WO2000002589A1

WO2000002589A1 - Modulation of haemopoietic cell activity and agents useful for same

Info

Publication number: WO2000002589A1
Application number: PCT/AU1999/000560
Authority: WO
Inventors: Ismail Kola; Leigh H. Mckinlay
Original assignee: Monash University
Priority date: 1998-07-09
Filing date: 1999-07-09
Publication date: 2000-01-20
Also published as: AUPP459998A0

Abstract

The present invention relates generally to a method of modulating haemopoietic cell functional activity and agents useful for same. More particularly, said modulation is effected via the Ets-1 gene. Still more particularly, the present invention contemplates a method of modulating mast cell and eosinophil activity. The method of the present invention is particularly useful, inter alia, in the treatment and/or prophylaxis of conditions involving activated haemopoietic cells such as inflammatory diseases, angiogenesis, metastasising tumours and wound repair.

Description

MODULATION OF HAEMOPOIETIC CELL ACTIVITY AND AGENTS USEFUL

FOR SAME

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

The bibliographic details of the publications referred to by author in this specification are collected at the end of the description.

Haemopoietic cells, and in particular activated mast cells, play a central role in inflammatory and IgE-mediated immediate hypersensitivity reactions. Mast cells, for example, produce molecules including histamine, heparin, proteases, leukotrienes, prostaglandins and cytokines that have inflammatory and vasoactive properties (Plaut et al., 1989; Wodnar-Filipowicz et al, 1989; Galli et al, 1991 and Valent et al, 1991). Mast cell cytokines play a pivotal role in IgE-dependent reactions by affecting cell types present in the tissue (eg. stromal cells, vascular endothelial cells, lymphocytes and eosinophils) which amplify the inflammatory reaction by recruiting leukocytes to the region. Mast cells have also been implicated in biological processes such as angiogenesis (Meininger & Zetter, 1992 and Wernert et al ,

1992). The local expansion of mast cell populations occurs either via autocrine factor production or as a result of cytokines secreted by local and recruited cell types. Mast cells originate from the haematopoietic stem cell in the bone marrow. Mast cell committed precursors, termed promastocytes, are thy-l'° ckit^hl cells containing cytoplasmic granules. Following migration from the bone marrow, and circulation in the bloodstream, promastocytes complete their differentiation in peripheral sites (Burd et al., 1989 and Lantz and Huff, 1995). In mice, mature mast cells are able to assume one of two phenotypes as determined by cytokines present in the local microenvironment (Abbas et al, 1991 and Swieter et al. , 1992). Mucosal mast cells (MMC), which are prevalent in the mucosa of the gastrointestinal tract and lung, are dependent upon T cell-derived cytokines IL-3 and IL-4 (Lee et al., 1986 and Galli, 1990). Connective tissue mast cells (CTMC), which are ubiquitous within connective tissue (ie. skin, peritoneal cavity and musculature), are independent of T cell cytokines but instead are dependent upon fibroblast-derived SCF (Tsai et al., 1991 and Takagi et al., 1992). CTMC characteristically produce IL-12 and contain histamine and heparin in their granules (Galli, 1990 and Smith et al., 1994). In contrast, MMC produce IL-4, store low quantities of histamine and produce chondroitin sulfate E rather than heparin (Galli, 1990). The cytokine GM-CSF is expressed by activated mast cells and has been implicated in the autocrine regulation of mast cell proliferation (Plaut et al. , 1989; Wodnar-Filipowicz et al , 1989; Galli et al., 1991 and Meade et al , 1993).

Due to the central role which haemopoietic cells, such as mast cells, play in the induction and progression of immune responses such as inflammatory responses, there is a need to elucidate the specific mechanisms involved in the functional activation and expansion of haemopoietic cells. This will facilitate the rational design of drugs for modulation of the functioning of these cells.

In work leading up to the present invention, the investigators have compared a parental factor dependent mast cell line FMP1.6 with a spontaneous factor independent derivative FMP6- in order to ascertain the basis for the activity of FMP6-. The inventors have identified that FMP6- is factor independent due to the up-regulation of cytokine genes, including GM-CSF, and that the transcription factor Ets-1 is highly expressed in FMP6- as compared to FMP1.6. Further, Ets-1 is shown to regulate a GM-CSF reporter in FMP6- cells. A role for Ets-1 in the activation process of mast cells has been investigated by stimulation of FMP6- mast cells and primary cultures of bone marrow derived mast cells. The inventors have developed a method of modulating the functional activity of haemopoietic cells, such as mast cells and eosinophils, by modulating the expression of the transcription factor Ets-1.

SUMMARY OF THE INVENTION

Throughout this specification and the claims which follow unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

The subject specification contains nucleotide sequence information prepared using the programme Patentln Version 2.0, presented herein after the bibliography. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e.g. <210> 1, < 210 > 2, etc). The length, type of sequence (DNA, etc) and source organism for each nucleotide sequence are indicated by information provided in the numeric indicator fields <211 > , <212 > and <213 > , respectively. Nucleotide sequences referred to in the specification are defined by the information provided in numeric indicator field <400> followed by the sequence identifier (eg. <400 > 1, < 400>2, etc).

One aspect of the present invention provides a method of modulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

In another aspect there is provided a method of modulating mast cell activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof. Yet another aspect of the present invention provides a method of modulating eosinophil activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

Still yet another aspect of the present invention provides a method of down-regulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to down-regulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

Still yet another further aspect of the present invention provides a method of up-regulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to up- regulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

A further aspect of the present invention provides a method of up-regulating haemopoietic cell functional activity, said method comprising administering to said mammal an effective amount of a nucleic acid molecule encoding Ets-1 or a derivative, analogue or mimetic of said nucleic acid molecule for a time and under conditions sufficient to up-regulate the functional activity of said haemopoietic cell.

Another further aspect of the present invention relates to a method of down-regulating haemopoietic cell activity in a mammal said method comprising administering to said mammal an effective amount of an Ets-1 antagonist for a time and under conditions sufficient to down- regulate Ets-1 functional activity.

Yet another further aspect of the present invention relates to a method of up-regulating haemopoietic cell activity in a mammal said method comprising administering to said mammal an effective amount of Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof.

Still yet another further aspect of the present invention relates to a method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1, or a functional equivalent or derivative thereof wherein said modulation results in modulation of said haemopoietic cell activity.

Another aspect of the present invention provides a method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functional activity of Ets-1 wherein said modulation results in modulation of said haemopoietic cell activity.

Yet another aspect of the present invention provides a method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of Ets-1 or a functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or a functional equivalent or derivative thereof for a time and under conditions sufficient to modulate the functional activity of said haemopoietic cell.

Still another aspect of the present invention relates to the use of an agent capable of modulating the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal. Still yet another aspect of the present invention relates to the use of an agent capable of modulating Ets-1 functional activity in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal.

Still a further aspect of the present invention relates to the use of Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or a derivative or analogue of said nucleic acid molecule in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal.

Yet another aspect of the present invention relates to agents for use in modulating the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof wherein modulating expression of said nucleotide sequence modulates haemopoietic cell activity.

A further aspect of the present invention relates to agents for use in modulating Ets-1 functional activity wherein modulating Ets-1 functional activity modulates haemopoietic cell activity.

Still another aspect of the present invention relates to Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or a derivative or analogue of said nucleic acid molecule for use in modulating haemopoietic cell activity.

In yet another aspect the present invention relates to a pharmaceutical composition comprising a modulatory agent as hereinbefore defined. Said modulatory agents are referred to as the active ingredients and one or more pharmaceutically acceptable carriers and/or diluents.

Accordingly, another aspect of the present invention provides a method for detecting an agent capable of modulating the function of Ets-1 or its functional equivalent or derivative thereof said method comprising contacting a cell or extract thereof containing said Ets-1 or its functional equivalent or derivative with a putative agent and detecting an altered expression phenotype associated with said Ets-1 or its ftinctional equivalent or derivative.

In a preferred embodiment, the present invention provides a method for detecting an agent capable of modulating the function of Ets-1 or its functional equivalent or derivative thereof said method comprising contacting a haemopoietic cell containing said Ets-1 or its functional equivalent or derivative with putative agent and detecting an altered cytokine expression profile associated with said Ets-1 or its functional equivalent or derivative.

In yet another aspect the present invention provides a method for detecting an agent capable of binding or otherwise associating with the Ets-1 binding site or ftinctional equivalent or derivative thereof said method comprising contacting a cell containing said Ets-1 bindng site or functional equivalent or derivative thereof with a putative agent and detecting an altered expression phenotype associated with modulation of the function of Ets-1 or its functional equivalent or derivative.

Still yet another aspect of the present invention relates to modulatory agents, as hereinbefore defined, when used in the method of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a photographic representation of the phenotypic characterisation of mast cell lines.

(A) RT-PCR analysis of IL-4, IL-12 (p35 subunit), and control β-actin transcripts in FMP6- and FMP1.6. PCR products were run on a 2% agarose gel together with low m.w. standards. Primers were designed across introns and products generated were of specific sizes for RNA. Expected sizes were 170 bp for IL-4, 260 bp for IL-12, and 100 bp for β-actin. Negative controls, as indicated (RT ).

(B) Paraffin-embedded section of FMP6- and FMP1.6 cells were stained. Staining of FMP6- shows histamine-containing cells stained with Alcian blue and some granules containing heparin, which stain red with safranin (arrow). Granules within FMP1.6 cells show a lack of staining of heparin by safranin, although Alcian blue staining may be detected.

