by a poly A tail at its 3 ′ end.
Selon une variante encore préférée, le fragment selon l'invention comprend tout ou partie de la séquence codante allant du nucléotide n° 32 à 1 192 de SEQ ID n° 1, ou son complémentaire, ou d'une séquence homologue ou complémentaire de ladite séquence homologue.According to a still more preferred variant, the fragment according to the invention comprises all or part of the coding sequence ranging from nucleotide No. 32 to 1,192 of SEQ ID No. 1, or its complement, or of a sequence homologous or complementary to said homologous sequence.
L'invention inclut également toute séquence capable de s'hybrider dans des conditions stringentes avec l'une des susdites séquences. A partir d'un fragment originaire d'une plante particulière, on peut ainsi isoler des fragments homologues d'autres plantes. D'autre part, à l'aide de l'ADNc, on a isolé les ADN génomiques correspondants.The invention also includes any sequence capable of hybridizing under stringent conditions with one of the above sequences. From a fragment originating from a particular plant, it is thus possible to isolate homologous fragments from other plants. On the other hand, using the cDNA, the corresponding genomic DNAs were isolated.
La présente invention a donc également pour objet l'ADN génomique codant pour la phytase de la plante.The present invention therefore also relates to the genomic DNA coding for the plant phytase.
La présente invention a également pour objet un fragment constitué par de l'ADNc et comportant en outre une partie seulement des fragments introniques de l'ADN génomique. Les introns permettent dans certains cas d'améliorer la structure conformationnelle de l'ARN messager et ses taux d'expression.The present invention also relates to a fragment consisting of cDNA and further comprising only part of the intronic fragments of genomic DNA. Introns allow in certain cases to improve the conformational structure of messenger RNA and its expression levels.
Il doit être bien entendu que l'invention a également pour objet toute séquence d'ADN équivalente, c'est-à-dire qui diffère des séquences mentionnées ci- dessus seulement par une ou plusieurs mutations neutres, c'est-à-dire dont le changement ou la substitution de nucléotides en cause n'affecte pas la séquence primaire de la protéine résultante.It should be understood that the invention also relates to any equivalent DNA sequence, that is to say that differs from the sequences mentioned above only by one or more neutral mutations, that is to say whose change or substitution of nucleotides involved does not affect the primary sequence of the resulting protein.
De préférence, le fragment d'ADN selon l'invention sera associé à une séquence régulatrice appropriée pour sa transcription, sa traduction et son adressage, tels que des promoteurs et ses éventuels enhancers, et des terminateurs, y compris des codons start et stop. Les moyens et méthodes pour identifier et sélectionner ces différents signaux de régulation sont bien connus de l'homme du métier.Preferably, the DNA fragment according to the invention will be associated with a regulatory sequence suitable for its transcription, its translation and its addressing, such as promoters and its possible enhancers, and terminators, including start and stop codons. The means and methods for identifying and selecting these different regulatory signals are well known to those skilled in the art.
La présente invention a également pour objet une séquence d'ADN identique ou homologue à plus de 70 % de tout ou partie de la séquence telle que définie dans SEQ ID N° 2 ou SEQ ID N° 3. SEQ ID N° 2 représente la séquence nucléotidique correspondant au gène PHYT I (également représentée sur la figure 4); SEQ ID N° 3 représente la séquence nucléotidique correspondant au gène PHYT II (également représentée sur la figure 5). Dans un mode de réalisation, le fragment selon l'invention comporte le promoteur de l'ADN génomique de la plante.The present invention also relates to a DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 2 or SEQ ID No. 3. SEQ ID No. 2 represents the nucleotide sequence corresponding to the PHYT I gene (also shown in Figure 4); SEQ ID No. 3 represents the nucleotide sequence corresponding to the PHYT II gene (also represented in FIG. 5). In one embodiment, the fragment according to the invention comprises the promoter of the genomic DNA of the plant.
L'invention a également pour objet une séquence d'ADN caractérisée en ce qu'elle comprend tout ou partie d'une séquence complémentaire ou complémentaire de l'homologue d'une séquence telle que définie dans SEQ ID N° 1, SEQ ID N° 2 ou SEQ DD N° 3. Elle a également pour objet l'utilisation d'une de ces séquences comme sonde moléculaire.The subject of the invention is also a DNA sequence characterized in that it comprises all or part of a sequence complementary or complementary to the homolog of a sequence as defined in SEQ ID N ° 1, SEQ ID N ° 2 or SEQ DD N ° 3. It also relates to the use of one of these sequences as a molecular probe.
La présente invention a donc également pour objet le promoteur d'un gène de phytase de plante ainsi que le promoteur d'un gène de phytase de céréale et le promoteur d'un gène de phytase de maïs. Avantageusement, le promoteur d'un gène de phytase de plante contient tout ou partie du fragment allant du nucléotide n° 1 au nucléotide n° 2096 de la séquence telle que définie par SEQ ID N° 2, ou tout ou partie du fragment allant du nucléotide n° 1 au nucléotide n° 1328 de la séquence définie par SEQ ED N° 3.The present invention therefore also relates to the promoter of a plant phytase gene as well as the promoter of a cereal phytase gene and the promoter of a corn phytase gene. Advantageously, the promoter of a plant phytase gene contains all or part of the fragment ranging from nucleotide No. 1 to nucleotide No. 2096 of the sequence as defined by SEQ ID No. 2, or all or part of the fragment ranging from nucleotide n ° 1 to nucleotide n ° 1328 of the sequence defined by SEQ ED N ° 3.
Entrent également dans le champ de la présente invention, les promoteurs d'un gène de phytase de plante comprenant une séquence identique ou homologue à plus de 70 % de la séquence des fragments telle que ci-dessus définie ainsi que les promoteurs comprenant tout ou partie d'une séquence complémentaire ou complémentaire de l'homologue d'une telle séquence.Also falling within the scope of the present invention are the promoters of a plant phytase gene comprising a sequence identical or homologous to more than 70% of the sequence of the fragments as defined above, as well as the promoters comprising all or part of a sequence complementary or complementary to the homolog of such a sequence.
L'invention comprend également l'utilisation des susdits promoteurs dans des constructions moléculaires destinées à améliorer la qualité agronomique alimentaire ou industrielle d'une plante notamment la résistance aux pathogènes ou la disponibilité en nutriments.The invention also includes the use of the above promoters in molecular constructions intended to improve the agronomic food or industrial quality of a plant, in particular resistance to pathogens or the availability of nutrients.
La présente invention a aussi pour objet une cassette d'expression caractérisée en ce qu'elle comporte un fragment d'acide nucléique selon la présente invention, placé sous le contrôle de séquences régulatrices capables de commander l'expression de ladite phytase. Avantageusement, ces séquences régulatrices comprennent un promoteur tel que défini plus haut.The present invention also relates to an expression cassette characterized in that it comprises a nucleic acid fragment according to the present invention, placed under the control of regulatory sequences capable of controlling the expression of said phytase. Advantageously, these regulatory sequences include a promoter as defined above.
Dans une variante de réalisation lesdites séquences régulatrices sont capables de commander l'expression spécifiquement dans un type particulier de tissu, notamment dans l'albumen.In an alternative embodiment, said regulatory sequences are capable of controlling expression specifically in a particular type of tissue, in particular in the albumen.
Comme exemple de signaux d'adressage chloroplastiques, on peut citer la séquence codant pour le peptide transit du précurseur de la petite sous-unité de la ribulose 1 ,5-biphosphate carboxylase de Pisum sativum. Comme signaux d'adressage mitochondrial, on peut citer la séquence codant pour le peptide transit du précurseur de la sous-unité bêta de l' ATP-aseFl mitochondriale de Nicotiana plumbaginifolia.As an example of chloroplastic addressing signals, mention may be made of the sequence coding for the transit peptide of the precursor of the small subunit of ribulose 1, 5-biphosphate carboxylase from Pisum sativum. As addressing signals mitochondrial, we can cite the sequence coding for the transit peptide of the precursor of the beta subunit of the mitochondrial ATP-aseFl of Nicotiana plumbaginifolia.
Ces peptides transits, ainsi que la méthionine N-terminale, sont normalement clivés dans les chloroplastes ou les mitochondries. L'expression des protéines dans les plastes a donc également l'avantage de produire une molécule dépourvue de la méthionine N-terminale comme la molécule naturelle.These transited peptides, along with the N-terminal methionine, are normally cleaved in chloroplasts or mitochondria. The expression of proteins in plasts therefore also has the advantage of producing a molecule devoid of the N-terminal methionine like the natural molecule.
Selon une autre variante, les séquences d'adressage peuvent être des séquences codant pour un peptide signal N-terminal ("prépeptide"), éventuellement en association à un signal responsable de la rétention de la protéine dans le réticulum endoplasmique (signal du type KDEL), ou un signal d'adressage vacuolaire ou "propeptide". La présence du peptide signal N-terminal ou prépeptide permet la pénétration de la protéine naissante dans le réticulum endoplasmique où ont lieu un certain nombre de maturations post-traductionnelles, notamment le clivage du peptide signal, les N-glycosylations, si la protéine en question présente des sites de N- glycosylation, et la formation des ponts disulfures. Parmi ces différents signaux, le prépeptide, responsable de l'adressage de la protéine dans le réticulum endoplasmique, est très utile. Il s'agit normalement d'un peptide signal N-terminal hydrophobe ayant entre 10 et 40 acides aminés et étant d'origine animale ou végétale. De préférence, il s'agit d'un prépeptide d'origine végétale, par exemple celui de la sporamine, de la lectine d'orge, de l'extensine végétale, de l'α-mating factor, de la protéine de pathogénèse 1 ou 2.According to another variant, the addressing sequences can be sequences coding for an N-terminal signal peptide ("prepeptide"), possibly in association with a signal responsible for the retention of the protein in the endoplasmic reticulum (signal of the KDEL type ), or a vacuolar or "propeptide" addressing signal. The presence of the N-terminal signal peptide or prepeptide allows the penetration of the nascent protein into the endoplasmic reticulum where a certain number of post-translational maturations take place, in particular the cleavage of the signal peptide, the N-glycosylations, if the protein in question presents N-glycosylation sites, and the formation of disulfide bridges. Among these different signals, the prepeptide, responsible for addressing the protein in the endoplasmic reticulum, is very useful. It is normally a hydrophobic N-terminal signal peptide having between 10 and 40 amino acids and being of animal or vegetable origin. Preferably, it is a prepeptide of plant origin, for example that of sporamine, barley lectin, plant extensin, α-mating factor, pathogenesis protein 1 or 2.
Normalement, le peptide signal est clivé par une signal peptidase dès l'introduction co-traductionnelle du polypeptide naissant dans la lumière du RER (Réticulum Endoplasmique Granuleux). La protéine mature ne comporte plus cette extension N-terminale. Pour obtenir la sécrétion, on peut par exemple utiliser le peptide signal de la sporamine A des racines tubérisées de la patate douce.Normally, the signal peptide is cleaved by a signal peptidase upon the co-translational introduction of the nascent polypeptide into the lumen of the RER (Granular Endoplasmic Reticulum). The mature protein no longer has this N-terminal extension. To obtain the secretion, it is possible, for example, to use the signal peptide of sporamine A from the tuberous roots of the sweet potato.
Les séquences d'adressage peuvent, outre le prépeptide, aussi comporter un signal de rétention endoplasmique, consistant en les peptides KDEL, SEKDEL ou HEKDEL. Ces signaux se trouvent normalement à l'extrémité C-terminale de la protéine et subsistent sur la protéine mature. La présence de ce signal a tendance à augmenter les rendements en protéines recombinantes.The addressing sequences can, in addition to the prepeptide, also include an endoplasmic retention signal, consisting of the peptides KDEL, SEKDEL or HEKDEL. These signals are normally found at the C-terminus of the protein and remain on the mature protein. The presence of this signal tends to increase the yields of recombinant proteins.
Les signaux d'adressage peuvent, outre le prépeptide, comporter aussi un signal d'adressage vacuolaire ou "propeptide". En présence d'un tel signal, après passage dans le RER, la protéine est adressée aux vacuoles des tissus aqueux, par exemple les feuilles, ainsi qu'aux corps protéiques des tissus de réserve, par exemple les graines, tubercules et racines. L'adressage de la protéine vers les corps protéiques de la graine est particulièrement intéressant en raison de la capacité de la graine à accumuler des protéines, jusqu'à 40 % des protéines par rapport à la matière sèche, dans des organites cellulaires dérivés des vacuoles, appelés corps protéiques et en raison de la possibilité de stocker plusieurs années les graines contenant les protéines recombinantes à l'état déshydraté.The addressing signals may, in addition to the prepeptide, also include a vacuolar or "propeptide" addressing signal. In the presence of such a signal, after passing through the RER, the protein is addressed to the vacuoles of the aqueous tissues, for example the leaves, as well as to the protein bodies of the reserve tissues, for example the seeds, tubers and roots. The targeting of the protein to the protein bodies of the seed is particularly interesting because of the capacity of the seed to accumulate proteins, up to 40% of the proteins relative to the dry matter, in cellular organelles derived from vacuoles. , called protein bodies and because of the possibility of storing for several years the seeds containing the recombinant proteins in the dehydrated state.
Comme propeptide, on peut utiliser un signal d'origine animale ou végétale, les signaux végétaux étant particulièrement préférés, par exemple la pro- sporamine. Le propeptide peut être N-terminal ("N-terminal targeting peptide" ouAs propeptide, a signal of animal or vegetable origin can be used, the plant signals being particularly preferred, for example pro-sporamine. The propeptide can be N-terminal ("N-terminal targeting peptide" or
NTTP), ou C-terminal (CTTP). Dans la mesure où les propeptides sont normalement clivés dès l'entrée de la protéine dans la vacuole, ils ne sont pas présents dans la protéine mature.NTTP), or C-terminal (CTTP). Since propeptides are normally cleaved upon entry of the protein into the vacuole, they are not present in the mature protein.
L'utilisation du peptide signal ou prépeptide, peut conduire à la glycosylation de la protéine.The use of the signal peptide or prepeptide, can lead to the glycosylation of the protein.
En l'absence de tout signal d'adressage, la protéine est exprimée dans le cytoplasme.In the absence of any addressing signal, the protein is expressed in the cytoplasm.
De préférence, l'accumulation de la phytase est réalisée dans l'albumen. Comme vecteur de clonage ou d'expression comprenant le fragment, on peut citer les vecteurs comprenant une séquence d'ADN contenant au moins une origine de réplication telle que des plasmides, des cosmides, des bactériophages, des virus etc. On utilisera en particulier, des plasmides.Preferably, the accumulation of phytase is carried out in the endosperm. As a cloning or expression vector comprising the fragment, mention may be made of vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses etc. In particular, plasmids will be used.
La présente invention a donc aussi pour objet un procédé pour accroître la teneur en phytase dans une plante, caractérisé en ce qu'on induit une surexpression de l'enzyme phytase dans la plante à l'aide d'une cassette d'expression selon la présente invention. En d'autres termes, on induit une surexpression de l'activité phytase dans la plante.The present invention therefore also relates to a method for increasing the phytase content in a plant, characterized in that an overexpression of the phytase enzyme is induced in the plant using an expression cassette according to the present invention. In other words, an overexpression of phytase activity is induced in the plant.
On entend ici par "phytase" une définition fonctionnelle qui inclut toute phytase de plante capable de fonctionner comme un marqueur de sélection en conférant l'activité phytase à une cellule hôte déficiente en phytase ou possédant une activité enzymatique telle que mesurée par exemple selon l'exemple 1. 13. Cette définition inclut aussi toute phytase de plante capable de fonctionner dans une plante donnée pour accroître l'activité phytase de ladite plante. Ce terme inclut donc non seulement l'enzyme spécifique de la plante spécifique à traiter, mais tout autre enzyme phytase d'autres plantes si cette phytase est capable de fonctionner dans les plantes à traiter.The term “phytase” is understood here to mean a functional definition which includes any plant phytase capable of functioning as a selection marker by conferring phytase activity on a host cell deficient in phytase or having an enzymatic activity as measured for example according to Example 1. 13. This definition also includes any plant phytase capable of functioning in a given plant to increase the phytase activity of said plant. This term therefore includes not only the specific enzyme of the specific plant to be treated, but any other phytase enzyme from other plants if this phytase is capable of functioning in the plants to be treated.
On entend ici par "surexpression" aussi bien une augmentation du taux d'activité de phytase par rapport au taux exprimé dans une plante normale, qu'une dérégulation de l'expression conduisant à l'expression de l'activité phytase dans un tissu ou un compartiment et/ou à un stade de développement où celle-ci n'est normalement pas exprimée.The term “overexpression” is understood here both to mean an increase in the level of phytase activity relative to the level expressed in a normal plant, as well as a deregulation of the expression leading to the expression of the phytase activity in a tissue or a compartment and / or at a stage of development where this is not normally expressed.
L'obtention de plantes exprimant de façon dérégulée la phytase, est obtenue en introduisant par les méthodes du génie génétique, un gène de phytase de plante éventuellement modifié de façon appropriée à obtenir la modification de l'expression, et de préférence la surexpression de la phytase dans la plante à améliorer.Obtaining plants expressing the phytase in a deregulated manner is obtained by introducing, by the methods of genetic engineering, a plant phytase gene possibly modified in an appropriate manner to obtain the modification of the expression, and preferably the overexpression of the phytase in the plant to be improved.
Ces plantes pourront être modifiées par les méthodes du génie génétique décrites dans la littérature, par transformation de cellules suivie de leur régénération, ou par transformation de tissus ou de gamètes.These plants may be modified by the methods of genetic engineering described in the literature, by transformation of cells followed by their regeneration, or by transformation of tissues or gametes.
Dans un mode préféré de réalisation du procédé de l'invention, on introduit dans le génome de la plante une séquence codante fonctionnelle dans des conditions permettant son expression.In a preferred embodiment of the method of the invention, a functional coding sequence is introduced into the plant genome under conditions allowing its expression.
On entend par "séquence codante fonctionnelle" une séquence d'ADN codant pour un polypeptide tel que défini ci-dessus comme "phytase", ladite séquence peut donc être plus courte ou plus longue que la séquence codante totale du gène complet de l'enzyme. En particulier, la "séquence codante fonctionnelle" inclura la séquence codante pour un peptide signal en 5' et/ou en 3 '.The term "functional coding sequence" means a DNA sequence coding for a polypeptide as defined above as "phytase", said sequence can therefore be shorter or longer than the total coding sequence of the complete gene of the enzyme . In particular, the "functional coding sequence" will include the coding sequence for a 5 'and / or 3' signal peptide.
Le gène étranger peut être un gène hétérologue, c'est-à-dire qui provient d'une plante différente que la cellule hôte, le gène codant pour un polypeptide ordinairement non produit par la plante dans le génome de laquelle il est introduit.The foreign gene can be a heterologous gene, that is to say which comes from a different plant than the host cell, the gene coding for a polypeptide ordinarily not produced by the plant in the genome of which it is introduced.
Le gène étranger introduit dans le génome de la plante peut aussi être un gène homologue au gène endogène, c'est-à-dire dont l'expression produit la phytase naturellement produite par la plante. Par "conditions permettant son expression", on entend que le gène codant la phytase est placé sous le contrôle d'éléments assurant son expression.The foreign gene introduced into the genome of the plant can also be a gene homologous to the endogenous gene, that is to say the expression of which produces the phytase naturally produced by the plant. By "conditions allowing its expression" is meant that the gene encoding phytase is placed under the control of elements ensuring its expression.
En particulier, la séquence d'ADN codant pour la phytase est associée à une séquence régulatrice appropriée pour sa transcription, sa traduction et son adressage, tels que des promoteurs et ses éventuels enhancers, et des terminateurs, y compris des codons start et stop. Les moyens et méthodes pour identifier et sélectionner ces différents signaux de régulation sont bien connus de l'homme du métier.In particular, the DNA sequence coding for phytase is associated with a regulatory sequence suitable for its transcription, translation and addressing, such as promoters and its possible enhancers, and terminators, including start and stop codons. The means and methods for identifying and selecting these different regulatory signals are well known to those skilled in the art.
Ledit gène fonctionnel codant pour la phytase peut être introduit dans des cellules de plantes selon des techniques connues. On pourra utiliser par exemple dans ce cas, mais non obligatoirement, le système de régulation du gène de la phytase.Said functional gene coding for phytase can be introduced into plant cells according to known techniques. We can use for example in this case, but not necessarily, the phytase gene regulation system.
On peut citer, tout d'abord, les méthodes de transfert direct de gènes telles que la micro-injection directe dans des cellules d'embryon de la plante (Neuhaus et Coll., 1987) ou l'électroporation (Chupeau et Coll., 1988) ou encore la précipitation directe au moyen de PEG (Schocher et Coll., 1986) ou le bombardement par canon de particules (Me Cabe et Coll., 1988).We can cite, first of all, direct gene transfer methods such as direct micro-injection into embryo cells of the plant (Neuhaus et al., 1987) or electroporation (Chupeau et al., 1988) or direct precipitation by means of PEG (Schocher et al., 1986) or bombardment with a particle gun (Me Cabe et al., 1988).
On peut aussi infecter la plante par une souche bactérienne notamment d'Agrobacterium tumefaciens selon une méthode éprouvée (Schell et Van Montagu, 1983) ou d'Agrobacterium rhizogenes notamment pour les espèces récalcitrantes à la transformation (Chilton et Coll., 1982). La souche bactérienne comportera le gène codant pour la phytase sous le contrôle d'éléments assurant l'expression dudit gène. La souche pourra être transformée par un vecteur dans lequel est inséré le gène codant la phytase sous le contrôle d'éléments assurant l'expression dudit gène. Ce gène sera inséré par exemple dans un vecteur binaire tel que pBIN19 (Bevan, 1984) ou pMON 505 (Horsch et Klee, 1986) ou tout autre vecteur binaire dérivé des plasmides Ti et Ri.It is also possible to infect the plant with a bacterial strain, in particular Agrobacterium tumefaciens according to a proven method (Schell and Van Montagu, 1983) or Agrobacterium rhizogenes in particular for species recalcitrant to transformation (Chilton and Coll., 1982). The bacterial strain will contain the gene coding for phytase under the control of elements ensuring the expression of said gene. The strain can be transformed by a vector into which is inserted the gene encoding phytase under the control of elements ensuring the expression of said gene. This gene will be inserted for example in a binary vector such as pBIN19 (Bevan, 1984) or pMON 505 (Horsch and Klee, 1986) or any other binary vector derived from the plasmids Ti and Ri.
II pourra aussi être utilement introduit par recombinaison homologue dans un plasmide Ti ou Ri désarmé, tel que pGV 3850 (Zambryski et Coll., 1983) avant la transformation de la plante.It can also be usefully introduced by homologous recombination into a disarmed Ti or Ri plasmid, such as pGV 3850 (Zambryski et Coll., 1983) before the transformation of the plant.
Il a été montré récemment que des plantes monocotylédones telles que le riz et le maïs pouvaient être avantageusement transformées par Agrobacterium tumefaciens, riz : Hiei et al. 1994, The Plant Journal 6 : 271-282; mais : Ishida et al. 1996, Nature biotechnology 14 : 745-750).It has recently been shown that monocots such as rice and corn can be advantageously transformed by Agrobacterium tumefaciens, rice: Hiei et al. 1994, The Plant Journal 6: 271-282; but: Ishida et al. 1996, Nature biotechnology 14: 745-750).
Par exemple, on transformera les espèces monocotylédones, notamment le riz, le blé et le maïs, en utilisant Agrobacterium tumefaciens. A titre de vecteur d'expression comprenant le gène fonctionnel de la phytase selon l'invention, on peut citer les vecteurs comprenant une séquence d'ADN contenant au moins une origine de réplication telle que des plasmides, des cosmides, des bactériophages, des virus, etc. On utilisera en particulier des plasmides. Lorsque l'on introduit un gène fonctionnel codant pour une phytase selon l'invention dans le génome de la plante, ce sera de préférence sous le contrôle d'un promoteur hétérologue.For example, we will transform monocotyledonous species, notably rice, wheat and corn, using Agrobacterium tumefaciens. As an expression vector comprising the functional phytase gene according to the invention, mention may be made of vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses , etc. In particular, plasmids will be used. When a functional gene coding for a phytase according to the invention is introduced into the genome of the plant, this will preferably be under the control of a heterologous promoter.
Enfin, la présente invention a également pour objet des plantes ou organes végétaux à teneur en phytase accrue pouvant être obtenus par le procédé selon l'invention.Finally, the present invention also relates to plants or plant organs with increased phytase content which can be obtained by the process according to the invention.
La teneur en phytase peut être accrue globalement ou seulement localement, c'est-à-dire dans une partie de la plante ou un compartiment cellulaire particulier.The phytase content can be increased globally or only locally, i.e. in a part of the plant or in a particular cell compartment.
On cite comme plantes transgéniques selon l'invention les céréales, notamment le maïs, le blé, l'orge, le sorgho, le seigle ainsi que le pois, le soja et la pomme de terre.Cereals, in particular corn, wheat, barley, sorghum, rye, as well as peas, soybeans and potatoes, are cited as transgenic plants according to the invention.
La présente invention a plus particulièrement pour objet une plante, notamment transgénique, selon l'invention, caractérisée en ce qu'elle produit des semences transgéniques exprimant une quantité accrue de phytase. La présente invention a également pour objet des semences séchées de plantes transgéniques selon l 'invention et notamment des semences comportant une teneur en phytase accrue obtenue par expression spécifique du fragment d'acide nucléique ou de la séquence d'ADN selon la présente invention, dans la semence.The present invention more particularly relates to a plant, in particular transgenic, according to the invention, characterized in that it produces transgenic seeds expressing an increased amount of phytase. A subject of the present invention is also dried seeds of transgenic plants according to the invention and in particular seeds comprising an increased phytase content obtained by specific expression of the nucleic acid fragment or of the DNA sequence according to the present invention, in the seed.
La présente invention a en effet également pour objet un hôte végétal consistant en une plante ou organe végétal notamment transgénique dans lequel la phytase de plante peut être exprimée dans une partie de la plante ou un compartiment cellulaire où cette enzyme n'est pas produite naturellement, caractérisé en ce qu'on a introduit une cassette d'expression selon l'invention comportant des séquences régulatrices qui induisent une expression spécifique dans ladite partie de la plante ou ledit compartiment cellulaire. La plante ou l'organe végétal en question est avantageusement une céréale et plus avantageusement encore du maïs ou leurs organes correspondants.The subject of the present invention is in fact also a plant host consisting of a plant or plant organ, in particular transgenic, in which the plant phytase can be expressed in a part of the plant or in a cell compartment where this enzyme is not produced naturally, characterized in that an expression cassette according to the invention has been introduced comprising regulatory sequences which induce specific expression in said part of the plant or said cell compartment. The plant or the plant organ in question is advantageously a cereal and more advantageously still corn or their corresponding organs.
La présente invention a également pour objet une farine obtenue à partir d'une semence selon l'invention. Enfin, la présente invention a pour objet une composition pour l'alimentation humaine ou animale comprenant des semences, une farine de semences ou une phytase selon la présente invention. De plus, la plante ou une partie de celle-ci peut être utilisée dans la ration alimentaire d'animaux monogastriques, d'une part pour réduire le taux de phytate dans le fumier ou lisier et d'autre part pour améliorer la digestibilité du phytate. Par exemple, la phytase exprimée agira sur la plante au cours de son développement. La phytase sera également utilisée dans les procédés de préparation alimentaire ou dans les procédés d'extraction de l'amidon (procédé de trempage). L'activité phytasique générée est également utilisable pour valoriser les eaux de trempage récupérées ou les eaux de brassage. En particulier, la disponibilité accrue du phosphore rend ces eaux très utiles comme additifs pour milieux de culture ou supports de fermentation. En outre, l'activité phytasique générée permet une meilleure récupération de l'innositol et de ses dérivés à partir des eaux de trempage ou de brassage.The present invention also relates to a flour obtained from a seed according to the invention. Finally, the subject of the present invention is a composition for human or animal consumption comprising seeds, a seed meal or a phytase according to the present invention. In addition, the plant or a part thereof can be used in the food ration of monogastric animals, on the one hand to reduce the level of phytate in the manure or slurry and on the other hand to improve the digestibility of the phytate . For example, the expressed phytase will act on the plant during its development. Phytase will also be used in food preparation processes or in starch extraction processes (soaking process). The phytase activity generated can also be used to recover recovered soaking water or brewing water. In particular, the increased availability of phosphorus makes these waters very useful as additives for culture media or fermentation supports. In addition, the phytase activity generated allows better recovery of innositol and its derivatives from soaking or brewing water.
L'invention concerne également l'utilisation de la phytase selon l'invention pour obtenir une meilleure disponibilité du calcium, par exemple à des fins alimentaires.The invention also relates to the use of the phytase according to the invention for obtaining better availability of calcium, for example for food purposes.
Si on utilise la phytase recombinante et non la plante elle-même, l'activité de la phytase s'exerce sur des phytates d'une autre origine végétale présentes dans la ration.If the recombinant phytase is used and not the plant itself, the activity of the phytase is exerted on phytates of another plant origin present in the ration.
Les fragments d'ADN selon l'invention peuvent aussi être utilisés pour transformer des microorganismes ou des cellules eucaryotes pour cloner et produire l'enzyme phytase. La présente invention a donc également pour objet une méthode de production de phytase, caractérisée en ce qu'elle comprend les étapes de : a) transformation d'un hôte eucaryote ou procaryote, en particulier d'un végétal ou d'un microorganisme avec une cassette d'expression selon la présente invention, comportant des séquences régulatrices capables de commander l'expression d'une quantité accrue de phytase dans l'hôte végétal ou le microorganisme respectivement ; b) culture du microorganisme transformé ou croissance de la plante transformée, et c) extraction de la phytase de la culture de microorganismes ou des tissus végétaux transgéniques.The DNA fragments according to the invention can also be used to transform microorganisms or eukaryotic cells to clone and produce the phytase enzyme. The present invention therefore also relates to a method for the production of phytase, characterized in that it comprises the steps of: a) transformation of a eukaryotic or prokaryotic host, in particular of a plant or of a microorganism with a expression cassette according to the present invention, comprising regulatory sequences capable of controlling the expression of an increased quantity of phytase in the plant host or the microorganism respectively; b) culture of the transformed microorganism or growth of the transformed plant, and c) extraction of the phytase from the culture of microorganisms or transgenic plant tissues.
La présente invention a également pour objet une phytase recombinante obtenue par le procédé selon l'invention, préférentiellement sous forme d'un dimère ou d'un hétérodimère, et des anticorps dirigés contre la phytase de la plante selon l'invention.The present invention also relates to a recombinant phytase obtained by the process according to the invention, preferably in the form of a dimer or a heterodimer, and antibodies directed against the plant phytase according to the invention.
