WO1998015575A1 - Promoter for smooth muscle cell expression - Google Patents
Promoter for smooth muscle cell expression Download PDFInfo
- Publication number
- WO1998015575A1 WO1998015575A1 PCT/US1997/016204 US9716204W WO9815575A1 WO 1998015575 A1 WO1998015575 A1 WO 1998015575A1 US 9716204 W US9716204 W US 9716204W WO 9815575 A1 WO9815575 A1 WO 9815575A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- vector
- cell
- smooth muscle
- nucleic acid
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4716—Muscle proteins, e.g. myosin, actin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/04—Drugs for disorders of the respiratory system for throat disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus
Definitions
- the present invention relates generally to the fields of gene expression, particularly tissue specific expression, and more particularly smooth muscle cell specific expression.
- the invention also relates to cell proliferation diseases such as atherosclerosis, restenosis following balloon angioplasty and airway blockage in asthma.
- SMCs smooth muscle cells
- the phenotypic plasticity of smooth muscle cells permits this muscle cell lineage to subserve diverse functions in multiple tissues including the arterial wall, uterus. respiratory, urinary and digestive tracts.
- SMCs are capable of simultaneously proliferating and expressing a set of lineage-restricted proteins including myofibrillar isoforms, cell surface receptors and SMC-restricted enzymes.
- a set of lineage-restricted proteins including myofibrillar isoforms, cell surface receptors and SMC-restricted enzymes.
- SMCs can modulate their phenotype by down-regulating a set of contractile protein genes, and in so doing, convert from the so called "contractile phenotype” to a de-differentiated "secretory phenotype"
- contractile phenotype a de-differentiated "secretory phenotype”
- Restenosis following coronary balloon angioplasty is a major problem, and contributes to the 40% failure rate of this procedure (Schwartz et al . 1992; Liu et al , Circ. 79: 1374-1387, 1989). Restenosis occurs because the smooth muscle cells are stimulated to proliferate after angioplasty and thus block the arterial wall. Because of restenosis, balloon angioplasty is used mainly for palliation in patients who are not acceptable candidates for open heart surgery ⁇ Scientific American Medicine, Rubenstein and Federman, Eds., March 1993, Section 1, XII, page 1 1). A method is needed, therefore, to control or inhibit the proliferation of smooth muscle cells after angioplasty.
- RDAd efficiently transduce both resting and proliferating SMCs in vivo
- a potential limitation of their use in the clinical setting is their capacity to infect and program transgene expression in many different cell lineages and tissues (Ohno et al, Science. 265 (5173):781-784, 1994; Haddada et al, Current Topics in Microbiology & mmunolog,. 199 (Pt 3):297-306, 1995).
- localized arterial administration of RDAd results in efficient infection of endothelial cells, vascular SMCs and adventitial cells (French et al.. Circulation, 90 (5):2402-2413, 1994; Simari et al, J. Clin.
- a second approach has involved delivery of adenoviral particles locally within the vasculature (to the site of vessel wall injury) or within a tissue (Ohno et al, 1994; Chang et al. Science, 267:518-522. 1995a: Guzman et al, 1994; Chang et al, Mol. Medicine, 1 : 172-181, 1995b).
- Specially-modified catheter delivery systems including coated-balloons and intravascular stents have been designed in order to achieve high local concentrations of adenovirus within the vasculature (March et al, Human Gene Therapy, 6 (l):41-53, 1995; Rajasubramanian et al . ASAIO Journal.
- tissue-tropism of RDAd can be modified by electrostatically conjugating adenoviral proteins to ligands that can bind specifically to tissue-specific cell-surface receptors (Krasnykh et al, Journal of Virology, 70 ( 10):6839-6846, 1996).
- tissue-specific transcriptional regulatory elements represents an alternative strategy to restrict adenoviral transgene expression to specific cell lineages or tissues in vivo (Miller and Vile, 1995). While theoretically appealing, this strategy is potentially limited because the adenovirus genome contains multiple highly active transcriptional enhancers that are capable of transactivating a variety of different promoters in multiple cell lineages (Haddada et al, 1995). Such a targeting strategy is particularly problematic in smooth muscle cells because of the lack of smooth muscle cell-specific transcriptional regulatory elements that function in vivo. Thus, there is still a need for discovery of a smooth muscle cell specific promoter that is not expressed in other types of cells and is constitutively expressed in both quiescent and proliferating cells and that maintains its tissue specificity when administered to an animal.
- the present invention seeks to overcome these and other drawbacks in the prior art by providing a promoter that is capable of expression of a heterologous gene in a tissue specific manner, in particular, smooth muscle cells, and by offering the further advantage that the control of expression directed by the promoter is constitutive and cell cycle independent.
- the promoter of the present invention thus promotes transcription in both resting and proliferating cells, in contrast to other known smooth muscle cell promoters that are down-regulated in proliferating cells.
- This promoter may be used therefore, to express heterologous proteins or mRNAs in proliferating smooth muscle cells and to control proliferative diseases or to promote angiogenesis, for example.
- the invention may be described, in certain embodiments, as an isolated nucleic acid segment comprising an SM22 promoter sequence operatively linked to a heterologous gene and capable of directing expression of that gene.
- the isolated SM22 ⁇ promoter may be described as the region immediately upstream of the transcriptional start site of the murine SM22 gene.
- a nucleic acid segment having a sequence according to bases 899-1382 of SEQ ID NO:l is also effective to promote transcription in a smooth muscle cell and a nucleic acid segment having that sequence or the transcriptional control elements of that sequence would also fall within the scope of the claimed invention.
- Such homologous promoters may be isolated from an animal sequence, such as from a mouse, pig, rat, hamster, rabbit or even a human genome or cDNA library using any of the sequences disclosed herein as a molecular probe.
- an animal sequence such as from a mouse, pig, rat, hamster, rabbit or even a human genome or cDNA library using any of the sequences disclosed herein as a molecular probe.
- one of skill might construct such a promoter by splicing elements taken from various sources including, but not limited to, chemically synthesized nucleic acid molecules, or elements removed from other naturally occurring promoters, or from the SM22 ⁇ promoter. It is understood that any such promoter, or a promoter having the essential elements of the promoter disclosed herein and useful to express a heterolgous nucleic acid sequence would be encompassed by the spirit and scope of the invention claimed herein.
- the promoter region of the present invention may be defined as comprising that region of the genome immediately upstream (5') of the structural SM22 ⁇ gene, and controlling expression of that gene.
- the promoter may comprise the region of up to 30, 40, 50, 100, 500, 1,000, 1,500, 2,000 or even up to 5,000 bases directly upstream of the transcriptional start site of the SM22 ⁇ gene, and more specifically, an SM22 ⁇ promoter of the present invention may be described as an isolated nucleic acid segment that comprises a contiguous sequence of bases 1-1381 (-1338 to +41) of SEQ ID NO:l .
- the designations of -1338 to +41 and the like indicate the position of a base relative to the transcriptional start site (+1 ), which, in the murine genome, is disclosed herein to be base 1341 of SEQ ID NO: 1.
- the promoter of the present invention may also be described as an isolated nucleic acid segment that comprises a contiguous sequence of bases 899-1381 (-441 to +41) of SEQ ID NO: l .
- Certain elements of the promoter that are identified in light of the present disclosure are a TATA box 29-bp 5' of the start site, five consensus E boxes/bHLH myogenic transcription factor binding sites located at bps -534, -577, -865, -898, -910, and -1267, three consensus GATA-4 binding sites located at bps -504, -828, -976, two AT-rich, potential MEF-2/rSRF binding sites located at bps -407 and -770 and at least one cis-acting, positive transcriptional regulatory element contained by bp -435 to -416.
- the promoter of the present invention contains consensus CArG/SRF binding sites located at bps -150 and -273 and one CACC box located at bp -104.
- the promoter of the present invention may comprise some or all of the elements described in the previous paragraph. Such elements may be isolated and recombined by techniques well known in the art to produce a smooth muscle cell specific promoter that may be smaller than the 441 to 482 bases disclosed herein as a minimal sequence required for constitutive smooth muscle cell transcription. It is also known that certain stretches of sequence in the promoter are required for spacing of the cis acting elements and that any sequence that does not impart hai ⁇ in loops or other deleterious structural properties may be substituted for those regions so long as the spacing and conformation remains the same. It is understood that all such promoters would be encompassed by the present invention.
- the isolated nucleic acid segments of the present invention may also be defined as comprising a nucleic acid sequence or even a gene operatively linked to an isolated SM22 ⁇ promoter sequence.
- Operatively linked is understood to mean that the gene is joined to the promoter region such that the promoter is oriented 5' to the gene and is of an appropriate distance from the transcription start site, so that the transcription of the gene will be dependent on or controlled by the promoter sequence.
- restriction enzyme digestion and nucleic acid ligation to be used in construction of a promoter-gene construct are well known in the art as exemplified by Maniatis et al, Molecular Cloning, A Laboratory- Manual. Cold Spring Harbor, New York, 1982, (inco ⁇ orated herein by reference).
- restriction enzyme recognition site may be a naturally occurring sequence, or a sequence generated by site directed mutagenesis, by a PCRTM primer sequence or by any other means known in the art.
- the gene or nucleic acid segment may be, for example, a structural gene that encodes a full length protein, a portion or part of a protein, or a peptide that one desires to express in a smooth muscle cell.
- the gene may also encode an RNA sequence, such as an antisense oligonucleotide sequence, or even a regulatory sequence that affects the expression of another gene or genes.
- the gene will be a cell cycle control gene, such as a retinoblastoma (Rb) gene, a phosphorylation deficient Rb gene, p53, p21, pl6, p27, a cell cycle dependent kinase inhibitor, E2F inhibitor, a CDK kinase or a cyclin gene; alternatively the gene will be an angiogenesis gene such as VEGF, iNOS, eNOS.
- Rb retinoblastoma
- the gene may be a cytotoxic gene such as a herpes simplex thymidine kinase gene, or any other gene, the expression of which will affect proliferation of the smooth muscle cells in which the gene is expressed, and/or endothelial cells in such a ways as to effect the growth of new blood vessels.
- the nucleic acid segment may encode an antisense RNA effective to inhibit expression of a cell cycle control gene or regulatory element.
- Antisense constructs are oligo- or polynucleotides comprising complementary nucleotides to the control regions or coding segments of a DNA molecule, such as a gene or cDNA.
- Such constructs may include antisense versions of both the promoter and other control regions, exons, introns and exon:intron boundaries of a gene.
- Antisense molecules are designed to inhibit the transcription, translation or both, of a given gene or construct, such that the levels of the resultant protein product are reduced or diminished.
- Antisense RNA constructs, or DNA encoding such antisense RNAs may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.
- the antisense constructs have evident utility in the types of nucleic acid hybridization described herein.
- the gene may also encode an antigenic sequence and the necessary leader sequence for transport to the cell surface, or it may encode an enzyme, or an intracellular signal protein or peptide. or it may even encode an SM22 ⁇ gene or SM22 ⁇ cDNA gene. Particularly preferred is a constitutively active form of the Rb gene product that inhibits cellular proliferation, disclosed in Chang et al, 1995a (inco ⁇ orated herein by reference).
- the present invention may also be described, in certain embodiments, as a recombinant vector that is capable of replication in an appropriate host cell and that comprises an SM22 promoter sequence as disclosed herein, including an SM22 ⁇ promoter operatively linked to a gene or nucleic acid segment.
- Preferred vectors include, but are not limited to. a plasmid, a raus sarcoma virus (RSV) vector, a p21 viral vector, an adeno- associated viral vector or an adenoviral vector.
- RSV raus sarcoma virus
- a variety of viral vectors such as retroviral vectors, he ⁇ es simplex virus (U.S.
- Patent 5,288,641 incorporated herein by reference
- cytomegalovirus and the like may be employed, as described by Miller (Microbiol Immunol., 158:1, 1992, inco ⁇ orated herein by reference).
- Recombinant adeno- associated virus (AAV) and AAV vectors may also be employed, such as those described in U.S. Patent 5,139,941, inco ⁇ orated herein by reference.
- Recombinant adenoviral vectors are currently preferred. Techniques for preparing replication-defective infective viruses are well known in the art, as exemplified by Ghosh-Choudhury & Graham.
- a preferred adenovirus used in the practice of the present invention is replication- defective and particularly those that lack the early gene region El or the early gene regions El and E3.
- the foreign DNA of interest such as the smooth muscle specific transcriptional regulatory sequence of the present invention may be inserted into the region of the deleted El and E3 regions of the adenoviral genome. In this way, the entire sequence is capable of being packaged into virions that can transfer the foreign DNA into an infectable host cell.
- a preferred adenovirus is a type 5 adenovirus and a SM22 promoter and coding sequence are preferably flanked by adenovirus type 5 sequences.
- the invention may be described in certain embodiments as a replication deficient adenoviral vector, wherein the vector comprises a smooth muscle cell specific transcriptional regulatory segment.
- Preferred smooth muscle cell specific transcriptional regulatory segments include, but are not limited to an SM22 ⁇ promoter, a smooth muscle calponin promoter, a smooth muscle myosin heavy chain promoter, a smooth muscle alpha actin promoter, a smooth muscle alpha actin enhancer, a telokin promoter, a smooth muscle gamma-actin promoter or a smooth muscle gamma-actin enhancer.
- the enhancer elements may be included in an adenoviral vector of the present invention in combination with a promoter segment.
- a smooth muscle cell specific transcriptional regulatory segment of the present invention may be isolated from any source such as a mammal or a bird, for example, and including but not limited to a mouse, pig, rat, rabbit, human or chicken. Specific examples of such segments would include a mouse smooth muscle calponin promoter (bases 1 - 1216 of Genbank accession #U38929, or the promoter sequence of Genbank accession #U37071.
- Genbank accession #L49022 a smooth muscle myosin heavy chain promoter from a mouse (bases 1-1536 of Genbank accession # U53469), a rat (bases 1- 1699 of Genbank accession #U55179, or bases 1-2425 of Genbank accession #U83321), or a rabbit (bases 1 -2267 of Genbank accession #U15514); a human smooth muscle alpha actin promoter (bases 1-1746 of Genbank accession #D00618, or bases 1-892 of Genbank accession #J05193) or a human smooth muscle alpha actin enhancer (bases 1789-5559 of Genbank accession #D00618): a chicken smooth muscle alpha actin promoter (bases 1 - 1013 of Genbank accession #M 13756.
- a mouse smooth muscle alpha actin promoter (bases 1- 1074 of Genbank accession #M57409, M35194), a rat smooth muscle alpha actin promoter (Genbank accession #S76011); a rabbit telokin promoter (bases 1-3460 of Genbank accession #U40712); a mouse smooth muscle gamma-actin promoter (bases 1-1076 of Genbank accession #U 19488) or a mouse smooth muscle gamma-actin enhancer (bases 1 123-5703 of Genbank accession #U 19488). (All sequences discussed in this paragraph inco ⁇ orated herein by reference).
- the smooth muscle cell specific regulatory element or segment may be operatively linked to a gene or nucleic acid segment as defined above, i.e. it may be a cell cycle control gene, such as a retinoblastoma (Rb) gene, a phosphorylation deficient Rb gene. p53. p21, pi 6. p27, a cell cycle dependent kinase inhibitor, E2F inhibitor, a CDK kinase or a cyclin gene; alternatively the gene will be an angiogenesis gene such as VEGF, iNOS, eNOS. basic FGF or FGF-5, or the gene may be a cytotoxic gene such as a herpes simplex thymidine kinase gene.