(C) RT-PCR analysis of MMCP-4, MMCP-6, and control β-actin transcripts in FMP6-, FMP1.6 and BMMC. PCR products were run on a 2% agarose gel together with low m.w. standards. Primers were designed across introns, and products generated were the expected size: MMCP-4 was 300 bp, MMCP-6 was 171 bp, and positive control β-actin transcripts were 100 bp. Negative controls, as indicated (RT ).

Figure 2 (A) A graphical representation of MTT assay measuring proliferation of two growth factor-dependent murine mast cell lines FMP1.6 and 32D cl23 as well as the factor- independent line FMP6- in culture. Growth curve of FMP1.6 (A) and 32D cl23 (T) cells in the presence of conditioned medium (+CM) as a source of IL-3 and GM-CSF. Factor- independent FMP6- cells were cultured only in FCS-supplemented IMDM (■). Also shown are curves for FMP1.6 (♦) and 32D cl23 (•) in the absence of conditioned medium (-CM). Measurements are taken at absorbance O.D. 595nm and results are shown as mean + SEM of 6-8 replicates.

(B) A graphical representation of analysis of the effect of GM-CSF and IL-3 neutralising monoclonal antibodies on the proliferation of FMP6- cells. Cells were cultured in media supplemented with lμg/ml GM-CSF (A) or IL-3 (T) antibodies respectively, or a control antibody (■) of identical IgGl subtype. Each data point represents the mean + SEM for 4 replicates.

(C) Photographic representation of RNase protection analysis of GM-CSF and IL-3 mRNA levels in FMP6- and FMP1.6. Antisense ³²P-labelled riboprobes for GM-CSF and IL-3 were used on 20μg of total RNA. β-microglobulin (β-MG) was used on an internal control to correct for RNA loadings.

Figure 3 is a photographic representation of:

(A) RNase protection analysis of Ets-1 mRNA levels in FMP6- and FMP1.6 cells. Antisense ³²P-labelled riboprobes of 302bp for murine Ets-1 and 187bp for β-MG were used on 20μg of total RNA. Protected fragments for Ets-1 and β-MG were 235bp and 117bp, respectively.

(B) Ets-1 RNase protections performed on 20μg of total RNA extracted from control (-) and PMA/I stimulated (+) FMP6- or BMMC cultures.

(C) GM-CSF RNase protections performed on 20μg of total RNA extracted from control (-) and PMA/I stimulated (+) FMP6- or BMMC cultures. The full length 423bp GM-CSF probe gave a 342bp protected fragment.

Figure 4 is a photographic representation of in vitro EMSA analysis of Ets-1 binding sites using rEts-1 protein as well as competition between the putative ETS binding sequences from the GM-CSF promoter and a MSV LTR-Ets-1 binding sequence. The gel shows binding of Ets-1 to MSV-LTR (lane 1); a supershift with Ets-1 antibody (lane 2); absence of a supershift with an Ets-2 antibody (lane 3); competition in the presence of a lOOx excess of unlabelled MSV-LTR (lane 4) and a lack of competition by a mutant oligonucleotide containing an AGAA substitution in the GGAA core binding site (MUT;lane 5). Lanes 6-11 show binding of Ets-1 to putative Ets binding sites from the GM-CSF promoter in the presence or absence of competition from a lOOx excess of unlabelled MSV-LTR oligonucleotide. Lanes 12-14 show competition of MSV LTR-Ets-1 with oligonucleotides representing the potential Ets binding sites. GM2 and GM5 compete MSV LTR-Ets-1 binding. Figure 5 is a graphical representation of Ets-1 transactivating GM-CSF via the GMS site in CLEO.

(A) FMP6- cells (5xl0⁶) were transiently transfected with 15μg of pMGMl.6 luciferase or pMGMl.6 luc-AGAA (containing a GGAA→AGAA mutation in GM5) in addition to 5μg of the Ets-1 expression construct (or 5μg control pEF-BOS vector alone) by electroporation. Luciferase data are represented as mean + SEM of at least 6 replicates, (p values: θ =0.0018, *=0.012).

(B) FMP6- cells were transiently transfected with pMGMl .6 luciferase together with 20μg of an antisense Ets-1 expression construct or 20μg of empty pEF-BOS vector. Data are represented as mean ± SEM of 3 replicates (p value: * =0.004).

DET AILED DESCRIPTION OF THE INVENTION

The present invention is predicated, in part, on the development of a method of regulating haemopoietic cell activity by regulating the functioning of Ets-1. This development now permits the rational design of drugs for modulating the functional activity of Ets-1 and the further identification of a range of molecules for use, inter alia, in the therapy, prophylaxis and diagnosis of conditions involving haemopoietic cell functional activity, and in particular, mast cell and eosinophil functional activity.

Accordingly, one aspect of the present invention provides a method of modulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

Reference herein to "Ets-1" or "nucleotide sequence encoding Ets-1" should be read as including reference to all forms of Ets-1 or other molecules having the function of Ets-1. This includes, for example, all protein or nucleic acid forms of Ets-1 or its functional equivalent or derivative including, for example, any isoforms which arise from alternative splicing of Ets-1 mRNA or mutants or polymoφhic variants of Ets-1. It should be understood that reference to a "nucleotide sequence encoding Ets-1" includes reference to any Ets-1 regulatory element (such as promoters or enhancers) which regulate the expression of Ets-1 and include the location at a position other than between the Ets-1 genomic DNA transcription initiation and termination sites (Watson et al. 1988). "Ets-1" should also be understood to include reference to any other molecules which exhibit the functional activity of Ets-1. Such molecules include, for example, endogenously expressed molecules which exhibit Ets-1 functional activity or molecules which have been introduced into the body and which mimic at least one of the Ets-1 functions. These molecules may be recombinant, synthetic or naturally occurring. To the extent that it is not specified, any reference to modulating the expression of a nucleic acid molecule encoding Ets-1 or the functional activity of the Ets-1 expression product should be understood to include reference to modulating the expression or functional activity of Ets-1 functional equivalents or derivatives.

Reference to "haemopoietic cells" should be understood to refer to cells which are derived from haematolymphoid tissue including but not limited to multipotential cells, haemopoietic stem cells, haemopoietic cells, myeloid cells or lymphoid cells of any differentiative state. In this regard reference to "haemopoietic cells" should be understood to extend to any cells deriving from the early differentiative cell types which differentiate to haemopoietic cells. For example, reference to "haemopoietic cell" includes reference to cells deriving from the haemangioblast. Some or all of said haemopoietic cell population may also be transgenic in that said cells may be engineered to express one or more genes such as genes encoding transcription factors (for example Ets-1), antigens, immune modulating agents, cytokines or receptors. Preferably said haemopoietic cells are mast cells or eosinophils.

An "effective amount" means an amount necessary to at least partly attain the desired response.

Accordingly, in one embodiment there is provided a method of modulating mast cell activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

In another embodiment there is provided a method of modulating eosinophil activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

The term "mammal" includes humans, primates, livestock animals (e.g. horses, cattle, sheep, pigs and donkeys) laboratory test animals (e.g. mice, rats, rabbits, guinea pigs) companion animals (e.g. dogs and cats) and captive wild animals (e.g. kangaroos, deer, foxes). Preferably, the mammal is a human or laboratory test animal. Even more preferably the mammal is a human. The term "expression" refers to the transcription and translation of a nucleic acid molecule. Reference to "expression product" is a reference to the product produced from the transcription and translation of a nucleic acid molecule.

Reference to modulating haemopoietic cell "functional activity" is a reference to modulation of one or more functions which a haemopoietic cell is capable of performing such as but not limited to, one or more of cytokine production (for example inflammatory cytokines and other molecules involved in inflammation), granule release, enzyme release, biogenic amine release, cell division, phagocytosis, or cell surface antigen production. Although not intending to limit the present invention to any one theory or mode of action, Ets-1 up- regulates functional activity, such as cytokine production, by binding to a nucleic acid binding sequence in the promoter region of the one or more genes which are expressed by the activated cells. For example, the Ets-1 transcription factor can bind at least two binding sites (termed GM2 and GM5) located in the human GM-CSF promoter in mast cells, thereby resulting in GM-CSF synthesis. In another example, it can also bind a cis-binding element in the promoter/5' regulatory region of the IL-5 gene. Without limiting the present invention to one theory or mode of action the expression of Ets-1 also correlates with that of TNF in mast cells and the TNFα promoter has putative Ets-1 binding sites. Further, TNFα is a cytokine expressed by activated mast cells and Ets-1 is induced by activation of mast cells thus indicating that other such cytokines in activated mast cells and eosinophils may also be regulated by Ets-1.

The method of the present invention can be exemplified with respect to mast cell activation in the context of an inflammatory response such as asthma. Mast cells which are activated as part of an inflammatory process mediate their inflammatory functions via the release of a large range of cytokines, such as GM-CSF and TNFα, and biogenic amines, such as histamines, which cause vasodilation. Transcription of the Ets-1 transcription factor is required for the up-regulation of said mast cell activity. Up-regulation of Ets-1 in a resting mast cell will activate said mast cell while down-regulation of Ets-1 expression represses the activity of an activated mast cell. The method of the present invention can also be exemplified with respect to eosinophil activation in the context of inflammatory diseases such as asthma. Eosinophils are important cell type involved in the pathogenesis of asthma. In this regard IL-5 is an important cytokine involved in eosinophil function and/or pathogenicity. Without limiting the present invention to any one theory or mode of action, Ets-1 binds a cis-binding element in the promoter/5' regulatory region of the IL-5 gene. Further, Ets-1 can increase the expression of a CAT reporter gene ligator to the IL-5 promoter. Still further, Ets-1 can synergise in the increased transcription of IL-5 with other transcription factors such as API. Modulation of Ets-1 binding in the IL-5 promoter region results in both reduced transcription of IL-5 and the reduced ability of other transcription factors such as API and GATA to activate transcription of IL-5.

