WO2003077945A1

WO2003077945A1 - Intracellular antibodies

Info

Publication number: WO2003077945A1
Application number: PCT/GB2003/001077
Authority: WO
Inventors: Maria Natividad Lobato-Caballero; Terence Howard Rabbitts
Original assignee: Medical Research Council
Priority date: 2002-03-14
Filing date: 2003-03-14
Publication date: 2003-09-25
Also published as: AU2003219277A1

Abstract

The present invention relates to immunoglobulin molecules which are capable of binding to a specific antigen within an intracellular environment. In particular, the invention relates to the use of intracellularly binding antibodies in the intracellular relocation and/or degradation of target ligand.

Description

Intracellular Antibodies

Background to the Invention

Intracellular antibodies or intrabodies have been demonstrated to function in antigen recognition in the cells of higher organisms (reviewed in Cattaneo, A. & Biocca, S. (1997) Intracellular Antibodies: Development and Applications. Landes and Springer- Verlag). This interaction can influence the function of cellular proteins which have been successfully inhibited in the cytoplasm, the nucleus or in the secretory pathway. This efficacy has been demonstrated for viral resistance in plant biotechnology (Tavladoraki, P., et al. (1993) Nature 366: 469-472) and several applications have been reported of intracellular antibodies binding to HIV viral proteins (Mhashilkar, A.M., et al. (1995) EMBO J 14: 1542-51; Duan, L. & Pomerantz, R.J. (1994) Nucleic Acids Res 22: 5433-8; Maciejewski, J.P., et al. (1995) Nat Med l: 667-73; Levy-Mintz, P., et al. (1996) J. Virol. 70: 8821-8832) and to oncogene products (Biocca, S., Pierandrei-Amaldi, P. & Cattaneo, A. (1993) Biochem Biophys Res Commun 197: 422- 7; Biocca, S., Pierandrei-Amaldi, P., Campioni, N. & Cattaneo, A. (1994) Biotechnology (N Y) 12: 396-9; Cochet, O., et al. (1998) Cancer Res 58: 1170-6). The latter is an important area because enforced expression of oncogenes often occurs in tumour cells after chromosomal translocations (Rabbitts, T.H. (1994) Nature 372: 143- 149). These proteins are therefore important intracellular therapeutic targets (Rabbitts, T.H. (1998) New Eng. J. Med 338: 192-194) which could be inactivated by binding with intracellular antibodies. Finally, the international efforts at whole genome sequencing will produce massive numbers of potential gene sequences which encode proteins about which nothing is known. Functional genomics is an approach to ascertain the function of this plethora of proteins and the use of intracellular antibodies promises to be an important tool in this endeavour as a conceptually simple approach to knocking-out protein function directly by binding an antibody inside the cell.

Simple approaches to derivation of antibodies which function in cells are therefore necessary if their use is to have any impact on the large number of protein targets. In normal circumstances, the biosynthesis of immunoglobulin occurs into the endoplasmic reticulum for secretion as antibody. However, when antibodies are expressed in the cell cytoplasm (where the redox conditions are unlike those found in the ER) folding and stability problems occur resulting in low expression levels and the limited half-life of antibody domains. These problems are most likely due to the reducing environment of the cell cytoplasm (Hwang, C, Sinskey, A.J. & Lodish, H.F. (1992) Science 257: 1496-502), which hinders the formation of the intrachain disulphide bond of the VH and VL domains (Biocca, S., Ruberti, F., Tafani, M., Pierandrei-Amaldi, P. & Cattaneo, A. (1995) Biotechnology (N Y) 13: 1110-5; Martineau, P., Jones, P. & Winter, G. (1998) J Mol Biol 280: 117-127) important for the stability of the folded protein. However, some ScFv have been shown to tolerate the absence of this bond (Proba, K., Honegger, A. & Pluckthun, A. (1997) J Mol Biol 265: 161-72; Proba, K., Worn, A., Honegger, A. & Pluckthun, A. (1998) J Mol Biol 275: 245-53) which presumably depends on the particular primary sequence of the antibody variable regions. No rules or consistent predictions until the present invention, been made about those antibodies which will tolerate the cell cytoplasm conditions. A further problem is the design of expression formats for intracellular antibodies and much effort has be expended on using ScFv in which the VH and VL segments (i.e. the antibody combining site) are linked by a polypeptide linker at the C- terminus of VH and the N-terminus of V (Bird, R.E., et al. (1988) Science 242: 423- 6). While this is the most successful form for intracellular expression, it has a drawback in the lowering of affinity when converting from complete antibody (e.g. from a monoclonal antibody) to a scFv. Thus not all monoclonal antibodies can be made as ScFv and maintain function in cells. Finally, different ScFv fragments have distinct properties of solubility or propensity to aggregate when expressed in this cellular environment. The antigen binding domain of an antibody comprises two separate regions: a heavy chain variable domain (VH) and a light chain variable domain (VL: which can be either Vkappa or Vjambda)* The antigen binding site itself is formed by six polypeptide loops: three from VH domain (HI, H2 and H3) and three from VL domain (LI, L2 and L3). A diverse primary repertoire of V genes that encode the VH and VL domains is produced by the combinatorial rearrangement of gene segments. The VH gene is produced by the recombination of three gene segments, VH, D and JH* In humans, there are approximately 51 functional VH segments (Cook and Tomlinson (1995) Immunol Today, 16: 237), 25 functional D segments (Corbett et al. (1997) J. Mol. Biol, 268: 69) and 6 functional JH segments (Ravetch et al. (1981) Cell, 27: 583), depending on the haplotype. The VH segment encodes the region of the polypeptide chain which forms the first and second antigen binding loops of the VH domain (HI and H2), whilst the VH, D and JH segments combine to form the third antigen binding loop of the VH domain (H3). The V gene is produced by the recombination of only two gene segments, VL and JL. In humans, there are approximately 40 functional VH segments (Schable and Zachau (1993) Biol. Chem. Hoppe-Seyler, 374: 1001), 31 functional VL segments (Williams et al. (1996) J. Mol. Biol, 264: 220; Kawasaki et al. (1997) Genome Res., 7: 250), 5 functional Jkappa segments (Hieter et al. (1982) J. Biol. Chem., 257: 1516) and 4 functional Jlambda segments (Vasicek and Leder (1990) J. Exp. Med., 172: 609), depending on the haplotype. The VL segment encodes the region of the polypeptide chain which forms the first and second antigen binding loops of the VL domain (LI and L2), whilst the VL and JL segments combine to form the third antigen binding loop of the VL domain (L3). Antibodies selected from this primary repertoire are believed to be sufficiently diverse to bind almost all antigens with at least moderate affinity. High affinity antibodies are produced by "affinity maturation" of the rearranged genes, in which point mutations are generated and selected by the immune system on the basis of improved binding. Analysis of the structures and sequences of antibodies has shown that five of the six antigen binding loops (HI, H2, LI, L2, L3) possess a limited number of main-chain conformations or canonical structures (Chothia and Lesk (1987) J Mol. Biol, 196: 901; Chothia et al. (1989) Nature, 342: 877). The main-chain conformations are determined by (i) the length of the antigen binding loop, and (ii) particular residues, or types of residue, at certain key position in the antigen binding loop and the antibody framework. Analysis of the loop lengths and key residues has enabled us to the predict the main-chain conformations of HI, H2, LI, L2 and L3 encoded by the majority of human antibody sequences (Chothia et al. (1992) J. Mol. Biol., 227: 799; Tomlinson et al. (1995) EMBO J., 14: 4628; Williams et al. (1996) J. Mol. Biol, 264: 220). Although the H3 region is much more diverse in terms of sequence, length and structure (due to the use of D segments), it also forms a limited number of main-chain conformations for short loop lengths which depend on the length and the presence of particular residues, or types of residue, at key positions in the loop and the antibody framework (Martin et al. (1996) J. Mol. Biol, 263: 800; Shirai et al. (1996) EERS letter-?, 399: 1.

Recently, the present inventors have devised a technique for the selection of immunoglobulins which are stable in an intracellular environment, are correctly folded and are functional with respect to the selective binding of their ligand within that environment. This is described in WO00/54057. In this approach, the antibody-antigen interaction method uses antigen linked to a DNA-binding domain as a bait and the ScFv linked to a transcriptional activation domain as a prey. Specific interaction of the two facilitates transcriptional activation of a selectable reporter gene. An initial in- vitro binding step is performed in which an antigen is assayed for binding to a repertoire of immunoglobulin molecules. Those immunoglobulins which are found to bind to their ligand in vitro assays are then assayed for their ability to bind to a selected antigen in an intracellular environment, generally in a cytoplasmic environment.

Summary of the invention The same inventors have now surprisingly found that a sub-group of intracellularly binding antibodies selected using the method described above is capable of causing degradation of cognate antigens within an intracellular environment.

The present inventors have shown that once within an intracellular environment, the immunoglobulins of the present invention bind to their specific cognate antigens to form a complex. Advantageously, they form an insoluble complex. Such an insoluble complex is then degraded within the cytoplasm for example via the lysosome system or the proteosome system.

Thus, in a first aspect, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1.

In a further aspect, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

In a further aspect, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulins comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

According to the above aspects of the invention, preferably the method comprises the use of one or more intracellularly binding immunoglobulin/s which exhibit at least 86% identity with the respective amino acid framework consensus sequences depicted in SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin show at least 87% identity. Advantageously, the immunoglobulins show at least 88% identity, 89% identity, 90% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulins show at least 91% identity. Advantageously the one or more immunoglobulin/s show at least 92% identity, 93% identity, 94%, 95, 96, 97, 98, 99% identity with the respective framework consensus amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In a most preferred embodiment the one or more immunoglobulin/s used according to a method of the present invention shows 100% identity with one or more framework amino acid sequence/s identified by SEQ 3 and 4 as herein described.

Immunoglobulins molecules, according to the present invention, refer to any moieties which are capable of binding to a target. In particular, they include members of the immunoglobulin superfamily, a family of polypeptides which comprise the immunoglobulin fold characteristic of antibody molecules, which contains two beta sheets and, usually, a conserved disulphide bond. Members of the immunoglobulin superfamily are involved in many aspects of cellular and non-cellular interactions in vivo, including widespread roles in the immune system (for example, antibodies, T-cell receptor molecules and the like), involvement in cell adhesion (for example the ICAM molecules) and intracellular signalling (for example, receptor molecules, such as the

PDGF receptor). The present invention is applicable to all immunoglobulin superfamily molecules which are capable of binding to target molecules. Preferably, the present invention relates to ScFv molecules.

As referred to herein, the term 'treating' the one or more cells means bringing an immunoglobulin as herein described into contact with the interior of a cell. 'Treating' as herein defined includes within its scope transferring an immunoglobulin molecule into the interior of the cell, advantageously the cytoplasm, by means familiar to those skilled in the art such as transfection methods like electroporation and microinjection. It also includes within its scope expression of an immunoglobulin as herein described within the cell using molecular biology techniques which known to those skilled in the art. In the case where the method of the present invention involves the cytoplasmic degradation of specific antigen, the term 'treating' refers to expressing or transferring an immunoglobulin molecule in or into the cytoplasm of the cell.

The term 'intracellular' means inside a cell, and the present invention is directed to those immunoglobulins, which will bind to ligands/antigens selectively within a cell. The cell may be any cell, prokaryotic or eukaryotic, and is preferably selected from the group consisting of a bacterial cell, a yeast cell and a higher eukaryote cell. Most preferred are yeast cells and mammalian cells. As used herein, therefore, 'intracellular' immunoglobulins and targets or ligands are immunoglobulins and targets/ligands which are present within a cell. In addition the term 'intracellular' refers to environments which resemble or mimic an intracellular environment. Thus, "intracellular" may refer to an environment which is not within the cell, but is in vitro. For example, the method of the invention may be performed in an in vitro transcription and/or translation system, which may be obtained commercially, or derived from natural systems.

Thus the term 'intracellular binding' means binding within a cell or an environment which mimics an intracellular environment as described herein.

A 'specific antigen' as herein defined describes an antigen to which one or more immunoglobulins bind to specifically. The term 'specific binding' means that the interaction between the immunoglobulin and the ligand are specific, that is, in the event that a number of molecules are presented to the immunoglobulin, the latter will only bind to one or a few of those molecules presented. Advantageously, the immunoglobulin ligand interaction will be of high affinity. The interaction between immunoglobulin and ligand will be mediated by non-covalent interactions such as hydrogen bonding and Van der Waals. Generally, the interaction will occur in the cleft between the heavy and the light chains of the immunoglobulin. One skilled in the art will appreciate that the antigen specificity of an antibody is determined by the structural characteristics of the antigen binding site. In the case of the BCR antigen intracellularly binding antibody comprising at least one variable heavy chain described by the amino acid sequence BIO, and designated SEQ 7 in fig 1, the 'specific antigen' is BCR-ABL. Likewise, in the case of the BCR antigen intracellularly binding antibody comprising at least one variable light chain described by the amino acid sequence BIO, and designated SEQ 25 in fig 1, the specific antigen is BCR-ABL. Furthermore, in the case of an intracellularly binding antibody comprising one or more variable heavy and/or light chains as described by the clone A17 and designated SEQ Nos 16 and 34 respectively, the 'specific antigen' is BCR- ABL. Finally, in the case of an intracellularly binding antibody comprising one or more variable heavy and/or light chains as described by the clone A25 and designated SEQ Nos 20 and 38 respectively, the 'specific antigen' is BCR-ABL.

