WO2002086140A2

WO2002086140A2 - Double-strand nucleic acids with one or two individual strand 5' overhangs, method for production and use thereof

Info

Publication number: WO2002086140A2
Application number: PCT/EP2002/004358
Authority: WO
Inventors: Rolf Postina
Original assignee: Qiagen Gmbh; Rolf Postina
Priority date: 2001-04-19
Filing date: 2002-04-19
Publication date: 2002-10-31
Also published as: AU2002315302A1; DE10119203B4; DE10119203A1; WO2002086140A3

Abstract

The invention relates to novel double-strand nucleic acids with individual strand overhangs, method for production and use thereof in recombinant reactions.

Description

Double-stranded nucleic acids with one or two single-stranded 5 'overhangs, process for their preparation and their use

The present invention relates to new double-stranded nucleic acids with single-stranded overhangs, processes for their preparation and their use in recombination reactions.

It is known from the prior art that DNA polymerases and reverse transcriptases require short double-stranded nucleotide sections for a template-dependent DNA re-synthesis. In Escherichia coli, in the case of DNA replication in vivo, short RNA oligonucleotides synthesized by the primase and hybridizing with the template strand serve as the starting point for the new DNA synthesis by the DNA polymerase III. The incorporated ribonucleotides are then removed by DNA polymerase I and replaced by deoxyribonucleotides, which produces ribonucleotide-free DNA strands [L. Stryer, Biochemistry, 4th edition, 1999, 845-850].

In reverse transcription, i.e. a DNA resynthesis, which is carried out on an RNA template by a reverse transcriptase, serves as a starting point for the DNA resynthesis in vivo tRNA molecules.

In contrast to this, synthetic deoxyoligonucleotides usually serve as starting points for DNA polymerases or reverse transcriptases in DNA resynthesis in vitro. The synthetic deoxyoligonucleotide becomes an integral part of the newly synthesized DNA strand and is used in a subsequent amplification reaction by a DNA polymerase as a template for the new DNA synthesis. In this second round of enzymatic replication, free 3 ^' hydroxyl groups of synthetic deoxyoligonucleotides also serve as starting points for DNA polymerases. In the second-strand synthesis of double-stranded DNA (cDNA) which is complementary to messenger RNA (mRNA), the 3 ^' hydroxyl groups of fragmented, endogenous mRNA often serve as starting points for in vitro DNA synthesis by a DNA polymerase.

The following DNA polymerases are suitable for this purpose: DNA polymerase I from Escherichia coli, its shortened form (Klenow fragment), the T4 or T7 DNA polymerases encoded by the bacteriophages T4 and T7, and thermostable DNA polymerases - Like the Taq or Pfu DNA polymerase from Thermus aquaticus or Pyrococcus furiosus. As synthetic deoxyoligonucleotides are generally used for gene-specific molecules; in addition, the use of oligonucleotides with a random composition is disclosed in the prior art in some special cases [cf. U.S. Patent 5,043,272].

Starting from single-stranded RNA, in particular from mRNA, or from single- or double-stranded DNA, double-stranded linear DNA sections can be generated using the methods mentioned. The nucleotide composition of the ends of these DNA molecules is determined by the oligonucleotides used. Usually double-stranded DNA molecules with smooth ends are obtained. In addition, however, the use of Taq DNA polymerase also makes it possible to synthesize double-stranded DNA molecules in which there is usually an adenine deoxynucleotide overhang (3 ^' dA) at each 3 ^' end [Ausubel et al., In: Current Protocols in Molecular Biology, 2000. Page 15.7.1].

With regard to recombinant DNA techniques, the following is known from the prior art: in general, the method of inserting a DNA section into a plasmid essentially follows two enzymatic steps. In the first step, linear DNA sections with defined ends are generated using sequence-specific restriction endonucleases. In the subsequent reaction step, the compatible ends between plasmid and DNA to be inserted are covalently linked with the aid of the enzyme DNA ligase to form a circular, hybrid DNA molecule [Ausubel et al., In: Current Protocols in Molecular Biology, Volume 2000, pages 3.16.1 to 3.16.10].

However, this procedure has the disadvantage that - if there are no suitable recognition sequences for restriction endonucleases in the plasmid and / or in the DNA section to be inserted - the two molecules inevitably have to be recombined in a different way. The polymerase chain reaction (PCR), which is well known from the prior art, is generally suitable for this purpose. In the context of this PCR reaction, the DNA section which lacks the suitable recognition sequences is identified with the aid of synthetic

Deoxyoligonucleotides and thermostable DNA polymerases reproduced.

The required choice of the oligonucleotides to be used can generally be used to insert the required endonuclease interfaces, which are then used within the in - / Ϊrσ recombination can be [cf. Ausubel et al., In: Current Protocols in Molecular Biology 2000, page 3.15.51.

If an error-reading DNA polymerase, e.g. If the Pfu DNA polymerase from Pyrococcus furiosus is used, then the amplified DNA fragment can alternatively also be clipped over its smooth ends.

If, however, a Taq DNA polymerase from Thermus aquaticus is used in the PCR reaction, the adenine nucleotide at each 3 ^' end can be used for the cloning of the amplified DNA fragment for fusion with a linearized plasmid 3 - overhanging thymine or uracil nucleotides can be used. Commercially available cloning aids are available for both strategies.

However, the latter two procedures have the considerable disadvantage that the DNA section taken up by the plasmid is statistically incorporated in two different orientations. There - e.g. for the expression of a protein - but only one orientation can be used is directed installation, i.e. installation in only one defined orientation is absolutely necessary.

Directed incorporation of a linear DNA fragment into a plasmid is only possible on the other hand if both ends of the linear DNA fragment differ. This is usually achieved by treatment with different restriction endonucleases. The methodology fails, however, as soon as one of the restriction endonucleases used cleaves within the DNA segment to be cloned, which cannot be ruled out entirely with unknown nucleotide sequences (e.g. with new cDNA sequences). However, due to the occurrence of this danger, a serious disadvantage of this procedure can also be seen.

In contrast, directional cloning of a complete cDNA becomes possible if the synthesis of the first strand of cDNA is carried out in the presence of methylated nucleotides, for example 5-methyl-dCTP. Certain restriction endonucleases - such as Xhol - are unable to hydrolyze DNA if their DNA recognition sequence is methylated. The double-stranded cDNA thus produced is used on both sides Oligonucleotide adapters fused, then hydrolysis takes place only within the unmethylated recognition sites which were introduced via the oligonucleotide adapters [Ausubel et al., In: Current Protocols in Molecular Biology, Volume 2000, pages 5.5.2 to 5.6.8].

In alternative procedures which do not require restriction endonucleases, the DNA to be cloned is amplified in the presence of oligonucleotides which contain deoxyuracil nucleotides [US Pat. Nos. 5229283 and 5137814]. This method makes it possible to modify the 5 ^' ends of amplified DNA over a section of twelve nucleotides, with every third base being a deoxyuracil nucleotide. When this section of DNA is treated with the enzyme uracil DNA glycosylase (UDG), the glycosidic bonds between the deoxyribose and the uracil bases are cleaved. This has the consequence that the hybridization with the previously complementary strand of the same DNA molecule is weakened, which results in free - that is to say hybridizable 3 ^′ - protruding ends which hybridize with the compatible ends of a linear plasmid produced in the same way ,

Hydrogen bonding of the nucleotide strands that hybridize at both ends via twelve base pairs creates a recombinant, circular plasmid in which the DNA strands are not covalently linked. Because of the strong hybridization of the two DNA strands, it is not necessary to covalently link them before transformation with a DNA ligase [Ausubel et al., In: Current Protocols in Molecular Biology, 2000. Pages 15.7.5 to 15.7.8 ].

The - at first glance - attractive advantage of the ligation-independent clonability through the use of this method is considerably reduced by the following disadvantages:

Firstly, in the protruding 3 ^' ends generated by the UDG treatment, every third nucleotide is an adenine deoxynucleotide. This means that the composition of the 3 'ends cannot be influenced arbitrarily. On the other hand, a suitable linearized one is inevitable

A plasmid is required in which every third nucleotide represents a thymine deoxynucleotide. It is therefore obvious that this second disadvantage also means that this method is by no means fully applicable. A newer method of the ligation- and restriction endonuclease-free cloning technique known from the prior art is cloning with vaccinia DNA topoisomerase [US Pat. No. 5,766,891; Shuman in: The Journal of Biological Chemistry, 269 (1994) 32678]. One of the two DNA sections to be fused is covalently linked to the vaccinia DNA topoisomerase I via its 3 ^' ends. Subsequently, the covalent linkage to a second DNA section takes place as soon as the free 5 ^' hydroxyl groups of the second DNA section meet the 3 ^' topoisomerase / DNA ends. The disadvantage inherent in this cloning method is that the covalent linkage of a double-stranded DNA with a sequence-specific DNA topoisomerase in the case of vaccinia DNA topoisomerase I inevitably requires the special nucleotide recognition sequence CCCTT.

It is therefore also obvious that the necessary presence of this penta nucleotide sequence can in no way enable the universal usability of DNA fusion using DNA topoisomerase. Rather, one usually depends on the installation of defined DNA fragments on plasmids, which however contain this recognition sequence only once.

Another recombinant DNA technique known from the prior art, which does not require restriction endonucleases and does not use DNA topoisomerases, uses the Cre recombinase. This enzyme, originally encoded by bacteriophage P1, is able to recognize and recombine specific DNA sequence elements - so-called loxP sites, which are 34 base pairs in size [Liu et al., Current Biology, 8 (1998) 1300; Abnemski et al., Cell, 32_ (1983) 1301].

However, the blatant disadvantage of this method can also be seen in the fact that the enzyme used requires specific DNA recognition sequences, which also means that it is no longer universally applicable.

However, methods for directed or ligase-independent cloning can also be found in the prior art. - Aslanidis and de Jong [C. Aslanidis et al., Nucleic Acids Research 18 (1990) 6069] described a method for ligation-independent cloning of DNA, in which the DNA molecules to be recombined are treated with T4 DNA polymerase. In addition to its DNA polymerase activity, this enzyme has one 3 ^{^'-5'} -Exonukleaseaktι ^'tivity. In the absence of nucleotides, the 3 ^' - 5' exonuclease activity of the enzyme dominates, which then produces 5 ^' protruding ends on linear double-stranded DNA molecules. If the protruding ends on two DNA molecules to be recombined are compatible, then both DNA molecules can be recombined independently of the ligase, the PCR product, however, having to be subsequently treated with T4 DNA polymerase.

In principle, this methodology can be used universally - on the other hand, it necessarily requires a second enzymatic step, the subsequent treatment with T4-DNA polymerase having to be strictly limited in time in order to break down the DNA to be recombined excessively to avoid.

Furthermore, Ailenberg and Silverman [M. Ailenberg et al., Biochem. Mol. Biol. Int., 39 (1996) 771] a further proposal for the generation of PCR products with overhanging ends which can be used for directional cloning. For this purpose, the DNA fragment to be cloned is generated in two separate PCR reactions, each with different primer pairs.

The attachment sites of the primer pairs are chosen so that they attach to the template DNA in a spatially offset manner. The resulting PCR products are largely identical, but differ at the ends defined by the primer sequences. If the two PCR products are then mixed, heat-denatured and then renatured again by cooling, this results in part in double-stranded DNA molecules in which the DNA single strands originate from different PCR reactions.