Accordingly, the term "modulation" refers to up-regulation or down-regulation. Down- regulation of the expression of a nucleotide sequence encoding Ets-1 is particularly desirable in the treatment of diseases and disorders, such as inflammatory diseases or diseases exacerbated or modulated by inflammation (for example asthma, rheumatoid arthritis, Alzheimer's disease and Atherosclerosis) which involve unwanted haemopoietic cell functional activity. Tumour metastases may also involve unwanted haemopoietic activity in that increased Ets-1 expression activates downstream cellular target genes thereby activating the mast cell and contributing to tumour growth, for example by contributing to angiogenesis during tumour growth. Preferably said down regulation results in down-regulation of haemopoietic cell functional activity.

According to this preferred embodiment, there is provided a method of down-regulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to down-regulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

Even more preferably, said haemopoietic cell is a mast cell and said haemopoietic cell functional activity is GM-CSF or TNFα expression. In another embodiment, said haemopoietic cell is an eosinophil and said haemopoietic cell functional activity is IL-5 expression.

Although the preferred method is to down-regulate expression of a nucleotide sequence encoding the Ets-1 transcription factor, up-regulation of said expression may be desired under certain circumstances. For example, to facilitate wound repair or to promote haemopoiesis during chemotherapy or radiotherapy. Preferably said up-regulation results in up-regulation of haemopoietic cell functional activity.

Accordingly, another preferred embodiment of the present invention provides a method of up-regulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to up-regulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

Preferably, said haemopoietic cell is a mast cell or eosinophil.

In another preferred embodiment, the present invention provides a method of up-regulating haemopoietic cell functional activity, said method comprising administering to said mammal an effective amount of a nucleic acid molecule encoding Ets-1 or a derivative, analogue or mimetic of said nucleic acid molecule for a time and under conditions sufficient to up-regulate the functional activity of said haemopoietic cell.

Preferably said haemopoietic cell is a mast cell or eosinophil.

Modulation of the expression of a nucleotide sequence encoding Ets-1 can be achieved by one of several techniques, including but in no way limited to:

(i) introducing into a cell a nucleic acid molecule encoding Ets-1 or functional equivalent or derivative thereof to modulate the capacity of that cell to synthesise Ets-1; or (ii) introducing into a cell a proteinaceous or non-proteinaceous molecule which modulates transcriptional and/or translational regulation of a gene, wherein said gene may be an Ets-1 gene or some other gene which directly or indirectly modulates the expression of an Ets-1 gene.

Modulation of haemopoietic cell functional activity via the modulation of the expression of a nucleotide sequence encoding Ets-1 can also be achieved by the administration of an agent which modulates Ets-1 functional activity such as Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof or an Ets-1 agonist or antagonist.

In this regard, modulation of the functional activity of Ets-1 expression product can be achieved by one of several techniques, including but in no way limited to introducing into said mammal a proteinaceous or non-proteinaceous molecule which:

(i) functions as an antagonist of Ets-1 expression product;

(ii) functions as an agonist of Ets-1 expression product (including administration of Ets-1 expression product or functional equivalent, derivative, homologue, analogue or mimetic thereof).

The proteinaceous molecule may be derived from natural or recombinant sources including fusion proteins or following, for example, natural product screening. Said non-proteinaceous molecule may be, for example, a nucleic acid molecule or may be derived from natural sources, such as for example natural product screening or may be chemically synthesised. The present invention contemplates chemical analogues of Ets-1 expression product or small molecules capable of acting as agonists or antagonists. Chemical agonists may not necessarily be derived from Ets-1 expression product but may share certain conformational similarities. Alternatively, chemical agonists may be specifically designed to mimic certain physiochemical properties. Antagonists may be any compound capable of blocking, inhibiting or otherwise preventing Ets-1 from carrying out their normal biological functions. Antagonists include monoclonal antibodies and antisense nucleic acids which prevent transcription or translation of Ets-1 genes or mRNA in mammalian cells. Modulation of expression may also be achieved utilising antigens, RNA, ribosomes, DNAzymes, RNA aptamers, antibodies or molecules suitable for use in co-suppression.

Said proteinaceous or non-proteinaceous molecule may act either directly or indirectly to modulate the expression of Ets-1 or the activity of Ets-1 expression product. Said molecule acts directly if it associates with Ets-1 nucleic acid molecule or expression product to modulate expression or activity. Said molecule acts indirectly if it associates with a molecule other than Ets-1 nucleic acid molecule or expression product which other molecule either directly or indirectly modulates the expression or activity of Ets-1 nucleic acid molecule or expression product. Accordingly, the method of the present invention encompasses the regulation of Ets-1 nucleic acid molecule or expression product expression or activity via the induction of a cascade of regulatory steps.

Accordingly, another aspect of the present invention relates to a method of down-regulating haemopoietic cell activity in a mammal said method comprising administering to said mammal an effective amount of an Ets-1 antagonist for a time and under conditions sufficient to down- regulate Ets-1 functional activity.

In one embodiment said haemopoietic cells are mast cells and said haemopoietic cell activity is GM-CSF or TNFα expression.

In another embodiment, said haemopoietic cells are eosinophils and said haemopoietic cell activity is IL-5 expression.

In another aspect the present invention relates to a method of up-regulating haemopoietic cell activity in a mammal said method comprising administering to said mammal an effective amount of Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof.

In one embodiment said haemopoietic cells are mast cells and said haemopoietic cell activity is GM-CSF expression. In another embodiment, said haemopoietic cells are eosinophils and said haemopoietic cell activity is IL-5 expression.

Up-regulating Ets-1 functional activity may also be achieved utilising an agent which functions as an agonist of Ets-1. Said agonist may be proteinaceous or non-proteinaceous as hereinbefore defined.

The term "functional equivalent or derivative" used herein includes but is not limited to fragments, said fragments having the functional activity of Ets-1, homologues, analogues, mutants, variants and derivatives thereof. This includes homologues, analogues, mutants, variants and derivatives derived from natural, recombinant or synthetic sources including fusion proteins. Reference to "homologues" should be understood as a reference to Ets-1 nucleic acid molecules or proteins derived from species other than the species being treated.

Derivatives include fragments, parts, portions, mutants, variants and mimetics from natural, synthetic or recombinant sources including fusion proteins. Parts or fragments include, for example, active regions of Ets-1. Derivatives may be derived from insertion, deletion or substitution of amino acids. Amino acid insertional derivatives include amino and/or carboxylic terminal fusions as well as intrasequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterized by the removal of one or more amino acids from the sequence. Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. An example of substitutional amino acid variants are conservative amino acid substitutions. Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Additions to amino acid sequences include fusions with other peptides, polypeptides or proteins. Chemical and functional equivalents of Ets-1 nucleic acid or protein molecules should be understood as molecules exhibiting any one or more of the functional activities of these molecules and may be derived from any source such as being chemically synthesized or identified via screening processes such as natural product screening.

The derivatives include fragments having particular epitopes or parts of the entire protein fused to peptides, polypeptides or other proteinaceous or non-proteinaceous molecules.

Analogues contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecules or their analogues.

Derivatives of nucleic acid sequences may similarly be derived from single or multiple nucleotide substitutions, deletions and/or additions including fusion with other nucleic acid molecules. The derivatives of the nucleic acid molecules of the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in cosuppression and fusion of nucleic acid molecules. Derivatives of nucleic acid sequences also include degenerate variants.

Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH^ amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH

The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal. The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitisation, for example, to a corresponding amide.

Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.

Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.

Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carboethoxylation with diethylpyrocarbonate.

Examples of incorporating unnatural amino acids and derivatives during protein synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy-5- phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-arnino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D- isomers of amino acids. A list of unnatural amino acids contemplated herein is shown in Table 1. TABLE 1

Non-conventional Code Non-conventional Code amino acid amino acid

α-aminobutyric acid Abu L-N-methylalanine Nmala α-amino-α-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-N-methylhistidine Nmhis cyclopentylalanine Cpen L-N-methy 1 isol leucine Nmile D-alanine Dal L-N-methylleucine Nmleu

D-arginine Darg L-N-methyllysine Nmlys

D-aspartic acid Dasp L-N-methylmethionine Nmmet

D-cysteine Dcys L-N-methylnorleucine Nmnle

D-glutamine Dgln L-N-methylnorvaline Nmnva D-glutamic acid Dglu L-N-methylornithine Nmorn

D-histidine Dhis L-N-methylphenylalanine Nmphe

D-isoleucine Dile L-N-methylproline Nmpro

D-leucine Dleu L-N-methylserine Nmser

D-lysine Dlys L-N-methylthreonine Nmthr D-methionine Dmet L-N-methyltryptophan Nmtrp

D-ornithine Dorn L-N-methyltyrosine Nmtyr

D-phenylalanine Dphe L-N-methylvaline Nmval

D-proline Dpro L-N-methylethylglycine Nmetg

D-serine Dser L-N-methyl-t-butylglycine Nmtbug D-threonine Dthr L-norleucine Nle

D-tryptophan Dtrp L-norvaline Nva

D-tyrosine Dtyr α-methyl-aminoisobutyrate Maib

D-valine Dval α-methyl-γ-aminobutyrate Mgabu D-α-methylalanine Dmala α-methylcyclohexylalanine Mchexa

