WO2001096584A2

WO2001096584A2 - Materials and methods for the control of nematodes

Info

Publication number: WO2001096584A2
Application number: PCT/US2001/018911
Authority: WO
Inventors: Arcady R. Mushegian; Christopher G. Taylor; Jerald S. Feitelson; Alexy M. Eroshkin
Original assignee: Akkadix Corporation
Priority date: 2000-06-12
Filing date: 2001-06-12
Publication date: 2001-12-20
Also published as: AU2001275474A1; WO2001096584A3

Abstract

The subject invention provides novel methods and compositions for controlling nematodes. More specifically, the subject invention provides RNAi molecules, polynucleotide sequences, and methods of using these sequences in nematode control.

Description

DESCRIPTION

MATERIALS AND METHODS FOR THE CONTROL OF NEMATODES

Background of the Invention

[0001] Plant parasitic nematodes, such as root-knot nematodes (Meloidogyne species) and cyst nematodes (Globodera and Heterodera), attack nearly every food crop, and are among the world's most damaging agricultural pests. For example, root-knot nematodes parasitize more than 2,000 plant species from diverse plant families and represent a tremendous threat to crop production world-wide. These biotrophic pathogens have evolved highly specialized and complex feeding relationships with their hosts.

[0002] Nematodes cause millions of dollars of damage each year to turf grasses, ornamental plants, and food crops. Efforts to eliminate or minimize damage caused by nematodes in agricultural settings have typically involved the use of soil fumigation with materials such as chloropicrin, methyl bromide, and dazomet, which volatilize to spread the active ingredient throughout the soil. Such fumigation materials can be highly toxic and may create an environmental hazard. Various non-fumigant chemicals have also been used, but these too create serious environmental problems and can be highly toxic to humans.

[0003] Some research articles have been published concerning the effects of δ- endotoxins from B. thuringiensis species on the viability of nematodes. See, for example, Bottjer, Bone and Gill ([1985] Experimental Parasitology 60:239-244); Ignoffo and Dropkin (Ignoffo, CM., Dropkin, V.H. [1977] J Kans. Entomol Soc. 50:394-398); and Ciordia, H. and W.E. Bizzell ([1961] Jour, of Parasitology 47:41 [abstract]). Several patents have issued describing the control of nematodes with B.t. See, for example, U.S. Patent Nos. 4,948,734; 5,093,120; 5,281,530; 5,426,049; 5,439,881; 5,236,843; 5,322,932; 5,151,363; 5,270,448; 5,350,577; 5,667,993; and 5,670,365. The development of resistance by insects to B.t. toxins is one obstacle to the successful use of such toxins. [0004] The pesticidal activity of avermectins is well known. The avermectins are disaccharide derivatives of pentacyclic, 16-membered lactones. They can be divided into four major compounds: A_la, A_2a, B_la, and B_2a; and four minor compounds: A_lb, A_2b, B_lb, and B_2b. The isolation and purification of these compounds is also described in U.S. Patent No. 4,310,519, issued January 12, 1982. Avermectin B_2a is active against the root- knot nematode, Meloidogyne incognita. It is reported to be 10-30 times as potent as commercial contact nematicides when incorporated into soil at 0.16-0.25 kg/ha (Boyce Thompson Institute for Plant Research 58th Annual Report [1981]; Putter, I. et al. [1981] "Avermectins: Novel Insecticides, Acaracides, and Nematicides from a Soil Microorganism," Experientia 37:963-964). Avermectin B_2a is not toxic to tomatoes or cucumbers at rates of up to 10 kg/ha.

[0005] Fatty acids are a class of natural compounds which occur abundantly in nature and which have interesting and valuable biological activities. Tarjan and Cheo (Tarjan, A.C., P.C. Cheo [1956] "Nematocidal Value of Some Fatty Acids," Bulletin 332, Contribution 884, Agricultural Experiment Station, University of Rhode Island, Kingston, 41 pp.) report the activity of certain fatty acids against nematodes. In 1977 Sitaramaiah and Singh (Sitaramaiah, K., R.S. Singh [1977] Indian J. Nematol 7:58-65) also examined the response of nematodes to fatty acids. The results of these tests with short chain acids were equivocal, showing nematode-inhibitory action in some instances and stimulatory activity in other instances. Phytotoxicity of these acids was observed at higher concentrations. The short chain fatty acids were also examined by Malik and Jairajpuri (Malik, Z., M.S. Jairajpuri [1977] Nematol medit. 12:73-79), who observed nematode toxicity at high concentrations of the fatty acids.

[0006] Notwithstanding the foregoing (some of the limitations of and problems associated with these approaches are discussed above), there is a need for safe and effective alternatives for controlling nematodes.

[0007] One method for disrupting normal cellular processes is by the use double- stranded interfering RNA (RNAi), or RNA-mediated interference (RNAi). When RNAi corresponding to a sense and antisense sequence of a target mRNA is introduced into a cell, the targeted mRNA is degraded and protein translation of that message is stopped. Although not yet fully understood, the mechanism of this post-transcriptional gene silencing appears to be at least partially due to the generation of small RNA molecules, about 21 - 25 nucleotides in length, that correspond to the sense and antisense pieces of the RNAi introduced into the cell (Bass, B. L. [2000] "Double-stranded RNA as a template for gene silencing" Cell 101:235-238).

[0008] The specificity of this gene silencing mechanism appears to be extremely high, blocking expression only of targeted genes, while leaving other genes unaffected. A recent example of the use of RNAi; to inhibit genetic function in plants used Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana (Chuang, C.-F. and E. M. Meyerowitz [2000] "Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana" Proc. Natl. Acad. Sci. USA 97:4985- 4990). Chuang et al. describe the construction of vectors delivering variable levels of RNAi targeted to each of four genes involved in floral development. Severity of abnormal flower development varied between transgenic lines. For one of the genes, AGAMOUS (AG), a strong correlation existed between declining accumulation of mRNA and increasingly severe phenotypes, suggesting that AG-specific endogenous mRNA is the target of RNAi.

Brief Summary of the Invention [0009] The subject invention provides novel methods and compositions for controlling nematodes. More specifically, the subject invention provides polynucleotide sequences that encode nematode genes, RNAi that selectively targets mRNA transcripts of these essential nematode genes, and methods of using these sequences in nematode control strategies. Such sequences for use according to the subject invention are summarized in Appendix 1. RNAi molecules disclosed herein can be used to inhibit the expression of one or more of these genes in nematodes. Brief Description of the Drawings

[00010] Figure 1 : Modular Binary Construct System (MBCS): A series of six, 8-base cutter restriction enzyme sites has been placed between the left and right Ti borders of a previously created kan^R/tet^R binary plasmid.

[00011] Figure 2: An exemplary shuttle vector created for cloning of useful DNA fragments by containing the multi-cloning site (MCS) of a modified Bluescript plasmid flanked by 8-base restriction sites.

[00012] Figure 3: An exemplary shuttle vector with exemplary inserts.

[00013] Figure 4: A suggested RNAi binary vector with exemplary inserts.

[00014] Figure 5: Exemplary selectable markers for MBCS.

[00015] Figure 6: Exemplary scorable markers for MCBS.

[00016] Figure 7: Exemplary RNAi binary vector.

[00017] Figure 8: Exemplary RNAi shuttle vector.

Brief Description of the Sequences [00018] Brief Description of the Sequences can be found in Appendix I.

Detailed Disclosure of the Invention

[00019] The subject invention provides novel methods and compositions for controlling nematodes. More specifically, the subject invention provides polynucleotide sequences and methods of using these sequences in nematode control strategies. A preferred method for controlling nematodes according to the subject invention provides materials and methods for controlling nematodes by using double-stranded interfering RNA (RNAi), or RNA-mediated interference (RNAi). The terms RNAi and RNAi are used interchangeably herein unless otherwise noted.

[00020] In one embodiment of the invention, RNAi molecules are provided which are useful in methods of killing nematodes and/or inhibiting their growth, development, parasitism or reproduction. RNAi molecules of the invention are also useful for the regulation of levels of specific mRNA in nematodes.

[00021] dsRNA (RNAi) typically comprises a polynucleotide sequence identical to a target gene (or fragment thereof) linked directly, or indirectly, to a polynucleotide sequence complementary to the sequence of the target gene (or fragment thereof). The dsRNA may comprise a polynucleotide linker (stuffer) sequence of sufficient length to allow for the two polynucleotide sequences to fold over and hybridize to each other; however, a linker sequence is not necessary. The linker (stuffer) sequence is designed to separate the antisense and sense strands of RNAi significantly enough to limit the effects of steric hindrances and allow for the formation of dsRNA molecules.

[00022] RNA containing a nucleotide sequence identical to a fragment of the target gene is preferred for inhibition; however, RNA sequences with insertions, deletions, and point mutations relative to the target sequence can also be used for inhibition. Sequence identity may optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g. , University of Wisconsin Genetic Computing Group). Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a fragment of the target gene transcript.

[00023] As disclosed herein, 100% sequence identity between the RNA and the target gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence.

[00024] RNA may be synthesized either in vivo or in vitro. Endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro. For transcription from a transgene in vivo or an expression construct, a regulatory region (e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation) may be used to transcribe the RNA strand (or strands). Inhibition may be targeted by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (e.g., infection, stress, temperature, chemical inducers); and/or engineering transcription at a developmental stage or age. The RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated into a polypeptide by a cell's translational apparatus. RNA may be chemically or enzymatically synthesized by manual or automated reactions. The RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). The use and production of an expression construct are known in the art (see, for example, WO 97/32016; U.S. Pat. Nos. 5,593,874; 5,698,425; 5,712,135; 5,789,214; and 5,804,693; and the references cited therein). If synthesized chemically or by in vitro enzymatic synthesis, the RNA may be purified prior to introduction into the cell. For example, RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA may be used with no or a minimum of purification to avoid losses due to sample processing. The RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.

[00025] Preferably and most conveniently, RNAi can be targeted to an entire polynucleotide sequence of a gene set forth herein. Preferred RNAi molecules of the instant invention are highly homologous or identical to the polynucleotides summarized in Appendix 1. The homology is preferably greater than 90% and is most preferably greater than 95%.

[00026] Fragments of genes can also be targeted. These fragments are typically in the approximate size range of about 20 nucleotides. Thus, targeted fragments are preferably at least about 15 nucleotides. In certain embodiments, the gene fragment targeted by the RNAi molecule is about 20-25 nucleotides in length. However, other size ranges can also be used. For example, using a C. elegans microinjection assay, RNAi "fragments" of about 60 nucleotides with between 95 and 100% identity (to a nematode gene) were determined to cause excellent inhibition.

[00027] Thus, RNAi molecules of the subject invention are not limited to those that are targeted to the full-length polynucleotide or gene. The nematode gene product can be inhibited with a RNAi molecule that is targeted to a portion or fragment of the exemplified polynucleotides; high homology (90-95%) or identity is also preferred, but not necessarily essential, for such applications.

[00028] The polynucleotide sequences identified in Appendix A and shown in the Sequence ID listing are from genes encoding nematode proteins having the functions shown in Appendix 1. The genes exemplified herein are representative of particular classes of proteins which are preferred targets for disruption according to the subject invention. These classes of proteins include, for example, proteins involved in ribosome assembly; neurol transmitter receptors and ligands; electron transport proteins; metabolic pathway proteins; and protein and polynucleotide production, folding, and processing proteins.

[00029] Genetic regulatory sequences, such as promoters, enhancers, and terminators, can be used in genetic constructs to practice the subject invention. Such constructs themselves can also be used for nematode control. Various constructs can be used to achieve expression in specific plant tissues (by using root specific promoters, for example) and/or to target specific nematode tissues (by using targeting elements or adjacent targeting sequences, for example).

[00030] In a specific embodiment of the subject invention, plant cells, preferably root cells, are genetically modified to produce at least one RNAi that is designed to be taken up by nematodes during feeding to block expression (or the function of) of a target gene. As is known in the art, RNAi can target and reduce (and, in some cases, prevent) the translation of a specific gene product. RNAi can be used to reduce or prevent message translation in any tissue of the nematode because of its ability to cross tissue and cellular boundaries. Thus, RNAi that is contacted with a nematode by soaking, injection, or consumption of a food source will cross tissue and cellular boundaries. RNAi can also be used as an epigenetic factor to prevent the proliferation of subsequent generations of nematodes.

[00031] Nematode polynucleotide sequences disclosed herein demonstrate conserved nucleotide motifs among different nematode genera. Conserved nucleotide motifs strongly suggest that these sequences are associated with viability and/or parasitism and are functionally conserved and expressed in both Meloidogyne incognita (root-knot nematode) and Globodera rostochiensis and Globdera pallids (potato cyst nematodes). The use of these polynucleotides, and RNAi inhibitors thereof, is advantageous because such RNAi can be designed to have broad RNAi specificity and are thus useful for controlling a large number of plant parasitic nematodes in planta. Because the genes identified in this disclosure are associated with nematode survival and/or parasitism, RNAi inhibition of these genes (arising from contacting nematodes with compositions comprising RNAi molecules) prevents and/or reduces parasitic nematode growth, development, and or parasitism.