Specifically, as herein described those clones designated A7, A12, A13, A17, A18, A20, A24, A25, A28, A32 are specific for the BCR-ABL antigen by virtue of their binding to the ABL moiety. The intracellularly binding antibody clones designated B3, B9, BIO, B21, B33, B89 are specific for the BCR-ABL antigen by virtue of their binding to the BCR moiety.

The term 'degradation of a specific antigen' in the context of the present invention also includes within its scope the substantial degradation of antigen. The degradation of antigen including the substantial degradation of antigen means the degradation/breakdown of that antigen such that the antigen is no longer capable of performing the function it normally performs within a native environment.

The term 'cytoplasmic' as referred to herein, includes within its scope any intracellular environment excluding the nucleus. That is, in the context of the present invention, the term 'cytoplasmic' includes within its scope organelles such as mitochondria cytoplasm, lysosomes, proteosomes or endoplasmic reticulum which are situated within the cytoplasm. Those skilled in the art will be aware of other such organelles. Thus the term 'cytoplasmic degradation' of a specific antigen as herein defined describes the degradation of a specific antigen within an intracellular environment other than the nucleus such as the cytoplasm, lysosomes, proteosomes or endoplasmic reticulum such that the degraded antigen is no longer capable of performing the function it normally performs within its native environment.

In a further aspect, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

In a further aspect, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1.

In a further aspect, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1.

According to the aspects of the invention referred to above, preferably the method comprises the use of one or more intracellularly binding immunoglobulin molecule/s which exhibit at least 86% identity with the respective amino acid consensus sequences depicted in SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s show at least 87% identity. Advantageously, the one or more immunoglobulin/s show at least 88% identity, 89% identity, 90% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s show at least 91% identity. Advantageously the one or more immunoglobulin/s show at least 92% identity, 93% identity, 94%, 95, 96, 97, 98, 99% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In a most preferred embodiment the one or more immunoglobulin/s used according to a method of the present invention show 100% identity with one or more amino acid consensus sequence/s identified by SEQ 3 and 4 as herein described.

Advantageously, the methods of the invention involve the use of one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or VL region amino acid sequences depicted in fig 1 and designated SEQ 5 to 22 and 23 to 40, respectively.

Most advantageously, one or more methods of the present invention involve the use of one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding antibody clones consisting of : A 17, A25 and B10, whose variable chain sequences are designated SEQ 16 and 34 (A17), SEQ 20 and 38 (A25), and SEQ 7 and 25 (B 10) and shown in fig 1.

In a further aspect still, the present invention provides the use of an intracellularly binding immunoglobulin comprising at least one antibody variable chain selected from the group consisting of: - A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1.

- A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

- A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

- A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1. in the preparation of a medicament for the cytoplasmic degradation of one or more specific antigens.

According to the aspects of the invention referred to above, preferably the method comprises the use of one or more intracellularly binding immunoglobulin molecule/s which exhibit at least 86% identity with the respective amino acid consensus sequences depicted in SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s shows at least 87% identity. Advantageously the one or more immunoglobulin/s show at least 88% identity, 89% identity, 90% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s show at least 91% identity. Advantageously the one or more immunoglobulin/s show at least 92% identity, 93% identity, 94%, 95, 96, 97, 98, 99% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In a most preferred embodiment the one or more immunoglobulin/s used according to a method of the present invention shows 100% identity with one or more amino acid consensus sequence/s identified by SEQ 3 and 4 as herein described.

Advantageously, the use according to the above aspect of the present invention is of one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or VL region amino acid sequences depicted in fig 1 and designated SEQ 5 to 22 and 23 to 40 respectively.

Most advantageously, the uses according to the present invention involve the use of one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding antibody clones consisting of : A17, A25 and B10, whose variable chain sequences are designated SEQ 16 and 34 (A17), SEQ 20 and 38 (A25), and SEQ 7 and 25 (B10) and shown in fig 1.

In a further aspect still, the present invention provides a method for the cytoplasmic degradation of a target antigen comprising the step of treating one or more cells with nucleic acid encoding one or more intracellularly binding immunoglobulin molecules according to the present invention.

In addition, the present inventors have surprisingly found that when an intracellularly binding immunoglobulin as herein described which further comprises a nuclear localization signal is expressed within a cell, the resulting antibody-antigen complex relocates from the cytoplasm to the nucleus. This relocation results in the specific antigen which is functional in the cytoplasm being rendered non-functional in the nucleus, and generally results in the antigen being at least partially degraded in the nucleus. This surprising finding may be used as a method for the functional inactivation of intracellular oncoproteins such as the oncogenic fusion protein BCR- AB or the RAS antigen.

Thus, in a further aspect, the present invention provides a method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

According to the above aspect of the invention, the term 'intracellular relocation' means the relocation of one or more specific antigen/s within the cell between any two compartments or regions, and in any direction. Examples of relocation according to the present invention includes the relocation of one or more antigens from the cytoplasm to the nucleus, the nucleus to the cytoplasm, the mitochondrion to the nucleus, the membrane to a lysosome and so on. Those skilled in the art will appreciate that this list is not intended to be exhaustive.

One skilled in the art will appreciate that the translation machinery required for expression of antigens is naturally present within the cytoplasm of a cell, and therefore generally antigens described herein will be expressed within the cytoplasm initially at least. However, subsequent to their expression signals 'intrinsic' to the antigen (that is signals naturally present within an antigen naturally expressed within a cell) may cause antigen localization to compartments other than the cytoplasm such as the membrane, lysosome, mitochondrion and so on. In these compartments such antigens perform their 'normal function' within the cell. For example transcription factors perform their function within the nucleus of a cell, and intrinsic signals within transcription factors result in the localisation of these factors to the nucleus.

The present inventors have realised that such 'intrinsic signals' if present on the antigen may be overidden by 'extrinsic localisation signals' present on the immunoglobulin, that is signals which are attached to the immunoglobulin either prior to (eg expressed along with the immunoglobulin), or subsequent to the expression of the immunoglobulin, and which signal for an antigen-antibody complex to locate to a particular compartment of the cell. Importantly, 'extrinsic localisation signals' signal for the localisation of an antibody-antigen complex to a particular compartment or region of the cell despite the presence of 'intrinsic localisation signals' within the antigen . Importantly, they have realised that the use of an immunoglobulin molecule comprising one or more 'extrinsic localisation signals' may be used to relocate one or more antigens from the environment in which they normally function, into an environment in which their function is modulated, in particular into an environment in which their function is significantly reduced as compared with the same antigen functioning within its 'normal environment'. Thus, the inventors have realised that the use of immunoglobulins according to the invention which further comprise an 'extrinsic localisation signal' as herein defined provides a suitable method for the relocation of antigens into environments in which their function is significantly reduced , advantageously completely inhibited and such a method may be of great therapeutic value.

Suitable extrinsic localisation signals will be familiar to those skilled in the art. For instance, the mitochondrial localisation signal GI no 452590 in the Genbank database and comprising nucleotides 49 to 96 of mitochonrial 3-oxyacyl-CoA thiolase may be used in the methods of the invention. In a preferred embodiment of the above aspect of the invention the method is for the nuclear relocation of one or more specific antigen/s and comprises the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and further comprising one or more nuclear localisation signals.

In the context of the present invention, the term 'nuclear relocation' means the nuclear targeting of one or more antigens mediated via an intracellularly binding immunoglobulin according to the present invention and which further comprises a nuclear-localisation signal, such that the antigen is no longer capable of performing the function it normally performs within its native environment (for example the cytoplasm). Generally, the functional inactivation involves degradation or at least partial degradation of the antigen.

A 'nuclear localization signal' as referred to herein describes those sequences which when attached to a protein produced within a cell cause it to be targeted to the nucleus. Examples include include the SV40 large T antigen consensus sequence PKKKRKV (reviewed in Dingwall, et al., 1991, Trends Biochem. Sci. 16, 478-481), or the bipartite nuclear localisation sequence as exemplified by nucleoplasmin protein (Dingwall, et al., 1987, EMBO J. 6, 69-74; Robbins, et al 1991, Cell 64, 615-623). Those skilled in the art will be aware of other suitable nuclear localization signals.

According to the present invention, preferably the nuclear localization signals is a cytoplasmic-nuclear relocation signal. That is, it localises antigens which are present in the cytoplasm to the nucleus. Other suitable relocation signals include but are not limited to mitochondria-nucleus relocation signals and membrane lysosome relocation signals. Those skilled in the art will appreciate that this list is not intended to be exhaustive.

In a further aspect, the present invention provides a method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

In a preferred embodiment of the above aspect of the invention the method involves the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more nuclear localisation signals.

In a further aspect, the present invention provides a method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

In a preferred embodiment of the above aspect of the invention, the method involves the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more nuclear localisation signals.

According to the aspects of the invention referred to above, preferably the method comprises the use of one or more intracellularly binding immunoglobulin molecule/s which exhibit at least 86% identity with the respective amino acid consensus sequences depicted in SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s show at least 87% identity. Advantageously the one or more immunoglobulin/s show at least 88% identity, 89% identity, 90% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s show at least 91% identity. Advantageously the one or more immunoglobulin/s show at least 92% identity, 93% identity, 94%, 95, 96, 97, 98, 99% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In a most preferred embodiment, the one or more immunoglobulin/s used according to a method of the present invention show 100% identity with one or more amino acid consensus sequence/s identified by SEQ 3 and 4 as herein described, and further comprising one or more localisation signals, in particular nuclear localisation signals.

In a further aspect, the present invention provides a method for the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and further comprising one or more nuclear localisation signals.

In a further aspect, the present invention provides a method for the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more nuclear localisation signals.

In a further aspect, the present invention provides a method for the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more nuclear localisation signals.

According to the above three aspects of the invention, preferably the method comprises the use of one or more intracellularly binding immunoglobulin molecule/s which exhibit at least 86% identity with the respective amino acid consensus sequences depicted in SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s shows at least 87% identity. Advantageously the one or more immunoglobulin/s show at least 88% identity, 89% identity, 90% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the one or more immunoglobulin molecule/s show at least 91% identity. Advantageously the one or more immunoglobulin/s show at least 92% identity, 93% identity, 94%, 95, 96, 97, 98, 99% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In a most preferred embodiment the one or more immunoglobulin/s used according to a method of the present invention show 100% identity with one or more amino acid consensus sequence/s identified by SEQ 3 and 4 as herein described, and further comprising one or more nuclear localisation signals.

Advantageously, the methods of the invention involve the use of one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or VL region amino acid sequences depicted in fig 1 and designated SEQ 5 to 22 and 23 to 40 respectively and further comprising one or more extrinsic localisation signals, in particular nuclear localisation signal/s.

Most advantageously, one or more methods of the present invention involve the use of one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding antibody clones consisting of : A17, A25 and B10, whose variable chain sequences are designated SEQ 16 and 34 (A17), SEQ 20 and 38 (A25), and SEQ 7 and 25 (BIO) and shown in fig 1 and further comprising one or more extrinsic localisation signals, in particular nuclear localisation signal/s.

In a further aspect still, the present invention provides the use of an intracellularly binding immunoglobulin comprising at least one antibody variable chain selected from the group consisting of:

A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1.

A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1. - A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1. and further comprising one or more extrinsic localisation signals in the preparation of a medicament for the intracellular relocation of one or more specific antigen/s.

In a preferred embodiment of the above aspect of the invention the use is of an intracellularly binding immunoglobulin comprising at least one antibody variable chain selected from the group consisting of:

- A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1. - A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1. A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1. and further comprising one or more nuclear localisation signals in the preparation of a medicament for the nuclear relocation of one or more specific antigen/s. According to the above aspect of the invention, preferably the use is of one or more intracellularly binding immunoglobulin molecule/s which exhibit at least 86% identity with the respective amino acid consensus sequences or the frameworks of those consensus sequences depicted in SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the immunoglobulin molecule shows at least 87% identity. Advantageously the immunoglobulin shows at least 88% identity, 89% identity, 90% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In an especially preferred embodiment, the immunoglobulin molecule shows at least 91% identity. Advantageously, the immunoglobulin shows at least 92% identity, 93% identity, 94%, 95, 96, 97, 98, 99% identity with the respective amino acid sequences identified by SEQ 3 and/or 4 and shown in fig 1. In a most preferred embodiment an immunoglobulin used according to a method of the present invention shows 100%) identity with one or more amino acid consensus sequence/s or the framework regions of those consensus sequences identified by SEQ 3 and 4 as herein described and further comprises one or more intracellular localisation signals, in particular nuclear relocation signals.

Advantageously, the use according to the above aspect of the present invention is of one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or VL region amino acid sequences depicted in fig 1 and designated SEQ 5 to 22 and 23 to 40 respectively and further comprises further comprises one or more intracellular localisation signals, in particular nuclear relocation signals.