- a cell cycle control gene such as a retinoblastoma (Rb) gene, a phosphorylation deficient Rb gene.
- p53. p21, pi 6. p27 a cell cycle dependent kinase inhibitor,
- the vector of the present invention is dispersed in a pharmaceutically or pharmacologically acceptable solution.
- Preferred solutions include neutral saline solutions buffered with phosphate, lactate, Tris, and the like.
- a preferred means of purifying the vector involves the use of buoyant density gradients, such as cesium chloride gradient centrifugation.
- the present invention may also be described, in certain embodiments, as a method of expressing a gene in a smooth muscle cell comprising the steps of: obtaining an isolated nucleic acid segment comprising a gene operatively linked to an SM22 promoter region; transferring that nucleic acid segment into a smooth muscle cell; and maintaining the smooth muscle cell under conditions effective to express the gene.
- the SM22 ⁇ promoter region preferably includes bases -441 to +41 of the SM22 ⁇ gene (899- 1382 of SEQ ID NO:l) or even bases -441 to +1 of the murine SM22 ⁇ gene (899-1341 of SEQ ID NO:l) and may include up to 5,000 bases of the SM22 ⁇ promoter.
- the heterologous gene is preferably a reporter gene, a cell cycle control regulatory gene, an angiogenesis gene, a virally encoded gene such as herpes simplex virus thymidine kinase (Chang, et. al., 1995b), an antisense molecule, or it may encode a muscle contraction inhibiting peptide, and may encode an Rb gene product or a peptide having the sequence MIRICRKK, SEQ ID NO: 19, or any gene or obvious variant of any gene as described above.
- the Rb gene may be the wild type Rb gene or it may be an altered gene such that the gene product is phosphorylation deficient.
- the gene product is a cell cycle regulatory element, or a contraction inhibiting peptide
- the cell itself will be the target of that effect and the utility of the method will not depend on collecting or even on identifying a protein product.
- certain gene products will have utility as markers of gene expression and as useful proteins or peptides produced by a recombinant cell.
- the present invention may be described as a method of inhibiting smooth muscle cell proliferation comprising the steps of: obtaining an isolated nucleic acid segment comprising a cell cycle regulatory gene operatively linked to an SM22 ⁇ promoter region; transferring the nucleic acid segment into a smooth muscle cell to obtain a transfected cell: and maintaining the smooth muscle cell under conditions effective to express the cell cycle regulatory gene; wherein expression of the cell cycle regulatory gene inhibits proliferation of the smooth muscle cell.
- the cell cycle regulatory gene operatively linked to an SM22 ⁇ promoter region may comprise a viral vector, a plasmid vector or it may comprise an adenoviral vector.
- the cell cycle regulatory gene ma ⁇ preferably encode Rb, a phosphorylation deficient Rb gene, p53, p21, pl6, p27. a cell cycle dependent kinase inhibitor, E2F inhibitor, a CDK kinase or a cyclin gene, for example.
- the present invention may also be described in certain broad aspects as a method of preventing restenosis in a subject following balloon angioplasty of either a coronary arten . renal artery, peripheral artery or carotid artery, for example.
- the present invention may be described in certain broad embodiments as a method of preventing restenosis in a subject following balloon angioplasty of a vein as would be used in a coronary artery bypass surgery, or other bioprosthetic grafts that might be used in the periphery.
- This method comprises the steps of obtaining a viral vector comprising a cell cycle regulatory gene operatively linked to an SM22 promoter region dispersed in a pharmaceutically acceptable solution and administering the solution to the subject.
- the subject may be an animal subject and is preferably a human subject.
- the viral vector is preferabh a replication defective adenoviral vector and the gene may preferably encode herpes simplex thymidine kinase, p53, Rb, a phosphorylation deficient Rb gene, p53, p21 , pl6. p27, a cell cycle dependent kinase inhibitor, E2F inhibitor, a CDK kinase or a cyclin gene.
- An aspect of the invention is also a method of screening for identifying smooth muscle cell specific transcriptional control elements and particularly those elements that work in trans.
- the method as provided herein preferably employs a reporter gene that confers on its recombinant hosts a readily detectable phenotype that is either expressed or inhibited, as the case may be.
- reporter genes encode (a) a polypeptide not otherwise produced by the host cell; or (b) a protein or factor produced by the host cell but at lower levels; or (c) a mutant form of a polypeptide produced by the host cell.
- the gene encodes an enzyme which produces colorimetric or fluorometric change in the host cell which is detectable by in situ analysis and which is a quantitative or semi-quantitative function of transcriptional activation.
- Exemplary enzymes include esterases, phosphatases, proteases (tissue plasminogen activator or urokinase) and other enzymes capable of being detected by activity that generates a chromophore or a fluorophore as will be known to those of skill in the art.
- Examples of such a reporter gene are the E. coli ⁇ -galactosidase ( ⁇ -gal) and firefly luciferase genes.
- the ⁇ -gal enzyme produces a color change upon cleavage of the indigogenic substrate, indolyl- ⁇ -D-galactoside by cells expressing ⁇ -galactosidase.
- this enzyme facilitates automatic plate reader analysis of expression directly in microtiter wells containing transformants treated with candidate activators. Also, since the endogenous ⁇ - galactosidase activity in mammalian cells ordinarily is quite low, the analytic screening system using ⁇ -galactosidase is not hampered by host cell background. This enzyme offers the further advantage that expression can be monitored in vivo by tissue analysis as described below.
- reporter genes that confers detectable characteristics on a host cell are those that encode polypeptides, generally enzymes, that render their transformants resistant against toxins, e.g., the neo gene, which protects host cells against toxic levels of the antibiotic G418; a gene encoding dihydrofolate reductase, which confers resistance to methotrexate, or the chloramphenicol acetyltransferase (CAT) gene.
- Other genes for use in the screening assay herein are those capable of transforming hosts to express unique cell surface antigens, e.g. viral env proteins such as HIV gpl20 or he ⁇ es gD, which are readily detectable by immunoassays.
- the present invention may be described as a recombinant vector comprising an isolated SM22 ⁇ promoter positioned adjacent a gene in a position to control expression of the gene.
- the splicing of nucleic acid sequences is well known in the art as described above and the insertion of such genes into vectors is also well known in the art.
- the vector of the present invention may be a plasmid, a phagemid, a replication defective adenovirus, an adeno-associated virus or a retrovirus. for example.
- the type of vector does not necessarily in and of itself define the present invention, and therefore in certain embodiments, any vector that can transfer genetic material into a cell to be expressed in that cell will be useful in the present invention.
- the nucleic acid segments may be transferred into a cell by means such as liposomes, receptor ligand carriers, mechanical means such as electroporation, etc. and that all such embodiments are encompassed within the claimed invention.
- the recombinant vector of the present invention preferably is a replication deficient adenovirus or a high expression plasmid comprising an SM22 ⁇ promoter operatively joined to a gene, and wherein the gene may be a cell cycle control gene, such as a retinoblastoma (Rb) gene, a phosphory lation deficient Rb gene, p53, p21, pl6, p27.
- a cell cycle control gene such as a retinoblastoma (Rb) gene, a phosphory lation deficient Rb gene, p53, p21, pl6, p27.
- the gene may be an angiogenesis gene such as VEGF, iNOS, eNOS, basic FGF or FGF-5: or the gene may be a cytotoxic gene such as a herpes simplex thymidine kinase gene.
- the method of inhibiting muscle contraction will have utility in the treatment of palliation of a variety of diseases that arise from muscle cell contraction.
- diseases include, but are not limited to Prinzmetal's angina, hypertension. Raynaud's phenomenon, migraine headache, a variety of collagen vascular diseases such as ELS, scleroderma, pulmonary hypertension, coronary arterial vasospasm, in contractile disorders of smooth muscle cells in the eye, gut, uterus, bladder, spleen, etc., or even in striated muscle spasms in paralysis victims.
- the present invention may be described as a method of promoting angiogenesis in a subject comprising the steps of obtaining a nucleic acid segment comprising an angiogenesis factor gene operatively linked to an SM22 ⁇ promoter region; and transferring the nucleic acid segment into a smooth muscle cell to obtain a transfected cell; wherein expression of the nucleic acid segment in the smooth muscle cell promotes angiogenesis.
- the smooth muscle cell may be a coronary arterial or venous smooth muscle cell, or it may be a peripheral arterial or venous smooth muscle cell.
- a preferred angiogenesis factor is VEGF. iNOS, eNOS. basic FGF or FGF-5.
- the nucleic acid segment comprising an angiogenesis factor gene operatively linked to an SM22 ⁇ promoter region is contained in a viral or plasmid vector and the vector is administered to a subject.
- the transferring is done ex vivo and the method further comprises the steps of seeding a bioprosthetic graft or stent with the transfected cells to obtain a seeded graft or stent; and placing the seeded graft or stent into a coronary or peripheral artery or vein of a subject.
- the present invention may also be described in certain broad aspects as a method of inhibiting smooth muscle proliferation comprising the steps of obtaining a nucleic acid segment comprising a cell cycle regulatory gene operatively linked to an SM22 ⁇ promoter region; transferring the nucleic acid segment into a primary smooth muscle cell in vivo or ex vivo to obtain a transfected cell; seeding a bioprosthetic graft or stent with the transfected cell to obtain a seeded graft or stent; and placing the seeded graft or stent into a coronary or peripheral artery or vein of a subject, wherein expression of the cell cycle regulatory gene inhibits proliferation of a smooth muscle cell.
- GenBank accession number for the murine SM22 ⁇ cDNA is L41 154.
- GenBank accession number for the murine SM22 ⁇ gene is L41161.
- FIG. 1 Cellular-specificity of the 441-bp SM22 promoter.
- FIG. 2 Schematic representation of the c/ -acting elements and the trans-acting factors identified DNase I footprint and EMSAs analyses that bind to the SM22 promoter.
- AdSM22-lacZ and AdCMV-lacZ adenoviral vectors are schematic representations of the AdSM22-lacZ and AdCMV-lacZ adenoviral vectors.
- the AdSM22-lacZ vector (upper panel) encodes the bacterial lacZ reporter gene (black box) and bovine growth hormone polyadenylation signal (box with horizontal lines) under the transcriptional control of the 441-bp murine SM22 ⁇ promoter (box with diagonal lines) and the 450-bp human 4F2 transcriptional enhancer (white box).
- the El and E3 regions of the Ad5Sub360 adenoviral genome were deleted ( ⁇ F3) rendering the virus replication-defective.
- the AdCMV-lacZ control virus encodes the lacZ reporter gene (black box) under the transcriptional control of the cytomegalovirus immediate early gene promoter enhancer (box filled with dots).
- FIG. 3B Comparison of the activity of AdSM22-lacZ and the AdCMV-lacZ control virus in primary cultures of rat aortic smooth muscle cells (VMSC) and human umbilical vein endothelial cells (HUVEC).
- VMSC rat aortic smooth muscle cells
- HUVEC human umbilical vein endothelial cells
- Primary cultures of VSMCs or HUVECs were infected with 1 -, 10-, and 100-PFU of either AdSM22-lacZ (black squares-FIUVEC and black circles-VSMC) or AdCMV-lacZ (open squares -HUVEC and open circles-VSMC) and the % of cells expressing ⁇ -galactosidase activity was quantitated 72-h post-infection. Data are expressed as the mean percentage of cells expressing ⁇ gal activity ⁇ S.E.M.
- the present invention arises from the isolation and characterization of a smooth muscle cell specific promoter region that, in its naturally occurring state, controls the expression of the SM22 gene, and the discovery that this isolated promoter region may be operatively joined to a heterologous structural gene and will control the expression of that gene specifically in smooth muscle cells and other myogenic cell lineages including an embryonic skeletal muscle cell.
- An important element of the present invention is that, unlike other known smooth muscle cell promoters, the SM22 ⁇ promoter is cell cycle independent and is thus not down-regulated when the cell enters the proliferative state.
- the promoter sequence of the present invention will be useful in the expression of heterologous genes in a smooth muscle cell, in the discovery of trans and cis acting transcriptional control elements that affect smooth muscle cell gene expression and as a probe to isolate SM22 ⁇ genes and promoters.
- the present invention will find use in the prevention of restenosis following balloon angioplasty or other arterial injury, in the treatment of artherosclerosis or peripheral vascular occlusive disease, in the promotion of angiogenesis in graft or stent implants and in the treatment or prevention of asthma, among other smooth muscle cell proliferative diseases.
- AdSM22-lacZ a recombinant replication-defective adenoviral vector (RDAd) was generated, designated AdSM22-lacZ, which contains the bacterial lacZ reporter gene under the transcriptional control of the SMC-specific SM22 ⁇ promoter (Solway et al., .1. Biol. Chem., 270 (22): 13460-13469, 1995; Kim et al. Mol. Cell. Biol, (17):2266-2278, 1997; Li et al, J. Cell Biol , 132:849-859, 1996b).
- this adenoviral construct, AdSM22-lacZ programs SMC-specific expression of the lacZ reporter gene in cultured cells.
- AdSM22-lacZ virus In addition, the SMC-specificity of the AdSM22-lacZ virus is maintained in vivo following intra-arterial, intra-muscular and intravenous administration. Finally, AdSM22-lacZ programs transgene expression in visceral, as well as vascular SMCs in vivo.
- the murine SM22 ⁇ promoter may contain an insulator element or a locus control region that is capable of protecting it from the activity of cryptic transcriptional regulatory elements located within the adenoviral genome.
- the murine SM22 ⁇ promoter is as active as the most potent viral LTRs in SMCs (Solway et al. 1995), and functions in a SMC-specific fashion both in vitro and in transgenic mice in vivo (Kim et al, 1997; Li et al, 1996b; Moessler et al, Development, 122:2415-2425, 1996). It is contemplated, therefore, that an insulator element, when isolated from an SM22 ⁇ promoter will be useful as a means of conferring tissue specificity to those tissue specific promoters that lose tissue specificity when expressed from an adenoviral vector.
- RDAd are particularly useful tools for studying the molecular pathogenesis of atherosclerosis and other vascular proliferative disorders.
- Adenoviruses can be delivered in spatially- and temporally-restricted fashions to the vessel wall in both normal and atherosclerotic vessels in large and small animals (French et al, 1994; Simari et al, 1996).
- previous studies using these vectors to investigate the pathogenesis of vascular proliferative disorders have not been able to distinguish effects due to alterations in vascular SMC gene expression from those resulting from transgene expression in endothelial or adventitial cells.
- RD Ad-containing transgenes under the control of the SM22 ⁇ promoter allow one to determine directly the effects of SMC-specific transgene expression on vascular SMC proliferation and neointima formation.
- SM22 containing RDAd program transgene expression in visceral SMCs these viruses may also be useful to examine the pathogenesis and treatment of diseases mediated by visceral SMCs. Examples of such diseases include asthma, achalasia, leiomyosarcomas, irritable bowel syndrome and uterine leiomyomas.
- SM22 promoter-driven adenoviruses may prove advantageous as vehicles to deliver therapeutic genes to the vessel wall for the treatment of vascular proliferative disorders.
- AdSM22 viruses may also reduce the immune-mediated damage to organs such as the liver and the lung following intentional or inadvertent systemic administration of the vector, as indicated by the finding of decreased hepatic toxicity following IV administration of high dose AdSM22-lacZ.