[00032] Methods of the subject invention include the transformation of plant cells with genes or polynucleotides of the present invention, which can be used to produce nematode inhibitors or RNAi in the plants. In one embodiment, the transformed plant or plant tissue can express RNAi molecules encoded by the gene or polynucleotide sequence introduced into the plant. Other nematode inhibitors contemplated by the invention include antisense molecules specific to the polynucleotide sequences disclosed herein. The transformation of plants with genetic constructs disclosed herein can be accomplished using techniques well known to those skilled in the art and can involve modification of the gene(s) to optimize expression in the plant to be made resistant to nematode infection and infestation. Furthermore, it is known in the art that many tissues of the transgenic plants (such as the roots) can be targeted for transformation.

[00033] RNA-mediated interference (RNAi) of gene expression. Several aspects of root-knot nematode biology make classical genetic studies difficult with this organism. Since root-knot nematodes reproduce by obligatory mitotic parthenogenesis, the opportunity to perform genetic crosses is not available. Microinjection of RNAi can be used to manipulate gene expression in C. elegans (Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. [1998] "Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans" Nature 391 :806- 811). Microinjecting (into adult nematodes) RNAi can turn off specific genes in progeny worms complementary to the coding region of the genes. Moreover, gene inhibition occurs in progeny when RNAi is injected into the body cavity of the adult, indicating the ability of the RNAi to cross cellular boundaries. This RNAi injection method provides a molecular genetic tool that allows for analysis of gene function in root-knot nematodes.

[00034] RNAi can be taken up by C. elegans by simply soaking the nematodes in a solution RNAi. This results in targeted inhibition of gene expression in the nematode (Maeda, I., Y. Kohara, M. Yamamoto and A. Sugimoto [1999] "RNAi screening with a non-redundant cDNA set" International Worm Meeting, Madison, WI, abstract 565). Nematodes fed E. coli expressing RNAi also demonstrate targeted and heritable inhibition of gene expression (Sarkissian, M., H. Tabara and C. C. Mello [1999] "A mut-6 screen for RNAi deficient mutants" International Worm Meeting, Madison, WI, abstract 741; Timmons, 1. and A. Fire [1998] "Specific interference by ingested dsRNA" Nature 395:854; WO 99/32619, hereby incorporated by reference in its entirety).

[00035] Accordingly, one aspect of the instant invention is directed to the control of nematodes comprising contacting nematodes with compositions comprising RNAi molecules specific to the nematode genes disclosed herein. The contacting step may include soaking the nematodes in a solution containing RNAi molecules, feeding nematodes RNAi molecules contained in microbes or plant cells upon which the nematode feeds, or injecting nematodes with RNAi. Nematodes can also be "contacted" and controlled by RNAi expressed in plant tissues that would be consumed, ingested, or frequented by nematodes.

[00036] The RNAi molecules provided to the nematodes may be specific to a single gene. A "cocktail" of RNAi molecules specific to various segments of a single gene can also be used. In addition, a "multigene cocktail" of RNAi molecules specific to two or more genes (or segments thereof) may be applied to the nematodes according to the subject invention.

[00037] In addition to RNAi uptake mediated by transgenic plants, nematodes can be directly transformed with RNAi constructs of cDNAs encoding secretory or other essential proteins to reduce expression of the corresponding gene. The transgenic animals can be assayed for inhibition of gene product using immunoassays or for reduced virulence on a host. Progeny of affected worms can also be assayed by similar methods.

[00038] Procedures that can be used for the preparation and injection of RNAi include those detailed by Fire et al, (1998; ftp://ciwl.ciwemb.edu). Root-knot nematodes can be routinely monoxenically cultured on Arabidopsis thaliana roots growing on Gamborg's B-5/Gelrite® media. This nematode-host pathosystem is ideally suited for these microinjection experiments since limited root galling results in the parasitic stages (late J2 through adult females) developing outside of the root for easy accessibility for injecting. Another advantage is the parthenogenic reproduction of root- knot nematodes, which makes fertilization by males unnecessary for egg production. The RNAi can be injected into the body cavity of parasitic stages of root-knot nematodes feeding on A. thaliana roots using microinjection. Control nematodes can be injected in parallel with only buffer or an unrelated RNAi. Injected nematodes can be monitored for egg production, and the eggs can be collected for the assays described below. Female root-knot nematodes will typically survive and lay more than 250 eggs following 1 μl injection of buffer.

[00039] Alternatively, methods are available for microinjecting materials directly into the plant root cells upon which nematodes feed: giant cells or syncytial cells (Bockenlioff, A. and F.M.W. Grundler [1994] "Studies on the nutrient uptake by the beet cyst nematode Heterodera schachtii by in situ microinjection of fluorescent probes into the feeding structures in Arabidopsis thaliana" Parasitology 109:249-254). This provides an excellent test system to screen RNAi molecules for efficacy by directly inhibiting growth and development of the nematode feeding upon the microinjected plant cell, or by reducing fecundity and the ability of said nematode to generate pathogenic or viable progeny.

[00040] There are a number of strategies that can be followed to assay for RNAi gene interference. Inhibition of gene expression by RNAi inhibits the accumulation of the corresponding secretory protein in the esophageal gland cells of transgenic J2 hatched from the eggs produced by the injected nematodes. In the first assay, polyclonal antibodies to the target gene product can be used in immunolocalization studies (Hussey, R. S. [1989] "Monoclonal antibodies to secretory granules in esophageal glands of Meloidogyne species" J Nematol. 21:392-398; Borgonie, G, E. van Driessche, C. D. Link, D. de Waele, and A. Coomans [1994] "Tissue treatment for whole mount internal lectin staining in the nematodes Caenorhabditis elegans, Panagrolaimus superbus and Acrobeloides maximus" Histochemistry 101:379-384) to monitor the synthesis of the target protein in the gland cells of progeny of the injected nematodes, or in any other nematode tissue that fails to express the essential targeted gene. Interference of endogenous gene activity by the RNAi eliminates binding of the antibodies to secretory granules in the glands, or any other target tissue, of the transgenic nematodes, and can be monitored by these in situ hybridization experiments. Control nematodes injected only with the injection buffer can be processed similar to the RNAi treated nematodes. [00041] Another assay is designed to determine the effect of the RNAi on reducing the virulence of J2 progeny of the injected females. Egg masses from injected females can be transferred singly to A. thaliana plates to assess the ability of the transgenic J2 to infect roots. The J2 hatching from the eggs transferred to the plates can be monitored; after 25 days the number of galls with egg laying females can be recorded. The A. thaliana roots can also be stained with acid fuschin to enumerate the number of nematodes in the roots. Egg masses from nematodes injected only with the injection buffer can be handled similarly and used as controls. The treatments can be replicated, and the root infection data can be analyzed statistically. These experiments can be used to assess the importance of the target genes in root-knot nematode 's virulence or viability. By staining the J2 progeny of the injected females with the antibodies, it can be determined whether RNAi blocks expression of the targeted gene.

[00042] Additional uses of polynucleotides. The polynucleotide sequences exemplified herein can be used in a variety of ways. These polynucleotides can be used in assays for additional polynucleotides and additional homologous genes, and can be used in tracking the quantitative and temporal expression of parasitism genes in nematodes. These polynucleotides can be cloned into microbes for production and isolation of their gene products. Among the many uses of the isolated gene product is the development of additional inhibitors and modifiers. The protein products of the subject polynucleotides can also be used as diagnostic tools. For example, proteins encoded by the parasitism genes, as identified herein, can be used in large scale screenings for additional peptide inhibitors. The use of peptide phage display screening is one method that can be used in this regard. Thus, the subject invention also provides new biotechnological strategies for managing nematodes under sustainable agricultural conditions.

[00043] Antisense technologies can also be used for phytopathogenic nematode control. Antisense technology can be used to interfere with expression of the disclosed endogenous nematode genes. Antisense technology can also be used to alter the components of plants used as targets by the nematodes. For example, the transformation of a plant with the reverse complement of an endogenous gene encoded by a polynucleotide exemplified herein can result in strand co-suppression and gene silencing or inhibition of a target involved in the nematode infection process. Thus, the subject invention includes transgenic plants (which are preferably made nematode-resistant in this manner, and other organisms including microbes and phages) comprising RNAi or antisense molecules specific to any of the polynucleotides identified herein.

[00044] Polynucleotide probes. DNA possesses a fundamental property called base complementarity. In nature, DNA ordinarily exists in the form of pairs of anti- parallel strands, the bases on each strand projecting from that strand toward the opposite strand. The base adenine (A) on one strand will always be opposed to the base thymine (T) on the other strand, and the base guanine (G) will be opposed to the base cytosine (C). The bases are held in apposition by their ability to hydrogen bond in this specific way. Though each individual bond is relatively weak, the net effect of many adjacent hydrogen bonded bases, together with base stacking effects, is a stable joining of the two complementary strands. These bonds can be broken by treatments such as high pH or high temperature, and these conditions result in the dissociation, or "denaturation," of the two strands. If the DNA is then placed in conditions which make hydrogen bonding of the bases thermodynamically favorable, the DNA strands will anneal, or "hybridize," and reform the original double- stranded DNA. If carried out under appropriate conditions, this hybridization can be highly specific. That is, only strands with a high degree of base complementarity will be able to form stable double-stranded structures. The relationship of the specificity of hybridization to reaction conditions is well known. Thus, hybridization may be used to test whether two pieces of DNA are complementary in their base sequences. It is this hybridization mechanism which facilitates the use of probes of the subject invention to readily detect and characterize DNA sequences of interest.

[00045] The specifically exemplified polynucleotides of the subject invention can themselves be used as probes. Additional polynucleotide sequences can be added to the ends of (or internally in) the exemplified polynucleotide sequences so that polynucleotides that are longer than the exemplified polynucleotides can also be used as probes. Thus, isolated polynucleotides comprising one or more of the exemplified sequences are within the scope of the subject invention. Polynucleotides that have less nucleotides than the exemplified polynucleotides can also be used and are contemplated within the scope of the present invention. For example, for some purposes, it might be useful to use a conserved sequence from an exemplified polynucleotide wherein the conserved sequence comprises a portion of an exemplified sequence. Thus, polynucleotides of the subject invention can be used to find additional, homologous (wholly or partially) genes.

[00046] Probes of the subject invention may be composed of DNA, RNA, or PNA (peptide nucleic acid). The probe will normally have at least about 10 bases, more usually at least about 17 bases, and may have about 100 bases or more. Longer probes can readily be utilized, and such probes can be, for example, several kilobases in length. The probe sequence is designed to be at least substantially complementary to a portion of a gene encoding a protein of interest. The probe need not have perfect complementarity to the sequence to which it hybridizes. The probes may be labeled utilizing techniques that are well known to those skilled in this art.

[00047] One approach for the use of the subject invention as probes entails first identifying DNA segments that are homologous with the disclosed nucleotide sequences using, for example, Southern blot analysis of a gene bank. Thus, it is possible, without the aid of biological analysis, to know in advance the probable activity of many new polynucleotides, and of the individual gene products expressed by a given polynucleotide. Such an analysis provides a rapid method for identifying commercially valuable compositions.

[00048] One hybridization procedure useful according to the subject invention typically includes the initial steps of isolating the DNA sample of interest and purifying it chemically. Either lysed nematodes or total fractionated nucleic acid isolated from nematodes can be used. Cells can be treated using known techniques to liberate their DNA (and/or RNA). The DNA sample can be cut into pieces with an appropriate restriction enzyme. The pieces can be separated by size through electrophoresis in a gel, usually agarose or acrylamide. The pieces of interest can be transferred to an immobilizing membrane.

[00049] The particular hybridization technique is not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied. [00050] The probe and sample can then be combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the membrane is washed free of extraneous materials, leaving the sample and bound probe molecules typically detected and quantified by autoradiography and/or liquid scintillation counting. As is well known in the art, if the probe molecule and nucleic acid sample hybridize by forming a strong non-covalent bond between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical or very similar. The probe's detectable label provides a means for determining in a known manner whether hybridization has occurred.

[00051] In the use of the nucleotide segments as probes, the particular probe is labeled with any suitable label known to those skilled in the art, including radioactive and non-radioactive labels. Typical radioactive labels include ³²P, ³⁵S, or the like. Non- radioactive labels include, for example, ligands such as biotin or thyroxine, as well as enzymes such as hydrolases or peroxidases, or the various chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and its derivatives. In addition, the probes can be made inherently fluorescent as described in International Application No. WO 93/16094.

[00052] Various degrees of stringency of hybridization can be employed. The more stringent the conditions, the greater the complementarity that is required for duplex formation. Stringency can be controlled by temperature, probe concentration, probe length, ionic strength, time, and the like. Preferably, hybridization is conducted under moderate to high stringency conditions by techniques well known in the art, as described, for example, in Keller, G.H., M.M. Manak (1987) DNA Probes, Stockton Press, New York, NY., pp. 169-170.