Most advantageously, the uses according to the present invention involve the use of one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding antibody clones consisting of : A17, A25 and B10, whose variable chain sequences are designated SEQ 16 and 34 (A17), SEQ 20 and 38 (A25), and SEQ 7 and 25 (B10) and shown in fig 1 and further further comprises one or more intracellular localisation signals, in particular nuclear relocation signals In an alternative embodiment, one or more methods of the invention involves the use of one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding anti-RAS antibody clones consisting of :J 48, 33 and 121, whose variable chain sequences are designated SEQ 41 and 44 (J48), SEQ 42 and 45 (33), and SEQ 43 and 46 (121) and shown in fig 3 and further comprises one or more intracellular localisation signals, in particular nuclear relocation signals In a further aspect still, the present invention provides a method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with nucleic acid encoding one or more intracellularly binding immunoglobulin molecules as herein described.

According to the above aspect of the invention, preferably the nucleic according to the present invention encodes one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or VL region amino acid sequences depicted in fig 1 and designated SEQ 5 to 22 and 23 to 40, respectively.

Most advantageously, the nucleic acid as used herein encodes one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding antibody clones consisting of: A 17, A25 and B10, whose variable chain sequences are designated SEQ 16 and 34 (A17), SEQ 20 and 38 (A25), and SEQ 7 and 25 (B10) and shown in fig 1 and further comprising one or more nuclear localisation signals.

In a further aspect still, the present invention provides a method for the intracellular relocation of a specific antigen comprising the step of treating one or more cells with nucleic acid encoding one or more intracellularly binding immunoglobulin molecules according to the present invention and further comprising one or more extrinsic localisation signals.

In a preferred embodiment of the above aspect of the invention, the method is for the nuclear relocation of a specific antigen and comprises the step of treating one or more cells with nucleic acid encoding one or more intracellularly binding immunoglobulin molecules according to the present invention and further comprising one or more nuclear localisation signals.

According to the above aspects of the invention, preferably the nucleic according to the present invention encodes one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or VL region amino acid sequences depicted in fig 1 and designated SEQ 5 to 22 and 23 to 40 respectively, and further encodes one or more extrinsic localisation signals, in particular nuclear localisation signals.

In an alternative embodiment, the nucleic acid encodes one or more intracellularly binding immunoglobulin molecules comprising one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding anti-RAS antibody clones consisting of :J 48, 33 and 121, whose variable chain sequences are designated SEQ 41 and 44 (J48), SEQ 42 and 45 (33), and SEQ 43 and 46 (121) and shown in fig 3 and further and further encodes one or more extrinsic localisation signals, in particular nuclear localisation signals.

Most advantageously, the nucleic acid as used herein encodes one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding antibody clones consisting of: A17, A25 and B10, whose variable chain sequences are designated SEQ 16 and 34 (A17), SEQ 20 and 38 (A25), and SEQ 7 and 25 (B10) and shown in fig 1 and further comprising one or more nuclear localisation signals.

In a further aspect still, the present invention provides a method for the treatment of specific antigen positive cancer comprising the step of administering to a patient in need of such treatment one or more intracellularly binding antibodies comprising at least one antibody variable chain selected from the group consisting of: - A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1. - A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

- A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1. - A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1.

In a preferred embodiment of this aspect of the invention, the invention provides a method for the treatment of specific antigen positive neoplastic growth comprising the step of administering to a patient in need of such treatment one or more intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising the clones designated B3, B9, BIO, B21, B33, B89 and depicted as SEQ 5,6,7,8,9,10 and SEQ 23, 24, 25, 26, 27, 28 respectively and shown in fig 1.

In an alternative embodiment, the invention provides a method for the treatment of RAS mediated neoplastic transformation of cells comprising the step of administering to a patient in need of such treatment one or more intracellularly binding antibodies comprising one or more VH and/or one or more VL amino acid sequences derived from the group of intracellularly binding anti-RAS antibody clones consisting of : J 48, 33 and 121, whose variable chain sequences are designated SEQ 41 and 44 (J48), SEQ 42 and 45 (33), and SEQ 43 and 46 (121) and shown in fig 3

In a particularly preferred embodiment of this aspect of the invention, the treatment involves the administration of one or more intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences which are identical to one or more variable chains comprising the B10 clone as shown in fig 1.

According to the above aspects of the present invention, advantageously, the intracellularly binding immunoglobulin molecule further comprises one or more extrinsic localisation signals as herein described. Most advantageously, the localisation signal is a nuclear-localisation signal as herein defined. In an alternative embodiment of this aspect of the invention, a method is provided for the treatment of ABL mediated cancer comprising the step of administering to a patient in need of such treatment one or more intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising designated A5, A6, A7, A12, A13, A17, A18, A20,A24,A25, A28, A32 and designated SEQ No 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and SEQ 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 and 40, respectively.

In a preferred embodiment of this aspect of the invention, the treatment involves the administration of one or more intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences which are identical to one or more variable chains comprising the A17 or A27 clone as shown in fig 1.

According to the above aspect of the present invention, advantageously, the intracellularly binding immunoglobulin molecule further comprises one or more nuclear localisation signals as herein described.

According to the methods referred to above, the term 'administering to a patient' refers to giving a patient one or more intracellularly binding immunoglobulin molecules such that one or more cells of the patient are 'treated' as herein defined with the one or more immunoglobulins of the present invention. In addition, it includes within its scope giving a patients cells in an ex vivo environment one or more immunoglobulins of the present invention such that the cells are 'treated' as herein defined.

In a further aspect still, the present invention provides the use of an intracellularly binding immunoglobulin molecule comprising at least one antibody variable chain selected from the group consisting of:

A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1. - A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

- A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 in the preparation of a medicament for the treatment of specific antigen positive cancer.

According to the above aspects of the present invention, advantageously, the intracellularly binding immunoglobulin molecule further comprises one or more extrinsic localisation signals as herein defined More advantageously, at least one localisation signal is a nuclear localisation signal as herein defined.

In a preferred embodiment of this aspect of the invention, the use is of an intracellularly binding immunoglobulin molecule selected from the list consisting of those intracellularly binding immunoglobin molecules comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising the clones designated B3, B9, BIO, B21, B33, B89 and depicted as SEQ 5,6,7,8,9,10 and SEQ 23, 24, 25, 26, 27, 28 respectively and shown in fig 1 an further comprising a nuclear localisation signal in the preparation of a medicament for the treatment of BCR-ABL positive cancer.

In an alternative embodiment of this aspect of the invention, the use is of an intracellularly binding antibody selected from the list consisting of those intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising the clones A5, A6, A7, A12, A13, A17, A18, A20,A24,A25, A28, A32 and designated SEQ 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and SEQ 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 and 40 respectively and further comprising a localisation signal in the preparation of a medicament for the treatment of BCR-ABL positive cancer.

In an alternative embodiment of this aspect of the invention, the use is of an intracellularly binding antibody selected from the list consisting of those intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising the clones: :J 48, 33 and 121, whose variable chain sequences are designated SEQ 41 and 44 (J48), SEQ 42 and 45 (33), and SEQ 43 and 46 (121) and shown in fig 3 and further comprising one or more nuclear localisation signals as herein described..

Common characteristics of 'cancer/neoplastic growth' include the ability of the cancer cell to undergo endless replication, loss of contact inhibition, invasiveness and the ability to metastasise. That is, when the cell divides in an uncontrollable way and can not recognise its own natural boundary, the cancer cells obtain the ability to spread to other areas of the body. Mutations within the nucleic acid of one or more cells are involved in the onset of cancer. Often, more than one nucleic acid mutation or other aberrant cellular event is required for the development of tumours (bundles of aberrantly dividing cells), that is tumour formation is a multi-signal event. In the context of the present invention, cancer cells include any cells which exhibit any one or more of the following features: aberrant cell division, aberrant contact inhibition, aberrant cell differentiation as compared with cells behaving normally within their native environment, the ability of the cell to invade tissues, and the ability to metastasise. The definition of 'cancer cells' in the context of the present invention, therefore includes within its scope tumour cells and also cells prior to the formation of tumours in so far as they possess one or more of the requisite characteristics listed above. In addition, the term cancer cells according to the present invention includes metastatic cells.

As referred to herein, the term 'specific antigen positive cancer' describes those 'cancer' cells which contain intracellularly a specific antigen as herein defined. Advantageously, the specific antigen is involved in the onset and/or progression of the cancerous/neoplastic state. Preferably, the specific antigen positive cancer is Leukemia or lymphoma, and the specific antigen is the BCR-ABL oncogenic fusion protein. In an alternative embodiment, the specific antigen is the RAS antigen as described herein.

Definitions Immunoglobulin molecules, according to the present invention, refer to any moieties which are capable of binding to a target. In particular, they include members of the immunoglobulin superfamily, a family of polypeptides which comprise the immunoglobulin fold characteristic of antibody molecules, which contains two beta sheets and, usually, a conserved disulphide bond. Members of the immunoglobulin superfamily are involved in many aspects of cellular and non-cellular interactions in vivo, including widespread roles in the immune system (for example, antibodies, T-cell receptor molecules and the like), involvement in cell adhesion (for example, the ICAM molecules) and intracellular signalling (for example, receptor molecules, such as the PDGF receptor). The present invention is applicable to all immunoglobulin superfamily molecules which are capable of binding to target molecules. Preferably, the present invention relates to ScFv molecules.

Antibodies as used herein, refers to complete antibodies or antibody fragments capable of binding to a selected target, and including Fv, ScFv, Fab' and F(ab') , monoclonal and polyclonal antibodies, engineered antibodies including chimeric, CDR-grafted and humanised antibodies, and artificially selected antibodies produced using phage display or alternative techniques. Small fragments, such as Fv and ScFv, possess advantageous properties for diagnostic and therapeutic applications on account of their small size and consequent superior tissue distribution. Preferably, the antibody is an scFv.

Heavy chain variable domain refers to that part of the heavy chain of an immunoglobulin molecule which forms part of the antigen binding site of that molecule.

Light-chain variable domain refers to that part of the light chain of an immunoglobulin molecule which forms part of the antigen binding site of that molecule.

Framework region of an immunoglobulin heavy and light chain variable domain describes the variable domain of an immunoglobulin molecule having a particular 3 dimensional conformation characterised by the presence of an immunolgobulin fold. Certain amino acid residues present in the variable domain are responsible for maintaining this characteristic immunoglobulin domain core structure. These residues are known as framework residues and tend to be highly conserved.

CDR (complementarity determining region) of an immunoglobulin molecule heavy and light chain variable domain describes those amino acid residues which are not framework region residues and which are contained within the hypervariable loops of the variable regions. These hypervariable loops are directly involved with the interaction of the immunoglobulin with the ligand. Residues within these loops tend to show less degree of conservation than those in the framework region.

Intracellular means inside a cell, and the present invention is directed to those immunoglobulins which will bind to ligands/targets selectively within a cell. The cell may be any cell, prokaryotic or eukaryotic, and is preferably selected from the group consisting of a bacterial cell, a yeast cell and a higher eukaryote cell. Most preferred are yeast cells and mammalian cells. As used herein, therefore, "intracellular" immunoglobulins and targets or ligands are immunoglobulins and targets/ligands which are present within a cell. In addition the term 'intracellular' refers to environments which resemble or mimic an intracellular environment. Thus, "intracellular" may refer to an environment which is not within the cell, but is in vitro. For example, the method of the invention may be performed in an in vitro transcription and/or translation system, which may be obtained commercially, or derived from natural systems.

Consensus sequence of V_H and V_L chains in the context of the present invention refers to the consensus sequences of those V_H and V chains from immunoglobulin molecules which can bind selectively to a ligand in an intracellular environment. The residue which is most common in any one given position, when the sequences of those immunoglobulins which can bind intracellularly are compared is chosen as the consensus residue for that position. The consensus sequence is generated by comparing the residues for all the intracellularly binding immunoglobulins, at each position in turn, and then collating the data. In this case the sequences of 11 immunoglobulins was compared. In the context of the present invention, a consensus residue is only conferred if a residue occurred greater than 5 times at any one position. For the avoidance of doubt, the terms VH and VL consensus sequences does not include the sequences of the J regions.

Specific binding in the context of the present invention, means that the interaction between the immunoglobulin and the ligand are specific, that is, in the event that a number of molecules are presented to the immunoglobulin, the latter will only bind to one or a few of those molecules presented. Advantageously, the immunoglobulin ligand interaction will be of high affinity. The interaction between immunoglobulin and ligand will be mediated by non-covalent interactions such as hydrogen bonding and Van der Waals. Generally, the interaction will occur in the cleft between the heavy and the light chains of the immunoglobulin.

A specific antigen as herein defined describes an antigen to which one or more immunoglobulins binds to specifically. One skilled in the art will appreciate that the antigen specificity of an antibody is determined by the structural characteristics of the antigen binding site. In the case of the BCR antigen intracellularly binding antibody comprising at least one variable heavy chain described by the amino acid sequence BIO, and designated SEQ 7 in fig 1, the 'specific antigen' is BCR-ABL oncogenic fusion protein. Likewise, in the case of the BCR antigen intracellularly binding antibody comprising at least one variable light chain described by the amino acid sequence BIO, and designated SEQ 25 in fig 1, the specific antigen is BCR-ABL oncogenic fusion protein. Furthermore, in the case of an intracellularly binding antibody comprising one or more variable heavy and/or light chains as described by the clone A17 and designated SEQ 16 and 34 respectively, the 'specific antigen' is the BCR-ABL oncogenic fusion protein. Finally, in the case of an intracellularly binding antibody comprising one or more variable heavy and/or light chains as described by the clone A25 and designated SEQ 20 and 38 respectively, the 'specific antigen' is also the BCR-ABL oncogenic fusion protein. Specifically, as herein described those clones designated A7, A12, A13, A17, A18, A20,A24, A25, A28, A32 are specific for the ABL antigen. The intracellularly binding antibody clones designated B3, B9, BIO, B21, B33, B89 are specific for the BCR-ABL oncogenic fusion protein.

