WO2000040756A1 - Novel coactivator overexpressed in endocrine tumors - Google Patents

Abstract

This invention provides screening and treatment methods for endocrine tumors based on abnormally elevated hormone coactivator levels. In addition, the invention provides a vector delivery system for the introduction of proteins and nucleotide sequences into cells for the purpose of altering the expression or effectiveness of hormone coactivators. The invention also provides methods for the evaluation of agents as possible endocrine tumor growth regulators. Also, methods are provided for evaluating the tumor promoting capacity of environmental agents. Furthermore, methods are provided for the prenatal or postnatal detection of Angelman syndrome. These methods comprise the measurement of ubiquitin-ligase activity in a tissue sample. The invention also provides methods for the detection of coactivator, E6-AP in mammary gland biopsy samples using a ubiquitin-ligase assay.

Description

NOVEL COACTIVATOR OVEREXPRESSED IN ENDOCRINE TUMORS

This application claims the benefit of U.S. Provisional Application Serial No. 60/115,025, filed January 7, 1999.

The work herein was supported, in part, by grants from the United States

Government. The United States Government may have certain rights in the

invention.

FIELD OF THE INVENTION

This invention relates to the fields of biotechnology and medicine and

provides methods for treatment of endocrine tumors comprising interfering with a

hormone coactivator pathway. It further relates to a method for screening tissues for

endocrine tumors comprising assaying for a novel nuclear hormone receptor

coactivator. It further relates to a method for the evaluation of possible anti-tumor

agents comprising assaying treated cells for nuclear hormone coactivators. It further

relates to a method for the evaluation of tumorogenicity of environmental agents

comprising assaying exposed cells for nuclear hormone coactivators. It further

relates to a method for the prenatal or postnatal detection of Angelman syndrome

comprising a ubiquitin-ligase activity assay. It further relates to a method for the

detection of Angelman syndrome comprising a ubiquitin-ligase assay. It additionally

relates to a methods of tumor detection and monitoring comprising use of a ubiquitin-

ligase assay. BACKGROUND OF THE INVENTION

Steroids, thyroid hormones, vitamin D and retinoids regulate diverse

biological processes including growth, development, and homeostasis through their

cognate nuclear hormone receptors which make up a superfamily of structurally

related intracellular ligand-activated transcription factors. Horwitz et al. (1996),

Mol. Endocrinol. 10: 1167-1177; Perlmann et al. (1997), Cell 90: 391-397; Shibata

et al. (1997), Recent. Prog. Hormone Res. 52: 141-165; Tsai et al. (1994), Ann. Rev.

Biochem.63: 451-486. Nuclear hormone receptors contain common structural motifs

which include a less well conserved amino-terminal activation function (AF-1) that

affects transcription efficiency, a central DNA-binding domain, which mediates

receptor binding to specific DNA enhancer sequences and determines target gene

specificity, and a carboxy-terminal hormone-binding domain (HBD). The HBD

contains activation function-2 (AF-2), a region which mediates the hormone-

dependent activation function of receptors. Shibata et al. (1997), Recent. Prog.

Hormone Res. 52: 141-165. When bound to hormone, these receptors undergo a

conformational change, dissociation from heat shock proteins, receptor dimerization,

phosphorylation, DNA-binding at an enhancer element of the target gene, interaction

with coactivators and subsequent recruitment of basal transcription factors to form

a stable preinitiation complex. These events are followed by either up-regulation or

down-regulation of target gene transcription. Shibata et al. (1997), Recent. Prog.

Hormone Res. 52: 141-165. Nuclear hormone receptor coactivators represent a growing class of proteins

which interact with receptors in a ligand-specific manner and serve to enhance their

transcriptional activity. Onate et al. (1995), Science 270: 1354-1357. Prior to their

identification, coactivators were predicted to exist based upon experiments which

showed that different receptors compete for a limiting pool of factors required for

optimal transcription. Stimulation of one receptor resulted in transrepression of

another receptor, indicating the depletion of a common coactivator pool. Bocquel et

al. (1989), Nuc. Acids Res. 17: 2581-2594; Conneely et al. (1989), In A. K. Roy and

J. Clark (ed.), Gene regulation by steroid hormones IV, p. 220-223, Spring-Verlag

Press, New York; Meyer et al. (1989), Cell 57: 433-442; Shemshedini et al. (1992),

J. Biol. Chem. 261 : 1834-1839. A number of coactivators have been cloned to date,

including steroid receptor coactivator- 1 (SRC-1) Onate et al. (1995), Science 270:

1354-1357; TIF2 (GRIP1) Hong et al. (1996), Proc. Natl Acad. Sci. USA. 93:

4948-4952; Voegel et al. (1996), EMBO J. 15: 3667-3675; p/CIP

(ACTR/RAC3/AIB1/TRAM-1) Anzick et al. (1997), Science 277: 965-968; Chen

et al. (1997), Cell 90: 569-580; Li et al. (1997), Proc. Natl. Acad. USA. 94: 8479-

8484; Torchia et al. (1997), Nature 387: 677-684; Tukeshita et al. (1997), J. Biol.

Chem. 272: 27629-27634; and ARA70 Yeh et al. (1996), Proc. Natl. Acad. Sci. USA.

93: 5517-5521. Coactivators were originally envisioned to serve a bridging role,

linking the receptor to the basal transcription machinery. Pugh et al. (1992), J. Biol.

Chem. 267: 679-682; Tjian et al. (1994), Cell 11: 5-8. Recently, the functional role

of coactivators has expanded by the observation that they have been shown to possess enzymatic activities which contribute to their ability to enhance receptor

mediated transcription; SRC-1, p300/CBP, and RAC3/ACTR/AIB 1 possess histone^'

acetyl transferase activity (HAT). Anzick et al. (1997), Science 277: 965-968; Chen

et al. (1997), Cell 90: 569-580; Li et al. (1997), Proc. Natl. Acad. USA. 94: 8479-

8484; Ogryzko et al. (1996), Cell 87: 953-959; Spencer et al. (1997), Nature 389:

194-198. Ligand-activated receptors are thought to bring these HAT activity

containing coactivators to the chromatin surrounding the receptor, disrupting the local

repressive chromatin structure by acetylating histones and possibly other chromatin

associated factors. Spencer et al. (1997), Nature 389: 194-198.

Due to their ability to enhance receptor mediated gene expression,

coactivators are thought to play an important role in regulating the magnitude of the

biological response to steroids, vitamin D, and retinoids in different tissues or from

individual to individual. The level of coactivator expression may contribute to

variations in hormone responsiveness seen in the population and disruption in

coactivator expression could lead to the pathologically hyper- or hypo-sensitivity to

steroid hormones. Recently, it has been shown that disruption of the SRC-1 locus in

mice resulted in an attenuated response to steroid hormones, a finding consistent

with this hypothesis. Xu et al. (1998), Science 279:1922-1924.

Steroid hormones, estrogen and progesterone, play major roles in the

development of the normal mammary gland and in breast tumor development. These

molecules mediate their signaling through intracellular receptors called estrogen

receptors (ER) and progesterone receptors (PR). ER and PR are members of a structurally related ligand-activated transcription factor superfamily. Upon ligand

binding, these factors undergo a conformational change, dissociate from heat shock

proteins and recruit a diverse group of coactivator proteins, including that of E6-

associated protein, E6-AP. The coactivator protein, E6-AP, enhances the hormone-

dependent transcriptional activity of ER, PR, and other members of the steroid

receptor superfamily. Considering the influence of E6-AP as a coactivator on

transactivation of target genes by ER, PR, and other members of the superfamily, the

expression pattern of coactivator E6-AP in mouse mammary tumors was examined.

The data indicates that coactivator E6-AP is overexpressed in 90-95% of breast

tumors in mouse tumor models, which indicates a role for E6-AP in tumor formation.

Many breast tumors require estrogens for tumor growth. Thus, treatment with anti-

estrogen compounds can slow or prevent tumor spread. Many anti-estrogens,

however, show both estrogen antagonistic and agonistic activity. The non-steroidal

anti-estrogen tamoxifen, for example, which is established as the treatment of choice

for the endocrine therapy of advanced breast cancer, shows both agonistic and

antagonistic activity. Sutherland, S.& Jackson, M. Cancer Treat. Revs. 15:183-194

(1987).

The prior art fails to provide a completely satisfactory treatment for endocrine

tumors. The agonistic activity of tamoxifen and other anti-estrogens can have

profound negative effects upon patients. Tamoxifen for example sometimes

increases endometrial tumor incidence, e.g. , lino, et al. Cancer Treat. & Res. 53 :228-

237 (1991), or switches from inhibition to stimulation of estrogen dependent growth in breast tumor progression. Parker, M.G. (Ed) Cancer Surveys 14: Growth

Regulation by Nuclear Hormone Receptors. Cold Spring Harbor Laboratory Press^"

(1992). Therefore, a need for more selective treatment methods still exists.

The E6-associated protein (E6-AP) (Huibregtse et al. (1993) Mol. Cell. Biol.