- the present invention provides a process of directing and regulating gene expression in a smooth muscle cell.
- a gene operatively joined to an SM22 ⁇ promoter is delivered to a smooth muscle cell and the smooth muscle cell is then maintained under physiological conditions and for a period of time sufficient for the gene to enter the smooth muscle cell, for the gene to be transcribed and in certain embodiments, for the product of that gene to be expressed.
- Delivery is preferably by transfection with a plasmid or a high expression plasmid. replication defective adenovirus, adeno-associated virus. p21 virus, raus sarcoma virus, or other virus vector construct capable of transfecting a smooth muscle cell, and comprising an SM22 ⁇ promoter operatively joined to a coding sequence that encodes the gene product.
- adenovirus vector-mediated cell transfection has been reported for various cells (Stratford- Perricaudet, et al, J. Clin. Invest, 90, 626-630, 1992).
- An adenovirus vector of the present invention is replication defective.
- a virus is rendered replication defective by deletion of the viral early region 1 (El) region.
- An adenovirus lacking an El region is competent to replicate only in cells, such as human 293 cells, which express adenovirus early region 1 genes from their cellular genome. Thus, such an adenovirus cannot replicate in cells that do not provide the early gene product of the El region.
- an adenovirus vector used in the present invention is lacking both the El and the E3 early gene regions.
- the coding sequence for a gene product at the position from which the El and/or E3 coding sequences have been removed (Karlsson et al, EMBO J., 5. 2377-2385, 1986).
- the El region of adenovirus is replaced by the coding DNA sequence or gene.
- the position of insertion within the adenovirus sequences is not critical to the present invention.
- a wide variety of adenovirus vectors can be used in the practice of the present invention.
- An adenovirus vector can be of any of the 42 different known serotypes of subgroups A-F.
- Adenovirus type 5 of subgroup C is the preferred starting material for production of a replication-defective adenovirus vector.
- Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector. In order to replicate the virus, the vector is co-transfected into 293 cells together with a plasmid carrying the complete adenovirus type 5 genome.
- Preferred plasmids may also confer ampicillin and tetracycline resistance due to insertion of the appropriate sequences into the virus genome.
- the molecular strategy employed to produce recombinant adenovirus is based upon the fact that, due to the packaging limit of adenovirus, the plasmid cannot efficiently form plaques on its own. Therefore, homologous recombination between the desired construct and the co-transfected plasmid within a transfected cell results in a viable virus that can be packaged and form plaques only on 293 cells.
- Co-transfection is performed in accordance with standard procedures well known in the art.
- 293 cells are cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum in a humidified 5% C0 2 atmosphere.
- Confluent 10 cm dishes are split into three 6 cm dishes.
- the cells are cotransfected in calcium phosphate with HeLa DNA as carrier.
- a 15% glycerol stock is used to boost transfection efficiency and the cells are overlaid with 0.65% Noble agar in DMEM containing 2% FCS, 50 mg/ml penicillin G, 10 mg/ml streptomycin sulfate, and 0.25 mg/ml fungizone (GIBCO, Grand Island, NY). Monolayers are incubated for approximately 10 days until the appearance of viral plaques.
- plaques are picked, suspended in DMEM containing 2% FCS, and used to infect a new monolayer of 293 cells.
- viral lysates are subjected to a freeze/thaw cycle and designated as primary stocks.
- Recombinant virus with the correct structure is verified by preparation of viral DNA from productively-infected 293 cells, restriction analysis, and Southern blotting.
- Secondary stocks are subsequently generated by infecting 293 cells with primary virus stock at a multiplicity of infection of 0.01 and incubation until lysis.
- Recombinant adenovirus vectors can be propagated on, e.g., human 293 cells, or in other cell lines that are permissive for conditional replication-defective adenovirus infection, e.g., those which express adenovirus El gene products "in trans" so as to complement the defect in a conditional replication-defective vector. Further, the cells can be propagated either on plastic dishes or in suspension culture, in order to obtain virus stocks thereof.
- a preferred method is to percutaneously infuse an adenovirus vector construct into a native or balloon-injured blood vessel that perfuses smooth muscle cells (WO 9411506: Barr et al. Gene Therapy, 1 (1 ):51 - 58, 1994; both inco ⁇ orated herein by reference) by intravenous or intra-arterial injection.
- Methods of delivery of foreign DNA are known in the art. such as containing the DNA in a liposome and infusing the preparation into an artery (LeClerc et al . Circulation 85:543, 1992. inco ⁇ orated herein by reference), transthoracic injection (Gal et al . Lab Invest. 68: 18-25.
- adenovirus vector construct After delivery of an adenovirus vector construct to a smooth muscle cell, that cell is maintained under physiological conditions and for a period of time sufficient for the adenovirus vector construct to infect the cardiac cell and for cellular expression of a coding sequence contained in that construct.
- Physiological conditions are those necessary for viability of the smooth muscle cell and include conditions of temperature, pH, osmolality and the like. In a preferred embodiment, temperature is from about 20°C to about 50°C, more preferably from about 30°C to about 40°C and, even more preferably about 37°C.
- pH is preferably from a value of about 6.0 to a value of about 8.0, more preferably from about a value of about 6.8 to a value of about 7.8 and, most preferably about 7.4.
- Osmolality is preferably from about 200 milliosmols per liter (mosm/L) to about 400 mostn/1 and, more preferably from about 290 mosm/L to about 310 mosm/L.
- Other physiological conditions needed to sustain smooth muscle cell viability are well known in the art.
- adenovirus vector employed is replication defective, it is not capable of replicating in the cells that are ultimately infected. Moreover, it has been found that the genomic integration frequency of adenovirus is usually fairly low, typically on the order of about 1%. Thus, where continued treatment is required, it may be necessary to reintroduce the virus every 6 months to a year. In these circumstances, it may therefore be necessary to conduct long term therapy, where expression levels are monitored at selected intervals.
- An adenovirus vector construct is typically delivered in the form of a pharmacological composition that comprises a physiologically acceptable carrier and the adenovirus vector.
- An effective expression-inducing amount of such a composition is delivered.
- the term "effective expression-inducing amount” means that number of virus vector particles necessary to effectuate expression of a gene product encoded by a coding sequence contained in that vector. Means for determining an effective expression-inducing amount of an adenovirus vector construct are well known in the art.
- An effective expression-inducing amount is typically from about 10 plaque forming units (pfu) to about 10 ?
- pfu preferably from about 10 pfu to about 10 pfu and, more preferably, from about 10 to about 10 " pfu.
- a specific dose level for any particular subject depends upon a variety of factors including the infectivity of the adenovirus vector, the age, body weight, general health, sex. diet, time of administration, route of administration, rate of excretion, and the severity of the particular disease undergoing therapy.
- adenovirus is a virus that infects humans
- certain individuals that have developed antibodies to certain adenovirus proteins.
- an immunological reaction is believed to be a possibility
- Such a test could be performed in a variety of accepted manners, for example, through a simple skin test or through a test of the circulating blood levels of adeno virus-neutralizing antibodies.
- the present invention relates to pharmaceutical compositions that may comprise an adenovirus vector gene construct dispersed in a physiologically acceptable solution or buffer.
- a composition of the present invention is typically administered parenterally in dosage unit formulations containing standard, well known, nontoxic, physiologically acceptable carriers, adjuvants, and vehicles as desired.
- parenteral as used herein includes intravenous, intramuscular, intraarterial injection, or infusion techniques.
- Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions are formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation can also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
- acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this pu ⁇ ose any bland fixed oil can be employed including synthetic mono- or di- glycerides.
- fatty acids such as oleic acid find use in the preparation of injectables.
- Preferred carriers include neutral saline solutions buffered with phosphate, lactate. Tris, and the like.
- a preferred means of purifying the vector involves the use of buoyant density gradients, such as cesium chloride gradient centrifugation.
- the coding region of the murine SM22 cDNA was isolated by performing low stringency PCRTM using murine uterine RNA and synthetic 5' and 3' oligonucleotide PCRTM primers constructed from the previously published sequence of the rat SM22 ⁇ cDNA (Nishida et al, Gene, 130:297-302, 1993).
- the 5' PCRTM primer was constructed to be identical to the first 34-bp of the rat SM22 ⁇ cDNA with the addition of a 5' EcoRI site (5'
- the 3' primer was constructed to include the reverse complement of bp 759 to 782 of the rat
- SM22 ⁇ cDNA with an additional 3' Hindlll restriction site (5' ATCAAGCTTGGTGGGAGCTGCCCATGTGCAGTC 3'. SEQ ID NO: l 1).
- PCRTM reaction products were subcloned into EcoRI/Hindlll-digested pGEM7Z (Promega. Madison. WI) as described elsewhere (Parmacek and Leiden, ./. Biol. Chem. :264: ⁇ 32 ⁇ 7- ⁇ 3225, 1989).
- the nucleotide sequence of the murine SM22 ⁇ cDNA was confirmed by sequencing of the full- length murine SM22 ⁇ genomic clone. MacVector DNA sequencing software (Kodak/IBI. Rochester. NY) was used for DNA sequence analyses.
- [ P]-labeled murine SM22 ⁇ cDNA probe (bp 29-81 1) as described previously (Parmacek et al, Mol. Cell. Biol, 12:1967-1976, 1992). Twelve clones were purified to homogeneity and analyzed by Southern blot analyses as described (Parmacek et al , 1992). Two independent clones, each of which contained a poly (A) tail, were subcloned into pGEM7Z and their nucleotide sequences determined. The nucleotide sequence of the 5' -untranslated region was determined from the sequence of the SM22 ⁇ genomic clone. The 5' -untranslated region was localized on the genomic clone by Southern blot hybridizations, in addition to RNase protection and primer extension analyses as described below.
- Approximately 1 x 10 recombinant phage from a murine 129SV Lambda FIX II genomic library (Stratagene, La Jolla, CA) were screened with the 783-bp murine SM22 ⁇ cDNA probe (bp 29-811) labeled with [ ⁇ - 32 P]dCTP, and three positive clones were purified to homogeneity as described previously (Parmacek et al, 1992).
- One clone (SM22-13a) was found to include the entire coding region of the SM22 gene and 9-kb of 5' flanking sequence and was used for all subsequent subcloning and sequencing studies.
- High molecular weight DNA was prepared from the tails of strain 129SV mice as described previously (Parmacek et al . 1989). Southern blotting and hybridization to the radiolabeled 783-bp murine SM22 ⁇ cDNA probe were performed as described previoush
- Northern blotting was performed using 10 mg of RNA per sample as described previously with the exception that 36 mg/ml of ethidium bromide was added to the RNA resuspension buffer in order to permit quantitation of the 28S and 18S ribosomal RNA subunits in each lane.
- Probes included the 783-bp (bp 29-811) murine SM22 ⁇ cDNA and the 754-bp (bp 659-1404) murine calponin cDNA probe. Quantitative image analyses were performed using a Molecular Dynamics Phosphorlmager (Sunnyvale, CA).
- a 25-mer oligonucleotide probe constructed to include the reverse complement of base pairs +80 to +104 of the SM22 ⁇ gene (5' TGCCGTAGGATGGACCCTTGTTGGC 3', SEQ ID NO: 12) was 5' end labeled with [ ⁇ - 32 P]ATP and T4 polynucleotide kinase.
- 40 mg of mouse uterine RNA was hybridized to 2 x 10 DPM of labeled probe and primer extension reactions performed at 42°C, 50°C and 56°C as described previously (Parmacek et al, 1992).
- 5' RACE was performed using murine uterine RNA and a synthetic antisense cDNA probe corresponding to bp 234 to 258 of the murine SM22 ⁇ cDNA according to the manufacturer's instructions (Perkin Elmer, Norwalk, CT).
- RNase protection analyses were performed by subcloning the -441 to +41 murine SM22 ⁇ genomic subfragment including a synthetic 3' Hindlll linker into Pstl/Hindlll-digested pGEM4Z and performing in vitro transcription of the antisense strand of the genomic subfragment with T7 polymerase of the Nco/-linearized plasmid (Ncol cuts at bp -88 of the genomic clone) in order to obtain an antisense cRNA probe corresponding to bp -88 to +44.
- the Hindlll linker shares sequence identity with the SM22 ⁇ cDNA resulting in a cRNA probe with sequence identity initiated at bp +44 (not +41) of the SM22 ⁇ genomic clone.
- the 142-bp probe was labeled with [ ⁇ - j2 P]UTP and RNase Protection Analyses were performed using the RPAIITM kit (Ambion, Austin, TX) according to the manufacturer's instructions.
- Antisense cRNA probe radiolabeled by inco ⁇ oration of ⁇ -[ P]-UTP is synthesized by in vitro transcription from linearized pBluescriptIIKST7-/ cZ, which contains the lacZ gene upstream of the T7 RNA polymerase promoter, using the MaxiScriptTM kit (Ambion, Austin, TX). Band intensity is quantified by PhosphorlmagerTM, as previously for southern analyses described above.
- Cell Culture The rat cell line A7r5 which was derived from embryonic thoracic aorta was grown in Dulbecco's Modified Essential Media (GIBCO) supplemented with 10% fetal bovine serum (GIBCO) and 1 % penicillin/streptomycin.
- the human hepatocellular carcinoma cell line Hep G2 was grown in Modified Eagle's Medium supplemented with 10% fetal bovine serum and 0.1 mM MEM non-essential amino acids (GIBCO).
- Murine lymphoma-derived EL4 cells were grown in Dulbecco's modified Eagle's Media supplemented with 10% horse serum (GIBCO).
- Murine NIH 3T3 cells, C3H10T1/2 cells, C2C12 myoblasts and myotubes were grown as described previously (Parmacek et al, J. Biol. Chem., 265:15970-15976, 1990; Parmacek et al, Mol. Cell. Biol, 14:1870-1885, 1994).
- rat aortic SMCs Primary cultures of rat aortic SMCs were isolated from 12-16 week old Sprague Dawley rats (Charles River Laboratories, Wilmington, MA) using the method described previously (Chang et al, Science, 1995a). Virtually all cells isolated using this method stain positive with anti-smooth muscle actin monoclonal antiserum. In all studies, only early passage (passage 2 or 3) rat aortic SMCs were utilized.
- SMCs from the third passage were placed in serum-free medium (50% Dulbecco's minimal essential medium (DMEM), 50% Ham's F-12, L-glutamine (292 mg/ml), insulin (5 mg/ml), transferrin (5 mg/ml), selenious acid (5 ng/ml)) for 72 hrs in order to synchronize the cells in G 0 /G] as described previously (Chang et al , 1995a). Following 72 hrs of serum starvation, cells were stimulated to proliferate by incubation in medium containing 45% DMEM, 45%> Ham's F-12 and 10% FBS. Mouse WEHI B-cells and mouse 70Z/3 pre-B lymphocytes were grown as described previously (Morrisey et al . Dev. Biol, 177:309-322, 1996). DNase I footprinting
- Nuclear extracts were prepared from the smooth muscle cell line, A7r5 (which express high levels of SM22 ⁇ mRNA (Solway et al. 1995)) and NIH 3T3 cells as described previously (Parmacek et al. 1992). Three overlapping genomic subfragments (bp -441 to - 256, bp -256 to -89, and bp -89 to +41) spanning the 482-bp SM22 ⁇ promoter were analyzed.