D-α-methylarginine Dmarg α-methylcylcopentylalanine Mcpen

D-α-methylasparagine Dmasn α-methyl-α-napthylalanine Manap

D-α-methylaspartate Dmasp α-methylpenicillamine Mpen D-α-methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu

D-α-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg

D-α-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn

D-α-methylisoleucine Dmile N-arnino-α-rnethylbutyrate Nmaabu

D-α-methylleucine Dmleu α-napthylalanine Anap D-α-methyllysine Dmlys N-benzylglycine Nphe

D-α-rnethylrnethionine Dmmet N-(2-carbamylethyl)glycine Ngln

D-α-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn

D-α-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Nglu

D-α-methylproline Dmpro N-(carboxymethyl)glycine Nasp D-α-methylserine Dmser N-cyclobutylglycine Ncbut

D-α-methylthreonine Dmthr N-cycloheptylglycine Nchep

D-α-methyltryptophan Dmtrp N-cyclohexylglycine Nchex

D-α-methyltyrosine Dmty N-cyclodecylglycine Ncdec

D-α-methylvaline Dmval N-cylcododecylglycine Ncdod D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct

D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro

D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund

D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm

D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe D-N-methylglutarnine Dnmgln N-(3-guanidinopropyl)glycine Narg

D-N-methylglutamate Dnmglu N-( 1 -hydroxyethyl)glycine Nthr

D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser

D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis

D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp D-N-methyllysine Dnmlys N-methyl-γ-aminobutyrate Nmgabu N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet

D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen

N-methylglycine Nala D-N-methylphenylalanine Dnmphe N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro

N-(l-methylpropyl)glycine Nile D-N-methylserine Dnmser

N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr

D-N-methyltryptophan Dnmtrp N-(l-methylethyl)glycine Nval D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap

D-N-methylvaline Dnmval N-methylpenicillamine Nmpen γ-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr

L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys

L-ethylglycine Etg penicillamine Pen L-homophenylalanine Hphe L-α-methylalanine Mala

L-α-methylarginine Marg L-α-methyiasparagine Masn

L-α-methylaspartate Masp L-α-methyl-t-butylglycine Mtbug

L-α-methylcysteine Mcys L-methylethylglycine Metg

L-α-methylglutarnine Mgln L-α-methylglutarnate Mglu L-α-methylhistidine Mhis L-α-methylhomophenylalanine Mhphe

L-α-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet

L-α-methylleucine Mleu L-α-methyllysine Mlys

L-α-methylmethionine Mmet L-α-methylnorleucine Mnle

L-α-methylnorvaline Mnva L-α-methylornithine Morn L-α-methylphenylalanine Mphe L-α-methylproline Mpro

L-α-methylserine Mser L-α-methylthreonine Mthr

L-α-methyltryptophan Mtrp L-α-methyltyrosine Mtyr

L-α-methylvaline Mval L-N-methylhomophenylalanine Nmhphe

N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)glycine

1 -carboxy- 1 -(2,2-diphenyl-Nmbc ethylamino)cyclopropane

Crosslinkers can be used, for example, to stabilise 3D conformations, using homo- bifunctional crosslinkers such as the bifunctional imido esters having (CH2)_n spacer groups with n= l to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-biftmctional reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety.

The molecules which may be administered to a mammal in accordance with the present invention may also be linked to a targeting means such as a monoclonal antibody, which provides specific delivery of these molecules to the target cells.

A further aspect of the present invention relates to the use of the invention in relation to the therapeutic or prophylactic treatment of human disease conditions. For example the present invention is particularly useful, but in no way limited to, use as an anti-inflammatory therapy in inflammatory disease conditions or disease exacerbated or modulated by inflammation (such as asthma, rheumatoid arthritis, Alzheimer's disease and atherosclerosis) or angiogenesis (for example, as occurs during tumour development) since angiogenesis and/or tumour metastases may also involve mast cell activation and migration. In another example, up-regulation of haemopoietic cell activity may be desirable such as during wound repair or prior to or during chemotherapy or radiotherapy where the up-regulation of GM-CSF production by differentiated mast cells is desirable.

Accordingly, another aspect of the present invention relates to a method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1, or a functional equivalent or derivative thereof wherein said modulation results in modulation of said haemopoietic cell activity.

Reference to "aberrant, unwanted or otherwise inappropriate" haemopoietic cell activity should be understood as a reference to over-active haemopoietic cell functional activity or to physiologically normal functional activity which is inappropriate in that it is unwanted or insufficient. For example, during an asthma attack mast cells respond to an allergen in accordance with a normal immunological hypersensitivity response. However, this response is unwanted and the method of the present invention is directed to down-regulating such activity. Conversely, during chemotherapy, although mast cells may be functioning in a normal physiological manner, it may be desirable to up-regulate their activity in terms of increasing GM-CSF production.

In a preferred embodiment the condition is an inflammatory condition and the haemopoietic cell is a mast cell or eosinophil. Preferably the functional activity is GM-CSF, IL-5 or TNFα expression which expression is down-regulated.

In a most preferred embodiment said agent is an Ets-1 antisense molecule.

In another aspect the present invention provides a method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functional activity of Ets-1 wherein said modulation results in modulation of said haemopoietic cell activity.

In yet another aspect the present invention provides a method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of Ets-1 or a functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets- 1 or a functional equivalent or derivative thereof for a time and under conditions sufficient to modulate the functional activity of said haemopoietic cell.

In a most preferred embodiment the condition is an inflammatory condition and the haemopoietic cell is a mast cell and/or an eosinophil. Preferably the functional activity is GM-CSF and IL-5 expression, respectively, which expression is down-regulated.

Still more preferably, said inflammatory condition is asthma or rheumatoid arthritis. In another preferred embodiment said condition is wound repair and said functional activity is up-regulated.

Administration of the agent, Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof, or Ets-1 nucleic acid molecule (herein referred to as "modulatory agent"), in the form of a pharmaceutical composition, may be performed by any convenient means. The modulatory agent of the pharmaceutical composition are contemplated to exhibit therapeutic activity when administered in an amount which depends on the particular case. The variation depends, for example, on the human or animal and the modulatory agent chosen. A broad range of doses may be applicable. Considering a patient, for example, from about 0.1 mg to about 1 mg of modulatory agent may be administered per kilogram of body weight per day. Dosage regimes may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, weekly, monthly or other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. The modulatory agent may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intraperitoneal, intramuscular, subcutaneous, intradermal or suppository routes or implanting (e.g. using slow release molecules). The modulatory agent may be administered in the form of pharmaceutically acceptable nontoxic salts, such as acid addition salts or metal complexes, e.g. with zinc, iron or the like (which are considered as salts for purposes of this application). Illustrative of such acid addition salts are hydrochloride, hydrobromide, sulphate, phosphate, maleate, acetate, citrate, benzoate, succinate, malate, ascorbate, tartrate and the like. If the active ingredient is to be administered in tablet form, the tablet may contain a binder such as tragacanth, corn starch or gelatin; a disintegrating agent, such as alginic acid; and a lubricant, such as magnesium stearate.

In another aspect the present invention relates to the use of an agent capable of modulating the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal. Preferably said haemopoietic cell is a mast cell and/or an eosinophil and said functional activity is GM-CSF and IL-5 expression, respectively.

Even more preferably expression of said nucleotide sequence is down-regulated.

Still more preferably said agent is an antisense Ets-1 molecule.

Another aspect of the present invention relates to the use of an agent capable of modulating Ets-1 functional activity in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal.

Preferably said haemopoietic cell is a mast cell and/or an eosinophil and said functional activity is GM-CSF and IL-5 expression, respectively.

Even more preferably, said haemopoietic cell activity is down-regulated.

Even more preferably, said haemopoietic cell activity is up-regulated.

Yet another aspect of the present invention relates to agents for use in modulating the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof wherein modulating expression of said nucleotide sequence modulates haemopoietic cell activity. A further aspect of the present invention relates to agents for use in modulating Ets-1 functional activity wherein modulating Ets-1 functional activity modulates haemopoietic cell activity.

Still another aspect of the present invention relates to Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets- 1 or a derivative or analogue of said nucleic acid molecule for use in modulating haemopoietic cell activity.

In a related aspect of the present invention the mammal undergoing treatment may be human or an animal in need of therapeutic or prophylactic treatment.

Reference herein to "treatment" and "prophylaxis" is to be considered in its broadest context. The term "treatment" does not necessarily imply that a mammal is treated until total recovery. Similarly, "prophylaxis" does not necessarily mean that the subject will not eventually contract a disease condition. Accordingly, treatment and prophylaxis include amelioration of the symptoms of a particular condition or preventing or otherwise reducing the risk of developing a particular condition. The term "prophylaxis" may be considered as reducing the severity of onset of a particular condition. "Treatment" may also reduce the severity of an existing condition or the frequency of acute attacks (for example, reducing the severity of asthma attacks).