13: 775-784.), a protein linked to Angelman syndrome (AS) (Kishino et al. (1993),

Nature Genet. 15: 70-73; Matsuura et al. (1997), Nature Genet. 15: 74-77; Sutcliff

et al. (1997), Genome Res. 1: 368-377) is a progesterone receptor (PR) interacting

protein which has been cloned and characterized. E6-AP was previously identified

as a protein of 100 kDa, present both in the cytoplasm and the nucleus (Hatakeyama

et al. (1997), J. Biol Chem. 272: 15085-15092.). E6-AP mediates the interaction of

human papillomaviruses type 16 and 18 E6 proteins with p53, a growth-suppressive

and tumor-suppressive protein. Hatakeyama etal. (1997), J. Biol Chem. 212: 15085-

15092; Huibregtse et al. (1993), Mol. Cell. Bio. 13: 4918-4927. Initial in vitro

studies suggested that the E6/E6-AP complex specifically interacts with p53 and

promotes the degradation of p53 via the ubiquitin-proteasome degradation pathway

but recent in vivo studies show that E6-AP can directly interact with p53 and promote

its degradation even in the absence of the papillomavirus E6 protein. Daniel et al.

(1998), J. Gen. Virol. 79: 489-499; Huibregtse et al. (1991), EMBO J. 10: 4129-

4135; Scheff er et al. (1993), Cell 75: 495-505. E6-AP is a member of a family of

proteins known as E3 ubiquitin-protein ligases which have been proposed to play a

role in defining the substrate specificity of the ubiquitin-proteasome degradation

system. Protein ubiquitination also involves two other classes of enzymes, namely El ubiquitin-activating enzymes and E2 ubiquitin-conjugating enzymes which

activate ubiquitin moities and transfer them to target proteins or E3's respectively.

Huibregtse et al. (1995), Proc. Natl. Acad. Sci. USA. 92: 2563-2567. The carboxyl-

terminal 350 aa of E6-AP constitutes a 'hecf (homologous to the E6-AP carboxy

terminus) domain which is conserved among many E3 ubiquitin protein-ligases and

E6-AP related proteins. Huibregtse et al. (1995), Proc. Natl. Acad. Sci. USA. 92:

2563-2567. The extreme carboxyl-terminal 100 aa contains the catalytic region of E6-

AP which transfers ubiquitin to the protein targeted for degradation. Huibregtse et

al. (1995), Proc. Natl. Acad. Sci. USA. 92: 2563-2567. The E6-binding domain

consists of an 18 aa region located within the central portion of the E6-AP protein

Huibregtse et al. (1993), Mol. Cell. Bio. 13: 4918-4927.

Recently, it has been shown that a genetic disorder, Angelman syndrome

(AS), is caused by the absence of a functional maternal copy of the E6-AP gene.

Kishino etal. (1993),Nαtwre Genet. 15: 70-73; Matsuura et al. (1991), Nature Genet.

15: 74-77; Sutcliff et al. (1997), Genome Res. 1: 368-377. AS is a neurological

disorder characterized by severe mental retardation, seizures, speech impairment, and

other symptoms. Beuten et al. (1996), Human Genet. 97: 294-298. Due to paternal

gene imprinting in the brain, only the defective maternally derived gene is expressed.

However, outside the brain, both the paternal and the maternal gene is expressed.

Thus, expression of the single functional paternal copy allows for partial

compensation throughout the rest of the body. While the exact mechanism by which the defective E6-AP gene causes AS

remains unknown, analysis of mutant E6-AP proteins from AS patients revealed that

the ubiquitin-protein ligase function of E6-AP was defective. The coactivator

function, however, was intact in the majority of the examined AS patients, but in the

same patients, both coactivation and ubiquitin-ligase functions are defective. It was

also demonstrated that the ubiquitin-ligase activity of E6-AP was not required for the

coactivation function of E6-AP. The data further indicated that the catalytic function

located within the hect domain of E6-AP was not necessary for the ability of E6-AP

to interact with and coactivate steroid hormone receptor function. These findings

indicate that E6-AP possesses two independent functions, as both a coactivator and

a ubiquitin-protein ligase.

Since patients with AS express either zero (brain) or one (rest of body)

functional E6-AP gene, tissues derived from these patients, except for brain samples,

possess lower ubiquitin-ligase activity compared to tissues expressing two functional

gene copies. On rare occasion, an AS patient will express zero functional E6-AP

genes peripherally. While brain tissue samples posses the greatest reduction in

ubiquitin-ligase activity, non-brain tissues posses sufficiently reduced activity such

that a lowered activity can be reliably detected compared to tissues possessing two

functional gene copies. Thus, a blood or other easily accessed tissue sample provides

adequate protein for assay.

Current methods for screening patients for AS involve screening DNA for

gross deletions or deletions of the E6-AP gene. For instance, gross deletions can be detected with some reliability by fluorescence in situ hybridization (FISH) and

restriction fragment length polymorphism (RFLP). Robson et al. (1995), Hum.

Genet., 96:345-349). RFLP can also be useful in detection of more limited deletions,

such as of the E6- AP gene. Smaller deletions within the E6-AP gene can be detected

using polymerase chain reaction (PCR) techniques to amplify DNA fragments of a

predicted size. Saitoh, S. (1993), No To Hattatsu, 25:501-507.

However, there are problems inherent to the above methods for AS detection.

While gross deletions or gene deletions detected by techniques such as FISH and

RFLP are generally predictive of the AS phenotype, they are capable of producing

false negative results (for example, see Robson et al. (1995), Hum. Genet., 96:345-

349). For instance, FISH and RFLP may be unable to detect smaller partial deletions

of critical regions of the E6-AP gene. However, while PCR techniques should

indicate most smaller DNA deletions or insertions undetected by FISH and RFLP,

even the PCR techniques cannot not readily detect point mutations within the gene.

A single point mutation can substantially alter E6-AP function without changing the

size of a predicted DNA product. As an example, changing a single cysteine residue

at position 833 to alanine or serine eliminates ubiquitin-ligase activity. Huibregtse

et al. (1995), Proc. Natl. Acad. Sci. USA. 92: 2563-2567. Methods which rely on an

altered gene size, such as FISH, RFLP, and PCR, would be unable to detect such a

change. In addition to the shortcomings in the prior art to predict AS when small

gene deletions or point mutations is the cause (false negatives), the prior art is also

susceptible to false positive results. For instance, a small deletion may be indicated by a PCR method which does not result in deficient E6-AP function. Such a false

positive diagnosis would be equally devastating as a false negative diagnosis. Given

that some parents might choose to terminate a pregnancy based on the findings of a

prenatal screening (See e.g., Toth-Fejel et al. (1995), Am. J. Med. Genet., 55:444-

452), it is crucial that the results be as accurate as possible. One significant

advantage of the ubiquitin-ligase activity assay is that the actual function of the E6-

AP protein is evaluated, thus adding certainty to the diagnosis. The ubiquitin-ligase

activity alone or in conjunction with existing DNA screening techniques would thus

be a significant improvement over the prior art.

BRIEF SUMMARY OF THE INVENTION

This invention provides a method of treating or detecting endocrine tumors

comprising interfering with a hormone coactivator pathway (anti-coactivator

method). The goal of this treatment is to reduce the hormone coactivating activity

of nuclear coactivator proteins comprising (a) reducing the concentration of said

protein in tumor cells, or (b) neutralizing said protein in tumor cells, or (c)

neutralizing the target protein(s) of said coactivator protein in tumor cells, or (d) any

combination of the above. It is to be understood that the invention is not to be limited

by the above examples. Methods for (a) above include, but are not limited to.

introducing oligonucleotides complementary to a region of selected coactivator

mRNA or introducing a chemical substance which reduces expression or stability of

selected coactivator mRNA or protein, or reducing the effective level of coactivator protein by neutralization with antibodies (see below). Methods for (b) and (c) above

include, but are not limited to, introducing a protein into the tumor cell which binds

or neutralizes a coactivator protein or a target protein for a coactivator protein. It is

preferred that such a neutralizing protein will possess a transcription-incompetent

fragment of a hormone receptor which binds the coactivator protein ('false substrate')

or a mutant of the coactivator which binds to the hormone receptor but which is

incapable of increasing transcription of the hormone receptor ('dominant negative').

It is expected that the anti-coactivator treatment method will be used in conjunction

with other endocrine tumor treatments, including but not limited to antihormones.

In doing so, it is expected that the combined treatment process will act synergistically

thereby increasing the effectiveness of the treatment and possibly reducing the dose

of one or both anti -tumor agents required.

This invention further provides a method for screening tissues for endocrine

tumors comprising assaying for a nuclear hormone coactivator mRNA or protein. In

this method, samples from tissue biopsies are screened to determine if a tumor exists

which is characterized as having high coactivator protein levels. In greater than 90%

of mouse mammary tumors evaluated, the coactivator E6-AP was found to be

overexpressed. Thus, this assay serves at least two functions. First, the assay serves

as a screening tool for a group of endocrine tumors. Second, the assay provides

information regarding the level of coactivators in the tissue. It follows that higher

than normal coactivator levels in a tissue sample indicates a tumor growth which is

a candidate for anti-coactivator treatment. In other instances, tumor growth may be indicated by other means but not by the above assay. In such an instance, the results

may suggest that an anti-coactivator treatment may not be effective, thus sparing a

patient from enduring an ineffective treatment.

This invention further provides a method for the evaluation of possible anti-

tumor agents comprising assaying treated cells for nuclear hormone coactivators. It

is an object of the present invention to provide a means of evaluating a large number

of agents for the ability to reduce the concentration, or reduce the coactivation

functions, of coactivators. In this method, cultured tumor cells are used to screen a

large number of possible anti-tumor agents for the ability to decrease coactivator

mRNA, protein concentration, or the coactivation function. Agents which

demonstrate the ability to reduce coactivator concentration, or the coactivation

function, can then be tested in vivo for the ability to inhibit tumor growth. In another

embodiment of this method, the tumor suppressor gene product p53 is assayed for,

in addition to the specific coactivator. Certain coactivators (such as E6-AP) have

been shown to directly promote degradation of p53. Thus, in the latter instance, a

promising anti-tumor agent will result in lowered levels of the coactivator and

increased levels of tumor suppressor protein, p53.