- DNase I footprint analyses were performed with 100-150 mg of nuclear extracts prepared from the smooth muscle cell line, A7r5, or NIH 3T3 fibroblasts and the end-labeled sense and antisense strands of the murine SM22 ⁇ promoter as described previously (Parmacek et al.. 1994). Standard Maxam and Gilbert (G + A) sequencing reactions were run in parallel to identify the protected sequences.
- Electrophoretic mobility shift assays (EMSAs)
- Nuclear extracts were prepared from low passage number primary rat aortic SMCs. A7r5 cells, NIH 3T3 cells, C3H10T1/2 cells, C2C12 myotubes, WEHI, 70Z/3 and EL4 cells as described by Dignam et al. Nucleic Acids Res. 1 1 : 1475, (1983). EMSAs were performed in 0.25X TBE (IX TBE is 100 mM Tris, 100 mM boric acid and 2 mM EDTA) as described previously (Ip et al. Mol. Cell. Biol, 14:7517-7526, 1994).
- sc-335X ⁇ -Spl rabbit polyclonal IgG (Santa Cruz, sc-059X), ⁇ -YYl rabbit polyclonal IgG (Santa Cruz, sc-281X), ⁇ -CREB-1 mouse monoclonal IgG2 (Santa Cruz, sc-271), ⁇ -ATF-1 mouse monoclonal IgA (Santa Cruz, sc-243), ⁇ -AP2 rabbit polyclonal IgG (Santa Cruz, sc-184X), or ⁇ -GATA-4 rabbit polyclonal IgG (Ip et al. 1994) was incubated with the indicated nuclear extract at 4°C for 20 minutes prior to the binding reaction as described previously (Ip et al, 1994).
- SM22 ⁇ mutant promoter-luciferase reporter plasmids were generated by PCRTM-mediated site directed mutagenesis as described previously (Morrisey et al, 1996).
- the rous sarcoma virus (RSV) LTR-driven luciferase reporter plasmid, pRSVL, and the pMSV ⁇ gal reference plasmid have been described previously (Parmacek et al. , 1992).
- the promoterless pGL2-Basic plasmid (Promega, Madison, WI) served as the cloning backbone for all of the luciferase reporter plasmids described herein.
- the p-5000/H SM221uc plasmid contains 5-kb of SM22 ⁇ 5' flanking sequence, the untranslated SM22 ⁇ first exon. the SM22 ⁇ first intron and the first 12-bp of exon 2 of the SM22 ⁇ gene subcloned 5' of the luciferase reporter gene.
- SM22 ⁇ genomic subfragment including at its 5' end the SM22 ⁇ intron 1 Hindlll restriction site, and running to bp +76 of the SM22 cDNA (which includes 12-bp of exon 2) was subcloned into the Hindlll-digested vector and its correct orientation (5' to 3' relative to the luciferase reporter gene) confirmed by DNA sequence analysis.
- the p-5000SM221uc plasmid containing 5-kb of SM22 ⁇ 5' flanking sequence subcloned 5' of the luciferase reporter gene, was constructed by first subcloning the 2.2-kb BamHIIEcoRI SM22 ⁇ genomic subfragment (corresponding to bp -5000 to -2800) into BamHI/EcoRI- ⁇ igested pBluescriptllKS (Stratagene La Jolla, CA).
- the 1250-bp EcoRIINcoI SM22 ⁇ genomic subfragment corresponding to bp -1338 to -89 and the 130-bp PCRTM-generated genomic subfragment containing bp -88 (including the Ncol site at its 5' end) to +41 (including a Hindlll linker at its 3' end) was ligated into the EcoRII Hindlll-dig sXcd vector.
- the 1.4-kb EcoRI SM22 ⁇ genomic subfragment (corresponding to bp -2800 to -1339) was subcloned into the plasmid and its orientation confirmed by DNA sequence analysis.
- the p- 1338SM221uc plasmid containing the 1379-bp SM22 ⁇ genomic subfragment (bp -1338 to +41 ) subcloned 5' of the luciferase reporter in the pGL2-Basic vector was constructed using the 1250-bp EcoRI/NcoI SM22 ⁇ genomic subfragment (bp -1338 to -89) and the 130-bp (bp -88 to +41) PCRTM -generated genomic subfragments described herein.
- the p-441SM221uc plasmid contains the 482-bp (bp -441 to +41) Pstli Hindlll SM22 ⁇ genomic subfragment subcloned into Bglll/Hindlll-digested pGL2-Basic plasmid.
- the p-300SM221uc and p-162SM221uc luciferase reporter plasmids contain the PCRTM-generated bp -300 to +41, and -162 to +41 SM22 ⁇ genomic subfragments (including synthetic Xhol (5' end) and Hindlll (3' end) linkers), subcloned into XhoI/HindW-digested pGL2-Basic vector. All PCRTM-generated genomic subfragments were confirmed by dideoxy DNA sequence analysis.
- SM22 ⁇ mutant promoter-luciferase reporter plasmids were generated and named according to the specific nuclear protein binding site (or sites) within the promoter that was mutated (mutated nucleotides within each nuclear protein binding site are underlined): p-441 SM22 ⁇ SME-l 5' AAGGAAGGGT TTCAGGGTCC TGCCCATAGA TCTTTTTTCC CGGCCGC 3' (SEQ ID NO:38); p-441SM22 ⁇ SME-25' CCGCCCTCAG CACCGCGGAT CCCCGACCCC CGCAGCATCT
- GCGGCCG 3' (SEQ ID NO:45); p-441 SM22 ⁇ YYl /SME-6 5' GGACGGCAGA GGGGATCCAT CACTGCCTAG GCGGCCG 3' (SEQ ID NO:46).
- SM22 ⁇ promoter-luciferase reporter plasmids were subcloned that contain mutations in two s-acting sequences in the SM22 ⁇ promoter sequence, p- 441SM22 ⁇ CArG contains the mutations described above in the SME-1 and SME-4 sites, and p-441 SM22 ⁇ SME2/5 contains the mutations described above in the SME-2 and SME-5 sites.
- p- 441SM22 ⁇ CArG contains the mutations described above in the SME-1 and SME-4 sites
- p-441 SM22 ⁇ SME2/5 contains the mutations described above in the SME-2 and SME-5 sites.
- Each PCRTM-generated SM22 ⁇ promoter mutant was confirmed by DNA sequence analyses as described previously (Parmacek et al, 1992).
- transgenic vectors were cloned each of which encodes the bacterial lacZ reporter gene under the transcriptional control of the native or mutated SM22 ⁇ promoter fragments.
- the p-5000SM22-/ ⁇ cZ, p-441 SM22-/ ⁇ cZ plasmid, the p- 441SM22 ⁇ CArG-/ ⁇ cZ, and p-280SM22-/ ⁇ cZ plasmids contain the 5-kb SM22 ⁇ promoter, the 441-bp SM22 ⁇ promoter, the 441-bp SM22 ⁇ promoter with mutations in SME-1 and SME-4 (that abolish binding of SRF), and the 280-bp SM22 ⁇ promoter, respectively. subcloned immediately 5' of the bacterial lacZ reporter gene in a modified pBluescript IIKS (Stratagene) plasmid. Transfections and Luciferase assays
- 1 x 10 6 NIH 3T3 or COS-7 were transfected with 20 ⁇ g of Lipofectin reagent, 15 ⁇ g of the luciferase reporter plasmid and 5 ⁇ g of the pMSV ⁇ gal reference plasmid as described previously (Ip et al, 1994; Forrester et al. . Am. Coll. Cardiol . 17:758-769, 1991).
- 1 x 10 6 Hep G2 cells were transfected using 360 ⁇ g of Lipofectamine reagent (Life Technologies, Gaithersburg, MD), 26 ⁇ g of luciferase reporter plasmid and 9 ⁇ g of the pMSV ⁇ gal reference plasmid.
- Luciferase activities were corrected for variations in transfection efficiencies as determined by assaying cell extracts for ⁇ -galactosidase activities. Data are expressed as normalized light units + S.E.M.
- Transgenic mice were produced harboring the p-5000SM22-/ ⁇ cZ, p-441 SM22-/ ⁇ cZ. p-441 SM22 ⁇ CArG-/ ⁇ cZ and p-280SM22-/ ⁇ cZ transgenes according to standard techniques as described previously (Metzger et al, Proc. Natl. Acad. USA, 90:9036, 1993). To identify transgenic founder mice, Southern blot analysis was performed using the radiolabeled lacZ probe and high molecular weight DNA prepared from tail biopsies of each potential founder.
- the number of copies per cell were quantitated by comparing the hybridization signal intensity (DPM) to standards corresponding to 1, 10 and 100 copies/cell using a Molecular Dynamics PhosphorlmagerTM. At least four independent founder lines containing each transgene were identified as described previously (Parmacek and Leiden, 1989). Transgenic embryos (less than ED 15.5) and tissue sections from adult mice were fixed, stained for ⁇ - galactosidase activity and counter-stained with hematoxylin and eosin as described previousl ⁇ (Lin et al, Circulation, 82:2217-2221, 1990), except that 0.02% NP-40 was added to PBS during the fixation of whole mount embryos.
- DPM hybridization signal intensity
- Murine SM22 ⁇ cDNA clones were isolated using the polymerase chain reaction in conjunction with synthetic oligonucleotide primers derived from the previously published sequence of the rat SM22 ⁇ cDNA (Nishida et al, 1993).
- the nucleotide sequence of the full- length murine SM22 ⁇ cDNA is designated herein as SEQ ID NO:8.
- the murine SM22 ⁇ cDNA encodes a 201-amino acid polypeptide, SEQ ID NO:9, with a predicted molecular mass of 22.5 kDa. It is composed of a 76-bp 5' untranslated region, a 603-bp open reading frame, and a 403-bp 3' untranslated region. Twenty three base pairs 5' of the poly(A) tail there is an A/T rich sequence (AATATA) which may function as the polyadenylation signal.
- AATATA A/T rich sequence
- the protein sequence encoded by the murine SM22 ⁇ cDNA exhibits partial sequence identity with the sequence of the Drosophila muscle protein mp20 (Lees-Miller et al, J. Biol. Chem., 262:2988-2993. 1987) across the entire cDNA. suggesting that these two proteins may have evolved from a common ancestral gene. Two domains were particularly well conserved between these proteins. One domain with 14/19 amino acid identity (corresponding to amino acids 104-122 of the murine SM22 ⁇ protein) may represent a calcium binding domain oriented in an EF hand conformation (Kretsinger. CRC Crit. Rev. Biochem., 8: 1 19-174, 1980). The second C-terminal conserved domain with 13/24 amino acid identity (corresponding to amino acids 158-181 of the murine SM22 ⁇ protein) is a domain of unknown function. SM22 ⁇ Is Encoded by a Single Copy Gene
- SM22 ⁇ might be related to other members of the troponin C supergene family of intracellular calcium binding proteins including slow/cardiac troponin C, fast skeletal troponin C, calmodulin, myosin light chain and parvalbumin (Kretsinger. 1980).
- the murine SM22 ⁇ cDNA was used to probe Southern blots containing murine genomic DNA under both high and low stringency conditions.
- the murine SM22 ⁇ cDNA probe hybridized to one or two BamHI, EcoRI, Hindlll, Pstl and Xbal bands, suggesting that SM22 ⁇ is a single copy gene in the murine genome.
- no additional bands were demonstrated under low stringency conditions, suggesting that although the SM22 ⁇ gene may have one EF hand calcium binding domain, it is not closely related to other members of troponin C supergene family.
- SM22 ⁇ protein is expressed solely in smooth muscle-containing tissues of the adult and may be one of the earliest markers of the smooth muscle cell lineage (Gimona et al, Eur. J. Biochem., 205:1067-1075. 1992; Duband et al. Differentiation, 55 (1):1-1 1, 1993; Nishida et al, 1993).
- the SM22 ⁇ cDNA was hybridized to Northern blots containing RNAs prepared from 12-week old murine tissues. The murine SM22 ⁇ cDNA probe hybridized to one predominant mRNA species of approximately 1.2-kb.
- SM22 ⁇ mRNA is expressed at high levels in the smooth muscle-containing tissues of aorta, small intestine, lung, spleen and uterus. In addition, prolonged autoradiographic exposures revealed very low. but detectable, levels of SM22 ⁇ mRNA in heart, kidney, skeletal muscle and thymus.
- the SM22 ⁇ cDNA probe was hybridized to northern blots containing RNAs prepared from rat aortic vascular SMCs, the rat SMC line A7r5, murine NIH 3T3 and C3H10T1/2 fibroblasts, the SV40-transformed monkey kidney cell line COS-7, murine C2C12 myoblasts and myotubes, the human hepatocellular carcinoma cell line Hep G2 and the murine lymphoid cell line EL4. High levels of SM22 ⁇ mRNA were detected in primary rat aortic vascular SMCs and the smooth muscle cell line A7r5.
- Detection of a second 1.5 kb species of mRNA represents cross hybridization of the SM22 ⁇ probe to the murine calponin mRNA.
- SM22 ⁇ mRNA was expressed in both undifferentiated C2C12 myoblasts and terminally- differentiated C2C12 myotubes.
- a faint hybridization signal was detectable in NIH 3T3, C3H10T1/2, and Hep G2 cells after a 3-day autoradiographic exposure.
- Quantitative PhosphorlmagerTM analysis of these low level hybridization signals revealed that SM22 ⁇ mRNA is expressed in these three non-myogenic cell lines at less than 1.5% the intensity of SM22 ⁇ gene expression in A7r5 and primary SMCs.
- SM22 ⁇ mRNA is expressed in other embryonic skeletal muscle cell lineages such as C2C12 myoblasts and myotubes, but not in other non-myogenic cell lineages.
- the SM22 ⁇ gene may be unique in that its expression is not differentially regulated during progression through the cell cycle.
- cultures of low passage number primary rat aortic SMCs were synchronized in the G 0 /G, stage of the cell cycle by serum starvation for 72 hrs.
- FACS analyses revealed that under these conditions approximately 90% of cells are arrested in G 0 /G, (Chang et al, 1995a).
- the cells were then serum-stimulated and RNA was prepared from replicate cultures at the time of serum stimulation (t 0 ), and at 8 hrs, 12 hrs, 16 hrs, and 24 hrs post-stimulation.
- the arrested vascular SMCs After serum stimulation, the arrested vascular SMCs begin to pass through the G,/S checkpoint of the cell cycle at approximately 12 hrs and by 24 hrs post-stimulation greater than 50% of cells are in the S and G 2 /M phases of the cell cycle (Chang et al, 1995a).
- a northern blot analysis demonstrated no differences in SM22 ⁇ gene expression in cell cycle arrested versus proliferating SMCs as assessed by quantitative PhosphorolmagerTM analysis of the hybridization signal.
- SM22 ⁇ appears to be constitutively expressed at high levels in both quiescent and proliferating vascular SMCs.
- a full length murine SM22 ⁇ genomic clone of 20-kb was isolated by screening a murine 129SV genomic library with a SM22 ⁇ cDNA probe under high stringency conditions.
- SEQ ID NO:l The nucleic acid sequence of the genomic clone is designated herein as SEQ ID NO:l , containing exon 1, SEQ ID NO:2. containing exons 2, 3 and 4, and SEQ ID NO: 6, containing exon 5. There is approximately a 4 kb gap between
- SEQ ID NO:l and SEQ ID NO:2 and approximately a 450 base gap between SEQ ID NO:2 and SEQ ID NO:6.