[00053] As used herein "moderate to high stringency" conditions for hybridization refers to conditions that achieve the same, or about the same, degree of specificity of hybridization as the conditions "as described herein." Examples of moderate to high stringency conditions are provided herein. Specifically, hybridization of immobilized DNA on Southern blots with ³²P-labeled gene-specific probes was performed using standard methods (Maniatis et al). In general, hybridization and subsequent washes were carried out under moderate to high stringency conditions that allowed for detection of target sequences with homology to sequences exemplified herein. For double-stranded DNA gene probes, hybridization was carried out overnight at 20-25 ° C below the melting temperature (Tm) of the DNA hybrid in 6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula from Beltz et al. (1983):

[00054] Tm=81.5°C+16.6 Log[Na+]+0.41(%G+C)-0.61(%formamide)- 600/length of duplex in base pairs.

Washes are typically carried out as follows:

(1) Twice at room temperature for 15 minutes in IX SSPE, 0.1% SDS (low stringency wash).

(2) Once at Tm-20°C for 15 minutes in 0.2X SSPE, 0.1% SDS (moderate stringency wash).

[00055] For oligonucleotide probes, hybridization was carried out overnight at 10-20°C below the melting temperature (Tm) of the hybrid in 6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. Tm for oligonucleotide probes was determined by the following formula from Suggs et al. (1981):

[00056] Tm (°C)^*=2(number T/A base pairs) +4(number G/C base pairs)

[00057] Washes were typically carried out as follows:

[00058] (1) Twice at room temperature for 15 minutes IX SSPE, 0.1% SDS

(low stringency wash). [00059] (2) Once at the hybridization temperature for 15 minutes in IX SSPE,

0.1% SDS (moderate stringency wash). [00060] In general, salt and/or temperature can be altered to change stringency. With a labeled DNA fragment of greater than about 70 or so bases in length, the following conditions can be used:

Low: 1 or 2X SSPE, room temperature

Low: l or 2X SSPE, 42°C

Moderate: 0.2X or IX SSPE, 65 °C High: 0.1X SSPE, 65°C.

[00061] Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, polynucleotide sequences of the subject invention include mutations (both single and multiple), deletions, and insertions in the described sequences, and combinations thereof, wherein said mutations, insertions, and deletions permit formation of stable hybrids with a target polynucleotide of interest. Mutations, insertions, and deletions can be produced in a given polynucleotide sequence using standard methods known in the art. Other methods may become known in the future.

[00062] The mutational, insertional, and deletional variants of the polynucleotide sequences of the invention can be used in the same manner as the exemplified polynucleotide sequences so long as the variants have substantial sequence similarity with the original sequence. As used herein, substantial sequence similarity refers to the extent of nucleotide similarity that is sufficient to enable the variant polynucleotide to function in the same capacity as the original sequence. Preferably, this similarity is greater than 50%; more preferably, this similarity is greater than 75%; and most preferably, this similarity is greater than 90%. The degree of similarity needed for the variant to function in its intended capacity will depend upon the intended use of the sequence. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations that are designed to improve the function of the sequence or otherwise provide a methodological advantage.

[00063] PCR technology. Polymerase Chain Reaction (PCR) is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see U.S. Patent Nos. 4,683,195; 4,683,202; and 4,800,159; Saiki et al, 1985). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with the 3' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA fragment produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours. By using a thermostable DNA polymerase such as Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes that can be used are known to those skilled in the art.

[00064] The polynucleotide sequences of the subject invention (and portions thereof such as conserved regions and portions that serve to distinguish these sequences from previously-known sequences) can be used as, and/or used in the design of, primers for PCR amplification. In performing PCR amplification, a certain degree of mismatch can be tolerated between primer and template. Therefore, mutations, deletions, and insertions (especially additions of nucleotides to the 5' end) of the exemplified ppolynucleotides can be used in this manner. Mutations, insertions and deletions can be produced in a given primer by methods known to an ordinarily skilled artisan.

[00065] The polynucleotide sequences of the instant invention may be "operably linked" to regulatory sequences such as promoters and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is "operably linked" to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is "operably linked" to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is "operably linked" to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.

[00066] Polynucleotides and proteins. Polynucleotides of the subject invention can be defined according to several parameters. One characteristic is the biological activity of the protein products as identified herein. The proteins and genes of the subject invention can be further defined by their amino acid and nucleotide sequences. The sequences of the molecules can be defined in terms of homology to certain exemplified sequences as well as in terms of the ability to hybridize with, or be amplified by, certain exemplified probes and primers. Additional primers and probes can readily be constructed by those skilled in the art such that alternate polynucleotide sequences encoding the same amino acid sequences can be used to identify and/or characterize additional genes. The proteins of the subject invention can also be identified based on their immunoreactivity with certain antibodies.

[00067] The polynucleotides and proteins of the subject invention include portions, fragments, variants, and mutants of the full-length sequences as well as fusions and chimerics, so long as the encoded protein retains the characteristic biological activity of the proteins identified herein. As used herein, the terms "variants" or "variations" of genes refer to nucleotide sequences that encode the same proteins or which encode equivalent proteins having equivalent biological activity. As used herein, the term "equivalent proteins" refers to proteins having the same or essentially the same biological activity as the exemplified proteins.

[00068] It will be apparent to a person skilled in this art that genes within the scope of the subject invention can be identified and obtained through several means. The specific genes exemplified herein may be obtained from root-knot nematodes. Genes, or portions or variants thereof, may also be artificially synthesized by, for example, a gene synthesizer.

[00069] Variations of genes may be readily constructed using standard techniques such as site-directed mutagenesis and other methods of making point mutations and by DNA shuffling, for example. In addition, gene and protein fragments can be made using commercially available exonucleases, endonucleases, and proteases according to standard procedures. For example, enzymes such as E /31 can be used to systematically cut off nucleotides from the ends of genes. In addition, genes that encode fragments may be obtained using a variety of restriction enzymes. Proteases may be used to directly obtain active fragments of these proteins. Of course, molecular techniques for cloning polynucleotides and producing gene constructs of interest are also well known in the art. In vitro evaluation techniques, such as MAXYGEN's "Molecular Breeding" can also be applied to practice the subject invention.

[00070] Other molecular techniques can also be applied using the teachings provided herein. For example, antibodies raised against proteins encoded by polynucleotides disclosed herein can be used to identify and isolate proteins from a mixture of proteins. Specifically, antibodies may be raised to the portions of the proteins that are conserved and most distinct from other proteins. These antibodies can then be used to specifically identify equivalent proteins by immunoprecipitation, enzyme linked immunosorbent assay (ELISA), or Western blotting. Antibodies to proteins encoded by polynucleotides disclosed herein, or to equivalent proteins, can readily be prepared using standard procedures known in the art. The genes that encode these proteins can be obtained from various organisms.

[00071] Because of the redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequences encoded by the polynucleotide sequences disclosed herein. It is well within the skill of a person trained in the art to create these alternative DNA sequences encoding proteins having the same, or essentially the same, amino acid sequence. These variant DNA sequences are within the scope of the subject invention. As used herein, reference to "essentially the same" sequence refers to sequences that have amino acid substitutions, deletions, additions, or insertions that do not materially affect biological activity. Fragments retaining the characteristic biological activity are also included in this definition.

[00072] A further method for identifying genes and polynucleotides (and the proteins encoded thereby) of the subject invention is through the use of oligonucleotide probes. Probes provide a rapid method for identifying genes of the subject invention. The nucleotide segments that are used as probes according to the invention can be synthesized using a DNA synthesizer and standard procedures.

[00073] The subject invention comprises variant or equivalent proteins (and nucleotide sequences coding for equivalent proteins or for inhibitors of the genes encoding such proteins) having the same or similar biological activity of inhibitors or proteins encoded by the exemplified polynucleotides. Equivalent proteins will have amino acid similarity with an exemplified protein (or peptide). The amino acid and/or nucleotide identity will typically be greater than 60%. Preferably, the identity will be greater than 75%. More preferably, the identity will be greater than 80%, and even more preferably greater than 90%. Most preferably, the identity will be greater than 95%. RNAi molecules will also have corresponding identities in these preferred ranges. These identities are as determined using standard alignment techniques for determining amino acid and/or nucleotide identity. The identity/similarity will be highest in critical regions of the protein or gene including those regions that account for biological activity or that are involved in the determination of three-dimensional configuration that is ultimately responsible for the biological activity. In this regard, certain amino acid substitutions are acceptable and can be expected if these substitutions are in regions which are not critical to activity or are conservative amino acid substitutions which do not affect the three- dimensional configuration of the molecule. For example, amino acids may be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the compound. Below is a list of examples of amino acids belonging to various classes

Class of Amino Acid Examples of Amino Acids

Nonpolar Ala, Val, Leu, He, Pro, Met, Phe,

Trp

Uncharged Polar Gly, Ser, Thr, Cys, Tyr, Asn, Gin

Acidic Asp, Glu

Basic Lys, Arg, His

[00074] In some instances, non-conservative substitutions can also be made. The critical factor is that these substitutions must not detract from the ability to manage nematode-caused diseases.

[00075] An "isolated" or "substantially pure" nucleic acid molecule or polynucleotide is a polynucleotide that is substantially separated from other polynucleotide sequences which naturally accompany a nucleic acid molecule. The term embraces a polynucleotide sequence which was removed from its naturally occurring environment by the hand of man. This includes recombinant or cloned DNA isolates, chemically synthesized analogues and analogues biologically synthesized by heterologous systems. An "isolated" or "purified" protein, likewise, is a protein removed from its naturally occurring environment.

[00076] Recombinant hosts. The genes, antisense, and RNAi polynucleotides within the scope of the present invention can be introduced into a wide variety of microbial or plant hosts. Plant cells can be transformed (made recombinant) in this manner. Microbes, for example, can also be used in the application of RNAi molecules of the subject invention in view of the fact that microbes are a food source for nematodes

[00077] There are many methods for introducing a heterologous gene or polynucleotide into a host cell or cells under conditions that allow for stable maintenance and expression of the gene or polynucleotide. These methods are well known to those skilled in the art. Synthetic genes, such as, for example, those genes modified to enhance expression in a heterologous host (such as by preferred codon usage or by the use of adjoining, downstream, or upstream enhancers) that are functionally equivalent to the genes (and which encode equivalent proteins) can also be used to transform hosts. Methods for the production of synthetic genes are known in the art.

[00078] Where the gene or polynucleotide of interest is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, certain host microbes are preferred. Certain microorganism hosts are known to occupy the phytosphere, phylloplane, phyllosphere, rhizosphere, and/or rhizoplane of one or more crops of interest. These microorganisms can be selected so as to be capable of successfully competing in the particular environment (crop and other habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing a polypeptide of interest, and, desirably, provide for improved protection of the protein/peptide from environmental degradation and inactivation.

[00079] A large number of microorganisms is known to inhabit the phylloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e.g., genera Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeast, e.g., genera Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are the pigmented microorganisms.

[00080] Methods of the subject invention also include the transformation of plants or plant tissue with genes which encode the RNAi molecules of the present invention. In one embodiment, the transformed plant or plant tissue expresses antisense RNA and or RNAi. Transformation of cells can be made by those skilled in the art using standard techniques. Materials necessary for these transformations are disclosed herein or are otherwise readily available to the skilled artisan.

[00081] Additional methods and formulations for control of pests. Control of nematode pests using the RNAi molecules of the instant invention can be accomplished by a variety of additional methods that would be apparent to those skilled in the art having the benefit of the subject disclosure. A "cocktail" of two or more RNAi molecules can be used to disrupt one or more of the genes identified herein. The "cocktail" of RNAi molecules may be specific to segments of a single gene or the entire gene. A "multigene cocktail" of RNAi molecules specific to two or more genes (or segments thereof) is also encompassed by the instant invention. In another embodiment of the instant invention, the disclosed RNAi molecules, cocktails, and/or multigene cocktails thereof, may be used in conjunction with other known nematode control agents and methodologies. Such cocktails can be used to combat the development of resistance by nematodes to a certain inhibitor or inhibitors.

[00082] Compositions of the subject invention which comprise RNAi molecules and carriers can be applied, themselves, directly or indirectly, to locations frequented by, or expected to be frequented by, nematodes. Microbial hosts which were transformed with polynucleotides that encode RNAi molecules, express said RNAi molecules, and which colonize roots (e.g., Pseudomonas, Bacillus, and other genera) can be applied to the sites of the pest, where they will proliferate and be ingested. The result is control of the pest. Thus, methods of the subject invention include, for example, the application of recombinant microbes to the pests (or their locations). The recombinant microbes may also be transformed with more than one RNAi molecule thereby delivering a "cocktail" of RNAi molecules to the nematode pests. A carrier may be any substance suitable for delivering the RNAi molecules to the nematode. Acceptable carriers are well known in the art and also are commercially available. For example, such acceptable carriers are described in E.W. Martin's Remington's Pharmaceutical Science, Mack Publishing Company, Easton, PA.

[00083] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification.

[00084] Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

Example 1— Production of Hairy Roots for RNAi Testing

[00085] A hairy root assay system was developed for testing the anti-nematode activity of RNAi molecules.