This invention further provides a method for the evaluation of endocrine

tumorogenicity for possible tumor promoting agents comprising assaying treated cells

for nuclear hormone coactivators. It is an object of the present invention to provide

a means for the evaluation of a large number of agents for the propensity to promote

endocrine tumors. In this method, cultured cells expressing normal levels of coactivator mRNA or protein are exposed to an agent suspected as a promoter of

endocrine tumors. Presumed tumor promoting agents will increase coactivator

mRNA or protein concentration. In another embodiment of this method, tumor

suppressor gene product p53 concentration is also measured. In the latter instance,

presumed tumor promoting agents will increase coactivator mRNA or protein

concentrations and decrease p53 mRNA or protein concentrations.

This invention further provides a method for the prenatal or postnatal

detection of Angelman syndrome (AS) by assaying a tissue or blood sample for

ubiquitin-ligase activity. Small amounts of tissue, such as could be derived from

amniocentesis or a blood drawing, are sufficient for the determination of ubiquitin-

ligase activity. A decreased ubiquitin-ligase activity correlates with development of

the AS phenotype. A significant advantage of this method over prior art methods is

that the protein function is actually measured rather than predicted based on DNA

alterations.

This invention further provides a method for the detection of AS comprising

an assay for ubiquitin-ligase activity from a tissue or blood sample. Such an assay

is capable of detecting reduced or lowered ubiquitin-ligase activity from a tissue

lacking expression of one or both functional E6-AP genes. The invention also

provides a method for assaying for the presence of tumors by comparing the

ubiquitin-ligase activity of a tissue or blood sample to a non-tumor control, where a

decrease in the ubiquitin-ligase activity indicates that the tumor is cancerous. The

method is particularly useful in detecting breast tumors when the tissue sample is obtained from a mammary gland biopsy. This invention further provides a method

of monitoring the progression or regression of a cancerous tumor comprising

comparing the ubiquitin-ligase activity of tissue or blood samples to a non-tumor

control and previously tested samples, wherein a change in the ubiquitin-ligase

activity over time compared to the control and the previously tested samples is

indicative of progression or regression of said tumor. One version of this latter

method can be used to monitor thr progression or regression of a breast tumor when

the tissue sample is obtained from a mammary gland biopsy.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1A shows interaction of PR with wild-type E6-AP in a yeast two-

hybrid assay as indicated by β-Gal activity.

Figure IB shows a Western blot analysis of E6-AP bound PR.

Figure 2 A shows a schematic representation of E6-AP showing the position

of the catalytic region (solid box), hect domain, transactivation domain, and PR-

binding domains.

Figure 2B shows localization of the PR interaction site in E6-AP using the

mammalian two-hybrid assay.

Figure 3 A shows E6-AP coactivating the transcriptional activity of PR-B.

Figure 3B shows that E6-AP coactivates the hormone-dependent

transcriptional activity of nuclear hormone receptors. Figure 3C shows the effect of E6-AP expression on the transcriptional activity

of diverse transcription factors.

Figure 4A shows E6-AP, but not a C-terminal mutant lacking the activation

domain reverses the transcriptional squelching between PR and ER.

Figure 4B shows that the C-terminal fragment of E6-AP (aa 680-851) was

unable to reverse the transcriptional interference between PR and ER.

Figure 5 shows transcriptional activity of the GAL4-E6-AP fusion protein.

Figure 6 shows E6-AP levels in mouse mammary tumors.

Figure 7 shows E6-AP protein levels in mouse mammary glands.

DETAILED DESCRIPTION OF THE INVENTION

This invention provides a method for treating endocrine tumors comprising

interfering with the function of certain hormone coactivators ('anti-coactivator'

treatment). This invention further provides a method for screening tissues for

endocrine tumors based on increased hormone coactivator levels. This method is also

useful as a means of identifying tumors which might be responsive to anti-coactivator

treatment. Additionally, this invention provides a method for the identification of

agents which affect the concentration of coactivators. The above mentioned methods

can be applied to multiple endocrine tumors including, but not limited to mammary,

prostate, and endometrial tumors. In another embodiment of this invention, a

screening method is provided for the evaluation of endocrine tumorogenicity for

suspected tumor promoting agents. In yet another embodiment of this invention, a method is provided for prenatal or postnatal detection of Angelman syndrome (AS)

comprising the assay of an accessible tissue for ubiquitin-ligase activity. Finally, a

kit for the prenatal or postnatal detection of AS is provided comprising an assay for

ubiquitin-ligase activity.

The objective of the anti-coactivator treatment is to reduce the hormone

coactivating activity of nuclear coactivator protein, E6- AP comprising of (a) reducing

the concentration of said protein in tumor cells or (b) neutralizing said protein in

tumor cells or (c) neutralizing the target protein(s) of said coactivator protein in

tumor cells or (d) any combination of the above. The term "neutralizing" in this

context is meant to indicate that a protein is rendered incapable of performing a

certain function, such as binding with another protein or facilitating transcription. It

is to be understood that the treatment is not to be limited by the above examples.

One embodiment of the method comprises the administration of a therapeutically

effective concentration of oligonucleotides to the tumor cells which are

complementary to the E6-AP mRNA. A person skilled in the art will recognize an

oligomer of appropriate length and hybridizing location. This embodiment also

allows for the use of more than one oligomer coding for several regions of E6-AP

mRNA. This embodiment further comprises the administration of a therapeutically

effective concentration of a chemical substance which inhibits the formation of E6-

AP, promotes the degradation of E6-AP, or both.

Another embodiment of the method comprises the administration of a

therapeutically effective concentration of a protein which binds E6-AP, thus preventing E6-AP from effectively interacting with a hormone receptor. While E6-

AP is capable of interacting with, and thus increasing transcriptional activity of, a

number of hormone receptors, the preferred hormone receptor is the ER. While one

skilled in the art will recognize that a number of proteins can serve this purpose, the

preferred embodiment is for a protein comprising the E6-AP binding domain of ER.

Such a protein will be sufficiently truncated or mutated so as to be ineffective as an

activator of transcription. An ER mutant protein in which the DNA binding domain

has been mutated or deleted is but one example. It is to be further understood that

any naturally occurring protein possessing an E6-AP binding domain may be mutated

or truncated in order to serve as a binding site for E6-AP. Such naturally occurring

proteins may include, but are not limited to ER, PR, thyroid hormone receptor (TR),

retinoic acid receptor (RARα), androgen receptor (AR), and glucocorticoid receptor

(GR).

Another embodiment of the method comprises the administration of a

therapeutically effective concentration of a protein which competes for the binding

site on the target protein for E6-AP, thus preventing the binding of native E6-AP.

This embodiment also allows for a protein which binds the target protein E6-AP at

a different site but which prevents binding of E6-AP. The preferred embodiment

comprises the delivery of a protein which binds to the E6-AP binding site of the ER.

One skilled in the art will recognize that numerous proteins can be made which will

bind to the E6-AP binding site on the ER. The preferred ER-binding protein

comprises a truncated or mutant E6-AP protein which lacks the ability to enhance transcription of the ER. E6-AP has been demonstrated to posses an intrinsic

activation domain located within amino acids 170 to 680. It is to be understood that

other receptors can be targeted as well. Nuclear receptors which are regulated by E6-

AP include, but are not limited to TR, PR, RARα, AR, and GR. One embodiment of

the method comprises the insertion of DNA encoding the desired protein into a viral

vector and then injecting a therapeutically effective concentration directly into or into

the immediate vicinity of tumor cells. Suitable viral vectors include, but are not

limited to, adenovirus, retrovirus, and vaccinia virus.

Another embodiment comprises the delivery of a therapeutically effective

concentration of oligonucleotides to the tumor cells. One skilled in the art will

recognize that the uptake of these oligonucleotides can be affected by several means

including adding nucleotides to the oligomers which facilitate uptake into the cells

but which are not complementary to the coactivator mRNA. In another embodiment,

viral vectors encoding partial or complete lengths of anti-sense mRNA to a

coactivator are used to insert complementary nucleotide sequences. Suitable viral

vectors for this purpose include, but are not limited to adenovirus, retrovirus, and

vaccinia virus.

Another embodiment comprises the delivery of a therapeutically effective

concentration of E6-AP neutralizing antibodies to the tumors. These antibodies can

be administered by any one of a number of methods well known in the art for

administering antibodies. Treatment of mammary tumors may also utilize any combination of some or

all of the above methods.

The anti-E6-AP treatment method can also be used in conjunction with other

endocrine tumor treatments. In doing so, the combined treatment process will act

synergistically thereby increasing the effectiveness of the treatment and possibly

reducing the dose of one or both anti -tumor agents required.

In an embodiment where mammary tumors are being treated, the anti-E6-AP

treatment method can be combined with an antihormone treatment method, including

but not limited to, tamoxifen. Such a combined treatment method can increase the

effectiveness compared to individual treatments alone. Alternatively, it can reduce

the concentration requirement for one or more treating agents. This latter expectation

is especially significant given the possible tumor promoting activity of tamoxifen in

the uterus.