- the amino acid sequences are encoded by exons 2, 3 and 4 and are designated herein as SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:7.
- the murine SM22 ⁇ gene is composed of five exons spanning 6.2-kb of genomic DNA.
- the transcriptional start site of the SM22 ⁇ gene was identified by RNase protection. primer extension and 5' RACE PCRTM analyses.
- Primer extension analyses utilizing an antisense synthetic oligonucleotide corresponding to bp 80-104 of the SM22 ⁇ cDNA resulted in a major extended product of 104-bp (arrow) which was generated at reaction temperatures up to 56°C
- 5' RACE PCRTM was performed utilizing an antisense oligonucleotide primer corresponding to bp 234-258 of the SM22 ⁇ cDNA
- DNA sequence analyses of eight random 5' RACE clones revealed a transcriptional start site 76-bp 5' of the initiation codon in seven of eight clones and 72-bp 5' of the initiation codon in one of eight clones
- RNase protection analyses were also performed using an antisense cDNA probe corresponding to bp -88 - +44 of the SM22 ⁇ genomic sequence as deduced by DNA sequence and Southern
- the nucleotide sequence TTTAAA, which might function as a TATA box was present 29-bp
- a consensus CAAT box was not identified in the immediate 5' flanking region of the SM22 ⁇ gene
- a computer homology search for previously described muscle- specific and/or skeletal or cardiac muscle lineage-restricted transcriptional regulatory elements revealed five consensus E boxes/bHLH myogemc transcription factor binding sites (CANNTG [Olson, Genes Dev , 4, 1454-1461 , 1990, Tapscott et al , J Clin Invest , 87 1133- 1138, 1991 , Lassar et al , Cell, 58 (5) 823-31, 1989]) located at bps -534, -577, -865, -898, - 910, and -1267, three consensus GATA-4 binding sites (WGATAR [Evans et al , Proc Natl Acad Sci (USA), 85 5976-5980, 1988]) located at bps -504, -828, -976, and two AT- ⁇ ch, potential MEF-2/rSRF binding sites
- the transcriptional activities of the 441-bp SM22 ⁇ promoter containing plasmid, p-441SM221uc was compared to the positive control plasmid containing the rous sarcoma virus LTR, pRSVL, in primary rat vascular SMCs, the smooth muscle cell line A7r5. NIH 3T3 fibroblasts, COS-7, and Hep G2 cells.
- the promoter-containing plasmid p-441SM221uc
- p-441SM221uc was active in primary rat aortic SMCs and A7r5 cells, increasing transcription of the luciferase reporter gene approximately 2500-fold and 540-fold, respectively, over that induced by transfection with the promoterless pGL2-Basic plasmid (FIG. 1).
- This level of promoter activity was comparable to levels obtained following transfection of these cells with the RSV LTR-driven positive control plasmid (FIG. 1).
- the 441 -bp SM22 ⁇ promoter was inactive in NIH 3T3, COS-7 and Hep G2 cells (FIG. 1).
- DNA sequence analyses revealed that this 441 -bp promoter contains two CArG/SRF boxes (Minty et al. , 1986), a CACC box (Dierks et al, 1983), and one A/T-rich, potential MEF-2/rSRF binding site (Gossett et al, 1989), c ' .v-acting elements which have each been demonstrated to be involved in the transcriptional programs that regulate skeletal and cardiac muscle-specific gene expression.
- the endogenous 441-bp SM22 ⁇ promoter contains all of the cis-actmg sequence elements required to recapitulate the smooth muscle lineage-restricted pattern of SM22 ⁇ gene expression demonstrated in vivo.
- a reporter construct was first prepared in which the 441-bp minimal SM22 ⁇ promoter was subcloned immediately 5' of the bacterial ⁇ -galactosidase reporter gene (l ⁇ cZ).
- the transgenic vector was generated from a pBluescript-KS phagemid containing Ascl restriction sites flanking the polylinker sequence. This construct is referred to herein as -44 ⁇ SM22l ⁇ cZ.
- the transgene was microinjectedinto oocytes that were transplanted into pseudo-pregnant hosts as described in Metzger et ⁇ l, 1993 (inco ⁇ orated herein by reference).
- transgenic founder mice Southern blot analysis was performed using the radiolabeled l ⁇ cZ probe and high molecular weight DNA prepared from tail snips of each potential founder pup.
- the radiolabeled l ⁇ cZ cDNA probe hybridized to the expected 4.2 kb if ⁇ mHT-digested band in 4 of 17 pups analyzed.
- the four founders contained between 5 and 160 copies per cell as assessed by comparing the hybridization signal intensity (DPM) to standards corresponding to 1 , 10 and 100 copies per cell using a Molecular Dynamics PhosphorlmagerTM.
- DPM hybridization signal intensity
- FI -44l SM22l ⁇ cZ #14 male was crossed with a CD-I female and El 1.5 embryos from this litter were isolated, genotyped (using PCRTM). fixed and stained for ⁇ -galactosidase activity.
- Transgenic embryos were easily distinguished from their non-transgenic litter mates by the obvious blue staining along their distal somites. This pattern correlated with the transient pattern of SM22 ⁇ gene expression observed in the developing somites.
- EDI 1.5 embryos the endogenous SM22 ⁇ gene is expressed throughout the primitive heart tube, developing somites, dorsal aorta and the forming branch arteries (Li et al. 1996a).
- ⁇ -galactosidase activity was detected within the myotomal component of the developing somites and within the bulbo-truncus region (future outflow tract) and at low levels within the bulbo-cordis region (future right ventricle) of the primitive heart, ⁇ -galactosidase activity was not detected within the future left ventricle, left atrium or right atrium at this stage of embryonic development.
- the SM22 ⁇ gene is expressed at high levels in smooth muscle cells lining the pulmonary airways, as well as within the gastrointestinal and genitourinary tracts, no ⁇ -galactosidase activity was detected in the developing lung buds, gastrointestinal mucosa, or the uterine or bladder mucosa during late murine embryogenesis or postnatal development.
- the 441 bp SM22 ⁇ promoter is necessary and sufficient to activate transcription in vascular SMCs in a lineage-restricted fashion in transgenic mice.
- this minimal promoter element contains c «-acting sequences required to activate transcription of the SM22 ⁇ gene in the developing somites.
- the normalized luciferase activity obtained with the 300-bp promoter was still 100-fold above that obtained with promoterless control plasmids in these transient transfection assays.
- a 280-bp SM22 ⁇ promoter fragment (bp -280 - +41) was sufficient to direct arterial SMC-specific gene expression.
- the inventors produced eight independent lines of transgenic mice in which the lacZ gene was placed under the transcriptional control of the 280-bp SM22 ⁇ promoter. These mice contained between 2 and 34 copies of the transgene per cell.
- the 280-bp of 5' flanking sequence was sufficient to direct high level ⁇ -galactosidase activity (blue staining) to arterial SMCs and the myotomal component of the somites of EDI 1.5 mice.
- Virtually identical patterns of transgene expression were demonstrated in 4 independent lines analyzed at EDI 1.5 in which copy numbers varied between 2 and 34 copies per cell.
- dense blue staining was detected within the cardiac outflow tract (a neural crest derivative) while a somewhat patchy pattern of blue staining was present in the developing arterial system (which is derived from lateral mesoderm and neural crest). Higher power sections confirmed that virtually every cell within the cardiac outflow tract stained blue.
- the 441-bp (and 280-bp) SM22 ⁇ promoter does not contain the ci.s-acting elements that control SM22 ⁇ transcription in either visceral (gastrointestinal, uterine, bladder, and bronchial) or venous SMCs nor in the primitive heart tube.
- the inventors observed virtually the same arterial SMC-specific pattern of expression using the 5000-bp SM22 ⁇ promoter in transgenic mice.
- Xgal tissue staining The lung, heart, liver, kidney, spleen, testis or ovary, and skeletal muscle are excised from euthanized animals, and stained to reveal ⁇ -galactosidase activity. If ⁇ -galactosidase activity is evident in non-transgenic mice, the transgenic lines are generated using a nuclear localizing ⁇ -galactosidase isoform to minimize false-positive staining (Hughes and Blau, 1990). To reveal ⁇ -galactosidase activity, tissues are washed in PBS, then fixed in 1.25% glutaraldehyde (lung is fixed as below).
- tissues are incubated overnight in the dark in Xgal solution (50 mM Tris HCI pH 7.5, 2.5 mM potassium ferriferrocyanide, 15 mM NaCl, 1 mM MgCl 2 , 0.5 mg/ml Xgal), then paraffin embedded; 4 micron sections are counterstained with eosin. Data analysis
- SM22 ⁇ mRNA by is detected in the lungs by in situ hybridization A digoxigenin- labeled cRNA corresponding to the reverse complement of mouse SM22 ⁇ cDNA bp 644 to 1007 was prepared by in vitro transcription (MaxiScriptTM Kit, Ambion, and GeniusTM 4 Kit. Boehringer Mannheim). In situ hybridization was performed on a lung specimen obtained at autopsy from a patient without lung disease. Hybridized probe is detected immunohistochemically with an anti-dioxigenin antibody linked to alkaline phosphatase. The SM22 ⁇ cRNA binds selectively to airway smooth muscle and to pulmonary vascular smooth muscle: black anthracotic pigment was also evident in this specimen (typical of urban dwellers).
- AdSM22- lacZ a RDAd (AdSM22- lacZ) was constructed containing the bacterial lacZ reporter gene under the transcriptional control of the murine SM22 ⁇ promoter (FIG. 3 A, upper panel).
- AdSM22-lacZ the activity of AdSM22-lacZ was compared to that of the control virus, AdCMV-lacZ (Tripathy et al, Proc. Natl. Acad. Sci.
- HUVECs expressed histochemically detectable ⁇ - galactosidase activity following infection with 1-, 10-, and 100-PFU, respectively, of the AdCMV-lacZ control virus (FIG. 3B).
- approximately 50% of NIH 3T3 cells expressed-detectable ⁇ -galactosidase activity following infection with 100-PFU/cell of the AdCMV-lacZ control virus.
- Southern blot analyses of DNA harvested from HUVECs infected 72-h previously with AdSM22-lacZ demonstrated the presence of the lacZ transgene in these cells.
- the hybridization signal was comparable in intensity to that obtained with DNA harvested from HUVECs infected with the AdCMV-lacZ control virus thereby confirming efficient infection of these cells by AdSM22-lacZ.
- the different sizes of the lacZ hybridizing bands seen in this study is consistent with the expected patterns of restriction endonuclease digestion of each adenoviral vector with Bglll.
- AdSM22-lacZ and AdCMV-lacZ both efficiently infected HUVECs, no lacZ transgene mRNA was detected in the AdSM22-lacZ infected HUVECs by Northern blot analysis.
- HUVECs infected with the control AdCMV-lacZ virus expressed abundant lacZ mRNA.
- the pAdSM22 plasmid was generated by subcloning the 441-bp murine SM22 ⁇ promoter (Solway et al, 1995) into Clal (5' endVHindlll (3' end)-digested pAdEFl (KN) plasmid (Tripathy et al, 1994).
- the pAdSM22-lacZ plasmid was generated by subcloning the Hindlll (5' end)/BglII (3' end)-linkered bacterial lacZ reporter gene into the Flindlll/BamHI- digested pAdSM22 plasmid.
- AdSM22-lacZ adenovirus encoding the bacterial lacZ reporter gene under the transcriptional control of the murine SM22 ⁇ promoter and the human 4F2 heavy chain transcriptional enhancer was generated by recombination in 293 cells between the pAdSM22-lacZ plasmid DNA and El- and E3-deleted Ad5Sub360 genomic DNA digested with Xbal and Clal as described previously (Barr et al, 1994) The structure of this virus was confirmed by Southern blot analyses.
- the AdCMV-lacZ RDAd encoding the bacterial lacZ reporter gene under the transcriptional control of the cytomegalovirus (CMV) immediate early gene promoter/enhancer has been described previously (Barr et al. 1994).
- Recombinant viruses were plaque purified three times to avoid contamination with replication-competent virus.
- rat aortic SMCs were isolated from 12- to 16-wk old Sprague Dawley rats and grown as described previously (Chang et al, 1995a). Virtually all cells stain positive for expression of SM- ⁇ - actin when isolated using this technique (Solway et al, 1995). In all experiments only third passage primary rat aortic SMCs were utilized. Immortalized rat vascular A7r5 SMCs, passage 4 human umbilical vein endothelial cells (HUVECs), and mouse NIH 3T3 fibroblasts were grown as described previously (Kim et al, 1997).
- ⁇ -galactosidase positive cells were placed in medium containing 2% fetal bovine serum (FBS) and infected with either 1-, 10- or 100-PFU/cell of purified adenoviral stocks. Following infection, cells were washed in PBS and placed in growth medium containing 10%> FBS. 72-h post-infection, cells were harvested for preparation of DNA and RNA, or were fixed and stained for ⁇ -galactosidase activity with X- gal as described (Lin et al, 1990). The unstained and blue-stained ( ⁇ -gal + ) cells from 10 representative high power fields were counted in each section and the percentage of ⁇ -gal + cells calculated. The data are expressed as % ⁇ -galactosidase positive cells ⁇ S.D.
- FBS fetal bovine serum
- Sprague-Dawley rats were isolated and a balloon-injury was created by dilatation with a 2F Fogarty catheter as described previously (Chang et al, 1995a).
- a 24-gauge intravenous catheter was introduced into the lumen of uninjured or balloon-injured arterial segments and 2 X 10 9 -PFU of AdSM22-lacZ or AdCMV-lacZ was instilled into the isolated arterial segment for 5 minutes.
- rats were euthanized and the isolated segments of carotid artery were removed, fixed in 1.25% glutaraldehyde, and stained for ⁇ - galactosidase activity with X-gal as described previously (Lin et al, 1990). Photomicroscopy was performed using Kodak EPT 160 film and a Zeiss Axiophot microscope.
- 2 X 10 9 PFU of either AdSM22-lacZ or the control AdCMV-lacZ virus were introduced into isolated segments of uninjured and balloon-injured rat carotid arteries. Diffuse blue staining of the vascular endothelium was observed seven days following administration of the control AdCMV-lacZ virus into the uninjured rat carotid artery. In addition, rare cells within the adventitia also stained blue.
- Intravenous administration of RDAd results in high level gene transfer to the liver and lung thereby potentially limiting the utility of these viruses in some clinical settings (Kashyap et al, 1995; Johns et al, 1995; Miller and Vile, 1995).
- 12-16 week old Sprague-Dawley rats were injected intravenously with 10 9 - or 10 10 -PFU of AdSM22-lacZ or AdCMV-lacZ, respectively.
- Liver function tests were performed on serum samples obtained 7 days following infection using Kodak DT60II and DTSCH automated analyzers. To determine the significance of alterations in liver function tests observed between control, AdSM22-lacZ- infected. and AdCMV-lacZ-infected rats, Student's t tests were performed.
- rats were euthanized and the injected tissue, as well as the liver, lung, kidney, and carotid arteries were isolated, washed, fixed and stained for ⁇ -galactosidase activity with X- gal as described previously (Lin et al, 1990).
- LacZ expression was observed throughout the livers of rats infected with the AdCMV- lacZ control virus.