In accordance with these methods, the modulatory agent defined in accordance with the present invention may be coadministered with one or more other compounds or molecules. By "coadministered" is meant simultaneous admimstration in the same formulation or in two different formulations via the same or different routes or sequential administration by the same or different routes. By "sequential" administration is meant a time difference of from seconds, minutes, hours or days between the administration of the two types of molecules, These molecules may be administered in any order. In yet another aspect the present invention relates to a pharmaceutical composition comprising a modulatory agent as hereinbefore defined. Said modulatory agents are referred to as the active ingredients and one or more pharmaceutically acceptable carriers and/or diluents.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion or may be in the form of a cream or other form suitable for topical application. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants. The preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absoφtion of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilisation. Generally, dispersions are prepared by incoφorating the various sterilised active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof. When the active ingredients are suitably protected they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incoφorated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1 % by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions in such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 μg and 2000 mg of active compound.

The tablets, troches, pills, capsules and the like may also contain the components as listed hereafter: a binder such as gum, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compound(s) may be incorporated into sustained-release preparations and formulations. The pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule encoding a modulatory agent. The vector may, for example, be a viral vector.

Screening for the modulatory agents hereinbefore defined can be achieved by any one of several suitable methods including, but in no way limited to, contacting a cell comprising the Ets-1 gene or functional equivalent or derivative thereof with an agent and screening for the modulation of Ets-1 protein production or functional activity, modulation of the expression of a nucleic acid molecule encoding Ets-1 or modulation of the activity or expression of a downstream Ets-1 cellular target. Detecting such modulation can be achieved utilising techniques such as Western blotting, electrophoretic mobility shift assays and/or the readout of reporters of Ets-1 activity such as luciferases, CAT and the like.

It should be understood that the Ets-1 gene or functional equivalent or derivative thereof may be naturally occurring in the cell which is the subject of testing or it may have been transfected into a host cell for the puφose of testing. Further, the naturally occurring or transfected gene may be constitutively expressed - thereby providing a model useful for, inter alia, screening for agents which down regulate Ets-1 activity, at either the nucleic acid or expression product levels, or the gene may require activation - thereby providing a model useful for, inter alia, screening for agents which up regulate Ets-1 expression. Further, to the extent that an Ets-1 nucleic acid molecule is transfected into a cell, that molecule may comprise the entire Ets-1 gene or it may merely comprise a portion of the gene such as the portion which regulates expression of the Ets-1 product. For example, the Ets-1 promoter region may be transfected into the cell which is the subject of testing. In this regard, where only the promoter is utilised, detecting modulation of the activity of the promoter can be achieved, for example, by ligating the promoter to a reporter gene. For example, the promoter may be ligated to luciferase or a CAT reporter, the modulation of expression of which gene can be detected via modulation of fluorescence intensity or CAT reporter activity, respectively. In another example, the subject of detection could be a downstream Ets-1 regulatory target, rather than Ets-1 itself or the reporter molecule ligated to the Ets-1 promoter or the reporter gene ligated to the promoter of the gene such as GM-CSF or IL-5 that Ets-1 regulates. Yet another example includes Ets-1 binding sites ligated to a minimal reporter. For example, modulation of Ets-1 activity can be detected by screening for the modulation of the functional activity in a haemopoietic cell. This is an example of an indirect system where modulation of Ets-1 expression, per se, is not the subject of detection. Rather, modulation of the molecules which Ets-1 regulates the expression of, are monitored. Where the cell which is the subject of the screening system is a mast cell or eosinophil, modulation of Ets-1 expression could be detected by screening for the modulation of either cytokine production by that cell or cytokine mRNA transcription. For example, modulation of GM-CSF, IL-5 or TNFα expression may be screened for.

These methods provide a mechanism for performing high throughput screening of putative modulatory agents such as the proteinaceous or non-proteinaceous agents comprising synthetic, combinatorial, chemical and natural libraries. These methods will also facilitate the detection of agents which bind either the Ets-1 nucleic acid molecule or expression product itself or which modulate the expression of an upstream molecule, which upstream molecule subsequently modulates Ets-1 expression or expression product activity. Accordingly, these methods provide a mechanism of detecting agents which either directly or indirectly modulate Ets-1 expression and/or activity.

Accordingly, another aspect of the present invention provides a method for detecting an agent capable of modulating the function of Ets-1 or its functional equivalent or derivative thereof said method comprising contacting a cell or extract thereof containing said Ets-1 or its functional equivalent or derivative with a putative agent and detecting an altered expression phenotype associated with said Ets-1 or its functional equivalent or derivative.

Reference to "Ets-1" should be understood as a reference to either the Ets-1 expression product or a nucleic acid molecule encoding Ets-1. It should also be understood as a reference to a portion or fragment of the Ets-1 molecule such as the regulatory region of the Ets-1 nucleic acid molecule. Alternatively, the molecule may comprise the binding portion of the Ets-1 expression product. In this regard, the Ets-1 nucleic acid molecule and/or expression product is expressed in a cell. The cell may be a host cell which has been transfected with the Ets-1 nucleic acid molecule or it may be a cell, such as a mast cell or an eosinophil which naturally contains the Ets-1 gene. Reference to "extraction thereof" should be understood as a reference to a cell free transcription system.

Reference to detecting an "altered expression phenotype associated with said Ets-1 " should be understood as the detection of cellular changes associated with modulation of the activity of Ets-1. These may be detectable for example as intracellular changes or changes observable extracellular ly. For example, this includes, but is not limited to, detecting changes in expression product levels, or, to the extent that the Ets-1 regulatory region is ligated to a reporter molecule such as luciferase or CAT, detecting changes in reporter molecule expression. Alternatively, this screening system may be established to detect changes in the expression of downstream molecules which are regulated by the Ets-1 expression product. For example, detecting changes in mRNA or expression product levels of cytokine such as GM-CSF, TNFα or IL-5.

As detailed earlier, the method of this aspect of the present invention should be understood to extend to screening for agents which modulate the expression of Ets-1 either directly or indirectly. An example of indirect modulation of Ets-1 would be modulation of the expression of a first nucleic acid molecule, which first nucleic acid molecule expression product modulates the expression of a nucleic acid molecule encoding Ets-1 or functional equivalent or derivative thereof. In yet another aspect the present invention provides a method for detecting an agent capable of binding or otherwise associating with the Ets-1 binding site or functional equivalent or derivative thereof said method comprising contacting a cell containing said Ets-1 binding site or functional equivalent or derivative thereof with a putative agent and detecting an altered expression phenotype associated with modulation of the function of Ets-1 or its functional equivalent or derivative.

Reference to "Ets-1 binding site" should be understood as a reference to the nucleic acid sequence to which the Ets-1 expression product can bind. For example, this includes reference to the GM2 or GM5 regions of the GM-CSF promoter or the Cis/binding element of IL-5. The Ets-1 binding region may be located within its naturally occurring promoter or it may be engineered by introducing into an unrelated promoter (for example a minimal promoter such as thymidine kinase) an Ets-1 binding sequence, for example, a nucleic acid molecule comprising the sequence Xaa Xaa GGAA Xaa Xaa wherein Xaa is any other nucleotide. Yet another method whereby greater specificity for Ets-1 binding (relative to other Ets-1 family member binding) could be achieved utilising a nucleic acid molecule comprising the sequence Xaa Xaa GGAT Xaa Xaa ( wherein Xaa is any other nucleotide) either in a natural promoter-reporter construct or one ligated to a minimal promoter and using this as a readout for agents which modulate Ets-1 activity in mast cells or eosinophils.

The present invention is further described by the following non-limiting examples. EXAMPLE 1 CELL LINES

The murine mast cell line FMP1.6 was isolated from the FMP1.1 clone which was generated in 1980 from a male DBA-2 mouse which was injected i.p. with cell-free supernatant from Friend virus producing erythroleukemia cells (Hasthoφe, 1980). Factor-dependent FMP1.6 cells were maintained in IMDM supplemented with 20% FCS, 20% PWM conditioned medium (PWCM) (Hasthoφe, 1980) plus lOOU/ml penicillin and lOOμg/ml streptomycin. Murine mast cell line FMP6- was derived as a spontaneous factor-independent variant from a culture of FMP1.6 cells which was observed to hypeφroliferate. FMP6- cells were cultured in IMDM supplemented with 10% FCS and antibiotics. Cell lines were cultured at 37° C in a humidified atmosphere with 5% CO₂. Mast cells and lines were activated by incubation with 20ng/ml PMA and lμ M ionomycin for 3 hours.

EXAMPLE 2

PRODUCTION OF BMMC

Primary bone marrow derived mast cell populations (BMMC) were prepared essentially as previously described by (Rottem et al, 1993) using bone marrow cells flushed from the femurs and tibias of 6- to 10-wk BALB/c mice. RPMI 1640 containing 4 mM L-glutamine, 5 x 10 ^"5 M β-mercaptoethanol, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 μg/ml streptomycin, and 0.1 mM nonessential amino acids was used to collect bone marrow cells. Cells were washed twice in this media and resuspended at 2 x 10⁵ cells/ml in RPMI media supplemented with 10% FCS and 5% X63 IL-3 -conditioned medium produced serum-free. The X63 cell line is a murine mammary tumour cell line expressing a transfected murine IL- 3 gene (Karasuyama and Melchers, 1988). The bone marrow cultures were incubated in a 5 % CO₂ incubator at 37 °C. Every 3 to 4 days the adherent cells were removed and the population of suspension cells was given one-half volume fresh medium. By 21 days, more than 95% of the cells were identified as mast cells, and this was confirmed by electron microscopy, staining with acidic toluidine blue and by FACS analysis using IgE and c-kit Abs. EXAMPLE 3 HISTOCHEMISTRY

Formalin fixed paraffin embedded sections of FMP6- and FMP1.6 cells were stained with alcian blue/safranin as described in (Bancroft and Cook 1984). After staining, sections were dehydrated before mounting in DPX.