Another embodiment comprises assaying tissue samples for increased levels

of E6-AP mRNA or protein. In >90% of mouse mammary tumors currently

evaluated, higher than normal concentrations of E6-AP protein were found. Also,

E6- AP has been shown to directly promote degradation of the tumor suppressor gene

product, p53. Therefore, a preferred embodiment comprises assaying for increased

levels of E6-AP and decreased levels of p53. This assay can be accomplished with

specific monoclonal or polyclonal antibodies to E6-AP, or any of several methods

well known in the art. The increased level of E6-AP can also be a measured by

utilizing a ubiquitin-protein ligase assay of the biopsy samples. The assay for these factors may also comprise the determination of the

relative amount of mRNA in a given tissue sample. It has been demonstrated that

levels of E6-AP mRNA are correspondingly increased in mammary tumor cells. One

skilled in the art will recognize that a number of techniques are available which are

capable of measuring relative mRNA concentrations. Such techniques may include,

but are not limited to RT-PCR and Northern blot hybridization. It is to be understood

that several endocrine tumors can be screened for with this method, including but not

limited to mammary, endometrial, and prostate tumors. Tumors can also be screened

by studying the ubiquitin-ligase activity of E6-AP from mammary biopsy samples.

Another embodiment comprises a method for the evaluation of possible anti-

tumor agents for the ability to alter hormone coactivator levels. The object of the

present method is to provide a means to quickly evaluate a large number of agents as

possible endocrine tumor therapeutics. A preferred embodiment comprises an

endocrine tumor cell line which is contacted with a possible anti-tumor agent and

then assayed for E6-AP. The above mentioned method for assay can be used.

Another preferred embodiment comprises a tumor cell line which is contacted with

a possible anti-tumor agent and then assayed for E6-AP and p53. In this

embodiment, the tumor cell line can be selected from a group of cell lines including,

but not limited to, MCF-7, T47D, MDA-MB-231, LnCaP, PC3, and RUCA-1 cells.

Another embodiment comprises a method for the evaluation of endocrine

tumorogenicity for selected tumor promoting agents. The object of the present

method is to provide a means for evaluating a large number of agents for the ability to increase hormone coactivator mRNA or protein concentration when said agents are

contacted with a cell. A preferred embodiment comprises the measurement of E6-AP

mRNA or protein within a cell following contact with a suspected tumor promoting

agent. A more preferred embodiment comprises the measurement of E6-AP mRNA

or protein and p53 protein within a cell following contact with a suspected tumor

promoting agent. Any agent which increases levels of E6-AP (mRNA or protein) and

decreases levels of p53 (protein) will be considered to be a possible tumor promoting

factor. In this embodiment, the cell type expresses E6-AP (mRNA and protein) and

p53 (protein) within a normal concentration range. Cell types for use in this

embodiment can be selected from a group of cells including, but not limited to

fibroblasts, epithelial cells, COS cells, HeLa cells, blood cells (e.g. leukocytes,

monocytes, etc.), and mammary-derived cells which do not express high levels of

E6-AP.

Another embodiment consists of a method for prenatal or postnatal detection

of AS comprising the measurement of ubiquitin-ligase activity from a tissue sample

and comparing that value to a control sample. AS has been shown to correlate well

with decreased ubiquitin-ligase activity. A preferred embodiment of this method

comprises the evaluation of ubiquitin-ligase activity from a relatively easily accessed

tissue such as blood or cells obtained from amniocentesis, from a chorionic villus

sampling, or isolation of fetal cells present within the mother' s circulation. Cells may

also be obtained directly from the fetus through procedures including fetoscopy. In

one embodiment of this method, cell extract is added to a solution comprising ubiquitin (~8 KDa) and [³⁵S]methionine labeled target protein HHR23A (-80 KDa).

Ubiquitin attachment occurs during the incubation period. Normal/wild type E6-AP

(E6-AP +/+) facilitates the attachment of several ubiquitin molecules in a

multiubiquitin chain whereas AS/mutant E6-AP (E6-AP +/- or E6-AP -/-) facilitates

attachment of fewer or no ubiquitin molecules. Following the incubation period, the

products are analyzed by SDS-PAGE and autoradiography. SDS-PAGE results in a

"ladder" consisting of products of approximately 80-200 KDa., reflecting the

attachment of varying numbers of ubiquitin to the labeled target protein. E6-AP +/+

results in a significantly greater proportion of larger, polyubiquinated products

compared to AS E6-AP +/- or E6-AP -/- protein. E6-AP +/+ protein standard may be

obtained from wild type human or animal donor cells including, but not limited to

blood, fibroblasts, epithelial cells, COS-7 cells, HeLa cells, or from recombinant wild

type E6-AP protein. Production of ubiquitin/target protein complexes of a

significantly smaller size is indicative of defective E6-AP which is responsible for

the AS phenotype. One skilled in the art will recognize that any of several methods

well known in the art are suitable for discriminating between protein complexes of

different sizes. It is to be understood that the present method for detecting AS can

be used alone or in combination with other methods for the detection of AS.

Yet another embodiment provides an assay kit for the prenatal or postnatal

detection of AS, and for the detection of coactivator dependent mammary gland

tumors, comprising an assay for ubiquitin-ligase activity with provided E6-AP +/+

standard for comparison. In a preferred embodiment of this product, ubiquitin-ligase activity is measured from a tissue sample using ubiquitin and [³⁵S]methionine

labeled HHR23A as a target protein. It is to be understood that any of several

ubiquitin target proteins may be used. Furthermore, it is to be understood that any

of several means well known in the art may be used to label and/or otherwise isolate

said target protein. In another embodiment, recombinant E6-AP protein is produced

from a tissue sample and ubiquitin-ligase activity measured and compared to a

standard. In one embodiment, the standard for comparison comprises wild type

human or animal cells or cell extract. In another embodiment, the standard for

comparison comprises wild type recombinant E6-AP protein. In yet another

embodiment, AS or mutant cells, cell extract, or recombinant protein is provided as

a disease state standard.

In other embodiments of the present invention, the present invention provides

a method for assaying for the presence of tumors by comparing the ubiquitin-ligase

activity of a tissue or blood sample to a non-tumor control, where a decrease in the

ubiquitin-ligase activity indicates that the tumor is cancerous. One embodiment of

the invention is a method that is particularly useful in detecting breast tumors when

the tissue sample is obtained from a mammary gland biopsy. Still another

embodiment provides a method of monitoring the progression or regression of a

cancerous tumor comprising comparing the ubiquitin-ligase activity of tissue or blood

samples to a non-tumor control and previously tested samples, wherein a change in

the ubiquitin-ligase activity over time compared to the control and the previously

tested samples is indicative of progression or regression of said tumor. One further embodiment of the method can be used to monitor the progression or regression of

a breast tumor when the tissue sample is obtained from a mammary gland biopsy.

The following examples serve to illustrate specific embodiments of this

invention, but should not be considered as limiting the scope of the invention.

EXAMPLE 1 Plasmid Construction

The bait plasmid for the yeast two-hybrid system (pASl-PRLBD) (Onate et

al. (1995), Science 270: 1354-1357), mammalian expression plasmids for PR-B

(Allan et al. (1992), J. Biol. Chem. 267: 19513-19520), estrogen receptor (ER)

(Burris et al. (1995), Proc. Natl. Acad. Sci. USA. 922: 9525-9529), androgen receptor

(AR) (Tilley et al. (1989), Proc. Natl. Acad. Sci. USA. 86:327-331),E2F, baculovirus

expression plasmids pVLGST and pVLGST-PRA (Onate et al. (1995), Science 270:

1354-1357), reporter plasmids UAS4-TATA-LUC (LUC, luciferase) (Spencer et al.

(1997), Nature 389: 194-198), E2F, Spl, and CREB responsive reporters (Onate et

al. (1995), Science 270: 1354-1357) as evidenced in the foregoing cited references,

are all well known in the art. To construct GR expression vector, the pSTCGR vector

was digested with BamHI then the BamHI fragment containing the GR cDNA was

cloned into the corresponding sites of the pCR3.1 plasmid (Invitrogen). The

pPRE/GRE-Elb-LUC and pERE-Elb-LUC were constructed by inserting PvuII-

Smal fragments of pPRE/GRE-Elb-CAT and pERE-Elb-CAT into the Smal site of

pGL3 basic plasmid (Promega). To construct mammalian expression plasmids of

wild-type E6-AP (aal-851), 76 kDaE6-AP (aal 70-851), and C833-S mutant E6-AP (aal -851 ), the BamHI-Hindlll fragments of pGEM E6-AP (100 kDa), pGEM-E6-AP

(76 kDa), and pGEM E6-AP(C833-S) were cloned into the corresponding sites of the

pBKRS V plasmid (Stratagene). The C-terminal fragment of E6-AP (aa 680-851 ), the

truncated mutant E6-AP (aal -449) and the 98 kDa (aa 1-834) form of E6-AP, found

in AS (See e.g., Kishino et al. (1993), Nature Genet. 15: 70-73; Matsuura et al.

(\991),Nature Genet. 15: 74-77; Sutcliff et al. (1997), GenomeRes. 1: 368-377) and

the 99kDa (aa 1-845) form of E6-AP, the 86 kDa (aa 1-714) form of E6-AP, the 47

kDa (aa450-851) form of E6-AP, and the 28 kDa (aa 1-240) were amplified by

polymerase chain reaction (PCR) with the primers (SEQ. ID. NO. 1.) 5'-

GCGGATCCACCATGAGGAATTCGGCACGAGATCTAAAGGA A-3' (upper

strand) and (SEQ. ID. NO. 2) 5'-CGGAATTCAAGCTTGTTTTACAGCATGCC

AAATCC-3' (lower strand); and (SEQ.ID.NO.3) 5'-GCGGATCCAC

CATGGAAGCCTGCACGAATGAGTTTTGTG CT-3' (upper strand) and (SEQ. ID.