- focal patches of ⁇ -gal + cells were observed within perivascular regions of the lung of AdCMV-lacZ-infected rats.
- histological sections of both the liver and lung were indistinguishable from those obtained from uninfected control rats.
- AdSM22-lacZ Direct injection of AdSM22-lacZ into SMC-containing tissues and skeletal muscle was performed following induction of anesthesia and intubation as described above.
- 10 -PFU of the AdSM22-lacZ virus was injected directly with a 30-gauge needle into the wall of the ureter, the bladder wall or intramuscularly. The site of each injection was marked by a suture. Seven days after injection, the sites of injection were isolated, fixed and stained for ⁇ - galactosidase activity as described (Lin et al, 1990).
- Dense blue staining was observed throughout the longitudinal and circumferential layers of SMCs within the wall of the ureter. In contrast, ⁇ -galactosidase activity was not observed within the epithelial cells lining the lumen of the ureter. Following direct injection of AdSM22-lacZ into the bladder mucosa, focal patches of ⁇ -gal + SMCs were observed surrounding the site of injection. In contrast, ⁇ -galactosidase activity was not observed within the bladder epithelium. These data demonstrated that AdSM22-lacZ programs transgene- expression in visceral, as well as vascular, SMCs.
- the 441-bp murine SM22 ⁇ promoter is active in embryonic skeletal muscle cells and the somites of transgenic mice (Kim et al , 1997).
- 10 9 -PFU of the AdSM22-lacZ virus was injected intramuscularly into the rat rectus abdominus and quadriceps muscles.
- ⁇ -galactosidase activity was not observed in either the rectus abdominus or quadriceps muscles.
- the lacZ reporter gene encoded by AdSM22- lacZ is expressed exclusively in visceral and vascular SMCs when administered intra- arterially, intravenously, or intra-muscularly.
- Example 12 Adenovirus Mediated Expression of a Cell Cycle Control Gene
- the Rb protein inhibits cell cycle progression in many mammalian cell types (Hollmgsworth et al , Curr Opin Genet Dev 3 55, 1993), and has been shown to be an important regulator of vascular smooth muscle proliferation (Chang et al , 1995a)
- the Rb gene product In its unphosphorylated state, the Rb gene product binds and inactivates certain cellular transcription factors that are required for cell cycle progression (Chen et al , Cell, 58 1193, 1989) and upon phosphorylation, the transcription factors are released and the cell progresses through the proliferation cycle
- a gene encoding a phosphorylation deficient Rb gene product has been constructed and shown to constitutively inhibit smooth muscle cell cycle proliferation (Chang et al , 1995a) when transfected into rat aortic smooth muscle cells in a replication defective adenovirus vector
- the Chang reference also shows that replication defective adenovirus vectors can be used to express heterologous genes in rat carotid
- this phosphorylation deficient Rb gene product may also be expressed under the control of the smooth muscle specific promoter contained in an adenovirus vector as disclosed herein, thus directing expression of the Rb gene product specifically in smooth muscle cells
- Such administration is contemplated to arrest smooth muscle cell proliferation when the described vector expressing Rb from the SM22 ⁇ promoter is administered to an animal or human subject as described in the previous examples, particularly following arterial balloon injury
- This method of preventing restenosis or other smooth muscle cell proliferative disordeis offers the advantage of administration of the virus vector by a less invasive method such as intravenous injection
- other cell cycle control gene products such as p53 for example would be effectiv e in this method of preventing restenosis
- DNase I footprint analyses were performed. Three overlapping genomic subfragments (bp -441 to - 256, bp -256 to -89, and bp -89 to +41) spanning the 482-bp (bp -441 to +42) SM22 ⁇ promoter were subjected to DNase I footprint analyses using nuclear extracts from the SMC line, A7r5 (which express high levels of SM22 ⁇ mRNA) and NIH 3T3 cells.
- the sense and antisense strands of the three genomic subfragments were end-labeled and incubated in the absence (control) or presence of A7r5 and NIH 3T3 (3T3) of nuclear extracts before partial digestion with DNase I (concentrations varied from 5 U/ml to 22.5 U/ml). Standard Maxam and Gilbert purine (G + A) sequencing reactions were run in parallel.
- the six protected regions identified on both strands with A7r5 nuclear extracts were designated smooth muscle elements (SME)-l-6, respectively.
- SME-1 Two footprinted regions, SME-1 (bp -279 to -256) and SME-4 (bp -171 to -136), contain embedded SREs, or CArG boxes (CCWWWWWWGG, SEQ ID NO:47), that have been shown previously to bind the MADS box transcription factor, SRF, and play an important role in regulating transcription of the genes encoding skeletal and cardiac ⁇ -actin (Minty et al, 1986; Moss et al . J. Biol. Chem., 269:12731, 1994; Muscat et al, Gene Exp. 2: 1 1 1, 1992). Fine differences in the digestion patterns between nuclear extracts prepared from A7r5 and NIH 3T3 cells could be distinguished over the SME-4 site.
- the SME-2 nuclear protein binding site (bp -249 and bp -216) contains consensus binding motifs for the ubiquitously expressed transcription factors, Spl (KRGGCKRRK) and AP2 (CCCMNSSS). Fine differences in the digestion patterns between nuclear extracts prepared from A7r5 and NIH 3T3 cells could be distinguished over this site.
- the SME-3 nuclear protein binding site (bp -215 to bp -186), which is flanked by DNase I hypersensitive sites at both its 5' and 3' borders, was protected only by nuclear extracts prepared from A7r5 and not by extracts prepared from NIH 3T3 cells. This nuclear protein binding site has not been described previously.
- the SME-5 nuclear protein binding site (bp -86 to bp -66) once again contains consensus Spl and AP2 motifs.
- the SME-6 nuclear protein binding site (bp - 59 to -35). lies immediately 5' of the non-consensus TATA box (TTTAA). and contains nucleotide sequences that have been demonstrated previously to bind the cyclic AMP response element (CRE) binding proteins (for review see Lalli and Sassone-Corsi. 1994).
- An AT-rich sequence (bp -408 to -415) with 8/10 bp sequence identity with the consensus MEF2 binding motif (Gossett et al, 1989) was not protected with either A7r5 or NIH 3T3 nuclear extracts.
- EMSAs electrophoretic mobility shift assays
- Unlabeled SME-4 oligonucleotide competed for binding of complex A, but failed to compete for complexes B and C.
- Unlabeled Spl oligonucleotide competed for binding of complex B (that co-migrated with complex A), as well as, complex C.
- Antibody supershift studies confirmed that complex A contains SRF (or an antigenically related protein) and complex B contains Spl (or an antigenically related protein).
- EMSAs performed with the radiolabeled SME-4 oligonucleotide probe demonstrated four specific nuclear protein complexes, designated A-D, as determined by addition of specific and non-specific competitor oligonucleotides.
- Addition of unlabeled SME-1 oligonucleotide competed only for binding of complexes A and B.
- Antibody supershift studies revealed that both of these low-mobility nuclear protein complexes contained a protein identical, or antigenically-related, to SRF, while complexes C and D contained a protein identical, or antigenically-related, to YYl .
- SRF or an SRF-containing protein complex
- EMSAs performed with nuclear extracts prepared from primary rat aortic SMCs and radiolabeled oligonucleotides corresponding to the SME-2 and SME-5 nuclear protein binding sites, respectively, revealed identical band-shift patterns suggesting that these two motifs might bind a common set of /ram-acting factors.
- Each probe bound three specific nuclear protein complexes, designated A-C, as determined by addition of unlabeled specific and non-specific oligonucleotide competitors.
- Unlabeled SME-2 oligonucleotide competed for binding of each nuclear protein complex that bound the radiolabeled SME-5 probe and visa versa.
- an oligonucleotide containing a consensus Spl motif competed for binding of complexes A-C.
- Antibody supershift studies revealed that complex A was ablated and supershifted by pre-incubation with Spl -specific antiserum, but not by control murine IgG, or ⁇ -AP2 antiserum.
- Each of these nuclear protein complexes were also present in nuclear extracts prepared from non-SMC lineages including the lymphoid lines. WEHI and 70Z/3.
- SME-3 was protected from DNase I digestion by nuclear extracts prepared from A7r5 cells, but not by extracts prepared from NIH 3T3 cells, suggesting that this previously undescribed motif might bind one or more SMC lineage-specific trans-acting factors.
- EMSAs performed with the radiolabeled SME-3 oligonucleotide probe revealed three specific binding activities, designated A-C, as determined by addition specific and nonspecific competitor oligonucleotides.
- Antibody supershift studies revealed that complex B and C contained YYl (or an antigenically related protein). None of the nuclear protein complexes were supershifted by control IgG or ⁇ -Spl antiserum.
- EMSAs were performed with the SME-3 probe and nuclear extracts prepared from primary rat aortic SMCs, the SMC line. A7r5, C3H10T1/2 and NIH 3T3 fibroblasts, and the mouse T cell line, EL4.
- complex C which was ablated by pre-incubation with a- YYl antiserum, was present only in primary rat aortic SMCs and the SMC line A7r5, but was absent in C3H10T1/2, NIH 3T3, and EL4 nuclear extracts.
- EMSAs performed with a radiolabeled oligonucleotide corresponding to the SME-6 nuclear protein binding site revealed four specific nuclear protein complexes, designated A- D, respectively. Each of these complexes were competed with unlabeled SME-6 oligonucleotide. Moreover, addition of an unlabeled consensus CRE oligonucleotide derived from the T cell receptor a enhancer competed exclusively for binding of complexes B and C. Pre-incubation of the binding reactions with ⁇ -CREB-1 antiserum ablated and supershifted complex B, while complex C was ablated by addition of ⁇ -ATF-1 antiserum.
- complex A was ablated and supershifted by pre-incubation with ⁇ -Spl antiserum.
- complex D was ablated by the addition of ⁇ -YYl antiserum.
- none of the four complexes were ablated or supershifted following pre-incubation with control rabbit or murine IgG, or antisera that recognize GATA-4 or SRF.
- EMSAs performed with the radiolabeled SME-6 oligonucleotide probe and nuclear extracts prepared from the non-SMC lines, C2C12 myotubes, C3H10T1/2 and NIH 3T3 fibroblasts, and EL4 T cells, revealed fine differences in the mobilities of several nuclear protein complexes (and/or novel complexes), as well as, increased intensity in each of the SME-6 binding activities. Taken together, these data revealed that the SME-6 motif binds CREB-1 and ATF-1, each of which are expressed in primary vascular SMCs, as well as, the ubiquitously expressed transcription factors, Spl and YYl .
- the arterial SMC-specific SM22 ⁇ promoter contains six nuclear protein binding sites, designated smooth muscle element (SME)l-6. respectively.
- SME-1 /CArG binds SRF (and ternary complex factors), Spl and one unidentified nuclear protein complex that is not cross-competed by SME-4/CArG oligonucleotides.
- SME-2 binds three specific nuclear protein complexes at least one of which contains Spl , each of which also binds to the SME-5 site.
- SME-3 a motif that has not been described previously, binds YYl and two unidentified nuclear protein complexes, one of which includes a potentially novel lineage-restricted tr ⁇ ra'-acting factor.
- SME-3 motif binds several transacting factors which are present in nuclear extracts prepared from non-SMCs but which are not present in SMC extracts.
- SME-4/CArG binds nuclear protein complexes containing SRF and YYl -related proteins. Two high mobility complexes were ablated and supershifted by pre-incubation with a-SRF antiserum suggesting that one, or both, of these nuclear protein complexes may contain accessory factors.
- SME-6 binds CREB-1 , ATF-1 , YYl, and Spl.
- the p-441 SM22 ⁇ CArG plasmid which contains mutations in both SME-1 and -4 that inhibit binding of SRF, completely abolished transcriptional activity of the SM22 ⁇ promoter in primary rat aortic SMCs and the SMC-line A7r5.
- the -441SM22 ⁇ CREB/SME-6 plasmid which abolishes binding specifically of each of the CRE-related complexes (but not YYl) was compared to the p- 441SM221uc reporter plasmid.
- the single mutation within the CREB motif reduced transcriptional activity by approximately 60% .
- mutations within SME-6 that do not abolish CRE binding activities did not significantly decrease transcriptional activities.
- the arterial SMC-specific SM22 ⁇ promoter is CArG-dependent in vivo As shown above, mutations of the SME-1 /CArG and SME-4/CArG elements that inhibited binding of SRF to the SM22 ⁇ promoter, totally abolished SM22 ⁇ promoter activity in arterial SMCs in vitro.
- transgenic mice were produced containing a transgene, designated -441 SM22 ⁇ CArG, that encodes the bacterial l ⁇ cZ reporter gene under the transcriptional control of a mutant SM22 ⁇ promoter containing mutations in both SME-1 and SME-4 that abolish binding of SRF (as described above). Thirteen independent -441 SM22 ⁇ CArG transgenic lines were produced with copy numbers ranging between 1 and 730 copies per cell.