The disadvantage associated with this method is that theoretically only 25% of the DNA molecules present in the reaction mixture have the desired overhangs. In addition, the other hybridization products can adversely affect cloning success. Another disadvantage of the method is that you need four - instead of two - different oligonucleotides for each PCR product to be cloned. This doubles the cost of the cloning experiment; Furthermore, the planning of the experiment becomes more time-consuming and the practical implementation is more prone to errors, since two PCR reactions have to be optimized. Another method known from the prior art, in which directionally clonable PCR products are generated, is described by Gal et al. [J. Gal et al., Molecular Gen Genet., 260 (1999) 569; Hungarian patent application file number P 9801320]. The method described there is based on one of Takeshita et al. disclosed teaching [M. Takeshita et al., Journal of Biological Chemistry, 262 (1987) 10171], in which it is described that the Taq DNA polymerase incorporates a dATP and then terminates the polymerase reaction if it is based on a base-free "nucleotide", ie a tetrahydrofuran partial structure in the template strand.

According to this teaching, the overhangs used by Gal begin with the tetrahydrofuran partial structure and extend to the end of the primer.

Such PCR products can be cloned in a directed manner, but in most cases either a nucleotide is deleted or an incorrect nucleotide is inserted. The method cannot therefore be used for standardizable, universally suitable, directed cloning of PCR products.

However, methods for directed combination of PCR products which do not require restriction endonucleases can also be found in the prior art.

For example, Coljee et al. (Coljee et al., Nature Biotechnology, 18 (2000) 789; US Pat. No. 6,358,712] discloses that, using oligonucleotides which contain ribonucleotide building blocks, the polymerase chain reaction (PCR) can be used to generate double-stranded nucleic acid molecules which, depending on the type of DNA polymerase used either have 5 ^' RNA overhangs or blunt ends.

For the directed recombination of the nucleic acids, two double-stranded nucleic acid molecules with mutually complementary 5 ^' RNA overhangs are ligated in one of the methods described, a hybrid being formed from double-stranded DNA with portions of double-stranded RNA. In a subsequent step with Taq DNA polymerase, the entire nucleic acid molecule is reamplified, whereby (due to the fact that Taq DNA polymerase can use RNA building blocks as a template) an RNA-free double-stranded DNA molecule is formed. In this way, a directed in vitro recombination of DNA is made possible. A decisive disadvantage of this method, however, is that, on the one hand, several PCR steps with different DNA polymerases have to be carried out and, on the other hand, the Taq DNA polymerase, which works with a high error rate, must be used for reamplification. As a result, this method is ultimately time-consuming and prone to errors.

The present invention is accordingly based on the object of overcoming the disadvantages of the methods known from the prior art and of providing a simple, time-saving and molecular biologically versatile process for the production of DNA double strands with one or two projecting 5 'ends ,

Another object of the present invention is to provide a

To provide a method for the production of DNA double strands with protruding 5 'ends, which allows free selection with regard to the size of the respective overhangs (i.e. the number of nucleotides) and with regard to the nucleotide composition.

Furthermore, the object of the present invention is, in particular, to provide a method which makes it possible to directly recombine the DNA double strands thus produced with protruding 5 'ends without further enzymatic manipulations.

Another object of the present invention is to provide an improved method for generating DNA which is complementary to mRNA and can be cloned in a directed manner.

Another object of the present invention is to provide an improved process for the production of synthetic and semi-synthetic genes.

Another object of the present invention is to provide a method for switching off or replacing genes or for producing transgenic organisms and for gene therapy. Another object of the present invention is to provide an improved analysis method for the analysis of differentially expressed genes.

Another object of the present invention is to provide an improved method for purifying DNA.

According to the invention, these objects are achieved by the use of appropriately designed oligonucleotides which have one or more polymerase-resistant nucleotide (s) which ensure that the matrix-dependent DNA re-synthesis is terminated as soon as a polymerase reaches this nucleotide.

For the purposes of the present invention, the following definitions are also used:

Adapter:

In the context of the present invention, an adapter is understood to mean a double-stranded nucleic acid molecule which has arisen from the attachment of two oligonucleotides.

Deoxy oli onucleotide:

For the purposes of the present invention, a deoxy-oligonucleotide is to be understood as a single-stranded polymer composed of deoxyribonucleotides.

DNA Polvmerase:

For the purposes of the present invention, a DNA polymerase is to be understood as an enzyme which synthesizes DNA depending on the template and uses DNA as a template. As a result, a reverse transcriptase also embodies a DNA polymerase.

nucleotide analogue:

In the sense of the present invention, a nucleotide analog is to be understood as a nucleotide which is changed at least at one molecular position in relation to a deoxynucleotide.

Oliqonukleotid:

For the purposes of the present invention, an oigonucleotide is understood to mean a single-stranded polymer composed of nucleotides, the Nucleotides can embody both deoxyribonucleotides and ribonucleotides.

Polymer-resistant oligonucleotide: Among a polymerase-resistant oligonucleotide is one

To understand oligonucleotide which contains at least one nucleotide analog with a protective group conferring polymerase resistance, wherein the nucleotide analog cannot be used by a DNA polymerase as a template for a new DNA synthesis. The polymerase-resistant oligonucleotides according to the invention can, however, be used by a DNA polymerase as a starting molecule for DNA resynthesis.

Protective group conferring polymerase resistance: For the purposes of the present invention, a protective group conferring polymerase resistance is to be understood as a chemically modified deoxyribonucleotide, the modification in the form of a protective group ensuring that the nucleotide analogs thus modified are no longer of a DNA polymerase as a template for DNA -New synthesis can be used.

Reverse transcriptase:

In the context of the present invention, reverse transcriptase is to be understood as an enzyme which synthesizes DNA on an RNA template, but also on a single-stranded DNA template.

According to the method according to the invention, the 5 ^' DNA end (s) protruding in the DNA are generated by incorporating modified, polymerase-resistant oligonucleotides. Such polymerase-resistant oligonucleotides embody a further object of the present invention and can be introduced into a DNA strand to be synthesized by DNA polymerases or by reverse transcriptases.

Surprisingly, it was found that a large number of nucleotide modifications lead to a DNA polymerase

Use of the polymerase-resistant oligonucleotide or a polymerase-resistant oligonucleotide already built into a DNA strand ends its template-dependent DNA resynthesis when the protective group conferring polymerase resistance is reached. A polymerase-resistant oligonucleotide is characterized in that it:

a) does not occur naturally; b) can serve as the starting point for a template-dependent DNA re-synthesis by DNA polymerases or reverse transcriptases; c) contains at least one nucleotide analog which cannot be used by a DNA polymerase as a template for DNA resynthesis and therefore serves as a protective group which causes the polymerase activity of DNA polymerases to stop at this point. d) it does not impair the ligability of the newly synthesized DNA double strand.

The modifications which, according to the invention, fulfill the function of a protective group conferring polymerase resistance include, for example:

1. Deoxyribonucleotides and ribonucleotides derivatized on the phosphate group, among which phosphorothioate-modified deoxyribonucleotides and phosphorothioate-modified ribonucleotides are preferred. For example, a ribose partial structure derivatized at the 5 ^' position of the ribose ring by a phosphorothioate group is particularly preferably used as the protective group conferring polymerase resistance.

2. Furthermore, for the purposes of the present invention, alkyl-modified nucleotide building blocks can be successfully used as protective groups conferring polymerase resistance at different positions.

This includes in particular alkylated ribonucleotides on the 2'-hydroxy group.

The following substituents are preferred as alkyl radicals:

Methyl, ethyl, propyl, 1-methylethyl (isopropyl), butyl, 1-methylpropyl, 2-methylpropyl, 1, 1-dimethylethyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1, 1 -Dimethylpropyl, 1, 2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1, 1-dimethylbutyl, 1, 2-dimethylbutyl, 1, 3-dimethylbutyl, 2,2- Dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-ethylbutyl, 2-ethylbutyl, 1, 1, 2-trimethylpropyl, 1, 2,2-trimethylpropyl, 1-ethyl-1-methylpropyl and 1 -ethyl-2methyl - Propyl, among which -CC ₃ alkyl radicals are particularly preferred and the methyl group is very particularly preferred.

The alkylated nucleotides mentioned are either commercially available or can be easily prepared in a manner known from the prior art.

Accordingly, 2'-methoxy ribonucleotides, for example, are particularly preferably used.

In addition, substituents with an alkoxyalkylene structure can be used, including, for example, the grouping - [(CH ₂ ) ₂ ] _q -O-alkyl in which q is an integer 1, 2, 3, 4 or 5 and alkyl has the meaning given above.

3. Ribonucleotides or deoxiribonucleotides halogenated in the 5-position, among which 5-fluoro-dU, 5-bromo-dU and 5-iodine-dU are preferred.

4. Ribonucleotides or deoxyribonucleotides that are in their bases

Partial structure are substituted with a dye, among which dyes of the fluorescein type or TAMRA are preferred.

5. Derivatives of naturally occurring nucleotides that have a different base that is not incorporated in naturally occurring nucleotides, among which 2-aminopurine and 5-nitroindole are preferred as bases

6. Nucleotide surrogates which do not have any of the bases known from the naturally occurring nucleotides, including ribose or

Deoxyribose are preferred, which may optionally be substituted or derivatized, among which phosphorothioate-derivatized riboses or deoxyriboses are preferred. 7. Ribonucleotides or deoxyribonucleotide replacing structures such as branched or unbranched polyether structures, including

HO (CH ₂ ) ₃ OH, HO [(CH ₂ ) nO] _n H where n is an integer 1, _2, ₃ , 4 or 5, or

HO-CH ₂ CH [(CH ₂ ) _m NH ₂ ] (CH ₂ ) OH, where m is an integer 3, 4, 5, 6 or 7, are preferred.

8. In addition, so-called reversed bases can be used, which are known from the prior art

Another object of the invention is the use of several protective groups conferring polymerase resistance within one polymerase-resistant oligonucleotide. These can occur either in direct succession or alternately. However, this is not necessary since the protective group conferring polymerase resistance which is closest to the 3 ^' end causes the DNA polymerase to be stopped. Furthermore, a combination of modifications, each of which alone brings about polymerase resistance, is possible. This is the case, for example, when using a phosphorothioate-modified ribonucleotide building block.

Another advantage of using a ribonucleotide as a protective group within a polymerase-resistant oligonucleotide is that ribonucleotides with complementary deoxyribonucleotides

Form hydrogen bonds that are identical to those formed between two complementary deoxyribonucleotides.

In the following, the advantages of a hybrid DNA / RNA oligonucleotide with a ribonucleotide building block as a protective group conferring polymerase resistance are exemplified.

An example of such an oligonucleotide has, for example, the general formula:

5 -XXXyXXXXX-3 ^'

In the present case, the oligonucleotide comprises, for example, 9 nucleotides, each X for any deoxyribonucleotide (dA, dT, dC or dG) and y stands for any ribonucleotide (A, U, C or G), which is located here at nucleotide position four.

It is evident to the person skilled in the art that the exemplified oligonucleotide can have any number of nucleotides.

For the purposes of the present invention, the oligonucleotide described in the general formula comprises 1 to 15, preferably 1 to 10 and very particularly preferably 1 to 4 in the desired 5 'overhang and 3 to 150, preferably 15 to 30 and particularly preferably 18 to 25 nucleotides in the later complementary substructure.

In principle, the ribonucleotide (y) can be located at any position in the oligonucleotide. Furthermore, it can be additionally modified the ribonucleotide, in particular it may be a 2 ^'O-methyl group and / or a phosphorothioate group possess.

Every oligonucleotide with a protective group conferring polymerase resistance can be designed freely according to the respective requirements. For stable hybridization with the template strand, the 3 ^′ region of the polymerase-resistant oligonucleotide is generally designed in such a way that it has six to thirty nucleotides hybridizing with the template strand.