NO.4) 5'- CCCAAGCTTGTTTTATGTTTCTACTTTGAAAAAAGTATA-3' (lower

strand); (SEQ. ID. NO. 5) 5'-GCGGATCCACCATGAGGAATTCGGCACGAG

ATCTAAAGGA A-3' (upper strand) and (SEQ. ID. NO. 6) 5'-CCCAAGCTTG

TTTTAAAGTTTTTCTTTGCTTGAGTATTC-3' (lower strand); (SEQ. ID. NO. 7)

5'-GCGGATCCACCATGAGGAATTCGGCACGAGATCTAAAGGAA-3'(upper

strand) and (SEQ.ID.NO.8) 5'-CCCAAGCTTGTTTTAGGCATACGTGATGGC

CTTCAACAA-3' (lower strand); (SEQ. ID. NO. 9) 5'-GCGGATCCAC

CATGAGGAATTCGGCACGAGATCTAAAGGAA-3' (upper strand) and (SEQ. ID.

NO. 10) 5'-CCCAAGCTTGTTTTACATATGAAAACCTCTCCGAAAAGC (lower strand); (SEQ. ID. NO. 11) 5'-GCGGATCCACCATGTACAGTGAACGAAGAA

TCACTGTT-3' (upper strand) and (SEQ.ID.NO.12) 5'-CGGAATTCGC

GGCCGCGTTTTACAGCATGCCAAATCC-3' (lower strand); and (SEQ. ID. NO.

13) 5'-GCGGATCCACCATGGAAGCCTGCACGAATGAGTTTTGTGCT-3' (upper

strand) and (SEQ. ID. NO. 14) 5'-GAATTCAAGCTTGTTTTACAAATATA

CAAGTGCATTGAG-3' (lower strand). The PCR product was digested with BamHI-

Hindlll and cloned into the corresponding sites of the pBKRSV plasmid. Then the

BamHI-Notl fragments of pBKRSV-E6-AP plasmids were subcloned into the

corresponding sites of pCR3.1 plasmid (Invitrogen). The I804K and F782Δ mutant

forms of E6-AP were constructed by utilizing site directed mutagenesis to create

these mutations in pCR3.1 E6-AP. To reconstitute the 104kDa 1-885 Δstop mutation

into the E6-AP, the BsaAI-Hindlll fragment of E6-AP was amplified by PCR with

the primers (SEQ. ID. NO. 15) 5'-GTTGAAGGCCATCACGTATGCCAAAGG-3'

(lower strand) and (SEQ. ID. NO. 16) 5'-GAATTCAAGCTTGTTTTAGTACTG

GGACACTATCACCACCA-3' (lower strand) using AS patient DNA as a template.

Then this BsaAI-Hindlll fragment was cloned into the corresponding sites of pGEM

E6-AP. To reconstitute this mutation into the mammalian expression plasmid, the

BamHI-Hindll fragment of E6-AP was cloned into the corresponding sites of

pBK.RSV plasmid. The BamHI-Notl fragment of pBK.RSVE6-AP was subcloned

into the BamHI-Notl sites of pCR3.1 plasmid. To reconstitute the full-length E6-AP

gene into a yeast two-hybrid plasmid, the Hindlll-digested (and filled) pGEM E6-AP

(100 kDa) was redigested with BamHI. The resulting BamHI-Hindlll (filled) fragment was inserted into the BamHI-EcoRI (filled) sites of pGADIO (Clonetech).

To reconstitute the PR-A gene into the yeast pASl plasmid, the Ncol-Sall fragment^"

of PRA was ligated into the corresponding sites of the vector. To fuse E6-AP with

the VP 16 activation domain and GAL DNA-binding domain (DBD) (residues 1 - 147),

the BamHI-Hindlll fragment of full-length E6-AP and several deletion fragments of

E6-AP were subcloned in frame into the pABVPlό and pABGAL plasmids utilizing

mehtods well known in the art, such as those contained in Baniahmad et al. (1993),

Proc. Natl. Acad. Sci. USA. 90: 8832-8836 and Baniahmad et al. (1995), Mol. Cell.

Biol. 15, 76-86). To fuse E6-AP with the glutathione-S-transferase (GST), the

BamHI-Notl fragments of full-length E6-AP and various mutant forms of E6-AP

were subcloned in frame with GST into the pGEX4T plasmid (Pharmacia).

EXAMPLE 2 In Vivo Interaction Assays

The interaction of PR with wild-type E6-AP was evaluated in a yeast two-

hybrid assay. The entire coding sequence of PR-A was fused in frame with the yeast

GAL4 DNA-binding domain (GAL-DBD-hPRA). Then the GAL-DBD-PRA

construct was coexpressed with either control vector or the GAL-AD-E6-AP

construct (GAL activation domain fused in frame with wild-type E6-AP) along with

a reporter plasmid in yeast strain B J2186. The transformants were propagated, and

the β-galactosidase activities from three independent colonies were determined. The

yeast cells were treated with either vehicle alone (-H), 10-6 M progesterone (+P), or 10-6 M RU486 (+RU). The β-galactosidase activity is expressed in Miller units and

each bar depicts the average of three assays, i.e. n=3.

EXAMPLE 3 In Vitro Interaction Assay

For the in vitro interaction assay, the PR-B was expressed as a his-tagged

fusion protein in a baculovirus expression system in the presence or absence of

progesterone, and purified using a nickel affinity column (Pharmacia). GST-tagged

E6-AP was expressed in Escherichia coli cells and purified on glutathione-sepharose

beads. The purified and glutathione-bound E6-AP was incubated with the purified

PR-B in NETN buffer (50 mM Nacl, ImM EDTA, 20 mM Tris, pH 8.0, and 0.5%

NP-40) for 1 hour at room temperature. Subsequently, the beads were incubated with

8 μl of in vitro transcribed and translated [³⁵S]methionine labeled E6-AP and

interactions were allowed to occur at 4 °C overnight. Beads were then washed five

times with NETN buffer. E6-AP bound PR was analyzed by SDS-PAGE on a 7.5%

gel followed by Western blot analysis using antibodies which specifically recognize

PR.

EXAMPLE 4 Transfections

HeLa cells were maintained in DMEM supplemented with 10% fetal bovine

serum. Twenty- four hours before transfection, 3X10⁵ cells were plated per well in

Falcon six-well dishes in DMEM containing 5% dextran-coated charcoal-stripped serum. Cells were transfected with the indicated DNAs using Superfect reagent

(Qiagen) or Lipofectin (Gibco BRL) according to the manufacturer's guidelines.^"

Cells were washed, and fed with DMEM containing 5% stripped serum and

subsequently treated with the indicated hormones. Cells were harvested twenty-four

hours thereafter. Cell extracts were assayed for luciferase activity using the

Luciferase Assay System (Promega), and values are corrected for either protein

concentration or β-Gal activity. Data is analyzed as the mean of triplicate values

obtained from representative experiments.

EXAMPLE 5

Coactivation Ubiquitin-Protein Ligase Activity

To study the coactivation function of wild- type and various mutant forms of

E6-AP, HeLa cells were transfected with 0.1 μg of PR-B expression plasmid, 1 μg of

pPRE/GRE.Elb.LUC and 0.25 μg of wild-type E6-AP expression plasmid (aa 1-851 )

or 0.25 μg of various mutant forms of E6-AP expression plasmids (aa 450-851, aa 1-

845, aa 1-834, aa 1-714, R417X, C833S, I804K, F782Δ, and Δstop aa 1-885). The

cells were incubated with 10^"7 M progesterone. The coactivation by wild-type E6-AP

is represented by (++++) signs. The coactivation by various mutant forms of E6-AP

is presented as relative activity compared to that of wild-type E6-AP.

To study the ubiquitin-protein ligase activity of wild-type E6-AP and various

mutant forms of E6-AP, the wild-type E6-AP and various mutant forms of E6-AP

(shown in Table 1) were expressed and purified from E.coli as GST-fusion proteins.

(+) represents positive for ubiquitin-protein ligase activity and (-) represents negative for ubiquitin-protein ligase activity. (*) represents natural mutants of E6-AP cloned

from AS patients. The E6 independent substrate of E6-AP, HHR23 A, was expressed

in vitro in TNT-coupled wheat germ extracts in the presence of [³⁵S]methionine as

per manufacturer's instructions (Promega). Ubiquitin was obtained from commercial

sources (Sigma). The ubiquitin-protein ligase activity of these proteins was measured

by incubating the labeled HHR23 A target protein (5 μl aliquot), ubiquitin (4 μg), and

cell extract at 30 °C in a reaction buffer comprising 20 mM Tris-HCl, pH 7.6, 50 mM

NaCl, 4mM ATP, 10 mM MgCl₂, and 0.2 mM dithiothreitol. Reactions were

terminated at 90 to 120 minutes by the addition of SDS-sample buffer. Samples were

then boiled for 5 minutes prior to size fractionation by SDS-PAGE and visualization

by autoradiography. Other suitable methods are known in the art, such as Kumar et

al. (1997), J. Biol. Chem. 272: 13548-13554.