Common characteristics of cancer/neoplastic growth include the ability of the cancer cell to undergo endless replication, loss of contact inhibition, invasiveness and the ability to metastasise. That is, when the cell divides in an uncontrollable way and can not recognise its own natural boundary, the cancer cells obtain the ability to spread to other areas of the body. Mutations within the nucleic acid of one or more cells are involved in the onset of cancer. Often, more than one nucleic acid mutation or other aberrant cellular event is required for the development of tumours (bundles of aberrantly dividing cells), that is tumour formation is a multi-signal event. In the context of the present invention, cancer cells include any cells which exhibit any one or more of the following features aberrant cell division, aberrant contact inhibition, aberrant cell differentiation as compared with cells behaving normally within their native environment, the ability of the cell to invade tissues, and the ability to metastasise. The definition of 'cancer cells' in the context of the present invention, therefore includes within its scope tumour cells and also cells prior to the formation of tumours in so far as they possess one or more of the requisite characteristics listed above. In addition the term cancer cells according to the present invention includes metastatic cells

The term nuclear relocation means the nuclear targeting of one or more antigens mediated via an intracellularly binding immunoglobulin according to the present invention and which further comprises a nuclear-localisation signal, such that the antigen is no longer capable of performing the function it normally performs within its native environment (ie the cytoplasm). Generally, the functional inactivation involves degradation or at least partial degradation of the antigen.

Brief Description of the figures Figure 1 shows the alignment of derived protein sequences of intracellular scFv. The nucleotide sequences of the ScFv were obtained and the derived protein translations (shown in the single letter code) were aligned. The complementarity determining regions (CDR) are shaded. Framework residues for SEQ 1 to 40 are those which are underlined. The consensus sequence at a specific position was calculated for the most frequently occurring residue but only conferred if a residue occurred greater than 5 times at that position.

A. Sequences of VH and VL from anti-BCR (designated as B3-B89) and anti-ABL (designated as A5-A32). The combined consensus (Con) of the anti-BCR and ABL ICAbs are indicated compared with the subgroup consensuses forVH3 and

V l from the Kabat database . - Represents sequence identity with the intracellular antibody binding V_H or V_L consensus (SEQ 3 and SEQ 4). . represents gaps introduced to optimise alignment. B. A sequence comparison of randomly obtained ScFv obtained from the unselected phage display library. The consensuses obtained from the randomly isolated ScFv (rcH and rcL) are indicated. represents gaps intoduced to optimise alignment. X represents positions at which no consensus could be assigned.

Figure 2: (A) and (B) The scFvBlO and scFv33 are localized in the cytoplasm (labelled 1) in accordance with the targeted expression of the proteins by pEF/myc/cyto vector. They were detected by fluorescein-labeled antibodies against the 9E10 mouse antibody that recognises the c-myc tag of the fusion proteins. (C) BCR-ABL protein is located in the nucleus which appears stained (2) with Cy3- conjugated anti-rabbit that recognises the N-20 BCR antibody. Note: The present inventors have consistently found that expression of the BCR-ABL protein in the nucleus of CHO cells causes a significant change in the morphology of the cells, with the cytoplasm becoming very narrow, like a thin ring around the nucleus, but there is no obvious change in nuclear shape.

(D) The localisation of scFv33 and BCR-ABL co-expressed in CHO cells are cytoplasmic (labelled 1) and nuclear (labelled 2), respectively as scFv33 is an antibody that does not bind BCR-ABL. The merged image shows that there is not co- localisation of the antigen and thus non-relevant antibody.

(E) When anti-BCR antibody scFvBlO is co-expressed with BCR-ABL, its localisation changes from cytoplasmic (as in panel A) to the nucleus (fluorescence ScFv staining labelled (2)). This nuclear location is due to association of ScFv with antigen and the specific antibody co-locates to the nucleus, giving a merged image. The antigen translocation from the cytoplasm to the nucleus occurs because the nuclear location signal on the antigen is dominant in this situation, where the ScFv has no cytoplasmic retention signal as such.

Figure 3. Sequence of anti-RAS intracellular scFv.

The nucleotide sequences were obtained and the derived protein translations (shown as single letter code) were aligned. Dashes in framework (FR) represent identities with the consensus (CON) sequence (derived from anti-BCR and anti-ABL scFv isolated by the IAC method (Tse et al., 2002)). The numbers indicate the reference positions of the residues, according to the system by Lefranc et al (Lefranc and Lefranc, 2001) (top column number, indicated as IMGT) and Kabat et al (Kabat et al, 1991) (second column, Kabat). The 15 residues of the linker, (GGGGS)₃ between the heavy chain of variable domain (VH) and light chain (VL) are not shown. The complementarily determining regions (CDR) are highlighted on grey background and demarcated from framework regions (FR). Three anti-RAS intracellular scFv are designed as 33, J48 and 121. All anti-RAS scFv belong to the VH3 subgroup of heavy chain and V 1 subgroup of light chain shown in the middle (designed VH3 or Vκl) from the Kabat database (Kabat et al., 1991) or IGVH3 and IGVK1 from the Lefranc database(Lefranc and Lefranc, 2001). The mutated anti-RAS scFv are shown designed as I21K33, I21R33, I21R33VHI21VL, con33, and I21R33VH (C22SC92S). I21K33 comprises the six CDRs of scFv33 in the 121 framework and I21R33 is identical except for a mutation Lys94Arg; I21R33VH21VL comprises the VH domain of I21R33 fused to the VL domain of 121; con33 has all six CDRs of scFv33 in the canonical consensus framework (Tse et al., 2002); I21R33VH (C22S;C92S) is a mutant of clone I21R33 with the mutations CYS22SER and CYS92SER of the VH domain. There are only four amino acid differences (at positions HI, H5, LO, and L3) between consensus and 121R framework regions.

Figure 4: Interaction of anti-RAS scFv with RAS protein in mammalian cells. A. Luciferase Assay; COS7 cells were transiently co-transfected with various scFv- VP16 activation domain fusions and the Gal4-DBD bait plasmid pMl-HRASG12V (closed boxes) or pMl-lacZ (open boxes), together with the firefly luciferase reporter plasmid pG5-Luc and an internal Renilla luciferase control plasmid pRL-CMV. ScFv- VP16 prey vectors were used expressing anti-RAS scFv33, J48 and 121 or anti-β-gal scFvR4 (Martineau et al., 1998). The luciferase activites were measured 48 hours after transfection using Dual Luciferase Assay System (Promega) and a luminometer. The luciferase activities of each assay were normalised to the Renilla lucifrerase activity (used as internal control for the transfection efficiency). The fold luciferase induction level is shown with the acitivy of each scFv-VP16 with non relevant bait taken as baseline.

B. In situ immunofluoresence study; COS7 cells were transiently co-transfected with pEF-myc-nuc-scFvJ48 (anti-RAS scFv) or scFvR4 (anti-β-gal scFv) and pHM6- HRASG12V vectors expressing the RAS antigen. After 48 hours, cells were fixed and stained with 9E10 monoclonal antibody (detecting the myc tagged scFv) and rabbit anti-HA tag polyclonal serum, followed by secondary fluorescein conjugated anti- mouse and Cy3 conjugated anti-rabbit antibodies, respectively. The staining patterns were examined using a BioRadiance confocal microscope. Co-location of antigen and intrabody fluorescence was found for scFvJ48 co-expressed with RAS. (A) (fluorescein) = fluorescence of scFv; (B) (Cy3) = fluorescence of antigen. (C) fluorescence of nuclear localised scFv-antigen.

General Techniques Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridisation techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and

Ausubel et al., Short Protocols in Molecular Biology (1999) 4 Ed, John Wiley & Sons, Inc. which are incorporated herein by reference) and chemical methods. In addition Harlow & Lane., A Laboratory Manual Cold Spring Harbor, N.Y, is referred to for standard Immunological Techniques.

Method of selecting immunoglobulins which bind to their ligand within an intracellular environment.

The Intracellular antibody capture technology A suitable method for the selection of immunoglobulins which bind to their ligand within an intracellular environment is described by the present inventors and detailed in WOOO/54057 which is herein incorporated by reference.

Generally, it is difficult to obtain antibody fragments which bind to antigen in vivo because antibodies are not equipped to function in a reducing environment such as the cell cytoplasm (Martineau, P., Jones, P. & Winter, G. (1998),J. Mol. Biol. 280, 117- 127; Proba, K., Ge, L. & Pluckthun, A. (1995), Functional antibody single-chain fragments from the cytoplasm of Escherichia coli in the presence of thioredoxin reductase (TrxB) (Gene, 159, 203-207). The intracellular antibody capture (IAC) approach described in WOOO/54057 constitutes a generic strategy for selection and intracellular characterisation of antigen-specific ScFv antibody fragments. By employing this strategy, the present inventors have identified immunoglobulin molecules which bind specifically to a ligand within an intracellular environment.

The IAC technology described in WOOO/54057, includes one round of ScFv phage display library screening in vitro with a recombinant bacterial protein, followed by selection in a yeast in vivo antibody-antigen interaction screening of the in vitro enriched ScFv repertoire (Visintin, M.., Tse, E., Axelson, H., Rabbitts, T.H. and Cattaneo, A. (1999) Proc. Natl. Acad. Sci. USA 96 11723-11728).

Those skilled in the art will appreciate that there are other suitable methods for the selection of immunoglobulin molecules which bind selectively to their ligand within the cell.

Intracellularly binding Immunoglobulins and molecules which exhibit at least 85% identity to these molecules Immunoglobulin molecules

Immunoglobulin molecules, used according to the present invention include members of the immunoglobulin superfamily, which are a family of polypeptides which comprise the immunoglobulin fold characteristic of antibody molecules. The fold contains two beta sheets and, usually, a conserved disulphide bond. Members of the immunoglobulin superfamily are involved in many aspects of cellular and non-cellular interactions in vivo, including widespread roles in the immune system (for example, antibodies, T-cell receptor molecules and the like), involvement in cell adhesion (for example, the ICAM molecules) and intracellular signalling (for example, receptor molecules, such as the PDGF receptor). The present invention is applicable to all immunoglobulin superfamily molecules which are capable of binding to target molecules. Preferably, the present invention relates to antibodies, and Scfv fragments.

The immunoglobulins molecules used according to the present invention all possess the requisite activity of being capable of selectively binding to a ligand within an intracellular environment.

In one aspect, the immunoglobulins used according to the invention comprise at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1. In a further aspect, the immnuoglobulins used as herein described comprise at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

The IAC VH consensus sequence (depicted in SEQ 3) matched the Kabat consensus (SEQ 1) at all positions in the frameworks, except residue 3 (residue 1 in the Kabat consensus) which is a glutamine rather than glutamic acid. The residues at each framewok position which vary among the IACBs are more restricted than in individual VH genes (Kabat, E., A. Wu, T. T., Perry, H. M., Gottesman, K. S., & Foeller, C, Sequences of Proteins of Immunological Interest, 5^th Ed 1991, Bethesda: National Insitiutes of Health) and further the CDR 1/2 conservation argues for limited acceptance of changes at this position compatible with intracellular activity. Indeed, the present inventors have isolated ScFv with identical frameworks in antigen-specific ICAbs which differ by only three residues in CDR1. The VHIII framework is therefore amenable for intracellular expression, solubility and function and the contribution of non-randomised CDR1 and CDR2 is also apparent. Detailed mutagenesis studies could reveal additional changes which might facilitate greater intracellular efficacy but the VH and VHIII consensus discussed here (and depicted in SEQ 1 and 3) provides at least one backbone on which to build CDR variability for future IAC use.

The L chain variable region in the anti-BCR and anti-ABL ICAb set also allows derivation of a consensus, in this case a match to the Vkl subgroup (Fig. 1A, SEQ 2). Unlike the VH, the present inventors were able to obtain consensuses for all three CDR regions. Comparison of the ICAb VL consensus with that obtained from random ScFv from the library (Fig. IB) shows that the latter display greater overall variability. Each residue differing between the two are the same in the ICAb VL consensus as in the Vκl consensus according to the Kabat database, indicating that the ICAb consensus (depicted by SEQ 4, Fig 1) is conserved and can provide the backbone for ScFv VL sequences for intracellular use. Importantly, the present inventors believe that the light chains are important for conferring structural stability on the protein and may have little antigen binding function.

The immunoglobulins used as herein described may be altered immunoglobulins comprising an effector protein such as a toxin or a label. Especially preferred are labels which allow the imaging of the distribution of the immunoglobulins in vivo. Such labels may be radioactive labels or radioopaque labels, such as metal particles, which are readily visualisable within the body of a patient. Moreover, they may be fluorescent labels or other labels which are visualisable on tissue samples removed from patients.