La présente invention a également pour objet l'utilisation de la phytase pour augmenter l'extractabilité des amidons des grains où elle s'exprime. Le phytate fait précipiter les protéines avec l'amidon de sorte que si l'on réduit le taux de phytate, l'extraction de l'amidon s'en trouve facilitée. L'ajout d'une phytase aux grains de plantes à partir desquels on souhaite extraire l'amidon permet de pallier la précipitation des protéines par les phytates.The present invention also relates to the use of phytase to increase the extractability of the starches of the grains where it is expressed. Phytate precipitates proteins with starch so that if you reduce the phytate level, the extraction of starch is easier. The addition of a phytase to the grains of plants from which it is desired to extract the starch makes it possible to alleviate the precipitation of proteins by phytates.
Plus précisément, la présente invention a donc pour objet l'utilisation d'une phytase selon l'invention et/ou de semences contenant une phytase selon l'invention pour extraire l'amidon à partir de grains de plantesMore specifically, the subject of the present invention is therefore the use of a phytase according to the invention and / or of seeds containing a phytase according to the invention for extracting starch from grains of plants
Enfin, on peut utiliser les fragments d'ADN selon l'invention comme marqueur d'un phénotype lié à l'expression de la phytaseFinally, the DNA fragments according to the invention can be used as a marker for a phenotype linked to the expression of phytase.
L'invention concerne également l'utilisation d'une phytase selon l'invention ou l'utilisation de tout ou partie de plantes contenant une phytase selon l'invention, pour la production de myo-inositol à des fins thérapeutiques ou diététiques.The invention also relates to the use of a phytase according to the invention or the use of all or part of plants containing a phytase according to the invention, for the production of myo-inositol for therapeutic or dietetic purposes.
Le myo-inositol, forme nutritionnelle active de l'inositol, est un constituant du phospholipide phosphatidylinositolMyo-inositol, the active nutritional form of inositol, is a constituent of the phospholipid phosphatidylinositol
Le myo-inositol est connu pour ses vertus dans le domaine de la santé. On lui a souvent attribué des effets sur la diminution de la concentration des triglycérides et du cholestérol dans le sang, et plus généralement pour la protection contre les maladies cardiovasculaires.Myo-inositol is known for its virtues in the health field. It has often been attributed to effects on the decrease in the concentration of triglycerides and cholesterol in the blood, and more generally for protection against cardiovascular diseases.
Il est reconnu que les composés issus d'un phospholipide tel que le myo- inositol ont des effets bénéfiques sur l'insomnie et l'anxiété. Par ailleurs, la névropathie périphérique du diabétique est une des complications les plus paralysantes du diabète. Or, on suppose depuis déjà plusieurs années qu'une diminution du taux de myo-inositol est associée aux dégâts des fibres nerveuses des diabétiques souffrant d'une telle complicationIt is recognized that compounds derived from a phospholipid such as myo-inositol have beneficial effects on insomnia and anxiety. In addition, the peripheral neuropathy of the diabetic is one of the most paralyzing complications of diabetes. However, it has already been assumed for several years that a reduction in the level of myo-inositol is associated with damage to the nerve fibers of diabetics suffering from such a complication.
Aux Etats-Unis, les personnes adultes consomment environ 1 gramme/jour de myo-inositol le plus souvent sous forme de phospholipide ou d'acide phytique d'origine végétale D'autres caractéristiques et avantages de la présente invention apparaîtront à la lumière de la description détaillée qui va suivre faite en référence aux Figures 1 à 6.In the US, the adults consume about 1 gram / day of myo-inositol most often in the form of phospholipid or phytic acid of plant origin Other characteristics and advantages of the present invention will appear in the light of the detailed description which follows, given with reference to FIGS. 1 to 6.
La Figure 1 représente la séquence nucléotidique et la séquence d'acides aminés déduite de l'ADNc phy SI 1. Les acides aminés soulignés correspondent à deux séquences N- terminales obtenues à partir de la phytase de maïs purifiée. La séquence d'aa qui présente une homologie avec 33 aa de la phytase à'Aspergillus Phy A (van Hartingsveldt et al., 1993) est soulignée en pointillé. Les sites Ncol (CCATGG) et Asel (ATTAAT) utilisés pour le clonage dans le vecteur d'expression pET 14 (b) sont encadrésFigure 1 represents the nucleotide sequence and the deduced amino acid sequence of the phy SI cDNA 1. The underlined amino acids correspond to two N-terminal sequences obtained from purified corn phytase. The sequence of aa which has a homology with 33 aa of phytase to Aspergillus Phy A (van Hartingsveldt et al., 1993) is underlined in dotted lines. The Ncol (CCATGG) and Asel (ATTAAT) sites used for cloning into the expression vector pET 14 (b) are framed
La Figure 2 représente la comparaison des régions de recouvrement de 33 aa de la séquence protéique déduite de l'ADNc phy S I 1 et des séquences de phytases Phy A et Phy B d' Aspergillus.FIG. 2 represents the comparison of the 33 aa overlap regions of the protein sequence deduced from the phy S I 1 cDNA and the phytase sequences Phy A and Phy B of Aspergillus.
Les ombres foncées indiquent les acides aminés conservés et les acides aminés similaires quant à eux sont encadrés et apparaissent en caractère gras. La séquence consensus RHGxRxP dont on suppose qu'elle correspond au motif accepteur de phosphate est soulignée. On procède à la comparaison en utilisant le programme FastA de GCG.Dark shadows indicate which amino acids are conserved, and similar amino acids are framed and appear in bold. The RHGxRxP consensus sequence which is assumed to correspond to the phosphate acceptor motif is underlined. The comparison is made using the GCA FastA program.
La Figure 3 représente les cartes de restriction déduites des clones génomiques isolés de la banque EMBL3FIG. 3 represents the restriction maps deduced from the genomic clones isolated from the EMBL3 library
Légende : El : EcoRI ; HIII : Hind III ; SI . Sal I Y/A séquence génomique adjacente région chimériqueLegend: El: EcoRI; HIII: Hind III; IF . Sal I Y / A adjacent genomic sequence chimeric region
La Figure 4 représente la séquence nucléotidique du clone de classe I ( I 9. 14 fragment HindIII / Sal I de 4,7 Kb) codant pour une protéine phytase de classe I correspondant au gène PHYT I (cette séquence correspond à SEQ ID N° 2).FIG. 4 represents the nucleotide sequence of the class I clone (I 9. 14 HindIII / Sal I fragment of 4.7 Kb) coding for a class I phytase protein corresponding to the PHYT I gene (this sequence corresponds to SEQ ID No. 2).
Légende : les lettres minuscules correspondent à la séquence non codante, les lettres majuscules correspondent à la séquence transcrite, la séquence protéique déduite est indiquée en utilisant le code à trois lettres de la représentation des acides aminésLegend: the lower case letters correspond to the non-coding sequence, the upper case letters correspond to the transcribed sequence, the deduced protein sequence is indicated using the three-letter code of the representation of amino acids
La Figure 5 représente la séquence nucléotidique du clone de classe II (P23 7 fragment HindIII de 3 Kb) codant pour une protéine phytase de classe II correspondant au gène PHYT II (cette séquence correspond à SEQ ID N° 3) 5 Légende : les lettres minuscules correspondent à la séquence non codante, les lettres majuscules correspondent à la séquence transcrite, la séquence protéique déduite est indiquée en utilisant le code à trois lettres de la représentation des acides aminés.FIG. 5 represents the nucleotide sequence of the class II clone (P23 7 HindIII fragment of 3 Kb) coding for a class II phytase protein corresponding to the PHYT II gene (this sequence corresponds to SEQ ID No. 3) 5 Legend: the lower case letters correspond to the non-coding sequence, the upper case letters correspond to the transcribed sequence, the deduced protein sequence is indicated using the three-letter code of the representation of amino acids.
(+ 1 161) : départ du produit Race n° 92 10 (+ 1175) : départ de TEST(+ 1,161): departure of Race product n ° 92 10 (+ 1175): departure of TEST
(+ 1314) : départ du produit Race n° 93 (+ 1351) : départ du produit Race n° 87 (+ 1548) : départ du produit Race n° 54.(+ 1314): departure from Race product n ° 93 (+ 1351): departure from Race product n ° 87 (+ 1548): departure from Race product n ° 54.
La Figure 6 représente la comparaison de séquences protéiques des 15 phytases de l'ADNc phy SU, de classe I et de classe II. L'alignement a été réalisé avec le programme "Clustal V multiple alignement". La séquence protéique est indiquée en utilisant le code à une lettre de la représentation des acides aminés.Figure 6 shows the comparison of protein sequences of phytase of the phy SU cDNA, class I and class II. The alignment was carried out with the "Clustal V multiple alignment" program. The protein sequence is indicated using the letter code of the amino acid representation.
I. MATERIELS ET PROCEDES 20 1.1) Conditions de germination des semences de maïsI. MATERIALS AND PROCESSES 20 1.1) Germination conditions for maize seeds
On utilise successivement trois lignées homozygotes de Zea mays pour ce travail. On construit la bibliothèque d'ADNc avec des ARN extraits à partir de Zea mays c.v. MO 17 (Maisadour). L'ARN utilisé pour des analyses de Northern blot est extrait de Zea mays c.v. AM0406 (Maisadour). On imbibe des semences de maïs 25 pendant douze heures dans de l'eau distillée aérée à la température ambiante puis on les transfère dans du sable humide à 26°C, avec une photo-période de huit heures (50 μE/s par vr).Three homozygous lines of Zea mays are successively used for this work. The cDNA library is constructed with RNAs extracted from Zea mays c.v. MO 17 (Maisadour). The RNA used for Northern blot analyzes is extracted from Zea mays c.v. AM0406 (Maisadour). Corn seeds are soaked for twelve hours in distilled water aerated at room temperature and then transferred to wet sand at 26 ° C, with an eight-hour photo-period (50 μE / s per vr) .
Des germinations de grains de maïs de la lignée B73 sont réalisées sur vermiculite à l'obscurité à 28°C. La lignée B73 a été choisie pour l'analyse des 30 départs de transcription car les séquences génomiques ont été déterminées à partir de ce matériel génétique. Ainsi, les différences éventuelles notées entre les séquences des transcrits et celles de fragments génomiques ne pourront pas être attribuées à du polymorphisme intervariétal.Germination of corn kernels of line B73 is carried out on vermiculite in the dark at 28 ° C. The B73 line was chosen for the analysis of the transcription starts since the genomic sequences were determined from this genetic material. Thus, the possible differences noted between the sequences of the transcripts and those of genomic fragments cannot be attributed to intervenarietal polymorphism.
1.2) Construction et criblage d'une bibliothèque d'ADNc }5 I.2a) ADN complémentaire1.2) Construction and screening of a cDNA library} 5 I.2a) Complementary DNA
On purifie l'ARN total à partir d'embryons congelés (scutellum et axe embryonnaire) de jeunes plants de maïs âgés de trois à quatre jours, en utilisant du chlorhydrate de guanidine (Logemann et al., 1987). On sélectionne la fraction poly(A)+ sur des colonnes d'oligo dT (Pharmacia). On a synthétisé l'ADNc à deux brins en utilisant un nécessaire d'ADNc (Promega) et un adaptateur d'amorce d'oligo (dT)-Notl. Après ligature des adaptateurs Eco RI (Pharmacia), on digère l'ADNc avec Notl et on le clone de façon directionnelle dans λgtl 1 (Promega). On obtient environ 1 x 10° recombinants indépendants après encapsidation (Stratagène) et infection d'E. coli souche LΕ392 (Promega). On amplifie la bibliothèque d'ADNc de λgtl 1 dans E. coli souche RY1090. On procède au criblage immunologique des plages du phage en utilisant le système d'immuno-criblage ProtoBlot de Promega selon le protocole du fournisseur. On effectue le criblage avec un antisérum brut de lapin dirigé contre la phytase purifiée de maïs (Labouré et al., 1993). Après dilutions ( 1 : 1000 pour le premier criblage et 1 : 5000 pour les étapes de criblage suivantes), on traite l' antisérum avec des extraits de E. coli comme il est indiqué dans les directives Promega. On isole plusieurs phages recombinants positifs après criblage de 1 ,5 x 10^ plages. On soumet alors ces phages positifs à un second criblage avec un anticorps plus spécifique purifié par affinité sur la sous-unité de phytase (Labouré et al., 1993). On estime la taille des inserts par réaction PCR avec des amorces U5 (5 'Total RNA is purified from frozen embryos (scutellum and embryonic axis) of young corn plants three to four days old, using guanidine hydrochloride (Logemann et al., 1987). We select the fraction poly (A) + on oligo dT columns (Pharmacia). Two-stranded cDNA was synthesized using a cDNA kit (Promega) and an oligo primer adapter (dT) -Notl. After ligation of the Eco RI adapters (Pharmacia), the cDNA is digested with NotI and it is cloned directionally in λgtl 1 (Promega). About 1 x 10 ° independent recombinants are obtained after packaging (Stratagene) and infection of E. coli strain LΕ392 (Promega). The cDNA library of λgtl 1 is amplified in E. coli strain RY1090. The phage plaques are immunologically screened using the Promega ProtoBlot immuno-screening system according to the supplier's protocol. The screening is carried out with a crude rabbit antiserum directed against the purified corn phytase (Labouré et al., 1993). After dilutions (1: 1000 for the first screening and 1: 5000 for the subsequent screening steps), the antiserum is treated with E. coli extracts as indicated in the Promega guidelines. Several positive recombinant phages are isolated after screening for 1.5 × 10 5 plaques. These positive phages are then subjected to a second screening with a more specific antibody purified by affinity on the phytase subunit (Labouré et al., 1993). The size of the inserts is estimated by PCR reaction with U5 primers (5 '
AACAGCTATGACCATG-3') (SΕQ ID N° 4) et U3 (5'- GTAAAACGAACGGCCAGT-3) (SΕQ ID N° 5), en utilisant les conditions d'amplification décrites par Marin et al. (1996). On sous-clone alors les inserts des phages intéressants dans les sites Eco RI - Notl d'un vecteur pBS-SK+ (Stratagène) On détermine les séquences nucléotidiques sur un ADN à deux brins en utilisant la trousse PRISM Ready Reaction Kit (Applied Biosystems), en suivant les instructions du fabricant et en utilisant un appareil à cycle thermique d'ADN Perking Elmer Cetus PEC480 et un séquenceur ABI 373A (Applied Biosystems).AACAGCTATGACCATG-3 ') (SΕQ ID N ° 4) and U3 (5'- GTAAAACGAACGGCCAGT-3) (SΕQ ID N ° 5), using the amplification conditions described by Marin et al. (1996). The phage inserts of interest are then subcloned into the Eco RI - Notl sites of a pBS-SK + vector (Stratagene). The nucleotide sequences are determined on a double-stranded DNA using the PRISM Ready Reaction Kit (Applied Biosystems). ), following the manufacturer's instructions and using a Perking Elmer Cetus PEC480 DNA thermal cycling device and an ABI 373A sequencer (Applied Biosystems).
On procède à des hybridations de plages de phages avec l'ADNc de phy AM10 partiel comme sonde, afin d'isoler des ADNc de pleine longueur, sur 360 000 plages selon la technique de Benton et Davis (Sambrook et al., 1989) : on plonge le filtre, côté ADN vers le haut, dans la solution dénaturante pendant dix minutes, puis pendant six minutes dans la solution neutralisante.Phage plaques are hybridized with partial phy AM10 cDNA as a probe, in order to isolate full-length cDNAs, on 360,000 plaques according to the technique of Benton and Davis (Sambrook et al., 1989): the filter is immersed, DNA side up, in the denaturing solution for ten minutes, then for six minutes in the neutralizing solution.
On effectue l'analyse de la séquence totale de l' insert à 1 ,4 kb de phy S I 1 sur les deux brins par le procédé de la terminaison de chaîne didésoxy (Sanger et al ,Analysis of the total sequence of the insert at 1.4 kb of phy S I 1 on the two strands is carried out by the dideoxy chain termination method (Sanger et al,
1977) en utilisant les matrices à un seul brin M13 mpl 8 et mpl 9 (la teneur élevée en GC dans cet insert ne permet pas son séquençage sur l'ADN à deux brins) On procède à des analyses de séquence en utilisant la trousse UWGCG1977) using the single-stranded matrices M13 mpl 8 and mpl 9 (the high content of GC in this insert does not allow its sequencing on DNA with two strands) Sequence analyzes are performed using the UWGCG kit
(University of Wisconsin Genetics Computer Group), manuel du programme de la trousse Wisconsin, version 8, septembre 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 5371 1.(University of Wisconsin Genetics Computer Group), Wisconsin Kit Program Manual, version 8, September 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 5371 1.
Le programme Mac Vector (Kaufman et al. 1994, Eastman KODAK company New Haven, CT, USA) a aussi été utilisé pour les traitements des séquences génomiques.The Mac Vector program (Kaufman et al. 1994, Eastman KODAK company New Haven, CT, USA) was also used for processing the genomic sequences.
I.2b) ADN génomique L'ADNc phytase phy SI 1 (fragment Eco RI / Not I contenant la séquence phy SU de 1335 pb) est utilisé comme sonde pour le criblage d'une banque génomique lambda de maïs. La banque est une banque commerciale (Clontech, PaloI.2b) Genomic DNA The phytase phy SI 1 cDNA (Eco RI / Not I fragment containing the phy SU sequence of 1335 bp) is used as a probe for the screening of a lambda corn genomic library. The bank is a commercial bank (Clontech, Palo
Alto, CA, USA) construite à partir de fragments d'ADN extraits de plantules de la lignée B73. L'ADN est digéré partiellement par l'enzyme Mbo I. Les fragments génomiques ainsi obtenus, d'une taille de 8 à 22 Kb, sont clones au site Bam HI du phage EMBL-3 (Frischauf ét al. 1983, J. Mol. Biol. 170 : 827) et peuvent être excisés par une digestion enzymatique Sal I.Alto, CA, USA) constructed from DNA fragments extracted from seedlings of the B73 line. The DNA is partially digested with the enzyme Mbo I. The genomic fragments thus obtained, of a size of 8 to 22 Kb, are cloned at the Bam HI site of the phage EMBL-3 (Frischauf et al. 1983, J. Mol Biol. 170: 827) and can be excised by an enzyme digestion Sal I.
Le criblage de la banque génomique a été réalisé suivant les indications de Sambrook et al. (1989, Molecular cloning : a laboratory manual, Cold Spring Harbor Laboratory Press, New York). 10° phages recombinants par banque d'ADN génomique (soit six équivalents génome maïs au total) sont étalés à différentes concentrations sur des boîtes de pétri en présence de la bactérie hôte. Des réplicats des plages de lyse sont réalisés sur filtre de nitrocellulose. Les phages recombinants contenant des fragments génomiques homologues à PADNc phytase sont repérés après hybridation des filtres avec la sonde phytase. Par superposition du filtre présentant des signaux positifs avec la boîte correspondante, la plage de lyse intéressante est prélevée et les phages remis en suspension. Les phages sont ensuite redilués, réétalés sur boîte de pétri pour subir un crible supplémentaire. Trois cribles successifs ont été réalisés afin d'obtenir des clones positifs isolés. Après le troisième tour de criblage, treize clones étaient positifs.The screening of the genomic library was carried out according to the indications of Sambrook et al. (1989, Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, New York). 10 ° recombinant phages by genomic DNA library (ie six corn genome equivalents in total) are spread at different concentrations on petri dishes in the presence of the host bacterium. Replicates of the lysis ranges are produced on a nitrocellulose filter. Recombinant phages containing genomic fragments homologous to cDNA phytase are identified after hybridization of the filters with the phytase probe. By superimposing the filter presenting positive signals with the corresponding box, the interesting lysis range is removed and the phages resuspended. The phages are then rediluted, re-spread on a petri dish to undergo an additional screen. Three successive screens were carried out in order to obtain isolated positive clones. After the third round of screening, thirteen clones were positive.
Après purification de l'ADN des treize clones génomiques isolés (protocole Qiagen®, Chatsworth, CA, USA), ceux-ci sont caractérisés par digestion enzymatique, hybridation et séquençage selon la technique classique de Sanger et al. ( 1977) à l'aide du kit commercial "fmol DNA Sequencing System" (Promega, Madison, WI, USA). Les ADN des treize clones sont digérés par les enzymes de restriction SalAfter purification of the DNA of the thirteen isolated genomic clones (Qiagen® protocol, Chatsworth, CA, USA), these are characterized by enzymatic digestion, hybridization and sequencing according to the conventional technique of Sanger et al. (1977) using the commercial kit "fmol DNA Sequencing System" (Promega, Madison, WI, USA). The DNAs of the thirteen clones are digested by the restriction enzymes Sal
I, Hind III, Eco RI (simples digestions) et Sal I + Hind III (double digestion). Après électrophorèse sur gel d'agarose des différents fragments et transfert sur membranes de nylon Hybond IN (Amersham, Buckinghamshire, UK), ces dernières sont hybridées avec la sonde d'ADNc phy SI 1. Plusieurs fragments issus des clones phagiques ont été sous-clonés dans le plasmide pBS II SK+ (Stratagène, La Jolla, CA, USA) selon les techniques classiques de clonage (Sambrook et al. 1989, Molecular cloning : a laboratory manual, Cold Spring Harbor Laboratory Press, New York). Les fragments sous-clonés présentés ci- dessous, contiennent une séquence homologue à l'ADNc phy SI 1. Classe I : P19.14 (fragment Sal I/Hind III de 4,7 Kb)I, Hind III, Eco RI (single digestion) and Sal I + Hind III (double digestion). After electrophoresis on agarose gel of the different fragments and transfer to nylon Hybond IN membranes (Amersham, Buckinghamshire, UK), the latter are hybridized with the phy SI 1 cDNA probe. Several fragments from phage clones have been sub- cloned into the plasmid pBS II SK + (Stratagene, La Jolla, CA, USA) according to conventional cloning techniques (Sambrook et al. 1989, Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, New York). The subcloned fragments presented below contain a sequence homologous to the phy SI 1 cDNA. Class I: P19.14 (Sal I / Hind III fragment of 4.7 Kb)
Classe II : P13.2 (fragment Sal I de 5,5 Kb)Class II: P13.2 (5.5 Kb Sal I fragment)
P13.6 (fragment Hind III de 2,6 Kb) P13.13 (fragment Eco RI de 3,8 Kb) P23.7 (fragment Hind III de 3 Kb) Le séquençage a été initié aux extrémités de ces inserts avec les amorces universelles Reverse et Ml 3-20 (Biolabs, Beverly MA, USA) de "façon manuelle" (utilisation du Kit "fmol DNA Sequencing System" de Promega). La stratégie de progression par oligonucléotides a été adoptée pour compléter les données. Les séquences déterminées avec les oligonucléotides internes ont été obtenues par séquençage automatique auprès d'une société de service (Génome Express, Grenoble,P13.6 (Hind III fragment of 2.6 Kb) P13.13 (Eco RI fragment of 3.8 Kb) P23.7 (Hind III fragment of 3 Kb) Sequencing was initiated at the ends of these inserts with the primers Universal Reverse and Ml 3-20 (Biolabs, Beverly MA, USA) "manually" (use of the "fmol DNA Sequencing System" Kit from Promega). The oligonucleotide progression strategy was adopted to complete the data. The sequences determined with the internal oligonucleotides were obtained by automatic sequencing from a service company (Génome Express, Grenoble,
France).France).
1.3) Analyses de gel d'ARN1.3) RNA gel analyzes
On extrait les ARN totaux en utilisant du chlorhydrate de guanidine (Logeman et al., 1987) provenant d'embryons congelés à divers stades de germination. On fractionne la taille de quantités égales d'ARN sur un gel d'agarose àTotal RNAs are extracted using guanidine hydrochloride (Logeman et al., 1987) from frozen embryos at various stages of germination. The size of equal amounts of RNA is fractionated on an agarose gel to
1 ,2 % contenant du formaldéhyde (Sambrook et al., 1989) et on les transfère sur une membrane Hybond N (Amersham). On procède aux préhybridations et hybridations à 42°C dans : formamide à 50 %, 5 x Denhardt, 5 x SSPE, Sarkosyl à 0,5 %, ADN de sperme de saumon à 100 μg/ml. On lave deux fois les membranes à 42°C avec 2 x SSC, SDS à 0, 1 % et une fois à 60°C pendant dix à trente minutes avec SSC à 0,2 %,1.2% containing formaldehyde (Sambrook et al., 1989) and they are transferred to a Hybond N membrane (Amersham). Prehybridizations and hybridizations are carried out at 42 ° C in: 50% formamide, 5 x Denhardt, 5 x SSPE, Sarkosyl at 0.5%, salmon sperm DNA at 100 μg / ml. The membranes are washed twice at 42 ° C with 2 x SSC, 0.1% SDS and once at 60 ° C for ten to thirty minutes with 0.2% SSC,
SDS à 0, 1 %, avant exposition au film.SDS at 0, 1%, before exposure to the film.
1.4) Surexpression de la protéine codée phy SU dans E.coli 5 On clone un fragment Nocl-Asel à 1 150 pb de l'ADNc phy SU (voir figure 1) entre les sites Nocl et Ndel du vecteur d'expression pET14 (b) (Novagen). On obtient l'expression de la protéine en clonant le vecteur recombinant dans E. coli souche BL21 (Novagen).1.4) Overexpression of the protein coded phy SU in E. coli A 1,150 bp Nocl-Asel fragment is cloned from the phy SU cDNA (see FIG. 1) between the Nocl and Ndel sites of the expression vector pET14 (b) (Novagen). The expression of the protein is obtained by cloning the recombinant vector into E. coli strain BL21 (Novagen).
On procède aux extractions et aux analyses des protéines selon lesProteins are extracted and analyzed according to the
10 procédés décrits par le fournisseur. On effectue les analyses de Western blot avec l'anticorps purifié par affinité et on détecte l'activité de phosphatase sur gel de polyacrylamide non dénaturant, comme il a été décrit antérieurement (Labouré et al., 1993).10 processes described by the supplier. Western blot analyzes are performed with the affinity purified antibody and phosphatase activity is detected on non-denaturing polyacrylamide gel, as described previously (Labouré et al., 1993).
1.5) Détermination de la séquence N-terminale1.5) Determination of the N-terminal sequence
15 On électrophorèse de la phytase de maïs purifiée sur SDS-PAGΕ à 12,5 % et on effectue un électro-transfert sur une membrane de PVDF "Problott" (Applied Biosystems). La région correspondant à la sous-unité à 38 kDa est révélée par coloration avec du noir amido. On procède à une dégradation automatisée d'Εdman de la protéine en utilisant un séquenceur Applied Biosystems 473 A avec les réactifs etThe purified corn phytase is electrophoresed on SDS-PAGΕ at 12.5% and an electro-transfer is carried out on a PVDF "Problott" membrane (Applied Biosystems). The region corresponding to the 38 kDa subunit is revealed by staining with amido black. Automated Εdman degradation of the protein is carried out using an Applied Biosystems 473 A sequencer with the reagents and
20 les procédés du fabricant.20 the manufacturer's procedures.
1.6) Cartographie des départs de transcription1.6) Mapping of transcription departures
Afin de déterminer le départ de transcription, nous avons choisi d'utiliser la méthode de RACE PCR (Rapid Amplification cDNA Ends, Chenchik 1995). La mise en application de cette technique a été réalisée grâce au kit "Marathon cDNA 25 Amplification" de Clontech (Palo Alto, CA, USA)In order to determine the start of transcription, we chose to use the RACE PCR method (Rapid Amplification cDNA Ends, Chenchik 1995). The application of this technique was carried out using the "Marathon cDNA 25 Amplification" kit from Clontech (Palo Alto, CA, USA)
Les embryons (axe embryonnaire et scutellum) âgés de un jour et un jour et demi ont été broyés séparément dans l'azote liquide. Les ARN totaux et les ARN messagers ont été extraits et purifiés à partir d'un gramme de broyât suivant les indications des kits utilisés . "RNAgents Total RNA Isolation System" etThe embryos (embryonic axis and scutellum) aged one day and one and a half days were ground separately in liquid nitrogen. The total RNA and the messenger RNA were extracted and purified from a gram of ground material according to the indications of the kits used. "RNAgents Total RNA Isolation System" and
30 "polyATtract mRNA Isolation Systems" (Promega, Madison WI, USA).30 "polyATtract mRNA Isolation Systems" (Promega, Madison WI, USA).
1.7) Cartographie génétique des loci homologues à l'ADNc phytase La technique R F L P (Restriction Fragment Length Polymorphism) a été utilisée. C'est un outil très performant pour le développement de cartes de liaisons génétiques saturées (Murigneux et al. 1993, Theor Appl Genêt. 87 : 278-287) La1.7) Genetic mapping of loci homologous to cDNA phytase The R F L P technique (Restriction Fragment Length Polymorphism) was used. It is a very powerful tool for the development of saturated genetic linkage maps (Murigneux et al. 1993, Theor Appl Genêt. 87: 278-287) La
JD méthode Southern (1975, J. Mol Biol.98 : 503-517) permet la mise en évidence des différences individuelles dans la taille des fragments de restriction obtenus avec une enzyme donnée et une sonde donnée, qui correspondent à des emplacements définis sur le génome c'est-à-dire à des loci génétiques Pour la localisation chromosomique du gène ou des gènes correspondant à l'ADNc phytase, la sonde phy SU - fragment Eco RI / Not I de 1361 pb - a été hybridée sur un transfert d'un gel d'électrophorèse contenant l'ADN digéré par Eco RI et Hind III de différentes lignées de maïs pour lesquelles des descendances en ségrégation étaient disponibles et utilisées pour la cartographie génétique du maïs. Le croisement Al 88 x HD7 a été choisi car un polymorphisme de la taille des fragments de restriction homologues à la sonde a été mis en évidence entre les deux lignées parentales. Al 88 est une lignée américaine (Université du Minnesota) et HD7 est une lignée haploïde doublée (Murigneux et al. 1993, Theor. Appl. Genêt. 87: 278-287) issue d'une population synthétique comprenant du matériel d'origine chinoise essentiellement. La sonde phy SU a par la suite été hybridée sur des membranes contenant l'ADN de 58 lignées recombinantes SSD ("Single Seed Descent" : lignées recombinantes obtenues par filiation monograine) issues de ce croisement. Sur les membranes contenant l'ADN digéré par Hind III, deux bandes de tailles différentes étaient observées pour chacun des parents. Dans la descendance, ces bandes coségrègent pour 55" individus, 2 individus possèdent les 4 bandes et un seul individu présente une bande de chacun des parents. Le même type de ségrégation est observé pour l'hybridation réalisée sur les membranes contenant l'ADN des lignées recombinantes digéré par Eco RI.JD Southern method (1975, J. Mol Biol. 98: 503-517) makes it possible to demonstrate individual differences in the size of the restriction fragments obtained with a given enzyme and a given probe, which correspond to defined locations on the genome i.e. at genetic loci For the chromosomal localization of the gene or genes corresponding to the phytase cDNA, the phy SU probe - Eco RI / Not I fragment of 1361 bp - was hybridized on a transfer of an electrophoresis gel containing the DNA digested with Eco RI and Hind III from different lines of maize for which segregated progeny were available and used for genetic mapping of maize. The Al 88 x HD7 crossover was chosen because a polymorphism of the size of the restriction fragments homologous to the probe was demonstrated between the two parental lines. Al 88 is an American line (University of Minnesota) and HD7 is a doubled haploid line (Murigneux et al. 1993, Theor. Appl. Genêt. 87: 278-287) from a synthetic population including material of Chinese origin essentially. The phy SU probe was then hybridized on membranes containing the DNA of 58 SSD ("Single Seed Descent") recombinant lines from this cross. On the membranes containing the DNA digested with Hind III, two bands of different sizes were observed for each of the parents. In the descendants, these bands co-aggregate for 55 "individuals, 2 individuals have the 4 bands and only one individual has a band from each of the parents. The same type of segregation is observed for the hybridization carried out on the membranes containing the DNA of the Recombinant lines digested with Eco RI.
1.8) Construction des gènes chimériques I.8a) Fusions GUS1.8) Construction of chimeric genes I.8a) GUS mergers
Le plasmide pBIOS 255 a été obtenu par l'insertion du fragment de 1 ,3 kb provenant de PI 9.14 restreint à Sac I (position + 749) / Nco I (Nco I se situe au niveau de la première méthionine du gène porté par ce fragment génomique), dans le plasmide pRPA-RD-100 coupé à Sac I / Nco I. Ce dernier contient le gène GUS et le terminateur Nos (Bevan et al., 1983, Nature 304 : 184-187). Une deuxième construction avec un fragment promoteur plus grand (2, 1 kb) a été élaborée. Le fragment P19.14 restreint à Eco RI / Sph I a été inséré dans le plasmide pBIOS 255 coupé à Eco RI / Sph I. Le plasmide résultant s'appelle pBIOS 261.The plasmid pBIOS 255 was obtained by inserting the 1.3 kb fragment from PI 9.14 restricted to Sac I (position + 749) / Nco I (Nco I is located at the level of the first methionine of the gene carried by this genomic fragment), in the plasmid pRPA-RD-100 cut with Sac I / Nco I. The latter contains the GUS gene and the terminator Nos (Bevan et al., 1983, Nature 304: 184-187). A second construct with a larger promoter fragment (2, 1 kb) was developed. The P19.14 fragment restricted to Eco RI / Sph I was inserted into the plasmid pBIOS 255 cut to Eco RI / Sph I. The resulting plasmid is called pBIOS 261.
Le plasmide pBIOS 262 a été obtenu par l'insertion du fragment de 1,3 kb provenant de P23.7 coupé à Eco RI / Nco I (Eco RI, site du polylinker du vecteur etThe plasmid pBIOS 262 was obtained by inserting the 1.3 kb fragment from P23.7 cut at Eco RI / Nco I (Eco RI, site of the polylinker of the vector and
Nco I situé au niveau de la première méthionine du gène porté par ce fragment génomique) dans le plasmide pRPA-RD-100 (Eco RI / Nco I). I.8b) Construction de gènes chimériques permettant une expression ectopique de la phytase de classe I (correspondant au clone PI 9.14, cf. II.4) ci-après) dans le grain et/ou la plante de maïsNco I located at the level of the first methionine of the gene carried by this genomic fragment) in the plasmid pRPA-RD-100 (Eco RI / Nco I). I.8b) Construction of chimeric genes allowing an ectopic expression of the class I phytase (corresponding to the clone PI 9.14, cf. II.4) below) in the grain and / or the corn plant
Dans un premier temps, les inventeurs ont élaboré un vecteur plasmidique de base, dénommé pBIOS 256 contenant l'ADNc phytase accolé au terminateur du gène de la nopaline synthetase (ter Nos) qui amène un signal de polyadénylation fonctionnel chez de nombreuses espèces végétales. Ce plasmide a été obtenu par clonage du fragment Sma I / Eco RV de 300 pb comportant le terminateur Nos (Bevan et al. 1983, Nature 304 : 184-187) du plasmide pBIOS 250 au site Bst XI (rendu "bouts francs" grâce à l'action de la T4 DNA polymérase) du plasmide phy SU . Le vecteur pBIOS 2500 avait été généré par délétion du fragment Sma I du plasmide pDM 302 (Cao et al. 1992, Plant Cell Reports 1 1 : 586-591).Initially, the inventors developed a basic plasmid vector, called pBIOS 256 containing the phytase cDNA attached to the terminator of the nopaline synthetase gene (ter Nos) which brings about a functional polyadenylation signal in many plant species. This plasmid was obtained by cloning the 300 bp Sma I / Eco RV fragment comprising the Nos terminator (Bevan et al. 1983, Nature 304: 184-187) from the plasmid pBIOS 250 at the Bst XI site (made "blunt ends" thanks to to the action of T4 DNA polymerase) of the plasmid phy SU. The vector pBIOS 2500 had been generated by deletion of the Sma I fragment from the plasmid pDM 302 (Cao et al. 1992, Plant Cell Reports 1 1: 586-591).