EXAMPLE 6 Isolation and Characterization of E6-AP as a PR Interacting Protein

To identify novel proteins which selectively modulate the transactivation

functions of members of the nuclear receptor superfamily, a HeLa cDNA library was

screened using the ligand binding domain (LBD) of PR as a bait in a yeast two-hybrid

screening assay. Thirteen colonies were isolated which strongly interacted with the

LBD of PR. These colonies contained cDNAs with identical sequences. A sequence

similarity search in the Gene Bank data base revealed that all colonies encoded the

carboxy-terminal amino acids, aa 680-851 region of the E6-AP protein. EXAMPLE 7 Regions of E6-AP required for interaction with PR

Since E6-AP interacts with PR in a hormone-dependent manner, the regions

of E6-AP important for interaction with PR were defined. Figure 2 A is a schematic

representation of E6-AP showing the position of the catalytic region (solid box), hect

domain, transactivation domain, and PR-binding domains. Wild-type E6-AP is a 100

KDa (aa 1-851) protein. The 76 KDa (aa 170-851) and the 47 KDa (aa 450-851)

represent E6-AP which contain deletions at the N-terminus. The 21 kDa form (aa

680-851 ) represents the carboxy-terminus of the E6-AP protein identified in the yeast

two-hybrid screen. The 99 kDa (aa 1-845), the 98 kDa (aa 1-834), the 86 kDa (aa 1-

714), the 53 kDa (aa 1-449), and the 28 kDa (aa 1-240) represent E6-AP C-terminus

deletion mutants. The C833S mutant represents a Cysteine 833 to Serine 833 mutant

form of E6-AP. The AS disease mutants are represented by the 98 kDa (deletion of

17 aa from the C-terminus), the 53 kDa C-terminally truncated E6-AP protein (aa 1 -

449), the I804K form of E6-AP contains lysine at position 804 instead of isoleucine,

the F782Δ contains a deletion of phenylalanine at position 782, and the 104 kDa (1-

885 Δstop) form of E6-AP is a read through mutant.

In order to locate the PR interaction site in E6-AP, an in vivo mammalian two-

hybrid interaction assay system was utilized. See e.g., Spencer et al. (1997), Nature

389: 194-198). In this assay, full-length E6-AP and various deletion fragments of

E6-AP were fused to the VP 16 activation domain and the ability of the VP 16-E6-AP

hybrid proteins to interact with receptor was determined in the absence or presence

of progesterone. As shown in Fig. 2B, wild-type E6-AP, N-terminal deletion fragments (aa 170-851 and aa 680-851 ) and C-terminal deletion fragments (aa 1-714

and aa 1 -449) of E6-AP were able to interact with PR while the control vector lacking

E6-AP cDNA and the N-terminal fragment (aa 1-240) of E6-AP did not interact,

indicating that at least two PR interaction sites are located within the E6-AP protein.

One site is located within the C-terminal (aa 680-851) (21 kDa) fragment of E6-AP,

the fragment of E6-AP which was originally isolated in the yeast two-hybrid screen.

The second PR interaction site is located within aa 240-449 and overlaps with the E6

binding site.

EXAMPLE 8

E6-AP as a Coactivator for Nuclear Hormone Receptor Superfamily

To investigate the possible role of E6-AP in receptor-dependent activation of

target gene expression, co-transfection assays in HeLa cells were performed. HeLa

cells were transiently transfected with 0.2 μg of pPR-B expression plasmid and 1 μg

of pPRE/GRE.Elb.LUC (a reporter plasmid containing a progesterone response

element) in the absence or presence of E6-AP expression plasmid, pBK.RSV-E6-AP

(0.250 μg). The cells were treated with either vehicle only (-H), 10^"7 M progesterone

(+P), or 10^"7 M RU486 (+RU). The data are expressed as fold activation and each bar

depicts the average of at least three wells. In the absence of ligand, PR has a minimal

effect on reporter gene expression either in the absence or in the presence of E6-AP

(Fig 3 A). Addition of the hormone yielded an eight- fold increase in PR activity in the

absence of E6-AP; when E6-AP was coexpressed with PR, the activity of PR was

further stimulated by ~5-fold, a total of 40-fold over basal. In contrast, coexpression of E6-AP with PR had no significant effect on the transcription of the reporter gene

when receptor was bound to antihormone-RU486 (Fig. 3A). These data are

consistent with data which indicate that the antihormone RU486 induces a distinct

conformational change in the receptor molecule that has reduced affinity for

coactivators (See e.g., Allan et al. (1992), J. Biol. Chem. 267: 19513-19520; Onate

et al. (1995), Science 270: 1354-1357; Vegeto et al. (1992), Cell 69: 703-713; Xu

et al. (1996), Proc. Natl. Acad. Sci. USA. 93: 12195-12199). Since, HeLa cells are

derived from a papillomavirus type 18 positive cervical carcinoma patient and thus

express the E6 protein and because E6-AP was originally cloned as an E6 interacting

protein, it was necessary to rule out the possibility that the E6 protein influences the

coactivation function of E6-AP. E6-AP was able to stimulate the hormone-dependent

transcriptional activity of steroid hormone receptors in the E6-negative HepG2 and

SK-N-SH cell lines (data not shown), suggesting that the coactivation observed in

HeLa cells is not dependent on the E6 protein.

The data show that E6-AP stimulates the hormone-dependent transcriptional

activity of PR by acting as a coactivator. In order to determine if E6-AP functions

as a coactivator for of the nuclear receptor superfamily, the effect of E6-AP

expression on the ligand-dependent transcriptional activity of different nuclear

hormone receptors and on several other transcription factors was examined (Figures

3B and C). E6-AP significantly enhanced the hormone-dependent transcriptional

activity of PR, estrogen receptor (ER), androgen receptor (AR), and glucocorticoid

receptor (GR). It also enhanced the transcriptional activity of retinoic acid (RARa), and thyroid hormone receptors (TR) (data not shown). E6-AP had a minimal or no

effect on the transcriptional activity of E2F and cyclic AMP response element

binding protein (CREB). Coexpression of E6-AP had only a moderate effect on the

activation function of Spl (Figure 3C). These data show that E6-AP preferentially

coactivates the hormone-dependent transcriptional activity of nuclear hormone

receptors, but is not uniquely specific for them as is the case for other coactivators

such as SRC-1. Onate et al. (1995), Science 270: 1354-1357.

EXAMPLE 9

E6-AP Relieves Squelching Between ER and PR

It has been shown previously that ER and PR share common coactivators

since hormone bound-ER can sequester limited pools of coactivators from PR, a

phenomenon known as squelching. See Conneely et al. (1989),. In A. K. Roy and J.

Clark (ed.), Gene regulation by steroid hormones IV, p. 220-223, Spring-Verlag

Press, New York., Meyer et al. (1989), Cell 57: 433-442; Shemshedini et al. (1992),

J. Biol. Chem. 261 : 1834-1839. It was determined whether coexpression of E6-AP

was able to reverse this squelching phenomenon. HeLa cells were transfected with

0.2 μg of PR expression plasmid, 0.3 μg of ER expression plasmid together with 1.0

μg of pPRE/GRE.Elb.LUC and increasing concentrations of wild-type E6-AP (0,

0.1, 0.5. and 1.0 μg). Cells were then treated with progesterone (Prog) or

progesterone and estradiol (E2) together (each at 10^~8 M). The data are expressed as

fold activation and each bar depicts the average of at least three wells. The hormone- induced transcriptional activity mediated by PR was reduced by 91% upon

coexpression of estradiol-bound ER (Figure 4A, compare lanes 2 and 3). Addition

of E6-AP reversed this squelching by as much as 9.6-fold (Figure 4A, compare lanes

3 and 6) in a dose-dependent manner. At the highest concentration of E6-AP used

in this reverse squelching experiment, the PR activity was enhanced by only 2.6 fold

(compare lanes 2 and 7). These data demonstrate that E6-AP is a limiting factor

which is necessary for efficient PR and ER transactivation. The fold coactivation by

E6-AP is lower in this experiment compared to that shown in Figure 3B, due to

different experimental conditions used in these experiments. In Figure 4 (lane 7), the

coactivation function of E6- AP on the transcriptional activity of PR was observed in

the presence of ER expression plasmid whereas in Figure 3B, only a single receptor

was transfected. As expected, no significant reverse squelching was observed (Figure.

4B, compare lanes 3 and 6) with the C-terminal fragment of E6-AP (aa 680-851)

(Figure 2A) which weakly interacts with ER and has no activation function (Figure

5). Western blot analysis confirmed that the C-terminal fragment of E6-AP (aa 680-

851) and full-length E6-AP are equally expressed.

EXAMPLE 10 E6-AP Contains an Intrinsic Activation Domain

To ascertain whether E6-AP possesses an intrinsic, transferable activation

domain, wild-type and deletion fragments of E6-AP were recruited to DNA by

linking them to the DNA-binding domain (DBD) of GAL4 in a fusion protein. The

full-length E6-AP (aa 1-851), N-terminal deletion fragments of E6-AP (aa 170-851 and aa 680-851) and C-terminal deletion fragment of E6-AP (aa 1-714) (shown in

Figure 1 A) were fused to the yeast GAL4 DBD. HeLa cells were then transfected

with 0.5 μg of UAS4-TATA-luciferase reporter DNA and GAL4DBD or GAL4-E6-

AP expression plasmids (1.0 μg). The data are expressed as fold activation and each

bar depicts the average of at least three wells. The wild-type E6-AP (aa 1-851), N-

terminal deletion fragment (aa 170-851, 76 kDa), and C-terminal deletion fragment

(aa 1-714, 86 kDa) stimulated the transcriptional activity of the reporter gene

compared to that of the control vector containing only GAL4DBD (Figure 5) while

the 21 kDa fragment (aa 680-851) did not. This suggests that E6-AP itself contains

a transcriptional activation domain located between aa 170-680.