[00086] Agrobacterium rhizogenes: Several Agrobacterium rhizogenes strains produce hairy roots on a variety of plant species. A. rhizogenes strains, A4, 15834, 8196 and LBA4404 demonstrate hairy root development on tomato and sugar beet, with A4 being the most efficient. The A. rhizogenes strain K599 demonstrated very efficient formation on transgenic soybean hairy roots and was also effective on sugar beet and Arabidopsis. However, stain K599 failed to produce hairy roots on tomato tissues possibly due to hyper-virulence.

[00087] Hairy root production: Transgenic hairy roots were identified by stable GUS expression in tomato, sugar beet, soybean and Arabidopsis. The construct pAKKHOl (pNOS / NPT-II / tNOS // pSU / GUS / tNOS) was used to produce hairy roots when transformed into A. rhizogenes strains A4 or K599. Transgenic roots were identified by GUS expression.

Example 2 — Protocol for Electro-competent Agrobacterium and Electroporation [00088] Electro-competent Agrobacterium Protocol: [00089] 1. Grow Agrobacterium overnight in 5 mis LB + antibiotics at 30°C on shaker (for Agrobacterium rhizogenes strain K599 no antibiotics are needed). [00090] 2. Use the 5 mis of overnight culture to inoculate 500 mis LB + antibiotics at 30°C on shaker. Grow overnight. [00091 ] 3. Add liquid culture in eight 50 ml polypropylene orange cap tubes. [00092] 4. Centrifuge 10 min., 4000 rpm, 4°C.

[00093] 5. Resuspend cells in each tube with 20 mis 10% glycerol (on ice) [00094] 6. Centrifuge 10 min., 4000 rpm, 4°C.

[00095] 7. Resuspend cells in each tube with 10 mis 10% glycerol (on ice). [00096] 8. Centrifuge 10 min., 4000 rpm , 4°C.

[00097] 9. Resuspend cells in each tube with 2 mis 10% glycerol (on ice). [00098] 10. Aliquot 50 μl into cold Eppendorf tube and place onto dry ice. [00099] 11. Store electro-competent cells at -80°C. These cells can be used for up to two years.

[000100] Electroporations:

[000101] 1. Add 1 μl to 5 μl of DNA (resuspended in H₂O and not TE or other buffer) to 50 μl of Agrobacterium electrocompetent cells and mix. [000102] 2. Transfer 20 μl of ON Al Agrobacterium mix to cuvette. [000103] 3. Electroporate:

25μF, 400 Ω resistance, 2.5 volts (0.2cm cuvette) or 1.8 volts (0.1cm cuvette for BioRad electroporator. 330 μF, 4000 kΩ, low w, fast charge rate for BRL Electroporator. [000104] 4. Add 1ml of LB and transfer to Eppendorf tube. [000105] 5. Shake at 30°C for 2 hours. [000106] 6. Centrifuge down cells (2 min. 14 krpm). [000107] 7. Plate all onto LB + antibiotics (most Agrobacterium strains are naturally streptomycin resistant).

Example 3 — Protocol for Production of Transgenic Hairy Roots on Soybean [000108] Seed Sterilization. Rinse the soybean seed with 70% ETOH for 2-5 min. Remove and add 20% Clorox and shake for 20-25 min. Rinse 3X with sterile water. Plate the seed, 5 seed per plate, onto ^lA MSB5 + 2% sucrose + 0.2% gel (referred to as Vi MSB5). Place seed into chamber at 25C, 16/8 photoperiod for 5-7 day (depending on genotype) germination period. After 1 week seedlings can be placed into cold room for longer storage if necessary (not to exceed 2 weeks).

[000109] Agrobacterium Preparation. For Agrobacterium rhizogenes strain K599, take a small sample from frozen glycerol into 25-50 ml of NZYM media with 50 mg/L kanamycin in a 125-250 ml Erlenmyer flask. Place onto shaker at 28-30 °C for 16 - 20 hours. Pour sample into centrifuge tube and centrifuge the bacterium at 4000 rpm for 10 min. Pour off supernatant and re-suspend the pellet with an equal volume of liquid V_ MSB5 + 200 μM acetosyringone. Use pipette to re-suspend the pellet and homogenize the sample (remove all clumps). To determine O.D., prepare a 1:10 dilution by putting 900 μl MSB5 into cuvette and add 100 μl of bacterial sample. Determine the O.D.₆₆₀ and calculate the volume needed to adjust (dilute) OD to approximately 0.2 for inoculation. Check final O.D.

[000110] Explant Preparation and inoculation. Place a sterile filter paper onto plates of 1/2 MSB5. Cut soybean cotyledons just above the shoot apex and place onto plate. Lightly scar the cotyledon's abaxial surface (flat side, upper surface that reaches toward sun) with a scalpel blade. Cut each cotyledon transversely into 2-3 pieces (no smaller than 1 cm). Add approximately 10 ml of prepared bacterial solution to each plate and allow cotyledons to incubate for 1 hr. Remove the bacteria using a vacuum aspirator fitted with sterile pipette tip, ensure that there is no standing liquid. Orient all explants with abaxial surface up and wrap plates for a 3 day co-culture, 25°C in light (16/8 photoperiod).

[000111] Hairy root selection and maintenance. After 3 day co-culture, wash explants with liquid Vi MSB5 + 500 mg/L carbenicillin. Transfer the explants abaxial side up to selection media, V₂ MSB5 supplemented with 500 mg/L carbenicillin and 200 mg/L kanamycin. Roots should develop in approximately 2-3 weeks. The roots will form primarily from the cut vascular bundles with other roots developing from the small cuts on cotyledon surface. Remove roots (>lcm in length) and place onto replica media with transfers to fresh media every 2 weeks to prevent Agrobacterium overgrowth. After 6-8 weeks on selection the roots can be moved to media without kanamycin, however carbenicillin must remain in media for several months for continued suppression of Agrobacterium. At this stage roots can be used for testing RNAi for nematode control. Sterilized nematodes can be added and observed for RNAi affects.

Example 4 — Testing of RNAi for Plant Parasitic Nematode Control.

[000112] Various types of nematodes can be used in appropriate bioassays. For example, Caenorhabditis elegans, a bacterial feeding nematode, and plant parasitic nematodes can be used for bioassay purposes. Examples of plant parasitic nematodes include a migratory endo-parasite, Pratylenchus scribneri (lesion), and two sedentary endo-parasites, Meloidogyne javanica (root-knot) and Heterodera schachtii (cyst).

[000113] C. elegans: RNAi vectors can be tested through expression of the RNAi in E. coli. C. elegans are fed E. coli and assayed for their growth by measuring growth of nematodes, production of eggs and viability of offspring. Another approach is to inject dsRNA directly into living nematodes. Finally, soaking nematodes in a solution of in vz^'trø-prepared RNAi can quickly establish efficacy of treatment.

[000114] P. scribneri: The P. scribneri in vitro feeding assay uses a corn root exudate (CRE) as a feeding stimulus and both the red dye Amaranth or potassium, arsenate as feeding indicators. Feeding is confirmed after seven days by the presence of red stained intestinal cells in live worms exposed to the Amaranth or death of worms exposed to arsenate. This bioassay is used to test soluble toxins or RNAi. P. scribneri has also been cultured on wild type roots of corn, rice and Arabidopsis, and on A. rhizogenes-induced hairy roots of sugar beet and tomato. P. scribneri is very valuable in evaluating transgenic hairy roots because of the non-specific feeding of these worms.

[000115] M javanica: Nematode eggs are sterilized using bleach and are used to inoculate hairy roots expressing RNAi. Nematodes are assessed for their growth by measuring knots, egg masses or production of viable eggs. An alternative approach is to microinject dsRNA directly into root feeding sites or into living female nematodes.

[000116] H schachtii: Cultures of this nematode were maintained on sugar beets. Nematodes eggs are sterilized using bleach and used to inoculate hairy roots expressing RNAi. Nematodes can be assessed for their growth by measuring knots, egg masses or production of viable eggs.

Example 5 — Plant Expression Vectors for RNAi

[000117] Modular Binary Construct System (MBCS): An important aspect of the subject disclosure is the Modular Binary Construct System. The MBCS eases the burden of construct development by creating modular pieces of DNA that can be easily added, removed, or replaced with the use of low frequency cutting restriction enzymes (8-base cutters). These constructs are useful for delivery of a variety of genes to plant cells and is not limited to the delivery of RNAi genes. To develop this system, a series of six, 8-base cutter restriction enzyme sites was placed between the left and right Ti borders of a previously created kan^R/tet^R binary plasmid (Figure 1). The production of both kan^R and tet^R MCBS aids the testing of constructs using different strains of Agrobacterium rhizogenes in different plant species. In addition to the MBCS, a series of shuttle vectors were created that aid in the cloning of useful DNA fragments by containing the multi-cloning site (MCS) of a modified Bluescript plasmid flanked by 8- base restriction sites (Figure 2). With six 8-base cutter sites, each site is, preferably, reserved for a particular function (Figures 3 and 4). Because of the close proximity of the Eme I and Sgfl sites to the left and right border of the binary vector, these sites are, preferably, reserved for gene tagging and enhancer trap experiments. The Not I site is, preferably, reserved for plant selectable markers (Figure 5). The Pac I site is reserved, preferably, for Plant Scorable Markers (Figure 6). The Asc I site is, preferably, reserved for RΝAi experiments (Figures 7 and 8), while the Sbfl site is, preferably, reserved for anti-nematode proteins. The restriction sites that are denoted in the Figures are, preferably, reserved for the denoted insertions; however, the MCBS binary and shuttle vectors do not require the restriction sites to contain these suggested inserts.

[000118] Plant Selectable Markers for MBCS: To further develop the MBCS, a series of plant selectable markers were added to the MBCS (Figure 5). Plant selectable markers that were added to the MBCS include: pΝOS/ΝPT-II/tΝOS (kan^R), pΝOS/Bar/tΝOS (basta^R for dicots), pUBI/Intron-Bar/tΝOS (basta¹¹ for monocots), and pUBI/Intron-PMI/tΝOS (mannitol isomerase¹¹). [000119] Reporter Genes for MBCS: Four exemplary reporter genes are used in the MBCS are provided in Figure 6 and Appendix 2. GUS, a nuclear localized GUS, GEP, and the anthocyanin transcriptional activator papIC genes into the MBCS.

[000120] Promoters for MBCS: We cloned several useful constitutive and nematode-inducible promoters (Figures 6, 7 and Appendix 2). Constitutive promoters include the SuperUbiquitin promoter from pine (pSU) and two promoter regions from the Strawberry Banding Vein virus (pSBVj and pSBV₂). Seven nematode-inducible promoters from Arabidopsis were also been cloned.

[000121] The following Scorable marker clones have been constructed and placed in the MBCS, NPT-II binary vector (pNOS/NPT-II/tNOS):

Intron/GUS/tNos Intron/NLS-GUS/tNOS Intron/GFP/tNOS pSU/Intron/GUS/tNOS pSU/Intron/NLS-GUS/tNOS pSU/Intron GFP/tNOS pSBV,/Intron GUS/tNOS pSBV,/Intron/NLS-GUS/tNOS pSBV ^Intron/GFP/tNOS pSBV₂/Intron/GUS/tNOS pSBV₂/Intron NLS-GUS/tNOS pSBV₂/Intron/GFP/tNOS pKT/Intron GFP/tNOS pKA/Intron/GFP/tNOS

Example 6 — Control of Plant parasitic nematodes using RNAi inplanta

[000122] Production of RNAi Vector. The RNAi shuttle vector to be used is adapted from the Modular Binary Construct System (MBCS - See Example 5). RNAi shuttle vectors preferably comprise a promoter, intron, antisense RNAi, stuffer fragment, sense RNAi, and terminator (See Figures 7 and 8 and Appendix 2 for more details). The plant promoter can be constitutive, tissue-specific or nematode-inducible. The intron is necessary to eliminate expression in Agrobacterium.

[000123] The anti-sense and sense RNAi molecules comprise nematode-specific sequences and are disclosed herein. These genes are associated with pathogenesis, growth, or other cellular function in nematodes. An exemplary group of RNAi sequences for use in plant/nematode control may be based upon:

[000124] 1. Genes specific for nematode esophageal gland cells.

[000125] 2. Genes specific for plant parasitic nematodes but not other free living nematodes. [000126] 3. Genes common to all plant parasitic nematodes.

[000127] 4. Genes common to all nematodes (nematode-specific).

[000128] 5. Genes specific for important tissues or cell types.

[000129] 6. Genes from large gene families.

[000130] 7. Genes involved in nematode signal transduction or other cellular pathways.

[000131] Appropriate RNAi constructs allow for the formation of dsRNA molecules (the sense and antisense strands join to form the dsRNA). The terminator sequence adds a poly-A tail for transcriptional termination. The RNAi shuttle vector can then be subcloned into the MBCS and transformed into Agrobacterium rhizogenes.

[000132] Plant Transformation with RNAi Vectors. An exemplary transformation system for generating hairy roots using Agrobacterium rhizogenes is provided below. The RNAi vector once introduced into the MBCS can subsequently (as a binary vector) be transformed in A. rhizogenes using, for example, the electroporation protocol of Example 2. Once the A. rhizogenes is confirmed to contain the plasmid, it is then used in generating hairy roots (See Example 3). Using this protocol transgenic hairy roots expressing RNAi are isolated, cultured and tested.