Recombinant DNA technology may be used to produce the immunoglobulins for use according to the present invention using an established procedure, in bacterial or preferably mammalian cell culture. The selected cell culture system preferably secretes the immunoglobulin product.

Multiplication of hybridoma cells or mammalian host cells in vitro is carried out in suitable culture media, which are the customary standard culture media, for example Dulbecco's Modified Eagle Medium (DMEM) or RPMI 1640 medium, optionally replenished by a mammalian serum, e.g. foetal calf serum, or trace elements and growth sustaining supplements, e.g. feeder cells such as normal mouse peritoneal exudate cells, spleen cells, bone marrow macrophages, 2-aminoethanol, insulin, transferrin, low density lipoprotein, oleic acid, or the like. Multiplication of host cells which are bacterial cells or yeast cells is likewise carried out in suitable culture media known in the art, for example, for bacteria in medium LB, NZCYM, NZYM, NZM, Terrific Broth, SOB, SOC, 2 x YT, or M9 Minimal Medium, and for yeast in medium YPD, YEPD, Minimal Medium, or Complete Minimal Dropout Medium.

In vitro production provides relatively pure immunoglobulin preparations and allows scale-up to give large amounts of the desired immunoglobulins. Techniques for bacterial cell, yeast or mammalian cell cultivation are known in the art and include homogeneous suspension culture, e.g. in an airlift reactor or in a continuous stirrer reactor, or immobilised or entrapped cell culture, e.g. in hollow fibres, microcapsules, on agarose microbeads or ceramic cartridges.

Large quantities of the desired immunoglobulins can also be obtained by multiplying mammalian cells in vivo. For this purpose, hybridoma cells producing the desired immunoglobulins are injected into histocompatible mammals to cause growth of antibody-producing tumours. Optionally, the animals are primed with a hydrocarbon, especially mineral oils such as pristane (tetramethyl-pentadecane), prior to the injection. After one to three weeks, the immunoglobulins are isolated from the body fluids of those mammals. For example, hybridoma cells obtained by fusion of suitable myeloma cells with antibody-producing spleen cells from Balb/c mice, or transfected cells derived from hybridoma cell line Sp2/0 that produce the desired antibodies are injected intraperitoneally into Balb/c mice optionally pre-treated with pristane, and, after one to two weeks, ascitic fluid is taken from the animals.

The foregoing, and other, techniques are discussed in, for example, Kohler and Milstein, (1975) Nature 256:495-497; US 4,376,110; Harlow and Lane, Antibodies: a Laboratory Manual, (1988) Cold Spring Harbor, are incorporated herein by reference. Techniques for the preparation of recombinant antibody molecules is described in the above references and also in, for example, EP 0623679; EP 0368684 and EP 0436597, which are incorporated herein by reference.

The cell culture supernatants are screened for the desired immunoglobulins, preferably, by immunofluorescent staining of cells expressing the desired target by immunoblotting, by an enzyme immunoassay, e.g. a sandwich assay or a dot-assay, or a radioimmunoassay.

For isolation of the immunoglobulins, those present in the culture supernatants or in the ascitic fluid may be concentrated, e.g. by precipitation with ammonium sulphate, dialysis against hygroscopic material such as polyethylene glycol, filtration through selective membranes, or the like. If necessary and/or desired, the antibodies are purified by the customary chromatography methods, for example gel filtration, ion- exchange chromatography, chromatography over DEAE-cellulose and/or (immuno-) affinity chromatography, e.g. affinity chromatography with the target molecule or with Protein-A.

The invention employs recombinant nucleic acids comprising an insert coding for a heavy chain variable domain and/or for a light chain variable domain of antibodies. By definition such nucleic acids comprise coding single stranded nucleic acids, double stranded nucleic acids consisting of said coding nucleic acids and of complementary nucleic acids thereto, or these complementary (single stranded) nucleic acids themselves.

Furthermore, nucleic acids encoding a heavy chain variable domain and/or for a light chain variable domain of antibodies can be enzymatically or chemically synthesised from nucleic acids having the authentic sequence coding for a naturally-occurring heavy chain variable domain and/or for the light chain variable domain, or a variant or derivative thereof as herein described. Preferably, said modification(s) are outside the CDRs of the heavy chain variable domain and/or of the light chain variable domain of the antibody.

Identitv/homolo gy

It will be understood that polypeptide sequences of the invention are not limited to the particular sequences set forth in SEQ 1 to 40 or fragments thereof, but also include homologous sequences obtained from any source, for example related cellular homologues, homologues from other species and variants or derivatives thereof.

Thus, the present invention encompasses variants, homologues or derivatives of the amino acid sequences set forth in SEQ 1 to SEQ 40 as long as when said variants, homologues or derivatives of the amino acid sequences set forth in SEQ 1 to SEQ 40 are one or more components of a immunoglobulin molecule, they possess the requisite activity of binding selectively to a ligand within an intracellular environment. In the context of the present invention, a homologous sequence is taken to include an amino acid sequence which is at least 94, 95, 96, 97, 98, 99% identical at the amino acid level over at least 30, preferably 50, 70, 90 or 100 amino acids. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.

Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

% homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.

However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Affine gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package (see below) the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al, 1984, Nucleic Acids Research 12:387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al, 1999 ibid - Chapter 18), FASTA (Atschul et al, 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al, 1999 ibid, pages 7-58 to 7-60). However it is preferred to use the GCG Bestfit program.

Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result. Method for the cytoplasmic degradation of specific antigen.

In a further aspect, the present invention provides a method for the intracellular degradation of a specific antigen comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

In a further aspect still, the present invention provides a method for the intracellular degradation of a specific antigen comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VL region amino acid sequence showing at least 85% identity with the region consensus sequence depicted in SEQ 4 and shown in fig 1.

Specific antigen Specific antigen/s describe those one or more antigens to which the immunoglobulins as herein described bind to specifically as herein defined.

Specific antigens include polypeptides and proteins, particularly nascent polypeptides and proteins or intracellular polypeptide or protein precursors, which are present in the cell. Advantageously, the antigen is a mutant polypeptide or protein, such as a polypeptide or protein generated through genetic mutation, including point mutations, deletions and chromosomal translocations. Such polypeptides are frequently involved in tumourigenesis. Examples include the gene product produced by the spliced BCR- ABL genes and RAS antigen.

The specific antigen may alternatively be an RNA molecule, for example a precursor RNA or a mutant RNA species generated by genetic mutation or otherwise.

The antigen may be inserted into the cell, for example as described below, or may be endogenous to the cell.

Delivery of immunoglobulins to cells Generally the immunoglobulin will be delivered to the cell. The antigen as herein defined may be a native component of the cell as described above, or may also be delivered to the cell.

In order to introduce immunoglobulins and antigens into an intracellular environment, cells are advantageously transfected with nucleic acids which encode the immunoglobulins and/or their specific antigen/s.

Nucleic acids encoding immunoglobulins and/or ligands can be incorporated into vectors for expression. As used herein, vector (or plasmid) refers to discrete elements that are used to introduce heterologous DNA into cells for expression thereof.

Selection and use of such vehicles are well within the skill of the artisan. Many vectors are available, and selection of appropriate vectors will depend on the intended use of the vector, the size of the nucleic acid to be inserted into the vector, and the host cell to be transformed with the vector. Each vector contains various components depending on its function and the host cell for which it is compatible. The vector components generally include, but are not limited to, one or more of the following: an origin of replication, one or more marker genes, an enhancer element, a promoter, a transcription termination sequence and a signal sequence.

Moreover, nucleic acids encoding the immunoglobulins and/or specific antigen/s according to the invention may be incorporated into cloning vectors, for general manipulation and nucleic acid amplification purposes.

Both expression and cloning vectors generally contain nucleic acid sequences that enable the vector to replicate in one or more selected host cells. Typically, in cloning vectors, this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences. Such sequences are well known for a variety of bacteria, yeast and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μm plasmid origin is suitable for yeast, and various viral origins (e.g. SV 40, polyoma, adenovirus) are useful for cloning vectors in mammalian cells. Generally, the origin of replication component is not needed for mammalian expression vectors unless these are used in mammalian cells competent for high level DNA replication, such as COS cells.

Most expression vectors are shuttle vectors, i.e. they are capable of replication in at least one class of organisms but can be transfected into another class of organisms for expression. For example, a vector is cloned in E. coli and then the same vector is transfected into yeast or mammalian cells even though it is not capable of replicating independently of the host cell chromosome. DNA may also be replicated by insertion into the host genome. However, the recovery of genomic DNA is more complex than that of exogenously replicated vector because restriction enzyme digestion is required to excise the nucleic acid. DNA can be amplified by PCR and directly transfected into host cells without any replication component.

Advantageously, an expression and cloning vector may contain a selection gene also referred to as selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that confer resistance to antibiotics and other toxins, e.g. ampicillin, neomycin, methotrexate or tetracycline, complement auxotrophic deficiencies, or supply critical nutrients not available from complex media.

As to a selective gene marker appropriate for yeast, any marker gene can be used which facilitates the selection for transformants due to the phenotypic expression of the marker gene. Suitable markers for yeast are, for example, those conferring resistance to antibiotics G418, hygromycin or bleomycin, or provide for prototrophy in an auxotrophic yeast mutant, for example the URA3, LΕU2, LYS2, TRP1, or HIS3 gene.

Since the replication of vectors is conveniently done in E. coli, an E. coli genetic marker and an E. coli origin of replication are advantageously included. These can be obtained from E. coli plasmids, such as pBR322, Bluescript© vector or a pUC plasmid, e.g. pUC18 or pUC19, which contain both an E. coli replication origin and an E. coli genetic marker conferring resistance to antibiotics, such as ampicillin.

Suitable selectable markers for mammalian cells are those that enable the identification of cells expressing the desired nucleic acid, such as dihydrofolate reductase (DHFR, methotrexate resistance), thymidine kinase, or genes conferring resistance to G418 or hygromycin. The mammalian cell transformants are placed under selection pressure which only those transformants which have taken up and are expressing the marker are uniquely adapted to survive. In the case of a DHFR or glutamine synthase (GS) marker, selection pressure can be imposed by culturing the transformants under conditions in which the pressure is progressively increased, thereby leading to amplification (at its chromosomal integration site) of both the selection gene and the linked nucleic acid. Amplification is the process by which genes in greater demand for the production of a protein critical for growth, together with closely associated genes which may encode a desired protein, are reiterated in tandem within the chromosomes of recombinant cells. Increased quantities of desired protein are usually synthesised from this amplified DNA.

Expression and cloning vectors usually contain a promoter that is recognised by the host organism and is operably linked to the desired nucleic acid. Such a promoter may be inducible or constitutive. The promoters are operably linked to the nucleic acid by removing the promoter from the source DNA and inserting the isolated promoter sequence into the vector. Both the native promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of nucleic acid encoding the immunoglobulin or target molecule. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. Promoters suitable for use with prokaryotic hosts include, for example, the beta- lactamase and lactose promoter systems, alkaline phosphatase, the tryptophan (trp) promoter system and hybrid promoters such as the tac promoter. Their nucleotide sequences have been published, thereby enabling the skilled worker to operably ligate a desired nucleic acid, using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems will also generally contain a Shine-Delgarno sequence operably linked to the nucleic acid.

Preferred expression vectors are bacterial expression vectors which comprise a promoter of a bacteriophage such as phagex or T7 which is capable of functioning in the bacteria. In one of the most widely used expression systems, the nucleic acid encoding the fusion protein may be transcribed from the vector by T7 RNA polymerase (Studier et al, Methods in Enzymol. 185; 60-89, 1990). In the E. coli BL21(DE3) host strain, used in conjunction with pET vectors, the T7 RNA polymerase is produced from the lysogen DE3 in the host bacterium, and its expression is under the control of the IPTG inducible lac UV5 promoter. This system has been employed successfully for over-production of many proteins. Alternatively the polymerase gene may be introduced on a lambda phage by infection with an int- phage such as the CE6 phage which is commercially available (Novagen, Madison, USA). Other vectors include vectors containing the lambda PL promoter such as PLEX (Invitrogen, NL), vectors containing the trc promoters such as pTrcHisXpressTm (Invitrogen) or pTrc99 (Pharmacia Biotech, SE), or vectors containing the tac promoter such as pKK223-3 (Pharmacia Biotech) or PMAL (new England Biolabs, MA, USA).

Suitable promoting sequences for use with yeast hosts may be regulated or constitutive and are preferably derived from a highly expressed yeast gene, especially a Saccharomyces cerevisiae gene. Thus, the promoter of the TRP1 gene, the ADHI or ADHII gene, the acid phosphatase (PH05) gene, a promoter of the yeast mating pheromone genes coding for the a- or alpha-factor or a promoter derived from a gene encoding a glycolytic enzyme such as the promoter of the enolase, glyceraldehyde-3- phosphate dehydrogenase (GAP), 3-phospho glycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosphofructo kinase, glucose-6-phosphate isomerase, 3- phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase or glucokinase genes, the S. cerevisiae GAL 4 gene, the S. pombe nmt 1 gene or a promoter from the TATA binding protein (TBP) gene can be used. Furthermore, it is possible to use hybrid promoters comprising upstream activation sequences (UAS) of one yeast gene and downstream promoter elements including a functional TATA box of another yeast gene, for example a hybrid promoter including the UAS(s) of the yeast PH05 gene and downstream promoter elements including a functional TATA box of the yeast GAP gene (PH05-GAP hybrid promoter). A suitable constitutive PHO5 promoter is e.g. a shortened acid phosphatase PH05 promoter devoid of the upstream regulatory elements (UAS) such as the PH05 (- 173) promoter element starting at nucleotide -173 and ending at nucleotide -9 of the PH05 gene.