Amplified by PCR using an error-reading thermostable DNA polymerase, such as Pfu DNA polymerase, a polymerase-resistant oligonucleotide and a conventional one

Deoxyoligonucleotide a DNA section, then the size of the 5 ^' overhang introduced by the polymerase-resistant DNA / RNA oligonucleotide is determined solely by the position of the ribonucleotide building block (y). The 5 ^' overhang begins with the ribonucleotide (y) and continues until the 5 ^' end of the polymerase-resistant DNA / RNA oligonucleotide used.

In the DNA / RNA oligonucleotide listed as an example, the 5 ^′ overhang would therefore be four nucleotides, which are composed of three deoxyribonucleotides (X) and one ribonucleotide (y) acting as a protective group. The second end of the amplified DNA molecule would have a smooth end since a conventional deoxyoligonucleotide was used. The PCR product generated in this way can, since the ends are different, be built into a vector with compatible ends. To generate a PCR product - for example - with two 5 - protruding ends are to be used according to the inventive method two polymerase-resistant DNA / RNA oligonucleotides.

When using Taq DNA polymerase in the method according to the invention, the fact that this enzyme and DNA polymerases derived from it usually add an adenine deoxynucleotide (dA) to the 3 ^' ends of DNA molecules, regardless of the template, must be taken into account , As shown in Example 7, a recombination of two DNA molecules produced by Taq DNA polymerase and polymerase-resistant oligonucleotides is still possible. However, if a PCR product obtained with Taq DNA polymerase is subsequently treated with an error-correcting enzyme, such as T4 DNA polymerase, then such DNA fragments can also be cloned very efficiently (cf. Example 4). Both methods can therefore be used alternatively. Any type of thermostable DNA polymerase can thus be used in the process according to the invention.

By using two polymerase-resistant oligonucleotides, which differ either in the size of the 5 ^' overhang and / or in the nucleotide sequence, a directed cloning of a PCR product can be achieved by using a nucleotide sequence produced according to the present invention.

In this case too, a linearized cloning vector with compatible DNA ends is required. These ends may have been generated, for example, by treatment with restriction endonucleases (cf. Example 1!). In an alternative embodiment, the required linear vector can also be generated via PCR amplification using suitable polymerase-resistant oligonucleotides, analogously to that already described (see Example 7!). The production of the cloning vector in this way has several decisive advantages:

1) Two 5 ^' protruding ends of any size and nucleotide composition can be created. This results in the possibility of generating 5 ^′ protruding ends, the generation of which by restriction endonucleases would not have been possible. This means that limitations of cloning strategies due to the availability of restriction endonucleases can be circumvented. 2) The possibility of generating large 5 ^' protruding DNA ends opens up access to a method of combining DNA fragments without an in vitro ligase reaction.

3) In the case of a linear vector produced by PCR with incompatible ends, DNA recombination with a less self-ligated vector can be expected than in the case when the ends were generated by restriction endonucleases. Reasons for incomplete restriction digestion include methylated DNA recognition sequences, suboptimal reaction conditions or enzyme instabilities.

If two nucleotide double strands hybridize at their ends each over regions of approximately 12 nucleotides, a circular, but not covalently linked DNA molecule is formed. If you transform bacteria, e.g. Escherichia coli, with such a DNA molecule, then the hybridizing ends of the recombinant DNA molecule are covalently linked by endogenous bacterial repair enzymes (cf. Example 7!). The advantage of a ligase-independent cloning strategy is that it saves time.

In addition to the generation of a linear cloning vector with one or two 5 ^' protruding ends by restriction endonucleases or by PCR with polymerase-resistant oligonucleotides, it is also possible to generate such a molecule by covalent linkage with double- or single-stranded DNA adapter molecules, but this is the most cumbersome Represents way.

A double-stranded DNA molecule with one or two protruding 5 ^' ends produced by using polymerase-resistant oligonucleotides can in principle be fused with each double-stranded DNA molecule via compatible ends or by homologous recombination. For example, plasmids, phagemids, cosmids, artificial chromosomes of yeast or bacteria (YAC, BAC), naturally occurring chromosomes or already modified chromosomes are suitable cloning systems.

The polymerase chain reaction (PCR) is a preferred embodiment, but it is not the only method using one or two polymerase-resistant oligonucleotides to generate a double-stranded DNA molecule with protruding 5 ^' ends. Alternatively, any naturally occurring or recombinant DNA polymerase can be used to synthesize a DNA strand starting from a polymerase-resistant oligonucleotide, depending on the template. Double-stranded or single-stranded DNA can serve as the template DNA, the double-stranded DNA, in order to be able to serve as a template, must be at least partially denatured. To denature double-stranded DNA, it can be heated to 90-100 ° C for 10 min, or an alkali treatment (pH> 12) can be carried out. As double-stranded template DNA, there are primarily those which have arisen from treatment with restriction endonucleases or from PCR. Single-stranded template DNA can be isolated, for example, from recombinant bacteriophages or produced by means of a PCR reaction with only one oligonucleotide.

Synthesis of DNA complementary to messenger RNA (mRNA) and its directed cloning.

Another object of the invention is the use of polymerase-resistant oligonucleotides in the synthesis of double-stranded DNA (cDNA) complementary to messenger RNA (mRNA). With the aid of the reverse transcriptase enzyme, it is possible to start from a single-stranded DNA or RNA template (eg: mRNA, tRNA, rRNA) to generate a complementary DNA strand. A short double-stranded nucleotide segment, which was generated, for example, by the addition of a deoxyoligonucleotide, serves as the starting point for DNA synthesis by means of a reverse transcriptase. As a rule, "anchored oligo dT oligonucleotides" serve as starter oligonucleotides, which hybridize with the 5 ^' beginning of the poly-A tail of mRNA. The nucleotides, which serve as "anchors", hybridize with the ribonucleotides located directly in front of the poly A tail. In addition to oligo dT oligonucleotides, gene-specific oligonucleotides and randomly produced oligonucleotides (random oligonucleotides) are used in the synthesis of the first DNA strand which is complementary to the mRNA.

In an alternative embodiment, polymerase-resistant oligonucleotides can be used to synthesize this DNA first strand (see Example 8). In principle, these can also be produced as anchored oligo dT oligonucleotides, as gene-specific oligonucleotides, as random oligonucleotides or as non-anchored oligo dT oligonucleotides. The great advantage of using a polymerase-resistant oligonucleotide in cDNA first strand synthesis is that a protective group is inserted into this DNA strand. This protective group has the effect that, when the second cDNA strand is synthesized by conventional methods known to the person skilled in the art, a 5 'protruding end of a known sequence is obtained at its 3 ^' region. The 5 ^' region of the double-stranded cDNA produced is smooth, as in conventional methods. The different ends of the double-stranded cDNA now available, the smooth 5 ^' region and the 3 ^' region with a 5 ^' overhang, allow their directed incorporation into a cloning vector or a phage.

Treatment of the double-stranded cDNA with restriction endonucleases is not necessary for this. Likewise, there is no need to fuse the cDNA obtained with adapter molecules, a modification that is common in conventional methods when cloning it.

In a preferred embodiment, in addition to the synthesis of the cDNA first strand, the cDNA second strand synthesis is also carried out using a polymerase-resistant oligonucleotide. In this way, a double-stranded cDNA with 5 ^' projecting ends on both sides is obtained, which can be cloned in a directed manner. In order to enable the attachment of the second polymerase-resistant oligonucleotide to the cDNA first strand, its 3 ^' end must have a known nucleotide sequence. This can be achieved, for example, by treating the first strand of cDNA with the enzyme terminal deoxynucleotide transferase in the presence of only one deoxynucleotide. When using, for example, deoxyguanosine 5 - End of cDNA ^{'triphosphate} (dG) a poly-dG-tailed to the ^3' first strand added. Such a 3 ^' end can then be easily attached to the polymerase-resistant oligonucleotide required for the synthesis of the second strand of cDNA, which contains a poly-deoxycytidylate sequence which enables hybridization.

In the following second strand cDNA synthesis, the non-hybridizing deoxyguanylates are cleaved off at the 3 ^' end of the first strand cDNA. A double-stranded cDNA molecule with 5 'protruding ends is thus generated, which can be clipped in a directed manner. The directional incorporation of a cDNA, for example, has significant advantages in an expression cloning approach in that it doubles the probability of finding the cDNA sought.

Manufacture of synthetic and semi-synthetic genes

The expression of genes is often made more difficult or completely prevented by the fact that certain codons cannot be converted into the corresponding amino acid, or only with difficulty, by the system used for expression. The synthesis of genes is therefore mainly used to adapt codons to the selected expression system, but also to introduce previously non-existing restriction sites and has been used increasingly recently.

The use of deoxyoligonucleotides for partial or total gene synthesis is well known in the art. Complementary deoxyoligonucleotides are synthesized separately and then hybridized to adapters. These double-stranded DNA molecules are then inserted into a suitable plasmid. Since the coupling yields in oligonucleotide synthesis are below 100%, it follows that the longer it is, the more defective an oligonucleotide is. For this reason, only oligonucleotides with a size between 80-120 nucleotides are generally used in gene synthesis. This means that in the synthesis of a gene of 1000 base pairs, approximately 10 adapter molecules have to be incorporated into a plasmid one after the other, which requires a large number of singly cutting restriction endonucleases and furthermore makes the gene synthesis lengthy.

When using the polymerase-resistant according to the invention

Oligonucleotides can accelerate gene synthesis. For this purpose, for example, two polymerase-resistant oligonucleotides with a size of 120 nucleotides each are used, both of which have a protective group conferring polymerase resistance at the 5 ^' end and which continue to hybridize with one another via their 3 ^' regions over a section of 20 nucleotides. If these hybridizing oligonucleotides are treated with a DNA polymerase, then this enzyme produces a double-stranded DNA molecule with a size of 200 base pairs and different protruding 5 ^' ends. This DNA molecule can then be directionally cloned. Compared to the methods known from the prior art, the procedure according to the invention has the following advantages:

1) The dependency on suitable endonuclease interfaces is reduced.

2) The method according to the invention makes it possible to generate larger DNA molecules with a lower error rate, since in the resulting double-stranded DNA molecule only half of the nucleotides originate from the defective oligonucleotide synthesis, while the other half is incorporated by a DNA polymerase that works much more precisely has been.

3) Gene synthesis can be carried out more quickly, since DNA molecules that are about twice as large can be generated with a lower error rate than with conventional methods. It only takes half as many DNA adapters and cloning steps to produce a gene.

Elimination of genes (knock-out), replacement of genes (gene replacement) and production of transgenic animals. Organisms and cells

Techniques for switching off and replacing genes use the so-called homologous recombination (exchange of genetic information between two nucleic acid segments). For the homologous recombination to succeed, it is crucial that the two mutually replacing nucleic acid sequences have homologous, but preferably almost identical, sequences. The exchange requires the following steps: First, the two DNA sequences to be recombined must be attached to each other, then strand breaks must occur in both strands, each of these strands separating from its intact partner strand in order to hybridize with the other partner. The new double helix that forms is then covalently linked by cellular repair enzymes. If this process takes place twice at different locations on a chromosome section, then the genetic information was replaced by means of the replaced nucleic acid section (gene replacement). A gene can also be destroyed in the same way (knock-out) by using its reading frame during homologous recombination, usually by inserting antibiotics. resistance genes, is destroyed [Lodish et al., in: Molecular Cell Biology, 3rd edition, 1995, pages 389]

In the previously described process of homologous recombination, intermediate single-stranded nucleic acid sections are formed, which then hybridize with a homologous partner in the chromosome. Normally, two double-stranded DNA molecules are brought together in homologous recombination, but the frequency of a recombination event is generally very rare and depends on the biological system and the size of the DNA section to be recombined.