EXAMPLE 4 ANTIBODY NEUTRALISATION EXPERIMENTS

Cells were seeded at 8xl0⁴cells/ml in 96 well round bottom microtitre plates and titrated in quadruplicate with neutralizing antibodies for GM-CSF or IL-3 (Genzyme) at a final concentration of 1 μg/ml. Monoclonal antibodies of the same isotype were used as a control. Each day for three days viable cells were stained using 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyl tetrazolium bromide (MTT) and absorbance read at 540nm (Loveland et al. , 1992).

EXAMPLE 5 REVERSE TRANSCRIPTASE-PCR

Total RNA was extracted using quanidinium isothiocyanate as described by (Chomczynski and Sacchi 1987). Reverse transcription was carried out by annealing 300ng of total RNA with 20pmoles of each of the 3' oligonucleotides below. To this was added lx RT buffer, 5mM MgCl₂ ImM each dNTP, 0.5U RNasin and 3U avian myeloblastosis virus (AMV) reverse transcriptase. After a 60 minute incubation at 42 °C samples were chilled on ice. Each 50μl PCR reaction contained lx Taq DNA polymerase buffer, 125μM dNTP's, 1.5mM MgCl₂, 50pmoles of each primer and 5U Taq DNA polymerase. PCR Primer sequences were:

IL-12: P35: 5' ACCAGCACATTGAAGACCTG (<400>1) and GACTGCATCAGCTCATCGAT (<400>2) IL-4: 5' AGGTCACAGGAGAAGGG (<400>3) and CAAGCATGGAGTTTTCC (<400>4) β actin: 5' GGGTCAGAAGGACTCCTATG ( <400> 5) and GTAACAATGCCATGTTCAAT ( <400> 6) MMCP-4: 5* TCTGTGAATGTAATTCCTCTGCC ( <400> 7) and TTTGCATCTCCGCGTCC ( <400> 8) 5 MMCP-6: 5' TATGTCCCTGAGCATTCCTGA ( <400> 9) and GGACTCAAGACGGAACT (<400> 10)

Primer sequences for IL-12, IL-4 and β-actin were taken from (Smith et al, 1994) and PCR conditions used were 40 cycles of 94°C for 30 seconds, 63 °C for 30 seconds and 72°C for

10 50 seconds using a Perkin-Elmer 9600 thermocycler. Primers for MMCP-4 spanned regions 353-375 and 638-654 of the mRNA sequence and PCR conditions were 35 cycles of 94°C for 10 seconds, 56 °C for 20 seconds and 72 °C for 20 seconds. Primer sequences for MMCP-6 were taken from (Piao and Bernstein 1996) and PCR conditions used were the same as for MMCP-4. RT-PCR was performed with appropriate controls.

15

EXAMPLE 6 RNASE PROTECTION ASSAY AND PROBES

RNase protections were performed as described elsewhere (Tymms, 1995). GM-CSF 20 mRNA was detected using 30 μg of total RNA from cycloheximide (10 μg/ml-treated cells. IL-3 mRNA was detected using 20 μg of total RNA from ionomycin (1 μM)-treated cells. Cycloheximide and ionomycin were required to stabilise otherwise unstable and rapidly degraded mRNA (Takeda et al, 1991; Iwai et al, 1993). Quantitation of signals in protected fragments was performed with a Fuji BAS1000 Phosphorimager (Berthold, Bundoora, 25 Australia). Pilot experiments established that the amounts of probe used were in sufficient excess to allow quantitative measurement of input RNA.

The murine Ets-1 probe was derived from the cDNA clone pABl (Watson et al , 1992), linearised using EcoRl and transcribed from the SP6 promoter to generate an antisense

30 transcript of 302bp. Digestion with ribonuclease yielded a specific 235bp protected fragment. A 379bp Pstl/EcoRV fragment from the 5' end of the GM-CSF gene from clone El-11 (Miyataki et al, 1985) was subcloned into pGEM5Zf+ and used as the template for the GM-CSF probe. Linearisation using Ddel and transcription from the T7 promoter generated a probe of 432bp and a 342bp protected fragment. A 588bp EcoRI fragment of murine IL-3 cloned into pGEMl was linearized using Bsu36I and transcription from the SP6 promoter generated a probe of 331bp and gave a 279bp protected fragment. Control protection experiments were performed using β₂ microglobulin. Linearisation using SnaBl and transcription from the T7 promoter yielded a 187bp full length probe and a 117bp protected fragment.

EXAMPLE 7

ELECTROPHORETIC MOBILITY SHIFT ASSAY

Recombinant ETS-1 protein was produced in E. coli using the pGEX expression system

(AMRAD, Melbourne, Australia) as previously described (Ascione et al, 1992). Oligonucleotides encoding Ets sites were labelled by the Klenow fill-in reaction using

[α³²P]dATP as described elsewhere (Thomas et al, 1995). Oligonucleotides for EMSA were:

GM2: 5' GATCAGGCCAGGAAGTCCAA3' ( <400 > 11) and 5'GATCTGGACTTCCTGGCCT3' ( <400> 12); GM4: 5'GATCAACTGTGGAATCTCCT3' ( <400 > 13) and 5 ^* GATCAGGAGATTCCACAGTT3 ' ( < 400 > 14) ;

GM5: 5'GATCCACAGAGGAAATGATT3' ( <400> 15) and 5'GATCAATCATTTCCTCTGTG3' ( <400> 16).

EXAMPLE 8

TRANSIENT TRANSFECTIONS OF FMP6- CELLS, LUCIFERASE ASSAYS AND

ANALYSIS

FMP6- cells (5xl0⁶) were electroporated in HEPES buffered RPMI 1640 at 390V, 960μF in a Gene Pulser unit (Biorad, California, USA) together with a maximum of 20μg of plasmid DNA. Cells were incubated in 15ml of growth medium for 24 hours and then lysed for 15 minutes in 300μl lx reporter lysis buffer (Promega, Wisconsin, USA). Luciferase activity was then determined on a 20μl aliquot of the supernatant in a Lumat LB 9501 Luminometer (Bertold, Germany) using luciferase reagent (Promega). The meaning of the various control replicates was normalised to one, and then each individual result was normalised relative to the mean. All statistical analysis was performed using Student's t test in the InStat statistical package ( andel Scientific).

EXAMPLE 9 PLASMID CONSTRUCTS FOR TRANSFECTION

pMGMl.6 luciferase contains 1.6kb of sequence upstream of the TIS site of the mouse GM- CSF promoter linked to the luciferase reporter gene. The murine GM-CSF promoter has been shown to be significantly more active than the 600bp human promoter which also requires an upstream enhancer for maximal activity, indicating l.όkp of murine sequence contains all the necessary regulatory elements (Osborne et α/., 1985). The construct pMGMl.6 luciferase-AGAA (containing an A for G substitution in the GGAA core of GM5) was created by replacing a BstEII fragment with a specific PCR product containing the mutation. Oligo A (GTCACCATTAATCATTTCTTCTAACTGGT ATATAAGAG ( < 400 > 17), spanning the BstEII site (bold) in the GM-CSF promoter and incoφorating the mutation (underlined), and oligo B (CTCTTATATACACAGTTAGAAGAAATGATAAT G ( < 400> 18), spanning the BstEII site (bold) within the luciferase gene, were used for PCR to generate a 760bp product. This product was digested with BstEII and used to replace the fragment removed from pMGMl.6 luciferase also digested with this enzyme by standard procedures. The integrity of pMGMl.6 luciferase-AGAA was confirmed by DNA sequencing. The Ets-1 and antisense Ets-1 expression constructs were generated by blunt- end cloning the Ets-1 cDNA into a blunt-ended Xbal site within the pEF-BOS vector (Mizushima and Nagata, 1990). EXAMPLE 10 PHENOTYPE CHARACTERISATION OF MAST CELL LINES

The mast cell line FMP6- is a spontaneous factor-independent clone that was derived from FMPl.6. To functionally characterise these lines, cytokine profiles were initially examined. RT-PCR analysis showed that IL-4, a cytokine characteristic of the MMC phenotype, was expressed by FMPl.6 cells (Fig. IA), and this cell line produced no detectable IL-12, which is expressed by mast cells with a CTMC phenotype. FMP6-, in contrast, produced IL-12, but no IL-4 (Fig. IA), indicating a CTMC-like phenotype.

Mast cell mediators histamine and heparin may be used both to characterise mast cells and to distinguish between MMC- and CTMC-like cells, since only only CTMC store heparin, while both subtypes produce histamine. FMP6- cells stained positive for histamine- containing granules using Alcian blue (Ab¹), and positive for heparin using safranin (S^1" ) (Figure IB). This was in contrast to the parental cell line FMPl .6 which stained with Alcian blue, but not with safranin (Ab⁺, S^"). This staining pattern further suggested that FMP6- has a different phenotype from FMPl.6, now exhibiting more CTMC-like features.