Gene transcription from vectors in mammalian hosts may be controlled by promoters derived from the genomes of viruses such as polyoma virus, adenovirus, fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus (CMV), a retrovirus and Simian Virus 40 (SV40), from heterologous mammalian promoters such as the actin promoter or a very strong promoter, e.g. a ribosomal protein promoter, and from promoters normally associated with immunoglobulin sequences.

Transcription of a nucleic acid by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are relatively orientation and position independent. Many enhancer sequences are known from mammalian genes (e.g. elastase and globin). However, typically one will employ an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) and the CMV early promoter enhancer. The enhancer may be spliced into the vector at a position 5' or 3' to the desired nucleic acid, but is preferably located at a site 5' from the promoter.

Advantageously, a eukaryotic expression vector may comprise a locus control region (LCR). LCRs are capable of directing high-level integration site independent expression of transgenes integrated into host cell chromatin, which is of importance especially where the gene is to be expressed in the context of a permanently- transfected eukaryotic cell line in which chromosomal integration of the vector has occurred.

Eukaryotic expression vectors will also contain sequences necessary for the termination of transcription and for stabilising the mRNA. Such sequences are commonly available from the 5' and 3' untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding the immunoglobulin or the target.

Particularly useful for practising the present invention are expression vectors that provide for the transient expression of nucleic acids in mammalian cells. Transient expression usually involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector, and, in turn, synthesises high levels of the desired gene product.

Construction of vectors according to the invention may employ conventional ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the plasmids required. If desired, analysis to confirm correct sequences in the constructed plasmids is performed in a known fashion.

Suitable methods for constructing expression vectors, preparing in vitro transcripts, introducing DNA into host cells, and performing analyses for assessing gene product expression and function are known to those skilled in the art. Gene presence, amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA, dot blotting (DNA or RNA analysis), or in situ hybridisation, using an appropriately labelled probe which may be based on a sequence provided herein. Those skilled in the art will readily envisage how these methods may be modified, if desired. Immunoglobulins and/or specific antigens may be directly introduced to the cell by microinjection, or delivery using vesicles such as liposomes which are capable of fusing with the cell membrane. Viral fusogenic peptides are advantageously used to promote membrane fusion and delivery to the cytoplasm of the cell.

Method for the nuclear relocation of specific antigen.

In a further aspect, the present invention provides a method for the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and further comprising one or more nuclear localisation signals.

In a further aspect still, the present invention provides a method for the nuclear relocation of one or more specific antigen/s comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more nuclear localisation signals.

The techniques used in producing the nuclear relocation of specific antigen are essentially those methods used and described above for the cytoplasmic degradation of antigen except that an immunoglobulin according to the present invention further comprises a nuclear localisation signal as herein described.

Nuclear localization signals

Nuclear localization signals are signals which are responsible for targetting an antigen to the nucleus. Such targeting sequences are reviewed generally in Baker et al., 1996, Biol Rev Camb Philos Soc 71, 637-702. Nuclear localisation sequences include the SV40 large T antigen consensus sequence PKKKRKV (reviewed in Dingwall, et al., 1991, Trends Biochem. Sci. 16, 478-481), or the bipartite nuclear localisation sequence as exemplified by nucleoplasmin protein (Dingwall, et al, 1987, EMBO J. 6, 69-1 A Robbins, et al 1991, Cell 64, 615-623). Those skilled in the art will be aware of other suitable nuclear localization signals.

Uses of immunoglobulins of the present invention In a further aspect still, the present invention provides the use of an intracellularly binding antibody selected from the list consisting of those intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising the clones designated B3, B9, BIO, B21, B33, B89 and depicted as SEQ 5,6,7,8,9,10 and SEQ 23, 24, 25, 26, 27, 28 respectively and shown in fig 1 in the preparation of a medicament for the treatment of specific antigen positive cancer.

In a further aspect, the present invention provides the use of an intracellularly binding antibody selected from the list consisting of those intracellularly binding antibodies comprising one or more VH and/or VL region amino acid sequences selected from the group of amino acid sequences comprising the clones A5, A6, A7, A12, A13, A17, A18, A20,A24,A25, A28, A32 and designated SEQ 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and SEQ 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 and 40 respectively in the preparation of a medicament for the treatment of specific antigen positive cancer.

Immunoglobulin molecules according to the present invention, preferably ScFv molecules may be employed in in vivo therapeutic and prophylactic applications, in vitro and in vivo diagnostic applications, in vitro assay and reagent applications, in functional genomics applications and the like.

Therapeutic and prophylactic uses of immunoglobulins and compositions according to the invention involve the administration of the above to a recipient mammal, such as a human. Preferably they involve the administration to the intracellular environment of a mammal.

Substantially pure immunoglobulins of at least 90 to 95% homogeneity are preferred for administration to a mammal, and 98 to 99% or more homogeneity is most preferred for pharmaceutical uses, especially when the mammal is a human. Once purified, partially or to homogeneity as desired, the immunoglobulin molecules may be used diagnostically or therapeutically (including extracorporeally) or in developing and performing assay procedures using methods known to those skilled in the art.

In the instant application, the term "prevention" involves administration of the protective composition prior to the induction of the disease. "Suppression" refers to administration of the composition after an inductive event, but prior to the clinical appearance of the disease.

The selected immunoglobulin molecules of the present invention can perturb protein function in vivo and thus will typically find use in preventing, suppressing or treating inflammatory states, allergic hypersensitivity, cancer, bacterial or viral infection, and autoimmune disorders (which include, but are not limited to, Type I diabetes, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease and myasthenia gravis), and in preventing transplant rejection. For instance, one application of the intracellular immnoglobulins of the present invention is in perturbing the function of oncogenic proteins, in particular fusion molecules which result in chromosomal translocations. In particular, specific immunoglobulins of the present invention are of use in perturbing the function of the BCR-ABL oncoprotein by substantially degrading it intracellularly. Advantageously, it may be degraded within the nucleus by the treatment of cells with one or more immunolgobulins which further comprises a nuclear localisation signal. Immunolgobulins of the present invention which degrade BCR-ABL hydrid fusion protein are of particular interest as they are tumour-specific proteins only occurring in the progeny of cell which acquired the chromosomal translocation. This protein is found in CML (Chronic myelogenous leukemia) and a proportion of ALL (Acute lymphoblastic leukemia) carrying translocation t(9;22)(q34;ql l) (de Klein, A. et al. (1982). A cellular oncogene is translocated to the Philadelphia chromosome in chronic myelocytic leukaemia (Bartram et al. (1983) Nature, 300, 765-767). Translocation of c-abl oncogene correlates with the presence of a Philadelphia chromosome in chronic myelocytic leukaemia (Nature, 306, 277-280.). Alternatively, specific immunoglobulins of the invention are of use in binding to RAS antigen and inhibiting the RAS mediated transformation of cells.

The antigen-specific immunoglobulins and/or antigen-specific immunoglobulins further comprising a nuclear localisation signal according to the present invention may be used as therapeutic agents in leukaemias or lymphomas, preferably, Philadelphia chromosome leukemia. In this approach, the immunoglobulins of the present invention form a complex with the one or more specific antigens. The immunolgobulin/antigen complex is then relocated into the nucleus in the case when an immunoglobulin comprising a nuclear localisation signal is used or via the proteosome or lyzosome pathways in the case that an immunoglobulin without a nuclear-localisation signal is employed.

Animal model systems which can be used to screen the effectiveness of the selected immunoglobulins of the present invention in protecting against or treating disease are available.

Generally, the selected immunoglobulins of the present invention will be utilised in purified form together with pharmacologically appropriate carriers. Typically, these carriers include aqueous or alcoholic/aqueous solutions, emulsions or suspensions, any including saline and/or buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's. Suitable physiologically-acceptable adjuvants, if necessary to keep a polypeptide complex in suspension, may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates.

Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, may also be present (Mack (1982) Remington's Pharmaceutical Sciences, 16th Edition). The selected immunoglobulins of the present invention may be used as separately administered compositions or in conjunction with other agents. These can include various immunotherapeutic drugs, such as cylcosporine, methotrexate, adriamycin or cisplatinum, and immunotoxins. Pharmaceutical compositions can include "cocktails" of various cytotoxic or other agents in conjunction with the chemokines, or binding proteins thereof, or T-cells of the present invention or even combinations of selected chemokines, or binding proteins thereof, according to the present invention.

The route of administration of pharmaceutical compositions according to the invention may be any of those commonly known to those of ordinary skill in the art. For therapy, including without limitation immunotherapy, the selected immunoglobulins can be administered to any patient in accordance with standard techniques. The administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, via the pulmonary route, or also, appropriately, by direct infusion with a catheter. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counterindications and other parameters to be taken into account by the clinician.

The selected immunoglobulins of the present invention can be lyophilised for storage and reconstituted in a suitable carrier prior to use. Known lyophilisation and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of functional activity loss and that use levels may have to be adjusted upward to compensate.

The compositions containing the present selected immunoglobulins of the present invention or a cocktail thereof can be administered for prophylactic and/or therapeutic treatments. In certain therapeutic applications, an adequate amount to accomplish at least partial inhibition, suppression, modulation, killing, or some other measurable parameter, of a population of selected cells is defined as a "therapeutically-effective dose". Amounts needed to achieve this dosage will depend upon the severity of the disease and the general state of the patient's own immune system, but generally range from 0.005 to 5.0 mg of selected immunoglobulin per kilogram of body weight, with doses of 0.05 to 2.0 mg/kg/dose being more commonly used. For prophylactic applications, compositions containing the present selected immunoglobulin molecules or cocktails thereof may also be administered in similar or slightly lower dosages.

A composition containing one or more selected immunoglobulin molecules according to the present invention may be utilised in prophylactic and therapeutic settings to aid in the alteration, inactivation, killing or removal of a select target cell population in a mammal. In addition, the selected repertoires of polypeptides described herein may be used extracorporeally or in vitro selectively to kill, deplete or otherwise effectively remove a target cell population from a heterogeneous collection of cells. Blood from a mammal may be combined extracorporeally with the selected antibodies, cell-surface receptors or binding proteins thereof whereby the undesired cells are killed or otherwise removed from the blood for return to the mammal in accordance with standard techniques.

The invention is further described, for the purposes of illustration only, in the following examples.

Examples Example 1

Materials and Methods

Bacterial protein expression and purification of antigens BCR antigen: A plasmid for expression of histidine tagged SH2 binding domain of BCR in bacteria, pRSET-BCRSH2BD, was made by amplifying the sequences encoding amino acids 185 - 417 of BCR and cloning the PCR product into mini pRSET vector (a gift from O. Perisic) as BamHI - EcoRI fragment.

ABL antigen: A plasmid for bacterial expression of histidine tagged ABL protein SH2 domain (amino acid 26 - 348) (pRSET-ABL) was constructed by PCR of the corresponding sequences and subcloning the PCR product as BamHI - EcoRI fragment into mini pRSET vector. PCR conditions were 30 cycles of 1 minute each at 95°C, 50°C and 72°C using specific primers

(5 'cagggatccgagcgcggcctggtgaag375 ' caggaattcatcgttgggccagatctg3 ' for pRSET- BCRSH2BD and 5 'cagggatccgaagcccttcagcggcca375 'caggaattccgagatctgagtggccat3 ' for pRSET-ABL) and pElA2 (BCR-ABL pl90, a gift from Dr. G. Grosveld) as template.

The plasmids were transformed into E. coli C41 bacteria (Tse, E., & Rabbitts, T. H (2000) Proc. Nat. Acad. Sci. USA 97, 12266-12271) and induction of protein was performed by adding ImM IPTG to the exponentially growing bacterial culture (O.D.₆oo 0.6) and by growth at 30°C for 4 hours. The histidine tagged proteins were purified using Ni-NTA agarose according to manufacturer's instructions (Qiagen). Concentration of the purified proteins was determined by using Bio-Rad Protein Assay Kit (BIO-RAD).

RAS antigen: Recombinant oncogenic-HRAS (GI2V; residues 1-166) was expressed in bacterial cells habouring expression plasmids based on pETl la (Novagen) and purfied by ion-exchange chromatography and gel filtration (Pacold et al, (2000), Cell 103, 931-943). To prepare the active form of RAS antigen, 3mg of purified HRASG12V protein was loaded with 2mM GppNp (Sigma), a non-hydrolysable analogues of GTP, using the alkaline phosphatase protocol (Hermann et al (1996), J. Biol. Chem, 271, 6794-6800).