I.8bl) Construits porteurs des gènes PHYT I (phytase de classe I exprimée de façon constitutive dans le cytoplasme) Les constructions permettant l'expression de la phytase dans le cytoplasme de façon constitutive ont été réalisées de la manière suivante :I.8bl) Constructs carrying the PHYT I genes (class I phytase constitutively expressed in the cytoplasm) The constructs allowing the expression of phytase in the cytoplasm in a constitutive manner were carried out as follows:
- clonage du fragment Hind III de pBIOS 250 comportant le promoteur Actine - intron Actine (pAct) (Me Elroy et al. 1991 , M.G.G. 231 : 150- 160), dans pBIOS 256 restreint à Hind III. Le vecteur obtenu est appelé pBIOS 259 porteur du gène pAct - PHYT I - ter Nos ;- Cloning of the Hind III fragment of pBIOS 250 comprising the Actin promoter - Actin intron (pAct) (Me Elroy et al. 1991, M.G.G. 231: 150-160), in pBIOS 256 restricted to Hind III. The vector obtained is called pBIOS 259 carrying the pAct - PHYT I - ter Nos gene;
- clonage du fragment Bam HI / Nsi I (PHYT I - fragment ter Nos) de pBIOS 256, dans les sites Bam HI / Nsi I de pBIOS 220. Le plasmide pBIOS 220 est un construit comportant le promoteur 35S du CaMV et le terminateur Nos. Le vecteur obtenu est appelé pBIOS 264 porteur du gène p35S - PHYT I - ter Nos. δblbis) Construits porteurs des gènes PHYT I (phytase de classe I exprimée dans le cycloplasme de l'albumen du grain de maïs)- cloning of the Bam HI / Nsi I fragment (PHYT I - fragment Nos) of pBIOS 256, into the Bam HI / Nsi I sites of pBIOS 220. The plasmid pBIOS 220 is a construct comprising the 35S promoter of CaMV and the Nos terminator . The vector obtained is called pBIOS 264 carrying the p35S - PHYT I - ter Nos gene. δblbis) Constructed carrying the PHYT I genes (class I phytase expressed in the cycloplasm of the corn grain albumin)
Les constructions permettant l'expression de la phytase dans le cytoplasme de l'albumen ont été réalisées de la façon suivante : - clonage du fragment Bam HI / Nsi I de pBIOS 256 dans les sites BamHI / Nsi I de pDV 03000, plasmide contenant le promoteur HMWG (promoteur du gène d'une protéine de réserve du blé, la "High Molecular Weight Glutenin" ; Robert et al. 1989, The Plant Cell 1 : 569-578) et le terminateur Nos. Le vecteur obtenu est appelé pBIOS 258, porteur du gène pHMWG - PHYT I - ter Nos ;The constructions allowing the expression of the phytase in the cytoplasm of the endosperm were carried out as follows: - cloning of the Bam HI / Nsi I fragment from pBIOS 256 into the BamHI / Nsi I sites of pDV 03000, plasmid containing the HMWG promoter (promoter of the gene for a wheat storage protein, the "High Molecular Weight Glutenin"; Robert et al. 1989, The Plant Cell 1: 569-578) and the terminator Nos. The vector obtained is called pBIOS 258, carrying the pHMWG - PHYT I - ter Nos gene;
- clonage du fragment Hind III / Bam HI du plasmide pγ63 dérivé de celui décrit dans Reina et al. (1990, N.A.R. 18 : 6425-6426) comportant le promoteur γ-zeine, dans pBIOS 259 digéré à Hind III et Bam HI, substituant ainsi le promoteur Actine et l'intron Actine de riz. Le vecteur obtenu, porteur du gène pγ-zeine -- cloning of the Hind III / Bam HI fragment of the plasmid pγ63 derived from that described in Reina et al. (1990, N.A.R. 18: 6425-6426) comprising the promoter γ-zeine, in pBIOS 259 digested with Hind III and Bam HI, thus substituting the promoter Actin and the intron Actin of rice. The vector obtained, carrying the pγ-zeine gene -
PHYT I - ter Nos, est appelé pBIOS 263 ;PHYT I - ter Nos, is called pBIOS 263;
- de façon alternative le clonage sous le contrôle du promoteur γ-zeine peut être obtenu par le clonage du fragment Hind III / Sma I du plasmide pγ 63 comportant le promoteur γ-zeine, dans pBIOS 259 digéré à Hind III et Eco RV, substituant ainsi le promoteur Actine et l'intron actine de riz par le promoteur γ-zeine- alternatively, cloning under the control of the γ-zeine promoter can be obtained by cloning the Hind III / Sma I fragment of the plasmid pγ 63 comprising the γ-zeine promoter, in pBIOS 259 digested to Hind III and Eco RV, substituting thus the actin promoter and the rice actin intron by the γ-zeine promoter
Le vecteur obtenu, porteur du gène p γ zeine -PHYT I - ter Nos, est appelé pBIOS 263bis.The vector obtained, carrying the p γ zeine -PHYT I - ter Nos gene, is called pBIOS 263bis.
I.8b2) Construits porteurs des gènes Sec-PHYT I (phytase de classe I exprimée de façon constitutive dans l'espace extracellulaire)I.8b2) Constructs carrying the Sec-PHYT I genes (class I phytase constitutively expressed in the extracellular space)
Pour l'ajout du signal d'adressage extracellulaire, nous avons choisi d'utiliser celui porté par la "Pathogenesis Related Protein", PR-S homologue à la thaumatine du tabac (Comelissen et al. 1986, Nature 321 : 531-532). Les auteurs ont opté pour une stratégie de mutagénèse dirigée utilisant la PCR grâce au kit "Ex- Site™- PCR based Site-Directed Mutagenesis Kit" (Stratagène, La Jolla-USA) selon les recommandations du fournisseur.For the addition of the extracellular addressing signal, we have chosen to use that carried by the "Pathogenesis Related Protein", PR-S homologous to tobacco thaumatin (Comelissen et al. 1986, Nature 321: 531-532) . The authors opted for a directed mutagenesis strategy using PCR using the "Ex-Site ™ - PCR based Site-Directed Mutagenesis Kit" (Stratagene, La Jolla-USA) according to the supplier's recommendations.
Le plasmide pBIOS 256 sert de construction de base. Les oligonucléotides utilisés pour l'amplification sont les suivants :The plasmid pBIOS 256 serves as the basic construction. The oligonucleotides used for the amplification are the following:
- ol MUP1 : 5' CAT GAA CTT CCT CAA AAG TTT CCC CTT TTA TGC CTT CCT TTGTTT TGG CCA ATA CTT TGT AGC TGT TAC TCA TGC TGA CTC- ol MUP1: 5 'CAT GAA CTT CCT CAA AAG TTT CCC CTT TTA TGC CTT CCT TTGTTT TGG CCA ATA CTT TGT AGC TGT TAC TCA TGC TGA CTC
GGA AGG AGT AGC AGC AAA GGT GGC 3' (SEQ ID N° 6),GGA AGG AGT AGC AGC AAA GGT GGC 3 '(SEQ ID N ° 6),
- ol MUP2 : 5' GAT CAA ACA CTA AGC TCA ATA AGG ATG G 3'(SEQ ID N°- ol MUP2: 5 'GAT CAA ACA CTA AGC TCA ATA AGG ATG G 3' (SEQ ID N °
V)V)
Plusieurs plasmides recombinants triés par analyse de digestion restrictive ont été séquences avec le Reverse primer Un plasmide a été retenu et la structure du gène Sec-PHYT I a été confirmée par séquençage grâce à trois oligonucléotidesSeveral recombinant plasmids sorted by restrictive digestion analysis were sequenced with the Reverse primer A plasmid was retained and the structure of the Sec-PHYT I gene was confirmed by sequencing using three oligonucleotides
- M 13-20 primer- M 13-20 primer
- phy 5 (position 718 / 737 de phy SU) - phy 6 (position 816 / 797 de phy SU)- phy 5 (position 718/737 of phy SU) - phy 6 (position 816/797 of phy SU)
Le plasmide résultant de l'addition du signal d'excrétion et contenant la partie codante de la phytase de classe I fusionnée est appelée pBIOS 265.The plasmid resulting from the addition of the excretion signal and containing the coding part of the fused class I phytase is called pBIOS 265.
Lors du criblage des plasmides recombinants, le clone M2 n° 61 présentait l'addition parfaite de 60 nucléotides sur 76, définissant ainsi seulement une partie du signal d'excrétion. La séquence du reste de ce plasmide a révélé une substitution de base dans la partie codante (adénine à la place de guanine en position 853 de phySl 1 ) n'altérant pas l'acide aminé codé par le triplet d'acide nucléiques affecté. Elle a montré également l'addition d'un doublet TA dans le partie 3 ' non traduite, juste avant la queue polyadénylée (en position 1334 de phyS l 1 ) De façon alternative pour obtenir le gène Sec-Phyt I, le plasmide M2 n° 61 a été retenu comme matrice de base, pour ajouter la totalité du signal PR-S par une deuxième série d'expériences de mutagénèse dirigée. Les oligonucléotides utilisés pour l'amplification étaient les suivants :When screening for recombinant plasmids, clone M2 # 61 had the perfect addition of 60 of 76 nucleotides, thus defining only part of the shedding signal. The sequence of the rest of this plasmid revealed a basic substitution in the coding part (adenine in place of guanine at position 853 of phySl 1) not altering the amino acid coded by the affected nucleic acid triplet. It also showed the addition of a TA doublet in the 3 'untranslated part, just before the polyadenylated tail (in position 1334 of phyS l 1) Alternatively to obtain the Sec-Phyt I gene, the plasmid M2 n ° 61 was selected as the base matrix, to add the entire PR-S signal by a second series of site-directed mutagenesis experiments. The oligonucleotides used for the amplification were the following:
- ol MUP9 : 5'GGA AGT TCA TGG ATC AAA CAC TAA GCT CAA TAA G3 * (SEQ ID N° 8) -- ol MUP9: 5'GGA AGT TCA TGG ATC AAA CAC TAA GCT CAA TAA G3 * (SEQ ID N ° 8) -
- ol MUT 10 : 5' TTA AGA GTT TCC CCT TTT ATG CCT TCC TTT G 3' (SEQ ID N° 9)- ol MUT 10: 5 'TTA AGA GTT TCC CCT TTT ATG CCT TCC TTT G 3' (SEQ ID N ° 9)
(Les 15 nucléotides à rajouter sont portés par les deux oligonucléotides)(The 15 nucleotides to be added are carried by the two oligonucleotides)
200 ng de matrice, 50 pmol des oligonucléotides MUP9 et MU 10, 10 nmol de chaque dNTP (Pharmacia, Uppsala, Sweden), 2 unités de Vent DNA polymerase200 ng of matrix, 50 pmol of the oligonucleotides MUP9 and MU 10, 10 nmol of each dNTP (Pharmacia, Uppsala, Sweden), 2 units of Vent DNA polymerase
(New England Biolabs, Ma USA), dans son tampon pour un volume réactionnel de 50 μl ont été soumis aux paramètres d'amplification décrits ci-après (Perkin Elmer Cetus 9600 PCR, New Jersey USA) : 4 cycles - 1 min 95°C - 1 min 54°C(New England Biolabs, Ma USA), in its buffer for a reaction volume of 50 μl were subjected to the amplification parameters described below (Perkin Elmer Cetus 9600 PCR, New Jersey USA): 4 cycles - 1 min 95 ° C - 1 min 54 ° C
- 4 min 72°C 21 cycles - 40 sec 94°C- 4 min 72 ° C 21 cycles - 40 sec 94 ° C
- 1 min 61°C- 1 min 61 ° C
- 4 min 72°C 1 cycle - 2 min 72°C- 4 min 72 ° C 1 cycle - 2 min 72 ° C
La totalité du produit d'amplification a été déposée sur gel d'agarose 1 %. La bande correspondant au plasmide mutagéneisé a été découpée puis éluée (Système Micropure 0,22 + Microcon 50 de Amicon, Ma USA). Le produit purifié a été ligasé 16h à 12°C avec 3 unités de T4 DNA LigaseThe entire amplification product was deposited on 1% agarose gel. The band corresponding to the mutagenized plasmid was cut and then eluted (Micropure 0.22 + Microcon 50 System from Amicon, Ma USA). The purified product was ligated for 16 h at 12 ° C. with 3 units of T4 DNA Ligase
(Promega, WI USA), dans un volume réactionnel de 10 μl. Le plasmide a ensuite été transformé dans la souche Escherichia coli XLl Blue selon les recommandations du fournisseur (Epicurian Coli® XLl-BLUE Supercompetent Cells 200236, Stratagène, LaJolla USA). Plusieurs plasmides recombinants triés par analyse de digestion restrictive ont été séquences avec le Reverse primer.(Promega, WI USA), in a reaction volume of 10 μl. The plasmid was then transformed into the Escherichia coli XLl Blue strain according to the recommendations of the supplier (Epicurian Coli® XLl-BLUE Supercompetent Cells 200236, Stratagene, LaJolla USA). Several recombinant plasmids sorted by restrictive digestion analysis were sequenced with the Reverse primer.
Un plasmide a été retenu et la structure du gène Sec-PHYT I a été confirmée par séquençage grâce à trois oligonucléotides : - Ml 3-20 primer, - phy5 (position 718/737 de phyS l 1),A plasmid was retained and the structure of the Sec-PHYT I gene was confirmed by sequencing using three oligonucleotides: - Ml 3-20 primer, - phy5 (position 718/737 of phyS l 1),
- phy6 (position 816/797 de phy S I 1).- phy6 (position 816/797 of phy S I 1).
Le plasmide résultant de l'addition du signal d'excrétion et contenant la partie codante de la phytase de classe I fusionnée est appelé pBIOS 265 bis.The plasmid resulting from the addition of the excretion signal and containing the coding part of the fused class I phytase is called pBIOS 265 bis.
La construction permettant une expression constitutive de la phytase excrétée a été obtenue de la manière suivante :The construction allowing a constitutive expression of the excreted phytase was obtained in the following way:
- clonage du fragment Hind III de pBIOS 250 comportant le promoteur Actine et l'intron Actine, dans le site Hind III de pBIOS 265. Ce vecteur a été appelé pBIOS 268 et il porte le gène chimérique pAct - Sec-PHYT I - ter Nos.- cloning of the Hind III fragment from pBIOS 250 comprising the promoter Actin and the intron Actin, into the Hind III site of pBIOS 265. This vector was called pBIOS 268 and it carries the chimeric gene pAct - Sec-PHYT I - ter Nos .
De façon alternative, la construction permettant une expression constitutive de la phytase excrétée a été obtenue de la manière suivante :Alternatively, the construction allowing a constitutive expression of the excreted phytase was obtained in the following way:
- clonage, par substitution, du fragment EcoRV / Ncol de p BIOS 265 bis comportant le signal d'excrétion et l'extrémité 5' de la partie codante de la phytase de classe I, dans les sites EcoRV / Ncol de pBIOS 259. Ce vecteur a été appelé pBIOS 268 bis et il porte le gène chimérique p Act -Sec-PHYT I- ter Nos. I.8b2bis) Construits porteurs des gènes Sec-PHYT I (phytase de classe I exprimée dans l'espace extracellulaire de l'albumen du grain de maïs) Les constructions permettant une expression dans l'albumen de la phytase excrétée ont été obtenues de la manière suivante : - clonage du fragment Hind III / Bam HI de pγ63 comportant le promoteur γ-zein dans les sites Hind III et Bam HI de pBIOS 265. Ce vecteur est appelé pBIOS 269 et il porte le gène chimérique pγ-zein - Sec-PHYT I - ter Nos. - clonage du fragment Bam HI / Nsi I de pBIOS 265 comportant Sec-PHYT I et une partie du terminateur Nos dans les sites Bam HI / Nsi I de pDV 03000 Ce vecteur est appelé pBIOS 270 et il porte le gène chimérique pHMWG - Sec-PHYT I - ter Nos.cloning, by substitution, of the EcoRV / Ncol fragment from p BIOS 265 bis comprising the excretion signal and the 5 ′ end of the coding part of the class I phytase, into the EcoRV / Ncol sites of pBIOS 259. This vector was called pBIOS 268 bis and it carries the chimeric gene p Act -Sec-PHYT I- ter Nos. I.8b2bis) Constructs carrying the Sec-PHYT I genes (class I phytase expressed in the extracellular space of the corn grain albumin) The constructions allowing expression in the albumin of the excreted phytase were obtained from the as follows: - cloning of the Hind III / Bam HI fragment from pγ63 comprising the γ-zein promoter into the Hind III and Bam HI sites of pBIOS 265. This vector is called pBIOS 269 and it carries the chimeric pγ-zein - Sec- gene PHYT I - ter Nos. - cloning of the Bam HI / Nsi I fragment from pBIOS 265 comprising Sec-PHYT I and part of the Nos terminator into the Bam HI / Nsi I sites of pDV 03000 This vector is called pBIOS 270 and it carries the chimeric gene pHMWG - Sec- PHYT I - ter Nos.
De façon alternative, les constructions permettant une expression dans l'albumen de la phytase excrétée ont été obtenues de la manière suivanteAlternatively, the constructs allowing expression in the albumen of the excreted phytase were obtained in the following manner
- Clonage, par substitution, du fragment BamHI / Ncol de pBIOS 265 bis comportant le signal d'excrétion et l'extrémité 5' de la partie codante de la phytase de classe I, dans les sites BamHI et Ncol de pBIOS 263 bis Ce vecteur est appelé pBIOS 269 bis et il porte le gène chimérique p γ zeine - Sec-PHYT I - ter Nos- Cloning, by substitution, of the BamHI / Ncol fragment from pBIOS 265 bis comprising the excretion signal and the 5 ′ end of the coding part of the class I phytase, into the BamHI and Ncol sites of pBIOS 263 bis This vector is called pBIOS 269 bis and it carries the chimeric gene p γ zeine - Sec-PHYT I - ter Nos
- Clonage, par substitution, du fragment EcoRI / Smal de pBIOS 265 bis comportant le signal d'excrétion et l'extrémité 5' de la partie codante de la phytase de classe I, dans les sites EcoRI et S al de pBIOS 258 Ce vecteur est appelé pBIOS 270 bis et il porte le gène chimérique pHMWG- Sec-PHYT I- ter Nos 1.9) Evaluation de l'activité promotrice par analyse de l'activité transitoire- Cloning, by substitution, of the EcoRI / Smal fragment of pBIOS 265 bis comprising the excretion signal and the 5 ′ end of the coding part of the class I phytase, into the EcoRI and S al sites of pBIOS 258 This vector is called pBIOS 270 bis and it carries the chimeric gene pHMWG- Sec-PHYT I- ter Nos 1.9) Evaluation of the promoter activity by analysis of the transient activity
Une étude de l'activité promotrice peut être avantageusement réalisée en introduisant, par la méthode du canon à particule, dans des cellules issues du tissu où cette activité est recherchée, la zone promotrice à évaluer fusionnée a un gène rapporteur dont l'activité est facilement décelable Le gène GUS (E coli β- glucuronidase) peut être utilisé à cet effet Chaque cellule ayant reçu ce gène chimérique dans des conditions permettant son expression, produit la protéine β- glucuronidase Cette protéine peut être aisément détectée in situ 48 h après bombardement par la méthode décrite par Jefferson (1987, Plant Mol Biol Report , 5(4) 387 405) Les cellules produisent alors un pigment bleu qui permet leur observation Si le promoteur est actif dans le tissu bombardé et au stade considère, plusieurs dizaines de cellules a la surface de l'expiant vont acquérir cette couleur bleue Aucun spot ne sera visible si le promoteur est inactif dans les conditions utilisées Des grains de mais sont stérilises par immersion de 20' dans une solution saturée en Hypochlorite de calcium, puis mis a germer en condition stéπle entre deux feuilles de papier buvard imbibées d'eau et placées à 25°C 1 jour, 3 jours et 4 jours après germination les grains sont dissèques de façon a placer sur un milieu gélose de bombardement, des fragments de tissus tels que aleurone, scutellum, épicotyle et mésocotyle. Le milieu de bombardement peut être par exemple composé de 0,2 M de Mannitol et de 0,2 M de Sorbitol solidifié avec 8 g/1 d'Agar. Les tissus sont ensuite bombardés. Les plasmides contenant le promoteur à étudier fusionné au gène GUS sont purifiés sur colonne Qiagen® en suivant les instructions du fabricant Ils sont ensuite précipités sur des particules de tungstène (M10) en suivant le protocole décrit par Klein (1987, Nature 327 : 70-73). Les particules ainsi enrobées sont projetées vers les cellules cibles à l'aide du canon. L'optimisation des conditions de bombardement peut dépendre du type d'appareil utilisé et fait partie des techniques normalement maîtrisées par l'homme de l'art. Quarante-huit heures après le bombardement, les tissus sont colorés comme décrit par Jefferson puis observésA study of the promoter activity can advantageously be carried out by introducing, by the particle gun method, into cells originating from the tissue where this activity is sought, the promoter zone to be evaluated fused to a reporter gene whose activity is easily detectable The GUS gene (E coli β-glucuronidase) can be used for this purpose Each cell having received this chimeric gene under conditions allowing its expression, produces the protein β-glucuronidase This protein can be easily detected in situ 48 h after bombardment by the method described by Jefferson (1987, Plant Mol Biol Report, 5 (4) 387 405) The cells then produce a blue pigment which allows their observation If the promoter is active in the bombarded tissue and at the stage considered, several tens of cells has the surface of the explant will acquire this blue color No spot will be visible if the promoter is inactive under the conditions used corn grains are sterilized by immersion of 20 'in a saturated solution of calcium hypochlorite, then put to germinate in stéπle condition between two sheets of blotting paper soaked in water and placed at 25 ° C 1 day, 3 days and 4 days after germination the grains are dissected so as to place on an agar medium of bombardment, tissue fragments such as aleurone, scutellum, epicotyle and mesocotyle. The bombardment medium can for example be composed of 0.2 M of Mannitol and 0.2 M of Sorbitol solidified with 8 g / l of Agar. The fabrics are then bombarded. The plasmids containing the promoter to be studied fused to the GUS gene are purified on a Qiagen® column according to the manufacturer's instructions. They are then precipitated on tungsten particles (M10) according to the protocol described by Klein (1987, Nature 327: 70- 73). The particles thus coated are projected towards the target cells using the cannon. Optimization of the bombardment conditions may depend on the type of aircraft used and is one of the techniques normally mastered by those skilled in the art. Forty-eight hours after the bombing, the fabrics are stained as described by Jefferson and then observed
1.10) Production de maïs transgéniques1.10) Production of transgenic corn
HOa) Méthode de transformation génétiqueHOa) Method of genetic transformation
La transformation génétique du maïs, quelle que soit la méthode employéeThe genetic transformation of corn, whatever the method used
(électroporation, Agrobacterium, microfibres, canon à particules) requiert généralement l'utilisation de cellules indifférenciées en divisions rapides ayant conservé une aptitude à la régénération de plantes entières Ce type de cellules compose le cal friable embryogène (dit de type II) de mais(electroporation, Agrobacterium, microfibers, particle gun) generally requires the use of undifferentiated cells in rapid divisions having retained an ability to regenerate whole plants. This type of cell makes up the friable embryogenic callus (type II) of corn
Ces cals sont obtenus à partir d'embryons immatures de génotype Hi II ouThese calluses are obtained from immature embryos of genotype Hi II or
A 188 x B73 selon la méthode et sur les milieux décrits par Armstrong (in The Maize Handbook , 1994, M Freeling, V Walbot Eds , pp 665 671), les cals ainsi obtenus peuvent être multipliés et maintenus par repiquages successifs tous les 15 jours sur le milieu d'initiationAt 188 x B73 according to the method and on the media described by Armstrong (in The Maize Handbook, 1994, M Freeling, V Walbot Eds, pp 665 671), the calluses thus obtained can be multiplied and maintained by successive subcultures every 15 days on the initiation environment
Des plantules sont régénérées à partir de ces cals en modifiant l'équilibre hormonal et osmotique des cellules selon la méthode décrite par Vain et al (1989, Plant Cell Tissue and Organ Culture 18 : 143-151). Ces plantes sont ensuite acclimatées en serre où elles peuvent être croisées ou auto-fécondéesPlantlets are regenerated from these calluses by modifying the hormonal and osmotic balance of the cells according to the method described by Vain et al (1989, Plant Cell Tissue and Organ Culture 18: 143-151). These plants are then acclimatized in the greenhouse where they can be crossed or self-fertilized
On utilise une méthode de transformation génétique conduisant à l'intégration stable des gènes modifiés dans le génome de la plante Cette méthode repose sur l'utilisation d'un canon à particules. Les cellules cibles sont des fragments de cals d'une surface de 10 à 20 mm2 Ils sont disposés, 4 h avant bombardement, à raison de 16 fragments par boîte, au centre d'une boîte de pétri contenant un milieu de culture identique au milieu d'initiation, additionné de 0,2 M de mannitol + 0,2 M de sorbitol Les tissus sont ensuite bombardés comme décrit précédemment Les boîtes de cals ainsi bombardés sont ensuite scellées à l'aide deWe use a genetic transformation method leading to the stable integration of the modified genes into the plant genome. This method is based on the use of a particle gun. The target cells are callus fragments with a surface of 10 to 20 mm 2 They are placed, 4 h before bombardment, at the rate of 16 fragments per dish, in the center of a petri dish containing a culture medium identical to the initiation medium, supplemented with 0.2 M mannitol + 0.2 M sorbitol The tissues are then bombarded as described above The boxes of calluses thus bombarded are then sealed using
Scellofrais® puis cultivées à l'obscurité à 27°C. Le premier repiquage a lieu 24 h après, puis tous les 15 jours pendant 3 mois sur milieu identique au milieu d'initiation additionné d'un agent sélectif dont la nature et la concentration peuvent varier selon le gène utilisé. Les agents sélectifs utilisables sont généralement des composés actifs de certains herbicides (Basta®, Round up®) ou certains antibiotiques (Hygromycine,Scellofrais® then grown in the dark at 27 ° C. The first subculturing takes place 24 hours later, then every two weeks for 3 months on medium identical to the initiation medium supplemented with a selective agent, the nature and concentration of which may vary depending on the gene used. The selective agents which can be used are generally active compounds of certain herbicides (Basta®, Round up®) or certain antibiotics (Hygromycin,
Kanamycine,).Kanamycin,).
Il apparaît après 3 mois ou parfois plus tôt, des cals dont la croissance n'est pas inhibée par l'agent sélectif, ceux-ci sont habituellement et majoritairement composés de cellules résultant de la division d'une cellule ayant intégré dans son patrimoine génétique une ou plusieurs copies du gène de sélection. La fréquence d'obtention de tels cals est d'environ 0,8 cals par boîte bombardée.It appears after 3 months or sometimes earlier, calluses whose growth is not inhibited by the selective agent, these are usually and mainly composed of cells resulting from the division of a cell having integrated into its genetic heritage one or more copies of the selection gene. The frequency of obtaining such calluses is approximately 0.8 calluses per bombarded box.
Ces cals sont identifiés, individualisés, amplifiés puis cultivés de façon à régénérer des plantuies. Afin d'éviter toute interférence avec des cellules non transformées, toutes ces opérations sont menées sur des milieux de culture contenant l'agent sélectif.These calluses are identified, individualized, amplified and then cultivated so as to regenerate the plants. In order to avoid any interference with untransformed cells, all of these operations are carried out on culture media containing the selective agent.
Les plantes ainsi régénérées sont acclimatées puis cultivées en serre où elles peuvent être croisées ou autofécondées.The plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized.
I.10b) Utilisation du gène Bar pour la sélectionI.10b) Use of the Bar gene for selection
Le gène Bar de Streptomyces hygroscopicus code pour une phosphinothricine acyl transférase (PAT) qui inactive par acétylation la phosphinotricine - molécule active de l'herbicide Basta®. Les cellules portant ce gène sont donc rendues résistantes à cet herbicide et peuvent être sélectionnées par son intermédiaire.The Bar gene from Streptomyces hygroscopicus codes for a phosphinothricin acyl transferase (PAT) which inactivates acetylation of phosphinotricin - the active molecule of the herbicide Basta®. The cells carrying this gene are therefore made resistant to this herbicide and can be selected through it.
Pour la transformation des céréales, la séquence codante du gène Bar est sous le contrôle d'une région régulatrice permettant une expression forte et constitutive dans les cellules végétales. Une telle région peut avantageusement être constituée par le promoteur et le premier intron du gène Actine de riz tels que décrits par Mc Elroy (1991 , Mol. Gen. Genêt. 231 : 150-160).For the transformation of cereals, the coding sequence of the Bar gene is under the control of a regulatory region allowing a strong and constitutive expression in plant cells. Such a region can advantageously consist of the promoter and the first intron of the rice Actin gene as described by Mc Elroy (1991, Mol. Gen. Genêt. 231: 150-160).
Ce gène chimérique est clone sur un plasmide permettant son amplification par Escherichia coli. Ce plasmide pDM 302 Cao ( 1992, Plant CellThis chimeric gene is cloned on a plasmid allowing its amplification by Escherichia coli. This plasmid pDM 302 Cao (1992, Plant Cell
Report 1 1 : 586-591), après amplification puis purification sur colonne Qiagen®' peut être utilisé en transformation génétique du maïs en utilisant par exemple la méthode décrite précédemment. Dans ce cas les milieux de cultures destinés à la sélection des cellules transformées sont additionnés de 2mg/l de Phosphinothricine.Report 1 1: 586-591), after amplification then purification on a Qiagen® 'column can be used in genetic transformation of corn using for example the method previously described. In this case, the culture media intended for the selection of the transformed cells are added with 2 mg / l of Phosphinothricin.
Pour l'introduction des construits phytase devant conduire à une expression ectopique des protéines issues des gènes PHYT I et Sec-PHYT I, une technique dite de cotransformation peut avantageusement être utilisée. On procède à une coprécipitation des deux plasmides (le plasmide porteur du gène de sélection et l'un des différents plasmides "phytase") sur les particules de tungstène, la quantité totale d'ADN précipité sur les particules restant identique à ce qu'elle est dans le protocole standard (5 μg d'ADN pour 2,5 mg de particules) chaque plasmide représentera environ la moitié du total d'ADN utilisé. L'expérience montre qu'avec cette méthode, la cointégration des plasmides dans les cellules végétales est l'événement le plus fréquent (de l'ordre deFor the introduction of the phytase constructs which should lead to ectopic expression of the proteins derived from the PHYT I and Sec-PHYT I genes, a so-called cotransformation technique can advantageously be used. The two plasmids (the plasmid carrying the selection gene and one of the different "phytase" plasmids) are coprecipitated on the tungsten particles, the total amount of DNA precipitated on the particles remaining identical to what it is in the standard protocol (5 μg of DNA for 2.5 mg of particles) each plasmid will represent approximately half of the total DNA used. Experience shows that with this method, cointegration of plasmids in plant cells is the most frequent event (of the order of
90 %) c'est-à-dire que pratiquement chaque plante ayant intégré le gène Bar et ayant été sélectionnée par son intermédiaire portera aussi le gène "phytase". Ainsi, le pourcentage de plantes sélectionnées exprimant le gène "phytase" est d'environ 70 %. Les gènes ainsi introduits sont généralement liés au sens génétique, le gène "phytase" peut ainsi avantageusement être suivi dans les descendances grâce à la résistance à l'herbicide qui lui est étroitement associée.90%), that is to say that practically each plant which has integrated the Bar gene and which has been selected through it will also carry the "phytase" gene. Thus, the percentage of selected plants expressing the "phytase" gene is around 70%. The genes thus introduced are generally linked to the genetic sense, the "phytase" gene can thus advantageously be followed in the progenies thanks to the resistance to the herbicide which is closely associated with it.
1.11) Amplification des gènes de phytase par RT-PCR1.11) Amplification of phytase genes by RT-PCR
Chaque RT-PCR est réalisée sur 10 mg de RNAs totaux préalablement traités durant 1 heure à 37°C par la DNase-RNase free (Boehringer) en présence deEach RT-PCR is carried out on 10 mg of total RNAs previously treated for 1 hour at 37 ° C. with DNase-RNase free (Boehringer) in the presence of
RNasine (Boehringer), dans le but d'éliminer d'éventuelles contaminations par de l'ADN génomique. Les RNAs sont ensuite déprotéinisés par un traitement au phénol- chloroforme et précipités.RNasin (Boehringer), in order to eliminate possible contamination by genomic DNA. The RNAs are then deproteinized by treatment with phenol-chloroform and precipitated.
La synthèse du brin de cDNA complémentaire des RNAs phytases est réalisée pendant 30 min à 37°C en présence de transcriptase réverse (BRL). La transcription est initiée par un oligonucleotide «D« complémentaire d'une séquence commune aux deux gènes hybridant 546 bp en aval de l'ATG pour le gène I et 552 bp en aval de l'ATG pour le gène II. La séquence de l'oligo «D» est la suivante : CTGGGAGTAGGCGCGGGAGTG (SEQ ID N° 15). Les amplifications sont réalisées sur une fraction de la réverse transcription, en présence d'un oligonucleotide «C» : GCTGTAGCAGTCGCTCACCG (SEQ ID N° 14), commun aux deux gènes et hybridant 214 bp en aval de l'ATG pour le gène I et 220 bp en aval pour le gène II. Les deuxièmes oligonuclétides utilisés débutent à l'ATG initiateur et sont spécifiques de chaque gène. L'oligo «A», complémentaire du gène I, à la séquence suivante : ATGGACTCGGAAGGAGTAGC (SEQ ID N° 12) et l'oligo «B» complémentaire du gène II à la séquence : ATGGACTCGGAAGGAGTTGT (SEQ ID N° 13);The synthesis of the cDNA strand complementary to the RNAs phytases is carried out for 30 min at 37 ° C. in the presence of reverse transcriptase (BRL). Transcription is initiated by an oligonucleotide "D" complementary to a sequence common to the two genes hybridizing 546 bp downstream of ATG for gene I and 552 bp downstream of ATG for gene II. The sequence of oligo "D" is as follows: CTGGGAGTAGGCGCGGGAGTG (SEQ ID No. 15). The amplifications are carried out on a fraction of the reverse transcription, in the presence of an oligonucleotide "C": GCTGTAGCAGTCGCTCACCG (SEQ ID N ° 14), common to both genes and hybridizing 214 bp downstream of ATG for gene I and 220 bp downstream for gene II. The second oligonucleotides used start at the initiating ATG and are specific for each gene. The oligo "A", complementary to gene I, to the following sequence: ATGGACTCGGAAGGAGTAGC (SEQ ID No. 12) and the oligo "B" complementary to gene II to the sequence: ATGGACTCGGAAGGAGTTGT (SEQ ID No. 13);
Les conditions de PCR sont les suivantes : 94°C, 1 min ; 60°C, 1 min ; 72°C, 1 min, répétées 30 fois. Les produits de PCR sont analysés sur gel d'agarose à 2The PCR conditions are as follows: 94 ° C, 1 min; 60 ° C, 1 min; 72 ° C, 1 min, repeated 30 times. PCR products are analyzed on agarose gel at 2
%.%.
1.12) Disponibilité du phosphore de maïs transgéniques exprimant ectopiquement la phytase1.12) Availability of transgenic corn phosphorus ectopically expressing phytase
Ces maïs transgéniques ont été cultivés au champ, et des quantités de l'ordre de 16 kg par lot ont été récoltées.These transgenic maize were cultivated in the field, and quantities of the order of 16 kg per batch were harvested.
L'étudezootechnique consiste à étudier la disponibilité du phosphore de ces maïs chez le poulet de chair. On retient pour cela deux critères biologiques de mesures : rétention ou bilan digestif du phosphore et minéralisation osseuse.The technical study consists in studying the availability of phosphorus from these corn in broiler chickens. Two biological measurement criteria are retained for this: phosphorus retention or digestive balance and bone mineralization.
Sur les lots de maïs testés ont été analysées leurs teneurs en phosphore (P) total, en P phytique, ainsi que leur activité phytasique selon une adaptation de la méthode de Bitar et Reinhold (1972).The lots of corn tested were analyzed for their total phosphorus (P) and phytic P content, as well as their phytase activity according to an adaptation of the method of Bitar and Reinhold (1972).
Chaque régime est composé de 3 parties : une base, la source de phosphore à tester et une partie d'ajustement.Each diet is made up of 3 parts: a base, the phosphorus source to be tested and an adjustment part.
La base est commune à tous les régimes , elle assure une apport minimum et constant de phosphore et de protéines, ainsi que les oligo-éléments et vitamines nécessaires pour couvrir les besoins des animauxThe base is common to all diets, it ensures a minimum and constant intake of phosphorus and proteins, as well as the trace elements and vitamins necessary to cover the needs of the animals.