[000133] Testing of RNAi Vector for Nematode or Plant Pathogen Resistance. RNAi expressing hairy roots can be inoculated with sterilized nematodes. Infested hairy roots can be observed and the effect on nematodes determined. An alternative approach involves the microinjection of RNAi directly into root feeding sites (giant-cells for root- knot nematode, and syncytia for cyst nematodes) or into living female nematodes.

Example 7 - Insertion of Genes Into Plants

[000134] One aspect of the subject invention is the transformation of plants with genes encoding proteins of the present invention. Transformation of plants as described herein can be used to improve the resistance of these plants to attack by the target pest.

[000135] Genes, polynucleotides, and/or RNAi molecules as disclosed or suggested herein can be inserted into plant cells using a variety of techniques which are well known in the art. For example, a large number of cloning vectors, for example, pBR322, pUC series, M13mp series, pACYC184, pMON, etc., are available for preparation for the insertion of foreign genes into higher plants via injection, biolistics (microparticle bombardment), Agrobacterium tumefaciens, ox Agrobacterium rhizogenes- mediated transformation, or electroporation as well as other possible methods. Once the inserted DNA has been integrated into the genome, the genetically modified-cell(s) can be screened via a vector carried-selectable marker that confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, or bialophos, inter alia. The transformed cell will be regenerated into a morphologically normal plant. The transgene(s) in the transgenic plant is relatively stable and can be inherited by progeny plants.

[000136] If a transformation event involves a germ line cell, then the inserted DNA an corresponding phenotypic trait(s) will be transmitted to progeny plants. Such plants can be grown in the normal manner and crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have the corresponding phenotypic properties.

[000137] It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

Claims

We claim:

1. An RNAi molecule, optionally comprising a linker, wherein at least one strand of said RNAi is encoded by a DNA sequence selected from the group consisting of SEQ ID NO: 1 through SEQ ID NO: 139.

2. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 1.

3. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

2.

4. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 3.

5. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 4.

6. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

5.

7. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 6.

8. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

7.

9. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 8.

10. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 9.

11. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

10.

12. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 11.

13. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 12.

14. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 13.

15. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 14.

16. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 15.

17. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 16.

18. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 17.

19. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 18.

20. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 19.

21. An RNAi molecule according to claim 1 , wherein said DNA sequence is SEQ ID NO : 20.

22. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

21.

23. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

22.

24. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 23.

25. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 24.

26. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

25.

27. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 26.

28. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

27.

29. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 28.

30. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 29.

31. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 30.

32. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 31.

33. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

32.

34. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 33.

35. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 34.

36. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

35.

37. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 36.

38. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ DD NO : 37.

39. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 38.

40. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 39.

41. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 40.

42. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 41.

43. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 42.

44. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

43.

45. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 44.

46. An RN-Ai molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

45.

47. An RN-Ai molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 46.

48. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

47.

49. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 48.

50. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 49.

51. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 50.

52. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 51.

53. An RN-Ai molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

52.

54. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 53.

55. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

54.

56. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

55.

57. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 56.

58. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

57.

59. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 58.

60. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 59.

61. An RNAi molecule according to claim 1 , wherein said DNA sequence is SEQ ID NO : 60.

62. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 61.

63. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 62.

64. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 63.

65. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 64.

66. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

65.

67. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 66.

68. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 67.

69. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 68.

70. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 69.

71. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 70.

72. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 71.

73. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

72.

74. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 73.

75. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 74.

76. An RNAi molecule according to claim 1, wherein said DNA.sequence is SEQ ID NO: 75.

77. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

76.

78. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 77.

79. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 78.

80. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 79.

81. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 80.

82. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 81.

83. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 82.

84. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 83.

85. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 84.

86. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 85.

87. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 86.

88. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

87.

89. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 88.

90. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 89.

91. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 90.

92. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 91.

93. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 92.

94. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 93.

95. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 94.

96. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 95.

97. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 96.

98. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 97.

99. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO:

98.

100. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 99.

101. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 100.

102. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 101.

103. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 102.

104. ^■ An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 103.

105. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED NO: 104.

106. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 105.

107. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 106.

108. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 107.

109. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID NO: 108.

110. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 9.

111. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 0.

112. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 1.

113. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 2.

114. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID .

115. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 4.

116. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 5.

117. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED 6.

118. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 7.

119. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED 8.

120. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 9.

121. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 0.

122. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 1.

123. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED .

124. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID .

125. An RN-Ai molecule according to claim 1, wherein said DNA sequence is SEQ ID .

126. An RN-Ai molecule according to claim 1, wherein said DNA sequence is SEQ ID 5.

127. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 6.

128. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED .

129. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED 8.

130. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ED 9.

131. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 0.

132. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 1.

133. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 2.

134. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 3.

135. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 4.

136. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 5.

137. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 6.

138. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 7.

139. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 8.

140. An RNAi molecule according to claim 1, wherein said DNA sequence is SEQ ID 9.

141. A transgenic plant or transgenic plant tissue comprising an RNAi molecule according f the preceding claims.

142. A method of disrupting cellular processes in a nematode comprising the steps of:

(a) 'providing a composition comprising a compound according to any of the preceding claims; and

(b) contacting a nematode with said composition.

143. An isolated promoter comprising the following nucleotide sequence:

aacagcccaagataacagaaaagtcaaaggtgttcgaaa gaccacttgtgactaaggatcatttcatccataat atctggtagca cagactcatgataaetgcgaggaacacaagttctttacagtcgattc aaagacactttctctttacggtttcattgaaggagccgacccagaat atgtcagagaagcttttcactgtgggttaatttcattaatctatcca ggtgaaaacctcaaggagatctctcttctcccaaaagacctctacag ggcaatcaaaaactacagaaccagagtttgtagtgcacagagtagac caatctacctgagaatcacgagtaccttcctagagtgggaaaatgat gacatccttattccataccactggattgaggtaggactatccaatgg aaaaattccatgggacaagtcatataagaagaccgcaacagtcgagt atcttccagagataactgcactcagacctaaaaggataaaagcagta tataatcagtgtactaagatcttcgcagattcaaagaagaagcttaa ctatgctgatgacaagataattctaataagcaattattcagaattaa tcaaggagaaagaattaataactctttcagaa-tatgaagcccgcttt acaagtggccagctagc atcactgaaaagacagcaagacaatggtg tctcgatgcaccagaaccacatct gcagcagatgtgaagcagcca gagtggtccacaagacgcactcagaaaaggcatcttctaccgacaca gaaaaagacaaccacagctca catccaacatgtagactgtcgttat gcgtcggctgaagataagactgaccccaggccagcactaaagaagaa ataatgcaagtggtcctagctccactttagctttaataattatgttt cattattattctctgcttttgctctc atataaagagcttgtatttt catttgaaggcagaggcgaacacacacacagaacctccctgcttaca aaccatgtattgtagctaaacctcttaggag^! .

144. An isolated promoter comprising the following nucleotide sequence:

tggtggggacaatggatccggtctgcgtagcaacaaggctg aaaaagattaaacagaaacctgtgatcat agcgttggaccaccacc aaaacctcctgagccaccaaagcctccagagcctgaaaaaccaaagc ctccaccagcacctgaaccaccaaagcatgta gcaagccaccttac tgcaacagttgtgatgttgtgtctg actacc atgaaagtggaag cggctgcaccattctttgagtcatatatcgcgtaccatagccttcat gttaagtcctgta tagccaatactaattcatcatgttctcatgct tttttgtt atttctttttctcaaatatgaatctctgttgtttgtcc ctcccctgtttataattagtcgcttctttgacacaagaagtctcatg agttcatgctaaagaaaataaaagttcaaattaaaacaccaaatgtt tgattaatttccataaacctgtgaagcagaaagttagtcatgttgac ctgaacagagcttaggaagtccttgaaggaca atcttcaagtgcta ttgggtcgtagcactcttaggcccattaacttcattgagcccattaa a tatgcaaaacaagaaatgagacatatggaaacattagggttctta caggaaaaaataggaaaaagcagggacaactaaacaaaaattcagaa acaagaggcaagtggacgaccacggcgtaagatcaacatgtggtgat gtgcatgagaccaagaccattttttctcgttcttcaacgcacacttg gtcttttcttatgtttgttgcatttctttattaggcagaccctctct cttttttaataggatagtaaaaaatatatgattttattttgttgaaa cattttgagttaaaacctaaacttatagtaagcatttgtagagtgaa tttccta acgacatcta caacatgacctctaaccaaaaaaatatt gatgaaactact taagtagtaaaacctaaagcaattaaaatttcct ^• ttaaattagtagtttgtgtaaattaattgacatgattgcgtcgaaag aaatcaaaacag atatcgtgaacttaggagaatgttttatatcgt gtttcaacacatgattgctagcatatgtgtaggtgtcgtagacgtta cataacaatcatcactcgtaaatatcaaagtggtttctgagagaaac aaagggttatgattttcccaactgcactagttgtgtattgtttcttt cacacg a gct ctgagttctgcccaaagtggaaattaaagcagag ttgggagagatcataat tattagggttcgttatgctcaagtcatga cgtaaaatgaaaatttgtttttattctttcaccaacacaaagaatag ctagttatctctttttttatatataacaattcatgaagttgatcagc tttatacacatcatccaatcgaattgctaatctagagatggaaa at caggatagagccaataaga atcaaatccaatggacccattttctcc a gtgctaattcatacaatctgtttttgtctgcttta ttgatgatg atgctgagcgtttttaagtgtgaactaagatctagctaaccaaacaa aagatggtctcttctgtctttgtcgtataagagcaagagagtggttt gattcaatttttaaaattctaaataaaactccaaccgtgaatccagc catgaaactctttttagaaaatccttttttataacaaataattcctc tgcttcttcttcttcttcgtttatttcaccttttttggtttctttag ctcagaaaaagcccattctttttttctattcttgtttattttaatca tactgtgcgtttctacaaagtttgttcctttcttcttcaactctctc actcacagtcacagagatctgtttcttttctttttttgctttcactc ttctcttccagt*.

145. An isolated promoter comprising the following nucleotide sequence:

agcaaagcaagaacaccagagaagaagaaaagcactacaga gaaaaatgtgagcttaagcgctctccaacaacacttctctgggagtc taaaggatgctgcaaaaagccttggtggtgagacttccgca atttc caagcatgggtttatttttgttagcacacaaactatctgaccctcga cttggattttcttctgcagtttgtccaactacattgaaacggatatg caggcaacatggga catgaggtggccatctcgtaagattaacaaag tgaacaggtcactaaggaaaatacagacggtactggactcggtccaa ggtgtagaaggaggactaaagttcgactcagcaactggcgaa tcat tgcagttagaccttttattcaagaaattgatacccaaaagggtctgt cgtctcttgataatgatgcacatgcaagaagaagtcaggaggatatg cctgacgatacttcattcaagctccaggaagctaaatctgtcgacaa tgccattaagttagaggaggatacaaccatgaatcaagcaagaccag gtaagaacttctctatccataaaccatagatggagcgattagaatct taatccattttcagtttttgcaggatcattcatggaggttaatgcta gtggtcagccatgggcttggatggccaaagagtctggcttgaatggc agtgaaggaataaagagcgtttgcaacttaagctctgtggaaatttc agatggaatggatccaacaatccgatgcagtggcagta tgttgaac ctaaccaatccatgtcatgcagcatatcagattcatcaaatggc ca ggcgcagttctgcgtggaagctcatctacttccatggaagattggaa ccaaatgagaacccacaacagtaatagcagcgagagtggatcaacaa cgctgatcgtaaaggccagttatagagaagacactgtacgtttcaag ttcgagccatcagttgggtgtcctcagctctacaaagaagttggaaa • acgt ttaaactgcaggacgggtcgtttcagctgaagtac ggatg atgaagaagaatgggtgatgctggttacagattctgatctccaagaa tgtttggagatattacatggtatgggaaaacactcggtgaagtttct cgttcgtgatttgtctgcccctctaggtagttctggtggcagtaatg g tatcttggaacaggcttatgacgtcgtaagacatagacacacaca gttatgtattcccagtgaaagaatgttgt a tctctagatatta gtatgc tataaataggcatgaaggagaaagacaattttgg atagt ggagttcagcagaaaatgtatatgttttttcgttttatatgaatcag agaataaaagttggatgttatatctacgttgctaatgttgtacctgc tcacccatctttcatataagaaaagagaacacttttagttatccctg tgatgcagaatcgtattctttgttatctctccattcctgtggaaacc aacaaagtcaactaaatttcggtttaattggttggtttttaagtcaa cgaggact gattttagttgggcttgggccta aattgtg tca ca ttgggttttttcccccttatcagtttaacgtccatatccatatcttt ttctttttttaacggcaaagttcatatccatatcttatgatgtgcct aaaagagggagaagatgcgaagacagaattttcatatttgaaagggt tcgatatcgatattgggaaacgaatcaaggtcaaaaaactcagtcta atagttgaaatttaaaaatt tat aattcaatccgattggtttcgt tttgttatggttcggttctatatcatcaaaccaatcggtttggtcct aaagataattat aatattcaccaacaccagtgttaaacacata ca acaaacctaaagttagataaacaaagaga^; .