Mutation of framework residues for anti-RAS scFv

The construct I21R33 (sequence shown in Figure 3), which comprises FRs of anti- RAS scFvI21 and the CDRs of anti-RAS scFv33, was made using stepwise site- specific mutagenesis of scFv33, cloned in pEF-VP16, as primary template using PCR mutagenesis (Hoogenboom and Winter, 1992; Tanaka et al., 2003). Pfu DNA polymerase was used throughout. I21R33 (VHC22S;C92S), con33 and I21R33VHI21VL (Figure 3) were also constructed by mutations of 121 R33 using PCR mutagenesis with appropriate oligonucleotides (Hoogenboom and Winter, 1992; Tanaka et al., 2003). All scFv constructs were digested with Sβl orNcol, and Notl and subcloned into pEF-VP16 (for in vivo antigen antibody interactionassay) and pEF/myc/cyto vector (for expression of scFv in mammalian cells). All mutated scFv constructs were verified by DNA sequencing.

Transformation assays in NIH 3T3 cells

RAS protein is functionally localized to the plasma membrane of cells and, therefore, in order to localize scFv to cell membrane, we generated the pEF-Memb and pEF- FLAG-Memb vectors, with farnesylation sites for membrane localization of proteins. The pEF-Memb expression plasmid was constructed by introducing the coding region for the C-terminal 20 amino acid residues of HRAS into the Notl±Xbal site of pEF/myc/cyto vector (Invitrogen). A FLAG tag peptide-coding sequence (MDYKDDDDK) and an S il±NotI cloning site was introduced into pEF- Memb to make pEF-FLAG-Memb. The scFvs were subcloned into S/zI±NotI sites of pEF- FLAG-Memb. For expression of HRASG12V, mutant HRASG12V cDNA was subcloned into the expression vector pZIPneoSV(X) (Cepko et al., 1984). Low passage NIH 3T3 cells clone D4 (a kind gift from Dr Chris Marshall) were seeded at 2 3 10 5 cells per well in 6-well plates, and 2 mg of each pEF-FLAG-Memb-scFv plus 100 ng of pZIPneoSV(X)-HRASG12V vector were used with 12 ml of LipofectAMINEO for transfection. Two days later, the cells were transferred to 10 cm plates and grown for 2 weeks in Dulbecco's modified Eagle's medium (DMEM) containing 5% donor calf serum (Invitrogen) together with penicillin and streptomycin. The plates were ®nally stained with crystal violet and the number of foci counted. Example 2

In vitro characterisation of ICAbs

ScFv was expressed as soluble bacterial periplasmic protein and used as primary antibodies for Western immunodetection. ScFv DNA fragments were isolated from the scFv-VP16AD plasmid by Sfil - Notl restriction enzyme digestion and subcloned into pHEN2 vector (see www. Mrc-cpe. cam. ac.uk) to make pHEN2-ScFv for bacterial periplasmic expression. pHEN2-ScFv plasmids were transformed into E. coli HB2151 and induction of protein was performed by adding ImM IPTG to 50ml exponentially growing bacterial culture (O.D.₆oo 0.6) and by further growing at 30°C for 4 hours. The cells were pelleted and resuspended in 400 μl of ice-cold lx TES buffer (0.2M Tris-HCl; 0.5mM EDTA; 0.5M sucrose). 600 μl of 1 :5 TES buffer (ice- cold) was added, mixed gently by inversion and placed on ice for 30 minutes. The supernatant containing the periplasmic soluble ScFv was collected after centrifugation. The periplasmic protein was used fresh for immunodetection at a dilution of 1 :50. 9E10 anti-myc tag mouse monoclonal antibody and HRP-conjugated anti-mouse antibody were used as the secondary antibodies at 1 :1000 and 1 :2500 dilution respectively.

Example 3 Mammalian in vivo antibody-antigen interaction assay

The expression vector pEF-BOS-VPHS3 allows cloning of ScFv in-frame with the VP16 transcriptional activation domain for mammalian expression. Individual anti- BCR ScFv DNA fragments were cloned into the Sfil/Notl site of ρEF-BOS-VPHS3. Expression plasmids for scFvF8 (anti-AMCV virus coat protein) and scFvR4 (anti- beta-galactosidase (Martineau, P., Jones, P., & Winter, G, (1998, J.Mol Biol 280, 117- 127)) was constructed by inserting the appropriate PCR products into the Sfi-Notl site of pEF-BOS-VPHS3 (Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. &Galeffi, P. (1993) Nature (London) 366, 469-472.. The mammalian BCR-ABL expression plasmid, expressing Gal4DBD linked to BCR-ABL (pM3- E1A2) was made by subcloning the 4kb Eagl fragment of pElA2 REF into the Smal site of pM3 (Sadowski, I., Bell, B., Broad, P & Hollis, M,. (1992), Gene 118, 137- 141). The control bait pMl-βgal has been described previously (Visintin, M., Tse, E., Axelson, H., Rabbitts, T. H., & Cattaneo, A., (1999), Proc. Nat. Acad. Sci, USA 96 11723-11728).

Chinese hamster ovary (CHO) cells were maintained in minimal essential medium (GIBCO/BRL) with 10% foetal calf serum, penicillin and streptomycin. One day prior to transfection, 2x 10⁵ CHO cells were seeded onto a single well of 6 well-plate. CHO cells were transiently transfected with 0.5μg of bait plasmid and pEF-BOS-scFv- VP16, together with 0.5μg of G5-Luciferase reporter plasmid (de Wet, J. R, Wood, K.V., DeLuca, M., Helinski, D. R., & Subramani, S., (1987) Mol Cell Biol 7, 725-37). and 50ng of pRL-CMV internal control plasmid (Promega), using Lipofectamine (GIBCO/BRL, according to manufacturer's instructions). 60 hours after transfection, luciferase assays were performed on the CHO cell extracts using the Dual-Luciferase Reporter Assay System (Promega) and a luminometer. Transfection efficiency was normalised with the Ranilla luciferase activity measured. Each transfection was performed twice.

Example 4

Isolating specific intracellular ScFv against BCR and ABL proteins by in vivo antibody-antigen interaction screening The genetic screening approach to the isolation of intracellular antibodies comprised of yeast expression of a "bait" antigen fused to the LexA DNA binding domain (DBD) and a library of ScFv fused to the VP16 transcription activation domain (AD) (Visintin, M.., Tse, E., Axelson, H., Rabbitts, T.H. and Cattaneo, A. (1999) Proc. Natl. Acad. Sci. USA 96 11723-11728. Interaction between the antigen bait and a specific ScFv in the yeast intracellular environment results in the formation of a complex which can activate yeast chromosomal reporter genes, such as HIS3 and LacZ. This facilitates the identification and thus isolation of the yeast carrying the DNA vectors encoding the scFv. The main limitation of this approach is the number of scFv-VP16 fusion clones that can be screened in yeast antibody-antigen interaction system (conveniently up to 2-5 X 10⁶). This figure is well below the size of ScFv repertoires displayed on phage (Sheets, M.D., Amersdorfer, P., Finnern, R., Sargent, P., Lindqvist, E., Schier, R., Hemingsen, G., Wong, C, Gerhart, J.C. and Marks, J.D. (1998) Proc. Natl. Acad. Sci. USA 95 6157-6162; McCafferty et al (1990), Nature 348, 552-554). Thus to limit the numbers of ScFv to be screened in vivo in yeast, we have used one round of in vitro phage ScFv library screening using recombinant protein as antigen, prior to the in vivo yeast antibody-antigen interaction screening. A flow chart of our overall strategy to obtain antigen specific intracellular antibodies to BCR and ABL is shown in Figure 1.

The protein antigens for the in vitro screening were made by expressing either the SH2 binding domain of the BCR protein (BCR) or the SH2 domain of ABL (ABL) as recombinant protein. The purified antigens were used for screening an ScFv phage display library (Sheets, M.D., Amersdorfer, P., Finnern, R., Sargent, P., Lindqvist, E., Schier, R., Hemingsen, G., Wong, C, Gerhart, J.C. and Marks, J.D. (1998) Proc. Natl. Acad. Sci. USA 95 6157-6162,) (a gift from Dr. James Marks) in vitro. The library was derived from spleen cells and peripheral blood lymphocytes of human origin and had an initial diversity of 6.7x 10⁹. A total of 2x 10¹³ phage from the amplified library were screened with the purified protein fragments. After one round of in vitro phage screening, about 10⁵ antigen- bound phage were recovered (Fig. 1). These sub- libraries had a reduced complexity because of the enrichment of antigen-specific scFv. Phagemid DNA encoding the ScFv was extracted, DNA fragments encoding ScFv were subcloned into the yeast prey expression vector to create yeast scFv-VP16AD libraries of 3.2x 10⁵ and 1.3 x 10⁵ for BCR and ABL respectively (i.e. about 3 times the original size of the enriched phage sub-library size). In vivo yeast antibody-antigen interaction screening was performed (Visintin, M et al (1999) Proc. Nat. Acad. Sci, USA 96, 11723-11728; Tse, E et al, K.Turksen, Editior, 2000, Humana Press: Totawa) by co-transforming Saccharomyces cerevisiae L40 with a bait plasmid expressing BCR-ABL pl90 (pBTM/ElA2) and the BCR or ABL scFv-VP16AD library. A total of approximately 8.5x 10⁵ yeast colonies were screened and 117 (anti-BCR) or anti ABL yeast colonies were selected, and confirmed using beta-galactosidase (beta-gal) filter assays (Fig. 1), indicating an interaction between the ScFv and the BCR-ABL protein in the yeast cytoplasm.

The scFv-VP16AD plasmids were isolated from the yeast clones and into sorted into different groups according to BsfNI DNA fingerprinting patterns, yielding 45 (anti-BCR) and 24 (anti-ABL) clones. Verification of the intracellular binding of ScFv with antigen was determined using representatives of the groups in re- transfections with the original antigen bait and assay by histidine-independent growth and beta-gal activation. In this way, six anti-BCR and 12 anti-ABL ScFv were verified by activation of beta-gal. Examples of this are displayed in Figure 2 in which interaction of anti-BCR ScFv with BCR-ABL in yeast is shown. The specificity of the ScFv binding to BCR-ABL was further verified by the lack of interaction between them and non-relevant antigen (a plant virus coat protein antigen AMCV) in the yeast in vivo assay (Fig 2B) and by the lack of binding of the non-relevant ScFv F8 to the BCR-ABL bait (Fig. 2A) (Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. &Galeffi, P. (1993) Nature (London) 366, 469-472).

Example 5. Use of specific anti-BCR and anti-ABL antibodies to affect BCR-ABL antigen degradation in vivo.

Clones BIO, A17 and A25 have been used primarily to disturb the function of BCR- ABL by re-location of BCR-ABL antigen from one cellular compartment to another. This occurs when the specific ICAbs are expressed in BCR-ABL positive cells thus disabling its function

In the first experimental design, an expression vector was used to allow production of BCR-ABL antigen in the nucleus of transfected CHO cells by fusing a nuclear localisation signal (nls) to BCR-ABL (see Fig. 2C). Conversely, an expression vector was used to produce the anti-BCR ICAb BIO in cytoplasm of CHO cells (Fig. 2 A) or a non-relevant ScFv which does not bind BCR (scFv33, Fig. 2B). When CHO were co- expressed with both nls-BCR-ABL and ScFv-BlO we found that the ScFv co-located with the antigen in the nucleus showing that interaction of antigen and antibody was of sufficient affinity to cause the nls on the BCR-ABL to dominate and draw the complex to the nucleus (Fig. 2E). When the non-relevant scFv33 was co-expressed with nls- BCR-ABL, there was no co-location of ScFv into the nuclear compartment. These experiments show that the antigen specific anti-BCR antibody can bind to the oncogenic BCR-ABL protein and co-locate in a cellular compartment in which the BCR-ABL would be non-functional. Similar results are found with the anti-ABL antibodies.

The results are shown in Figure 2. Immunofluorescence studies of the interaction of scFvBlO and BCR-ABL in mammalian cells

Methods: The intracellular interaction between BCR-ABL oncogenic protein and the single chain Fv antibody fragment BIO, scFvBlO, isolated using IAC (Intracellular Antibody Capture) technology, has been studied in situ by immunofluorescence technique that allows to identify the subcellular localisation of the antigen and scFv. The BCR-ABL antigen expression vector plasmid pM3El A2 was made by subcloning the blunted Eagl pi 90 DNA fragment isolated from pΕlA2 construct into Smαl blunted site of pM3. The mammalian expression vector pM3 REF contains the DNA- binding domain of GAL4 which also has a nuclear location signal, targeting the fusion protein to the nucleus. The DNA fragments of ScFv were cloned into the NcollNotl site of pEF/mvc/cyto vector (Invitrogen) designed to locate recombinant proteins to the cytoplasm and to express them with a C-terminal c-myc epitope tag. The antibody and/or antigen expression plasmids were transiently transfected into CHO cells (Chinese Hamster Ovary), grown in chamber slides at about 60 percent of confluence, using Lipofectamine reagent (Invitrogen). 48 hours after transfection the cells were washed with PBS, fixed in 1% of paraformaldehyde in PBS (PFA-PBS), permeabilised with 0.5% Triton X-100 in PBS, post-fixed with 4% PFA-PBS and incubated with 0.5% blocking reagent in PBS (BR, Boehringer Manheim). Proteins were detected in the fixed cells by incubating with the primary antibodies 9E10, a mouse monoclonal antibody against c-myc tag of the ScFv protein, and/or with N-20 rabbit polyclonal antibody (Santa Cruz) against BCR protein. Antibodies were used at dilution of 1 : 100 in 0.5% BR. Secondary antibodies were fluorescein-conjugated anti-mouse and Cy3- conjugated anti-rabbit (Amersham) used at dilutions of 1:200 in 0.5% BR. After several washes with PBS, the cells were covered with mounting medium for fluorescence with DAPI (Vector) that binds to DNA and aids visualisation of the nucleus. Finally, the slides were overlaid with cover slips and studied using Bio- Radiance confocal microscope (Bio-Rad). The photos show the confocal analysis of CHO cells transiently transfected with scFvBlO, the specific antibody isolated against BCR, and scFv33, a no-relevant antibody in the presence of absence of the antigen BCR-ABL. The transfection of the ScFv and antigen plasmids alone shows their subcellular locations, namely cytoplasm of ScFv and nucleau for BCR-ABL (A-C). Co-transfection of BCR-ABL with ScFv shows antigen-antibody co-localisation in the cas eof scFvBlO but not scFv33. At least three pictures were taken corresponding to transmission image (black and white), the ScFv staining with fluorescein (green fluorescence) and BCR-ABL staining with Cy3-conjugated antibodies (red fluorescence). When the antigen was co-transfected with one of the antibodies, the merged image overlapping both staining (green and red fluorescence together) is shown.