La source de phosphore à tester est constituée par les différents lots de mais selon l'invention ou bien par le phosphate monocalcique de référenceThe phosphorus source to be tested consists of the different lots of corn according to the invention or else the reference monocalcium phosphate
(digestibilité de 100 %).(100% digestibility).
Les lots à tester sont introduits à raison d'environ 50 %, de manière à ce que la quantité de phosphoie à tester soit identique pour tous les régimes, et le phosphore monocalcique à 3 taux : 0 ; 0,45 et 0,90 %) La partie d'ajustement est constituée de matières premières n'apportant pas de phosphore (amidon de mais, acides aminés, huile, calcium, cellulose) et permet d'équilibrer les régimes en acides aminés, en énergie et en calcium Seul le phosphore des régimes expérimentaux est très en-dessous des recommendations pour le poulet de cet âge (sinon relargage de P dans les urines qui sont mélangées avec les fécès, et impossibilité de mesurer la digestibilité du P)The batches to be tested are introduced at the rate of approximately 50%, so that the quantity of phosphorus to be tested is identical for all the regimes, and the monocalcic phosphorus at 3 rates: 0; 0.45 and 0.90%) The adjustment part is made up of raw materials which do not provide phosphorus (corn starch, amino acids, oil, calcium, cellulose) and helps to balance the amino acid, energy and calcium regimes Only the phosphorus of experimental diets are far below the recommendations for chicken of this age (otherwise release of P in the urine which is mixed with the feces, and impossibility of measuring the digestibility of P)
Les régimes ont été granulés à la vapeur (presse La Meccanica, type CLM 200, filière de 2,5 mm x 35 mm)The bunches were steam granulated (La Meccanica press, type CLM 200, 2.5 mm x 35 mm die)
Pour tester l'influence du process, certains régimes ont été testés à la fois en farine, en granules (température du process de l'ordre de 60°C) et en granulés avec des températures de l'ordre de 75°CTo test the influence of the process, certain regimes have been tested in flour, granules (process temperature of around 60 ° C) and granules with temperatures of around 75 ° C
Chaque régime expérimental est testés sur 8 répétitions ou cages de 2 poulets mâles ISA JV15 de même poids La conduite expérimentale est celle décrite par Bruno Bamer-Guillot et al (1994)Each experimental diet is tested on 8 repetitions or cages of 2 ISA JV15 male chickens of the same weight The experimental procedure is that described by Bruno Bamer-Guillot et al (1994)
Les lots expérimentaux sont constitués de - un mais témoin seul , un mais témoin additionné de 500 Unîtes (UP) de phytase microbienne , une mais additionne de 1000 Unités (UP) de phytase microbienne , les lots de mais transgéniques selon l'invention Les aliments expérimentaux sont distribués à volonté de J14 à J25 La collecte de fientes s'effectue toutes les 24 heures pendant trois jours de J22 à J25 Les excréta sont regroupés par cage Ils sont ensuite congelés à - 20°C, puis lyophilisés pendant 72 heures avant d'être broyés Un échantillon par cage est ensuite prélevé pour la détermination de la teneur en phosphore total A J25, les poulets sont sacrifiés et les deux phalanges centrales du doigt majeur de chaque patte sont prélevées pour la détermination du taux de cendresThe experimental batches consist of - one but only control, one but control supplemented with 500 Units (UP) of microbial phytase, one but adds 1000 Units (UP) of microbial phytase, the batches of transgenic corn according to the invention Food are distributed at will from D14 to D25 The collection of droppings is carried out every 24 hours for three days from D22 to D25 The excreta are grouped by cage They are then frozen at - 20 ° C, then lyophilized for 72 hours before d '' to be ground A sample per cage is then taken for the determination of the total phosphorus content On D25, the chickens are sacrificed and the two central phalanges of the middle finger of each leg are taken for the determination of the ash rate
La disponibilité in vivo du P est appréciée selon deux critères, soit par la mesure du P retenu par l'animal (bilan digestif), soit par le test de minéralisation osseuse (Sauveur, 1983) Sur chacun des régimes est mesuré le coefficient de rétention du phosphore (CR P) Le CR P des différents mais expérimentaux est ensuite calculé par différence avec le CR P de la base mesuré sur le régime constitué uniquement de la base et de la partie d'ajustementThe in vivo availability of P is assessed according to two criteria, either by measuring the P retained by the animal (digestive assessment), or by the bone mineralization test (Sauveur, 1983) The phosphorus retention coefficient (CR P) is measured on each of the regimes. The CR P of the different but experimental ones is then calculated by difference with the CR P of the base measured on the regime consisting solely of the base and the part of adjustment
La disponibilité du phosphore des mais expérimentaux mesurée par le test de minéralisation osseuse est calculée par le rapport entre la quantité de cendres obtenues avec le régime contenant la matière première, et la quantité de cendres obtenue avec les régimes contenant le phosphore monocalcique (calculée par régression à l'aide des 3 régimes de cette gamme étalon pour une même quantité de phosphore ingérée) 1.13) Dosage de l'activité phytasiqueThe availability of phosphorus from experimental maize measured by the bone mineralization test is calculated by the ratio between the amount of ash obtained with the diet containing the raw material, and the amount of ash obtained with the plans containing monocalcium phosphorus (calculated by regression using the 3 diets of this standard range for the same amount of phosphorus ingested) 1.13) Determination of phytase activity
I.13.a) Extraction des protéines de maïs en vue des dosages d'activité phytaseI.13.a) Extraction of corn proteins for phytase activity assays
Un gramme de matériel congelé (feuilles ou graines de mais transgéniques et jeunes plantules de mais non transgénique - germination âgées de 5 ou 6 jours- ) est broyé à l'état de poudre dans l'azote liquide Le matériel broyé est transféré dans 10 ml de tampon d'extraction (100 mM acétate de sodium, pH 4,8, 2 mM CaCl ,l mM DTT, 0,5 à 1 mM Pefablock SC, antiprotéase (Interchim, Montluçon)) Les échantillons sont agites énergiquement pendant 15 minutes au froid et les extraits sont centrifugés 20 min à 8000 rpm (Sorvall, SS34) Les surnageants sont récupérés et éventuellement filtres sur miracloth Ensuite les protéines sont précipitées par addition de SO4 (NH4)2 à 60 % de la saturation à 0°C cette précipitation est indispensable, sinon le phosphate provenant des graines et contenu dans les extraits interfère avec le dosage Les culots protéiques sont repris dans 2 ml de tampon acétate 50 mM, pH 4,8 et après resuspension, mis à dialyser sur la nuit contre 3 fois 100 ml du même tampon Les protéines insolubles après dialyse sont éliminées par centrifugation (on a vérifié que ces précipités ne contenaient pas de phytase) L'activité est mesurée sur le surnageantOne gram of frozen material (transgenic maize leaves or seeds and young non-transgenic maize seedlings - germination 5 or 6 days old) is ground to powder in liquid nitrogen The ground material is transferred into 10 ml extraction buffer (100 mM sodium acetate, pH 4.8, 2 mM CaCl, 1 mM DTT, 0.5 to 1 mM Pefablock SC, antiprotease (Interchim, Montluçon)) The samples are stirred vigorously for 15 minutes at cold and the extracts are centrifuged for 20 min at 8000 rpm (Sorvall, SS34) The supernatants are recovered and optionally filtered on a miracloth Then the proteins are precipitated by addition of SO4 (NH4) 2 at 60% of the saturation at 0 ° C. this precipitation is essential, otherwise the phosphate from the seeds and contained in the extracts interferes with the dosage. The protein pellets are taken up in 2 ml of 50 mM acetate buffer, pH 4.8 and after resuspension, put to dialyse overnight. 3 times 100 ml of the same buffer The insoluble proteins after dialysis are removed by centrifugation (it has been checked that these precipitates do not contain phytase) The activity is measured on the supernatant
I.13.b) Mesures d'activité phytase Il s'agit de la méthode de Gibson et Ullah, légèrement modifiée (Arch Biochem Biophys , 1988, 260, 503-513) L'activité est mesurée a 55°C Chaque tube eppendorf (l ml) contient 450 ml acétate de sodium 50 mM, pH 4,8, 2 mM sodium phytate et 2 mM CaC12. On ajoute l'extrait à tester, 50 ml dans acétate de sodium 50 mM, pH 4,8 ; après 1 h d'incubation à 55°C, le phosphate inorganique libéré est mesuré de la façon suivante : on ajoute à chaque tupe 750 ml du mélange : acétone : 5N SO^ : 10 mM ammonium molybdate (2: 1 : 1) et 50 ml d'acide citrique 1M. Après homogénéisation au vortex, les tubes sont centrifugés 3 min à 3000XG pour éliminer tout précipité dû à l'acétone.I.13.b) Measures of phytase activity This is the Gibson and Ullah method, slightly modified (Arch Biochem Biophys, 1988, 260, 503-513) The activity is measured at 55 ° C. Each eppendorf tube (l ml) contains 450 ml 50 mM sodium acetate, pH 4.8, 2 mM sodium phytate and 2 mM CaC12. The test extract is added, 50 ml in 50 mM sodium acetate, pH 4.8; after 1 h of incubation at 55 ° C., the released inorganic phosphate is measured as follows: 750 ml of the mixture are added to each tupe: acetone: 5N SO 4: 10 mM ammonium molybdate (2: 1: 1) and 50 ml citric acid 1M. After homogenization with a vortex, the tubes are centrifuged for 3 min at 3000XG to remove any precipitate due to acetone.
Pour chaque essai un témoin identique est gardé à 0°C pendant l'heure d'incubation. Ce témoin utilisé comme zéro, permet d'éliminer les absorbances possibles dues aux extraits. L'absorbance est mesurée à 355 nm. La quantité de phosphate est évaluée à l'aide d'une courbe standard établie entre 2,5 et 200 nmoles de phosphate.For each test, an identical control is kept at 0 ° C. during the hour of incubation. This control, used as zero, eliminates the possible absorbances due to the extracts. The absorbance is measured at 355 nm. The amount of phosphate is evaluated using a standard curve established between 2.5 and 200 nmol of phosphate.
L'activité est exprimée en nmoles de phosphate libérées en 1 heure à 55°C, par mg de protéines. Les protéines sont dosées sur les extraits par la méthode classique de Bradford.The activity is expressed in nmoles of phosphate released in 1 hour at 55 ° C, per mg of protein. The proteins are dosed on the extracts by the classic Bradford method.
H. RESULTATS π.l) Isolement et caractérisation d'un ADNc codant pour une phytase de jeunes plants de maïsH. RESULTS π.l) Isolation and characterization of a cDNA coding for a phytase from young maize plants
On construit une bibliothèque d'ADNc dans le vecteur d'expression λgtl 1 en utilisant des ADNc synthétisés avec des ARNm polyadénylés isolés à partir de jeunes plants de maïs âgés de trois à quatre jours. On crible la bibliothèque avec l' antisérum brut de lapin dirigé contre la sous-unité de phytase purifiée à partir des jeunes plants de maïs. Le criblage initial aboutit à l'isolement de douze clones positifs. Lorsqu'on teste avec l'antisérum purifié par affinité sur la sous-unité de phytase, un seul clone donne une forte réponse positive. On sous-clone l'insert correspondant dans le vecteur pBS-SK et on le séquence. Il contient 930 pb avec un cadre ouvert de lecture codant pour 139 aa. On utilise cet ADNc marqué, appelé phy AM10, comme sonde pour cribler la même bibliothèque afin de rechercher des clones de pleine longueur correspondants. On isole plusieurs clones positifs contenant un insert d'environ 1400 pb. On séquence entièrement l'insert d'un de ces clones, appelé ADNc phy SI 1. La séquence nucléotidique de l'ADNc phy SI 1 contient 1335 pb avec une teneur élevée en GC (65 %) et présente un cadre ouvert de lecture pour un polypeptide à 387 aa (figure 1). La présence d'un codon d'arrêt (TGA) deux codons en amont du premier ATG suggère que cet ATG est le codon d'initiation et montre que la séquence de codage est complète Cet ADNc présente 31 pb de séquences non traduites en 5' et 147 pb de séquence non traduite en 3' On trouve un signal de polyadénylation AATAAA décrit pour les plantes supérieures (Joshi, 1987) (position 1236 - 41) à 63 nucléotides en amont de l'extension poly-AA cDNA library is constructed in the expression vector λgtl 1 using cDNAs synthesized with polyadenylated mRNAs isolated from young corn plants three to four days old. The library is screened with crude rabbit antiserum directed against the phytase subunit purified from young corn plants. The initial screening results in the isolation of twelve positive clones. When tested with affinity purified antiserum on the phytase subunit, a single clone gives a strong positive response. The corresponding insert is subcloned into the vector pBS-SK and sequenced. It contains 930 bp with an open reading frame coding for 139 aa. This labeled cDNA, called phy AM10, is used as a probe to screen the same library in order to search for corresponding full-length clones. Several positive clones containing an insert of approximately 1400 bp are isolated. The insert of one of these clones, called cDNA phy SI 1, is completely sequenced. The nucleotide sequence of cDNA phy SI 1 contains 1335 bp with a high GC content (65%) and presents an open reading frame for a 387 aa polypeptide (Figure 1). The presence of a stop codon (TGA) two codons upstream of the first ATG suggests that this ATG is the initiation codon and shows that the coding sequence is complete This cDNA has 31 bp of 5 'untranslated sequences and 147 bp of 3' untranslated sequence There is an AATAAA polyadenylation signal described for higher plants (Joshi, 1987) (position 1236 - 41) at 63 nucleotides upstream of the poly-A extension
La taille de la protéine codée déduite de la séquence d'acides aminés est de 41 kDa, correspondant à la taille de la sous-unité phytase détectée par analyseThe size of the encoded protein deduced from the amino acid sequence is 41 kDa, corresponding to the size of the phytase subunit detected by analysis.
Western blot des protéines totales extraites dé jeunes plants (Labouré et al , 1993) II faut mentionner que la sous-unité de la phytase puπfiée selon le procédé décrit antérieurement est toujours légèrement plus petite (environ 38 kDa), ce qui suggère que des clivages spécifiques apparaissent au cours de la purification On détermine l'extrémité N sur la sous-unite purifiée Le peptide a 38 kDa semble être un mélange de deux peptides un peptide mineur avec une extrémité N XXEDGESKAGMTDL (SEQ ID N° 10) et un peptide majeur commençant par la séquence d'acides aminés AGMTDLLMLTDKSQL (SEQ ID N° 1 1) Ces deux séquences qui se recouvrent partiellement sont localisées respectivement dans les positions 19- 32 et 27 - 41 sur la séquence d'aa déduite de l'ADNc phy S i 1 (figure 1), ce qui confirme que cet ADNc code bien pour la sous-unité de phytase et que le premier ATG est le codon d'initiationWestern blot of total proteins extracted from young plants (Labouré et al, 1993) It should be mentioned that the phytase subunit puπfié according to the previously described process is always slightly smaller (about 38 kDa), which suggests that cleavages specific appear during purification The N end is determined on the purified subunit The peptide at 38 kDa seems to be a mixture of two peptides a minor peptide with an N end XXEDGESKAGMTDL (SEQ ID N ° 10) and a major peptide starting with the amino acid sequence AGMTDLLMLTDKSQL (SEQ ID No. 1 1) These two partially overlapping sequences are located in positions 19-32 and 27-41 respectively on the aa sequence deduced from the phy S cDNA i 1 (FIG. 1), which confirms that this cDNA codes well for the phytase subunit and that the first ATG is the initiation codon
Une recherche sur ordinateur des similitudes entre la séquence d'acides aminés déduite et d'autres protéines dans plusieurs bases de données utilisant le programme FastA de la trousse UWGCG a révèle une homologie a 96% avec un EST indéterminé a 162 pb de Zea mays (numéro d'accès T20338) On a également trouve une similitude de 55 % (30 % d'identité) avec une séquence d'aa encodée par un ADNc d'Hordeum vulgare (numéro d'accès X82937) dont on a signalé qu'elle est induite par le jasmonate, et dont la fonction est inconnue (I Leopold, 1994, non publie)A computer search for similarities between the deduced amino acid sequence and other proteins in several databases using the FastA program of the UWGCG kit revealed 96% homology with an EST determined at 162 bp of Zea mays ( access number T20338) We also found a 55% (30% identity) similarity with an AA sequence encoded by Hordeum vulgare cDNA (access number X82937) which has been reported to be is induced by jasmonate, and whose function is unknown (I Leopold, 1994, unpublished)
Lorsqu'on compare la séquence d'acides aminés pour laquelle code l'ADNc phy SU avec celle de la phytase phy A d'Aspergillus niger en utilisant le programme Best Fit de la trousse UWGCG, on trouve que la seule zone significative de similitude correspond à un recouvrement de seulement 33 aa (souligne en pointillés dans la figure 1 ) La figure 2 montre l'alignement de cette séquence de mais avec les séquences correspondantes des phytases Phy A et Phy B d'Aspergillus cette séquence du mais présente 84 % de similitude (27 % d'identité) avec la séquence correspondante de la phytase Phy A d'Aspergillus et 79 % de similitude avec celle de la phytase de Phy B. Ces séquences des phytases d'Aspergillus contiennent le motif consensus RHGxRxP (souligné en figure 2) caractéristique des phosphatases acides de la levure, de E. coli et de certains mammifères, et dont on pense qu'il s'agit de la région accepteur de phosphatase (Piddington et al., 1993).When comparing the amino acid sequence coded for by the phy SU cDNA with that of the phytase phy A by Aspergillus niger using the Best Fit program of the UWGCG kit, we find that the only significant area of similarity corresponds at an overlap of only 33 aa (dotted underlining in FIG. 1) FIG. 2 shows the alignment of this maize sequence with the corresponding sequences of the Phy A and Phy B phytases of Aspergillus this sequence of maize presents 84% of similarity (27% identity) with the corresponding Phy A phytase sequence from Aspergillus and 79% similarity with that of Phy B phytase. These Aspergillus phytase sequences contain the RHGxRxP consensus motif (underlined in FIG. 2) characteristic of the acid phosphatases of yeast, E. coli and certain mammals, and which it is believed to be acts from the phosphatase acceptor region (Piddington et al., 1993).
H.2) Analyse de l'expression du gène de phytase par Northern blot à divers stades de la germination du grain de maïsH.2) Analysis of the expression of the phytase gene by Northern blot at various stages of the germination of the corn kernel
Pour examiner si l'accumulation de la protéine signalée dans les jeunes plants de maïs au cours des premiers jours de la germination (Labouré et al., 1993) est en relation avec une augmentation de la teneur en ARNm correspondant, on détermine les niveaux de produit de transcription par analyse de Northern blot. On extrait l'ARN total de semences sèches, on hydrate les semences pendant douze heures dans de l'eau aérée, on transfère les semences dans du sable humide pendant 1, 2, 3, 5 et 6 jours. On compare avec l'ARN extrait de feuilles matures. Dans chaque cas, on soumet 10 μg d'ARN à une analyse de Northern blot, en utilisant l'ADNc phy SU comme sonde. On ne détecte aucun produit de transcription Phy S 1 1 dans les ARN totaux provenant de semences sèches ou provenant de semences imbibées pendant douze heures dans de l'eau aérée. On trouve que l'ADNc phy SU s'hybride à un ARNm unique d'environ 1400 pb, qui apparaît au cours du premier jour de germination à 26°C, atteint son plus haut niveau au jour 2, puis diminue progressivement du jour 3 au jour 6. On n'observe qu'une très légère hybridation avec l'ARNm provenant de feuilles matures. Cette cinétique de l'accumulation d'ARNm est compatible avec ce qui a été décrit antérieurement pour l'accumulation de phytase, mais le niveau maximum d'ARN est obtenu deux jours avant le niveau maximum signalé pour l'accumulation de protéine.To examine whether the accumulation of protein reported in young corn plants during the first days of germination (Labouré et al., 1993) is related to an increase in the corresponding mRNA content, the levels of Transcript by Northern blot analysis. The total RNA is extracted from dry seeds, the seeds are hydrated for twelve hours in aerated water, the seeds are transferred to wet sand for 1, 2, 3, 5 and 6 days. We compare with the RNA extracted from mature leaves. In each case, 10 μg of RNA is subjected to a Northern blot analysis, using the phy SU cDNA as a probe. No Phy S 11 transcripts were detected in total RNA from dry seeds or from seeds soaked for twelve hours in aerated water. The phy SU cDNA is found to hybridize to a single mRNA of about 1400 bp, which appears during the first day of germination at 26 ° C, reaches its highest level on day 2, then gradually decreases from day 3 on day 6. Only a very slight hybridization is observed with the mRNA originating from mature leaves. This kinetics of mRNA accumulation is compatible with what has been described previously for phytase accumulation, but the maximum level of RNA is obtained two days before the maximum level reported for protein accumulation.
H.3) Expression de l'ADNc phy SU dans E. coli Pour tester si l'ADNc phy Si 1 code pour la phytase fonctionnelle du maïs, on cherche à exprimer le gène dans E. coli. On insère la séquence de codage complète en phase au site Nco I du vecteur pET-14b, sous la commande des signaux de transcription et de traduction du bactériophage T7. On transfère le plasmide pET.Sl l résultant dans l'hôte d'expression BL21 dans lequel on peut induire l'expression de T7 par IPTG. On extrait les protéines solubles totales provenant de E. coli non transformées ou transformées avant et après induction avec IPTG, dans des conditions dénaturantes, et on analyse sur SDS-PAGE. La coloration du gel par le bleu Coomassie révèle une bande faible à 40 kDa, qui n'est présente qu'après induction par 5 IPTG Lorsqu'on analyse les mêmes extraits par analyse de Western blot, on procède comme suit . on sépare les protéines totales (10 μg par piste) extraites de E. coli BL21 sur SDS/PAGE à 12,5 % et on effectue un électrobuvardage sur une membrane de nitrocellulose. On repère la protéine avec l'anticorps purifié pour : 1) BL21 non transformé, 2) BL21 transformé avec pET14 recombinant, sans induction par IPTG,H.3) Expression of the phy SU cDNA in E. coli To test whether the phy cDNA Si 1 codes for the functional phytase of maize, it is sought to express the gene in E. coli. The complete coding sequence in phase is inserted at the Nco I site of the vector pET-14b, under the control of the transcription and translation signals of the bacteriophage T7. The resulting plasmid pET.S1 is transferred to the expression host BL21 in which the expression of T7 can be induced by IPTG. Total soluble proteins from untransformed or transformed E. coli are extracted before and after induction with IPTG, under denaturing conditions, and analyzed on SDS-PAGE. The coloring of the gel with Coomassie blue reveals a weak band at 40 kDa, which is only present after induction by IPTG When the same extracts are analyzed by Western blot analysis, the procedure is as follows. the total proteins are separated (10 μg per lane) extracted from E. coli BL21 on SDS / PAGE at 12.5% and an electrostatic analysis is carried out on a nitrocellulose membrane. The protein is identified with the purified antibody for: 1) unprocessed BL21, 2) transformed BL21 with recombinant pET14, without induction by IPTG,
10 3), 4) et 5) BL21 transformé avec pET14 recombinant au bout de 1, 2 ou 3 heures d'induction respectivement, 6) 10 μg de protéines totales dé jeunes plants de mais de cinq jours et 7) 1 μg de phytase purifiée à partir dé jeunes plants de maïs.10 3), 4) and 5) BL21 transformed with recombinant pET14 after 1, 2 or 3 hours of induction respectively, 6) 10 μg of total protein from young five-day corn plants and 7) 1 μg of phytase purified from young corn plants.
L'anticorps de phytase réagit de façon croisée avec un polypeptide provenant des extraits de E.coli induits qui migrent exactement aux mêmes niveauxThe phytase antibody cross-reacts with a polypeptide from induced E. coli extracts which migrate at exactly the same levels
15 que le polypeptide détecté sur les protéines totales extraites de jeunes plants de mais de cinq jours. De façon intéressante, la protéine synthétisée dans E. coli subit des clivages aboutissant à un peptide de même taille que la sous-unité de la phytase purifiée. Lorsqu'on sépare des protéines solubles sur PAGE dans des conditions non dénaturantes et qu'on les analyse par Western blot, on observe une protéine d'environ15 that the polypeptide detected on the total proteins extracted from young maize plants of five days. Interestingly, the protein synthesized in E. coli undergoes cleavages leading to a peptide of the same size as the purified phytase subunit. When soluble proteins are separated on PAGE under non-denaturing conditions and analyzed by Western blot, a protein of approximately
20 80 kDa dans les extraits de E. coli induits. Cette protéine migre au même niveau que la protéine native provenant de jeunes plants de maïs, ce qui indique que les sous- unités synthétisées dans E. coli sont capables de s'assembler Cependant, lorsqu'on teste l'activité de phosphatase sur le gel, on n'observe pas d'activité au niveau de la protéine réassemblée provenant de l'extrait de E. coli Lorsqu'on ajoute de la phytase80 kDa in induced E. coli extracts. This protein migrates at the same level as the native protein from young corn plants, which indicates that the subunits synthesized in E. coli are able to assemble However, when testing the phosphatase activity on the gel , no activity is observed in the reassembled protein from the E. coli extract When phytase is added
25 de mais purifiée à l'extrait de E coli une activité est présente, ce qui montre qu'aucune substance inhibitrice n'est présente dans l'extrait25 of corn purified with the extract of E coli an activity is present, which shows that no inhibitory substance is present in the extract
En résumé, l'immunocriblage d'une bibliothèque d'ADNc de jeunes plants de mais a permis l'isolement d'un ADNc appelé phy S U, codant pour un polypeptide à 41 kDa qui correspond en fait à la sous-unité de phytase détectée parIn summary, the immuno-screening of a cDNA library of young maize plants allowed the isolation of a cDNA called phy SU, coding for a polypeptide at 41 kDa which in fact corresponds to the phytase subunit detected through
30 des analyses de Western blot dans des extraits de protéine totale provenant de jeunes plants de semis On a déterminé la séquence N-termmale de la sous-unité de phytase purifiée on trouve un mélange de deux séquences correspondant aux acides aminés 19 - 32 et 27 - 41 de la séquence déduite de l'ADNc phy Si 1 Ce résultat est en accord avec les différences observées entre la taille de la sous-unité révélée par Western blot30 Western blot analyzes in total protein extracts from young seedlings The N-term sequence of the purified phytase subunit has been determined a mixture of two sequences corresponding to amino acids 19-32 and 27 is found - 41 of the deduced sequence of the phy cDNA Si 1 This result is in agreement with the differences observed between the size of the subunit revealed by Western blot
J .1 sur les extraits protéiques totaux provenant dé jeunes plants de semences et celle de la protéine purifiée La correspondance entre les séquences d'aa déterminées sur la protéine purifiée et celle déduite d'après la séquence nucléotidique de l'ADNc phy S 1 1 , confirme que cet ADNc code bien pour la sous-unité de phytase L'utilisation de l'ADNc phy SU comme sonde pour estimer les niveaux d'ARN de phytase au cours des premiers jours de germination montre clairement que l'accumulation de la protéine signalée antérieurement (Labouré et al., 1993) est en corrélation avec une forte augmentation du niveau de produit de transcription correspondant. En fait, on ne détecte aucun ARNm dans les grains secs ou dans des grains échelonnés en douze heures, tandis qu'on mesure déjà une accumulation significative du produit de transcription un jour après transfert dans des conditions de germination. Le niveau maximum d'ARNm est atteint au bout de deux jours, ce qui correspond au stade de l'extrusion radiculaire. Par conséquent, l'induction de l'accumulation d'ARNm de phytase se produit à un stade très précoce du processus de germination. Dans des travaux antérieurs, on a montré que l'accumulation de la protéine ne culmine qu'au bout de quatre jours d'imbibition. Cette différence entre la cinétique d'accumulation du produit de transcription et de la protéine suggère qu'une commande de traduction peut apparaître outre la régulation du niveau d'ARNm.J .1 on the total protein extracts from young seedlings and that of the purified protein The correspondence between the sequences of aa determined on the purified protein and that deduced from the nucleotide sequence of the cDNA phy S 1 1 , confirms that this cDNA codes well for the phytase subunit The use of the phy SU cDNA as a probe to estimate the levels of phytase RNA during the first days of germination clearly shows that the accumulation of the protein previously reported (Labouré et al., 1993) is correlated with a sharp increase in the level of corresponding transcription product. In fact, no mRNA is detected in the dry grains or in grains staggered in twelve hours, while a significant accumulation of the transcript is already measured one day after transfer under germination conditions. The maximum level of mRNA is reached after two days, which corresponds to the stage of root extrusion. Therefore, the induction of phytase mRNA accumulation occurs at a very early stage in the germination process. In previous work, it has been shown that protein build-up only peaks after four days of soaking. This difference between the kinetics of accumulation of the transcript and of the protein suggests that a translation command may appear in addition to regulating the level of mRNA.
L'expression dans E. coli en utilisant le vecteur pET14 permet la production de la sous-unité de phytase et son assemblage comme on le détecte parExpression in E. coli using the vector pET14 allows the production of the phytase subunit and its assembly as detected by
Western blot. Cependant, la protéine cible est produite en faible quantité, et on n'observe aucune accumulation au bout d'une heure d'induction. La forme assemblée migre à la même taille que la phytase purifiée native, mais la protéine résultante ne montre aucune activité de phosphatase. Ceci suggère ou bien que l'assemblage qui se produit dans la bactérie n'est pas correct et aboutit à une protéine non fonctionnelle, ou bien qu'une modification post-traductionnelle de la protéine nécessaire qui ne se produit pas dans E. coli est nécessaire pour l'activité.Western blot. However, the target protein is produced in small quantities, and no accumulation is observed after one hour of induction. The assembled form migrates to the same size as the native purified phytase, but the resulting protein shows no phosphatase activity. This suggests either that the assembly that occurs in the bacteria is not correct and results in a non-functional protein, or that a post-translational modification of the necessary protein that does not occur in E. coli is necessary for the activity.
H.4) Deux gènes phytase sont présents chez le maïs et ils sont localisés sur le chromosome 3 Sur les treize clones génomiques isolés et analysés, dix clones positifs sont finalement retenus dont sept sont différents. Les inventeurs ont pu établir au moins deux classes :H.4) Two phytase genes are present in maize and they are located on chromosome 3 Out of the thirteen genomic clones isolated and analyzed, ten positive clones are finally retained, seven of which are different. The inventors were able to establish at least two classes:
- la classe I qui comprend trois clones différents chevauchants : P3 = P4 (12kb), P 19 (13,5 kb), et P22 (16 kb). Les cartes de restriction sont présentées à la Figure 3, - la classe II qui comprend deux clones chevauchants : P5 = P26 (17 kb) et PI 3 =- class I which includes three different overlapping clones: P3 = P4 (12kb), P 19 (13.5 kb), and P22 (16 kb). The restriction maps are presented in Figure 3, - class II which includes two overlapping clones: P5 = P26 (17 kb) and PI 3 =
P24 ( 18,5 kb). Les cartes de restriction sont également présentées à la Figure 3. En ce qui concerne les 2 clones restants : - P23 (12,7 kb, Figure 3) présente un seul fragment de taille identique à un des fragments des clones de classe II, fragment qui n'est pas révélé à l'hybridation. Ce clone a finalement été rattaché à cette classe après comparaison des séquences effectuées sur les clones phagiques réalisées avec Poligonuciéotide Phy 8, désigné sur l'ADNc phy SU à la position 1 129 / 1 148. Ces dernières se sont retrouvées parfaitement homologues ;P24 (18.5 kb). The restriction maps are also presented in Figure 3. Regarding the 2 remaining clones: - P23 (12.7 kb, FIG. 3) has a single fragment of size identical to one of the fragments of the class II clones, a fragment which is not revealed at hybridization. This clone was finally attached to this class after comparison of the sequences carried out on the phage clones carried out with Poligonucleotide Phy 8, designated on the phy cDNA SU at position 1129 / 1148. The latter were found perfectly homologous;
- P25 quant à lui ne présente aucun fragment retrouvé chez les autres clones. L'hybridation des blots contenant l'ADN des phages digérés par les différentes enzymes énumérées ci-dessus, avec le fragment P23.7 Hind III de 3 kb (Figure 3), a montré des différences d'intensité des signaux d'hybridations qui concordent avec la classification proposée des fragments génomiques : signal intense pour les clones de la classe II et faible pour ceux de la classe I dont P25 ferait partie. L'appartenance de P25 à cette classe a pu être confirmée par hybridation avec le fragment Eco RI / Sph I du plasmide portant le fragment PI 9.14 clone à Sal I / Hind III (Figure 4, EcoRI : site du polylinker du vecteur et Sph I : site du fragment génomique à la position 1794).- P25 for its part does not present any fragment found in the other clones. Hybridization of the blots containing the phage DNA digested by the various enzymes listed above, with the P23.7 Hind III fragment of 3 kb (FIG. 3), showed differences in the intensity of the hybridization signals which agree with the proposed classification of genomic fragments: strong signal for clones of class II and weak for those of class I of which P25 is a part. The membership of P25 in this class could be confirmed by hybridization with the Eco RI / Sph I fragment of the plasmid carrying the PI 9.14 fragment cloned to Sal I / Hind III (Figure 4, EcoRI: site of the vector polylinker and Sph I : site of the genomic fragment at position 1794).
Des réactions de séquences ont été également menées sur les clones phagiques P3, P19 et P22 à l'aide d'oligonucléotides spécifiques de l'ADNc phytase phy S I 1. Les résultats des séquences P3 et P22 obtenues avec l'oligonucléotide Phy 8, désigné sur fADNc phy S I 1 à la position 1 129 / 1 148, indiquent que le fragment Sal I de 6,9 kb commun aux deux clones et homologue à l'ADNc, est adjacent à l'un des deux bras du vecteur phagique, au petit bras pour P3 et au grand bras pour P22. P3, P22 et PI 9 ont ainsi pu être positionnés les uns par rapport aux autres (Figure 3).Sequence reactions were also carried out on phage clones P3, P19 and P22 using oligonucleotides specific for the cDNA phytase phy SI 1. The results of the sequences P3 and P22 obtained with the oligonucleotide Phy 8, designated on phy cDNA SI 1 at position 1,129 / 1,148, indicate that the 6.9 kb Sal I fragment common to the two clones and homologous to the cDNA, is adjacent to one of the two arms of the phage vector, at small arm for P3 and large arm for P22. P3, P22 and PI 9 could thus be positioned in relation to each other (Figure 3).