Newer techniques known from the prior art for manipulating chromosomes use oligonucleotides with the property of being able to form triple helices. These oligonucleotides are usually polymers made from deoxy-ribonucleotides and ribonucleotides. These oligonucleotides then change the natural sequence segments [US Pat. No. 5,962,426].

Homologous recombination takes place all the more frequently, the larger a homologous single-stranded area on an otherwise double-stranded DNA molecule. When using polymerase-resistant oligonucleotides, DNA molecules with large 5-protruding ends can be generated, which can be designed so that they are homologous to a target gene. Such a DNA molecule therefore integrates efficiently at the desired gene locus.

DNA molecules with large 5 ^' protruding ends produced by means of polymerase-resistant oligonucleotides can also be used for the generation of transgenic organisms and for gene therapy if these are carried out via the mechanism of homologous recombination.

Analysis of differential gene expression

Methods for identifying differently expressed genes are based on isolating the mRNAs from differently stimulated cells and rewriting them into cDNAs in order to then compare the existing cDNAs semi-quantitatively. In the method SAGE (Serial Analysis of Gene Expression, Velculescu et al., Science, 270 (1995) 484; US-Psen 5,866,330 and 5,695,937), restriction fragments from all existing cDNAs are ligated together and then sequenced. The disadvantage of the method is that poorly expressed genes cannot be detected. Methods that can also detect low-expression genes are based on the amplification of the cDNAs by PCR. For this purpose, the cDNAs obtained are cut with enzymes which very often hydrolyze DNA. Oligonucleotide adapters of known sequence are then ligated to the resulting DNA ends. In the aforementioned PCR step, the sequences introduced via the oligonucleotide adapters are then used. Currently use e.g. B. the following methods use this technique: DEPD (digital expression pattern display, [German Patent No. 198 064 31]), READS (Restriction enzyme analysis of differentially expressed genes) [Prashar and Weissman in: Methods in Enzymology, 303 (1999) 258; Gene Calling (Shimkets et al., In: Nature Biotechnology, 17 (1999) 798]; TOGA (Total gene expression analysis, [Sutcliffe et al., In: Proceedings of the National Academie of Sciences USA, 9Z (2000) 1976 to 1981; U.S. Patents 6,096,503 and 5,459,037]).

The use of polymerase-resistant oligonucleotides to generate double-stranded cDNA has the advantage when using the SAGE technique that the ligation of the cDNAs could be carried out more efficiently. If polymerase-resistant anchored oligo dT oligonucleotides are used in the synthesis of the first cDNA strands, there is a further advantage that the 3 ^' regions within the cDNA population can preferably be obtained. This significantly reduces the sequencing effort and bioinformatics analysis. As a result, the method can be carried out more cost-effectively without loss of information.

A combination of the SAGE technique with other methods, such as DEPD, is possible through the use of polymerase-resistant oligonucleotides. For this purpose, only the oligonucleotide adapters used for the ligation need to be replaced by those with polymerase-resistant oligonucleotides (claims 37 and 38). In the subsequent PCR steps, cDNA sections that have 5 'protruding ends would then be amplified. If the nucleotide composition is selected accordingly, these can be ligated and then sequenced. Method for the selective purification of DNA

Established methods for isolating DNA and RNA are known from the prior art and mainly use two methods, whereby the binding of DNA or RNA to ion exchange resins or to silica gel matrices is used. Corresponding cleaning systems are also known from the prior art and are commercially available. DNA and RNA can be separated efficiently using these methods. However, none of these methods makes it possible to separate a specific nucleic acid species from a similar nucleic acid mixture.

An example of a selective isolation of a nucleic acid species is the isolation of mRNA. This method makes use of the fact that mRNAs have a poly (A) sequence at the 3 ^' end. Using oligo (dT) coated matrices, the mRNAs can therefore be isolated via their poly (A) sequence hybridizing with them.

Linear DNA molecules have no protruding ends of sufficient size to be isolated using a comparable affinity chromatography. When using polymerase-resistant oligonucleotides in the production of double-stranded DNA, the size and sequence of the 5 ^' overhang can be designed as desired. This allows protruding ends of sufficient size to be produced which are suitable for affinity chromatography

Explanation of the figures:

Fig. 1 shows schematically the production of a double-stranded DNA molecule with two 5 ^' projecting ends, which are compatible with EcoRI or Xbal cut DNA. These overhangs were introduced according to the method according to the invention via polymerase-resistant oligonucleotides in a polymerase chain reaction. The nucleotides that confer polymerase resistance within the oligonucleotides are responsible for the formation of the overhangs. The PCR product was then inserted into a plasmid, the compatible ends of which had been generated by restriction endonucleases. The PCR is carried out using polymerase-resistant oligonucleotides, which are indicated by arrows. The polymerase resistance-conferring nukeotide analogs of the oligonucleotides are marked with lowercase letters. The PCR produces a DNA molecule with two 5 ^' protruding ends, the left of which is compatible with EcoRI cut DNA and the right one with Xbal cut DNA. This PCR-ProduM can be cloned by restriction enzymes without further modification.

Alternatively, the plasmid fragment could be generated with appropriate polymerase-resistant oligonucleotides, but in this case would have to be phosphorylated before the ligation.

Phosphorylation would not be necessary if the two DNA fragments to be fused did not hybridize with one another only over a range of four nucleotides, as shown in FIG. 1, but rather over a larger range of, for example, 12 nucleotides.

Examples

Preliminary remarks:

All the oligonucleotides used and listed below were obtained from MWG-Biotech AG (Ebersberg, Germany) and QIAGEN Operon Cologne. The lyophilized oligonucleotides are dissolved in deionized water. In the case of oligonucleotides with natural ribonucleotide building blocks, the protective groups on the ribonucleotide building blocks are split off beforehand according to the manufacturer's instructions.

Oligonucleotides used

1 A: 5 -AATtCGAATTCGATAAGAAACTGGACAAGCAG-3 ^' (SEQ ID NO: 1) 1 B: 5 ^' -CTAaATTCTAGACTAGCACTCTGTCTCTTTGCT- ^' 3 (SEQ ID NO: 2)

The oligonucleotides are deoxy-oligonucleotides, in each of which the underlined and small print nucleotide in position 4 is a DNA building block modified at the 5 ^' position of the deoxyribose phosphorothioate.

2A: 5 -AATuCGAATTCGATAAGAAACTGGACAAGCAG-3 (SEQ ID NO: 3) This oligonucleotide is a DNA / RNA hybrid. The underlined and small print nucleotide in position 4 is an RNA building block which is additionally modified at the 5 position of the ribose phosphorothioate.

3B: 5 ^' -CTAaATTCTAGACTAGCACTCTGTCTCTTTGCT-3 ^' (SEQ ID NO: 4)

This oligonucleotide is a DNA / RNA hybrid. Only the underlined and small print nucleotide in position 4 is an RNA building block which is additionally modified at the 2 ^' position of the ribose 2-O-methyl.

4A: 5-AATuCGGTATTAAGATATGCAGTGTACAT-3 ^' (SEQ ID NO: 5) 4B: 5-TCGaGTCAACGTCTCATATGTCCCATCTG-3 ^' (SEQ ID NO: 6)

The oligonucleotides are hybrid DNA / RNA oligonucleotides, in each of which the underlined and small print nucleotide in position 4 represents a ribonucleotide building block.

5A: 5 -CATATGGCCATGGGTATTAAG ATATGCAGTGTAC AT-3 ^' (SEQ ID NO: 7) 5B: 5 -CATTCAACGTCTCATATGTCCCATCTG-3 ^' (SEQ ID NO: 8)

Oligonucleotide 5A (SEQ ID NO: 7) is an unmodified deoxy oligonucleotide.

Oligonucleotide 5B (SEQ ID NO: 8) embodies a deoxy oligonucleotide in which the underlined and small-sized nucleotide in position 2 is a DNA building block modified at the 5 ^' position of the deoxyribose phosphorothioate.

6A: 5 -UGAGATGCTGAGCAGCATGGA-3 ^' (SEQ ID NO: 9) 6B: 5 -ACTAGAAGGCACAGTCGAG-3 ^' (SEQ ID NO: 10)

Oligonucleotide 6A (SEQ ID NO: 9) is a DNA / RNA hybrid in which the nucleotide at the 5 ^' end represents an uracil ribonucleotide. Oligonucleotide 6B (SEQ ID NO: 10) is an unmodified deoxy oligonucleotide.

7 A: 5 -AGG ATCCTGTGaGCGGCCGCTAAATTCAATTCGCCC-3 ^' (SEQ ID NO: 11)

7B: 5 -CATGGTGTGTGcG AATTCGTTTAAACCTGCAGG ACTAGTCCCTT-

3 ^' (SEQ ID NO: 12) 7C: 5 -GCACACACCATgGTGGATAAGAAACTGGACAAGCAG-3 ^'

(SEQ ID NO: 13) 7D: 5 -TCACAGGATCCuTAGCACTCTGTCTCTTTGCTGTC-3 ^'

(SEQ ID NO: 14)

The oligonucleotides 7A (SEQ ID NO: 11) -7D (SEQ ID NO: 14) are DNA / RNA hybrids, in each of which the nucleotide at position 12 is an RNA building block.

8A: 5 ^' -GGCcGCTCGAGTTAGCGTCTCATGTGTCCCATTTG-3 ^' (SEQ ID NO: 15)

8B: 5 -GCAGAATCATGATGACTAC-3 ^' (SEQ ID NO: 16) 8C: 5 -AGCATCTACTAATCTGCAC-3 ^' (SEQ ID NO: 17)

Oligonucleotide 8A (SEQ ID NO: 15) is a DNA / RNA hybrid in which the nucleotide at position 4 is an RNA building block. Oligonucleotides 8B (SEQ ID NO: 16) and 8C (SEQ ID NO: 17) embody unmodified deoxy oligonucleotides.

DNA polymerases used:

Pfu-DNA polymerase (Promega, Mannheim) Pfu-Turbo-DNA polymerase (Stratagene, La Jolla, USA) QBio-Taq-DNA polymerase (Q-Biogen, Heidelberg) Taq-DNA polymerase (Promega, Mannheim)

Vent polymerase (New England Biolabs, FranWurt / Höchst)

T4 DNA polymerase (Promega, Mannheim)

Superscript Il-Reverse Transcriptase (Life Technologies, Karlsruhe) Plasmids used:

pUC19 (New England Biolabs, FranMurt / Höchst) pCR4 (Invitrogen, Groningen, The Netherlands) pGEXmod (EigenstrustruM, based on pGEX-2T (Amersham Pharmacia Biotech, Freiburg) in which the cloning sites in the polylinker were modified.)

DNA purification methods used:

Extractions of DNA from agarose gels were carried out using a commercially available gel extraction kit - such as e.g. the QIAquick Gel Extraction Kit from Qiagen GmbH, Hilden, DE - according to the manufacturer's instructions.

The isolation of DNA from PCR reaction batches or other enzymatic reaction batches was also carried out using a commercially available purification kit for PCR reaction batches - such as e.g. the QIAquick PCR Purification Kit from Qiagen GmbH, Hilden, DE) - according to the manufacturer's instructions.

example 1

Generation of a double-stranded DNA molecule with 5 ^' protruding ends by the polymerase chain reaction using phosphorothioate-modified polymerase-resistant deoxy-oligonucleotides and its directional incorporation into a cloning vector

The oligonucleotides 1A (SEQ ID NO: 1) and 1 B (SEQ ID NO: 2) were used to amplify the DNA sequence coding for the carboxy-terminal region of murine TACE by means of the polymerase chain reaction (PCR). Both oligonucleotides (1A (SEQ ID NO: 1) and 1 B (SEQ ID NO: 2)) embody deoxy oligonucleotides, each of which contains a DNA building block modified at the 5 ^' position of the deoxyribose phosphorothioate.