Example 6.

Method for assaying the nuclear-degradation of antigen using IL-3 dependency Background:

IL3-dependent cells like Baf3 become IL3 -independent when they express BCR- ABL. Method:

Baf3 cells were transfected with immunoglobulins as described herein which bind to the ABL or BCR moiety of the BCR-ABL antigen and which immunoglobulins were attached to a nuclear localisation signal. The degree of nuclear degradation was assessed by measuring the reversion of the IL-3 independent cells to IL-3 dependency in these cells.

Example 7

Isolation and characterisation of specific intracellular antibody fragments which recognise RAS protein in vivo We have applied the intracellular antibody capture technique (Tse et al., 2002; Visintin et al., 2002) to the isolation of anti-RAS intrabodies. The sequential steps comprise initial in vitro phage scFv library panning with purified RAS protein and in vivo antigen-antibody two hybrid interaction screening to isolate specific intracellular antibodies. For in vitro phage Ab screen, purified carboxyl-terminal truncated human HRASG12V was used as antigen, bound to 5'-guanylylimidodi-phosphate (GppNp, non-hydrolysable analogue of GTP). After one round of in vitro panning, about 1.18 x 10⁶ antigen-bound phage were recovered from 2.7 x 10¹³ initial phage. A sub-library was prepared as phagemid DNA and cloned into a yeast pVP16* transcriptional activiation domain (AD) vector to make an anti-RAS scFv-VP16-AD library (about 4 x 10⁶ clones). This yeast sub-library was transfected into a yeast strain (L40 with HIS3 and β-gal reporter genes) expressing the fusion protein bait comprising the pBTMl 16 LexA-DBD fused to HRASG12V. Approximately 8.45 x 10⁷ yeast colonies were screened. 428 colonies grew in the absence if histidine and these clones also showed activation of β-gal. The scFv-VP16-AD plasmids were isolated from the histidine- independent, β-gal positive clones and assorted by their DNA restriction patterns. More than 90% of these scFv-VP16-AD plasmids had an identical DNA finger printing pattern and twenty had identical DNA sequences. Those scFv with differing DNA finger print patterns were co-transformed with the pBTM116-HRASG12V bait in fresh yeast and assayed for histidine-independent growth and β-gal activation. Three anti-RAS scFv, designated 33, J48 and 121, were thus identified. The specificity of these scFv for binding to RAS in yeast was further verified by their lack of interaction with the LexA-DBD (made from the empty pBTMl lό vector) and a non- relevant antigen (β-galactosidase) (data not shown).

The efficacy of the anti-RAS intrabodies was confirmed using a mammalian cell reporter assay and in vivo antigen co-location assays (Fig.4). The mammalian cell assay used was luciferase production from a luciferase reporter gene. The three scFv were shuttled into a mammalian expression vector, pEF-VP16, which has the elongation factor- la promoter (Mizushima and Nagata, 1990) and the VP16 transcriptional activation domain (AD) (Triezenberg et al., 1988). The scFv were cloned in frame with the VP16 segment, on its N-terminal side. The HRASG12V antigen was cloned into the pMl vector (Sadowski et al., 1992) which has the Gal4- DBD as an N-terminal fusion with antigen (pMl-HRASG12V). pEF-scFv-VP16 and pM-HRASG12V were co-transfected into COS7 cells with the luciferase reporter plasmid. More than 10-fold activation was observed when scFv33 or scFJ48-VP16 fusion were expressed with the bait antigen HRASG12V (Fig.4A) but none with a non-relevant antigen β-galactosidase. However, no activation was observed when the yeast anti-RAS scFvI21 was co-expressed with the HRASG12V bait (Fig.4A). Similar results were obtained in other mammalian cell lines viz. Hela and CHO cells. The failure of scFvI21 to interact with antigen in this mammalian cell assay, as opposed to yeast, may simply be due to it having insufficient affinity or may reflect the relative insensitivity of mammalian assays compared to yeast, perhaps due to factors such as transfection efficiency, reporter gene activation requiring access to endogenous transcription factors and/or the expression level of antigen or antibody.

Example 8. Anti-RAS scFv attached to a nuclear-relocation signal inhibits the oncogenic transformation of NIH-3T3 cells.

The observed interaction of scFv33 and scFvJ48 in a yeast system expressing LexA-DBD and a mammalian system expressing Gal4-DBD is a good indicator that the scFv interact with a native epitope of the RAS antigen, rather that an artificial one due to fusion of RAS and a DBD in the bait. Additional evidence for this was obtained from co-location assays in which the native RAS antigen was expressed together with the scFv to which nuclear localisation signals (nls) had been added. COS7 cells were co-transfected with a RAS expression vector with HA epitiope tag and scFv expression vectors encoding scFv with a myc epitiope tag. After 48 hours, RAS antigen was detected with anti-HA tag Ab and scFv with anti-myc tag Ab (Fig.4B). When the RAS antigen was expressed alone or with a non-relevant scFv (scFvR4 (Martineau et al., 1998)), the antigen was detected in the cytoplasm and antibody in the nucleus (Fig.4B, lower panels), whereas if the antigen was co- expressed with the anti-RAS scFvJ48 with an nls, co-location of RAS antigen and scFv was observed in the nucleus. This means that the anti-RAS intrabody has sufficient expression and affinity to bind RAS antigen in vivo and cause re-location within the cell (similar results were found with anti-RAS scFv33, data not shown).

In the experiments discussed above, we sought to improve the effectiveness of anti- RAS intrabodies by mutational analysis of the VH and VL FRs to make them equivalent to the canonical IAC consensus (Tse et al., 2002b; Visintin et al., 2002). A further test of the utility of our predetermined consensus frameworks was carried out by assessing the ability of anti-RAS sequences to inhibit oncogenic RAS transformation of NIH 3T3 cells. We evaluated this by taking as a starting point the scFvI21 clone, which was isolated from the yeast screening using RAS as a bait. Mutagenesis of the scFv33 to I21R33 (i.e. the 121 framework with VH and VL CDRs of scFv33) gives a well expressed protein able to activate the luciferase reporter gene. We have used this scFv in competitive transformation assays in which NIH 3T3 cells were transfected with a plasmid expressing activated HRAS alone (HRASG12V) to yield transformed foci (non-contact-inhibited colonies) which can grow in multilayers and show a swirling appearance of spindle-shaped cells (HRASG12V + empty scFv vector). When the NIH 3T3 cells were co-transfected with the HRASG12V vector together with one expressing scFvI21, essentially no difference from control was observed, in keeping with the observed lack of activation of the RAS-dependent luciferase reporter assays. On the other hand, when HRASG12V was expressed with the mutated 121 clone, scFvI21R33, the number of transformed foci was reduced to 30%), presumably due to interaction of the scFv with the HRASG12V-expressed protein, preventing its function. Thus the consensus scaffolds provide a basis for creation of functional scFvs.

All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

Claims

1. A method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1.

2. A method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

3. A method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL framework region amino acid sequence showing at least 85%) identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

4. A method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

5. A method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin comprising at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1.

6. A method for the cytoplasmic degradation of a specific antigen comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1.

7. The use of an intracellularly binding immunoglobulin comprising at least one antibody variable chain selected from the group consisting of:

- A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1. A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1. - A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1.

A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1. in the preparation of a medicament for the cytoplasmic degradation of one or more specific antigens.

8. A method for the cytoplasmic degradation of a target antigen comprising the step of treating one or more cells with nucleic acid encoding one or more intracellularly binding immunoglobulin molecules defined in claim 7.

9. A method for the intracellular relocation of one or more specific antigen s comprising the step of treating one or more cells with one or more intracellularly binding immunoglobulin/s comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

10. A method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with one intracellularly binding immunoglobulin/s comprising at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

11. A method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

12. A method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VH region amino acid sequence showing at least 85%o identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

13. A method for the intracellular relocation of one or more specific antigen/s comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VL region amino acid sequence showing at least 85%) identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more extrinsic localisation signals.

14. A method for the intracellular relocation of one or more specific antigen comprising the step of treating one or more cells with an intracellularly binding immunoglobulin comprising at least one VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1 and at least one VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 and further comprising one or more intrinsic localisation signals.

16. A method according to any of claims 9 to 14 wherein the intracellular relocation is nuclear relocation and the extrinsic localisation signal is a nuclear relocation signal.

17. The use of an intracellularly binding immunoglobulin comprising at least one antibody variable chain selected from the group consisting of:

A VL region amino acid sequence showing at least 85%> identity with the consensus sequence depicted in SEQ 4 and shown in fig 1. and further comprising one or more extrinsic localisation signals in the preparation of a medicament for the intracellular relocation of one or more specific antigens.

18. The use according to claim 17 wherein the relocation is nuclear relocation and the extrinsic localisation signal is a nuclear relocation signal.

19. A method for the intracellular relocation of a specific antigen comprising the step of treating one or more cells with nucleic acid encoding one or more intracellularly binding immunoglobulin molecules described in claim 18 and further comprising one or more extrinsic localisation signal/s.

20. A method according to claim 19 wherein the relocation is nuclear relocation and the extrinsic localisation signal is a nuclear relocation signal.

21. A method for the treatment of specific antigen positive cancer comprising the step of administering to a patient in need of such treatment one or more intracellularly binding antibodies comprising at least one antibody variable chain selected from the group consisting of: - A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1.

- A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1.

22. A method according to claim 21 wherein the immunoglobulin molecule further comprises one or more extrinsic localisation signals.

23. A method according to claim 21 wherein the one or more extrinsic localisation signals is/are nuclear localisation signal/s.

24. A method according to any of claim 19 to 23 wherein the specific antigen is BCR- ABL oncogenic fusion protein.

25. A method according to claim 24 wherein the intracellularly binding immunoglobulin comprises one or more variable chains described by those variable chain sequences comprising clone B10.

26. A method according to claim 24 wherein the intracellularly binding immunoglobulin comprises one or more variable chains described by those variable chain sequences comprising clones A17 or A25.

27. A method according to any of claims 19 to 23 wherein the specific antigen is RAS oncogenic protein..

28. A method according to claim 27 wherein the intracellularly binding immunoglobulin comprises one or more variable chains comprised by those clones in the group consisting of the following: J48, 33 and 121 and which variable chain amino acid sequences are designated 41, 42 and 43 respectively in Fig 3

29. A method according to any of claims 19 to 28 wherein the cancer is leukemia or lymphoma.

30. The use of an intracellularly binding immunoglobulin molecule comprising at least one antibody variable chain selected from the group consisting of:

A VH framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 3 and shown in fig 1. A VL framework region amino acid sequence showing at least 85% identity with the framework region consensus sequence depicted in SEQ 4 and shown in fig 1.

A VH region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 3 and shown in fig 1. - A VL region amino acid sequence showing at least 85% identity with the consensus sequence depicted in SEQ 4 and shown in fig 1 in the preparation of a medicament for the treatment of specific antigen positive cancer.

31. The use according to claim 30 wherein the immunoglobulin molecule further comprises one or more extrinsic localisation signals.

32. The use according to claim 31 wherein extrinsic localisation signal is a nuclear localisation signal.

33. The use according to any of claims 30 to 32 wherein the specific antigen is BCR- ABL oncogenic fusion protein.

34. The use according to claim 33 wherein the intracellularly binding immunoglobulin comprises one or more variable chains described by those variable chain sequences comprising clone BIO.

35. The use according to any of claims 30 to 33 wherein the intracellularly binding immunoglobulin comprises one or more variable chains described by those variable chain sequences comprising clones A17 or A25.

36. The use according to any of claims 30 to 32 wherein the specific antigen is RAS oncogenic protein..

37. The use according to claim 36 wherein the intracellularly binding immunoglobulin comprises one or more variable chains comprised by those clones in the group consisting of the following: J48, 33 and 121 and which variable chain amino acid sequences are designated 41, 42 and 43 respectively in Fig 3

38. Use according to any of claims 30 to 37 wherein the cancer is leukemia or lymphoma.