Les séquences complètes du clone de classe I, P19.14 (4,7 kb) et du clone de classe II, P23.7 (3 kb) ont été déterminées et sont présentées aux Figures 4 et 5. Les tailles exactes sont 4695 pb pour P19.14 et 2991 pb pour P23.7.The complete sequences of the class I clone, P19.14 (4.7 kb) and of the class II clone, P23.7 (3 kb) have been determined and are presented in Figures 4 and 5. The exact sizes are 4695 bp for P19.14 and 2991 bp for P23.7.
Des séquences incomplètes du clone P13.2 (5,5 kb) et P13.6 (2,6 kb) ont montré que le clone phagique dont ils dérivent est certainement chimérique. En effet, on ne trouve pas d'homologie avec les 100 premières pb de l'ADNc phy SU . La présence d'un site Mbo I (enzyme utilisée pour la digestion partielle de l'ADN génomique lors de la construction de la banque Clontech) à cette position semble conforter cette hypothèse (position + 122 de phy S I 1).Incomplete sequences of the clone P13.2 (5.5 kb) and P13.6 (2.6 kb) have shown that the phage clone from which they are derived is certainly chimeric. Indeed, there is no homology with the first 100 bp of the phy SU cDNA. The presence of an Mbo I site (enzyme used for the partial digestion of genomic DNA during the construction of the Clontech bank) at this position seems to support this hypothesis (position + 122 of phy S I 1).
Les analyses de restriction et d'hybridation du clone P5, révèlent que ce dernier est aussi chimérique. En ce qui concerne le fragment génomique P19 14 (classe I), la comparaison de la séquence tirée du fragment génomique et de la séquence de l'ADNc phy SU, met en évidence un seul intron de 131 pb dans la région 5' leader non traduite L'épissage de l'intron se situerait après la 13eme base nucléotidique de l'ADNc phy S U Quelques différences ponctuelles sont observées par rapport à la séquence de phy S 1 1 Ces différences pourraient correspondre à du polymorphisme intervariétal (phy SU vient de la lignée Mol 7 et P19 14 de la lignée B73) La séquence de phy SU est entièrement retrouvée dans la séquence génomique Du site Nco I situé au niveau du triplet codant pour la première méthionine, au site Hind III de clonage, 2, 1Kb permettent de déterminer la région promotrice de ce gène. Le cadre de lecture ouvert déterminé est le même que celui de phy SU, le codon de terminaison est également TAA Ce gène coderait donc pour une protéine de 387 acides aminés, identique à celle déduite de l'ADNc phy S I 1The restriction and hybridization analyzes of the P5 clone reveal that the latter is also chimeric. With regard to the genomic fragment P19 14 (class I), the comparison of the sequence drawn from the genomic fragment and of the sequence of the cDNA phy SU, reveals a single intron of 131 bp in the region 5 'leader not translated The splicing of the intron would take place after the 13 th nucleotide base of the phy SU cDNA A few point differences are observed compared to the phy sequence S 1 1 These differences could correspond to intervenarietal polymorphism (phy SU comes from the Mol 7 line and P19 14 of the B73 line) The phy SU sequence is entirely found in the genomic sequence From the Nco I site located at the triplet coding for the first methionine, to the Hind III cloning site, 2, 1Kb allow to determine the promoter region of this gene. The open reading frame determined is the same as that of phy SU, the termination codon is also TAA This gene would therefore code for a protein of 387 amino acids, identical to that deduced from the phy cDNA SI 1
La séquence complète du clone P23.7 (fragment Hind III de 3 kb) a été déterminée. D'après l'alignement des séquences de phy SI 1 et P23.7, le gène phytase clone dans P23 7 semble plus éloigné de phy SI 1 que ne l'est P19.14. Les différences observées ne sont toutefois pas très importantes L'alignement des séquences débute à la première base de l'ADNc phytase et à la base 1 174 du fragment génomique séquence Un intron de 125 pb est situé dans la région 5' leader non traduite Une vingtaine de mutations ponctuelles sont observées et on peut noter une plus grande variation entre les séquences au niveau de la région 3' non traduite Nous avons également observé une addition de deux fois 3 bases dans la région 5 ' traduite Le cadre de lecture ouvert demeure ainsi le même que celui de phy S I 1 et le codon stop est également TAA. Le gène clone dans P23 7 coderait pour une protéine de 389 acides aminés. La comparaison des séquences génomiques de PI 9 14 et P23 7 en amont et en aval de la région transcrite de ces deux gènes phytase montre que ces séquences étaient totalement différentesThe complete sequence of clone P23.7 (Hind III fragment of 3 kb) was determined. According to the alignment of the phy SI 1 and P23.7 sequences, the phytase gene cloned in P23 7 seems to be more distant from phy SI 1 than is P19.14. The differences observed are not very significant, however. The alignment of the sequences begins at the first base of the phytase cDNA and at the base 1,174 of the genomic fragment sequence A 125 bp intron is located in the 5 'leader region untranslated A around twenty point mutations are observed and we can note a greater variation between the sequences at the level of the 3 'untranslated region We also observed an addition of twice 3 bases in the 5' translated region The open reading frame remains thus the same as that of phy SI 1 and the stop codon is also TAA. The gene cloned in P23 7 would code for a protein of 389 amino acids. The comparison of the genomic sequences of PI 9 14 and P23 7 upstream and downstream of the transcribed region of these two phytase genes shows that these sequences were totally different
L'interrogation des banques de données en utilisant la séquence phy S U et le logiciel de comparaison FastA avait montré l'existence d'un EST de mais de 162 pb, n° d'accession T20338, fortement homologue Celui-ci provient d'une banque d'ADNc obtenue à partir d'ARNm de plantules étiolées de 10 jours de la lignée B73 Il se révèle complètement homologue au début de transcription du gène phytase de classe II (P23.7). On peut noter en particulier, la présence des deux acides aminés supplémentaires.The interrogation of the databases using the phy SU sequence and the FastA comparison software had shown the existence of a corn EST of 162 bp, accession number T20338, highly homologous This comes from a cDNA library obtained from mRNA of 10-day etiolated seedlings of line B73 It turns out to be completely homologous at the start of transcription of the phytase gene from class II (P23.7). In particular, the presence of the two additional amino acids can be noted.
Les séquences protéiques déduites des parties codantes de PI 9.14 (classe I), P23.7 (classe II) et phy SU ont été comparées grâce au logiciel d'alignement "clustal V multiple séquence alignement" (Figure 6). Cette analyse a permis de confirmer l'appartenance des protéines codées par P19.14 et P 23.7 à des classes différentes dénommées ci-après respectivement phytase de classe I et phytase de classe II. L'analyse du cadre de lecture ouvert deP19.14 et de phy SI 1 montre que les deux protéines se distinguent uniquement pour deux acides aminés (on trouve une Alanine et une Valine pour phy S I 1, et une Glycine et une Isoleucine respectivement pour P19-14).The protein sequences deduced from the coding parts of PI 9.14 (class I), P23.7 (class II) and phy SU were compared using the “clustal V multiple sequence alignment” alignment software (FIG. 6). This analysis made it possible to confirm the membership of the proteins coded by P19.14 and P 23.7 to different classes hereinafter called respectively class I phytase and class II phytase. Analysis of the open reading frame of P19.14 and phy SI 1 shows that the two proteins differ only for two amino acids (there is an Alanine and a Valine for phy SI 1, and a Glycine and an Isoleucine respectively for P19 -14).
En conclusion, ces résultats semblent indiquer que les fragments génomiques de classe I correspondraient à l'ADNc phy S I 1.In conclusion, these results seem to indicate that the class I genomic fragments correspond to the phy S I 1 cDNA.
Toutes ces données attestent donc de la présence de deux gènes phytase transcriptionnellement actifs dans la plantule de mais en germination. Les séquences protéiques de ces deux phytases sont quasiment identiques.All these data therefore attest to the presence of two transcriptionally active phytase genes in the germinating corn seedling. The protein sequences of these two phytases are almost identical.
Parallèlement, les résultats de cartographie génétique (cf. matériels et procédés) semblent indiquer l'existence de deux loci présentant des homologies de séquence avec l'ADNc phytase phy S I 1. Le traitement des données avec le logiciel de cartographie Mapmaker version 2.0 pour Macintosh (Lander et al. 1987, Genomics 1 : 174-181) a montré que ces deux loci dénommés phy I et phy II sont très liés, positionnés à 1 cm l'un de l'autre sur le chromosome 3 du mais. Ils sont encadrés par les loci umcOW et umc026 (MNL 69 : p 249). Phy 1 est à environ 4,6 cm du locus umcOlO du côté du bras court du chromosome et phy II, positionné au même endroit que bnl 06.06, est distant de 4,2 cm du marqueur umc026. Une hybridation complémentaire a été réalisée sur les membranes contenant l'ADN digéré des lignées recombinantes afin d'établir la correspondance entre ces deux loci et les gènes de classes I et II caractérisées à partir des fragments génomiques. Pour ce faire, le fragment Eco RI / Sph I spécifique de la séquence en amont du gène de classe I (P19.14) a été utilisé comme sonde. Les résultats des hybridations démontrent que le gène de classe I correspond au locus phy I.At the same time, the results of genetic mapping (cf. materials and processes) seem to indicate the existence of two loci presenting sequence homologies with the cDNA phytase phy SI 1. Data processing with the mapping software Mapmaker version 2.0 for Macintosh (Lander et al. 1987, Genomics 1: 174-181) has shown that these two loci called phy I and phy II are very linked, positioned 1 cm apart from each other on chromosome 3 of maize. They are supervised by the umcOW and umc026 loci (MNL 69: p 249). Phy 1 is approximately 4.6 cm from the umcOlO locus on the side of the short arm of the chromosome and phy II, positioned in the same location as bnl 06.06, is 4.2 cm from the marker umc026. Complementary hybridization was carried out on the membranes containing the digested DNA of the recombinant lines in order to establish the correspondence between these two loci and the genes of classes I and II characterized from the genomic fragments. To do this, the Eco RI / Sph I fragment specific for the sequence upstream of the class I gene (P19.14) was used as probe. The hybridization results demonstrate that the class I gene corresponds to the phy I locus.
II.5) Détermination du départ de transcription et des régions promotrices des gènes phytase H.5a) Cartographie des départs de transcription Pour déterminer les départs de transcription des gènes phytase, nous avons utilisé la méthode 5 'RACE.II.5) Determination of the start of transcription and of the promoter regions of the phytase genes H.5a) Mapping of the start of transcription To determine the transcription starts of phytase genes, we used the 5 'RACE method.
Plusieurs combinaisons d'oligonucléotides ont été testées : AP I et AP2 (Kit Marathon) / phy 20 (position + 95 / + 75 de phy SU) ; API et AP2 / phy 18 (position + 294 / + 273 de phy S U ). Les produits d'amplification obtenus dans les conditions suivantes : 1 min 94°C ; 40 cycles (30 sec 94°C, 30 sec 55°C, 2 min 68°C), n'ont pu être détectés par coloration au bromure d'éthidium après migration sur gel d'agarose à 2 %. Leur mise en évidence a été réalisée par hybridation avec la sonde ADNc phy SU (EcoR I / Not I). Les produits positifs ont alors été clones dans le vecteur plasmidique pGEM-T (Promega) selon les recommandations du fournisseur, puis séquences. Différents produits, que l'on peut classer en deux groupes, se sont révélés informatifs :Several combinations of oligonucleotides were tested: AP I and AP2 (Kit Marathon) / phy 20 (position + 95 / + 75 of phy SU); API and AP2 / phy 18 (position + 294 / + 273 of phy S U). The amplification products obtained under the following conditions: 1 min 94 ° C; 40 cycles (30 sec 94 ° C, 30 sec 55 ° C, 2 min 68 ° C), could not be detected by staining with ethidium bromide after migration on 2% agarose gel. Their demonstration was carried out by hybridization with the phy SU cDNA probe (EcoR I / Not I). The positive products were then cloned into the plasmid vector pGEM-T (Promega) according to the recommendations of the supplier, then sequenced. Different products, which can be classified into two groups, have proved to be informative:
- le clone n° 53 (obtenu à partir de l'oligonucléotide phy 18), beaucoup plus court que le produit minimal attendu défini par la séquence de l'ADNc phy SI 1, semble mettre en évidence la présence d'une structure secondaire forte en 5' de l'ARN messager, qui empêcherait une bonne activité de la réverse transcriptase. La réverse transcriptase a été stoppée à la position + 245 de phy S I 1 ;- clone No. 53 (obtained from the oligonucleotide phy 18), much shorter than the expected minimum product defined by the sequence of the phy cDNA SI 1, seems to demonstrate the presence of a strong secondary structure 5 'of the messenger RNA, which would prevent good activity of the reverse transcriptase. The reverse transcriptase was stopped at position + 245 of phy S I 1;
- les clones n° 92, 93 et 87 (obtenus à partir de l'oligonucléotide phy 20), de taille sensiblement équivalente à la taille du fragment attendue à partir de l'ADNc phy S I 1. On a pu noter un arrêt de la réverse transcriptase à 10 pb en amont du début de l'ADNc pour le n° 92 , à la position + 19 pour le n° 93, + 54 pour le n° 87. La séquence du clone n° 92 présente 100 % d'homologie avec la séquence déterminée pour le fragment P23.7 et également avec l'EST de maïs, n° d'accession T20338. Le départ de transcription se situe à la position 1261 de la séquence génomique déterminée sur P23.7 ou légèrement en amont. Les expériences visant à mettre en évidence les départs de transcription des différents gènes phytase se sont donc révélées fructueuses pour le gène phytase de classe II. L'isolement de l'ADNc phy S I 1 atteste que l'initiation de la transcription du gène de classe I a lieu à la position 1935 de la séquence génomique ou légèrement en amont (Figure 4 ou SEQ ID N° 2). Pour les deux gènes on constate la présence d'une boîte TATA à environ- Clones No. 92, 93 and 87 (obtained from the oligonucleotide phy 20), of size substantially equivalent to the size of the fragment expected from the cDNA phy SI 1. We could note a halt in the reverse transcriptase at 10 bp upstream of the start of the cDNA for No. 92, at position + 19 for No. 93, + 54 for No. 87. The sequence of clone No. 92 has 100% of homology with the sequence determined for the P23.7 fragment and also with the EST of maize, accession no. T20338. The start of transcription is located at position 1261 of the genomic sequence determined on P23.7 or slightly upstream. The experiments aimed at highlighting the transcriptional departures of the various phytase genes have therefore proved to be successful for the class II phytase gene. The isolation of the phy S I 1 cDNA attests that the initiation of the transcription of the class I gene takes place at position 1935 of the genomic sequence or slightly upstream (FIG. 4 or SEQ ID No. 2). For the two genes there is the presence of a TATA box at approximately
60 à 70 pb en amont des transcrits trouvés.60 to 70 bp upstream of the transcripts found.
II.5b) Expression transitoire Afin d'étudier la spécificité des promoteurs des deux gènes phytaseII.5b) Transient expression To study the specificity of the promoters of the two phytase genes
(classes I et II) vis-à-vis des différents tissus de grains de maïs en germination, trois constructions plasmidiques ont été réalisées. Il s'agit de fusions traductionnelles au niveau du codon d'initiation avec le gène rapporteur codant pour la β-glucuronidase (Jefferson, 1987, Plant Mol. Report 5 : 387-405). En ce qui concerne l'étude de la région promotrice du gène de classe I, deux fragments génomiques du plasmide P19.14 ont été fusionnés au gène GUS pour analyser l'expression transitoire de la β-glucuronidase. Un fragment long de 2, 1 kb et un fragment plus court de 1,3 kb. Pour le gène de classe II, un fragment de 1,3 kb a été fusionné (cf. matériels et procédés). Après bombardement de grains en germination (cf matériels et procédés), une expression transitoire faible (un à deux spots visibles par embryon) a pu être ainsi détectée au niveau du noeud cotylédonnaire d'embryons bombardés un jour après la mise en germination avec les construits suivants : - pBIOS 261 (fragment promoteur de 2, 1 kb de classe I) - pBIOS 262 (fragment promoteur de 1,3 kb de classe II)(classes I and II) with respect to the different tissues of germinating corn kernels, three plasmid constructions were carried out. These are translational fusions at the initiation codon with the reporter gene coding for β-glucuronidase (Jefferson, 1987, Plant Mol. Report 5: 387-405). As regards the study of the promoter region of the class I gene, two genomic fragments of the plasmid P19.14 were fused to the GUS gene to analyze the transient expression of β-glucuronidase. A 2.1 kb long fragment and a 1.3 kb shorter fragment. For the class II gene, a 1.3 kb fragment has been fused (cf. materials and methods). After bombardment of germinating grains (see materials and processes), a weak transient expression (one to two spots visible per embryo) could thus be detected at the cotyledon node of bombarded embryos one day after germination with constructs following: - pBIOS 261 (promoter fragment of 2.1 kb class I) - pBIOS 262 (promoter fragment of 1.3 kb class II)
Aucune expression n'a été décelée dans le scutellum ni dans la couche d'aleurone pour ces construits Aucune expression n'a été constatée dans aucun tissu avec le fragment promoteur court du gène de classe I (pBIOS 255)No expression was detected in the scutellum or in the aleurone layer for these constructs No expression was found in any tissue with the short promoter fragment of the class I gene (pBIOS 255)
Nous avons donc déterminé qu'au moins un fragment de chaque gène phytase (2, 1 kb amont du codon start pour la classe I et 1,3 kb amont du codon start pour la classe II), peut conférer une expression transcriptionnelle dans certains tissus de la plantule de maïs. Ces fragments promoteurs des deux gènes phytase (contenant aussi les leaders avec leur unique intron) peuvent être utilisés pour toutes modifications biotechnologiques de diverses plantes Les données sur la régulation des gènes phytase laissent penser qu'ils ne sont transcriptionnellement actifs qu'au moment de la phase germinative Nous disposons donc de promoteurs qui ont toutes les chances d'être spécifiques de cette étape clef du développement de la plante et de son rendementWe have therefore determined that at least one fragment of each phytase gene (2.1 kb upstream from the start codon for class I and 1.3 kb upstream from the start codon for class II) can confer transcriptional expression in certain tissues. of the corn seedling. These promoter fragments of the two phytase genes (also containing the leaders with their unique intron) can be used for all biotechnological modifications of various plants The data on the regulation of phytase genes suggest that they are only transcriptionally active at the time of germinative phase We therefore have promoters who are likely to be specific to this key stage in the development of the plant and its yield
Chez le mais, ils peuvent par exemple être utiles pour diriger la production d'un peptide antifongique afin d'augmenter la résistance de la plante aux champignons particulièrement lors de l'étape de germination D'autres applications comme l'augmentation de la vigueur de germination peuvent être préférentiellement envisagées via l'accroissement de la production de certaines hormones comme par exemple les cytokinines et les gibbéréllines. Ceci peut être obtenu par l'expression d'enzymes de biosynthèse de ces hormones. π.6) Expression ectopique de la phytase de classe I dans le maïs pour améliorer la digestibilité du phosphore et augmenter l'efficacité d'extraction de l'amidon de grain de maïs Afin d'augmenter la digestibilité du phosphore du grain de mais et/ou d'améliorer l'extraction de l'amidon durant l'étape industrielle du trempage, nous avons adopté plusieurs stratégies utilisant toutes une expression ectopique de la phytase de classe I.In corn, for example, they can be useful for directing the production of an antifungal peptide in order to increase the resistance of the plant to fungi, particularly during the germination stage. Other applications such as increasing the vigor of germination can be preferentially envisaged via the increase in the production of certain hormones such as by for example cytokinins and gibberellines. This can be achieved by the expression of biosynthetic enzymes from these hormones. π.6) Ectopic expression of class I phytase in corn to improve the digestibility of phosphorus and increase the extraction efficiency of corn kernel starch In order to increase the digestibility of phosphorus from corn grain and / or to improve the extraction of starch during the industrial steeping stage, we have adopted several strategies, all using an ectopic expression of class I phytase.
H.6a) Expression constitutive dans le cytoplasme La première consiste à diminuer directement la quantité d'acide phytique produite dans l'embryon de maïs. Il est connu que certains mutants de maïs, low phytic acid I et 2 peuvent avoir une réduction de leur teneur en acide phytique pouvant atteindre 33 % de la quantité totale sans voir une diminution de leur contenu en phosphore total (Raboy et al. , 37 * " Annual Maize Genetics Conférence 1995, Asilomar : Asbstract p. 6). Nous avons aussi choisi de produire la phytase de classe I dans toute la plante via l'utilisation de promoteurs constitutifs et ceci afin qu'elle hydrolyse l'acide phytique en cours de production dans l'embryon. Comme il semble que l'acide phytique soit nécessaire au cours du développement de l'embryon - en effet Raboy et al. (37Tn Annual Maize Genetics Conférence 1995, Asilomar . Asbstrac p. 6) ont isolé des allèles du mutant Ipa I qui sont léthaux, ces derniers n'ont plus du tout d'acide phytique - nous avons testé tout d'abord un promoteur d'expression constitutive faible chez le maïs, le promoteur 35S (Guilley et al. 1982,H.6a) Constitutive expression in the cytoplasm The first consists in directly reducing the quantity of phytic acid produced in the corn embryo. It is known that certain mutants of corn, low phytic acid I and 2 can have a reduction in their phytic acid content of up to 33% of the total amount without seeing a reduction in their total phosphorus content (Raboy et al., 37 * "Annual Maize Genetics Conference 1995, Asilomar: Asbstract p. 6). We have also chosen to produce class I phytase throughout the plant via the use of constitutive promoters and this so that it hydrolyzes phytic acid into during production in the embryo as it seems that phytic acid is required during development of the embryo. - in effect Raboy et al (37 Tn Annual Maize Genetics Conference 1995 Asilomar Asbstrac 6 p..) have. isolated from the alleles of the mutant Ipa I which are lethal, the latter no longer have phytic acid at all - we first tested a promoter of weak constitutive expression in maize, the promoter 35S (Guilley et al. 1982,
Cell 30 : 763-773). Parallèlement l'utilisation d'un promoteur fort, le promoteur associé au premier intron du gène Actine 1 de riz (Me Elroy et al. 1991, M.G.G. 231 : 150- 160) a été développée. Ces promoteurs dirigeront pour cette stratégie l'expression de la phytase de classe I telle qu'elle est naturellement exprimée au cours de la germination, c'est-à-dire qu'elle sera produite dans le cytoplasme de toutes les cellules de la plante (PHYT I). π.6b) Expression dans un compartiment cellulaire et/ou un tissu différent de celui contenant l'acide phytiqueCell 30: 763-773). In parallel with the use of a strong promoter, the promoter associated with the first intron of the rice Actin 1 gene (Me Elroy et al. 1991, M.G.G. 231: 150-160) has been developed. These promoters will direct for this strategy the expression of class I phytase as it is naturally expressed during germination, that is to say that it will be produced in the cytoplasm of all the cells of the plant. (PHYT I). π.6b) Expression in a cell compartment and / or a tissue different from that containing phytic acid
Dans une autre stratégie, nous visons à produire ectopiquement de la phytase de classe I dans le grain de maïs sec de manière à ce qu'elle n'interfère pas avec l'acide phytique produit dans le germe au cours de la maturation du grain Cette stratégie vise à optimiser la croissance des plantes selon l'invention. Le but est de procéder de telle manière que la phytase ne soit pas dans le même compartiment que la phytine, et de ce fait n'exercera son activité qu'au moment où les grains seront broyés et ingérés par l'animal ou lors de l'opération de trempage, première étape industrielle de l'extraction de l'amidon. Pour cette deuxième stratégie, nous utilisons deux approches différentes qui peuvent être combinées pour en faire une troisième.In another strategy, we aim to ectopically produce class I phytase in the dry corn kernel so that it does not interfere with the phytic acid produced in the germ during the maturation of the grain. strategy aims to optimize the growth of plants according to the invention. The goal is to proceed in such a way that the phytase is not in the same compartment as the phytin, and therefore will not exercise its activity until the grains are crushed and ingested by the animal or during the 'dipping operation, the first industrial stage of starch extraction. For this second strategy, we use two different approaches which can be combined to make a third.
H.όbl) Expression cytoplasmique dans l'albumen La première consiste à tirer partie de la morphologie du grain de maïs en exprimant la phytase de classe I de type cytoplasmique (PHYT I) dans le compartiment qui ne contient pas d'acide phytique, c'est-à-dire dans l'albumen. Ce compartiment tissulaire est très volumineux et peut permettre l'expression d'une grande quantité de phytase. Des promoteurs d'expression spécifique de ce tissu sont connus et nous avons choisi d'utiliser 2 promoteurs de gènes codant pour des protéines de réserves de céréales : le premier vient du gène de γ-zéine de maïs (Reina et al. 1990, N.A.R. 18 : 6425-6426) le deuxième vient du gène d'une protéine de réserve du blé, la "High Molecular Weight Glutenin" (Robert et al. 1989, The Plant Cell 1 : 569-578).H.όbl) Cytoplasmic expression in the albumen The first consists in taking advantage of the morphology of the grain of corn by expressing the phytase of class I of cytoplasmic type (PHYT I) in the compartment which does not contain phytic acid, c is to say in the albumen. This tissue compartment is very large and can allow the expression of a large amount of phytase. Promoters of specific expression of this tissue are known and we have chosen to use 2 promoters of genes coding for cereal reserve proteins: the first comes from the γ-zein gene of corn (Reina et al. 1990, NAR 18: 6425-6426) the second comes from the gene for a wheat storage protein, "High Molecular Weight Glutenin" (Robert et al. 1989, The Plant Cell 1: 569-578).
H.6b2) Expression constitutive dans l'espace extracellulaire La deuxième approche est semblable à la réalisation utilisant une phytase fongique (Pen et al. 1993, Biotechnology 1 1 : 81 1-814 et brevet d'invention de Pen et al. n° EP-0 449 375) chez le tabac et le colza via l'expression dans un compartiment cellulaire différent de celui où se trouve l'acide phytique. Le compartiment choisi étant l'espace extracellulaire. Pour cela on rajoute un signal d'adressage extracellulaire au début de la protéine phytase de classe I via une fusion en phase, pour donner une nouvelle protéine (Sec-PHYT I). Les signaux d'adressage qui permettent un transit via le réticulum endoplasmique puis l'appareil de golgi pour terminer dans les vésicules excrétrices sont bien connus de l'homme de l'art. Ils sont de plus clivés lors de la maturation de la protéine ; ceci garantit la production d'une protéine quasiment identique à la phytase originelle. Pour cette réalisation, nous avons choisi le peptide transit d'une "Pathogenesis Related Protein", la thaumatine du tabacH.6b2) Constitutive expression in the extracellular space The second approach is similar to the realization using a fungal phytase (Pen et al. 1993, Biotechnology 1 1: 81 1-814 and patent of invention of Pen et al. N ° EP-0 449 375) in tobacco and rapeseed via expression in a cell compartment different from that in which phytic acid is found. The compartment chosen is the extracellular space. For this, an extracellular addressing signal is added at the start of the class I phytase protein via a phase fusion, to give a new protein (Sec-PHYT I). The addressing signals which allow transit via the endoplasmic reticulum and then the golgi apparatus to terminate in the excretory vesicles are well known to those skilled in the art. They are further cleaved during the maturation of the protein; this guarantees the production of a protein almost identical to the original phytase. For this realization, we chose the transit peptide of a "Pathogenesis Related Protein", the thaumatin of tobacco
(Comelissen et al. 1986, Nature 321 : 531-532). Ce peptide a été utilisé avec succès pour la production d'albumine du sérum humain (Sijmons et al. 1990, Biotechnology 8 : 217-221) et pour la production de phytase d'Aspergillus (Pen et al. 1993, Biotechnology 1 1 : 81 1-814). Des promoteurs constitutifs peuvent être bien évidemment utilisés comme dans la réalisation de Pen et al. (1993, Biotechnology 1 1 : 81 1-814). Nous avons choisi le promoteur fort déjà mentionné : Actine de riz avec son premier intron.(Comelissen et al. 1986, Nature 321: 531-532). This peptide has been successfully used for the production of albumin from human serum (Sijmons et al. 1990, Biotechnology 8: 217-221) and for the production of Aspergillus phytase (Pen et al. 1993, Biotechnology 1 1: 81 1-814). Constitutive promoters can obviously be used as in the embodiment of Pen et al. (1993, Biotechnology 1 1: 81 1-814). We have chosen the strong promoter already mentioned: Rice actin with its first intron.
H.6b3) Expression extracellulaire dans l'albumen Prenant en compte l'opportunité que le maïs et les céréales en général ont un albumen développé, on peut combiner les deux approches précédentes à savoir : utiliser des promoteurs spécifiques de l'albumen pour exprimer la phytase excrétée (Sec-PHYT I). Les mêmes promoteurs que ceux utilisés pour l'expression de la phytase cytoplasmique, ont été choisis. Cette troisième approche garantit un fort taux d'expression de la phytase dans le grain de maïs assurant son absence d'expression dans le germe riche en acide phytique.H.6b3) Extracellular expression in endosperm Taking into account the opportunity that corn and cereals in general have a deep endosperm, we can combine the two previous approaches, namely: using specific endosperm promoters to express the excreted phytase (Sec-PHYT I). The same promoters as those used for the expression of the cytoplasmic phytase were chosen. This third approach guarantees a high level of phytase expression in the corn kernel ensuring its absence of expression in the germ rich in phytic acid.
L'expression ectopique de PHYT I et de Sec-PHYT I est détectée dans les différents organes des maïs transgéniques par la méthode Western.The ectopic expression of PHYT I and Sec-PHYT I is detected in the various organs of transgenic maize by the Western method.
IL 7) Analyse de l'expression spatio-temporelle du cDNA phy SU au cours de la germination et de la croissance de la plantuleIL 7) Analysis of the spatio-temporal expression of cDNA phy SU during germination and seedling growth
H.7a) Expression de la phytase au niveau du coléorhize de la racine et du coléoptile.H.7a) Expression of phytase at the level of the root beetlehize and the coleoptile.
Il est intéressant d'observer l'expression phytasique, et plus particulièrement, son expression dans certains organes de la plante et/ou à certaines étapes du développement de la plante.It is interesting to observe phytase expression, and more particularly, its expression in certain organs of the plant and / or at certain stages in the development of the plant.
Une première analyse a été réalisée par Northern blots sur des RNAs totaux extraits à divers stades du développement (1, 2, 4 et 7 jours) de différentes parties de la jeune plantule (coléoptile, feuille, scutellum, coléorhize et racine). Les résultats des Northerns montrent une accumulation importante du mRNA phytase à 1 jour dans le coléorhize, la racine et le coléoptile. Le signal d'hybridation diminue ensuite dans la racine au cours des stades suivants (2, 4 et 7 jours). Il continue à augmenter dans le coléoptile au moins jusqu'au stade 4 jours.A first analysis was carried out by Northern blots on total RNAs extracted at various stages of development (1, 2, 4 and 7 days) from different parts of the young seedling (coleoptile, leaf, scutellum, coleorrhize and root). The results of the Northerns show a significant accumulation of mRNA phytase at 1 day in the coleorhize, the root and the coleoptile. The hybridization signal then decreases in the root during the following stages (2, 4 and 7 days). It continues to increase in the coleoptile at least until the 4-day stage.
Des Northerns ont également été réalisés sur les RNAs totaux extraits de feuilles ou de racines de plantes adultes (1 mois). Alors qu'aucune hybridation avec l'ADNc phytase n'est observée dans le cas des RNAs de feuilles, un signal faible mais significatif est observé avec les RNAs provenant de racines: la présence de RNA phytase est donc détectée dans les transcrits provenant de racines adultes, à un stade très postérieur à la germination.Northerns were also carried out on total RNAs extracted from leaves or roots of adult plants (1 month). While no hybridization with phytase cDNA is observed in the case of leaf RNAs, a weak signal but significant is observed with RNAs originating from roots: the presence of RNA phytase is therefore detected in transcripts originating from adult roots, at a stage very after germination.
Des hybridations m situ, réalisées sur les embryons à 1 jour, mettent également en évidence une accumulation importante du mRNA phytase au niveau du coléoptile et de la racine. De plus par immunolocalisation sur des coupes au même stade on a pu localiser la protéine phytase au même endroit que son mRNAM situ hybridizations, carried out on embryos at 1 day, also demonstrate a significant accumulation of mRNA phytase at the level of the coleoptile and the root. In addition, by immunolocation on sections at the same stage, it was possible to locate the protein phytase in the same place as its mRNA.
H.7b) Expression de la phytase au niveau de l'endoderme et du péricycle racinaires La présence de mRNA phytase dans les RNAs totaux de racine adulte a conduit à se poser la question de la localisation cellulaire de ce transcrit dans les racinesH.7b) Expression of phytase at the level of the root endoderm and pericycle The presence of mRNA phytase in the total RNAs of adult root has led to the question of the cellular localization of this transcript in the roots