The cDNA from TACE of the mouse (GenBank / EMBL database, accession number: AB021709) was used as the template DNA in the PCR. The error-reading and error-correcting Pfu-DNA polymerase was used for the amplification of the TACE cDNA section. This enzyme usually produces smooth DNA ends during PCR.

To separate the template DNA, the PCR approach was carried out on a

Applied agarose gel and separated electrophoretically. The 410 base pair PCR product was then isolated from the agarose gel. The DNA was extracted from the gel using the QIAquick Gel Extraction Kit.

The isolated PCR product was then ligated to a pUC19 plasmid fragment by a DNA ligase. The pUC19 plasmid fragment used in the ligation was obtained as follows: the plasmid pUC19 was first cut with the restriction endonucleases EcoRI and Xbal, then the plasmid fragment was isolated from an agarose gel using the QIAquick Gel Extraction Kit.

After transformation of E. coli DH5α with the ligation mixture, the transformants obtained were examined by means of PCR for the presence of the recombinant plasmids. It was found that the majority of the transformants examined had the recombinant plasmid (pUC19 with integrated PCR product).

DNA ends can only be linked by a DNA ligase if the DNA ends to be linked are compatible with one another. This is always the case with two smooth DNA ends, but with protruding DNA ends this is only possible if the DNA ends to be linked can base pair with each other.

The successful recombination of the EcoRI / Xbal-cut pUC19 plasmid fragment with the PCR-ProduM could therefore only take place if it had the required compatible DNA ends. Since the PCR-ProduM had not been subjected to any treatment by restriction endonucleases, these overhangs must have arisen in the polymerase chain reaction with the oligonucleotides 1A (SEQ ID NO: 1) and 1B (SEQ ID NO: 2).

Since the heat-stable DNA polymerase used would produce smooth ends when using unmodified deoxy-oligonucleotides, the formation of the 5 ^' overhangs, each comprising four nucleotides, must occur directly due to oligonucleotides 1A (SEQ ID NO: 1) and 1B (SEQ ID NO: 2). The two oligonucleotides are deoxyoligonucleotides, each of which contains a phosphorothioate-modified DNA building block at nucleotide position four.

A PCR product with 5 ^' protruding ends that are compatible with EcoRI and Xbal cut DNA must have on one side the 5 ^' overhang AATT compatible with EcoRI and on the other side the Xbal compatible 5 ^' overhang CTAG.

Oligonucleotide 1A (SEQ ID NO: 1) produced the EcoRI-compatible 5 ^' overhang of the following composition on the PCR product: 5'-AATt. The underlined and small-pressed nucleotide is a phosphorothioate-modified thymine deoxyribonucleotide, which is solely responsible for the formation of the overhang. The second 5 ^' overhang of the PCR product has the following composition: 5 -CTAg. The underlined and small print nucleotide is a guanine deoxyribo deoxyribose nucleotide modified at the 5 ^' position of the phosphorothioate, which is solely responsible for the formation of the overhang. This overhang was generated by the oligonucleotide 1 B (SEQ ID NO: 2) and is compatible with DNA ends which have been generated by treatment with the restriction endonuclease Xbal.

The PCR-ProduM thus has two different protruding 5 ^' ends. Each of the overhangs begins with the phosphorothioate-modified deoxyribonucleotide building block of the oligonucleotides 1A (SEQ ID NO: 1) and 1 B (SEQ ID NO: 2) built into the PCR product and extends to their 5 ^' ends.

Such a PCR product can therefore be built into a plasmid which has previously been treated with EcoRI and Xbal.

DNA sequencing on a randomly selected recombinant plasmid showed that the PCR product was integrated correctly between EcoRI and Xbal in pUC19. This is clear evidence that the DNA repair mechanisms of the E. coli bacteria used were able to exchange the phosphorothioate-modified deoxybonucleotides present in the ligated recombinant plasmids for natural DNA building blocks. Conclusion:

The generation of double-stranded DNA with overhanging 5 ^' ends is possible if a polymerase chain reaction is carried out with polymerase-resistant deoxy-oligonucleotides, in each of which one nucleotide contains phosphorothioate modification at the 5 ^' position of the deoxyribose. The size of the 5 ^' overhang is determined solely by the position of the phosphorothioate modification within the oligonucleotide. The overhang begins with the phosphorothioate-modified nucleotide and extends to the 5 ^' end of the oligonucleotide built into the PCR-ProduM.

With this novel method, protruding 5 ^' DNA ends of any composition and size can be created. These can be designed to be compatible with DNA ends through

Restriction endonucleases were generated. It is also possible to use this method to produce protruding 5 ^' DNA ends which have hitherto not been able to be produced by any restriction endonuclease. This opens up completely new possibilities for recombinant DNA.

Example 2

Generation of a double-stranded DNA molecule with 5 ^' protruding ends by the polymerase chain reaction using a

Phosphorothioate-modified polymerase-resistant deoxyoligonucleotide and a phosphorothioate-modified polymerase-resistant hybrid RNA / DNA oligonucleotide and their directional incorporation into a cloning vector

The oligonucleotides 2A (SEQ ID NO: 3) and 1 B (SEQ ID NO: 2) were used to amplify the DNA sequence coding for the carboxy-terminal region of murine TACE using the polymerase chain reaction. The oligonucleotide 2A (SEQ ID NO: 3) is a DNA / RNA hybrid in which only the nucleotide in position four is an RNA building block which is additionally modified at the 5 ^' position of the ribose phosphorothioate. Oligonucleotide 1B (SEQ ID NO: 2) is a deoxy oligonucleotide which contains a phosphorothioate-modified DNA building block. The cDNA from TACE of the mouse was used as the template DNA (GenBank / EMBL database, accession number: AB021709).

The 410-base pair PCR-ProduM obtained with the Pfu-Turbo DNA polymerase was isolated with the QIAquick PCR-Purification Kit (Qiagen, Germany) according to the manufacturer's instructions.

The PCR product isolated in this way was ligated with a pGEXmod plasmid fragment cut with EcoRI and Xbal. The pGEXmod plasmid fragment used in the ligation was obtained as follows: the plasmid pGEXmod was first cut with the restriction endonucleases EcoRI and Xbal, then the plasmid fragment was isolated from an agarose gel using the QIAquick Gel Extraction Kit.

After transformation of E. coli DH5α, the transformants obtained were analyzed by PCR for the presence of the recombinant plasmid. It was found that all of the transformants examined had the recombinant plasmid.

DNA sequencing on a randomly selected recombinant plasmid showed that the PCR product was integrated without error between EcoRI and Xbal in pGEXmod and that the ribonucleotide component uracil had been replaced by the DNA component thymine. This shows that the DNA repair mechanisms of the BaMeries used were able to exchange the phosphorothioate-modified nucleotides (a ribonucleotide and a deoxyribonucleotide) present in the ligated recombinant plasmids for natural DNA building blocks.

The successful recombination of EcoRI / Xbal-cut pGEXmod plasmid fragment with the PCR product is only possible if the PCR-ProduM has the necessary compatible DNA ends. Since the PCR product had not been subjected to any treatment by restriction endonucleases, these overhangs must have arisen in the polymerase chain reaction with the oligonucleotides 2A (SEQ ID NO: 3) and 1B (SEQ ID NO: 2).

Oligonucleotide 2A (SEQ ID NO: 3) produced a 5 'overhang of the following composition during PCR: 5 ^' AATu. The underlined and small print nucleotide is a Phosphorothioate-modified uracil ribonucleotide, which is solely responsible for the formation of the overhang. This overhang is compatible with DNA ends generated by the restriction endonuclease EcoRI. The second 5 ^' overhang of the PCR product has the following composition: 5 ^' -CTAg. The underlined and imprinted nucleotide is a

Phosphorothioate-modified guanine deoxyribonucleotide, which is solely responsible for the formation of the overhang. This overhang was generated in the PCR by the oligonucleotide 1 B (SEQ ID NO: 2) and is compatible with DNA ends which have been generated by the residual ion endonuclease Xbal.

The PCR product thus has two different ends and could therefore be installed in pGEXmod between EcoRI and Xbal.

Conclusion:

The generation of double-stranded DNA with overhanging 5 ^' ends is possible if a polymerase chain reaction with two different phosphorothioate-modified polymerase-resistant is possible

Performs oligonucleotides. It is sufficient if the oligonucleotides used each contain only one nucleotide conferring polymerase resistance. This can either be a phosphorothioate-modified deoxyribonucleotide or a phosphorothioate-modified ribonucleotide.

The size of the 5 ^' overhang is determined solely by the position of the phosphorothioate-modified nucleotides. The overhang begins with the phosphorothioate-modified nucleotide and extends to the 5 ^' end of the oligonucleotide built into the PCR product.

Example 3

Generation of a double-stranded DNA molecule with 5 ^′ protruding ends by the polymerase chain reaction using differently modified polymerase-resistant hybrid DNA / RNA oligonucleotides and its incorporation into a cloning vector The oligonucleotides 2A (SEQ ID NO: 3) and 3B (SEQ ID NO: 4) were used to amplify the DNA sequence coding for the carboxy-terminal region of murine TACE using the polymerase chain reaction. Both oligonucleotides are DNA / RNA hybrids, each containing an RNA building block at position four. For oligonucleotide 2A

(SEQ ID NO: 3) this RNA building block is additionally modified at the 5 ^' position of the Ribose phosphorothioate, whereas with oligonucleotide 3B (SEQ ID NO: 4) the RNA building block is at the 2 ^' position of the Ribose 2-O -Methyl- modified.

The cDNA from TACE of the mouse was used as the template DNA (GenBank / EMBL database, accession number: AB021709).

The 410-base pair PCR-ProduM obtained with the Pfu-DNA polymerase was isolated with the QIAquick PCR-Purification Kit according to the manufacturer's instructions and ligated with the pGEXmod plasmid fragment cut with EcoRI and Xbal described in Example 2.

DNA sequencing on a randomly selected recombinant plasmid showed that the PCR-ProduM was perfectly integrated between EcoRI and Xbal in pGEXmod.

This further shows that the DNA repair mechanisms of the bacteria used were able to modify the modified ribonucleotides present in the ligated recombinant plasmids (one carries a

Phosphorothioate modification, the other a 2-O-methyl modification) for natural DNA building blocks.

The successful recombination of EcoRI / Xbal-cut pGEXmod plasmid fragment with the PCR product is only possible if the PCR product has the necessary compatible DNA ends. Since the PCR product had not been subjected to any treatment by restriction endonucleases, these overhangs must have arisen in the polymerase chain reaction with the oligonucleotides 2A (SEQ ID NO: 3) and 3B (SEQ ID NO: 4). Oligonucleotide 2A (SEQ ID NO: 3) resulted in a 5 ^' overhang of the following composition during PCR: 5 ^' AATu. The underlined and fine-printed nucleotide is a phosphorothioate-modified uracil ribonucleotide which is suitable for the

The formation of the overhang is solely responsible. This overhang is compatible with DNA ends generated by the restriction endonuclease EcoRI. The second 5-overhang of the PCR-ProduM has the following composition: 5 ^' -CTAg. The underlined and small-pressed nucleotide is a 2-O-methyl-modified guanine ribonucleotide, which is solely responsible for the formation of the overhang. This overhang was generated by the oligonucleotide 3B (SEQ ID NO: 4) in the PCR and is compatible with DNA ends which were generated by the restriction endonuclease Xbal. The PCR-ProduM thus has two different ends and could therefore be installed in pGEXmod between EcoRI and Xbal.