An isolated promoter comprising the following nucleotide sequence:

-aattggcactcttcttctgctgggttccaaaagaaacgaat caatatgtgcaacaagaagagctccagaagcagtca cttctaaaat cttaatctaacaacagctcaagaagaaaaaaattccatagctagaga gaacacaaagtcacaagacgacgtcgtagaggcacaaagtcaaacct gaatggcttaagccgaactgagtggttttgactagaccatcatcaga aaagtctccaagacggtagtcggatgttagatcgctcaagtaatttt tggttttgttggtctcacgttttcagctgcccatttgatttcagttt gggctt tcct a ctctaaaggcccaat tcatttaggtttagttt atttgatcattatccttactataaaggcttcgcctttcgagaaattt agggtttcttctgtctgtctcgtcactcaggtttgtgcctcaacgac tgcttcacttctagcttgattcttcttcttcgtttatatgtatactg tacattagat attcttgtttctcgagcttctgctatagattttgat tcttt ttttgttgtctttgtttcgtttccaggatcagatcttagct aaattgagacaagctcaaaatgaggtacttgacgcatctc taoatt cactgtttaattagagaacaatapgtctctgaatcgtgattcagaga cgtattgttcttctgtcatatgcaataagtttaattagagaacaata cgtctctgaatcgtgattgttttttggatgtgcgttattgatagctt tatgatgttaatagtctaggattgacacgaagttgttctgcagtttt gcataaatgctctttactaaggcctctaaatttggatgacaaatcta aatcttgcc cataaaaatttaggtgtattaagataagattat ttg tatggtagtgtctataatgtgggttgttcatgttgaggttgtcaatg ttgtgtatttttgtttgtttagttaatttgcttaactctgttctttg tgggttaatacagtaagcttcagagtgaggccgttcgtgaagccatc actactatcacagggaaatccgaggcaaagaaacgtaactttgtcga gactattgagctccagatcggtctgaagaactatgaccctcaaaagg acaagcgtttcagtggatctgtcaagttaccacatatcccccgtcct aaaatgaagatctgcatgctcggagatgcccagcatgttgaagaggt gata a cttttcatggaaattgatcattttgtgctctgtttcttgt ataatggttttgtgctcatttcatttggtggctctattagtttca t tgatgttgtatatgtcttctgaatgtagatgcatgatgttttcggaa tttggtcattgt tat taggcttca ttcttgcataattaaata t tgctta tcatct gtatct ttcgtaggctgagaagatggggttg gaaaacatggatgttgagtctctaaaaaagct aacaagaacaagaa actcgtcaagaagcttgcaaagaaataccatgctttcttggcctctg agtctgtcattaagcagattcctcgtcttcttggtcctggtcttaac aaggcaggcaagttctggctacagctaatattccattgttcttcttt acatccgttttgattttggataggttttagtagtctatttcttttgt caatgtctttttgatacaatgccaatcctt atcctgtgagattatg cttctttgatgattcttaagtaacattcctttgctttactttacaca ggaaaattcccaactcttgtgagccaccaggaatccttggagtcaaa ggtgaatgaaacaaaggcaacagtgaagttccagctgaagaaggttc tgtgcatgggagttgcagttggtaaccttt .

7. An isolated promoter comprising the following nucleotide sequence:

•tggcaaactgagatataagagggaaggtgattttcatgcaa attttttttttatttttttttgaatgaatgcaaaatttattcaaaaa aaaaaaacctgggctacatcaagtacttcatttctgagtttttgaaa aatctaaagacaacaaaagactttacaatttaataaaaaaataataa aaatactttatcactctcaacgaaattgttgatttaataacgtatct cttggtaaaacagcgttttat tgacgaaattgttataaatgaataa aatgataatagaaactagtgtggtacgtaaaatacctctcatttggc aaaataacggttatg atcatgagtat gcatacgacagcgtgctta aatagtgtgctttcaggagaaaatatataccaag at tgctgaaa ttaccacgcaaatctgaggttcgaatggcaaaataaaaaaccaatgt catttccttaatgtattaaggtcatttaaataaaattgtacactttt ttcacctgtaagcgttccaaagtgtagaatggataactagaagggtc aaaggta aata taataagcgaactcactttttgcccaagtgattt cacttcttacatttgcttgatatagttacccaaaagtgtatatatat tcccttatacaattgttctattttctggattataaggggaataagaa aaaagaaaagagagagtatataataatactttt taaagtgatgtta gattctaatttgtaacgaaaagttcaaagtgaaagaaaaaacgaaaa agttt tctgttttgttttatatctatagccaagaaagtttctcaga tttacaagaagttaactgagaaaaacaaaaaaaaaacttatgaagca tgaaagactaattaacgaggtgattaattttgagacaaattaaacat cgaattaaaagtaacatttggagggtttatatgtta atatgtgaca tgataagtccgattcatgactaatgtatatctggaatctaacatgga agaatagagaacgaagcagagccaaggtcaacttgccagacacgaat caacagattgtgaatgagaccaaatcaatggtcataaaccggttggg tttaaaccggcaagtcatccttggctcaattccattcg tattcctt catgcaagaccctctgatacaaccaaagactcccattacaatattct ttcgatcacgagctacttat ttcaaatgtgttacctctttcgtgac tcttgtgttgtgtggtaaagcctagtcgagatgtgtcggtata ata ggcatacatatacaaatgcgacaaaataagtatattatattgtttaa tttctatattccatttctatatgcatggctgggatttttgaccaaaa ccctaattcaagaatagaatccaaaagatgggatcaaagaatataat ctaatgggctgaccacattttccgatttaattcgcatagttaa at ctttccactactttatgccgcagaaatttgtaattaagtaagacaaa gaaatacagatataagatggtcgtagaaaccagtagaggaatttcat ttttcgtggataagtggaatattaataagagaatggtctttactct tacagtgggaaatgggaatagtagcccattataatttca cagattc tatatatgcatgtttgtataagctaaaataaatacgtttaagcattc ttcaaaaaaatttacaagttctagagactctcttaacgtcggcaatt tatattctactttacatgacactttcaggaaaagaaaactatactca ctagcagatcattaaattttctttttctttttttgaatgaaccttag ttgtggtttttatttttgttagctagaaacttcagtgttttttttcc gccaatggtagtgctttgatgatggtccgg' .

148. An isolated promoter comprising the following nucleotide sequence:

caatcaaggtaacgaaggaggatcagcgaaaggatgggcta ta tggagttttttcctgcgtgtaagtaatgctttgtgatcttcca tgcggacata aactgaagaataaactcaactcattgtgttctggtg tgtttcttctgatcaga tcctcgttgcatctgcacttttctgctgt gggggctt at tataaaacaagagtagagcgtgtggtaatcttcat atctttctacaattccacttccattctctaattattctctcacgtga tatacacacactcaatcactgatgtactcgtatggatgcagcgtgga actgatgcattgccggggatgtcacttctatcgggcttactagaaac tgtaagta tacaagaaaactcaaaaggattccatttatgcaaaatc taagagaaagctcactgtggtctttggttacaatttatggatc ctc aagagacaaatgctatgtaagctaattgattttggtcttgataaaca ggtgagtggaagtggacaaagctactcaagaactgaagacatcaaca atgcttttgccaatgaagtctcatgggaccgctcttccgcatcttct actcaagcgacaacaacacagagaccaagtgaaagaacata ggtgc gatctaattttgtcaagtgcctcacaagaggtactgtttcaagccat ggtatggcacgcttgtgatctgcgatttctggattttgctttgtatg tttattttctacc tctagaaagaggtcaaaaagttaatagc tcac cgtgagaatgttgttttcaccagattcatgtgctatgatagaaaaag acaaagcaaacaagagttctttctttgcttaggttacaagaacaaga gtatcgttataaagtcaacaaagattgaaacatatttttgtcaaggg agtggttagaatctcttcctactctcttgcctttctcactaagacaa aaaaaagacttggactttgtctaaggttttgtggatattat aacca agtccttttgcaaaaagtaatattgttttttcgcattcctcttttag aatttagt taatctaggctttatattggttattactttcttgaaaa atgatctgtttattctattcatacttggttacctcgctttttatctt act ctacaaaaggattatcagtgaaagttagtctcttactctcacc ttccgaaaataaaacaaaaatatcgatacttctagatcaaaccaagt tgattaaaacatccctattccctacgattctgatcttgagatatatt atcatgttaagatctaaattgacaagaaaactgatttttcatttcta gtaggaaaaataattactattagtgatcatgattgtcgaccgtaaga ggtggtttagttactctccatctttct tgaagaagtcagaaagtca gaaattatatcaaattaaacatcaatattgaacacata atctgtat ggttttatgtttagaaaattccaatatttatatattcctagggaaaa agaagcttattcttcaaat attgttatgagtcgttaaaatatggat aaaaatataaagtctaaatattaaaaactcagtttgctttgctttta cctctccaagtctccaaagtcaaattaattttagttaattaaaccaa aaaaggtttattagtcaaacttagcatgcaatgctgggtaccaaacc caagcattagtctcttttaatcttctttttctccaataagtttttac aatttttaattgtttgcatttcccttgattatttatcttcatcccaa tttagctaataccaactccgtttcttattcttccaagtcttttccta taaatacgttcttcttcccctcttatttcatatcactcaccacaaag tcttctcatttcctcat .

. An isolated promoter comprising the following nucleotide sequence:

atgttgtgagtgaaggagaagaagagggaaacaaaggtatt tatttgtagcgagttttgttttgtgacgcggttttgtctgtgttcaa tgttgacgaaacgagtgagagagtgtctgattattaaagaaaaccct aattaagtcagacccgccggttataaaaatagtcaaaaagtaggaaa acgcgtgtgtgagtgagacagagacagcccattgtttgctttatggg cttataagcgagacgtgttaattgggctttttcctttatggccgaaa acaaaagaaacgtcgcctgagagattcgaactctcgcgggcagagcc catgtacttagcaggcacacgccttaaccactcggccaaagcgactt gttgctatgagttagacaaaatcattaaaattctctattatgatttc tcatagtgtgtgtgtatattgtggatctactaaaaattctttgttat tattactttat ttgtgaattagtttgatataggtaagtacaaagtt aactttattatttactcaaaatttatcagattaactgattttatatt gtttcctttggtatatagacgtactatagtttttagaaaaaccataa gattcct atatttcatagagtgaagagatgagatgagatcttggc tggagaagaaataagtttccacgaggaggactctttttttttggtga agacgaggaggaggactcttggttgatccagtctttacgttagacat cgacccctacatttatttgcctttctctatcaacatggcaggtaaaa atcttcattcaaccgaaccaaccaaagtctcttcccaataa attca agcaccatcctttgggaaactcatacatactacagtctacactcttt cattttctttcaacgctcaacttaacaaatgatatagtctagttgtc aattatatgttttaattagtgttttcacatcaaattctggtttgata tttgatgactattttcggaaacatctcaatgtcccgcaaatacaatc gtctatcatatataatcccgtacgttgtat cttatagatagaataa tatggcgtgatctttataatataacatatagaatcgtgtagat tat tttattttatttttatatatcgcataaattgcaaaatacttatatat gtttgttatatatgatacccattttatagttacttaaaaaaagttaa gcgataatatatatatatcaactttttataacaaaaaagtataacac atggtaaagaaaaataaaaatgaagacatggtgtgacacgaaaatgg cactaaatatacatatataatagatagc acaata ccca cataca cacttttttaattgactaatacataacttacacacttttttaattga ctaattcataactttttatcattgtcaacatgcaaattcatatttcc gttgaactattattcttattttgtttttaaaagaagggcttcctggt aataaaaatatgatttccaaatgacgttagagcaaaaaaaaaaaaag gttgtctggtctggtaaaatgaaaaagcaaagcgtcttggtatagaa aagtaatatactgcctcctaatttcttcgtccttctaccgaagaatc tctccactcttgccctctttcgaaaccctaaaccagaagcaccagat tttttcaactttttcccagagaacaatagaaaacccaacttgtgctc tctagggttttctttattccttctcatctttggattttcttgggtca tcattttggaagcttacccaccagcgaaaaaattataacttccatcg attcctggcttctctctctcgctctctctgcatgtgctaaatcgccg gactgatcctcactgtcacctctgtt .