Des hybridations /// situ sur coupes transversales ( 4, 8 ou 14 jours) ont montré que les transcrits phytases sont localisés essentiellement au niveau de deux assises cellulaires entourant le cylindre central l'endoderme et le péricycle On en détecte également au niveau de l'épiderme La phytase révélée par immunolocalisation se situe au niveau des mêmes assises cellulaires L'ensemble de ces données montrent donc une expression très localisée de la phytase au niveau des racines portant a la fois sur le messager, la protéine et l'activité enzymatiqueHybridizations /// situated on transverse sections (4, 8 or 14 days) have shown that phytase transcripts are located essentially at the level of two cellular layers surrounding the central cylinder, the endoderm and the pericycle. We also detect them at the level of l epidermis The phytase revealed by immunolocation is located at the same cellular base All of these data therefore show a very localized expression of the phytase at the level of the roots bearing at the same time on the messenger, the protein and the enzymatic activity
L'endoderme est connu pour constituer une barrière physiologique importante c'est au niveau de cette assise cellulaire que se produit la régulation du transport sélectif des minéraux vers le cylindre central et par la suite vers les parties aériennes de la plante Ces résultats amènent à penser que la phytine observée dans les cellules de ces assises (Van Steveninck et al , 1993) et son hydrolyse par la phytase pourrait jouer un rôle important dans la régulation des flux de phosphate et de cations vers les parties aériennesThe endoderm is known to constitute an important physiological barrier it is at the level of this cellular base that occurs the regulation of the selective transport of minerals to the central cylinder and subsequently to the aerial parts of the plant These results lead to think that the phytin observed in the cells of these foundations (Van Steveninck et al, 1993) and its hydrolysis by phytase could play an important role in regulating the flow of phosphate and cations towards the aerial parts
L'ensemble de ces résultats suggèrent que l'un des deux gènes phytase s'exprime préférentiellement au cours de la germination dans l'embryon, coléoptile et racine, et est impliqué dans la mobilisation de la phytine stockée dans le germe L'autre gène est plutôt spécifique de la racine (épiderme, endoderme et/ ou péπcycle) et est régulé de façon distincte pour contrôler l'homéostasie du phosphate et des cations dans la plante C'est ce que démontre l'exemple suivantAll of these results suggest that one of the two phytase genes is expressed preferentially during germination in the embryo, coleoptile and root, and is involved in the mobilization of the phytin stored in the germ. The other gene is rather specific for the root (epidermis, endoderm and / or period) and is regulated separately to control the homeostasis of phosphate and cations in the plant. This is demonstrated by the following example
II.8) Discrimination des transcrits de classe I et II par RT-PCRII.8) Discrimination of class I and II transcripts by RT-PCR
La forte homologie observée entre les séquences transcrites des deux gènes de classe I et II ne permet pas de produire des sondes spécifiques de l'un ou l'autre gène II est donc difficile à l'aide de telles sondes de vérifier l'hypothèse selon laquelle l'un des deux gènes serait spécifique de la germination et l'autre des racinesThe strong homology observed between the transcribed sequences of the two class I and II genes does not allow the production of specific probes for one or the other gene II is therefore difficult using such probes to verify the hypothesis according to which one of the two genes is specific for germination and the other for roots
Cependant, la comparaison des séquences codantes des 2 gènes de classe I et II montre la présence de 2 codons supplémentaires en 5' du gène de classe II codant pour deux acides aminés supplémentaires ( acides aminés 7 et 25 de la protéine codée par le gène de classe II, Figure 6)However, the comparison of the coding sequences of the 2 class I and II genes shows the presence of 2 additional codons 5 ′ of the class II gene coding for two additional amino acids (amino acids 7 and 25 of the protein encoded by the gene for class II, Figure 6)
Mettant à profit la différence résultant de la présence du premier codon supplémentaire, deux oligonucléotides (20-mères), A (SEQ ID N° 4) spécifique du gène de classe I et B (SEQ ID N° 5) spécifique du gène de classe II ont été synthétisés Ces ohgos débutent au niveau de l'ATG et se terminent pour B sur le premier codon supplémentaire et pour A sur le codon suivant Deux autres ohgos communs aux deux gènes ont également été synthétisés l'un C (SEQ ED N° 6) situé a environ 200 pb en aval des 2 premiers, l'autre D (SEQ ID N° 7) situe a environ 300 pb en aval de C L'oligo D permet en présence de réverse transcriptase et d'une population de RNAs totaux de synthétiser par réverse transcription les brins de cDNA complémentaires des mR As phytase Ces cDNAs sont ensuite utilises pour réaliser des amplifications par PCR en présence soit du couple d'oligo A+C, soit du couple B+C Des contrôles ont montré que la combinaison A+C amplifiait bien spécifiquement la région correspondante du plasmide contenant le gène I, tandis que la combinaison B+C amplifiait spécifiquement le cDNA correspondant au plasmide de classe IITaking advantage of the difference resulting from the presence of the first additional codon, two oligonucleotides (20-mer), A (SEQ ID No. 4) specific for the class I gene and B (SEQ ID No. 5) specific for the class gene II have been synthesized These ohgos start at the ATG level and end for B on the first additional codon and for A on the following codon Two other ohgos common to the two genes have also been synthesized one C (SEQ ED N ° 6) located approximately 200 bp downstream of the first 2, the other D (SEQ ID No. 7) located approximately 300 bp downstream of C Oligo D allows in the presence of reverse transcriptase and a population of RNAs total to synthesize by reverse transcription the cDNA strands complementary to the mR As phytase These cDNAs are then used to carry out amplifications by PCR in the presence of either the oligo A + C pair or the B + C pair. Controls have shown that the combination A + C specifically amplified the a corresponding region of the plasmid containing the gene I, while the combination B + C specifically amplified the cDNA corresponding to the class II plasmid
De plus il a ete montre qu'il existait une proportionalite entre la quantité de plasmide utilisée pour la PCR et l'amplification obtenue.In addition, it has been shown that there is a proportionality between the quantity of plasmid used for the PCR and the amplification obtained.
Les RNAs extraits des différentes parties de la plantule à des stades distincts ont été ainsi testés par RT-PCR. Les premiers résultats réalisés sur des RNAs extraits à 4 jours, montrent que dans le coléoptile seul le gène de classe I est abondamment exprimé. Dans les RNAs provenant de la racine, les deux gènes I et II sont exprimés de façon à peu près identique.The RNAs extracted from the different parts of the seedling at different stages were thus tested by RT-PCR. The first results carried out on RNAs extracted at 4 days show that in the coleoptile only the class I gene is abundantly expressed. In the RNAs originating from the root, the two genes I and II are expressed more or less identically.
D'après ces résultats, le promoteur du gène I contrôle l'expression de la phytase dans les organes embryonnaires (coléoptile, coléorhize, racine embryonnaire) et régule la mobilisation de la phytine stockée dans l'embryon. De son côté, le promoteur du gène II est spécifique des assises cellulaires racinaires impliquées dans le contrôle de l'homéostasie des minéraux dans la plante.According to these results, the promoter of gene I controls the expression of phytase in the embryonic organs (coleoptile, coleorhize, embryonic root) and regulates the mobilization of the phytin stored in the embryo. For its part, the promoter of gene II is specific to the root cell bases involved in the control of homeostasis of minerals in the plant.
II.9) Analyse de l'expression ectopique de la phytase dans les maïs transgéniques : protéine, activité enzymatique et niveau d'expression π.9a) Mise en évidence de l'expression ectopique d'une phytase conforme L'analyse des transformants primaires a été réalisée tout d'abord par analyse Western des protéines isolées de feuilles de plantes acclimatées en serre et de graines sèches obtenues après croisement avec du pollen d'une variété élite non transformée. Dans ce dernier cas, 6 graines sont broyées simultanément, ceci afin de maximiser les chances d'en avoir au moins une contenant le transgène (en théorie 50 % au moins portent le transgène).II.9) Analysis of the ectopic expression of phytase in transgenic maize: protein, enzymatic activity and level of expression π.9a) Demonstration of the ectopic expression of a conforming phytase Analysis of primary transformants was firstly carried out by Western analysis of proteins isolated from leaves of plants acclimatized in a greenhouse and from dry seeds obtained after crossing with pollen of an elite unprocessed variety. In the latter case, 6 seeds are crushed simultaneously, this in order to maximize the chances of having at least one containing the transgene (in theory at least 50% carry the transgene).
Les extractions et les westerns ont été réalisés comme décrit dans Labouré et al., Biochem. J., 1993, 295, 413-419 avec la modification suivante : avant l'électrophorèse, les protéines ont été précipitées au TCA 10 %, lavées 2 fois à l 'acétone 80 % avant d'être reprises dans le tampon de dépôt ; des produits non protéiques réagissant avec l'anticorps ont en effet été trouvés notamment dans les extraits de feuilles. Ces produits ont été éliminés par cette précipitation.Extractions and westerns were carried out as described in Labouré et al., Biochem. J., 1993, 295, 413-419 with the following modification: before electrophoresis, the proteins were precipitated with 10% TCA, washed twice with 80% acetone before being taken up in the deposition buffer; non-protein products reacting with the antibody have indeed been found in particular in leaf extracts. These products were eliminated by this precipitation.
Pour les différents gènes chimériques, nous avons pu mettre en évidence l'expression d'une protéine réagissant spécifiquement avec les anticorps anti Phytase et qui comigrait avec la phytase détectable dans des extraits de germinations âgées de 5 - 6 jours de maïs non transgénique. L'expression dans les feuilles était détectable uniquement avec les gènes portés par les plasmides pBIOS 259, pBIOS 264 et pBIOS 268 bis ; ceci était attendu car les promoteurs utilisés sont constitutifs. Une expression dans les graines a aussi été visualisée sur la majorité des transformants exprimant au niveau des feuilles. La taille de la Phytase ectopique exprimée par le construit constitutif excrétion : gène Sec -Phyt I, est identique à celle de la Phytase détectée pendant la germination. Ceci indique que la maturation s'effectue bien à l'endroit attendu juste après le signal d'adressage PR-S.For the various chimeric genes, we have been able to demonstrate the expression of a protein reacting specifically with anti-Phytase antibodies and which co-migrates with the detectable phytase in extracts of germination aged 5 - 6 days of non-transgenic corn. Expression in the leaves was detectable only with the genes carried by the plasmids pBIOS 259, pBIOS 264 and pBIOS 268 bis; this was expected because the promoters used are constitutive. Seed expression was also seen on the majority of transformants expressing at the leaf level. The size of the ectopic Phytase expressed by the constitutive excretion construct: Sec -Phyt I gene, is identical to that of the Phytase detected during germination. This indicates that maturation is taking place in the expected location just after the PR-S addressing signal.
Pour les transformants ayant intégré les gènes à expression spécifique dans l'albumen, comme attendu aucune expression n'a été mise en évidence dans les feuilles. Dans les graines, nous avons obtenus pour certains transformants une expression ectopique très forte qui était supérieure à la quantité normalement présente dans des extraits de germinations âgées de 6 jours.For the transformants having integrated the genes with specific expression in the endosperm, as expected no expression was highlighted in the leaves. In the seeds, we obtained for certain transformants a very strong ectopic expression which was greater than the amount normally present in extracts of germinations aged 6 days.
Sur la base des résultats western, nous obtenons des taux d'expression qui varient dans les feuilles entre 0,005 % et 0,3 % des protéines totales solubles. Dans les graines, la phytase ectopique varie de 0,03 % à I % des protéines totales solubles.Based on the western results, we obtain expression rates which vary in the leaves between 0.005% and 0.3% of the total soluble proteins. In seeds, ectopic phytase ranges from 0.03% to 1% of total soluble protein.
H.9b) Activité Phytasique dans les feuilles et graines de maïs transgéniquesH.9b) Phytase activity in transgenic corn leaves and seeds
La détection par western de phytase ectopique ne suffisait pas pour affirmer que nous avions réussi à avoir une protéine capable d'hydrolyser l'acide phytique car des modifications posttraductionnelles peuvent influer sur l'activité de la protéine. Aussi, nous avons dosé l'activité phytasique des extraits transgéniques comparativement à des extraits issus de germinations âgées de 5 à 6 jours. Cinq transformants positifs en western ont été analysés : 3 au niveau feuille et 2 au niveau graine. Les résultats sont donnés ci-dessous en nmoles de phosphate inorganique libérées en 1 heure à 55°C et par mg de protéines.The western detection of ectopic phytase was not enough to say that we had succeeded in having a protein capable of hydrolyzing phytic acid because post-translational modifications can influence the activity of the protein. Also, we measured the phytase activity of transgenic extracts compared to extracts from germinations aged 5 to 6 days. Five positive western transformants were analyzed: 3 at leaf level and 2 at seed level. The results are given below in nmoles of inorganic phosphate released over 1 hour at 55 ° C. and per mg of proteins.
Extraits Activité PhytasiquePhytase Activity Extracts
(nmoles Pi / h / mg de prot.) Germinations 5 jours (Maïs non transformé) 3 500(nmoles Pi / h / mg of prot.) Germination 5 days (unprocessed corn) 3,500
Feuilles (pBIOS 264) événement 2D 1 950Sheets (pBIOS 264) 2D event 1,950
Feuilles (pBIOS 264) événement 2H 1 800Sheets (pBIOS 264) event 2H 1 800
Feuilles (pBIOS 259) événement 2A 1 000 Graines sèches (pBIOS 258) événement 1 J 3 050Leaves (pBIOS 259) event 2A 1,000 Dry seeds (pBIOS 258) event 1 D 3,050
Graines sèches (pBIOS 258) événement IF 3 600Dry seeds (pBIOS 258) event IF 3 600
Ces résultats démontrent que la phytase produite selon l'invention est active biologiquement et parfaitement conforme, notamment dans le grain de mais qui sert de base à l'alimentation des monogastriques, alors qu'il est connu que le maïs non transformé (grains et feuilles) possède une activité phytase déficiente et pratiquement indétectable. These results demonstrate that the phytase produced according to the invention is biologically active and perfectly compliant, in particular in corn grain which serves as a basis for feeding monogastrics, while it is known that unprocessed corn (grains and leaves ) has a deficient and practically undetectable phytase activity.
LISTE DE SEQUENCESLIST OF SEQUENCES
(1) INFORMATIONS GENERALES:(1) GENERAL INFORMATION:
(i) DEPOSANT:(i) DEPOSITOR:
(A) NOM: BIOCEM(A) NAME: BIOCEM
(B) RUE: 24 AVENUE DES LANDAIS(B) STREET: 24 AVENUE DES LANDAIS
(C) VILLE: AUBIERE(C) CITY: AUBIERE
(E) PAYS: FRANCE(E) COUNTRY: FRANCE
(F) CODE POSTAL: 63170(F) POSTAL CODE: 63170
(A) NOM: INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE(A) NAME: NATIONAL INSTITUTE OF AGRONOMIC RESEARCH
(INRA)(INRA)
(B) RUE: 147 RUE DE L'UNIVERSITE(B) STREET: 147 STREET OF THE UNIVERSITY
(C) VILLE: PARIS(C) CITY: PARIS
(E) PAYS: FRANCE(E) COUNTRY: FRANCE
(F) CODE POSTAL: 75007(F) POSTAL CODE: 75007
(n) TITRE DE L' INVENTION: PHYTASES DE PLANTES ET APPLICATIONS BIOTECHNOLOGIQUES(n) TITLE OF THE INVENTION: PLANT PHYTASES AND BIOTECHNOLOGICAL APPLICATIONS
(m) NOMBRE DE SEQUENCES: 15(m) NUMBER OF SEQUENCES: 15
(iv) FORME DECHIFFRABLE PAR ORDINATEUR:(iv) COMPUTER-DETACHABLE FORM:
(A) TYPE DE SUPPORT: Floppy disk(A) TYPE OF SUPPORT: Floppy disk
(B) ORDINATEUR: IBM PC compatible(B) COMPUTER: IBM PC compatible
(C) SYSTEME D' EXPLOITATION: PC-DOS/MS-DOS(C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) LOGICIEL: Patentin Release #1.0, Version #1.30 (OEB)(D) SOFTWARE: Patentin Release # 1.0, Version # 1.30 (EPO)
(vi) DONNEES DE LA DEMANDE ANTERIEURE:(vi) DATA FROM THE PREVIOUS APPLICATION:
(A) NUMERO DE LA DEMANDE: FR 9609734(A) REQUEST NUMBER: FR 9609734
(B) DATE DE DEPOT: 01-AUG-1996(B) DEPOSIT DATE: 01-AUG-1996
(2) INFORMATIONS POUR LA SEQ ID NO: 1:(2) INFORMATION FOR SEQ ID NO: 1:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 1335 paires de bases(A) LENGTH: 1335 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(il) TYPE DE MOLECULE ADNc(il) TYPE OF cDNA MOLECULE
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: ADNc de la phytase de mais(A) NAME / KEY: corn phytase cDNA
(îx) CARACTERISTIQUE:(îx) CHARACTERISTIC:
(A) NOM/CLE: CDS(A) NAME / KEY: CDS
(B) EMPLACEMENT: 32..1192(B) LOCATION: 32..1192
(κi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 1:(κi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:
ΛICCATCCTT ATTGAGCTTA GTGTTTGATC C ATG GAC TCG GAA GGA GTA GCA 52ΛICCATCCTT ATTGAGCTTA GTGTTTGATC C ATG GAC TCG GAA GGA GTA GCA 52
Met Asp Ser Glu Gly Val Ala 1 5 GCA AAG GTG GCA GAT GAG ACT ACT AAA CCG GCA AGC CAA GAA GAC GGC 100 Ala Lys Val Ala Asp Glu Thr Thr Lys Pro Ala Ser Gin Glu Asp Gly 10 15 20Met Asp Ser Glu Gly Val Ala 1 5 GCA AAG GTG GCA GAT GAG ACT ACT AAA CCG GCA AGC CAA GAA GAC GGC 100 Ala Lys Val Ala Asp Glu Thr Thr Lys Pro Ala Ser Gin Glu Asp Gly 10 15 20
GAG AGC AAG GCC GGG ATG ACT GAT CTG CTG ATG CTG ACC GAC AAG TCG 148 Glu Ser Lys Ala Gly Met Thr Asp Leu Leu Met Leu Thr Asp Lys Ser 25 30 35GAG AGC AAG GCC GGG ATG ACT GAT CTG CTG ATG CTG ACC GAC AAG TCG 148 Glu Ser Lys Ala Gly Met Thr Asp Leu Leu Met Leu Thr Asp Lys Ser 25 30 35
CAG CTG CAG GCG CTA GCG ATG CTG CTG CGG AAC AAC GAG GAG CTC ATG 196 Gin Leu Gin Ala Leu Ala Met Leu Leu Arg Asn Asn Glu Glu Leu Met 40 45 50 55CAG CTG CAG GCG CTA GCG ATG CTG CTG CGG AAC AAC GAG GAG CTC ATG 196 Gin Leu Gin Ala Leu Ala Met Leu Leu Arg Asn Asn Glu Glu Leu Met 40 45 50 55
ATG AGC CAA GCG ATC AAG TCG GAG ACG GAG CGC GTT GAG TAC CTC AAG 244 Met Ser Gin Ala Ile Lys Ser Glu Thr Glu Arg Val Glu Tyr Leu Lys 60 65 70ATG AGC CAA GCG ATC AAG TCG GAG ACG GAG CGC GTT GAG TAC CTC AAG 244 Met Ser Gin Ala Ile Lys Ser Glu Thr Glu Arg Val Glu Tyr Leu Lys 60 65 70
ACG GTG AGC GAC TGC TAC ACG CGG ACA ATG AAG CTC CTT GAC GAC TCC 292 Thr Val Ser Asp Cys Tyr Thr Arg Thr Met Lys Leu Leu Asp Asp Ser 75 80 85ACG GTG AGC GAC TGC TAC ACG CGG ACA ATG AAG CTC CTT GAC GAC TCC 292 Thr Val Ser Asp Cys Tyr Thr Arg Thr Met Lys Leu Leu Asp Asp Ser 75 80 85
ATG GCC GCC AGG ATC ACG TAC GAG CGT TCG GGC GGA ACG AGG AGC CTC 340 Met Ala Ala Arg Ile Thr Tyr Glu Arg Ser Gly Gly Thr Arg Ser Leu 90 95 100ATG GCC GCC AGG ATC ACG TAC GAG CGT TCG GGC GGA ACG AGG AGC CTC 340 Met Ala Ala Arg Ile Thr Tyr Glu Arg Ser Gly Gly Thr Arg Ser Leu 90 95 100
GTC GCC CGG GAC ATG GAC GAC TAC GTC GTC TAC GGC CTC AAC GCG TGC 388 Val Ala Arg Asp Met Asp Asp Tyr Val Val Tyr Gly Leu Asn Ala Cys 105 110 115GTC GCC CGG GAC ATG GAC GAC TAC GTC GTC TAC GGC CTC AAC GCG TGC 388 Val Ala Arg Asp Met Asp Asp Tyr Val Val Tyr Gly Leu Asn Ala Cys 105 110 115
TTG CAG AAC GTC CGC AAC TGC TGC GTG CGT CTG GAC GCC ATC GAC AAG 436 Leu Gin Asn Val Arg Asn Cys Cys Val Arg Leu Asp Ala Ile Asp Lys 120 125 130 135TTG CAG AAC GTC CGC AAC TGC TGC GTG CGT CTG GAC GCC ATC GAC AAG 436 Leu Gin Asn Val Arg Asn Cys Cys Val Arg Leu Asp Ala Ile Asp Lys 120 125 130 135
CTG CGG GCG CAC TAC GAC GCC CTC GCC GAC GCC GTC GCC GAA CCG GCC 484 Leu Arg Ala His Tyr Asp Ala Leu Ala Asp Ala Val Ala Glu Pro Ala 140 145 150CTG CGG GCG CAC TAC GAC GCC CTC GCC GAC GCC GTC GCC GAA CCG GCC 484 Leu Arg Ala His Tyr Asp Ala Leu Ala Asp Ala Val Ala Glu Pro Ala 140 145 150
GCC AAC GTC GAG GGC CTC GCC GCG GAG GCG TCC GAG TAC AAG GCC GCC 532 Ala Asn Val Glu Gly Leu Ala Ala Glu Ala Ser Glu Tyr Lys Ala Ala 155 160 165GCC AAC GTC GAG GGC CTC GCC GCG GAG GCG TCC GAG TAC AAG GCC GCC 532 Ala Asn Val Glu Gly Leu Ala Ala Glu Ala Ser Glu Tyr Lys Ala Ala 155 160 165
ATG TGG CAG TAC TGC TAC AAC CAG CGG AGC GCC TCC GCG CGG GCG CAC 580 Met Trp Gin Tyr Cys Tyr Asn Gin Arg Ser Ala Ser Ala Arg Ala His 170 175 180ATG TGG CAG TAC TGC TAC AAC CAG CGG AGC GCC TCC GCG CGG GCG CAC 580 Met Trp Gin Tyr Cys Tyr Asn Gin Arg Ser Ala Ser Ala Arg Ala His 170 175 180
TCC CGC GCC TAC TCC CAG GCG CTC AAG CTG GAG GGC ATC GAC TTC GCC 628 Ser Arg Ala Tyr Ser Gin Ala Leu Lys Leu Glu Gly Ile Asp Phe Ala 185 190 195TCC CGC GCC TAC TCC CAG GCG CTC AAG CTG GAG GGC ATC GAC TTC GCC 628 Ser Arg Ala Tyr Ser Gin Ala Leu Lys Leu Glu Gly Ile Asp Phe Ala 185 190 195
GAG CTT GTG CGG AGG CAC CAG CTC CGG CTC GGG TAC GGC AGC AAG GGC 676 Glu Leu Val Arg Arg His Gin Leu Arg Leu Gly Tyr Gly Ser Lys Gly 200 205 210 215GAG CTT GTG CGG AGG CAC CAG CTC CGG CTC GGG TAC GGC AGC AAG GGC 676 Glu Leu Val Arg Arg His Gin Leu Arg Leu Gly Tyr Gly Ser Lys Gly 200 205 210 215
GAG GAG TTC GAG GAC CTG GAC GAC ACC CAG AAG CTG GAG GTG TAC AAC 724 Glu Glu Phe Glu Asp Leu Asp Asp Thr Gin Lys Leu Glu Val Tyr Asn 220 225 230GAG GAG TTC GAG GAC CTG GAC GAC ACC CAG AAG CTG GAG GTG TAC AAC 724 Glu Glu Phe Glu Asp Leu Asp Asp Thr Gin Lys Leu Glu Val Tyr Asn 220 225 230
AGC ATC ATC GTC GAG TCG GGG CGG GCG GGG CTA CCG GTG CGG ATG TTC 772 Ser Ile Ile Val Glu Ser Gly Arg Ala Gly Leu Pro Val Arg Met Phe 235 240 245 TCA TCG GGC CGC TCT GCC GGT GGC CCT AAG ATT GCA GCC ACG ACG TGG 820 Ser Ser Gly Arg Ser Ala Gly Gly Pro Lys Ile Ala Ala Thr Thr Trp 250 255 260AGC ATC ATC GTC GAG TCG GGG CGG GCG GGG CTA CCG GTG CGG ATG TTC 772 Ser Ile Ile Val Glu Ser Gly Arg Ala Gly Leu Pro Val Arg Met Phe 235 240 245 TCA TCG GGC CGC TCT GCC GGT GGC CCT AAG ATT GCA GCC ACG ACG TGG 820 Ser Ser Gly Arg Ser Ala Gly Gly Pro Lys Ile Ala Ala Thr Thr Trp 250 255 260
GCG CAG GCG GTG AGC GTC TTC ATC ATG GCG GCG GGC AAC CTG GCG TGG 868 Ala Gin Ala Val Ser Val Phe Ile Met Ala Ala Gly Asn Leu Ala Trp 265 270 275GCG CAG GCG GTG AGC GTC TTC ATC ATG GCG GCG GGC AAC CTG GCG TGG 868 Ala Gin Ala Val Ser Val Phe Ile Met Ala Ala Gly Asn Leu Ala Trp 265 270 275
GAC GTG TTC ACC ACG GAG CAC GAG GTG GAG GCC ATC CTC AAG GGC AGC 916 Asp Val Phe Thr Thr Glu His Glu Val Glu Ala Ile Leu Lys Gly Ser 280 285 290 295GAC GTG TTC ACC ACG GAG CAC GAG GTG GAG GCC ATC CTC AAG GGC AGC 916 Asp Val Phe Thr Thr Glu His Glu Val Glu Ala Ile Leu Lys Gly Ser 280 285 290 295
CTC AAC CTC CTG GCG GGG CTA GGG GGC TTC GCC GTG GAG GCC GTC GTC 964 Leu Asn Leu Leu Ala Gly Leu Gly Gly Phe Ala Val Glu Ala Val Val 300 305 310CTC AAC CTC CTG GCG GGG CTA GGG GGC TTC GCC GTG GAG GCC GTC GTC 964 Leu Asn Leu Leu Ala Gly Leu Gly Gly Phe Ala Val Glu Ala Val Val 300 305 310
GGC GCG GCT GTC ACC AAG GCG GTC GCA AAC GTC GCC GCC GGC GTC TTT 1012 Gly Ala Ala Val Thr Lys Ala Val Ala Asn Val Ala Ala Gly Val Phe 315 320 325GGC GCG GCT GTC ACC AAG GCG GTC GCA AAC GTC GCC GCC GGC GTC TTT 1012 Gly Ala Ala Val Thr Lys Ala Val Ala Asn Val Ala Ala Gly Val Phe 315 320 325
GCT TGC TCT CTC GCG GGC TTC GTC GTG GGC GCC ATC GCC GGG CTG ATC 1060 Ala Cys Ser Leu Ala Gly Phe Val Val Gly Ala Ile Ala Gly Leu Ile 330 335 340GCT TGC TCT CTC GCG GGC TTC GTC GTG GGC GCC ATC GCC GGG CTG ATC 1060 Ala Cys Ser Leu Ala Gly Phe Val Val Gly Ala Ile Ala Gly Leu Ile 330 335 340
TTC GTC GGC GTC AGC GGC CTC CTC ATT AAC CTC ATC ATC GGC TCC CCT 1108 Phe Val Gly Val Ser Gly Leu Leu Ile Asn Leu Ile Ile Gly Ser Pro 345 350 355TTC GTC GGC GTC AGC GGC CTC CTC ATT AAC CTC ATC ATC GGC TCC CCT 1108 Phe Val Gly Val Ser Gly Leu Leu Ile Asn Leu Ile Gly Ser Pro 345 350 355
AGG AAG GTG CCT GAC ATG AGC AAG CTC ATG TTC CAC ACC GCC GTC ATG 1156 Arg Lys Val Pro Asp Met Ser Lys Leu Met Phe His Thr Ala Val Met 360 365 370 375AGG AAG GTG CCT GAC ATG AGC AAG CTC ATG TTC CAC ACC GCC GTC ATG 1156 Arg Lys Val Pro Asp Met Ser Lys Leu Met Phe His Thr Ala Val Met 360 365 370 375
CCC GAT GGA ATG GCC CTT GCG TAT GCG GTA TCT CAT TAATTACTTA 1202CCC GAT GGA ATG GCC CTT GCG TAT GCG GTA TCT CAT TAATTACTTA 1202
Pro Asp Gly Met Ala Leu Ala Tyr Ala Val Ser His 380 385Pro Asp Gly Met Ala Leu Ala Tyr Ala Val Ser His 380 385
TTATCATCGC AGTCACTACC AATGCAACTG CTTCAGATCC TACTGTTGGA ACGCGTGTGG 1262TTATCATCGC AGTCACTACC AATGCAACTG CTTCAGATCC TACTGTTGGA ACGCGTGTGG 1262
AAATAATAAA GCAATAATAA TAATTATTAT TGTAATAACA ATAATTATGA TAT.ATTGATA 1322AAATAATAAA GCAATAATAA TAATTATTAT TGTAATAACA ATAATTATGA TAT.ATTGATA 1322
ATGATTATAT ATC 1335ATGATTATAT ATC 1335
(2) INFORMATIONS POUR LA SEQ ID NO: 2:(2) INFORMATION FOR SEQ ID NO: 2:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 4695 paires de bases(A) LENGTH: 4,695 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(il) TYPE DE MOLECULE: ADN(il) TYPE OF MOLECULE: DNA
(îx) CARACTERISTIQUE:(îx) CHARACTERISTIC:
(A) NOM/CLE: clone classe I / P19.14(A) NAME / KEY: class I clone / P19.14
(îx) CARACTERISTIQUE:(îx) CHARACTERISTIC:
(A) NOM/CLE: CDS(A) NAME / KEY: CDS
(B) EMPLACEMENT: 2097..3260 (xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 2:(B) LOCATION: 2097..3260 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:
AAGCTTTCTG AAAAAGTCCA ATCACTAAAA TTGAGTTCAG AGTAAAAACT TATGGCATTT 60AAGCTTTCTG AAAAAGTCCA ATCACTAAAA TTGAGTTCAG AGTAAAAACT TATGGCATTT 60
TTCGTGAAGC TGGTTGTGCA GCGGCAATGC GACACGGATG AGCGGCAGCA TAGGGCCTGT 120TTCGTGAAGC TGGTTGTGCA GCGGCAATGC GACACGGATG AGCGGCAGCA TAGGGCCTGT 120
ATAGCCCCAA ACAGCTAGTT TTAACCCCAA CGACTAGTTT TGGTTGGGGT TATATTTACA 180ATAGCCCCAA ACAGCTAGTT TTAACCCCAA CGACTAGTTT TGGTTGGGGT TATATTTACA 180
CATCCCACGC CCTGGGGTCC TGCTGGTGTC TAGAATAGTT CAAACTCATC CCAAACCATA 240CATCCCACGC CCTGGGGTCC TGCTGGTGTC TAGAATAGTT CAAACTCATC CCAAACCATA 240
TTTAAGCCCT CTCTAATTCC TCTATTTATG GGAGCGTGTG ACTAGTGTTT GATTACGGTT 300TTTAAGCCCT CTCTAATTCC TCTATTTATG GGAGCGTGTG ACTAGTGTTT GATTACGGTT 300
AAAGAACTGA TTAAGAGCTA GAGAGCAGAT CTAGAGCAAG ACAACCTTGA GCACTTGTCA 360AAAGAACTGA TTAAGAGCTA GAGAGCAGAT CTAGAGCAAG ACAACCTTGA GCACTTGTCA 360
GGCTTCGTCA ACATTCATTG CACACTCATT ACTCTTGGAG GGGAAGCCTC CTCAACGGCT 420GGCTTCGTCA ACATTCATTG CACACTCATT ACTCTTGGAG GGGAAGCCTC CTCAACGGCT 420
AGGCGTCCCC CGGTGATCTC CCATGCTTGT TGTGAACCGC AGGAAAGTCT GTAATTACCC 480AGGCGTCCCC CGGTGATCTC CCATGCTTGT TGTGAACCGC AGGAAAGTCT GTAATTACCC 480
CATATCTTAG TGAAAAAACC AGCTCAGTAT TTTGGTGGTG AGTTGAAACA GACTCCTTTT 540CATATCTTAG TGAAAAAACC AGCTCAGTAT TTTGGTGGTG AGTTGAAACA GACTCCTTTT 540
AGCTTCCTCA ACAACATGGA CTTAGACATA GCCTGACACA CTCTTATTTT GGATATCTCT 600AGCTTCCTCA ACAACATGGA CTTAGACATA GCCTGACACA CTCTTATTTT GGATATCTCT 600
ACTCCTTTAA AGCACCAGTT TCTTGTGTCG TGTGTCACGT GCGAAACTTG TTAGTCTGTT 660ACTCCTTTAA AGCACCAGTT TCTTGTGTCG TGTGTCACGT GCGAAACTTG TTAGTCTGTT 660
GCTCTCCCTT GCATCTTGCC TGACCATGGA CCCAATAGGT TGTTATACCA TAGATAGGCC 720GCTCTCCCTT GCATCTTGCC TGACCATGGA CCCAATAGGT TGTTATACCA TAGATAGGCC 720
ATGATAGACT ACCCAACGAG CTCAACCCGA TAGGAAGCCA CACACAACGC AACACTCTCA 780ATGATAGACT ACCCAACGAG CTCAACCCGA TAGGAAGCCA CACACAACGC AACACTCTCA 780
CATAGTACCA CCTCGCTAGC GGAAGGGAAC GAGCGATCGA GCGAGCTATA AAAATGTTCA 840CATAGTACCA CCTCGCTAGC GGAAGGGAAC GAGCGATCGA GCGAGCTATA AAAATGTTCA 840
GTCTGTTTGT CATGCCTGGC GTGGCCATAA TTATTCTTAG GGTATGTTAG ATTACTTTAG 900GTCTGTTTGT CATGCCTGGC GTGGCCATAA TTATTCTTAG GGTATGTTAG ATTACTTTAG 900
TCTCGGTATT AAAGTTTAGT CATTACTCTG TTTGGTTTCA GAGATTAAAA ATGTTCATAA 960TCTCGGTATT AAAGTTTAGT CATTACTCTG TTTGGTTTCA GAGATTAAAA ATGTTCATAA 960
CTCACTAAAA AATTTGTAAG AAGACCAAAA TATTCTTTAT CATTCTCTCG CCACTACTCT 1020CTCACTAAAA AATTTGTAAG AAGACCAAAA TATTCTTTAT CATTCTCTCG CCACTACTCT 1020
TCTCCCGCGA CAACGGAAAT AAATAAGGGG CAACCATGAA ATTGACATGT TTTAGGGGTT 1080TCTCCCGCGA CAACGGAAAT AAATAAGGGG CAACCATGAA ATTGACATGT TTTAGGGGTT 1080
GTTTGAATGC ACTAGAGCTA ATAGTTAGTC AGCTAAAAAT ATACTAGTAG AATTAGCTAA 1140GTTTGAATGC ACTAGAGCTA ATAGTTAGTC AGCTAAAAAT ATACTAGTAG AATTAGCTAA 1140
CTAACAAATA GTTAGCTAAC GAGTAGCTAA TTTACTAAAA ATAGTTAATA GCTAAACTAT 1200CTAACAAATA GTTAGCTAAC GAGTAGCTAA TTTACTAAAA ATAGTTAATA GCTAAACTAT 1200
ATATTAGCTA TAGGGTGTTT GGATGTCTCT AGCTAATTTT AGCTAACTAT TATCTCTAGT 1260ATATTAGCTA TAGGGTGTTT GGATGTCTCT AGCTAATTTT AGCTAACTAT TATCTCTAGT 1260
GCATTCAAAT AACCCCTTAA TCCCATTTAG TCACTCGAGG AACTACTATT TCCGGTGTCT 1320GCATTCAAAT AACCCCTTAA TCCCATTTAG TCACTCGAGG AACTACTATT TCCGGTGTCT 1320
TATTATTTAT CGTTTTGGAT AAGGTTTGAG TAAAACTTAT AAATTTTTTA CTATAAATAA 1380TATTATTTAT CGTTTTGGAT AAGGTTTGAG TAAAACTTAT AAATTTTTTA CTATAAATAA 1380
CTATTTTGAT ATTAGTTTGA AAACCTAATA CTTATATGCA TAGGTTTGTC TTAAAAAGTA 1440CTATTTTGAT ATTAGTTTGA AAACCTAATA CTTATATGCA TAGGTTTGTC TTAAAAAGTA 1440
CTTTTATAAA AGTATAAATG TAATAAGAGT TTATTTGTAT TTTAGGAAAA AACATCGGTC 1500CTTTTATAAA AGTATAAATG TAATAAGAGT TTATTTGTAT TTTAGGAAAA AACATCGGTC 1500
AAAGCTATAT ATATTTTGGA GACTATATCG TTGTCCTAAA CGACAATAAA AAGGCACCGA 1560AAAGCTATAT ATATTTTGGA GACTATATCG TTGTCCTAAA CGACAATAAA AAGGCACCGA 1560
GAGAGTAGGG ACTAAAGCGG TTTAATCTAT CCTTTACTGT TATTGTTTGA TAATTTATGG 1620GAGAGTAGGG ACTAAAGCGG TTTAATCTAT CCTTTACTGT TATTGTTTGA TAATTTATGG 1620
ATTAATGAGA CTAAAATTCT ATGACTAATC TTTAGTCCCC AAACTAAACA AACCCTTAGT 1680 ATGATTGATC CTGGACAGCA TACAGACCCA TGCTTAACTT GATACAACAC CAACAAGACC 1740ATTAATGAGA CTAAAATTCT ATGACTAATC TTTAGTCCCC AAACTAAACA AACCCTTAGT 1680 ATGATTGATC CTGGACAGCA TACAGACCCA TGCTTAACTT GATACAACAC CAACAAGACC 1740
AGACCCCACC CCCTTCCCTA TCAACGGAGG GATGATATAT TATTTAAGTG CATGCGCGTG 1800AGACCCCACC CCCTTCCCTA TCAACGGAGG GATGATATAT TATTTAAGTG CATGCGCGTG 1800
CTGCACGCTG TTATGGACCT ATTTGGTAGG ACTAGGAGTA GGATATATAT CACAAAGTTG 1860CTGCACGCTG TTATGGACCT ATTTGGTAGG ACTAGGAGTA GGATATATAT CACAAAGTTG 1860
TATACCTATA AATAGCTCGC TTTGATCATA TGATCTGCTG CCTTATACGA AACATAGCTA 1920TATACCTATA AATAGCTCGC TTTGATCATA TGATCTGCTG CCTTATACGA AACATAGCTA 1920
CTCCTACTAC TCAAATCCAT CCTTATTGTA AGTGCGGTCT TATAAGCTAC TACTAGTTAC 1980CTCCTACTAC TCAAATCCAT CCTTATTGTA AGTGCGGTCT TATAAGCTAC TACTAGTTAC 1980
AAGCTGGTTT ATACTTAACT ACAAGTAGCA ACGATTTGCC TTAGTATATA TGGTTCATAA 2040AAGCTGGTTT ATACTTAACT ACAAGTAGCA ACGATTTGCC TTAGTATATA TGGTTCATAA 2040
TACATAAATA TTGGAACTGA GACAATATAT ATATGCAGGA GCTTAGTGTT TGATCC 2096TACATAAATA TTGGAACTGA GACAATATAT ATATGCAGGA GCTTAGTGTT TGATCC 2096
ATG GAC TCG GAA GGA GTA GCA GCA AAG GTG GCA GAT GAG ACT ACT AAA 2144 Met Asp Ser Glu Gly Val Ala Ala Lys Val Ala Asp Glu Thr Thr Lys 1 5 10 15ATG GAC TCG GAA GGA GTA GCA GCA AAG GTG GCA GAT GAG ACT ACT AAA 2144 Met Asp Ser Glu Gly Val Ala Ala Lys Val Ala Asp Glu Thr Thr Lys 1 5 10 15
CCG GCA AGC CAA GAA GAC GGC GAG AGC AAG GCC GGG ATG ACT GAT CTG 2192 Pro Ala Ser Gin Glu Asp Gly Glu Ser Lys Ala Gly Met Thr Asp Leu 20 25 30CCG GCA AGC CAA GAA GAC GGC GAG AGC AAG GCC GGG ATG ACT GAT CTG 2192 Pro Ala Ser Gin Glu Asp Gly Glu Ser Lys Ala Gly Met Thr Asp Leu 20 25 30
CTG ATG CTG ACC GAC AAG TCG CAG CTG CAG GCG CTA GCG ATG CTG CTG 2240 Leu Met Leu Thr Asp Lys Ser Gin Leu Gin Ala Leu Ala Met Leu Leu 35 40 45CTG ATG CTG ACC GAC AAG TCG CAG CTG CAG GCG CTA GCG ATG CTG CTG 2240 Leu Met Leu Thr Asp Lys Ser Gin Leu Gin Ala Leu Ala Met Leu Leu 35 40 45
CGG AAC AAC GAG GAG CTC ATG ATG AGC CAA GCG ATC AAG TCG GAG ACG 2288 Arg Asn Asn Glu Glu Leu Met Met Ser Gin Ala Ile Lys Ser Glu Thr 50 55 60CGG AAC AAC GAG GAG CTC ATG ATG AGC CAA GCG ATC AAG TCG GAG ACG 2288 Arg Asn Asn Glu Glu Leu Met Met Ser Gin Ala Ile Lys Ser Glu Thr 50 55 60
GAG CGC GTT GAG TAC CTC AAG ACG GTG AGC GAC TGC TAC ACG CGG ACA 2336 Glu Arg Val Glu Tyr Leu Lys Thr Val Ser Asp Cys Tyr Thr Arg Thr 65 70 75 80GAG CGC GTT GAG TAC CTC AAG ACG GTG AGC GAC TGC TAC ACG CGG ACA 2336 Glu Arg Val Glu Tyr Leu Lys Thr Val Ser Asp Cys Tyr Thr Arg Thr 65 70 75 80
ATG AAG CTC CTT GAC GAC TCC ATG GCG GCC AGG ATC ACG TAC GAG CGT 2384 Met Lys Leu Leu Asp Asp Ser Met Ala Ala Arg Ile Thr Tyr Glu Arg 85 90 95ATG AAG CTC CTT GAC GAC TCC ATG GCG GCC AGG ATC ACG TAC GAG CGT 2384 Met Lys Leu Leu Asp Asp Ser Met Ala Ala Arg Ile Thr Tyr Glu Arg 85 90 95
TCG GGC GGA ACG AGG AGC CTC GTC GCC CGG GAC ATG GAC GAC TAC GTC 2432 Ser Gly Gly Thr Arg Ser Leu Val Ala Arg Asp Met Asp Asp Tyr Val 100 105 110TCG GGC GGA ACG AGG AGC CTC GTC GCC CGG GAC ATG GAC GAC TAC GTC 2432 Ser Gly Gly Thr Arg Ser Leu Val Ala Arg Asp Met Asp Asp Tyr Val 100 105 110
GTC TAC GGC CTC AAC GCG TGC TTG CAG AAC GTC CGC AAC TGC TGC GTG 2480 Val Tyr Gly Leu Asn Ala Cys Leu Gin Asn Val Arg Asn Cys Cys Val 115 120 125GTC TAC GGC CTC AAC GCG TGC TTG CAG AAC GTC CGC AAC TGC TGC GTG 2480 Val Tyr Gly Leu Asn Ala Cys Leu Gin Asn Val Arg Asn Cys Cys Val 115 120 125
CGT CTG GAC GCC ATC GAC AAG CTG CGG GCG CAC TAC GAC GCC CTC GCC 2528 Arg Leu Asp Ala Ile Asp Lys Leu Arg Ala His Tyr Asp Ala Leu Ala 130 135 140CGT CTG GAC GCC ATC GAC AAG CTG CGG GCG CAC TAC GAC GCC CTC GCC 2528 Arg Leu Asp Ala Ile Asp Lys Leu Arg Ala His Tyr Asp Ala Leu Ala 130 135 140
GAC GCC GTC GCC GAA CCG GCC GCC AAC GTC GAG GGC CTC GCC GCG GAG 2576 Asp Ala Val Ala Glu Pro Ala Ala Asn Val Glu Gly Leu Ala Ala Glu 145 150 155 160GAC GCC GTC GCC GAA CCG GCC GCC AAC GTC GAG GGC CTC GCC GCG GAG 2576 Asp Ala Val Ala Glu Pro Ala Ala Asn Val Glu Gly Leu Ala Ala Glu 145 150 155 160
GCG TCC GAG TAC AAG GCC GCC ATG TGG CAG TAC TGC TAC AAC CAG CGG 2624 Ala Ser Glu Tyr Lys Ala Ala Met Trp Gin Tyr Cys Tyr Asn Gin Arg 165 170 175GCG TCC GAG TAC AAG GCC GCC ATG TGG CAG TAC TGC TAC AAC CAG CGG 2624 Ala Ser Glu Tyr Lys Ala Ala Met Trp Gin Tyr Cys Tyr Asn Gin Arg 165 170 175
AGC GCC TCC GCG CGG GCG CAC TCC CGC GCC TAC TCC CAG GCG CTC AAG 2672 Ser Ala Ser Ala Arg Ala His Ser Arg Ala Tyr Ser Gin Ala Leu Lys 180 185 190 CTG GAG GGC ATC GAC TTC GCC GAG CTT GTG CGG AGG CAC CAG CTC CGG 2720 Leu Glu Gly Ile Asp Phe Ala Glu Leu Val Arg Arg His Gin Leu Arg 195 200 205AGC GCC TCC GCG CGG GCG CAC TCC CGC GCC TAC TCC CAG GCG CTC AAG 2672 Ser Ala Ser Ala Arg Ala His Ser Arg Ala Tyr Ser Gin Ala Leu Lys 180 185 190 CTG GAG GGC ATC GAC TTC GCC GAG CTT GTG CGG AGG CAC CAG CTC CGG 2720 Leu Glu Gly Ile Asp Phe Ala Glu Leu Val Arg Arg His Gin Leu Arg 195 200 205
CTC GGG TAC GGC AGC AAG GGC GAG GAG TTC GAG GAC CTG GAC GAC ACC 2768 Leu Gly Tyr Gly Ser Lys Gly Glu Glu Phe Glu Asp Leu Asp Asp Thr 210 215 220CTC GGG TAC GGC AGC AAG GGC GAG GAG TTC GAG GAC CTG GAC GAC ACC 2768 Leu Gly Tyr Gly Ser Lys Gly Glu Glu Phe Glu Asp Leu Asp Asp Thr 210 215 220
CAG AAG CTG GAG GTG TAC AAC AGC ATC ATC GTC GAG TCG GGG CGG GCG 2816 Gin Lys Leu Glu Val Tyr Asn Ser Ile Ile Val Glu Ser Gly Arg Ala 225 230 235 240CAG AAG CTG GAG GTG TAC AAC AGC ATC ATC GTC GAG TCG GGG CGG GCG 2816 Gin Lys Leu Glu Val Tyr Asn Ser Ile Val Glu Ser Gly Arg Ala 225 230 235 240
GGG CTA CCG GTG CGG ATG TTC TCG TCG GGC CGC TCT GCC GGT GGC CCT 2864 Gly Leu Pro Val Arg Met Phe Ser Ser Gly Arg Ser Ala Gly Gly Pro 245 250 255GGG CTA CCG GTG CGG ATG TTC TCG TCG GGC CGC TCT GCC GGT GGC CCT 2864 Gly Leu Pro Val Arg Met Phe Ser Ser Gly Arg Ser Ala Gly Gly Pro 245 250 255
AAG ATT GCA GCC ACG ACG TGG GCG CAG GCG GTG AGC GTC TTC ATC ATG 2912 Lys Ile Ala Ala Thr Thr Trp Ala Gin Ala Val Ser Val Phe Ile Met 260 265 270AAG ATT GCA GCC ACG ACG TGG GCG CAG GCG GTG AGC GTC TTC ATC ATG 2912 Lys Ile Ala Ala Thr Thr Trp Ala Gin Ala Val Ser Val Phe Ile Met 260 265 270
GCG GCG GGC AAC CTG GCG TGG GAC GTG TTC ACC ACG GAG CAC GAG GTG 2960 Ala Ala Gly Asn Leu Ala Trp Asp Val Phe Thr Thr Glu His Glu Val 275 280 285GCG GCG GGC AAC CTG GCG TGG GAC GTG TTC ACC ACG GAG CAC GAG GTG 2960 Ala Ala Gly Asn Leu Ala Trp Asp Val Phe Thr Thr Glu His Glu Val 275 280 285
GAG GCC ATC CTC AAG GGC AGC CTC AAC CTC CTG GCG GGG CTA GGG GGC 3008 Glu Ala Ile Leu Lys Gly Ser Leu Asn Leu Leu Ala Gly Leu Gly Gly 290 295 300GAG GCC ATC CTC AAG GGC AGC CTC AAC CTC CTG GCG GGG CTA GGG GGC 3008 Glu Ala Ile Leu Lys Gly Ser Leu Asn Leu Leu Ala Gly Leu Gly Gly 290 295 300
TTC GCC GTG GAG GCC GTC GTC GGC GCG GCT GTC ACC AAG GCG GTC GCA 3056 Phe Ala Val Glu Ala Val Val Gly Ala Ala Val Thr Lys Ala Val Ala 305 310 315 320TTC GCC GTG GAG GCC GTC GTC GGC GCG GCT GTC ACC AAG GCG GTC GCA 3056 Phe Ala Val Glu Ala Val Val Gly Ala Ala Val Thr Lys Ala Val Ala 305 310 315 320