- TCCCTTCCCA AGACCACTGA AGCTAGGTGC AAGATAAGTG GGGACCCTTT CTGAGGTGGT 540
- AGAGCAGACC CAAGTCCGGG TAACAAGGAA GGGTTTCAGG GTCCTGCCCA TAAAAGGTTT 1080
- GCCAAGAGAA CACATAGCAA GGGGACCAGC TTGGTGGTAC AGCATTTCCT TCTGGGTACA 680 AGGGCCTGTT TTGGATCCTA GAATATCAAA TATATACCAC ACCATACTCA CTAGGGTTTA 740
- ATCCTGCTTA GCCTGCCTCA CAAATGCCTA TGTAGGTTCT TAGCCCTGAC AGCTCTGAGG 259 TGTCACTGGG CAAAGATGAC TGCACATGGG CAGCTCCCAC CTATCCTTAG CCTCAGCCCA 319
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU44150/97A AU738651B2 (en) | 1996-10-07 | 1997-08-29 | Promoter for smooth muscle cell expression |
CA002267067A CA2267067A1 (en) | 1996-10-07 | 1997-08-29 | Promoter for smooth muscle cell expression |
EP97942457A EP0941245A1 (en) | 1996-10-07 | 1997-08-29 | Promoter for smooth muscle cell expression |
JP51752898A JP3457332B2 (en) | 1996-10-07 | 1997-08-29 | Promoter for smooth muscle cell expression |
US09/381,750 US7169764B1 (en) | 1995-10-05 | 1997-08-29 | Promoter for smooth muscle cell expression |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/726,807 US6090618A (en) | 1996-10-07 | 1996-10-07 | DNA constructs and viral vectors comprising a smooth muscle promoter |
US08/726,807 | 1996-10-07 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998015575A1 true WO1998015575A1 (en) | 1998-04-16 |
Family
ID=24920087
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/016204 WO1998015575A1 (en) | 1995-10-05 | 1997-08-29 | Promoter for smooth muscle cell expression |
Country Status (6)
Country | Link |
---|---|
US (6) | US6090618A (en) |
EP (1) | EP0941245A1 (en) |
JP (2) | JP3457332B2 (en) |
AU (1) | AU738651B2 (en) |
CA (1) | CA2267067A1 (en) |
WO (1) | WO1998015575A1 (en) |
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1083231A1 (en) * | 1999-09-09 | 2001-03-14 | Introgene B.V. | Smooth muscle cell promoter and uses thereof |
US6254573B1 (en) | 1998-02-05 | 2001-07-03 | Biosense, Inc. | Intracardiac drug delivery device utilizing spring-loaded mechanism |
WO2001052915A1 (en) * | 2000-01-24 | 2001-07-26 | Biocompatibles Limited | Coated implants |
EP1190082A1 (en) * | 1999-06-25 | 2002-03-27 | Yissum Research Development Company of the Hebrew University of Jerusalem | Method of inducing angiogenesis by micro-organs |
US6591129B1 (en) | 1996-02-15 | 2003-07-08 | Biosense, Inc. | Method for treating tissue through injection of a therapeutic agent |
EP1925626A1 (en) | 2003-07-21 | 2008-05-28 | Transgene S.A. | Novel multifunctional cytokines |
US7767201B2 (en) * | 2000-08-08 | 2010-08-03 | Multi-Gene Vascular Systems Ltd. | Vascular cells genetically altered to over-express angiogenic proliferation and maturation factors; treatment of atherosclerosis using same |
WO2014066443A1 (en) | 2012-10-23 | 2014-05-01 | Emory University | Gm-csf and il-4 conjugates, compositions, and methods related thereto |
US9127084B2 (en) | 2006-09-14 | 2015-09-08 | Medgenics Medical Israel Ltd. | Long lasting drug formulations |
US9155749B2 (en) | 2006-09-14 | 2015-10-13 | Medgenics Medical Israel Ltd. | Long lasting drug formulations |
Families Citing this family (103)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7169764B1 (en) * | 1995-10-05 | 2007-01-30 | Arch Development Corporation | Promoter for smooth muscle cell expression |
US6090618A (en) * | 1996-10-07 | 2000-07-18 | Arch Development Corporation | DNA constructs and viral vectors comprising a smooth muscle promoter |
US6777203B1 (en) | 1997-11-19 | 2004-08-17 | Geron Corporation | Telomerase promoter driving expression of therapeutic gene sequences |
US6610839B1 (en) | 1997-08-14 | 2003-08-26 | Geron Corporation | Promoter for telomerase reverse transcriptase |
US6335010B1 (en) * | 1996-11-08 | 2002-01-01 | University Of California At San Diego | Gene therapy in coronary angioplasty and bypass |
US6818016B1 (en) * | 1997-06-27 | 2004-11-16 | The Regents Of The University Of Michigan | Methods for coating stents with DNA and expression of recombinant genes from DNA coated stents in vivo |
US7378244B2 (en) * | 1997-10-01 | 2008-05-27 | Geron Corporation | Telomerase promoters sequences for screening telomerase modulators |
JP2003524444A (en) * | 1998-09-10 | 2003-08-19 | パーカーディア,インコーポレイティド | TMR shunt |
US6764820B2 (en) * | 1999-03-26 | 2004-07-20 | Ludwig Institute For Cancer Research | Screening for lymphatic disorders involving the FLT4 receptor tyrosine kinase (VEGFR-3) |
US6329348B1 (en) | 1999-11-08 | 2001-12-11 | Cornell Research Foundation, Inc. | Method of inducing angiogenesis |
CA2400319C (en) * | 2000-03-15 | 2008-09-16 | Orbus Medical Technologies Inc. | Coating that promotes endothelial cell adherence |
US7115653B2 (en) * | 2000-03-30 | 2006-10-03 | Curis, Inc. | Small organic molecule regulators of cell proliferation |
US6683108B1 (en) * | 2000-03-30 | 2004-01-27 | Curis, Inc. | Agonists of hedgehog signaling pathways and uses related thereto |
US8852937B2 (en) * | 2000-03-30 | 2014-10-07 | Curis, Inc. | Small organic molecule regulators of cell proliferation |
US6913762B2 (en) * | 2001-04-25 | 2005-07-05 | Mayo Foundation For Medical Education And Research | Stent having non-woven framework containing cells |
WO2002087594A1 (en) * | 2001-04-30 | 2002-11-07 | The Regents Of The University Of California | Non-viral vesicle vector for cardiac specific gene delivery |
US20030077310A1 (en) | 2001-10-22 | 2003-04-24 | Chandrashekhar Pathak | Stent coatings containing HMG-CoA reductase inhibitors |
WO2003052121A2 (en) * | 2001-12-17 | 2003-06-26 | Beth Israel Deaconess Medical Center | Method of reducing angiogenesis |
US8940292B2 (en) * | 2003-01-28 | 2015-01-27 | Wake Forest University Health Sciences | Enhancement of angiogenesis to grafts using cells engineered to produce growth factors |
EP3045136B1 (en) | 2003-09-12 | 2021-02-24 | Vessix Vascular, Inc. | Selectable eccentric remodeling and/or ablation of atherosclerotic material |
CN1621094A (en) * | 2003-11-26 | 2005-06-01 | 犹太大学阿尔伯特爱因斯坦医学院 | Gene transfer for regulating smooth muscle tone |
US8920414B2 (en) | 2004-09-10 | 2014-12-30 | Vessix Vascular, Inc. | Tuned RF energy and electrical tissue characterization for selective treatment of target tissues |
US9713730B2 (en) | 2004-09-10 | 2017-07-25 | Boston Scientific Scimed, Inc. | Apparatus and method for treatment of in-stent restenosis |
US8396548B2 (en) | 2008-11-14 | 2013-03-12 | Vessix Vascular, Inc. | Selective drug delivery in a lumen |
GB0507983D0 (en) * | 2005-04-20 | 2005-05-25 | Univ Cambridge Tech | Apoptosis model |
US8019435B2 (en) | 2006-05-02 | 2011-09-13 | Boston Scientific Scimed, Inc. | Control of arterial smooth muscle tone |
AU2007310991B2 (en) | 2006-10-18 | 2013-06-20 | Boston Scientific Scimed, Inc. | System for inducing desirable temperature effects on body tissue |
ES2560006T3 (en) | 2006-10-18 | 2016-02-17 | Vessix Vascular, Inc. | Induction of desirable temperature effects on body tissue |
US20080269159A1 (en) * | 2007-04-27 | 2008-10-30 | Board Of Trustees Of The University Of Arkansas | Compositions and methods for regulation of smooth muscle cells and blood pressure |
CN101977632A (en) | 2008-02-19 | 2011-02-16 | 塞拉东公司 | Compositions for enhanced uptake of viral vectors in the myocardium |
CN104274256A (en) * | 2008-11-04 | 2015-01-14 | 坦吉恩股份有限公司 | Cell-scaffold constructs |
WO2010056745A1 (en) | 2008-11-17 | 2010-05-20 | Minnow Medical, Inc. | Selective accumulation of energy with or without knowledge of tissue topography |
CA2756833C (en) * | 2009-04-09 | 2019-11-19 | Sangamo Biosciences, Inc. | Targeted integration into stem cells |
JP6083559B2 (en) * | 2009-07-31 | 2017-02-22 | クロモセル コーポレーション | Methods and compositions for identifying and verifying modulators of cell fate |
CA2795229A1 (en) | 2010-04-09 | 2011-10-13 | Vessix Vascular, Inc. | Power generating and control apparatus for the treatment of tissue |
US9192790B2 (en) | 2010-04-14 | 2015-11-24 | Boston Scientific Scimed, Inc. | Focused ultrasonic renal denervation |
US8473067B2 (en) | 2010-06-11 | 2013-06-25 | Boston Scientific Scimed, Inc. | Renal denervation and stimulation employing wireless vascular energy transfer arrangement |
US9408661B2 (en) | 2010-07-30 | 2016-08-09 | Patrick A. Haverkost | RF electrodes on multiple flexible wires for renal nerve ablation |
US9084609B2 (en) | 2010-07-30 | 2015-07-21 | Boston Scientific Scime, Inc. | Spiral balloon catheter for renal nerve ablation |
US9358365B2 (en) | 2010-07-30 | 2016-06-07 | Boston Scientific Scimed, Inc. | Precision electrode movement control for renal nerve ablation |
US9155589B2 (en) | 2010-07-30 | 2015-10-13 | Boston Scientific Scimed, Inc. | Sequential activation RF electrode set for renal nerve ablation |
US9463062B2 (en) | 2010-07-30 | 2016-10-11 | Boston Scientific Scimed, Inc. | Cooled conductive balloon RF catheter for renal nerve ablation |
US8974451B2 (en) | 2010-10-25 | 2015-03-10 | Boston Scientific Scimed, Inc. | Renal nerve ablation using conductive fluid jet and RF energy |
US9220558B2 (en) | 2010-10-27 | 2015-12-29 | Boston Scientific Scimed, Inc. | RF renal denervation catheter with multiple independent electrodes |
US9028485B2 (en) | 2010-11-15 | 2015-05-12 | Boston Scientific Scimed, Inc. | Self-expanding cooling electrode for renal nerve ablation |
US9668811B2 (en) | 2010-11-16 | 2017-06-06 | Boston Scientific Scimed, Inc. | Minimally invasive access for renal nerve ablation |
US9089350B2 (en) | 2010-11-16 | 2015-07-28 | Boston Scientific Scimed, Inc. | Renal denervation catheter with RF electrode and integral contrast dye injection arrangement |
US9326751B2 (en) | 2010-11-17 | 2016-05-03 | Boston Scientific Scimed, Inc. | Catheter guidance of external energy for renal denervation |
US9060761B2 (en) | 2010-11-18 | 2015-06-23 | Boston Scientific Scime, Inc. | Catheter-focused magnetic field induced renal nerve ablation |
US9192435B2 (en) | 2010-11-22 | 2015-11-24 | Boston Scientific Scimed, Inc. | Renal denervation catheter with cooled RF electrode |
US9023034B2 (en) | 2010-11-22 | 2015-05-05 | Boston Scientific Scimed, Inc. | Renal ablation electrode with force-activatable conduction apparatus |
US20120157993A1 (en) | 2010-12-15 | 2012-06-21 | Jenson Mark L | Bipolar Off-Wall Electrode Device for Renal Nerve Ablation |
WO2012100095A1 (en) | 2011-01-19 | 2012-07-26 | Boston Scientific Scimed, Inc. | Guide-compatible large-electrode catheter for renal nerve ablation with reduced arterial injury |
CN103813745B (en) | 2011-07-20 | 2016-06-29 | 波士顿科学西美德公司 | In order to visualize, be directed at and to melt transcutaneous device and the method for nerve |
WO2013016203A1 (en) | 2011-07-22 | 2013-01-31 | Boston Scientific Scimed, Inc. | Nerve modulation system with a nerve modulation element positionable in a helical guide |
WO2013055826A1 (en) | 2011-10-10 | 2013-04-18 | Boston Scientific Scimed, Inc. | Medical devices including ablation electrodes |
EP2765940B1 (en) | 2011-10-11 | 2015-08-26 | Boston Scientific Scimed, Inc. | Off-wall electrode device for nerve modulation |
US9420955B2 (en) | 2011-10-11 | 2016-08-23 | Boston Scientific Scimed, Inc. | Intravascular temperature monitoring system and method |
US9364284B2 (en) | 2011-10-12 | 2016-06-14 | Boston Scientific Scimed, Inc. | Method of making an off-wall spacer cage |
WO2013059202A1 (en) | 2011-10-18 | 2013-04-25 | Boston Scientific Scimed, Inc. | Integrated crossing balloon catheter |
US9162046B2 (en) | 2011-10-18 | 2015-10-20 | Boston Scientific Scimed, Inc. | Deflectable medical devices |
CN104023662B (en) | 2011-11-08 | 2018-02-09 | 波士顿科学西美德公司 | Hole portion renal nerve melts |
WO2013074813A1 (en) | 2011-11-15 | 2013-05-23 | Boston Scientific Scimed, Inc. | Device and methods for renal nerve modulation monitoring |
US9119632B2 (en) | 2011-11-21 | 2015-09-01 | Boston Scientific Scimed, Inc. | Deflectable renal nerve ablation catheter |
US9265969B2 (en) | 2011-12-21 | 2016-02-23 | Cardiac Pacemakers, Inc. | Methods for modulating cell function |
US9174050B2 (en) | 2011-12-23 | 2015-11-03 | Vessix Vascular, Inc. | Methods and apparatuses for remodeling tissue of or adjacent to a body passage |
EP2797534A1 (en) | 2011-12-28 | 2014-11-05 | Boston Scientific Scimed, Inc. | Device and methods for nerve modulation using a novel ablation catheter with polymeric ablative elements |
US9050106B2 (en) | 2011-12-29 | 2015-06-09 | Boston Scientific Scimed, Inc. | Off-wall electrode device and methods for nerve modulation |
WO2013169927A1 (en) | 2012-05-08 | 2013-11-14 | Boston Scientific Scimed, Inc. | Renal nerve modulation devices |
CN104540465A (en) | 2012-08-24 | 2015-04-22 | 波士顿科学西美德公司 | Intravascular catheter with a balloon comprising separate microporous regions |
WO2014043687A2 (en) | 2012-09-17 | 2014-03-20 | Boston Scientific Scimed, Inc. | Self-positioning electrode system and method for renal nerve modulation |
WO2014047454A2 (en) | 2012-09-21 | 2014-03-27 | Boston Scientific Scimed, Inc. | Self-cooling ultrasound ablation catheter |
US10398464B2 (en) | 2012-09-21 | 2019-09-03 | Boston Scientific Scimed, Inc. | System for nerve modulation and innocuous thermal gradient nerve block |
US10835305B2 (en) | 2012-10-10 | 2020-11-17 | Boston Scientific Scimed, Inc. | Renal nerve modulation devices and methods |
US9956033B2 (en) | 2013-03-11 | 2018-05-01 | Boston Scientific Scimed, Inc. | Medical devices for modulating nerves |
US9693821B2 (en) | 2013-03-11 | 2017-07-04 | Boston Scientific Scimed, Inc. | Medical devices for modulating nerves |
US9808311B2 (en) | 2013-03-13 | 2017-11-07 | Boston Scientific Scimed, Inc. | Deflectable medical devices |
JP6220044B2 (en) | 2013-03-15 | 2017-10-25 | ボストン サイエンティフィック サイムド,インコーポレイテッドBoston Scientific Scimed,Inc. | Medical device for renal nerve ablation |
JP6139772B2 (en) | 2013-03-15 | 2017-05-31 | ボストン サイエンティフィック サイムド,インコーポレイテッドBoston Scientific Scimed,Inc. | Control unit for use with electrode pads and method for estimating leakage |
US10265122B2 (en) | 2013-03-15 | 2019-04-23 | Boston Scientific Scimed, Inc. | Nerve ablation devices and related methods of use |