. An isolated promoter comprising the following nucleotide sequence:

ga aggggtttgagttgtcactggaaagaggtttgattgt gagtgatgatggagagattatgaaggagtttgtgtgtatttatagag gagttagggttttgaggtttgatgagaagtaggtttgaagaagtttt gttgttgcaactta ttagagttacttgttccacaaccacaagtaag attggtcacttctaagttctaactagaaacaaccatgacacatggag atttcagctaacctagtttaatgtatatgtattatattttatttaaa tattataaaataaaataaattttcacaaataaaagaactacaaaaaa gtgagaaaaataatttgataaacaaatttagaaaattagtatatcaa taaataaatttataatccgatggttttgccttttggtttggcctttg tttgaacttcgatgagtgactatgtatagcgaaaacaattcggtttg tttttggtttaattttaaaaaatacaagcgacaatatctgatgagaa taggtgaaaagcaaataatatcagtttaattggaaatat act tt ttacaactaatattttgtttggtcaaccaacaaatagatttaattaa ttatggtttatgagcttttatttgttgcgacagtatatatatgttaa aatagtgata tgcatggcggaaggtccggaagcaacacatatctcc tttttaattttttttttaacaagaataacatgttaatttttttttga aattaataaagaatacatatttctaatttttgcgtcagatagatgat taaagagtgtgtgttttttttaacaaacaaggaatacattatacata tttcatatttctctcgacattgtttgtttttttaaaaaatagattaa agagtctacgaagctaagtagctaacgaagacttgaaatgagaagaa gacgagaatcttttaatattttttgttaagcgataatattttgaaaa ttaataaatatagattaaggaaataacaataacgcagatatcgg aa gtcatagaaaaaaagaaacaacacaaacttacataaacatgtttcct aatttgtaatggagtaaaattccttcttttttttttttttttgattt ggattccaattagtaaagaactcaatgactataaataacctttaacc ctctcattatttcttactatcaattgattaagctctcgttcc aaga aagcaatagacgaacaagaacccatcgaagaacacaaatctctcttt gaagttgtcgataatgttagtacaccgttacttcgtccaagactttt ttgccgttccgtttcttacaaaacaaggatttggttacca tacttt tgtcgtaactcctttttacatgtacgtcaaaaagtggttcctcgctc cggcttgaagaaacgaccttcttacccacaaaaagcttattttaaac cgtctaaaaccggaaaatctcaatctaaaccggatacggttea gag aaaccgattcaaacaccgagtgaagaagtagaattttttgatggttc cgtcacaatgtgtgctgctccttcgccaagacatgtaccgattccga tattttgtggtgtaaagatgatcaaagagtcttcaaagctaagcacg acttgaatgagaagaagaagaccaattactcaattagattttgtttt gtggagcaattattgtctatttatctttgtttttagcaaataatctg tatccactaatcttcacagtacttgactaacaagaagtaaagagttt tcttatttccaattgttttttaatctgatacttttttcataatttta caatgtttgatgaaaaaaaacattcaaacctaaattttctttttttg gtatgaattcaaacctgaattact ttgacgaggacccgacggtata aatagggtgatctcccaacaaacaaaaagggt .

151. A transgenic plant or transgenic plant tissue comprising an isolated promoter according to any of claims 143 through 150.

54 APPENDIX 1

56

57

58

59

Appendix 2:

Exemplary genes used for RNAi vectors. Promoters:

Constitutive:

Super Ubiquitin from Pine

CCCGGGAAAACCCCT CACAAATACATAAAAAAAATTCTTTATTTAATTATCAAACTCTCCACTACCTT TCCCACCAACCGTTACAATCCTGAATGTTGGAAAAAACTAACTACATTGATATAAAAAAACTACATTA CTTCCTAAATCATAT CAAAATTGTATAAATATATCCACTCAAAGGAGTCTAGAAGATCCACTTGGACA AATTGCCCATAGTTGGAAAGATGTTCACCAAGTCAACAAGATTTATCAATGGAAAAATCCATCTACCA AACTTACTTTCAAGAAAATCCAAGGATTATAGAGTAAAAAATCTATGTATTATTAAGTCAAAAAGAAA ACCAAAGTGAACAAATATTGATGTACAAGTTTGAGAGGATAAGACATTGGAATCGTCTAACCAGGAGG CGGAGGAATTCCCTAGACAGTTAAAAGTGGCCGGAATCCCGGTAAAAAAGATTAAAATTTTTTTGTAG AGGGAGTGCTTGAATCATGTTTTTTATGATGGAAATAGATTCAGCACCATCAAAAACATTCAGGACAC CTAAAATTTTGAAGTTTAACAAAAATAACTTGGATCTACAAAAATCCGTATCGGATTTTCTCTAAATA TAACTAGAATTTTCATAACTTTCAAAGCAACTCCTCCCCTAACCGTAAAACTTTTCCTACTTCACCGT TAATTACATTCCTTAAGAGTAGATAAAGAAATAAAGTAAATAAAAGTATTCACAAACCAACAATTTAT TTCTTTTATTTACTTAAAAAAACAAAAAGTTTATTTATTTTACTTAAATGGCATAATGACATATCGGA GATCCCTCGAACGAGAATCTTTTATCTCCCTGGTTTTGTATTAAAAAGTAATTTATTGTGGGGTCCAC GCGGAGTTGGAATCCTACAGACGCGCTTTACATACGTCT CGAGAAGCGTGACGGATGTGCGAC CGGAT GACCCTGTATAACCCACCGACACAGCCAGCGCACAGTATACACGTGTCATTTCTCTATTGGAAAATGT CGTTGTTATCCCCGCTGGTACGCAACCACCGATGGTGACAGGTCGTCTGTTGTCGTGTCGCGTAGCGG GAGAAGGGTCTCATCCAACGCTATTAAATACTCGCCTTCACCGCGTTACTT CTCATCTTTTCT CTTGC GTTGTATAATCAGTGCGATATTCTCAGAGAGCTTTTCATTCAACCCGGG

Strawberry Banding Vein Virus 1 aagcttttcactgtgggttaatttcattaatctatccaggtgaaaacctcaaggaga tctctcttctcccaaaagacctctacagggcaatcaaaaactacagaaccagagttt gtagtgcacagagtagaccaatctacctgagaatcacgagtaccttcctagagtggg aaaatgatgacatccttattccataccactggattgaggtaggactatccaatggaa aaattccatgggacaagtcatataagaagaccgcaacagtcgagtatcttccagaga taactgcactcagacctaaaaggataaaagcagtatataatcagtgtactaagatct tcgcagattcaaagaagaagctt

Strawberry Banding Vein Virus 2

Gtttaaacaacagcccaagataacagaaaagtcaaaggtgttcgaaagaccacttgt gactaaggatcatttcatccataattatctggtagcacagactcatgataactgcga ggaacacaagttctttacagtcgattcaaagacactttctctttacggtttcattga aggagccgacccagaatatgtcagagaagcttttcactgtgggttaatttcattaat ctatccaggtgaaaacctcaaggagatctctcttctcccaaaagacctctacagggc aatcaaaaactacagaaccagagtttgtagtgcacagagtagaccaatctacctgag aatcacgagtaccttcctagagtgggaaaatgatgacatccttattccataccactg gattgaggtaggactatccaatggaaaaattccatgggaσaagtcatataagaagac cgcaacagtcgagt tcttccagagataactgcactcagacctaaaaggataaaagc agtatataatcagtgtactaagatcttcgcagattcaaagaagaagcttaactatgc tgatgacaagataattctaataagcaattattcagaattaatcaaggagaaagaatt aataactctttcagaatatgaagcccgctttacaagtggccagctagctatcactga aaagacagcaagacaatggtgtctcgatgcaccagaaccacatctttgcagcagatg tgaagcagccagagtggtccacaagacgcactcagaaaaggcatcttctaccgacac agaaaaagacaaccacagctcatcatccaacatgtagactgtcgttatgcgtcggct gaagataagactgaccccaggccagcactaaagaagaaataatgcaagtggtcctag ctccactttagctttaataattatgtttcattattattctctgcttttgctctctat ataaagagcttgtattttcatttgaaggcagaggcgaacacacacacagaacctccc tgcttacaaaccatgtattgtagctaaacctcttaggaggatatc 60

Nematode Inducible:

Trypsin Inhibitor from Arabidopsis (clone#6598343) cccgggagcaaagcaagaacaccagagaagaagaaaagcactacagagaaaaatgtg agcttaagcgctctccaacaacacttctctgggagtctaaaggatgctgcaaaaagc cttggtggtgagacttccgcatatttccaagcatgggtttatttttgttagcacaca aactatctgaccctcgacttggattttcttctgcagtttgtccaactacattgaaac ggatatgcaggcaacatgggatcatgaggtggccatctcgtaagattaacaaagtga acaggtcactaaggaaaatacagacggtactggactcggtccaaggtgtagaaggag gactaaagttcgactcagcaactggcgaattcattgcagttagaccttttattcaag aaattgatacccaaaagggtctgtcgtctcttgataatgatgcacatgcaagaagaa gtcaggaggatatgcctgacgatacttcattcaagctccaggaagctaaatctgtcg acaatgccattaagttagaggaggatacaaccatgaatcaagcaagaccaggtaaga acttctctatccataaaccatagatggagcgattagaatcttaatccattttcagtt tttgcaggatcattcatggaggttaatgctagtggtcagccatgggcttggatggcc aaagagtctggcttgaatggcagtgaaggaataaagagcgtttgcaacttaagctct gtggaaatttcagatggaatggatccaacaatccgatgcagtggcagtattgttgaa cctaaccaatccatgtcatgcagcatatcagattcatcaaatggctcaggcgcagtt ctgcgtggaagctcatctacttccatggaagattggaaccaaatgagaacccacaac agtaatagcagcgagagtggatcaacaacgctgatcgtaaaggccagttatagagaa gacactgtacgtttcaagttcgagccatcagttgggtgtcctcagctctacaaagaa gttggaaaacgttttaaactgcaggacgggtcgtttcagctgaagtacttggatgat gaagaagaatgggtgatgctggttacagattctgatctccaagaatgtttggagata ttacatggtatgggaaaacactcggtgaagtttctcgttcgtgatttgtctgcccct ctaggtagttctggtggcagtaatggttatcttggaacaggcttatgacgtcgtaag acatagacacacacagttatgtattcccagtgaaagaatgttgtttatttctctaga tattagtatgcttataaataggcatgaaggagaaagacaattttggtatagtggagt tcagcagaaaatgt tatgttttttcgttttatatgaatcagagaataaaagttgga tgttatatctacgttgctaatgttgtacctgctcacccatctttcatataagaaaag agaacacttttagttatccctgtgatgcagaatcgtattctttgttatctctccatt cctgtggaaaccaacaaagtcaactaaatttcggtttaattggttggtttttaagtc aacgaggacttgattttagttgggcttgggcctataattgtgttcatcattgggttt tttcccccttatcagtttaacgtccatatccatatctttttctttttttaacggcaa agttcatatccatatcttatgatgtgcctaaaagagggagaagatgcgaagacagaa ttttcatatttgaaagggttcga atcgatattgggaaacgaatcaaggtcaaaaaa ctcagtctaatagttgaaatttaaaaattttatt attcaatccgattggtttcgtt ttgttatggttcggttctatatcatcaaaccaatcggtttggtcctaaagataatta taaatattcaccaacaccagtgttaaacacat tcaacaaacctaaagttagataaa caaagagacccggg

Arabidopsis Transmembrane Protein from Arabidopsis (clone#6468048) cccgggaattggcactcttcttctgctgggttccaaaagaaacgaatcaatatgtgc aacaagaagagctccagaagcagtcatcttctaaaatcttaatctaacaacagctca agaagaaaaaaattccatagctagagagaacacaaagtcacaagacgacgtcgtaga ggcacaaagtcaaacctgaatggcttaagccgaactgagtggttttgactagaccat catcagaaaagtctccaagacggtagtcggatgttagatcgctcaagtaatttttgg ttttgttggtctcacgttttcagctgcccatttgatttcagtttgggcttttcctta tctctaaaggcccaatttcatttaggtttagtttatttgatcattatccttactata aaggcttcgcctttcgagaaatttagggtttcttctgtctgtctcgtcactcaggtt tgtgcctcaacgactgcttcacttctagcttgattcttcttcttcgtttatatgtat actgtacattagattattcttgtttctcgagcttctgctatagattttgattctttt ttttgttgtctttgtttcgtttccaggatcagatcttagctaaattgagacaagctc aaaatgaggtacttgacgcatctcttacattcactgtttaattagagaacaatacgt ctctgaatcgtgattcagagacgtattgttcttctgtcatatgcaataagtttaatt agagaacaatacgtctctgaatcgtgattgttttttggatgtgcgttattgatagct 61 ttatgatgttaatagtctaggattgacacgaagttgttctgcagttttgcataaatg ctctttactaaggcctctaaatttggatgacaaatctaaatcttgcctcataaaaat ttaggtgtattaagataagattattttgtatggtagtgtctataatgtgggttgttc atgttgaggttgtcaatgttgtgtatttttgtttgtttagttaatttgcttaactct gttctttgtgggttaatacagtaagcttcagagtgaggccgttcgtgaagccatcac tactatcacagggaaatccgaggcaaagaaacgtaactttgtcgagactattgagct ccagatcggtctgaagaactatgaccctcaaaaggacaagcgtttcagtggatctgt caagttaccacatatcccccgtcctaaaatgaagatctgcatgctcggagatgccca gcatgttgaagaggtgatatatcttttcatggaaattgatcattttgtgctctgttt cttgtataatggttttgtgctcatttcatttggtggctctattagtttcatttgatg ttgtatatgtcttctgaatgtagatgcatgatgttttcggaatttggtcattgttta tttaggcttcatttcttgcataattaaatatttgcttatttca cttgtatcttttc gtaggctgagaagatggggttggaaaacatggatgttgagtctctaaaaaagcttaa caagaacaagaaactcgtcaagaagcttgcaaagaaataccatgctttcttggcctc tgagtctgtcattaagcagattcctcgtcttcttggtcctggtcttaacaaggcagg caagttctggctacagctaatattccattgttcttctttacatccgttttgattttg gataggttttagtagtctatttcttttgtcaatgtctttttgatacaatgccaatcc tttatcctgtgagattatgcttctttgatgattcttaagtaacattcctttgcttta ctttacacaggaaaattcccaactcttgtgagccaccaggaatccttggagtcaaag gtgaatgaaacaaaggcaacagtgaagttccagctgaagaaggttctgtgcatggga gttgcagttggtaacctttcccggg