AAC GTC GGC GCC GGC GTC TTT GCT TGC TCT CTC GCG GGC TTC GTC GTG 3104 Asn Val Gly Ala Gly Val Phe Ala Cys Ser Leu Ala Gly Phe Val Val 325 330 335AAC GTC GGC GCC GGC GTC TTT GCT TGC TCT CTC GCG GGC TTC GTC GTG 3104 Asn Val Gly Ala Gly Val Phe Ala Cys Ser Leu Ala Gly Phe Val Val 325 330 335
GGC GCC ATA GCC GGG CTG ATC TTC ATC GGC GTC AGC GGC CTC CTC ATT 3152 Gly Ala Ile Ala Gly Leu Ile Phe Ile Gly Val Ser Gly Leu Leu Ile 340 345 350GGC GCC ATA GCC GGG CTG ATC TTC ATC GGC GTC AGC GGC CTC CTC ATT 3152 Gly Ala Ile Ala Gly Leu Ile Phe Ile Gly Val Ser Gly Leu Leu Ile 340 345 350
AAC CTC ATC ATC GGC TCC CCT AGG AAG GTG CCT GAC ATG AGC AAG CTC 3200 Asn Leu Ile Ile Gly Ser Pro Arg Lys Val Pro Asp Met Ser Lys Leu 355 360 365AAC CTC ATC ATC GGC TCC CCT AGG AAG GTG CCT GAC ATG AGC AAG CTC 3200 Asn Leu Ile Ile Gly Ser Pro Arg Lys Val Pro Asp Met Ser Lys Leu 355 360 365
ATG TTC CAC ACC GCC GTC ATG CCC GAT GGA ATG GCC CTT GCG TAT GCG 3248 Met Phe His Thr Ala Val Met Pro Asp Gly Met Ala Leu Ala Tyr Ala 370 375 380ATG TTC CAC ACC GCC GTC ATG CCC GAT GGA ATG GCC CTT GCG TAT GCG 3248 Met Phe His Thr Ala Val Met Pro Asp Gly Met Ala Leu Ala Tyr Ala 370 375 380
GTA TCT CAT TAA TTACTTATTA TCATCGCAGT GACTACCGAT GCAACTGCTT 3300GTA TCT CAT TAA TTACTTATTA TCATCGCAGT GACTACCGAT GCAACTGCTT 3300
Val Ser His *Val Ser His *
385385
CAGATCCTAC TGTTGGAACG CGTGTGGAAA TAATAAAGGA ATAATAATAA TTATTATTGT 3360CAGATCCTAC TGTTGGAACG CGTGTGGAAA TAATAAAGGA ATAATAATAA TTATTATTGT 3360
AATAACAATA ATTATCATAT ATTGATAATG ATTATATATC AAATAGCTTC TCTCGATTCG 3420AATAACAATA ATTATCATAT ATTGATAATG ATTATATATC AAATAGCTTC TCTCGATTCG 3420
TCGTGACACA CGTCACATGA GTCCATGGTG TGCCCCGCTT CGCACGACCC ACGACCGGAC 3 β0TCGTGACACA CGTCACATGA GTCCATGGTG TGCCCCGCTT CGCACGACCC ACGACCGGAC 3 β0
AGACAATTTT AGCTGAGTGT TAAATTTTTG TCTCGAGTAC AAATCCACGG GGC.AAAGAAA 3540 GGCCATCGAG CAAATCGAAC ATTTATTTAG TGTCAGACAC TCGGTAAAGA AATCAAATTT 3600AGACAATTTT AGCTGAGTGT TAAATTTTTG TCTCGAGTAC AAATCCACGG GGC.AAAGAAA 3540 GGCCATCGAG CAAATCGAAC ATTTATTTAG TGTCAGACAC TCGGTAAAGA AATCAAATTT 3600
TTGGTGTGAA CACTTAACAA AGAAAAACAA TCAGTAAAAA GGTGGTTTAA CTAATATCGG 3660TTGGTGTGAA CACTTAACAA AGAAAAACAA TCAGTAAAAA GGTGGTTTAA CTAATATCGG 3660
ATACTTATCA AATAAAAATG CTCGACAAAA AGTGGTTTGG CTAGTGTCAC CATCAGCAAC 3720ATACTTATCA AATAAAAATG CTCGACAAAA AGTGGTTTGG CTAGTGTCAC CATCAGCAAC 3720
TAATACCACC TAACCACCAT TCTTTTTGCC GAGTGTCCTA CCGCGTCACT CGTCAAAGGA 3780TAATACCACC TAACCACCAT TCTTTTTGCC GAGTGTCCTA CCGCGTCACT CGTCAAAGGA 3780
GGCCTCTTTG TTTGGTACCA TTTCTAGACT CTAGTTAAAT AGGTATTTGC CTAGCGTCAG 3840GGCCTCTTTG TTTGGTACCA TTTCTAGACT CTAGTTAAAT AGGTATTTGC CTAGCGTCAG 3840
CTCAGAATAG GAGGCAAAGA TGCACTTTGT GTATTATTAT CTTCTTTTAC ACCCAACAAA 3900CTCAGAATAG GAGGCAAAGA TGCACTTTGT GTATTATTAT CTTCTTTTAC ACCCAACAAA 3900
GTATTTTTTA TTTTTTTCTT CTTGCCCTAA AACTTGTTCT GCTATATTCC TATAACACCT 3960GTATTTTTTA TTTTTTTCTT CTTGCCCTAA AACTTGTTCT GCTATATTCC TATAACACCT 3960
AGAACTACAT GTTCAGTTTT GGTACATTTC TCAGTGTTTT GTAGATTTAG TAAATTTATT 4020AGAACTACAT GTTCAGTTTT GGTACATTTC TCAGTGTTTT GTAGATTTAG TAAATTTATT 4020
TTATTTAACT GAATTTCTTG AGATAATTCA AATTTGAACG GTAAGTCATT CGTATAATGA 4080TTATTTAACT GAATTTCTTG AGATAATTCA AATTTGAACG GTAAGTCATT CGTATAATGA 4080
AAACATGAAT AGAAAACAGA TGTTCATGTT ACTAAGTATA AGTTGAGGTC GTATACAATA 4140AAACATGAAT AGAAAACAGA TGTTCATGTT ACTAAGTATA AGTTGAGGTC GTATACAATA 4140
ATAGACCAGA AAATTCGAAC ATTATGTTCA CGAAATATCA CCATGTACAA TTGTTTTTAA 4200ATAGACCAGA AAATTCGAAC ATTATGTTCA CGAAATATCA CCATGTACAA TTGTTTTTAA 4200
ATTGTATAAA AAGCAAACGA AGTTTGAAAA ATTATAAAAC TTTCGGGATG TCATGATATC 4260ATTGTATAAA AAGCAAACGA AGTTTGAAAA ATTATAAAAC TTTCGGGATG TCATGATATC 4260
ATAAGTGGAG GCTATAATAA AAGGTTGATA AAGTTTCATT AAAGTTTGAC ATGTACTATG 4320ATAAGTGGAG GCTATAATAA AAGGTTGATA AAGTTTCATT AAAGTTTGAC ATGTACTATG 4320
GTTACCACCT AATCAATCTC CATATGAAAC AAATCATGAA ACATATTCGT CGATTCTTCG 4380GTTACCACCT AATCAATCTC CATATGAAAC AAATCATGAA ACATATTCGT CGATTCTTCG 4380
GTTTGTAAAC ATTCATGAAA TCATGTCAAC TTTTTATCAC AGCCTCCACA TATAAACTAT 4440GTTTGTAAAC ATTCATGAAA TCATGTCAAC TTTTTATCAC AGCCTCCACA TATAAACTAT 4440
CATGATTTTC TAACTTTGTT TGCTTTTTAT ATAATTTAAA AACGGTTTTT TGGACACTAG 4500CATGATTTTC TAACTTTGTT TGCTTTTTAT ATAATTTAAA AACGGTTTTT TGGACACTAG 4500
GCAAAGAGCT TCTTTGCCAA GTGTTTTTTG GACTCTTGGC AAAGACAATA GTTGGAAACT 4560GCAAAGAGCT TCTTTGCCAA GTGTTTTTTG GACTCTTGGC AAAGACAATA GTTGGAAACT 4560
TTTTGATTTG AAGACATCTT GTCAATGAAA ACTATGTCTG AATTTTTTTA AAAATGTAAT 4620TTTTGATTTG AAGACATCTT GTCAATGAAA ACTATGTCTG AATTTTTTTA AAAATGTAAT 4620
TCAAAATTTT CAAATGACCT CGAATGAAAA AATCACCAAA AT ATAGTTG TAGATCCGTT 4680TCAAAATTTT CAAATGACCT CGAATGAAAA AATCACCAAA AT ATAGTTG TAGATCCGTT 4680
GACCTGCAGG TCGAC 4695 (2) INFORMATIONS POUR LA SEQ ID NO: 3:GACCTGCAGG TCGAC 4695 (2) INFORMATION FOR SEQ ID NO: 3:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 2990 paires de bases(A) LENGTH: 2990 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(n) TYPE DE MOLECULE: ADN(n) TYPE OF MOLECULE: DNA
(îx) CARACTERISTIQUE:(îx) CHARACTERISTIC:
(A) NOM/CLE: clone classe II / P23.7(A) NAME / KEY: class II clone / P23.7
(IX) CARACTERISTIQUE:(IX) CHARACTERISTIC:
(A) NOM/CLE: CDS(A) NAME / KEY: CDS
(B) EMPLACEMENT: 1329..2495(B) LOCATION: 1329..2495
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 3: AAGCTTAAAG ATCCCATTGG AAGTTAAACT CTCGGAAAGA GTTGATCGGA TGTTAGACTA 60(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: AAGCTTAAAG ATCCCATTGG AAGTTAAACT CTCGGAAAGA GTTGATCGGA TGTTAGACTA 60
ACTTCTGACG GTCGTTGGGG CCCATCGGAA GTTAGCGACG TAGACGTTGT TAGCACCGAA 120ACTTCTGACG GTCGTTGGGG CCCATCGGAA GTTAGCGACG TAGACGTTGT TAGCACCGAA 120
ACTTCTAACC ATTTTAGTGG CCTCTCGGAA GTTATTGTGC TAACTTCCAA GGGGTCCCAC 180ACTTCTAACC ATTTTAGTGG CCTCTCGGAA GTTATTGTGC TAACTTCCAA GGGGTCCCAC 180
CGGCTTCTCA AAAGTTAATG TGCTAACTTC AGGCCATTTT AGTGGCCTCT CGAAATTTAT 240CGGCTTCTCA AAAGTTAATG TGCTAACTTC AGGCCATTTT AGTGGCCTCT CGAAATTTAT 240
ATTGAACCAA CATTCAAAAT GTTATTTATT TTCAAATTTC ACTATATTTC AATACATCGG 300ATTGAACCAA CATTCAAAAT GTTATTTATT TTCAAATTTC ACTATATTTC AATACATCGG 300
GATACCAACC ATCCGGAAAA CAACACTAAC TGCAATAGCA TCTCATCTGT TTCATCACAA 360GATACCAACC ATCCGGAAAA CAACACTAAC TGCAATAGCA TCTCATCTGT TTCATCACAA 360
TAACACCACA CCTCATAAAT CTCATCAATT AAACACAATT CCAATATATT TCTTCAAAAT 420TAACACCACA CCTCATAAAT CTCATCAATT AAACACAATT CCAATATATT TCTTCAAAAT 420
AAGAACTCAA TTAGTCTCAT CTCAACCCAA GACACATCCC AAATGTCTTA CAGGGTTCAC 480AAGAACTCAA TTAGTCTCAT CTCAACCCAA GACACATCCC AAATGTCTTA CAGGGTTCAC 480
AAGTTCACCT CCCATCTATT TGAACTATAT CTTATATATT AACAAACAAC ATTAGTTTAA 540AAGTTCACCT CCCATCTATT TGAACTATAT CTTATATATT AACAAACAAC ATTAGTTTAA 540
ATATCATACA TTTAGTTATG TCTCTTTCCT CATTTTTACT CGTAGCCATG ATTTTTGTTT 600ATATCATACA TTTAGTTATG TCTCTTTCCT CATTTTTACT CGTAGCCATG ATTTTTGTTT 600
AGTTTTGCCT CTTCTGCTCT TCAGCAACAG AATAACAAAA CTGAGTAGAA AATACAACTA 660AGTTTTGCCT CTTCTGCTCT TCAGCAACAG AATAACAAAA CTGAGTAGAA AATACAACTA 660
AGGGTAAAAA TAAGGAAAGC GGTAGAACTA ACGGCACCAC TTCAAAATGT CGTAGTTTAA 720AGGGTAAAAA TAAGGAAAGC GGTAGAACTA ACGGCACCAC TTCAAAATGT CGTAGTTTAA 720
ATAATTTGAT GTTCATCAAA TACTAAAATT CAAAATTAAA GACCTCTAGA GTATATTTTT 780ATAATTTGAT GTTCATCAAA TACTAAAATT CAAAATTAAA GACCTCTAGA GTATATTTTT 780
CTTACAAGCT CCAGTGGTGG CCGTGCCTCG CGTGGCCATA ATCATCCTTA GTATGATTGA 840CTTACAAGCT CCAGTGGTGG CCGTGCCTCG CGTGGCCATA ATCATCCTTA GTATGATTGA 840
TCATGGACAG GGTACAGACC CATGCTTGAC TTGATAAAAC ACCAACAATA CCAGACCCCA 900TCATGGACAG GGTACAGACC CATGCTTGAC TTGATAAAAC ACCAACAATA CCAGACCCCA 900
TCCCCTTCCC TATCAACAAC GGAGGGACGA TGATATATTA TTTAGGTCTT GTTCGGATAC 960TCCCCTTCCC TATCAACAAC GGAGGGACGA TGATATATTA TTTAGGTCTT GTTCGGATAC 960
TCTACTATTA TATTCACTCT AAATCATATG TGTTAATACT AGAGTACCTA AACAAGGTCT 1020TCTACTATTA TATTCACTCT AAATCATATG TGTTAATACT AGAGTACCTA AACAAGGTCT 1020
TAAGTGCATG CACGTGCTGC ACGCTGTTAT GGACCTATTA GGTAGTAGTA GGTCGAGTAG 1080TAAGTGCATG CACGTGCTGC ACGCTGTTAT GGACCTATTA GGTAGTAGTA GGTCGAGTAG 1080
GATATATATC ACAAAGTTGT ATACCTATAA ATAGCTCGCT TTGATAACAT GATCTGCTGC 1140GATATATATC ACAAAGTTGT ATACCTATAA ATAGCTCGCT TTGATAACAT GATCTGCTGC 1140
CTTATACGAA ACATAGCTAC CTACTACTCA AGTATCCATC CTTATTGTAA GTGCTCTTAT 1200CTTATACGAA ACATAGCTAC CTACTACTCA AGTATCCATC CTTATTGTAA GTGCTCTTAT 1200
AAGCTACTAC TAGTTACAAG CTGGTTTATA TTTAACTACA AGTAGCAACG ATTTGTCTTA 1260AAGCTACTAC TAGTTACAAG CTGGTTTATA TTTAACTACA AGTAGCAACG ATTTGTCTTA 1260
GTAT TATGG TTCATAATAC ATATATATTG GAACTGAGAT AATATATGCA GGAGTACAGT 1320GTAT TATGG TTCATAATAC ATATATATTG GAACTGAGAT AATATATGCA GGAGTACAGT 1320
GTTGATCC ATG GAC TCG GAA GGA GTT GTA GCA GCA AAG GTG GCA GAT GAG 1370 Met Asp Ser Glu Gly Val Val Ala Ala Lys Val Ala Asp Glu 1 5 10GTTGATCC ATG GAC TCG GAA GGA GTT GTA GCA GCA AAG GTG GCA GAT GAG 1370 Met Asp Ser Glu Gly Val Val Ala Ala Lys Val Ala Asp Glu 1 5 10
ACT ACT AAA CCG GCA ATC CAA GAA GAC GGC GCC GAG AGC AAG GCC GGG 1418 Thr Thr Lys Pro Ala Ile Gin Glu Asp Gly Ala Glu Ser Lys Ala Gly 15 20 25 30ACT ACT AAA CCG GCA ATC CAA GAA GAC GGC GCC GAG AGC AAG GCC GGG 1418 Thr Thr Lys Pro Ala Ile Gin Glu Asp Gly Ala Glu Ser Lys Ala Gly 15 20 25 30
ATG ACT GAT CTG CTG ATG CTG ACC GAC AAG TCG CAG CTG CAG GCG CTG 1466 Met Thr Asp Leu Leu Met Leu Thr Asp Lys Ser Gin Leu Gin Ala Leu 35 40 45ATG ACT GAT CTG CTG ATG CTG ACC GAC AAG TCG CAG CTG CAG GCG CTG 1466 Met Thr Asp Leu Leu Met Leu Thr Asp Lys Ser Gin Leu Gin Ala Leu 35 40 45
GCG ATG CTG CTG CGG AAC AAC GAG GAG CTC ATG ATG AGC CAG GCG ATC 1514 Ala Met Leu Leu Arg Asn Asn Glu Glu Leu Met Met Ser Gin Ala Ile 50 55 60 AAG TCG GAG ACG GAG CGC ATT GAG TAC CTC AAG ACG GTG AGC GAC TGC 1562 Lys Ser Glu Thr Glu Arg Ile Glu Tyr Leu Lys Thr Val Ser Asp Cys 65 70 75GCG ATG CTG CTG CGG AAC AAC GAG GAG CTC ATG ATG AGC CAG GCG ATC 1514 Ala Met Leu Leu Arg Asn Asn Glu Glu Leu Met Met Ser Gin Ala Ile 50 55 60 AAG TCG GAG ACG GAG CGC ATT GAG TAC CTC AAG ACG GTG AGC GAC TGC 1562 Lys Ser Glu Thr Glu Arg Ile Glu Tyr Leu Lys Thr Val Ser Asp Cys 65 70 75
TAC ACG CGG ACG ATG AAG CTC CTC GAC GAT TCC ATG GCG GCC AGG ACC 1610 Tyr Thr Arg Thr Met Lys Leu Leu Asp Asp Ser Met Ala Ala Arg Thr 80 85 90TAC ACG CGG ACG ATG AAG CTC CTC GAC GAT TCC ATG GCG GCC AGG ACC 1610 Tyr Thr Arg Thr Met Lys Leu Leu Asp Asp Ser Met Ala Ala Arg Thr 80 85 90
ACG TAC GAG CGT TCG GGC GGA ACG AGG AGC CTC GTC GCC CGG GAC ATG 1658 Thr Tyr Glu Arg Ser Gly Gly Thr Arg Ser Leu Val Ala Arg Asp Met 95 100 105 110ACG TAC GAG CGT TCG GGC GGA ACG AGG AGC CTC GTC GCC CGG GAC ATG 1658 Thr Tyr Glu Arg Ser Gly Gly Thr Arg Ser Leu Val Ala Arg Asp Met 95 100 105 110
GAC GAC TAC GTC GTC TAC GGC CTC AAC GCG TGC TTG CAG AAC GTC CGC 1706 Asp Asp Tyr Val Val Tyr Gly Leu Asn Ala Cys Leu Gin Asn Val Arg 115 120 125GAC GAC TAC GTC GTC TAC GGC CTC AAC GCG TGC TTG CAG AAC GTC CGC 1706 Asp Asp Tyr Val Val Tyr Gly Leu Asn Ala Cys Leu Gin Asn Val Arg 115 120 125
AAC TGC TGC GTG CGC CTG GAC GCC ATC GAC AAG CTG CGG GCG CAC TAC 1754 Asn Cys Cys Val Arg Leu Asp Ala Ile Asp Lys Leu Arg Ala His Tyr 130 135 140AAC TGC TGC GTG CGC CTG GAC GCC ATC GAC AAG CTG CGG GCG CAC TAC 1754 Asn Cys Cys Val Arg Leu Asp Ala Ile Asp Lys Leu Arg Ala His Tyr 130 135 140
GAC GCC CTC GCC GAC GCC GTC GCC GAC CCG GCC GCC AAC GTC GAG GGC 1802 Asp Ala Leu Ala Asp Ala Val Ala Asp Pro Ala Ala Asn Val Glu Gly 145 150 155GAC GCC CTC GCC GAC GCC GTC GCC GAC CCG GCC GCC AAC GTC GAG GGC 1802 Asp Ala Leu Ala Asp Ala Val Ala Asp Pro Ala Ala Asn Val Glu Gly 145 150 155
CTC GCC GCG GAG GCG TCC GAG TAC AAG GCC GCC ATG TGG CAG TAC TGC 1850 Leu Ala Ala Glu Ala Ser Glu Tyr Lys Ala Ala Met Trp Gin Tyr Cys 160 165 170CTC GCC GCG GAG GCG TCC GAG TAC AAG GCC GCC ATG TGG CAG TAC TGC 1850 Leu Ala Ala Glu Ala Ser Glu Tyr Lys Ala Ala Met Trp Gin Tyr Cys 160 165 170
TAC AAC CAG CGG AGC GCC TCC GCG CGG GCG CAC TCC CGC GCC TAC TCC 1898 Tyr Asn Gin Arg Ser Ala Ser Ala Arg Ala His Ser Arg Ala Tyr Ser 175 180 185 190TAC AAC CAG CGG AGC GCC TCC GCG CGG GCG CAC TCC CGC GCC TAC TCC 1898 Tyr Asn Gin Arg Ser Ala Ser Ala Arg Ala His Ser Arg Ala Tyr Ser 175 180 185 190
CAG GCG CTC AAG CTG GAG GGC ATC GAC TTC GCC GAG CTG GTG CGG AGG 1946 Gin Ala Leu Lys Leu Glu Gly Ile Asp Phe Ala Glu Leu Val Arg Arg 195 200 205CAG GCG CTC AAG CTG GAG GGC ATC GAC TTC GCC GAG CTG GTG CGG AGG 1946 Gin Ala Leu Lys Leu Glu Gly Ile Asp Phe Ala Glu Leu Val Arg Arg 195 200 205
CAC CAG CTC CGG CTC GGG TAC GGC AGC AAG GGC GAG GAG TTC GAG GAC 1994 His Gin Leu Arg Leu Gly Tyr Gly Ser Lys Gly Glu Glu Phe Glu Asp 210 215 220CAC CAG CTC CGG CTC GGG TAC GGC AGC AAG GGC GAG GAG TTC GAG GAC 1994 His Gin Leu Arg Leu Gly Tyr Gly Ser Lys Gly Glu Glu Phe Glu Asp 210 215 220
CTG GAC GAC ACC CAG AAG CTG GAG GTG TAC AAC AGC ATC ATC GTC GAG 2042 Leu Asp Asp Thr Gin Lys Leu Glu Val Tyr Asn Ser Ile Ile Val Glu 225 230 235CTG GAC GAC ACC CAG AAG CTG GAG GTG TAC AAC AGC ATC ATC GTC GAG 2042 Leu Asp Asp Thr Gin Lys Leu Glu Val Tyr Asn Ser Ile Ile Val Glu 225 230 235
TCG GGG CGG GCG GGG CTA CCG GTG CGG ATG TTC TCG TCG GGC CGC TCT 2090 Ser Gly Arg Ala Gly Leu Pro Val Arg Met Phe Ser Ser Gly Arg Ser 240 245 250TCG GGG CGG GCG GGG CTA CCG GTG CGG ATG TTC TCG TCG GGC CGC TCT 2090 Ser Gly Arg Ala Gly Leu Pro Val Arg Met Phe Ser Ser Gly Arg Ser 240 245 250
GCC GGT GGC CCT AAG ATT GCA GCC ACG ACG TGG GCG GAG GCG GTG AGC 2138 Ala Gly Gly Pro Lys Ile Ala Ala Thr Thr Trp Ala Glu Ala Val Ser 255 260 265 270GCC GGT GGC CCT AAG ATT GCA GCC ACG ACG TGG GCG GAG GCG GTG AGC 2138 Ala Gly Gly Pro Lys Ile Ala Ala Thr Thr Trp Ala Glu Ala Val Ser 255 260 265 270
GTC TTC ATC ATG GCG GCG GGC AAC CTG GCG TGG GAC GTG TTC ACC ACG 2186 Val Phe Ile Met Ala Ala Gly Asn Leu Ala Trp Asp Val Phe Thr Thr 275 280 285GTC TTC ATC ATG GCG GCG GGC AAC CTG GCG TGG GAC GTG TTC ACC ACG 2186 Val Phe Ile Met Ala Ala Gly Asn Leu Ala Trp Asp Val Phe Thr Thr 275 280 285
GAG CAC GAG GTG GAG GCC ATC CTC AAG GGC AGC CTC AAC CTC CTG GCG 2234 Glu His Glu Val Glu Ala Ile Leu Lys Gly Ser Leu Asn Leu Leu Ala 290 295 300GAG CAC GAG GTG GAG GCC ATC CTC AAG GGC AGC CTC AAC CTC CTG GCG 2234 Glu His Glu Val Glu Ala Ile Leu Lys Gly Ser Leu Asn Leu Leu Ala 290 295 300
GGG CTA GGG GGC TTC GCC GTG GAG GCC GTC GTC GGC GCG GCT GTC ACC 2282 Gly Leu Gly Gly Phe Ala Val Glu Ala Val Val Gly Ala Ala Val Thr 305 310 315GGG CTA GGG GGC TTC GCC GTG GAG GCC GTC GTC GGC GCG GCT GTC ACC 2282 Gly Leu Gly Gly Phe Ala Val Glu Ala Val Val Gly Ala Ala Val Thr 305 310 315
AAG GCG GTC GCA AAC GTC GGC GCC GGC GTC TTT GCT TGC TCT CTC GCC 2330 Lys Ala Val Ala Asn Val Gly Ala Gly Val Phe Ala Cys Ser Leu Ala 320 325 330AAG GCG GTC GCA AAC GTC GGC GCC GGC GTC TTT GCT TGC TCT CTC GCC 2330 Lys Ala Val Ala Asn Val Gly Ala Gly Val Phe Ala Cys Ser Leu Ala 320 325 330
GGC TTC GTC GTG GGC GCC ATC GCC GGG CTG ATC TTC GTC GGC GTC AGC 2378 Gly Phe Val Val Gly Ala Ile Ala Gly Leu Ile Phe Val Gly Val Ser 335 340 345 350GGC TTC GTC GTG GGC GCC ATC GCC GGG CTG ATC TTC GTC GGC GTC AGC 2378 Gly Phe Val Val Gly Ala Ile Ala Gly Leu Ile Phe Val Gly Val Ser 335 340 345 350
GGC CTC CTC ATT AAC CTC ATC ATC GGC TCC CCA AGG AAG GTG CCT GAC 2426 Gly Leu Leu Ile Asn Leu Ile Ile Gly Ser Pro Arg Lys Val Pro Asp 355 360 365GGC CTC CTC ATT AAC CTC ATC ATC GGC TCC CCA AGG AAG GTG CCT GAC 2426 Gly Leu Leu Ile Asn Leu Ile Gly Ser Pro Arg Lys Val Pro Asp 355 360 365
ATG AGC AAG CTC ATG TTC CAC ACC GCC GTC ATG CCC GAT GGA ATG GCC 2474 Met Ser Lys Leu Met Phe His Thr Ala Val Met Pro Asp Gly Met Ala 370 375 380ATG AGC AAG CTC ATG TTC CAC ACC GCC GTC ATG CCC GAT GGA ATG GCC 2474 Met Ser Lys Leu Met Phe His Thr Ala Val Met Pro Asp Gly Met Ala 370 375 380
CTT GCG TAT GCG GTA TCT CAT TAATTACTTA ATATCATCGC AGTGACTACC 2525 Leu Ala Tyr Ala Val Ser His 385CTT GCG TAT GCG GTA TCT CAT TAATTACTTA ATATCATCGC AGTGACTACC 2525 Leu Ala Tyr Ala Val Ser His 385
AATGCAACTG CTTCAGCTCC TACTGTTGCA ACGCGCGTGT GGAAATAAGA AGGGAATAAT 2585AATGCAACTG CTTCAGCTCC TACTGTTGCA ACGCGCGTGT GGAAATAAGA AGGGAATAAT 2585
AATAATTATT ATTATTGTAA TAAAAAATAA TTATCATATA TTGATAATGA TTATATATCA 2645AATAATTATT ATTATTGTAA TAAAAAATAA TTATCATATA TTGATAATGA TTATATATCA 2645
AATATCTTTT CTCGATTCGT CGTGACACAC GTCACATGAG TCCATGGTGC ACGCCTTCGC 2705AATATCTTTT CTCGATTCGT CGTGACACAC GTCACATGAG TCCATGGTGC ACGCCTTCGC 2705
TCGACCCACG ACCAGACAAT TTTAGCTGAC GTCCCGTTTA GACTCATTAG AATTGAATTT 2765TCGACCCACG ACCAGACAAT TTTAGCTGAC GTCCCGTTTA GACTCATTAG AATTGAATTT 2765
CATTCTAATA ATAGTAATTT AGGCATATAT TAACTAAGAT AATTCGATTT TATACAAAAT 2825CATTCTAATA ATAGTAATTT AGGCATATAT TAACTAAGAT AATTCGATTT TATACAAAAT 2825
ATATTGGTAT ATTATTATTA GTAAGATGTC GAAGATATTT ATGTGCTACA TTTTTACTAT 2885ATATTGGTAT ATTATTATTA GTAAGATGTC GAAGATATTT ATGTGCTACA TTTTTACTAT 2885
AGAGGAGTGA GACGAAAAGT GTCATGTAAG TTATATAGAA GAAACAAATT CTACTCATGC 2945AGAGGAGTGA GACGAAAAGT GTCATGTAAG TTATATAGAA GAAACAAATT CTACTCATGC 2945
ATAAAATCAT TTCTCATCCC CCACCCCATG AATTTGAGAT AAGCTT 2991ATAAAATCAT TTCTCATCCC CCACCCCATG AATTTGAGAT AAGCTT 2991
(2) INFORMATIONS POUR LA SEQ ID NO: 4:(2) INFORMATION FOR SEQ ID NO: 4:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 16 paires de bases(A) LENGTH: 16 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(ii) TYPE DE MOLECULE: ADN(ii) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE: (A) NOM/CLE: U5(ix) CHARACTERISTIC: (A) NAME / KEY: U5
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 4: '.ACAGCTATG ACCATG 16 (2) INFORMATIONS POUR LA SEQ ID NO: 5:(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: '.ACAGCTATG ACCATG 16 (2) INFORMATION FOR SEQ ID NO: 5:
(1) CARACTERISTIQUES DE LA SEQUENCE(1) CHARACTERISTICS OF THE SEQUENCE
(A) LONGUEUR: 18 paires de bases(A) LENGTH: 18 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(n) TYPE DE MOLECULE: ADN(n) TYPE OF MOLECULE: DNA
(IX) CARACTERISTIQUE: (A) NOM/CLE: U3(IX) CHARACTERISTIC: (A) NAME / KEY: U3
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 5:(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5:
GTAAAACGAA CGGCCAGTGTAAAACGAA CGGCCAGT
(2) INFORMATIONS POUR LA SEQ ID NO: 6:(2) INFORMATION FOR SEQ ID NO: 6:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 105 paires de bases(A) LENGTH: 105 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION- linéaire(D) CONFIGURATION- linear
(n) TYPE DE MOLECULE: ADN(n) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: ol MUP1(A) NAME / KEY: ol MUP1
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 6: CATGAACTTC CTCAAAAGTT TCCCCTTTTA TGCCTTCCTT TGTTTTGGCC AATACTTTGT 60 AGCTGTTACT CATGCTGACT CGGAAGGAGT AGCAGCAAAG GTGGC 105(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: CATGAACTTC CTCAAAAGTT TCCCCTTTTA TGCCTTCCTT TGTTTTGGCC AATACTTTGT 60 AGCTGTTACT CATGCTGACT CGGAAGGAGT AGCAGCAAAG GTGGC 105
(2) INFORMATIONS POUR LA SEQ ID NO: 7:(2) INFORMATION FOR SEQ ID NO: 7:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR. 28 paires de bases(A) LENGTH. 28 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION, linéaire(D) CONFIGURATION, linear
(n) TYPE DE MOLECULE: ADN(n) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE(ix) CHARACTERISTICS
(A) NOM/CLE. ol MUP2(A) NAME / KEY. ol MUP2
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 7. G TCAAACAC TAAGCTCAAT AAGGATGG 28(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7. G TCAAACAC TAAGCTCAAT AAGGATGG 28
(2) INFORMATIONS POUR LA SEQ ID NO: 8. (i) CARACTERISTIQUES DE LA SEQUENCE:(2) INFORMATION FOR SEQ ID NO: 8. (i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 34 paires de bases(A) LENGTH: 34 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(n) TYPE DE MOLECULE: ADN(n) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: ol MUP9(A) NAME / KEY: ol MUP9
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 8: GGAAGTTCAT GGATCAAACA CTAAGCTCAA TAAG 34(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: GGAAGTTCAT GGATCAAACA CTAAGCTCAA TAAG 34
(2) INFORMATIONS POUR LA SEQ ID NO: 9:(2) INFORMATION FOR SEQ ID NO: 9:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 30 paires de bases(A) LENGTH: 30 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(n) TYPE DE MOLECULE: ADN(n) TYPE OF MOLECULE: DNA
(îx) CARACTERISTIQUE:(îx) CHARACTERISTIC:
(A) NOM/CLE: ol MUP10(A) NAME / KEY: ol MUP10
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 9: TTAAGAGTTT CCCCTTTTAT GCCTTCCTTT 30(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: TTAAGAGTTT CCCCTTTTAT GCCTTCCTTT 30
(2) INFORMATIONS POUR LA SEQ ID NO: 10.(2) INFORMATION FOR SEQ ID NO: 10.
(1) CARACTERISTIQUES DE LA SEQUENCE:(1) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 14 acides aminés(A) LENGTH: 14 amino acids
(B) TYPE: acide aminé(B) TYPE: amino acid
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(n) TYPE DE MOLECULE- peptide(n) TYPE OF MOLECULE- peptide
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: peptide mineur(A) NAME / KEY: minor peptide
(κ ) DESCRIPTION DE LA SEQUENCE- SEQ ID NO: 10.(κ) DESCRIPTION OF THE SEQUENCE - SEQ ID NO: 10.
Xaa Xaa Glu Asp Gly Glu Ser Lys Ala Gly Met Tnr Asp Leu 1 5 10 (2) INFORMATIONS POUR LA SEQ ID NO: 11:Xaa Xaa Glu Asp Gly Glu Ser Lys Ala Gly Met Tnr Asp Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 11:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 15 acides aminés(A) LENGTH: 15 amino acids
(B) TYPE: acide aminé(B) TYPE: amino acid
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(ii) TYPE DE MOLECULE: peptide(ii) TYPE OF MOLECULE: peptide
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: peptide majeur(A) NAME / KEY: major peptide
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 11:(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11:
Ala Gly Met Thr Asp Leu Leu Met Leu Thr Asp Lys Ser Gin Leu 1 5 10 15Ala Gly Met Thr Asp Leu Leu Met Leu Thr Asp Lys Ser Gin Leu 1 5 10 15
,2) INFORMATIONS POUR LA SEQ ID NO: 12:, 2) INFORMATION FOR SEQ ID NO: 12:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 20 paires de bases(A) LENGTH: 20 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(il) TYPE DE MOLECULE: ADN(il) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: oligo A(A) NAME / KEY: oligo A
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 12: ATGGACTCGG AAGGAGTAGC 20(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12: ATGGACTCGG AAGGAGTAGC 20
(2) INFORMATIONS POUR LA SEQ ID NO: 13:(2) INFORMATION FOR SEQ ID NO: 13:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 20 paires de bases(A) LENGTH: 20 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(ii) TYPE DE MOLECULE: ADN(ii) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: oligo B(A) NAME / KEY: oligo B
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 13: ATGGACTCGG AAGGAGTTGT 20(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: ATGGACTCGG AAGGAGTTGT 20
(2) INFORMATIONS POUR LA SEQ ID NO: 14:(2) INFORMATION FOR SEQ ID NO: 14:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 20 paires de bases(A) LENGTH: 20 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(ii) TYPE DE MOLECULE: ADN(ii) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: oligo C(A) NAME / KEY: oligo C
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 14: GCTGTAGCAG TCGCTCACCG 20(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: GCTGTAGCAG TCGCTCACCG 20
(2) INFORMATIONS POUR LA SEQ ID NO: 15:(2) INFORMATION FOR SEQ ID NO: 15:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 21 paires de bases(A) LENGTH: 21 base pairs
(B) TYPE: nucléotide(B) TYPE: nucleotide
(C) NOMBRE DE BRINS: simple(C) NUMBER OF STRANDS: single
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(il) TYPE DE MOLECULE: ADN(il) TYPE OF MOLECULE: DNA
(ix) CARACTERISTIQUE:(ix) CHARACTERISTIC:
(A) NOM/CLE: oligo D(A) NAME / KEY: oligo D
(xi) DESCRIPTION DE LA SEQUENCE: SEQ ID NO: 15. CTGGGAGTAG GCGCGGGAGT G 21 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15. CTGGGAGTAG GCGCGGGAGT G 21
REFERENCESREFERENCES
- Armstrong C. L. (1994) Régénération of plants fro somatic cell cultures : applications for in vitro genetic manipulation. Freeling M., Walbot V. Eds ; 665- 671. - Basso B., Bagnaresi P., Bracale M., Soave C. (1994) The Yello -stripe-1 and -3 mutants of maize : nutritional and biochemical studies Maydica 39 : 97-105.- Armstrong C. L. (1994) Regeneration of plants fro somatic cell cultures: applications for in vitro genetic manipulation. Freeling M., Walbot V. Eds; 665-671. - Basso B., Bagnaresi P., Bracale M., Soave C. (1994) The Yello -stripe-1 and -3 mutants of maize: nutritional and biochemical studies Maydica 39: 97-105.
- Barrier-Guillot B, Pala-Teles J.C., Métayer J.P., Maupetit P., Gène F., 1994,- Barrier-Guillot B, Pala-Teles J.C., Métayer J.P., Maupetit P., Gène F., 1994,
Journée Valicentre, Chambray les Tours, décembre 93-104.Valicentre Day, Chambray les Tours, December 93-104.
- Bevan M., Flavell R., and Chilton M.-D. (1983) A chimeric antibiotic résistance marker for plant transformation. Nature 304 : 184-187.- Bevan M., Flavell R., and Chilton M.-D. (1983) A chimeric antibiotic resistance marker for plant transformation. Nature 304: 184-187.
- Bevan M., Barnes W. M., and Chilton M.-D. (1983) Structure and transcription of the nopaline synthase gène région of T-DNA. Nucleic AcSEQ ID Research 1 1 : 369-385.- Bevan M., Barnes W. M., and Chilton M.-D. (1983) Structure and transcription of the nopaline synthase gene region of T-DNA. Nucleic AcSEQ ID Research 1 1: 369-385.
- Bitar K. Reinhold J.G., 1972. Bioch Biophys Acta., 66557, 442-452. - Cao J., Duan X:, McElroy D., and Wu R. (1992) Régénération of herbicide résistant transgenic rice plants following microprojectile-mediated transformation of suspension culture cells. Plant Cell Reports ; 1 1 : 586-591.- Bitar K. Reinhold J.G., 1972. Bioch Biophys Acta., 66557, 442-452. - Cao J., Duan X :, McElroy D., and Wu R. (1992) Regeneration of herbicide resistant transgenic rice plants following microprojectile-mediated transformation of suspension culture cells. Plant Cell Reports; 1 1: 586-591.
- Chenchik A., Moqadam F., and Siebert P. (January 1995) Marathon cDNA amplification : A new ethod for cloning full-length cDNA. CLONTECHniques IX (1 ) : 9-12 .- Chenchik A., Moqadam F., and Siebert P. (January 1995) Marathon cDNA amplification: A new ethod for cloning full-length cDNA. CLONTECHniques IX (1): 9-12.
- Comelissen B. J. C, Hooft van Huijsduijnen R. A. M., and Bol J F. (1986) A tobacco osaic virus-induced tobacco protein is homologous to the sweet-tasting protein thaumatin. Nature 321 : 531-532.- Comelissen B. J. C, Hooft van Huijsduijnen R. A. M., and Bol J F. (1986) A tobacco osaic virus-induced tobacco protein is homologous to the sweet-tasting protein thaumatin. Nature 321: 531-532.
- Dellaporta S.L., Wood J. et Hicks J.B. (1983) Plant Mol. Biol. Reptr. 1, 19 - 22. - Ehrlich K.C. et Montalbano B.G. (1992) Plant Physiol., supplément 99, abrégé- Dellaporta S.L., Wood J. and Hicks J.B. (1983) Plant Mol. Biol. Reptr. 1, 19 - 22. - Ehrlich K.C. and Montalbano B.G. (1992) Plant Physiol., Supplement 99, abridged
515515
- Ehrlich K. C, Montalbano B. G., Mullaney E. J., Dischinger H. C Jr, et Ullah A H J (1993) Biochem. Biophys. Res Commun. 195, 53 - 57.- Ehrlich K. C, Montalbano B. G., Mullaney E. J., Dischinger H. C Jr, and Ullah A H J (1993) Biochem. Biophys. Res Commun. 195, 53-57.
- Finner J. J., Vain P., Jones M. W., and McMuilen M. D. (1992) Development of the particle inflow gun for DNA delivery to plant cells Plant Cell Reports, 1 1 :- Finner J. J., Vain P., Jones M. W., and McMuilen M. D. (1992) Development of the particle inflow gun for DNA delivery to plant cells Plant Cell Reports, 1 1:
323-328.323-328.
- Frischauf, A -M., H. Lehrach, A. Poustka, and N. Murray. (1983). Lambda replacement vectors carryings polylinker séquences. J. Mol. Biol. 170 : 827. - Gellatly K S , et Lefebvre D D (1990) Plant Physiol , supplément 93, abrégé 562- Frischauf, A -M., H. Lehrach, A. Poustka, and N. Murray. (1983). Lambda replacement vectors carryings polylinker sequences. J. Mol. Biol. 170: 827. - Gellatly KS, and Lefebvre DD (1990) Plant Physiol, supplement 93, abridged 562
- Gibson D M et Ullah A B J (1990) dans Inositol Metabohs in Plants, pp 77 - 92, Wiley - Liss, New- York- Gibson D M and Ullah A B J (1990) in Inositol Metabohs in Plants, pp 77 - 92, Wiley - Liss, New- York
- Guilley H , Dudley R.K , Jonard G , Balazs E , and Richards K E (1982) Transcription of cauliflower mosaic virus DNA . détection of promoter séquences, and characterization of transcripts Cell 30 763-773- Guilley H, Dudley R.K, Jonard G, Balazs E, and Richards K E (1982) Transcription of cauliflower mosaic virus DNA. detection of promoter sequences, and characterization of transcripts Cell 30 763-773
- Graf E dir pub (1986) Phytic acid, chemistry and applications, Pillsburry Co , Pilatus Press , Minneapolis, M N , USA- Graf E dir pub (1986) Phytic acid, chemistry and applications, Pillsburry Co, Pilatus Press, Minneapolis, M N, USA
- Hiei Y , Ohfa S., Komari T and Kumasho T (1994) Efficient transformation of πce (Oriza sativa L ) mediated by Agrobacterium and séquence analysisof the boundaries ofthe T-DNA The Plant Journal 6 271-282- Hiei Y, Ohfa S., Komari T and Kumasho T (1994) Efficient transformation of πce (Oriza sativa L) mediated by Agrobacterium and sequence analysisof the boundaries ofthe T-DNA The Plant Journal 6 271-282
- Ishida Y , Saito H , Ohta S , Hlei Y , Komari T , and Kumashiro T (1996) High effîciency transformation of maize (Zea mays L ) mediated by Agrobacterium tumefaciens Nature Biotechnology 14 745-750- Ishida Y, Saito H, Ohta S, Hlei Y, Komari T, and Kumashiro T (1996) High effîciency transformation of maize (Zea mays L) mediated by Agrobacterium tumefaciens Nature Biotechnology 14 745-750
- Jefferson R A (1987) Assaying chimeπc gènes in plants the GUS fusion System Plant Mol Biol Rep 5 387-405- Jefferson R A (1987) Assaying chimeπc genes in plants the GUS fusion System Plant Mol Biol Rep 5 387-405
- Joshi C P (1987) Nucl Acid Res 15, 9627 - 9641- Joshi C P (1987) Nucl Acid Res 15, 9627 - 9641
- Klein T M , Wolf E D , Wu R , and Sanford J C (1987) High-velocity microprojectiles for dehvenng nucleic acSEQ ID mto living cells Nature , 327 70-73 - Laboure A M . Gagnon J et Lescure A M (1993) Biochem J , 295, 413- 419- Klein T M, Wolf E D, Wu R, and Sanford J C (1987) High-velocity microprojectiles for dehvenng nucleic acSEQ ID mto living cells Nature, 327 70-73 - Laboure A M. Gagnon J and Lescure A M (1993) Biochem J, 295, 413-419
- Lander E S , Green P , Abrahamson et al (1987) MAPMAKER an interactive computer package for constructing pπmary genetic linkage maps of expérimental and natural populations Genomics 1, 174-181- Lander E S, Green P, Abrahamson et al (1987) MAPMAKER an interactive computer package for constructing pπmary genetic linkage maps of experimental and natural populations Genomics 1, 174-181
- Logemann J , Schell J et Wιllmιtzer ( 1987) Anal Biochem 163, 16 - 20 - Mac Elroy D , Blowers A D , Jenes B , Wu R (1991) Construction of expression vectors based on the rice actin 1 (Actl) 5' région for use in monocot transformation Mol Gen Genêt 231 150-160- Logemann J, Schell J and Wιllmιtzer (1987) Anal Biochem 163, 16 - 20 - Mac Elroy D, Blowers AD, Jenes B, Wu R (1991) Construction of expression vectors based on the rice actin 1 (Actl) 5 'region for use in monocot transformation Mol Gen Genêt 231 150-160
- Maniatis T , Fritsch E F et Sambrook J (1982) Molecular Cloning A Laboratory Manual, 1ère édition (Cold Spring Harbor, NY , Cold Spπng Harbor Laboratory Press)- Maniatis T, Fritsch E F and Sambrook J (1982) Molecular Cloning A Laboratory Manual, 1st edition (Cold Spring Harbor, NY, Cold Spπng Harbor Laboratory Press)
- Mann E , Nussaume L , Quesada A , Sotta B , Gonneau M et Maπon-Poll A (1996) EMBO J , 15, 233 -2342 - Murigneux A , Baud S , and Beckert M ( 1993b) Molecular and morphological évaluation of doubled lines in maize 2 Comparison with single seed descent lines Theor App! Genêt 87 278-287- Mann E, Nussaume L, Quesada A, Sotta B, Gonneau M and Maπon-Poll A (1996) EMBO J, 15, 233 -2342 - Murigneux A, Baud S, and Beckert M (1993b) Molecular and morphological evaluation of doubled lines in maize 2 Comparison with single seed descent lines Theor App! Broom 87 278-287
- Nair V C et Duvnjak Z (1990) Appl Microbial Biotechnol 34, 183 - 188- Nair V C and Duvnjak Z (1990) Appl Microbial Biotechnol 34, 183 - 188
- O'Dell B. L , de Bolant A R et Koirtyohann S M (1972), J Agr Food Chem , 20, 718 - 721- O'Dell B. L, de Bolant A R and Koirtyohann S M (1972), J Agr Food Chem, 20, 718 - 721
- -Ostanin K , Harms E H , Stevis P E , Kuciel R , Zhou M. M et van Etten R L- -Ostanin K, Harms E H, Stevis P E, Kuciel R, Zhou M. M and van Etten R L
(1992) J Biol. Chem 267, 22830 - 22836(1992) J Biol. Chem 267, 22830 - 22836
- Pen J ( 1991) The expression of phytase in plant, EP-0 449 375- Pen J (1991) The expression of phytase in plant, EP-0 449 375
- Pen J , Verwoerd T C , van Paridon P A , Beudeker R F , van den Elzen P J M , Geerse K , van Ooyen A J J et Hoekema A (1993) Bio/Technology 1 1 , 81 1 -- Pen J, Verwoerd T C, van Paridon P A, Beudeker R F, van den Elzen P J M, Geerse K, van Ooyen A J J and Hoekema A (1993) Bio / Technology 1 1, 81 1 -
814814
- Piddington C S , Houston C S , Paloheimo M , Cantrell M , Miettinen-Oinonen A , Nevalainen H et Rambosek J (1993) Gène 133, 55 - 62- Piddington C S, Houston C S, Paloheimo M, Cantrell M, Miettinen-Oinonen A, Nevalainen H and Rambosek J (1993) Gene 133, 55 - 62
- Pointillard A (1994) INRA-Productions Animales 7, 29 - 39 - Raboy V , Pickett S , Galli T , Ertl D , Cook A and Young K (1995) Low phytic acid loci two or many ? 37TH annual Maize genetics conférence, Asilomar Abstract p 6- Pointillard A (1994) INRA-Productions Animales 7, 29 - 39 - Raboy V, Pickett S, Galli T, Ertl D, Cook A and Young K (1995) Low phytic acid loci two or many? 37TH annual Maize genetics conference, Asilomar Abstract p 6
- Reina M , Ponte I , Guillen P , Borona A and Palau J (1990) Séquence analysis of a genomic clone encoding a Zc2 protein from Zea mays W64 A Nucleic AcSEQ ID Research 18 6425-6426- Reina M, Ponte I, Guillen P, Borona A and Palau J (1990) Sequence analysis of a genomic clone encoding a Zc2 protein from Zea mays W64 A Nucleic AcSEQ ID Research 18 6425-6426
- Robert L S , Thompson R D , Flavell R B (1989) Tissue-specific expression of Wheat High Molecular Weight Glutenin gène in transgenic tobacco The Plant Cell 1 569-578- Robert L S, Thompson R D, Flavell R B (1989) Tissue-specific expression of Wheat High Molecular Weight Glutenin gene in transgenic tobacco The Plant Cell 1 569-578
- Sanger F , Nicklen S et Coulson A R (1977) Proc Natl Acad Sci 74, 5463 - Sauveur B , 1983, Proc 4* Europ Symp Poult Nutr , Tours 17-20 octobre 103-- Sanger F, Nicklen S and Coulson A R (1977) Proc Natl Acad Sci 74, 5463 - Sauveur B, 1983, Proc 4 * Europ Symp Poult Nutr, Tours 17-20 October 103-
1 131 13
- Sijmons P C , Dekker B M M , Schrammeijer B , Verwoert T C , van den Elsen P J M , and Hoekema A (1990) Production of correctly processed human sérum albumin in transgenic plants Bio/Technology 8 217-221 - Simons P C M , Wersteegh H. A J , Jongbloed A W , Kemme P A , Verschoor- Sijmons PC, Dekker BMM, Schrammeijer B, Verwoert TC, van den Elsen PJM, and Hoekema A (1990) Production of correctly processed human serum albumin in transgenic plants Bio / Technology 8 217-221 - Simons PCM, Wersteegh H. AJ, Jongbloed AW, Kemme PA, Verschoor
G J (1990) Br J Nutr 64, 525 - 540G J (1990) Br J Nutr 64, 525 - 540
- Southern E M (1975) Détection of spécifie séquences among DNA fragments separated by gel electrophoresis J Mol Biol 98, 503-517 - Vain P., Yean H., Flament P. (1989) Enhancement of production and régénération of embryogenetic type II callus in Zea mays L. by silver nitrate. Plant Cell Tissue and Organ Culture. 18 : 143-151.- Southern EM (1975) Detection of specifies sequences among DNA fragments separated by gel electrophoresis J Mol Biol 98, 503-517 - Vain P., Yean H., Flament P. (1989) Enhancement of production and regeneration of embryogenetic type II callus in Zea mays L. by silver nitrate. Plant Cell Tissue and Organ Culture. 18: 143-151.
- van Hartingsveldt W., van Zeijl C. M. J., Harteveld G. M., Gouka R. J.,- van Hartingsveldt W., van Zeijl C. M. J., Harteveld G. M., Gouka R. J.,
Suyberbuyk M.E.G., Luiten R. G. M., van Paridon P. A., Selton G. C. M., Veenstra E. E., van Gorcom R. F. M. et van den Hondel C. A. M. J. J. (1993)
Figure imgf000070_0001
Suyberbuyk MEG, Luiten RGM, van Paridon PA, Selton GCM, Veenstra EE, van Gorcom RFM and van den Hondel CAMJJ (1993)
Figure imgf000070_0001
- Van Steveninck et al, 1993, Plant and Soi 155/156. 525-528- Van Steveninck et al, 1993, Plant and Soi 155/156. 525-528
- Verwoerd T. C, van Paridon P. A., van Ooyen A. J. J., van Lent J. W. M.,- Verwoerd T. C, van Paridon P. A., van Ooyen A. J. J., van Lent J. W. M.,
Hoekema A. et Pen J. (1995) Plant Physiol. 109, 1 199 - 1205. Hoekema A. and Pen J. (1995) Plant Physiol. 109, 1199 - 1205.