Conclusion:

The generation of double-stranded DNA with overhanging 5 ^' ends is possible if a polymerase chain reaction is carried out with two modified hybrid DNA / RNA oligonucleotides. It is sufficient if the two oligonucleotides each contain only one modified ribonucleotide building block. The modification of the ribonucleotide building block can represent a phosphorothioate or a 2-0-methyl modification.

The size of the 5 ^' overhang is determined solely by the location of the modified nucleotide. The overhang begins with the modified nucleotide and extends to the 5 ^' end of the oligonucleotide built into the PCR product.

Example 4

Generation of a double-stranded DNA molecule with 5 ^' protruding ends by the polymerase chain reaction using polymerase-resistant hybrid DNA / RNA oligonucleotides and its directional incorporation The oligonucleotides 4A (SEQ ID NO: 5) and 4B (SEQ ID NO: 6) were used to amplify the DNA sequence coding for the carboxy-terminal region of bovine Adam 10 by means of the polymerase chain reaction. The oligonucleotides 4A (SEQ ID NO: 5) and 4B (SEQ ID NO: 6) are hybrid DNA / RNA oligonucleotides in which only the nucleotide in position four represents a ribonucleotide building block.

The cDNA from AdamIO of bovine served as template DNA (GenBank / EMBL database, accession number: Z21961).

The 150 base pair PCR product obtained with the Taq DNA polymerase was isolated using the QIAquick PCR Purification Kit (Qiagen, Germany) according to the manufacturer's instructions. The purified PCR-ProduM was then treated with T4 DNA polymerase. The QIAquick PCR Purification Kit was then used to isolate the treated PCR product.

The PCR-ProduM isolated in this way was then ligated with a pGEXmod plasmid fragment. The pGEXmod plasmid fragment used in the ligation was obtained as follows: the plasmid pGEXmod was first cut with the restriction endonucleases EcoRI and Xhol, then the plasmid fragment was isolated from an agarose gel using the QIAquick Gel Extraction Kit according to the manufacturer's instructions (Qiagen, Germany).

After transformation of E. coli DH5α with the ligation mixture, the transformants obtained were examined for the presence of the recombinant plasmid. A restriction analysis on the plasmids isolated from the transformants showed the following:

1. The recombinant plasmid was present in more than 90% of the clones examined.

2. All recombinant plasmids each had an EcoRI and an Xhol recognition sequence.

The presence of these two restriction sites shows that the DNA repair mechanisms of the bacteria used were able to exchange the ribonucleotides present in the ligated recombinant plasmids for DNA building blocks. DNA sequencing on one randomly selected recombinant plasmid showed that the PCR product was correctly integrated between EcoRI and Xhol in pGEXmod.

The successful recombination of EcoRI / Xhol-cut pGEXmod plasmid fragment with the PCR product is only possible if the PCR-ProduM has the necessary compatible DNA ends. Since the PCR-ProduM had not been subjected to any treatment by restriction endonucleases, these overhangs must have arisen in the polymerase chain reaction with the oligonucleotides 4A (SEQ ID NO: 5) and 4B (SEQ ID NO: 6).

During the PCR, the oligonucleotide 4A (SEQ ID NO: 5) produced a 5 ^' overhang of the following composition: 5 -AATu. The second 5 overhang was introduced into the PCR product by the oligonucleotide 4B (SEQ ID NO: 6) and has the following composition: 5 -TCGa. The small print and underlined nucleotides are ribonucleotides that have no further modifications. The ribonucleotide building block is responsible for the formation of the respective overhang.

The PCR product thus has two different ends that are compatible with DNA ends that were generated by EcoRI or Xhol. It is therefore possible to insert this PCR product in a directed manner into a correspondingly prepared plasmid.

Conclusion:

The generation of double-stranded DNA with overhanging 5 ^' ends is possible if one polymerase chain reaction is carried out with two hybrid DNA / RNA oligonucleotides. It is sufficient if the two oligonucleotides each contain only one ribonucleotide building block. The size of the 5 ^' overhang is determined solely by the position of the ribonucleotide. The overhang begins with the ribonucleotide and extends to the 5 ^' end of the oligonucleotide built into the PCR product.

A single ribonucleotide that is within a hybrid DNA / RNA oligonucleotide obviously cannot serve as a template in DNA synthesis by a DNA polymerase. Example 5

Generation of a double-stranded DNA molecule with a smooth 5 ^' end protruding by two nucleotides and its directional incorporation into a cloning vector

Using the polymerase-resistant at the 5 ^' position of the deoxyribose phosphorothioate-modified deoxy-oligonucleotide 5B (SEQ ID NO: 8) and the deoxyribonucleotide 5A (SEQ ID NO: 7), a double-stranded DNA molecule with a um was first converted via the polymerase chain reaction generated two nucleotides protruding 5 ^' end and a smooth 5' end. The cDNA from AdamIO of bovine served as template DNA (GenBank / EMBL database, accession number: Z21961).

The 150 base pair PCR product obtained with the Pfu DNA polymerase was isolated from an agarose gel with the QIAquick Gel Extraction Kit and ligated with a linear pUC19 plasmid fragment.

The pUC19 plasmid fragment used in the ligation was obtained as follows: the plasmid pUC19 was first cut with the restriction endonucleases Smal and Accl, then the plasmid fragment was isolated from an agarose gel using the QIAquick Gel Extraction Kit.

After transformation of E. coli DH5α with the ligation mixture, the transformants obtained were examined for the presence of the recombinant plasmid. DNA sequencing on a randomly selected recombinant plasmid showed that the PCR product was integrated correctly between Smal and Accl in pUC19.

The successful recombination of Smal / AccI-cut pUC19 plasmid fragment with the PCR-ProduM is only possible if the PCR product has the necessary compatible DNA ends. Since the PCR product had not been subjected to any treatment by restriction endonucleases, these overhangs must have arisen in the polymerase chain reaction with the oligonucleotides 5A (SEQ ID NO: 7) and 5B (SEQ ID NO: 8). During the PCR, the oligonucleotide 4A (SEQ ID NO: 5) produced a smooth, Smal-cut DNA compatible end. The 5 ^' overhang comprising two nucleotides was introduced into the PCR product by oligonucleotide 5B (SEQ ID NO: 8) and has the following composition: 5 ^' -Cg. The small-sized nucleotide is a

Phosphorothioate-modified DNA building block, which is responsible for the formation of the overhang.

The PCR product thus has two different ends, so it can be built into a suitably prepared plasmid.

Conclusion:

The generation of double-stranded DNA with a 5 ^' end protruding by two nucleotides is possible if one carries out a polymerase chain reaction with deoxyoligonucleotides, one of which has a phosphorothioate-modified DNA building block which confers polymerase resistance. The size of the 5 ^' overhang is determined solely by the position of the modified nucleotide, begins with this building block and extends to the 5 ^' end of the oligonucleotide built into the PCR-ProduM.

Example 6

Generation of a single nucleotide overhang at the 5 ^' end of a double-stranded DNA molecule and its directional incorporation into a cloning membrane

Using the polymerase resistant RNA / DNA

Oligonucleotide hybrids 6A (SEQ ID NO: 9) and deoxyribonucleotide 6B (SEQ ID NO: 10) were first produced via the polymerase chain reaction with a double-stranded DNA molecule with a 5 ^' end protruding by a nucleotide and a smooth 5 ^' end , The cDNA from AdarnlO of bovine served as the template DNA (GenBank / EMBL database, accession number: Z21961).

Two different heat-stable DNA polymerases were used for the amplification of the Adam10 cDNA section: 1. The error-reading and error-correcting Pfu DNA polymerase, this enzyme usually produces smooth DNA ends during PCR.

2. The QBio-Taq DNA polymerase, which is a modified Taq DNA polymerase. This enzyme, like Taq DNA polymerase, has no error-reading activity. In contrast to Taq DNA polymerase, however, this enzyme normally produces smooth DNA ends.

The 460 base pairs of PCR products obtained with both polymerases were subsequently analyzed using the QIAquick PCR Purification Kit

Manufacturer's information (Qiagen, Germany) cleaned and then treated with Xbal, the 460 base pair PCR products being split into two 400 and 60 base pair fragments. The 400 base pair fragment was then isolated from an agarose gel using the QIAquick Gel Extraction Kit according to the manufacturer's instructions (Qiagen, Germany). These DNA fragments were then ligated to a linear plasmid fragment which had previously been treated with EcoNI and Xbal and had also been gel-isolated.

After transformation of E. coli DH5α with the ligation mixture, the transformants obtained were examined for the presence of the recombinant plasmid. Restriction analysis showed that 95% of the recombined plasmids had taken up the PCR product. It was irrelevant with which DNA polymerase the corresponding PCR product was generated.

DNA sequencing on a recombinant plasmid that had taken up a PCR product that had been generated with QBio-Taq showed that the PCR-ProduM was correctly integrated between the plasmid ends generated by EcoNI and Xbal.

The successful recombination of EcoNI / Xbal-cut plasmid fragment with a PCR-ProduM is only possible if the PCR product has the necessary compatible DNA ends. Since the PCR products had only been treated with Xbal, the second end compatible with EcoNI in the polymerase chain reaction must have been generated by oligonucleotide 6A (SEQ ID NO: 9). During the PCR, the oligonucleotide 6A (SEQ ID NO: 9) produced a 5 ^' individual nucleotide overhang with the following composition: 5 ^' -u. The small print and underlined nucleotide is a ribonucleotide building block, which is responsible for the formation of the overhang and in this case is compatible with DNA cut by EcoNI.

The PCR-ProduM thus has two different ends and can therefore be built into a suitably prepared plasmid.

Conclusion:

The generation of double-stranded DNA with 5 ^' single nucleotide overhangs is possible with Pfu and QBio-Taq DNA polymerase with very good efficiency if a suitable polymerase-resistant oligonucleotide is used in the PCR.

So far, there has been no universal method of attaching single nucleotide overhangs of any sequence to 5 ^' ends of DNA. Single nucleotide overhangs are the smallest possible overhangs that can be used for directional cloning.

Example 7

Recombinant DNA technique without the use of restriction endonuclease and ligases

Oligonucleotides 7A (SEQ ID NO: 11) and 7B (SEQ ID NO: 12) were used to amplify the plasmid backbone of pCR4 (Invitrogen, the Netherlands).

The oligonucleotides 7C (SEQ ID NO: 13) and 7D (SEQ ID NO: 14) were used to amplify the DNA sequence coding for the carboxy-terminal region of murine TACE by means of the polymerase chain reaction. The cDNA from TACE of the mouse (GenBank EMBL database, accession number: AB021709) was used as the template DNA.

The Taq DNA polymerase was used for the amplification of the pCR4 plasmid fragment. The PCR approach was carried out on an agarose gel applied, separated by electrophoresis, then the 3950 base pair pCR4 plasmid fragment was isolated from the gel (PCR purification kit, Qiagen, Hilden). The isolated DNA was divided into equal parts. A portion was then treated with T4 DNA polymerase and then isolated using the PCR purification kit.

Two different thermostable DNA polymerases were used to amplify the TACE sequence:

1. Vent polymerase (New England Biolabs, FranMurt Höchst), this enzyme has error-reading and error-correcting activities and usually produces smooth DNA ends during PCR:

2. The Taq DNA polymerase, this enzyme has no error-reading activity and normally produces DNA ends with deoxyadenosine single nucleotide overhangs at the 3 ^' ends during PCR.