WO2014205399A1 (en) | 2013-06-21 | 2014-12-24 | Boston Scientific Scimed, Inc. | Medical devices for renal nerve ablation having rotatable shafts |
CN105473091B (en) | 2013-06-21 | 2020-01-21 | 波士顿科学国际有限公司 | Renal denervation balloon catheter with co-movable electrode supports |
US9707036B2 (en) | 2013-06-25 | 2017-07-18 | Boston Scientific Scimed, Inc. | Devices and methods for nerve modulation using localized indifferent electrodes |
JP6204579B2 (en) | 2013-07-01 | 2017-09-27 | ボストン サイエンティフィック サイムド,インコーポレイテッドBoston Scientific Scimed,Inc. | Renal nerve ablation medical device |
EP3019106A1 (en) | 2013-07-11 | 2016-05-18 | Boston Scientific Scimed, Inc. | Medical device with stretchable electrode assemblies |
CN105377169B (en) | 2013-07-11 | 2019-04-19 | 波士顿科学国际有限公司 | Device and method for neuromodulation |
WO2015010074A1 (en) | 2013-07-19 | 2015-01-22 | Boston Scientific Scimed, Inc. | Spiral bipolar electrode renal denervation balloon |
US10342609B2 (en) | 2013-07-22 | 2019-07-09 | Boston Scientific Scimed, Inc. | Medical devices for renal nerve ablation |
CN105392435B (en) | 2013-07-22 | 2018-11-09 | 波士顿科学国际有限公司 | Renal nerve ablation catheter with twisting sacculus |
CN105473093B (en) | 2013-08-22 | 2019-02-05 | 波士顿科学国际有限公司 | Flexible circuit with the improved adhesion strength to renal nerve modulation sacculus |
CN105555218B (en) | 2013-09-04 | 2019-01-15 | 波士顿科学国际有限公司 | With radio frequency (RF) foley's tube rinsed with cooling capacity |
EP3043733A1 (en) | 2013-09-13 | 2016-07-20 | Boston Scientific Scimed, Inc. | Ablation balloon with vapor deposited cover layer |
WO2015057521A1 (en) | 2013-10-14 | 2015-04-23 | Boston Scientific Scimed, Inc. | High resolution cardiac mapping electrode array catheter |
US11246654B2 (en) | 2013-10-14 | 2022-02-15 | Boston Scientific Scimed, Inc. | Flexible renal nerve ablation devices and related methods of use and manufacture |
US9770606B2 (en) | 2013-10-15 | 2017-09-26 | Boston Scientific Scimed, Inc. | Ultrasound ablation catheter with cooling infusion and centering basket |
JP6259098B2 (en) | 2013-10-15 | 2018-01-10 | ボストン サイエンティフィック サイムド,インコーポレイテッドBoston Scientific Scimed,Inc. | Medical device and method for manufacturing the medical device |
EP3057521B1 (en) | 2013-10-18 | 2020-03-25 | Boston Scientific Scimed, Inc. | Balloon catheters with flexible conducting wires |
WO2015061457A1 (en) | 2013-10-25 | 2015-04-30 | Boston Scientific Scimed, Inc. | Embedded thermocouple in denervation flex circuit |
CN105899157B (en) | 2014-01-06 | 2019-08-09 | 波士顿科学国际有限公司 | Tear-proof flexible circuit assembly |
WO2015119890A1 (en) | 2014-02-04 | 2015-08-13 | Boston Scientific Scimed, Inc. | Alternative placement of thermal sensors on bipolar electrode |
US11000679B2 (en) | 2014-02-04 | 2021-05-11 | Boston Scientific Scimed, Inc. | Balloon protection and rewrapping devices and related methods of use |
JP6584494B2 (en) * | 2014-09-12 | 2019-10-02 | ザ プロクター アンド ギャンブル カンパニーThe Procter & Gamble Company | Method for inhibiting HMGB1 activation of melanin producing cells, and method for identifying a drug suitable for such inhibition |
WO2021035211A1 (en) * | 2019-08-22 | 2021-02-25 | Applikate Technologies Llc | Tissue processing |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994011506A1 (en) * | 1992-11-18 | 1994-05-26 | Arch Development Corporation | Adenovirus-mediated gene transfer to cardiac and vascular smooth muscle |
WO1994013824A1 (en) * | 1992-12-16 | 1994-06-23 | Universite Pierre Et Marie Curie (Paris Vi) | Retroviral vectors for the treatment of tumors, and cell lines containing them |
EP0666270A2 (en) * | 1994-02-08 | 1995-08-09 | Bristol-Myers Squibb Company | Peptide inhibitors of the p33cdk2 and p34cdc2 cell cycle regulatory kinases and human papillomavirus E7 oncoprotein |
WO1996000006A1 (en) * | 1994-06-24 | 1996-01-04 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Inducible nitric oxide synthase gene for treatment of disease |
WO1996026742A1 (en) * | 1995-02-28 | 1996-09-06 | The Regents Of The University Of California | Gene transfer-mediated angiogenesis therapy |
WO1997035974A1 (en) * | 1996-03-26 | 1997-10-02 | Institut Pasteur | Sequences ahead of gene sm22, vectors containing same, and therapeutical uses thereof, particularly for treating vascular diseases |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5830879A (en) * | 1995-10-02 | 1998-11-03 | St. Elizabeth's Medical Center Of Boston, Inc. | Treatment of vascular injury using vascular endothelial growth factor |
US6090618A (en) * | 1996-10-07 | 2000-07-18 | Arch Development Corporation | DNA constructs and viral vectors comprising a smooth muscle promoter |
US5837534A (en) * | 1995-11-14 | 1998-11-17 | The Board Of Regents Of The University Of Texas System | Smooth muscle 22α promoter, gene transfer vectors containing the same, and method of use of the same to target gene expression in arterial smooth muscle cells |
-
1996
- 1996-10-07 US US08/726,807 patent/US6090618A/en not_active Expired - Fee Related
-
1997
- 1997-08-29 JP JP51752898A patent/JP3457332B2/en not_active Expired - Fee Related
- 1997-08-29 CA CA002267067A patent/CA2267067A1/en not_active Abandoned
- 1997-08-29 EP EP97942457A patent/EP0941245A1/en not_active Withdrawn
- 1997-08-29 AU AU44150/97A patent/AU738651B2/en not_active Ceased
- 1997-08-29 WO PCT/US1997/016204 patent/WO1998015575A1/en active Application Filing
-
1999
- 1999-01-05 US US09/225,670 patent/US6297221B1/en not_active Expired - Fee Related
- 1999-02-26 US US09/258,367 patent/US6114311A/en not_active Expired - Fee Related
- 1999-11-01 US US09/431,349 patent/US6331527B1/en not_active Expired - Fee Related
- 1999-11-01 US US09/431,414 patent/US6291211B1/en not_active Expired - Fee Related
-
2000
- 2000-04-10 US US09/546,550 patent/US6284743B1/en not_active Expired - Fee Related
-
2002
- 2002-05-10 JP JP2002136310A patent/JP2003009894A/en active Pending
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994011506A1 (en) * | 1992-11-18 | 1994-05-26 | Arch Development Corporation | Adenovirus-mediated gene transfer to cardiac and vascular smooth muscle |
WO1994013824A1 (en) * | 1992-12-16 | 1994-06-23 | Universite Pierre Et Marie Curie (Paris Vi) | Retroviral vectors for the treatment of tumors, and cell lines containing them |
EP0666270A2 (en) * | 1994-02-08 | 1995-08-09 | Bristol-Myers Squibb Company | Peptide inhibitors of the p33cdk2 and p34cdc2 cell cycle regulatory kinases and human papillomavirus E7 oncoprotein |
WO1996000006A1 (en) * | 1994-06-24 | 1996-01-04 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Inducible nitric oxide synthase gene for treatment of disease |
WO1996026742A1 (en) * | 1995-02-28 | 1996-09-06 | The Regents Of The University Of California | Gene transfer-mediated angiogenesis therapy |
WO1997035974A1 (en) * | 1996-03-26 | 1997-10-02 | Institut Pasteur | Sequences ahead of gene sm22, vectors containing same, and therapeutical uses thereof, particularly for treating vascular diseases |
Non-Patent Citations (8)
Title |
---|
DATABASE EMBL/DDBJ 16 January 1996 (1996-01-16) * |
DATABASE EMBL/DDBJ 28 May 1996 (1996-05-28) * |
DATABASE EMBL/DDBJ 6 March 1995 (1995-03-06) * |
H. MOESSLER ET AL.,: "The SM22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice", DEVELOPMENT, vol. 122, 1 May 1996 (1996-05-01), CAMBRIDGE, UK, pages 2415 - 2425, XP000196601 * |
J. SOLWAY ET AL.,: "Structure and expression of a smooth muscle cell-specific gene, SM22 alpha", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 22, 2 June 1996 (1996-06-02), BETHESDA, MD,US, pages 13460 - 13469, XP000609071 * |
L. LI ET AL.,: "Expression of the SM22 alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells", THE JOURNAL OF CELL BIOLOGY, vol. 132, no. 5, 1 March 1996 (1996-03-01), pages 849 - 859, XP000609076 * |
M.W. CHANG ET AL.,: "Cytostatic gene therapy for vascular proliferative disorders with a constitutively active form of the retinoblastoma gene product", SCIENCE, vol. 267, 1995, WASHINGTON DC, US, pages 518 - 522, XP000609101 * |
P.R. KEMP ET AL.,: "Cloning and analysis of the promoter region of the rat SM22 alpha gene", BIOCHEMICAL JOURNAL, vol. 310, 1995, LONDON, UK, pages 1037 - 1043, XP000196609 * |
Cited By (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6591129B1 (en) | 1996-02-15 | 2003-07-08 | Biosense, Inc. | Method for treating tissue through injection of a therapeutic agent |
US6309370B1 (en) | 1998-02-05 | 2001-10-30 | Biosense, Inc. | Intracardiac drug delivery |
US6254573B1 (en) | 1998-02-05 | 2001-07-03 | Biosense, Inc. | Intracardiac drug delivery device utilizing spring-loaded mechanism |
EP1190082A4 (en) * | 1999-06-25 | 2003-07-02 | Yissum Res Dev Co | Method of inducing angiogenesis by micro-organs |
EP1190082A1 (en) * | 1999-06-25 | 2002-03-27 | Yissum Research Development Company of the Hebrew University of Jerusalem | Method of inducing angiogenesis by micro-organs |
WO2001018048A3 (en) * | 1999-09-09 | 2001-08-02 | Van Guillaume Johannes Jo Eijs | Smooth muscle cell promoter and uses thereof |
EP1083231A1 (en) * | 1999-09-09 | 2001-03-14 | Introgene B.V. | Smooth muscle cell promoter and uses thereof |
WO2001018048A2 (en) * | 1999-09-09 | 2001-03-15 | Universiteit Maastricht/Cardiovascular Research Institute Maastricht (Carim) | Smooth muscle cell promoter and uses thereof |
WO2001052915A1 (en) * | 2000-01-24 | 2001-07-26 | Biocompatibles Limited | Coated implants |
US6746686B2 (en) | 2000-01-24 | 2004-06-08 | Biocompatibles Uk Limited | Coated implants |
US7767201B2 (en) * | 2000-08-08 | 2010-08-03 | Multi-Gene Vascular Systems Ltd. | Vascular cells genetically altered to over-express angiogenic proliferation and maturation factors; treatment of atherosclerosis using same |
EP1925626A1 (en) | 2003-07-21 | 2008-05-28 | Transgene S.A. | Novel multifunctional cytokines |
EP1944318A1 (en) | 2003-07-21 | 2008-07-16 | Transgene S.A. | Novel multifunctional cytokines |
US9127084B2 (en) | 2006-09-14 | 2015-09-08 | Medgenics Medical Israel Ltd. | Long lasting drug formulations |
US9155749B2 (en) | 2006-09-14 | 2015-10-13 | Medgenics Medical Israel Ltd. | Long lasting drug formulations |
WO2014066443A1 (en) | 2012-10-23 | 2014-05-01 | Emory University | Gm-csf and il-4 conjugates, compositions, and methods related thereto |
EP3587455A1 (en) | 2012-10-23 | 2020-01-01 | Emory University | Gm-csf and il-4 conjugates, compositions, and methods related thereto |
Also Published As
Publication number | Publication date |
---|---|
US6114311A (en) | 2000-09-05 |
EP0941245A1 (en) | 1999-09-15 |
JP3457332B2 (en) | 2003-10-14 |
AU738651B2 (en) | 2001-09-20 |
US6090618A (en) | 2000-07-18 |
US6297221B1 (en) | 2001-10-02 |
JP2001502899A (en) | 2001-03-06 |
JP2003009894A (en) | 2003-01-14 |
US6291211B1 (en) | 2001-09-18 |
US6331527B1 (en) | 2001-12-18 |
CA2267067A1 (en) | 1998-04-16 |
AU4415097A (en) | 1998-05-05 |
US6284743B1 (en) | 2001-09-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU738651B2 (en) | Promoter for smooth muscle cell expression | |
Legraverend et al. | High level activity of the mouse CCAAT/enhancer binding protein (C/EBPα) gene promoter involves autoregulation and several ubiquitous transcription factors | |
Lu et al. | Retroviral integration within the Fli-2 locus results in inactivation of the erythroid transcription factor NF-E2 in Friend erythroleukemias: evidence that NF-E2 is essential for globin expression. | |
Oettgen et al. | Isolation and characterization of a novel epithelium-specific transcription factor, ESE-1, a member of the ets family | |
Epstein et al. | Pax3 modulates expression of the c-Met receptor during limb muscle development. | |
US6472520B2 (en) | Rat PEG-3 promoter | |
RU2214280C2 (en) | Methods and components for induction of tumor- -specific cytotoxicity | |
US5773583A (en) | Methods and materials relating to the functional domains of DNA binding proteins | |
EP1083231A1 (en) | Smooth muscle cell promoter and uses thereof | |
SK132797A3 (en) | Viral vectors and their use for treating hyperproliferative disorders, in particular restenosis | |
US6300484B1 (en) | DNA encoding DP. 75 and a process for its use | |
US6194547B1 (en) | ETS2 repressor factor (ERF) | |
US20030175260A1 (en) | Novel DNA and a process for its use | |
Ostendorff et al. | Functional characterization of the gene encoding RLIM, the corepressor of LIM homeodomain factors | |
JP2001521387A (en) | Gene carrier expressing apoptosis-inducing protein VP2 and / or apoptin | |
US7169764B1 (en) | Promoter for smooth muscle cell expression | |
KR100336551B1 (en) | Tissue specific expression of retinoblastoma protein | |
FR2746815A1 (en) | SEQUENCES UPSTREAM OF THE SM 22 GENE, VECTORS CONTAINING THEM AND THEIR THERAPEUTIC USES, ESPECIALLY IN THE TREATMENT OF VASCULAR DISEASES | |
JP2003531613A (en) | Regulatory nucleic acid sequence of ABC1 gene | |
JPH11506325A (en) | ΔP62, variants thereof, nucleic acid sequences and uses thereof | |
MXPA01001655A (en) | A single gene encoding aortic-specific and striated-specific muscle cell isoforms, its regulatory sequences and uses thereof. | |
Retroviruses et al. | Members of the GATA Family of Transcription | |
JP2004512045A (en) | Nucleic acids that regulate the ABCA7 gene, molecules that modulate its activity, and therapeutic uses | |
WO1997004090A1 (en) | SEQUENCE AND EXPRESSION OF Sox-18 | |
WO1999046373A1 (en) | IDENTIFICATION OF PACTOLUS: A β INTEGRIN-LIKE PROTEIN |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
CFP | Corrected version of a pamphlet front page |
Free format text: ADD INID NUMBER (63) "RELATED BY CONTINUATION (CON) OR CONTINUATION-IN-PART (CIP) TO EARLIER APPLICATION" WHICH WAS INADVERTENTLY OMITTED FROM THE FRONT PAGE |
|
ENP | Entry into the national phase |
Ref document number: 2267067 Country of ref document: CA Ref country code: CA Ref document number: 2267067 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 517528 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997942457 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1997942457 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09381750 Country of ref document: US |