Serine protease production by mast cells also permits their classification into specific subtypes. RT-PCR was used to examine the serine protease profiles of FMP6-, FMPl.6, and primary cultures BMMC, FMP6-, like CTMC, expressed both MMCP-4 and (low levels of) MMCP-6 (Fig. IC). On the other hand, no expression of either MMCP-4 or MMCP-6 could be detected in FMP1.6 cells, while BMMC expressed only MMCP-6 (Fig. IC). The expression of MMCP-4 and MMCP-6 by FMP6-, together with IL-12 production and heparin storage, provides evidence for a CTMC-like classification for this cell line. EXAMPLE 11 AUTOCRINE GM-CSF AND IL-3 ARE NECESSARY FOR FACTOR- INDEPENDENT GROWTH OF FMP6-CELLS

Proliferation of growth factor-dependent FMPl.6 cells requires PWCM that contains cytokines including GM-CSF and IL-3 (Fig. 2A). This PWCM mixture also supports the growth of IL-3-dependent mast cell line 32Dcl23, which was employed as a positive control in these experiments (Fig. 2A) (Hasthorpe et α/., 1988). In contrast, factor-independent FMP6- cells do not require conditioned medium for their continued proliferation in culture (Figue 2A). To assess the possibility that FMP6- had become factor independent by autocrine production of growth factors, cell proliferation assays were conducted in the presence and absence of neutralizing mAbs to GM-CSF and IL-3. Neutralizing GM-CSF and IL-3 mAbs significantly reduced the rate of proliferation of the FMP6- cell line as compared with cells cultured in the presence of an IgG isotype control (Fig. 2B). These data demonstrate that GM-CSF and IL-3 at least are necessary for the factor-independent growth of FMP6- and suggest that these cytokines act in an autocrine or paracrine manner. This is further supported by the finding of significantly elevated levels of GM-CSF and IL-3 mRNA in FMP6- cells compared with FMPl.6 cells in Rnase protection assays (Fig. 2C).

EXAMPLE 12

CORRELATION OF GM-CSF AND Ets-1 EXPRESSION IN MAST CELLS

RNase protection analysis of RNA from FMPl.6 and FMP6- cells showed that CTMC-like FMP6- cells expressed significantly higher levels of Ets-1 mRNA than that found in FMPl.6 (Figure 3(a)). This correlates with the finding of higher levels of GM-CSF mRNA in FMP6- than FMPl.6 (Figure 2(c)). To further explore the relationship between Ets-1 and GM-CSF and specifically to investigate whether Ets-1 levels are modulated during mast cell activation, the levels of Ets-1 and GM-CSF mRNA were assayed in both FMP6- and BMMC activated with PMA and ionomycin, two agents which have previously been shown to mimic cellular activation in T cell and mast cell lines. PMA and ionomycin (PMA/I) treatment of FMP6- and BMMC for 3 hours resulted in a significant elevation of Ets-1 mRNA levels (Figure 3(b)). GM-CSF mRNA levels were also significantly elevated in both FMP6- and BMMC after activation with PMA/I for 3 hours (Figure 3(c)). Thus an increase in Ets-1 expression is associated with a concomitant increase in GM-CSF expression in primary BMMC cultures and in the FMP6- cell line during mast cell activation.

Ets-1 was not up-regulated in FMPl.6 cells upon PMA/I stimulation, and neither were cytokines such as GM-CSF and TNF-α. Indeed it appeared that FMPl.6 cells could not be activated by PMA/I, but required additional factors for Ets-1 and GM-CSF up-regulation and mast cell activation. The data provide further evidence of a correlation between Ets-1 and GM-CSF expression.

EXAMPLE 13 THE GM-CSF PROMOTER CONTAINS Ets-1 BINDING SITES

Previous studies in our laboratory have shown that the human GM-CSF promoter contains 5 putative Ets-1 binding sites, termed GM1-GM5 (Thomas et al, 1995). For relevance to this current study using the murine GM-CSF promoter, only three of the five identified Ets sites are also conserved in the murine promoter, sites GM2 (-295/-302), GM4 (-97/-104) and GM5 (-39/-46). Electrophoretic mobility shift assays (EMS A) were performed using oligonucleotides containing these three putative Ets-1 binding sites and recombinant human Ets-1 protein to determine which of these sites may be functionally important. An MSV- LTR oligonucleotide sequence, which had previously been shown to bind Ets-1 strongly, bound the recombinant Ets-1 protein (Figure 4, lane 1) and could be supershifted using an Ets-1 specific monoclonal antibody but not by an Ets-2 antibody (lanes 2 and 3). This Ets-1 complex was able to be competed off using an excess of unlabelled MSV-LTR oligonucleotide (lane 4) but not by an oligonucleotide containing a mutation in the MSV-LTR sequence (lane 5). EMS A involving direct binding using recombinant Ets-1 protein showed that sites GM2 and GM5 from the GM-CSF promoter bound Ets-1 strongly (lanes 6 and 10). These Ets-1 complexes were able to be competed off with an excess of unlabelled MSV-LTR oligonucleotide (lanes 7 and 11). In competition assays using labelled MSV oliognucleotides and an excess of unlabelled oligonucleotides to the putative Ets binding sequences, GM2 and GM5 effectively competed for binding, with GM5 being the most effective (lanes 12-14). As GM5 bound Ets-1 particularly strongly, this suggested it might be a functional Ets site.

EXAMPLE 14 Ets-1 TRANSACTIVATES GM-CSF IN FMP6-CELLS VIA THE GM5 SITE IN

CLEO

FMP6- cells were transiently transfected with pMGMl .6 luciferase, a murine GM-CSF luciferase reporter construct containing 1.6kp of promoter sequence, in the presence or absence of an Ets-1 expression construct. Ets-1 was able to significantly transactivate the GM-CSF reporter (Figure 5(a)) indicating that Ets-1 was sufficient on its own in this mast cell line to increase the level of GM-CSF. To examine if Ets-1 mediated this transactivation via GM5, a mutation was made in the purine-rich Ets core of GM5, from GGAA to AGAA, to generate the reporter construct pMGM 1.6 luc-AGAA. Transfection of this construct into FMP6- cells resulted in significantly lower levels of GM-CSF reporter activity demonstrating the importance of the GM5 site for basal GM-CSF activity (Figure 5(a)). In additon, pMGM 1.6 luc-AGAA was unable to be transactivated by the Ets-1 expression construct thereby demonstrating Ets-1 requires this site to mediate its effects (Figure 5(a)). Furthermore, in order to test whether Ets-1 plays a role in basal GM-CSF synthesis seen in FMP6- cells, we performed transient transfections using an antisense Ets-1 expression vector together with the pMGMl.6 luciferase reporter construct. Antisense Ets-1 was shown to significantly repress the activity of the GM-CSF reporter compared with the control of pEF- BOS vector without insert (Figure 5), suggesting that Ets-1 is playing a role in the constitutive GM-CSF expression observed in FMP6- cells.

EXAMPLE 15 Ets-1 BINDING TO IL-5 PROMOTER

Ets-1 binds a sequence (a so-called cis-binding element) in the promoter/5' regulatory region of the IL-5 gene as determined by electrophoretic mobility shift assays (EMS A).

Furthermore, Ets-1 can increase the expression of a CAT reporter gene ligated to the IL-5 promoter, thus demonstrating that Ets-1 can increase the transcription of the IL-5 gene in a T-cell line such as Jurkatt cells and this presumably also in eosinophils. Ets-1 can also synergise in the increased transcription of IL-5 with other transcription factors such as API (as manifest in cotransfection experiments with Fos, Jun and an IL-5-CAT reporter construct). Additional evidence for Ets-1 functioning on the IL-5 promoter has been demonstrated by mutation of the Ets-1 binding site in the IL-5 promoter resulting in reduced transcription for IL-5 and reduced ability of other transcription factors such as API and GATA to activate transcription of IL-5.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more said steps or features.

BIBLIOGRAPHY

Abbas A.K., Lichtman A.H., and Pober J.S., Cellular and Molecular Immunology (1991)

Ascione R., Thompson D.M., Thomas R.S., Panayiotakis A., Ramsay R.G. , Tymms M.J. and Seth A., Int. J. Oncol ι:631-637 (1992)

Bancroft and Cook (1984) Manual of Histological Techniques (Churchill Livingston, USA)

Burd P.R., Rogers H.W., Gordon J.R., Martin C.A., Jayaraman S. , Wilson S.D., Dvorak A.S. , Galli S.J., and Dorf M.E., J. Exp. Med. 170:245-251 (1989)

Chomczynski P., and Sacchi N., Analytical Biochemistry 162: 156-159 (1987)

Galli S.J., Laboratory Investigation 62:5-33 (1990)

Galli S.J., Gordon J.R., and Wershil B.K., Current. Opinion, in Immunology 3:865-873 (1991)

Gurish M.F., Nadeau J.H., Johnson K.R., McNeil H.P., Grattan K.M., Austen F.K.F., and Stevens R.L., J. Biol. Chem. 265:11372-11379 (1993)

Gurish et al, J. Biol. Chem. 265:11372-11379 (1993)

Hasthoφe S., Journal, of. Cellular. Physiology. 705:379-384 (1980)

Hasthoφe S., Journal, of. Cellular. Physiology 705:379-384 (1988)

Huntley J.F., J. Comp. Path. 707:349-372 (1992) Iwai Y., Akahane, K., Pluznik D.H., and Cohen R.B., J. Immunol 750:4386 (1993)

Karasuyama H., and Melchers F., Eur. J. Immunol. 75:97-104 (1988)

Lantz C.S. and Huff T.F., J. Immunol 754:355-362 (1995)

Lee F., Yokota T., Otsuka T., Meyerson P., Villaret D., Coffman R., Mosmann T. , Rennick D., Roehm N., Smith C, Zlotnik A., and Arai Ki., Proc. Natl Acad. Sci. USA 53:2061-2065 (1986)