Diaminopimelate Decarboxylase from Arabidopsis (clone#4159709) cccgggtggcaaactgagatataagagggaaggtgattttcatgcaaattttttttt tatttttttttgaatgaatgcaaaatttattcaaaaaaaaaaaacctgggctacatc aagtacttcatttctgagtttttgaaaaatctaaagacaacaaaagactttacaatt taataaaaaaataataaaaatactttatcactctcaacgaaattgttgatttaataa cgtatctcttggtaaaacagcgttttatttgacgaaattgttataaatgaataaaat gataatagaaactagtgtggtacgtaaaatacctctcatttggcaaaataacggtta tgtatcatgagtattgcatacgacagcgtgcttaaatagtgtgctttcaggagaaaa tatataccaagttatttgctgaaattaccacgcaaatctgaggttcgaatggcaaaa taaaaaaccaatgtcatttccttaatgtattaaggtcatttaaataaaattgtacac ttttttcacctgtaagcgttccaaagtgtagaatggataactagaagggtcaaaggt ataatattaataagcgaactcactttttgcccaagtgatttcacttcttacatttgc ttgatatagttacccaaaagtgtatatatattcccttatacaattgttctattttct ggattataaggggaataagaaaaaagaaaagagagagtatataataatacttttata aagtgatgttagattctaatttgtaacgaaaagttcaaagtgaaagaaaaaacgaaa aagtttttctgttttgttttatatctatagccaagaaagtttctcagatttacaaga agttaactgagaaaaacaaaaaaaaaacttatgaagcatgaaagactaattaacgag gtgattaattttgagacaaattaaacatcgaattaaaagtaacatttggagggttta tatgttatatatgtgacatgataagtccgattcatgactaatgtatatctggaatct aacatggaagaatagagaacgaagcagagccaaggtcaacttgccagacacgaatca acagattgtgaatgagaccaaatcaatggtcataaaccggttgggtttaaaccggca agtcatccttggctcaattccattcgttattccttcatgcaagaccctctgatacaa ccaaagactcccattaςaatattctttcgatcacgagctacttattttcaaatgtgt tacctctttcgtgactcttgtgttgtgtggtaaagcctagtcgagatgtgtcggtat atataggcatacatatacaaatgcgacaaaataagtatattatattgtttaatttct atattccatttctatatgcatggctgggatttttgaccaaaaccctaattcaagaat agaatccaaaagatgggatcaaagaatataatctaatgggctgaccacattttccga tttaattcgcatagttaatattctttccactactttatgccgcagaaatttgtaatt aagtaagacaaagaaatacagatataagatggtcgtagaaaccagtagaggaatttc atttttcgtggataagtggaat ttaataagagaatggtctttactctttacagtgg gaaatgggaatagtagcccattataatttcatcagattctatatatgcatgtttgta taagctaaaataaatacgtttaagcattcttcaaaaaaatttacaagttctagagac tctcttaacgtcggcaatttatattctactttacatgacactttcaggaaaagaaaa ctatactcactagcagatcattaaattttctttttctttttttgaatgaaccttagt tgtggtttttatttttgttagctagaaacttcagtgttttttttccgccaatggtag 62 tgctttgatgatggtccggcccggg

Peroxidase from Arabidopsis (clone#4006885) cccgggcaatcaaggtaacgaaggaggatcagcgaaaggatgggctatatttggagt tttttcctgcgtgtaagtaatgctttgtgatcttccatgcggacatataactgaaga ataaactcaactcattgtgttctggtgtgtttcttctgatcagattcctcgttgcat ctgcacttttctgctgtgggggctttatttataaaacaagagtagagcgtgtggtaa tcttcatatctttctacaattccacttccattctctaattattctctcacgtgatat acacacactcaatcactgatgtactcgtatggatgcagcgtggaactgatgcattgc cggggatgtcacttctatcgggcttactagaaactgtaagtattacaagaaaactca aaaggattccatttatgcaaaatctaagagaaagctcactgtggtctttggttacaa tttatggatctctcaagagacaaatgctatgtaagctaattgattttggtcttgata aacaggtgagtggaagtggacaaagctactcaagaactgaagacatcaacaatgctt ttgccaatgaagtctcatgggaccgctcttccgcatcttctactcaagcgacaacaa cacagagaccaagtgaaagaacatatggtgcgatctaattttgtcaagtgcctcaca agaggtactgtttcaagccatggtatggcacgcttgtgatctgcgatttctggattt tgctttgtatgtttattttctaccttctagaaagaggtcaaaaagttaatagcttca ccgtgagaatgttgttttcaccagattcatgtgctatgatagaaaaagacaaagcaa acaagagttctttctttgcttaggttacaagaacaagagtatcgttataaagtcaac aaagattgaaacatatttttgtcaagggagtggttagaatctcttcctactctcttg cctttctcactaagacaaaaaaaagacttggactttgtctaaggttttgtggatatt attaaccaagtccttttgcaaaaagtaatattgttttttcgcattcctcttttagaa tttagtttaatctaggctttatattggttattactttcttgaaaaatgatctgttta ttctattcatacttggttacctcgctttttatcttacttctacaaaaggattatcag tgaaagttagtctcttactctcaccttccgaaaataaaacaaaaatatcgatacttc tagatcaaaccaagttgattaaaacatccctattccctacgattctgatcttgagat atatta catgttaagatctaaattgacaagaaaactgatttttcatttctagtagg aaaaataattactattagtgatcatgattgtcgaccgtaagaggtggtttagttact ctccatctttctttgaagaagtcagaaagtcagaaattatatcaaattaaacatcaa tattgaacacatatatctgtatggttttatgtttagaaaattccaatatttatat t tcctagggaaaaagaagcttattcttcaaattattgttatgagtcgttaaaatatgg ataaaaatataaagtctaaatattaaaaactcagtttgctttgcttttacctctcca agtctccaaagtcaaattaattttagttaattaaaccaaaaaaggtttattagtcaa acttagcatgcaatgctgggtaccaaacccaagcattagtctcttttaatcttcttt ttctccaataagtttttacaatttttaattgtttgcatttcccttgattatttatct tcatcccaatttagctaataccaactccgtttcttattcttccaagtcttttcctat aaatacgttcttcttcccctcttatttcatatcactcaccacaaagtcttctcattt cctcatcccggg

Mitochondrial ϋncoupler from Arabidopsis (clone#4220510) cccgggatgttgtgagtgaaggagaagaagagggaaacaaaggtat tatttgtagc gagttttgttttgtgacgcggttttgtctgtgttcaatgttgacgaaacgagtgaga gagtgtctgattattaaagaaaaccctaattaagtcagacccgccggttataaaaat agtcaaaaagtaggaaaacgcgtgtgtgagtgagacagagacagcccattgtttgct ttatgggcttataagcgagacgtgttaattgggctttttcctttatggccgaaaaca aaagaaacgtcgcctgagagattcgaactctcgcgggcagagcccatgtacttagca ggcacacgccttaaccactcggccaaagcgacttgttgctatgagttagacaaaatc attaaaattctctattatgatttctcatagtgtgtgtgtatattgtggatctactaa aaattctttgttattattactttattttgtgaattagtttgatataggtaagtacaa agttaactttattatttactcaaaatttatcagattaactgattttatattgtttcc tttggtatatagacgtactatagtttttagaaaaaccataagattcctttatatttc atagagtgaagagatgagatgagatcttggctggagaagaaataagtttccacgagg aggactctttttttttggtgaagacgaggaggaggactcttggttgatccagtcttt acgttagacatcgacccctacatttatttgcctttctctatcaacatggcaggtaaa aatcttcattcaaccgaaccaaccaaagtctcttcccaataatat caagcaccatc ctttgggaaactcatacatactacagtctacactctttcattttctttcaacgctca acttaacaaatgatatagtctagttgtcaattatatgttttaattagtgttttcaca 63 tcaaattctggtttgatatttgatgactattttcggaaacatctcaatgtcccgcaa atacaatcgtctatcatatataatcccgtacgttgtattcttatagatagaataata tggcgtgatctttataatataacatatagaatcgtgtagatttattttattttattt ttatatatcgcataaattgcaaaatacttatatatgtttgttatatatgatacccat tttatagttacttaaaaaaagttaagcgataatatatatatatcaactttttataac aaaaaagtataacacatggtaaagaaaaataaaaatgaagacatggtgtgacacgaa aatggcactaaatatacatatataatagatagctacaatatcccatcatacacactt ttttaattgactaatacataacttacacacttttttaattgactaattcataacttt ttatcattgtcaacatgcaaattcatatttccgttgaactattattcttattttgtt tttaaaagaagggcttcctggtaataaaaatatgatttccaaatgacgttagagcaa aaaaaaaaaaaggttgtctggtctggtaaaatgaaaaagcaaagcgtcttggtatag aaaagtaatatactgcctcctaatttcttcgtccttctaccgaagaatctctccact cttgccctctttcgaaaccctaaaccagaagcaccagattttttcaactttttccca gagaacaatagaaaacccaacttgtgctctctagggttttctttattccttctcatc tttggattttcttgggtcatcattttggaagcttacccaccagcgaaaaaattataa cttccatcgattcctggcttctctctctcgctctctctgcatgtgctaaatcgccgg actgatcctcactgtcacctctgttcccggg

Stress protein from Arabidopsis (clone#6598614) cccggggattaggggtttgagttgtcactggaaagaggtttgattgtgagtgatgat ggagagattatgaaggagtttgtgtgtatttatagaggagttagggttttgaggttt gatgagaagtaggtttgaagaagttttgttgttgcaacttatttagagttacttgtt ccacaaccacaagtaagattggtcacttctaagttctaactagaaacaaccatgaca catggagatttcagctaacctagtttaatgtatatgtattatattttatttaaatat tataaaataaaataaattttcacaaataaaagaactacaaaaaagtgagaaaaataa tttgataaacaaatttagaaaattagtatatcaataaataaatttataatccgatgg ttttgccttttggtttggcctttgtttgaacttcgatgagtgactatgtatagcgaa aacaattcggtttgtttttggtttaattttaaaaaatacaagcgacaatatctgatg agaataggtgaaaagcaaataatatcagtttaattggaaatatttac tttttacaa ctaatattttgtttggtcaaccaacaaatagatttaattaattatggtttatgagct tttatttgttgcgacagtata atatgttaaaatagtgatattgcatggcggaaggt ccggaagcaacacatatctcctttttaattttttttttaacaagaataacatgttaa tttttttttgaaattaataaagaatacatatttctaatttttgcgtcagatagatga ttaaagagtgtgtgttttttttaacaaacaaggaatacattatacatatttcatatt tctctcgacattgtttgtttttttaaaaaatagattaaagagtctacgaagctaagt agctaacgaagacttgaaatgagaagaagacgagaatcttttaatattttttgttaa gcgataatattttgaaaattaataaatatagattaaggaaataacaataacgcagat atcggtaagtcatagaaaaaaagaaacaacacaaacttacataaacatgtttcctaa tttgtaatggagtaaaattccttcttttttttttttttttgatttggattccaatta gtaaagaactcaatgactataaataacctttaaccctctcattatttcttactatca attgattaagctctcgttcctaagaaagcaatagacgaacaagaacccatcgaagaa cacaaatctctctttgaagttgtcgataatgttagtacaccgttacttcgtccaaga cttttttgccgttccgtttcttacaaaacaaggatttggttaccattacttttgtcg taactcctttttacatgtacgtcaaaaagtggttcctcgctccggcttgaagaaacg accttcttacccacaaaaagcttattttaaaccgtctaaaaccggaaaatctcaatc taaaccggatacggttcatgagaaaccgattcaaacaccgagtgaagaagtagaatt ttttgatggttccgtcacaatgtgtgctgctccttcgccaagacatgtaccgattcc gatattttgtggtgtaaagatgatcaaagagtcttcaaagctaagcacgacttgaat gagaagaagaagaccaattactcaattagattttgttttgtggagcaattattgtct at tatctttgtttttagcaaataatctgtatccactaatcttcacagtacttgact aacaagaagtaaagagttttcttatttccaattgttttttaatctgatacttttttc ataattttacaatgtttgatgaaaaaaaacattcaaacctaaattttctttttttgg tatgaattcaaacctgaattacttttgacgaggacccgacggtataaatagggtgat ctcccaacaaacaaaaagggtcccggg

Pectinacetylesterase from Arabidopsis (clone#6671954) cccgggtggtggggacaatggatccggtctgcgtagcaacaaggctgaaaaagatta

1/8