EXAMPLE 11 Expression Pattern of E6-AP in Mouse Mammary Glands

Changes in the expression levels of coactivator proteins such as E6-AP can

contribute to the etiology of steroidal cancers. The altered expression pattern of

E6-AP in mouse mammary gland model of multistage tumorigenesis was

examined using Western blot analysis techniques. Cell extracts were prepared

from normal mammary glands and mammary gland tumors by homogenization in

a buffer containing 50 mM NaCl, 20 mM HEPES pH 7.5, 5 mM KC1, 10%

Glycerol, 1 mM PMSF, and protease inhibitors Leupeptin (1.25 g/ml) and

Pepstatin A (1.0 g/ml). Protein concentrations were estimated using the Bradford

reagent. 15 ug of total protein was denatured, separated on SDS-polyacrylamide and analyzed with rabbit polyclonal antibody raised against E6-AP. Purified

human E6-AP protein was used as a control. As seen in Figure 7, there is

approximately a 4.5 -fold increase in E6-AP expression in mammary tumors

compared to that of normal tissue from mammary glands. Furthermore, increased

expression of E6-AP was associated with tumor progression because E6-AP

overexpression was not observed in the earlier stages of mammary tumorigenesis.

EXAMPLE 12 E6-AP Contains Two Independent Separable Functions, Coactivation and Ubiquitin-Ligase Activity

Since E6-AP is a ubiquitin-protein ligase, it was determined if the

coactivation function of E6-AP is dependent on this enzymatic function. It has

been shown that a conserved cysteine (C) residue in E6-AP at position 833 (C833)

forms a thioester bond with ubiquitin and is necessary for the transfer of ubiquitin

to the protein targeted for ubiquitination. The mutation of C833 to alanine (A) or

serine (S) has been shown to eliminate the ubiquitin-protein ligase activity of E6-

AP. Huibregtse et al. (1995), Proc. Natl. Acad. Sci. USA. 92: 2563-2567. In

cotransfection experiments, an E6-AP bearing a C to S mutation at this critical site

was still able to coactivate PR (Table 1) and ER to nearly the same extent as that

of wild-type E6-AP. Furthermore, the C833S mutant of E6-AP also can reverse

squelch the hormone-dependent transcriptional activity of PR to a similar extent

as that of wild-type E6-AP. The data suggest that the ubiquitin-protein ligase

activity of E6-AP is not required for the coactivation function of E6-AP. To further confirm that the ubiquitin-proteasome pathway is not involved in the

coactivation function of E6-AP, a deletion mutant of E6-AP (aa 1-845) was

analyzed which lacks six amino acids at the carboxy terminus and has been shown

to be defective for ubiquitin-protein ligase activity Huibregtse et al. (1995), Proc.

Natl. Acad. Sci. USA. 92: 2563-2567. Like the C833S mutant, this mutant also

retains the ability to coactivate the hormone-dependent transcriptional activity of

PR (Table 1), further confirming that the ubiquitin-protein ligase activity of E6-

AP is not necessary for E6-AP to function as a coactivator. The data indicate that

E6-AP possesses two independent, separable functions; coactivation and

ubiquitin-protein ligase activity.

EXAMPLE 13

The AS Phenotype Results From Defects in the Ubiquitin-protein Ligase Activity of E6-AP

Recently, it was shown that a subset of AS patients express mutant forms

of the E6-AP, rather than possessing large scale deletions of the 15ql l-ql3 region

which contains E6-AP, that are more common. Kishino et al. (1993), Nature

Genet. 15: 70-73., Matsuura et al. (1997), Nature Genet. 15: 74-77.; Sutcliff et al.

(1997), Genome Res. 1: 368-377. In order to determine if the coactivator function

of E6-AP was necessary for development of the AS phenotype, several mutant E6-

AP proteins corresponding to those found in these AS patients were generated

(shown in Table 1). First, the effect of an E6-AP mutant was tested which had a

gross deletion whereby the C-terminal half of the protein was deleted due to a non-sense mutation at codon 417 (R417X). The ability of this AS mutant protein

to coactivate PR was greatly diminished in comparison to the wild-type E6-AP,

but was still able to interact with PR (Figure 2B) indicating that a loss of

coactivation was due to disruption of the activation domain located at aa 170-680.

Furthermore, the loss of coactivation by the R417X mutant was not due to the loss

of expression of mutant protein, since this mutant was able to interact with PR to

the same extent as that of wild-type E6-AP in mammalian cells which were used

to assess coactivation (Figure 2B). The R417X mutant of E6-AP was also unable

to coactivate ER and AR.

Another mutant form of E6-AP was then tested which contained a small

deletion in the hect domain due to a frameshift mutation which results in the

truncation of the last 17 aa of the protein (1-834) and the replacement of four

different amino acids from the new reading frame. This mutant E6-AP was able

to coactivate PR to the same extent as the wild-type E6-AP (Table 1). Similarly,

an artificial mutant which lacks six aa at the extreme C-terminus of E6-AP (aa 1-

845), was also able to act as a coactivator of PR activity (Table 1). Three other

mutants which were evaluated for their ability to coactivate PR transcription

consisted of a missense mutation I804K in which isoleucine 804 was mutated to

lysine, F782Δ, an internal in-frame deletion of phenylalanine 782, and 1-885

Δstop, a read through mutation which results in a longer mutant form of E6-AP.

All three of these mutant forms of E6-AP were able to coactivate PR activity,

demonstrating that the coactivator function of E6-AP is not involved in the central nervous system (CNS) phenotype of AS (Table 1).

TABLE 1

Amino Acid Position Coactivation Ubiquitin activitv

1-851 ++++ +

450-851 + -

680-851 - -

1-845 ++++ -

1-834^* ++++ -

1-714 ++ -

R417X^* + -

1-240 not tested -

C833S ++++ -

I804K^* ++++ +

F782Δ^* ++++ -

1-885* Δ Stop ++++ not tested

AS mutant forms of E6-AP

To correlate the ubiquitin-protein ligase activity of E6-AP with AS, the

ubiquitin-ligase function of wild-type and AS mutant forms of E6-AP was tested.

Some AS mutant forms of E6-AP, such as aa 1-834, R417X, and F782Δ were

unable to ubiquitinate a protein (HHR23A) implemented as a target of E6-AP

ubiquitin-protein ligase activity in an in vitro ubiquitin assay (See also Kumar et

al. (1997), J. Biol. Chem. 272: 13548-13554; Van der Spek et al. (1994), Genomics 23: 651-658). The results show that loss of ubiquitin-protein ligase

activity contributes to the AS phenotype in these patients. However, the AS

missense mutant (I804K), was able to ubiquitinate the target protein HHR23 A, to

an extent comparable to that of wild-type E6-AP (Table 1).

REFERENCES

All patents and publications mentioned in the specification are indicative

of the level of those skilled in the art to which the invention pertains. All patents

and publications are herein incorporated by reference to the same extent as if each

individual publication was specifically and individually indicated to be

incorporated by reference.

Allan et al. (1992), J. Biol. Chem. 267: 19513-19520.

Anzick et al. (1997), Science 277: 965-968.

Baniahmad et al. (1993), Proc. Natl. Acad. Sci. USA. 90: 8832-8836.

Baniahmad et al. (1995), Mol. Cell. Biol. 15, 76-86.

Beuten et al. (1996), Human Genet. 97: 294-298.

Bocquel et al. (1989), Nuc. Acids Res. 17: 2581-2594.

Burris et al. (1995), Proc. Natl. Acad. Sci. USA. 922: 9525-9529.

Chen et al. (1997), Cell 90: 569-580.

Conneely et al. (1989),. In A. K. Roy and J. Clark (ed.), Gene regulation by

steroid hormones IV, p. 220-223, Spring- Verlag Press, New York.

Daniel et al. (1998), J. Gen. Virol. 79: 489-499.

Durfee et al. (1993), Gene Dev. 7: 555-569.

Hatakeyama et al. (1997), J. Biol. Chem. 272: 15085-15092.

Hong et al. (1996), Proc. Natl. Acad. Sci. USA. 93: 4948-4952.

Horwitz et al. (1996), Mol Endocrinol. 10: 1167-1177. Huibregtse et al. (1995), Proc. Natl. Acad. Sci. USA. 92: 2563-2567.

Huibregtse et al. (1991), EMBO J. 10: 4129-4135.

Huibregtse et al. (1993) Mol. Cell. Biol. 13: 775-784.

Huibregtse et al. (1993), Mol. Cell. Bio. 13: 4918-4927.

Kishino et al. (1993), Nature Genet. 15: 70-73.

Kumar et al. (1997), J. Biol. Chem. 272: 13548-13554.

Li et al. (1997), Proc. Natl. Acad. USA. 94: 8479-8484.

Matsuura et al. (1997), Nature Genet. 15: 74-77.

Meyer et al. (1989), Cell 57: 433-442.

Ogryzko et al. (1996), Cell 87: 953-959.

Onate et al. (1995), Science 270: 1354-1357.

Perlmann et al. (1997), Cell 90: 391-397.

Pugh et al. (1992), J. Biol. Chem. 267: 679-682.

Scheffher et al. (1993), Cell 75: 495-505.

Shemshedini et al. (1992), J. Biol. Chem. 261: 1834-1839.

Shibata et al. (1997), Recent. Prog. Hormone Res. 52: 141-165.

Spencer et al. (1997), Nature 389: 194-198.