Loveland B.E., Johns T.G., Mackay I.R., Valliant F., Wang Z.X., and Hertzog P.J., Bichemistry International 27:501-510 (1992)

Meade R., Neddermann K.M., Greenfield R.S., Braslawsky G., and Bursuker I., Journal of. Leukocyte Biology 54:523-521 (1993)

Meininger C.J., and Zetter B.R., Seminars in Cancer Biology 3:73-79 (1992)

Miyataki S., Otsuka T., Yokoda T., and Arai K., The. EMBO Journal 4:2561-2568 (1985)

Mizushima S., and Nagata S., Nucleic. Acids. Research 75:5322 (1990)

Osborne et al, J. Immunol 755:226-235 (1995)

Piao X. , and Bernstein A., Blood 57:3117-3123 (1996)

Plaut M., Pierce J.H., Watson C.J., Hanley-Hyde J., Nordan R.P., and Paul W.E., Nature 339:64-67 (1989)

Rodewald H.R., Dessing M., Dvorak A.M. and Galli S.J., Science 277:818-821 (1996) Rottem M., Goff J.P., Albert J.P., and Metcalfe D.D., Eur. J. Immunol 24:822-826 (1993)

Smith T.J., Ducharme L.A. and Weis J.H., Ear. J. Immunol 24:822-826 (1994)

Swieter M., Mergenhagen S.Ε., and Siraganian R.P., Proc. Soc. Exp. Biol. Med. 799:22-33 (1992)

Takagi M. , Nakahata T., Kubo T. , Shiohara M., Koike K. , Miyajima A. , Arai K., Nishikawa S., Zsebo K.M., and Komiyama A., J. Immunol 745:3446-3453 (1992)

Takeda, K. , Hatakeyama K., Tsuchiya Y., Riklishi H. , and Kumagai K., Int. J. Cancer 47:413 (1991)

Thomas R.S., Tymms M., Seth A., Shannon M.F. , and Kola I., Oncogene 77:2135-2143 (1995)

Tsai M., Shih L., Newlands G.F.J., Takeishi T., Langley K.E., Zsebo M., Miller H.R.P., Geissler E.N., and Galli S.J., /. Exp. Med. 774: 125-131 (1991)

Tymms M.J., Humans Press, Clifton, NJ., p. 31 (1995)

Valent et al, J. Immunol 745:3432-3437 (1990)

Watson, D.K. et al. PNAS 85: 7862-7866 (1988)

Watson D.K., Smyth F.E., Thompson D.M., Cheng J.Q., Testa J.R., Papas T.S., and Seth A., Cell Growth and Differentiation 3:705-713 (1992)

Wernert et al, American J. Path 740:119-127 (1992) Wodnar-Filipowicz A., Heusser C.H., and Moroni C, Nature 339:150-152 (1989)

Zonetal, J. Biol. Chem.266:22948-22953 (1991)

Claims

CLAIMS:

1. A method of modulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof.

2. A method according to claim 1 wherein said haemopoietic cell is a mast cell.

3. A method according to claim 2 wherein said mast cell functional activity is GM-CSF or TNF╬▒ expression.

4. A method according to claim 2 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for mast cell activation and/or inflammation.

5. A method according to claim 1 wherein said haemopoietic cell is an eosinophil.

6. A method according to claim 5 wherein said eosinophil functional activity is IL-5 expression.

7. A method according to claim 5 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for eosinophil pathogenicity.

8. A method according to any one of claims 2 to 7 wherein said modulation is down- regulation.

9. A method according to claim 8 wherein said agent is an Ets-1 antisense molecule.

10. A method of modulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functional activity of Ets-1 or ftinctional equivalent or derivative thereof.

11. A method according to claim 10 wherein said haemopoietic cell is a mast cell.

12. A method according to claim 11 wherein said mast cell functional activity is GM- CSF or TNF╬▒ expression.

13. A method according to claim 11 wherein said ftinctional activity is the expression of a gene regulated by Ets-1 which gene is required for mast cell activation and/or inflammation.

14. A method according to claim 10 wherein said haemopoietic is an eosinophil.

15. A method according to claim 14 wherein said eosinophil functional activity is IL-5 expression.

16. A method according to claim 14 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for eosinophil pathogenicity.

17. A method according to any one of claims 11 to 16 wherein said modulation is down- regulation.

18. A method of up-regulating haemopoietic cell functional activity in a mammal said method comprising administering to said mammal an effective amount of Ets-1 or a functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or a functional equivalent or derivative thereof for a time and under conditions sufficient to up-regulate functional activity of said haemopoietic cell.

19. A method according to claim 18 wherein said haemopoietic cell is a mast cell.

20. A method according to claim 19 wherein said mast cell functional activity is GM- CSF or TNF╬▒ expression.

21. A method according to claim 19 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for mast cell activation and/or inflammation.

22. A method according to claim 18 wherein said haemopoietic cell is an eosinophil.

23. A method according to claim 22 wherein said eosinophil functional activity is IL-5 expression.

24. A method according to claim 22 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for eosinophil pathogenicity.

25. A method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate ftinctional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of a nucleotide sequence encoding Ets-1 or a functional equivalent or derivative thereof wherein said modulation results in modulation of said haemopoietic cell activity.

26. A method according to claim 25 wherein said condition is an inflammatory condition, a condition modulated by inflammation or angiogenesis.

27. A method according to claim 26 wherein said condition modulated by inflammation is asthma, rheumatoid arthritis, Alzheimer's disease or atherosclerosis.

28. A method according to claim 25 to 27 wherein said haemopoietic cell is a mast cell.

29. A method according to claim 28 wherein said mast cell functional activity is GM- CSF or TNF╬▒ expression.

30. A method according to claim 28 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for mast cell activation and/or inflammation.

31. A method according to claim 25 to 27 wherein said haemopoietic cell is an eosinophil.

32. A method according to claim 31 wherein said eosinophil functional activity is IL-5 expression.

33. A method according to claim 31 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for eosinophil pathogenicity.

34. A method according to any one of claims 26 to 33 wherein said modulation is down- regulation.

35. A method according to claim 34 wherein said agent is an Ets-1 antisense molecule.

36. A method according to claim 25 wherein said condition is wound repair.

37. A method according to claim 36 wherein said modulation is up-regulation.

38. A method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate functional activity of Ets-1 or a functional equivalent or derivative thereof wherein said modulation results in modulation of said haemopoietic cell activity.

39. A method according to claim 38 wherein said condition is an inflammatory condition, a condition modulated by inflammation or angiogenesis.

40. A method according to claim 39 wherein said condition modulated by inflammation is asthma, rheumatoid arthritis, Alzheimer's disease or atherosclerosis.

41. A method according to claim 38 to 40 wherein said haemopoietic cell is a mast cell.

42. A method according to claim 41 wherein said mast cell functional activity is GM- CSF or TNF╬▒ expression.

43. A method according to claim 41 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for mast cell activation and/or inflammation.

44. A method according to claim 38 to 40 wherein said haemopoietic cell is an eosinophil.

45. A method according to claim 44 wherein said eosinophil functional activity is IL-5 production.

46. A method according to claim 44 wherein said functional activity is the expression of a gene regulated by Ets-1 which gene is required for eosinophil pathogenicity.

47. A method according to any one of claims 39 to 46 wherein said modulation is down- regulation.

48. A method according to claim 38 wherein said condition is wound repair.

49. A method according to claim 48 wherein said modulation is up-regulation.

50. A method for the treatment and/or prophylaxis of a condition characterised by the aberrant, unwanted or otherwise inappropriate functional activity of a haemopoietic cell in a mammal said method comprising administering to said mammal an effective amount of Ets-1 or a functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or a functional equivalent or derivative thereof for a time and under conditions sufficient to up-regulate said haemopoietic cell activity.

51. A method according to claim 50 wherein said condition is wound repair.

52. The use of an agent capable of modulating the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal.

53. The use of an agent capable of modulating the functional activity of Ets-1 or functional equivalent or derivative thereof in the manufacture of a medicament for the modulation of haemopoietic cell activity.

54. The use of Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or functional equivalent or derivative thereof in the manufacture of a medicament for the modulation of haemopoietic cell activity in a mammal.

55. Agent for use in modulating the expression of a nucleotide sequence encoding Ets-1 or functional equivalent or derivative thereof wherein modulating expression of said nucleotide sequence modulates haemopoietic cell activity.

56. Agent for use in modulating Ets-1 functional activity wherein modulating Ets-1 functional activity modulates haemopoietic cell activity.

57. Ets-1 or functional equivalent, derivative, homologue, analogue or mimetic thereof or a nucleic acid molecule encoding Ets-1 or a derivative or analogue of said nucleic acid molecule for use in modulating haemopoietic cell activity.

58. A pharmaceutical composition comprising a modulatory agent and one or more pharmaceutically acceptable carriers and/or diluents.

59. A method for detecting an agent capable of modulating the function or Ets-1 or its functional equivalent or derivative thereof said method comprising contacting a cell or extract thereof containing said Ets-1 or its functional equivalent or derivative with a putative agent and detecting an altered expression phenotype associated with said Ets-1 or its functional equivalent or derivative.

60. A method for detecting an agent capable of binding or otherwise associating with the Ets-1 binding site said method comprising contacting a cell containing said Ets-1 binding site or functional equivalent or derivative thereof with a putative agent and detecting an altered expression phenotype associated with modulation of the function of Ets-1 or its functional equivalent or derivative.