The 400 base pair PCR product obtained with the Vent polymerase was isolated from an agarose gel. In contrast, the product of the same size obtained with the Taq DNA polymerase was isolated directly from the PCR mixture.

Hybridization and transformation of the DNA fragments Two separate hybridization and transformation approaches were carried out:

1. The 3950 base pair gel-isolated pCR4 plasmid fragment obtained with the Taq DNA polymerase and subsequently treated with T4 DNA polymerase was hybridized with the 400 base pair gel-isolated TACE sequence which had been obtained with the Vent polymerase.

2. The 3950 base pair gel-isolated pCR4 plasmid fragment obtained with the Taq DNA polymerase was hybridized with the 400 base pair TACE sequence, which had also been obtained with the Taq DNA polymerase.

The DNAs to be hybridized were mixed, the solutions were adjusted to 20mM Tris / HCl pH 7.5 \ 10mM MgCl2 \ 50mM NaCI, heated to 80 ° C and then slowly cooled to room temperature. E. coli DH5α was then transformed using the hybridization approaches. The plasmid DNA was isolated from the transformants obtained and examined for the presence of the recombinant plasmids by means of restriction analysis. It was found that 65% of the transformants had the recombinant plasmid when they started with the first

Hybridization approach (see above!) Had been transformed. In contrast, only 6% of the transformants showed the recombinant plasmid when they had been transformed with the second hybridization approach (see above!).

Apparently, ligation-free recombination is more efficient if an error-correcting DNA polymerase is used to produce the DNA fragments to be combined. On the other hand, the results of DNA sequencing show that it is irrelevant for the correctness of the recombination which DNA polymerase is used. In both cases, the BaMerium had covalently linked the gaps of the hybridized DNA molecules, although none of the 5 ^' DNA ends was phosphorylated. Furthermore, all ribonucleotide building blocks had been replaced by the corresponding DNA building blocks.

Conclusion:

Recombinant DNA that does not require restriction endonucleases and ligases becomes possible if the DNA fragments to be recombined are produced using polymerase-resistant oligonucleotides. The position of the protective group conferring polymerase resistance of the oligonucleotides used should be chosen so that 5 ^' overhangs of sufficient size are created to enable a specific and sufficiently stable hybridization of compatible ends.

The oligonucleotides required for the production of the DNA molecules to be combined need not be phosphorylated at the 5 ^' end, since the covalent linkage is not carried out in vitro by a DNA ligase, but in vivo by the BaMerium. Example 8

Generation of a cDNA complementary to the mRNA using a polymerase-resistant oligonucleotide

A cDNA synthesis was carried out on an mRNA population isolated from human kidney cells with the aid of the polymerase-resistant oligonucleotide 8A (SEQ ID NO: 15) and the reverse transcriptase Superscript II (Gibco-Lifetechnologies). Oligonucleotide 8A (SEQ ID NO: 15) hybridizes only with the human within the entire mRNA population

Adam10 mRNA, correspondingly only a single-stranded DNA complementary to the Adam10 mRNA is generated with the reverse transcriptase.

The presence of the single-stranded Adam10 cDNA was then checked by PCR with the Adam10-specific oligonucleotides 8B (SEQ ID NO: 16) and 8C (SEQ ID NO: 17). The expected 1030 base pair Adam10 fragment was generated in this ReaMion.

Conclusion:

A first strand cDNA synthesis can be started with a polymerase resistant oligonucleotide. The double-stranded cDNA can then be amplified with unmodified, but also with polymerase-resistant oligonucleotides. The use of polymerase-resistant oligonucleotides has the decisive advantage that a double-stranded cDNA with overhanging 5 ^' ends is obtained, which can be clipped in a directed manner without further enzymatic modifications. A comparable method is not yet known.

Further examples:

Preliminary remarks:

16 of the oligonucleotides used were obtained from QIAGEN Operon (Cologne). Another oligonucleotide was obtained from MWG-Biotech AG (Ebersberg). All oligonucleotides used were dissolved in TE buffer (10 mM Tris / HCl, 1 mM EDTA, pH8) (100 M) and then adjusted to the final concentration of 5 μM in RNase-free water. Oligonucleotides used:

EPOIigo (FI) -Lac403-379 Primer 1A: 5'-agc [5FI-dU] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 18) The nucleotide at position four is a 5-fluoro-deoxy-uridine

EPOIigo (Br) -Lac403-379

Primer 2A: 5'-agc [5Br-dU] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 19) The nucleotide at position four is a 5-bromo-deoxy-uridine

EPOIigo (l) -Lac403-379

Primer 3A: 5'-agc [5l-dU] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 20)

The nucleotide at position four is a 5-iodo-deoxy-uridine

EPOIigo (DSP) -Lac403-379

Primer 4A: 5'-agc [dSpacer] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 21)

The nucleotide at position four is an abasic (d-spacer)

EPOIigo (Sp-3) -Lac403-379

Primer 5A: 5'-agc [Sp-3] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 22) Instead of the nucleotide at position four, C3 spacer is included

EPOIigo (Sp-9) -Lac403-379 Primer 6A: 5'-agctt [Sp-9] tcgaattcactggccgtcgttttac-3 '(Seq ID NO: 23) Instead of the nucleotide at position four, C9 spacer is included.

EPOIigo (Uni) -Lac403-379 Primer 7A: 5'-agc [Am-Uni] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 24) Instead of the nucleotide at position four, a Uni-link amino modifier is included.

EPOIigo (rev) -Lac403-379 Primer 8A: 5'-agc [dT-5] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 25) The nucleotide at position four is a reverse base bound by a 3'-3' bond.

EPOIigo (Amino) -Lac403-379 Primer 9A: 5'-agc [AmPur] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 26) The nucleotide at position four contains 2-aminopurine as the base.

EPOIigo (nitro) -Lac403-379

Primer 10A: 5'-agc [5-Nitldl] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 27) The nucleotide at position four contains a 5-nitroindole as base.

EPOIigo (Ribo) -Lac403-379

Primer 11 A: 5'-agc [20MeU] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 28)

The nucleotide at position four is a 2'-0-methyl ribonucleotide (uridine)

EPOIigo (Ribothio) -Lac403-379

Primer 12A: 5'-agc [20MeU ^* ] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 29) The nucleotide at position four is a 2'-0-methyl ribonucleotide (uridine), which is additionally modified thioate

EPOIigo (Tamra) -Lac403-379

Primer 13A: 5'- [Tamra] agcttgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 30)

The oligonucleotide is labeled with TAMRA at the 5 'end

EPOIigo-Lac403-379

Primer 14A: 5'-agcttgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 31) No modification

EPOIigo (FI) -Lac403-379 Primer 15A: 5'-agc [2FI-dU] tgtcgaattcactggccgtcgttttac-3 '(Seq ID NO: 32) The nucleotide at position four is a 2-fluoro-deoxy-uridine

EPOligo-Lad 19-139

Primer 1 B: 5'-CCTGTTGGCGGGTGTCGGGGCTG-3 '(Seq ID NO: 33) No modification

EPOIigo- (fluoro) Lac119-139

Primer 2B: 5'-CCTG [FI-dT] TGGCGGGTGTCGGGGCTG-3 '(Seq ID NO: 34)

The nucleotide at position five is labeled with fluorescein

Construction of the cloning vector Q1.1 (pUC19ΔLacZ Kanr):

The plasmid Q1.1 is a derivative of the vector pUC19 whose LacZ alpha complementation gene was destroyed. To construct the vector Q1.1, pUC19 was cut with the restriction endonuclease Ndel (nucleotide 184). The resulting overhang was filled in with T4 DNA polymerase. The resulting fragment was then cut with the Hind III restriction endonuclease. A 1490 bp kanamycin resistance cassette was inserted into the 2423 bp pUC19 vector fragment by amplification of the coding region

(Nucleotide positions 2671-4164) of the plasmid pGBKT7 (Clontech) was obtained. At the ends of the 1490 bp PCR product, a Stul or HindIII interface was introduced via the primers, which were used for ligation.

Construction of the template vector Q2.7

Plasmid Q2.7 is a derivative of VeMor pUC19, whose ampicillin resistance gene has been destroyed. Instead, a tetracycline resistance gene was introduced. To create the template VeMor Q2.7, pUC19 was digested with the restriction endonucleases Seal (cuts at position 2177 in pUC19) and Sspl (cuts at position 2501 in pUC19). A tetracycline resistance cassette was installed at the position of the deleted amp resistance codons. This was obtained from the plasmid pALTER-1 (Promega) by digestion with the restriction endonucleases HindIII and Styl fragment. The protruding ends of the 1772 bp fragment were smoothed before treatment by treatment with T4-DNA polymerase. The resulting plasmid is 4134 bp.

Generation of double-stranded DNA molecules with a protruding 5 'end by using the polymerase chain reaction using a modified oligonucleotide, their size analysis on a GeneScanGel and their directional incorporation into a cloning vector

With the oligonucleotide 2B (Seq ID NO: 17) as a forward primer and the oligonucleotides 1A (Seq ID NO: 1), 2A (Seq ID NO: 2), 3A (Seq ID NO: 3), 4A (Seq ID NO: 4), 5A (Seq ID NO: 5), 6A (Seq ID NO: 6), 7A (Seq ID NO: 7), 8A (Seq ID NO: 8), 9A (Seq ID NO: 9), 10A ( Seq ID NO: 10), 11A (Seq ID NO: 11), 12A (Seq ID NO: 12), 13A (Seq ID NO: 13), 14A (Seq ID NO: 14) and 15A (Seq ID NO: 15 ) As a reverse primer, the amino-terminal fragment (alpha fragment) of the DNA sequence encoding LacZ was amplified by means of PCR using the following programs. The plasmid Q2.7 was used as a template. Either the error-reading and corrective Pfu-DNA polymerase (Pfu Hot Start, Stratagene La Jolla, USA or the Taq-DNA polymerase (HotStar Taq, QIAGEN, Hilden) was used for the amplification. used. The latter has no error-reading activity. The Pfu-DNA polymerase normally produces smooth DNA ends, while the Taq-DNA polymerase creates 3'-DNA ends, some of which have single nucleotide overhangs (usually deoxyadenosine).

PCR approach 1 (Pfu DNA polymerase):

PCR program 1 (Pfu):

X = 34 cycles

PCR approach 2 (HotStar Taq DNA polymerase):

PCR program 2 (Taq):

X = 34 cycles

After the polymerase chain reaction had ended, the amplificates were stored at -20 ° C. A 2 μl aliquot of each amplificate was applied to a 2% agarose gel and separated. 4μl and 6μl of the Low Mass Ladder (Gibco) were used as size markers. The PCR reaction using the Pfu-DNA polymerase with the primer combinations 2B (Seq ID NO: 17) and 1A (Seq ID NO: 1) as well as 2B (Seq ID NO: 17) and 15A (Seq ID NO: 15) resulted no amplificate. The amount of each amplificate was quantified and an aliquot in water was adjusted to 1 ng / μl. 1.5 μl of each amplificate set in this way were mixed with 4.5 μl blue marker (blue dextran 50 mg / ml; EDTA 25 mM) and 0.5 μl ROX 600 (GENEPRINT-KIT, Promega) and on a GeneScan gel for size analysis applied. Size differences of a DNA sequence can be separated from a base pair on a GeneScan gel. The fragment lengths are detected by a fluorescence signal (primer 2B, fluorescein labeled).