Sutcliff et al. (1997), Genome Res. 1: 368-377.

Tilley et al. (1989), Proc. Natl. Acad. Sci. USA. 86:327-331.

Tjian et al. (1994), Cell 11: 5-8.

Torchia et al. (1997), Nature 387: 677-684.

Tsai et al. (1994), Ann. Rev. Biochem. 63: 451-486. Tukeshita et al. (1997), J. Biol. Chem. 272: 27629-27634.

Nan der Spek et al. (1994), Genomics 23: 651-658.

Vegeto et al. (1992), Cell 69: 703-713.

Voegel et al. (1996), EMBOJ. 15: 3667-3675.

Xu et al. (1996), Proc. Natl. Acad. Sci. USA. 93: 12195-12199.

Xu et al. (1998), Science 279:1922-1924.

Yeh et al. (1996), Proc. Natl. Acad. Sci. USA. 93: 5517-5521.

One skilled in the art readily appreciates that the present invention is well

adapted to carry out the objectives and obtain the ends and advantages mentioned

as well as those inherent therein. Systems, treatments, methods, procedures and

techniques described herein are presently representative of the preferred

embodiments and are intended to be exemplary and are not intended as limitations

of the scope. Changes therein and other uses will occur to those skilled in the art

which are encompassed within the spirit of the invention or defined by the scope

of the pending claims.

Claims

What is claimed is:

1. A method of treating endocrine tumors comprising interfering with a

hormone coactivator pathway.

2. The method of claim 1 , wherein said interfering comprises reducing the

concentration of a hormone coactivator.

3. The method of claim 2, wherein said concentration is reduced by

administrating oligonucleotides complementary to the coactivator mRNA.

4. The method of claim 2, wherein said concentration is reduced by the

administration of a chemical agent which inhibits transcription of a coactivator

mRNA.

5. The method of claim 2, wherein said concentration is reduced by the

administration of a chemical agent which inhibits translation of a coactivator

mRNA.

6. The method of claim 2, wherein said concentration is reduced by the

administration of a chemical agent which promotes degradation of a coactivator

mRNA, or d) promotes degradation of a coactivator protein.

7. The method of claim 2, wherein said concentration is reduced by the

administration of a chemical agent which promotes degradation of a coactivator

protein.

8. The method of claim 1 , wherein said interfering comprises neutralizing a

coactivator.

9. The method of claim 8, wherein said neutralizing comprises binding a

coactivator to a substrate which lacks the activity of the natural endogenous

receptor.

10. The method of claim 1 , wherein said interfering comprises blocking the

coactivator binding site on the target nuclear receptor with a transcriptionally

incompetent substrate.

11. The method of claim 1 , wherein said interfering comprises any

combination of one or more of the methods selected from the group consisting of

reducing the concentration of a hormone coactivator;

administrating oligonucleotides complementary to the coactivator

mRNA;

administrating a chemical agent which inhibits transcription of a

coactivator mRNA; administrating a chemical agent which inhibits translation of a

coactivator mRNA;

administrating a chemical agent which promotes degradation of a

coactivator mRNA,

administrating a chemical agent which promotes degradation of a

coactivator protein;

neutralizing a coactivator;

binding a coactivator to a substrate which lacks the activity of the

natural endogenous receptor; and

blocking the coactivator binding site on the target nuclear receptor

with a transcriptionally incompetent substrate.

12. The method of claim 1, wherein said endocrine tumors are selected from a

group consisting of mammary tumors, endometrial tumors, and prostate tumors.

13. The method of claim 1, wherein said hormone coactivator is E6-AP.

14. A vector containing an agent which interferes with a hormone coactivator

pathway.

15. The vector of claim 14, wherein said vector comprises a viral vector

coding for said agent.

16. The vector of claim 14, wherein said agent binds to a nuclear hormone

coactivator.

17. The vector of claim 14, wherein said nuclear hormone coactivator is

selected from a group consisting of E6- AP, SRC- 1 , TIF2, p/CIP, and ARA70.

18. The vector of claim 14, wherein said agent binds at or about the site for

coactivator binding on a nuclear hormone receptor.

19. The vector of claim 18, wherein said nuclear hormone receptor is selected

from a group consisting of PR, ER, TR, RARα, AR, and GR.

20. The vector of claim 14, wherein said agent is comprises a nucleotide

sequence complementary to a hormone coactivator mRNA.

21. The vector of claim 14, wherein said hormone coactivator pathway is that

ofE6-AP.

22. A method for screening a tissue sample for endocrine tumors comprising

assaying said tissue for nuclear hormone coactivator mRNA or protein wherein an

increased level indicates tumor presence.

23. The method of claim 22, wherein said endocrine tumors are selected from

a group consisting of mammary tumors, endometrial tumors, and prostate tumors. ^"

24. The method of claim 22, wherein said nuclear hormone coactivator is from

a group consisting of E6-AP, SRC-1, TIF2, p/CIP, and ARA70.

25. The method of claim 22, wherein said tissue is assayed for E6-AP and p53

concentrations.

26. The method of claim 22, wherein said assay comprises the use of

antibodies directed against specific nuclear coactivators.

27. The method of claim 22, wherein said assay comprises an antibody

directed against E6-AP.

28. The method of claim 22, wherein said assay comprises antibodies directed

against E6-AP and p53.

29. The method of claim 22, wherein said assay comprises the measurement of

specific nuclear hormone coactivator mRNA by RT-PCR.

30. The method of claim 22, wherein said assay comprises the measurement of specific nuclear hormone coactivator mRNA by Northern hybridization.

31. A method for screening a compound for the potential to regulate endocrine

tumor growth comprising contacting a tissue with said compound and

subsequently assaying that tissue for nuclear hormone coactivator mRNA or

protein wherein a lowered nuclear hormone coactivator level indicates the ability

of said compound to inhibit endocrine tumor growth.

32. The method of claim 31 , wherein said tissue consists of cells selected from

a group consisting of MCF-7, T47D, MDA-MB-231, LnCaP, PC3, and RUCA-1

cells.

33. The method of claim 31, wherein said endocrine tumor is selected from a

group consisting of mammary, endometrial, and prostate tumors.

34. The method of claim 31 , wherein said nuclear hormone coactivator is

selected from a group consisting of E6-AP, SRC-1, TIF2, p/CIP, and ARA70.

35. The method of claim 31 , wherein said nuclear hormone coactivator is E6-

AP.

36. The method of claim 31 , wherein p53 and the coactivator E6-AP are assayed.

37. A method for the evaluation of endocrine tumorogenicity of environmental

agents comprising contacting a tissue with said compound and subsequently

assaying that tissue for nuclear hormone coactivator mRNA or protein wherein an

increased level of nuclear hormone coactivator level indicates tumorogenicity of

an agent.

38. The method of claim 37, wherein said tissue comprises cells from a group

consisting of fibroblasts, epithelial cells, COS cells, HeLa cells, blood cells, and

mammary-derived cells which do not express high levels of E6-AP.

39. The method of claim 37, wherein said tissue comprises freshly isolated

cells from a group consisting of mammary, endometrial, and prostate tissues.

40. The method of claim 37, wherein said nuclear hormone coactivator is

selected from a group consisting of E6-AP, SRC-1, TIF2, p/CIP, and ARA70.

41. The method of claim 37, wherein p53 and the coactivator E6-AP are

assayed.

42. A method for the detection of Angelman syndrome comprising the steps of:

a) obtaining a cell extract from a patient tissue sample,

b) incubating said cell extract with a reaction solution comprising ubiquitin

and a ubiquitin-binding target protein,

c) size fractionating the ubiquitin/target protein products, and

d) comparing the ubiquitin/target protein product size to that produced by a

standard,

wherein a decreased ubiquitin/target protein product size compared with that of a

wild type standard indicates Angelman syndrome.

43. The method of claim 42, wherein said tissue sample is from a group

consisting of blood cells, amniocentesis-derived cells, epithelial cells, and

fibroblasts.

44. The method of claim 42, wherein said ubiquitin-ligase activity is E6-AP

dependent.

45. The method of claim 42, wherein said ubiquitin-ligase activity is measured

from recombinant E6-AP protein generated from said tissue sample.

46. The method of claim 42, wherein said target protein is ³⁵S-Met labeled

HHR23A.

47. The method of claim 42, wherein said standard a cell extract from E6-AP

+/+ cells.

48. The method of claim 42, wherein said standard is a recombinant E6-AP

protein.

49. The method of claim 42, wherein said standard is a cell extract from E6-

AP +/- cells.

50. The method of claim 42, wherein said standard is a recombinant AS

mutant E6-AP protein.

51. The method of claim 42, wherein said target protein is made amenable to

size fractionation and subsequent detection via one of several methods including

incorporation of a radioisotope, fluorescent tag, or antibody recognized epitope.

52. A method of detecting a cancerous tumor comprising comparing the

ubiquitin-ligase activity of a tissue or blood sample to a non-tumor control,

wherein a decrease in said ubiquitin-ligase activity indicates that said tumor is

cancerous.

53. The method of Claim 52, wherein said tissue sample is obtained from a mammary gland biopsy.

54. A method of monitoring the progression or regression of a cancerous

tumor comprising comparing the ubiquitin-ligase activity of tissue or blood

samples to a non-tumor control and previously tested samples, wherein a change

in the ubiquitin-ligase activity over time compared to said control and said

previously tested samples is indicative of progression or regression of said tumor.

55. The method of Claim 54, wherein said tissue sample is obtained from a

mammary gland biopsy.