Claims

REVENDICATIONS
1. Séquence d'ADN identique ou homologue à plus de 70 % de tout ou partie de la séquence telle que définie dans SEQ ID N° 1.1. DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 1.
2 Séquence d'ADN identique ou homologue à plus de 70 % de tout ou partie de la séquence telle que définie dans SEQ ID N° 2.2 DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 2.
3. Séquence d'ADN identique ou homologue à plus de 70 % de tout ou partie de la séquence telle que définie dans SEQ ID N° 3.3. DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 3.
4. Séquence d'ADN caractérisée en ce qu'elle comprend tout ou partie d'une séquence complémentaire ou complémentaire de l'homologue d'une séquence selon l'une des revendications 1 à 3.4. DNA sequence characterized in that it comprises all or part of a sequence complementary to or complementary to the homolog of a sequence according to one of claims 1 to 3.
5. Utilisation d'une séquence selon l'une des revendications 1 à 3 comme sonde moléculaire.5. Use of a sequence according to one of claims 1 to 3 as a molecular probe.
6 Fragment d'acide nucléique codant pour une phytase de plante.6 Nucleic acid fragment encoding a plant phytase.
7 Fragment d'acide nucléique selon la revendication 6, caractérisé en ce qu'il code pour une phytase de céréale7 Nucleic acid fragment according to claim 6, characterized in that it codes for a cereal phytase
8 Fragment d'acide nucléique selon la revendication 6 ou 8, caractérisé en ce qu'il code pour une phytase de mais.8 Nucleic acid fragment according to claim 6 or 8, characterized in that it codes for a corn phytase.
9. Fragment selon la revendication 6, 7 ou 8 caractérisé en ce qu'il s'agit d'un fra *ogm" ent d'ADNc.9. Fragment according to claim 6, 7 or 8 characterized in that it is a fragment of cDNA.
10 Fragment d'acide nucléique selon l'une des revendications 6 à 9 caractérisé en ce qu'il comprend tout ou partie d'une séquence de nucléotides substantiellement telle que montrée dans l'identificateur de séquences (SEQ ID) n° 1 codant pour une activité phytase.10 Nucleic acid fragment according to one of claims 6 to 9 characterized in that it comprises all or part of a nucleotide sequence substantially as shown in the sequence identifier (SEQ ID) No. 1 coding for phytase activity.
1 1 Fragment selon la revendication 10, caractérisé en ce qu'il comprend tout ou partie de la séquence codante allant du nucléotide n° 32 à 1 192 de SEQ ID n°l 1 1 Fragment according to claim 10, characterized in that it comprises all or part of the coding sequence ranging from nucleotide No. 32 to 1,192 of SEQ ID No. 1
12 Fragment selon l'une des revendications 10 ou 1 1, caractérisé en ce qu'il comprend la séquence complète de 1335 nucléotides telle que montrée sur SEQ ID n°12 Fragment according to one of claims 10 or 1 1, characterized in that it comprises the complete sequence of 1335 nucleotides as shown in SEQ ID no.
1.1.
13. Fragment selon la revendication 6, 7 ou 8, caractérisé en ce qu'il s'agit d'un fragment d'ADN génomique.13. Fragment according to claim 6, 7 or 8, characterized in that it is a genomic DNA fragment.
14 Fragment selon la revendication 13, caractérisé en ce qu'il comprend tout ou partie de la séquence telle que définie dans SEQ ID N° 2 ou SEQ ID N° 3.14 Fragment according to claim 13, characterized in that it comprises all or part of the sequence as defined in SEQ ID No. 2 or SEQ ID No. 3.
15 Fragment caractérisé en ce qu'il comprend tout ou partie d'une séquence complémentaire, homologue ou complémentaire de l'homologue d'une séquence telle que selon l'une des revendications 10 à 14.15 Fragment characterized in that it comprises all or part of a complementary sequence, homologous or complementary to the homolog of a sequence such as according to one of claims 10 to 14.
16 Fragment d'acide nucléique selon la revendication 15, caractérisé en ce qu'il comprend de l'ADN génomique de la plante16 Nucleic acid fragment according to claim 15, characterized in that it comprises genomic DNA of the plant
17 Fragment d'acide nucléique selon la revendication 15, caractérisé en ce qu'il est constitué par de l'ADNc et comporte en outre une partie des fragments introniques de l'ADN génomique17 Nucleic acid fragment according to claim 15, characterized in that it is constituted by cDNA and further comprises a part of the intronic fragments of the genomic DNA
18 Promoteur d'un gène de phytase de plante18 Promoter of a plant phytase gene
19. Promoteur d'un gène de phytase de céréale19. Promoter of a cereal phytase gene
20 Promoteur d'un gène de phytase de maïs20 Promoter of a corn phytase gene
21 Promoteur d'un gène de phytase de plante selon la revendication 18, caractérisé en ce qu'il contient tout ou partie du fragment allant du nucléotide n° 1 au nucléotide n° 2096 de la séquence telle que définie dans SEQ ID N° 221 Promoter of a plant phytase gene according to claim 18, characterized in that it contains all or part of the fragment going from nucleotide No. 1 to nucleotide No. 2096 of the sequence as defined in SEQ ID No. 2
22 Promoteur d'un gène de phytase de plante selon la revendication 18, caractérisé en ce qu'il contient tout ou partie du fragment allant du nucléotide n° 1 au nucléotide n° 1328 de la séquence telle que définie dans SEQ ID N° 3 22 Promoter of a plant phytase gene according to claim 18, characterized in that it contains all or part of the fragment going from nucleotide No. 1 to nucleotide No. 1328 of the sequence as defined in SEQ ID No. 3
23. Promoteur d'un gène de phytase de plante caractérisé en ce qu'il comprend une séquence identique ou homologue à plus de 70 % de la séquence du promoteur tel que défini dans la revendication 19 ou 20.23. Promoter of a plant phytase gene characterized in that it comprises a sequence identical or homologous to more than 70% of the promoter sequence as defined in claim 19 or 20.
24. Promoteur d'un gène de phytase de plante caractérisé en ce qu'il comprend tout ou partie d'une séquence complémentaire ou complémentaire de l'homologue d'une séquence telle que définie dans la revendication 23.24. Promoter of a plant phytase gene characterized in that it comprises all or part of a sequence complementary or complementary to the homolog of a sequence as defined in claim 23.
25. Utilisation d'un promoteur selon l'une des revendications 18 à 24 dans des constructions moléculaires destinées à améliorer la qualité agronomique alimentaire ou industrielle d'une plante, notamment la résistance aux pathogènes ou la disponibilité en nutriments.25. Use of a promoter according to one of claims 18 to 24 in molecular constructions intended to improve the agronomic food or industrial quality of a plant, in particular resistance to pathogens or the availability of nutrients.
26. Cassette d'expression caractérisée en ce qu'elle comporte un fragment d'ADN selon l'une des revendications 6 à 17, placé sous le contrôle de séquences régulatrices capables de commander l'expression de ladite phytase.26. Expression cassette characterized in that it comprises a DNA fragment according to one of claims 6 to 17, placed under the control of regulatory sequences capable of controlling the expression of said phytase.
27. Cassette d'expression, caractérisée en ce qu'elle comporte un promoteur tel que défini dans l'une des revendications 18 à 24.27. Expression cassette, characterized in that it comprises a promoter as defined in one of claims 18 to 24.
28. Cassette d'expression selon la revendication 26, caractérisée en ce que lesdites séquences régulatrices sont capables de commander l'expression spécifiquement dans un type particulier de tissu.28. Expression cassette according to claim 26, characterized in that said regulatory sequences are capable of controlling expression specifically in a particular type of tissue.
29. Procédé pour accroître la teneur en phytase d'une plante, caractérisé en ce qu'on transforme ladite plante avec un vecteur comportant une cassette d'expression selon l'une des revendications 26 à 28 dans laquelle lesdites séquences régulatrices sont capables de commander l'expression de ladite phytase dans ladite plante.29. Method for increasing the phytase content of a plant, characterized in that said plant is transformed with a vector comprising an expression cassette according to one of claims 26 to 28 in which said regulatory sequences are capable of controlling the expression of said phytase in said plant.
30. Hôte végétal consistant en une plante ou organe végétale, notamment transgénique, contenant une quantité accrue de phytase, caractérisé en ce que l'hôte végétal a été transformé avec une cassette d'expression selon l'une des revendications 26 à 28.30. Plant host consisting of a plant or plant organ, in particular transgenic, containing an increased quantity of phytase, characterized in that the plant host has been transformed with an expression cassette according to one of claims 26 to 28.
31. Plante transgénique selon la revendication 30, caractérisée en ce qu'elle produit des semences transgéniques exprimant une quantité accrue de phytases. 31. Transgenic plant according to claim 30, characterized in that it produces transgenic seeds expressing an increased quantity of phytases.
32 Hôte végétal consistant en une plante ou organe végétal transgénique dans lequel la phytase de plante est exprimée dans une partie de la plante ou un compartiment cellulaire où cette enzyme n'est pas produite naturellement, caractérisé en ce qu'on a introduit une cassette d'expression selon la revendication 26 comportant des séquences régulatrices qui induisent une expression spécifique dans ladite partie de la plante ou ledit compartiment cellulaire32 Plant host consisting of a transgenic plant or plant organ in which plant phytase is expressed in a part of the plant or a cellular compartment where this enzyme is not produced naturally, characterized in that a cassette of 'expression according to claim 26 comprising regulatory sequences which induce specific expression in said part of the plant or said cellular compartment
33 Plante ou organe végétal selon l'une des revendications 30 à 32, caractérisée en ce qu'il s'agit de céréales33 Plant or plant organ according to one of claims 30 to 32, characterized in that it is cereal
34 Plante ou organe végétal selon la revendication 33, caractérisée en ce qu'il
Figure imgf000074_0001
34 Plant or plant organ according to claim 33, characterized in that it
Figure imgf000074_0001
35 Semences sèches de plante selon l'une des revendications 30 à 3435 Dry plant seeds according to one of claims 30 to 34
36 Semences selon la revendication 35, caractérisées en ce qu'elles comportent une teneur globalement ou localement accrue en phytase obtenue par une expression spécifique dans la semence de la séquence d'ADN selon l'une des revendications 1 à 4 ou du fragment d'acide nucléique selon l'une des revendications 6 à 1736 Seeds according to claim 35, characterized in that they comprise a globally or locally increased content of phytase obtained by specific expression in the seed of the DNA sequence according to one of claims 1 to 4 or of the fragment of nucleic acid according to one of claims 6 to 17
37 Farine de semences obtenue à partir d'une semence selon l'une des revendications 35 et 3637 Seed flour obtained from a seed according to one of claims 35 and 36
38 Méthode de production de phytase, caractérisée en ce qu'elle comprend les étapes de a) transformation d'un hôte eucaryote ou procaryote, en particulier d'un végétal ou d'un microorganisme avec une cassette d'expression selon la revendication 26, comportant des séquences régulatrices capables de commander l'expression d'une quantité accrue de phytase dans l'hôte végétal ou le microorganisme respectivement , b) culture du microorganisme transformé ou croissance de la plante transformée , et c) extraction de la phytase de la culture de microorganismes ou des tissus végétaux transgéniques 38 Method for producing phytase, characterized in that it comprises the steps of a) transformation of a eukaryotic or prokaryotic host, in particular of a plant or a microorganism with an expression cassette according to claim 26, comprising regulatory sequences capable of controlling the expression of an increased amount of phytase in the plant host or the microorganism respectively, b) culturing the transformed microorganism or growing the transformed plant, and c) extracting the phytase from the culture of microorganisms or transgenic plant tissues
39. Phytase recombinante obtenue par le procédé de la revendication 38.39. Recombinant phytase obtained by the process of claim 38.
40. Phytase selon la revendication 39, caractérisée en ce qu'elle est un dimère ou un hétérodimère.40. Phytase according to claim 39, characterized in that it is a dimer or a heterodimer.
41. Anticorps dirigés contre la phytase de la plante selon la revendication 39.41. Antibodies directed against plant phytase according to claim 39.
42. Composition pour l'alimentation humaine ou animale comprenant tout ou partie de plante selon l'une des revendications 30 à 36 ou une farine de semence selon la revendication 37.42. Composition for human or animal food comprising all or part of a plant according to one of claims 30 to 36 or a seed flour according to claim 37.
43. Composition pour l'alimentation humaine ou animale comprenant une phytase de plante selon la revendication 39.43. Composition for human or animal food comprising a plant phytase according to claim 39.
44. Composition pour l'alimentation humaine ou animale selon la revendication44. Composition for human or animal food according to claim
42 ou 43, caractérisée en ce que la plante est choisie parmi le blé, l'orge, le sorgho, le maïs, le pois, le soja et la pomme de terre.42 or 43, characterized in that the plant is chosen from wheat, barley, sorghum, corn, peas, soya and potatoes.
45 Utilisation d'un fragment selon l'une des revendications 6 à 17 comme marqueur d'un phénotype lié à l'expression de la phytase.45 Use of a fragment according to one of claims 6 to 17 as a marker of a phenotype linked to the expression of phytase.
46 Utilisation d'une phytase selon la revendication 39, pour l'extraction d'amidon à partir de grains de plantes et/ou pour la valorisation des eaux de trempage ou de brassage.46 Use of a phytase according to claim 39, for the extraction of starch from plant grains and/or for the valorization of steeping or brewing water.
47. Utilisation de tout ou partie de plante selon l'une des revendications 30 à 36, pour l'extraction d'amidon à partir de grains de plantes et/ou pour la valorisation des eaux de trempage ou de brassage. 47. Use of all or part of a plant according to one of claims 30 to 36, for the extraction of starch from plant grains and/or for the valorization of steeping or brewing water.
PCT/FR1997/001443 1996-08-01 1997-08-01 Plant phytases and biotechnological applications WO1998005785A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU39446/97A AU3944697A (en) 1996-08-01 1997-08-01 Plant phytases and biotechnological applications
EP97936730A EP0938568A1 (en) 1996-08-01 1997-08-01 Plant phytases and biotechnological applications

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR9609734A FR2751987B1 (en) 1996-08-01 1996-08-01 PLANT PHYTASES AND BIOTECHNOLOGICAL APPLICATIONS
FR96/09734 1996-08-01

Publications (1)

Publication Number Publication Date
WO1998005785A1 true WO1998005785A1 (en) 1998-02-12

Family

ID=9494738

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1997/001443 WO1998005785A1 (en) 1996-08-01 1997-08-01 Plant phytases and biotechnological applications

Country Status (5)

Country Link
EP (1) EP0938568A1 (en)
AU (1) AU3944697A (en)
CA (1) CA2261913A1 (en)
FR (1) FR2751987B1 (en)
WO (1) WO1998005785A1 (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999055882A1 (en) * 1998-04-24 1999-11-04 E.I. Du Pont De Nemours And Company Phytic acid biosynthetic enzymes
WO1999067398A2 (en) * 1998-06-25 1999-12-29 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
WO2000073473A1 (en) * 1999-05-26 2000-12-07 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phosphate synthase gene
WO2001004147A2 (en) * 1999-07-12 2001-01-18 E.I. Du Pont De Nemours And Company Plant inositol polyphosphate phosphatase homologs
WO2002000890A1 (en) * 2000-06-30 2002-01-03 Biogemma Nucleic acids coding for a plant phosphatase of the mipp type with phytase activity and uses
WO2002036788A2 (en) * 2000-11-06 2002-05-10 Institut National De La Recherche Agronomique (Inra) Nucleic acids and polypeptides specifically expressed in cells of the transfer zone of a plant seed and uses thereof
FR2818286A1 (en) * 2000-12-19 2002-06-21 Agronomique Inst Nat Rech New DD1-a and DD1-b genes of maize and their regulators, useful for specific control of transgene expression in the transfer zone of grain during development
EP1221830A1 (en) * 1999-09-24 2002-07-17 Commonwealth Scientific And Industrial Research Organisation Expression of phytase in plants as a method of modifying plant productivity
US6511699B1 (en) 1999-03-31 2003-01-28 Cornell Research Foundation, Inc. Enzymes with improved phytase activity
US6841370B1 (en) 1999-11-18 2005-01-11 Cornell Research Foundation, Inc. Site-directed mutagenesis of Escherichia coli phytase
WO2005005646A2 (en) 2003-06-10 2005-01-20 Novozymes North America, Inc. Fermentation processes and compositions
WO2006110507A2 (en) * 2005-04-07 2006-10-19 The Samuel Roberts Noble Foundation, Inc. Plant phytase genes and methods of use
US7148064B1 (en) 1999-05-26 2006-12-12 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phospathe synthase gene
US7736680B2 (en) 2002-09-13 2010-06-15 Cornell Research Foundation, Inc. Using mutations to improve Aspergillus phytases
US7833743B2 (en) 2001-10-31 2010-11-16 Phytex, Llc Phytase-containing animal food and method
EP2295545A1 (en) 2002-09-26 2011-03-16 Novozymes North America, Inc. Fermentation methods and compositions
US7919297B2 (en) 2006-02-21 2011-04-05 Cornell Research Foundation, Inc. Mutants of Aspergillus niger PhyA phytase and Aspergillus fumigatus phytase
US8540984B2 (en) 2006-08-03 2013-09-24 Cornell Research Foundation, Inc. Phytases with improved thermal stability
WO2015035914A1 (en) 2013-09-11 2015-03-19 Novozymes A/S Processes for producing fermentation products
WO2017112540A1 (en) 2015-12-22 2017-06-29 Novozymes A/S Processes for producing fermentation products
WO2019055455A1 (en) 2017-09-15 2019-03-21 Novozymes A/S Enzyme blends and processes for improving the nutritional quality of animal feed
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S Processes for reducing lactic acid in a biofuel fermentation system
CN109922667A (en) * 2016-11-08 2019-06-21 谷万达公司 Phytase produces and uses phytic acid enzyme method
WO2019231944A2 (en) 2018-05-31 2019-12-05 Novozymes A/S Processes for enhancing yeast growth and productivity
WO2020160126A1 (en) 2019-01-31 2020-08-06 Novozymes A/S Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed
WO2021026201A1 (en) 2019-08-05 2021-02-11 Novozymes A/S Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct
WO2021126966A1 (en) 2019-12-16 2021-06-24 Novozymes A/S Processes for producing fermentation products

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU7242200A (en) * 2000-06-12 2001-12-13 Academia Sinica Protein production in transgenic plant seeds

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0321004A1 (en) * 1987-11-17 1989-06-21 Dorr-Oliver Incorporated A process for steeping cereals with a new enzyme preparation
EP0420358A1 (en) * 1989-09-27 1991-04-03 Gist-Brocades N.V. Cloning and expression of microbial phytase
EP0449375A2 (en) * 1990-03-23 1991-10-02 Gist-Brocades N.V. The expression of phytase in plants
WO1993009237A1 (en) * 1991-11-05 1993-05-13 Sandoz Ltd. Improved supersweet corn
WO1993012668A1 (en) * 1991-12-20 1993-07-08 Abbott Laboratories Separation of phytate and manganese from plant protein and dietary fiber using alumina
WO1995006128A2 (en) * 1993-08-25 1995-03-02 Dekalb Genetics Corporation Fertile, transgenic maize plants and methods for their production
WO1995014099A2 (en) * 1993-11-16 1995-05-26 The Regents Of The University Of California Process for protein production in plants

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0321004A1 (en) * 1987-11-17 1989-06-21 Dorr-Oliver Incorporated A process for steeping cereals with a new enzyme preparation
EP0420358A1 (en) * 1989-09-27 1991-04-03 Gist-Brocades N.V. Cloning and expression of microbial phytase
EP0449375A2 (en) * 1990-03-23 1991-10-02 Gist-Brocades N.V. The expression of phytase in plants
WO1993009237A1 (en) * 1991-11-05 1993-05-13 Sandoz Ltd. Improved supersweet corn
WO1993012668A1 (en) * 1991-12-20 1993-07-08 Abbott Laboratories Separation of phytate and manganese from plant protein and dietary fiber using alumina
WO1995006128A2 (en) * 1993-08-25 1995-03-02 Dekalb Genetics Corporation Fertile, transgenic maize plants and methods for their production
WO1995014099A2 (en) * 1993-11-16 1995-05-26 The Regents Of The University Of California Process for protein production in plants

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
(1995) 140 PP. AVAIL.: UNIV. MICROFILMS INT., ORDER NO. DA9618981 FROM: DISS. ABSTR. INT., B 1996, 57(2), 893 *
CARANSA, A., ET AL.: "A novel enzyme application for corn wet milling", STARCH, vol. 40, 1988, pages 409 - 411, XP002030182 *
CHEMICAL ABSTRACTS, vol. 125, no. 7, 12 August 1996, Columbus, Ohio, US; abstract no. 77808, LI, JIA: "Secretion of active recombinant phytase from stably transformed soybean cells(phosphorous, glycine max, aspergillus niger)" XP002030183 *
EHRLICH K C ET AL: "CLONING AND SEQUENCING OF THE PHYTASE GENE FROM SOYBEAN.", ANNUAL MEETING OF THE AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, PITTSBURGH, PENNSYLVANIA, USA, AUGUST 1-5, 1992. PLANT PHYSIOL (BETHESDA) 99 (1 SUPPL.). 1992. 87., XP002030180 *
GELLATLY, K.S., ET AL.: "Isolation and characterization of an acid phosphatase cDNA clone from potato tubers", PLANT PHYSIOLOGY SUPPLEMENT, vol. 93, no. 1, May 1990 (1990-05-01), pages 96, XP002030179 *
GROTEWALD, E., ET AL.: "Isolation and charcterization of a maize gene encoding chalcone flavonone isomerase", MOL. GEN. GENET., vol. 242, pages 1 - 8, XP002049933 *
LABOURE, A.-M., ET AL.: "Purification and characterization of a phytase (myo-inositol-hexakisphosphate phosphohydrolase) accumulated in maize (Zea mays) seedlings during germination", BIOCHEMICAL JOURNAL, vol. 295, no. 2, 15 October 1993 (1993-10-15), pages 413 - 419, XP000673228 *
MAUGENEST S ET AL: "Cloning and characterization of a cDNA encoding a maize seedling phytase.", BIOCHEMICAL JOURNAL 322 (2). 1997. 511-517., XP000673229 *
PEN J ET AL: "Phytase-containing transgenic seeds as a novel feed-additive for improved phosphorus utilization", BIO/TECHNOLOGY;(1993) 11, 7, 811-14, XP002026203 *
SHEN, B., ET AL.: "6c01c10-t7 etiolated seedling Zea mays cDNA clone 6c01c10", EMBL SEQUENCE DATABASE, REL. 40, 10-JUN-1994, ACCESSION NO. T20338, XP002030178 *
VERWOERD, T. C. ET AL: "Stable accumulation of Aspergillus niger phytase in transgenic tobacco leaves", PLANT PHYSIOLOGY, (1995) VOL. 109, NO. 4, PP. 1199-1205., XP002030181 *

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999055882A1 (en) * 1998-04-24 1999-11-04 E.I. Du Pont De Nemours And Company Phytic acid biosynthetic enzymes
WO1999055879A1 (en) * 1998-04-24 1999-11-04 E.I. Du Pont De Nemours And Company Phytic acid biosynthetic enzymes
US6855869B2 (en) 1998-04-24 2005-02-15 E.I. Du Pont De Nemours And Company Phytic acid biosynthetic enzymes
US7271317B2 (en) 1998-04-24 2007-09-18 E. I. Du Pont De Nemours And Company Phytic acid biosynthetic enzymes
US6451572B1 (en) 1998-06-25 2002-09-17 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
EP1688500A2 (en) * 1998-06-25 2006-08-09 Cornell Research Foundation, INC. Overexpression of phytase genes in yeast systems
KR100870886B1 (en) * 1998-06-25 2008-11-28 코넬 리서치 파운데이션 인코포레이티드 Overexpression of phytase genes in yeast systems
EP1688500A3 (en) * 1998-06-25 2008-11-05 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
CN100365126C (en) * 1998-06-25 2008-01-30 康乃尔研究基金会有限公司 Overexpression of phytase genes in yeast systems
WO1999067398A3 (en) * 1998-06-25 2000-04-20 Cornell Res Foundation Inc Overexpression of phytase genes in yeast systems
US7026150B2 (en) 1998-06-25 2006-04-11 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
US8993300B2 (en) 1998-06-25 2015-03-31 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
WO1999067398A2 (en) * 1998-06-25 1999-12-29 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
US6511699B1 (en) 1999-03-31 2003-01-28 Cornell Research Foundation, Inc. Enzymes with improved phytase activity
US6974690B2 (en) 1999-03-31 2005-12-13 Cornell Research Foundation, Inc. Phosphatases with improved phytase activity
WO2000073473A1 (en) * 1999-05-26 2000-12-07 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phosphate synthase gene
US7148064B1 (en) 1999-05-26 2006-12-12 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phospathe synthase gene
WO2001004147A2 (en) * 1999-07-12 2001-01-18 E.I. Du Pont De Nemours And Company Plant inositol polyphosphate phosphatase homologs
WO2001004147A3 (en) * 1999-07-12 2001-08-23 Rebecca E Cahoon Plant inositol polyphosphate phosphatase homologs
EP1221830A4 (en) * 1999-09-24 2004-06-16 Commw Scient Ind Res Org Expression of phytase in plants as a method of modifying plant productivity
EP1221830A1 (en) * 1999-09-24 2002-07-17 Commonwealth Scientific And Industrial Research Organisation Expression of phytase in plants as a method of modifying plant productivity
US6841370B1 (en) 1999-11-18 2005-01-11 Cornell Research Foundation, Inc. Site-directed mutagenesis of Escherichia coli phytase
WO2002000890A1 (en) * 2000-06-30 2002-01-03 Biogemma Nucleic acids coding for a plant phosphatase of the mipp type with phytase activity and uses
FR2810994A1 (en) * 2000-06-30 2002-01-04 Biogemma Fr NUCLEIC ACIDS ENCODING A PLANT PHOSPHATASE MIPP TYPE WITH PHYTASIC ACTIVITY AND APPLICATIONS
WO2002036788A3 (en) * 2000-11-06 2003-09-25 Agronomique Inst Nat Rech Nucleic acids and polypeptides specifically expressed in cells of the transfer zone of a plant seed and uses thereof
WO2002036788A2 (en) * 2000-11-06 2002-05-10 Institut National De La Recherche Agronomique (Inra) Nucleic acids and polypeptides specifically expressed in cells of the transfer zone of a plant seed and uses thereof
FR2818286A1 (en) * 2000-12-19 2002-06-21 Agronomique Inst Nat Rech New DD1-a and DD1-b genes of maize and their regulators, useful for specific control of transgene expression in the transfer zone of grain during development
US7833743B2 (en) 2001-10-31 2010-11-16 Phytex, Llc Phytase-containing animal food and method
US7736680B2 (en) 2002-09-13 2010-06-15 Cornell Research Foundation, Inc. Using mutations to improve Aspergillus phytases
EP2295545A1 (en) 2002-09-26 2011-03-16 Novozymes North America, Inc. Fermentation methods and compositions
WO2005005646A2 (en) 2003-06-10 2005-01-20 Novozymes North America, Inc. Fermentation processes and compositions
WO2006110507A2 (en) * 2005-04-07 2006-10-19 The Samuel Roberts Noble Foundation, Inc. Plant phytase genes and methods of use
WO2006110507A3 (en) * 2005-04-07 2007-04-12 Samuel Roberts Noble Found Inc Plant phytase genes and methods of use
US7557265B2 (en) 2005-04-07 2009-07-07 The Samuel Roberts Noble Foundation Plant phytase genes and methods of use
US7919297B2 (en) 2006-02-21 2011-04-05 Cornell Research Foundation, Inc. Mutants of Aspergillus niger PhyA phytase and Aspergillus fumigatus phytase
US8540984B2 (en) 2006-08-03 2013-09-24 Cornell Research Foundation, Inc. Phytases with improved thermal stability
EP3712274A1 (en) 2013-09-11 2020-09-23 Novozymes A/S Processes for producing fermentation products
WO2015035914A1 (en) 2013-09-11 2015-03-19 Novozymes A/S Processes for producing fermentation products
WO2017112540A1 (en) 2015-12-22 2017-06-29 Novozymes A/S Processes for producing fermentation products
US11371052B2 (en) 2016-11-08 2022-06-28 Agrivida, Inc. Phytase production and methods of using the same
CN109922667A (en) * 2016-11-08 2019-06-21 谷万达公司 Phytase produces and uses phytic acid enzyme method
WO2019055455A1 (en) 2017-09-15 2019-03-21 Novozymes A/S Enzyme blends and processes for improving the nutritional quality of animal feed
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S Processes for reducing lactic acid in a biofuel fermentation system
WO2019231944A2 (en) 2018-05-31 2019-12-05 Novozymes A/S Processes for enhancing yeast growth and productivity
WO2020160126A1 (en) 2019-01-31 2020-08-06 Novozymes A/S Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed
WO2021026201A1 (en) 2019-08-05 2021-02-11 Novozymes A/S Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct
WO2021126966A1 (en) 2019-12-16 2021-06-24 Novozymes A/S Processes for producing fermentation products

Also Published As

Publication number Publication date
AU3944697A (en) 1998-02-25
FR2751987B1 (en) 1998-12-31
EP0938568A1 (en) 1999-09-01
FR2751987A1 (en) 1998-02-06
CA2261913A1 (en) 1998-02-12

Similar Documents

Publication Publication Date Title
WO1998005785A1 (en) Plant phytases and biotechnological applications
CA2242903C (en) Amino acid-enriched plant protein reserves, particularly lysine-enriched maize .gamma.-zein, and plants expressing such proteins
Murphy et al. Role of lipid bodies and lipid-body proteins in seeds and other tissues
KR101965019B1 (en) Modulating beta-damascenone in plants
CA2296840A1 (en) Dna sequence coding for a hydroxyphenylpyruvate dioxygenase and overproduction thereof in plants
US7199284B2 (en) Chlorophyllases
JP2009509509A (en) Nucleic acids and proteins associated with sucrose degradation in coffee
RO122151B1 (en) Process for modifying concentration levels of secondary metabolic compounds in plants
JP2008523821A (en) Nucleic acid molecules encoding plant-derived fatty acid desaturase genes and methods of use thereof
WO2005068625A1 (en) Plants transformed for elevated levels of gallic acid and methods of producing said plants
FR2774379A1 (en) PROCESS FOR THE PRODUCTION OF ALPHA 1-ANTITRYPSIN AND ITS VARIANTS BY PLANT CELLS, AND PRODUCTS CONTAINING THE ALPHA-ANTITRYPSIN OBTAINED THEREBY
EP2627667B1 (en) Production of plants having improved water-deficit tolerance
CA2385763C (en) Plant seed endosperm-specific promoter
CN101600340A (en) The production of plant with oil, albumen or fiber content of change
JP2003511049A (en) Method for increasing crop yield or biomass using protoporphyrinogen oxidase gene
FR2794772A1 (en) PROMOTER ALLOWING THE EXPRESSION OF TRANSGENES INTO THE PLANT HORIZED IN THE SEED
WO2002036788A2 (en) Nucleic acids and polypeptides specifically expressed in cells of the transfer zone of a plant seed and uses thereof
WO2013030812A1 (en) High-methionine transgenic soybean seeds expressing the arabidopsis cystathionine gamma-synthase gene
WO1997031106A1 (en) Method of changing the composition of the phospholipid produced by the living body and recombinant vector therefor
EP2627772B1 (en) Production of plants with improved tolerance to water deficit
EP1294900A1 (en) Nucleic acids coding for a plant phosphatase of the mipp type with phytase activity and uses
TWI332029B (en)
MXPA05006761A (en) Generation of plants with altered oil content.
EP1121451B1 (en) Method for obtaining transgenic plants expressing a protein with activity producing hydrogen peroxide by transformation by agrobacterium rhizogenes
CA2454119A1 (en) Nucleic acids coding for a isum2a polypeptide and use of said nucleic acids to obtain transformed plants producing seeds altered in germ development

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2261913

Country of ref document: CA

Ref country code: CA

Ref document number: 2261913

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997936730

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09230763

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998507680

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1997936730

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997936730

Country of ref document: EP