The PCR product generated using Pfu DNA polymerase and primers 2B and primer 14A shows a size of 289 bp (84.5%). Whereas the PCR product generated using the same primers and the HotStarTaq DNA polymerase has two main fragments. These have a size of 289 bp (46.2%) and 290 bp (50.9%). The 290 bp product is generated by the template-independent synthesis activity of the Taq DNA polymerase. The following table shows the results of the GeneScan analyzes with which the efficiency of polymerase-resistant protective groups was investigated.

The maximum size of the fragments can be 289 nucleotides. Due to the protective group, the size of the DNA fragments generated should be smaller, ideally comprising 285 nucleotides.

Information in the table:

Fragment size: Size of the DNA fragments generated (specified in

nucleotides)

Height: signal intensity

Area: integral of the signal area

V. Frequency of polymerase stop in%

Preparation of the vector fragment (2429 bp) from Q1.1 with a Hindill interface and a smooth end (Q1.1-Pfu)

The cloning VeMors Q1.1 no longer contains an alpha peptide. The plasmid Q1.1 was treated with the restriction endonucleases Stul and Hindill. This creates two fragments of 2429 bp and 1490 bp in size. The 2429 bp Q1.1 Stul-Hindlll vector fragment represents the pUC19 backbone without alpha peptide and codes for the ampicillin resistance gene, the 1490 bp fragment contains a kanamycin resistance cassette. The 2429 bp vector fragment was isolated from an agarose gel, the concentration of the vector fragment was determined photometrically.

Preparation of the vector fragment (2429 bp) from Q1.1 with a HindIII interface and a 3'-T overhang (Q1.1-Taq) The cloning vector Q1.1 no longer contains an alpha peptide. The plasmid Q1.1 was linearized with the Stul restriction endonuclease. Subsequently, T single nucleotide overhangs were generated with Taq DNA polymerase in the presence of dTTP at the 3 ^' ends. After purification (QIAspin), Hind III was cut with the restriction endonuclease. This creates two fragments of 2429 bp and 1490 bp in size. The 2429 bp Q1.1 Stul-Hindlll vector fragment represents the pUC19 backbone without alpha peptide and codes for the ampicillin resistance gene, the 1490 bp fragment contains a kanamycin resistance cassette. The 2429 bp vector fragment was isolated from an agarose gel, the concentration of the vector fragment was determined photometrically.

Directed installation of the LacZ alpha PCR fragments (LacZ alpha fragment) in a cloning membrane

The position of the protective group conferring polymerase resistance in the respective reverse primer for the PCR reaction is chosen in such a way that a double strand with a protruding 5 ′ end is produced. This 5 'end is complementary to a DNA end which is formed when double-stranded DNA has been cut with the restriction endonuclease HindIII. Depending on the DNA polymerase used, the second 5 'end of the amplified product should either be smooth (Pfu-DNA polymerase) or at least partially have a 3'-overhang (Taq-DNA polymerase). If the PCR fragment is introduced into the previously prepared vector fragment of Q1.1, plasmids should be generated which code for a functional LacZ alpha fragment. Transformation of these plasmids into an E. coli strain which is capable of so-called alpha complementation produces blue colonies on solid nutrient media suitable for detection.

Ligation of the PCR fragments:

All PCR fragments generated with both DNA polymerases were ligated with the VeMor fragment Q1.1 with a HindIII site and a 3'-T overhang (Q1.1-Taq). Ligation conditions

All samples were incubated at 16 ° C. overnight and 1 μl each was transformed into the E. coli strain QEZ (QIAGEN, Hilden). This was then spread on suitable solid SeleMion medium. In addition, the PCR fragments generated with the forward oligonucleotide 2B in combination with the reverse oligonucleotides 2A, 3A, 9A, 11A and 12A with both polymerases were converted into the VeMor fragment Q1.1 with a HindIII interface and a smooth end ( Q1.1 Pfu) ligated.

Ligation conditions

All samples were incubated at 16 ° C. overnight and 1 μl each was transformed into the E. coli strain QEZ (QIAGEN, Hilden). This was then streaked onto suitable solid SeleMion medium. Number of blue clones

nb not determined

Claims

claims

1. A process for the preparation of double-stranded nucleic acids with one or two 5'-overhangs, characterized in that a DNA synthesis with one or two polymerase-resistant oligonucleotides is carried out by means of a DNA polymerase on a DNA template, with a polymerase-resistant oligonucleotide at least one Contains nucleotide analog, which is capable of entering into a nucleotide-specific base pairing with deoxribonucleic acid, ie also with ribonucleic acid.

2. A process for the preparation of deoxyribonucleic acid / ribonucleic acid hybrids, characterized in that DNA synthesis with a polymerase-resistant oligonucleotide is carried out by means of a reverse transcriptase on an RNA template, the polymerizable oligonucleotide containing at least one nucleotide analog capable of deoxribonucleic acid thus also entering into a nucleotide-specific base pairing with ribonucleic acid.

3. The method according to claim 1 or 2, characterized in that deoxribonucleotides or ribonulleotides derivatized on the phosphate group are used as polymerase-resistant nucleotides.

4. The method according to claim 3, characterized in that phosphorothioate-modified deoxyribonucleotides or phosphorothioate-modified ribonucleotides are used as polymerase-resistant nucleotides.

5. The method according to claim 4, characterized in that a 5 ^' - position of the ribose ring derivatized by a phosphorothioate grouping ribose are used as polymerase-resistant nucleotides.

6. The method according to any one of claims 1 or 2, characterized in that alkyl-modified nucleotide building blocks are used as polymerase-resistant nucleotide protective groups at different positions.

7. The method according to claim 6, characterized in that a ribonucleotide modified on the 2 ^' hydroxyl group is used as the polymerase-resistant nucleotide.

8. The method according to claim 7, characterized in that the 2 ^' -

Hydroxyl group of the ribonucleotide is etherified with an alkyl group having one to three carbon atoms.

9. The method according to claim 8, characterized in that the 2 ^' - hydroxyl group of the ribonucleotide is etherified with a methyl group.

10. The method according to claim 1 or 2, characterized in that a ribonucleotide vereehterter on the 2 ^' hydroxy group with an alkoxyalkylene group is used as a polymerase-resistant nucleotide.

11. The method according to claim 10, characterized in that the 2'-hydroxyl group of the ribonucleotide is etherified by a - [(CH ₂ ) ₂ ] q-0-alkyl group in which q is an integer 1, 2, 3, 4 or 5 and alkyl preferably represents an alkyl group having one to three carbon atoms.

12. The method according to claim 1 or 2, characterized in that a halogenated in the base partial structure ribonucleotide or deoxyribonucleotide is used as the polymerase-resistant nucleotide.

13. The method according to claim 12, characterized in that 5-fluorine-dU, 5-bromo-dU and 5-iodine-dU derivatized nucleotides are used as the polymerase-resistant nucleotide.

14. The method according to claim 1 or 2, characterized in that a nucleotide derivatized by a dye is used as the polymerase-resistant nucleotide.

15. The method according to claim 14, characterized in that dyes of the fluorescein type or TAMRA are used as the dye.

16. The method according to claim 1 or 2, characterized in that nucleotides which have a different base than that in naturally occurring nucleotides are used as polymerase-resistant nucleotides.

17. The method according to claim 16, characterized in that 2-aminopurine and 5-nitroindole are used as bases.

18. The method according to claim 1 or 2, characterized in that instead of a nucleotide ribonucleotide or deoxyribonucleotide-replacing structures are used

19. The method according to claim 18, characterized in that as ribonucleotide or deoxyribonucleotide replacing structures

HO (CH ₂ ) ₃ OH

HO [(CH ₂ ) ₂ 0] _n H where n is an integer 1, 2, 3, 4 or 5, or

HO-CH ₂ CH [(CH ₂ ) _m NH ₂ ] (CH ₂ ) OH, where m is an integer 3, 4, 5, 6 or 7, can be used.

20. The method according to claim 1 or 2, characterized in that a reversed base is used as the polymerase-resistant nucleotide.

21. The method according to claim 1 to 15, characterized in that one or more polymerase-resistant nucleotides are used, which can optionally be modified at one or more locations.

22. Deoxyribonucleic acid (DNA) or deoxyaribonucleic acid / ribonucleic acid hybrid, produced by a method of claims 1 to 21.

23. deoxyribonucleic acid (DNA) according to claim 22, characterized in that the DNA is a linear double-stranded DNA with 5 ^' protruding ends on both sides.

24. Deoxyribonucleic acid (DNA) according to claim 22, characterized in that the DNA is a directionally clonable, linear double-stranded DNA with 5 ^' protruding ends on both sides of different nucleotide compositions.

25. Deoxyribonucleic acid (DNA) according to claim 22, characterized in that the DNA is a directionally clonable, linear double-stranded DNA with only one 5 ^' protruding end.

26, deoxyribonucleic acid (DNA) according to claim 22, characterized in that the DNA a directed clonable, double-stranded, complementary to a messenger RNA (mRNA) DNA (cDNA) with one or both 5 ^'ends -überstehenden.

27. Deoxyribonucleic acid (DNA) according to claim 22, characterized in that the DNA is a directionally clonable double-stranded DNA complementary to RNA with ends protruding on one or both sides 5 ^' .

28. Deoxyribonucleic acid (DNA) according to claim 22, characterized in that the DNA is a linear double-stranded DNA with one or two 5 ^' protruding ends, in which the size of the overhang each comprises only one nucleotide.

29. Use of a polymerase-resistant oligonucleotide for the new synthesis of a DNA strand by a DNA polymerase.

30. Use of a polymerase-resistant oligonucleotide for the re-synthesis of a DNA strand by a reverse transcriptase.

31. Use of a polymerase-resistant oligonucleotide for the polymerase chain reaction (PCR).

32. Use of a free or a polymerase-resistant oligonucleotide already built into a DNA strand as the substrate of a

DNA or an RNA ligase.

33. Use of a polymerase-resistant oligonucleotide for the ligase chain reaction (LCR).

34. Use of a polymerase-resistant oligonucleotide for the first strand synthesis of DNA complementary to RNA.

35. Use of polymerase-resistant oligonucleotides for the production of double-stranded oligonucleotide adapters with one or two through

DNA polymerases non-fillable ends.

36. Use of polymerase-resistant oligonucleotides for the production of cDNA libraries.

37. Use of polymerase-resistant oligonucleotides for the production of genome libraries.

38. Use of polymerase-resistant oligonucleotides for the production of synthetic genes.

39. Use of polymerase-resistant oligonucleotides for the production of partially synthetic genes.

40. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA with one or two 5 ^' protruding ends.

41. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA with one or two 5 ^' protruding ends for directional cloning.

42. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA with one or two 5 ^' protruding ends for DNA recombination with compatible DNA ends.

43. Use of polymerase-resistant oligonucleotides according to claim 29 for the production of double-stranded DNA molecules with 5 ^' - protruding ends for ligation-independent recombinant DNA techniques.

44. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA molecules with 5 ^' protruding ends for homologous recombination.

45. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA molecules with 5 ^' protruding ends for homologous recombinations in the production of transgenic non-human organisms, transgenic unicellular organisms, transgenic pro- and eukaryotic cells and transgenic viruses.

46. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA molecules with 5 ^' protruding ends for homologous recombinations when knocking out genes (knockout) and when replacing genes (gene replacement).

47. Use of polymerase-resistant oligonucleotides to generate double-stranded DNA molecules with 5 ^' protruding ends for gene therapy.

48. Use of polymerase resistant oligonucleotides Generation of single or double stranded DNA molecules with one or two 5 ^' protruding ends for use in affinity chromatography

49. Kit containing a deoxyribonucleic acid (DNA) according to claim 22.

0. Kit containing a polymerase-resistant oligonucleotide.