WO2004083387A2

WO2004083387A2 - Anti-ganglioside antibodies and methods of use

Info

Publication number: WO2004083387A2
Application number: PCT/US2004/007524
Authority: WO
Inventors: Gary R. Fanger
Original assignee: Corixa Corporation
Priority date: 2003-03-13
Filing date: 2004-03-11
Publication date: 2004-09-30
Also published as: WO2004083387A3

Abstract

Methods of inhibiting the induction of T cell apoptosis by a tumor cell are presented. In particular, the methods may be used to block T cell apoptosis that is induced by a tumor cell that is over-expressing a ganglioside such as monisialo-GM2. Such methods may be useful in the treatment of cancer. Such methods include contacting the ganglioside on the tumor cell with an antibody or antigen binding fragment thereof that specifically binds to the ganglioside. These antibodies may be for example, hamster antibodies, chimeric human/hamster antibodies, or humanized antibodies.

Description

A TI-GANGLIOSIDE ANTIBODIES AND METHODS OF USE

Field of the Invention The present invention relates to antibodies that can be used in the treatment of cancer, including myeloma, melanoma, small cell lung cancer and renal cancer. It also relates to . methods for the use of such antibodies that specifically bind to tumor cells and thereby inhibit the induction of T-Cell apoptosis by the cancer cell.

Background of the Invention Gangliosides are glycosphingolipids that are present in high numbers on cells of neural crest origin as well as on a wide variety of tumor cells of neuroectodermal origin. Portoukalian et al., Eur. J. Biochem. 94:19-23 (1979); Yates et al., J. Lipid Res. 20:428-436 (1979). More specifically, expression of the gangliosides GD2, GD3, and GM2 has been reported in neuroblastoma, lung small cell carcinoma, and melanoma, each of which are highly malignant neuroectodermal tumors. J. Exp. Med., 155:1133 (1982); J. Biol. Chem. 257:12752 (1982); Cancer Res. 47:225 (1987); Cancer Res.47:1098 (1987); Cancer Res. 45:2642 (1985); Proc. Natl. Acad. Sci. U.S.A. 80:5392 (1983).

The chemical structure of gangliosides includes a hydrophilic carbohydrate portion (one or more sialic acids linked to an oligosaccharide) attached to a hydrophobic lipid moiety composed of a long-chain base (sphingosine) and a fatty acid (ceramide). (G is an abbreviation for ganglioside and M, D, and T are abbreviations for mono, di, and tri, respectively; for further discussion of ganglioside nomenclature, see, Lehninger, Biochemistry, pp. 294-296 (Worth Publishers, 1981) and Wiegandt, in Glycolipids: New Comprehensive Biochemistry (Neuberger et al., ed., Elsevier, 1985), pp. 199-260; see, also, Figure 1 for a schematic of ganglioside biosynthesis).

Gangliosides may be involved in cell recognition, immunosuppression, adhesion and signal transduction. The ceramide portion anchors the ganglioside into the cell membrane and may, thereby, modulate intracellular signal transduction as a second messenger. The ganglioside designated GM2 is one of a group of sialic acid residue-containing glycolipids and is uniquely characterized by its presence in only trace amounts in normal cells and its upregulation in a variety of cancer cells such as, for example, lung small cell carcinoma, melanoma, and neuroblastoma.

Because they are immunogenic, gangliosides have received much attention as possible vaccine targets. For example, vaccination with a GM2 ganglioside, has been shown to stimulate high levels of anti-GM2 antibodies in melanoma patients. GM2 vaccines comprising either bacilli Calmette-Guerin (BCG) or, more recently, keyhole limpet hemagglutinin (KLH) as adjuvant have been tested in human clinical trials. Livingston et al., Proc. Natl. Acad. Sci U.S.A. 84:2911-2915 (1987); Livingston, In "Immunity to Cancer IE." Eds MS Mitchell, Pub Alan L. Liss, Inc., NY; Me et al. U.S. Patent No.4,557,931; Kirkwood et al. J. Clin. Oncol. 19(5): 1430-1436 (2001); Chapman et al. Clin. Cancer Res. 6(3): 874-879 (2000).

In an effort to develop a therapeutic agent against GM2-positive cells, a number of investigators have reported the production of anti-GM2 antibodies. For example, Yamaguchi et al., described the isolation of lymphocytes from a GM2-vaccinated patient and the transformation of those lymphocytes with Epstein-Barr virus to produce an antibody

(designated 3-207) simultaneously reactive for both GM2 and GD2. Proc. Natl. Acad. Sci. USA 87:3333-3337 (1990). Similarly, Lie et al., disclosed a human monoclonal anti-GM2 antibody for melanoma treatment. Lancet 1:786-787 (1989); see, also, Tai et al., Proc. Nat. Acad. Sci. U.S.A. 80:5392-5396 (1983) (disclosing a human anti-GM2 monoclonal antibody designated L55) and Yamasaki et al. U.S. Patent No.4,965,498 (disclosing a monoclonal antibody specific to a sugar chain containing an N-glycolylneuramine acid and having the ability to bind to at least N-glycolyl GM2 ganglioside). Furthermore, Ritter et al., disclosed antibodies produced following immumzation with a lipopolysaccharide antigen of Campylobacter jejuni that reportedly binds to monosialogangliosides, including both GM2 and GM1. Int. J. Cancer 66(2):184-190 (1996).

Summary of the Invention The invention is based on the discovery that cancer cells over-expressing monosialo- GM2 can induce apoptosis in T cells. It was found that this apoptotic effect was inhibited a monoclonal antibody (mAb) which binds specifically to monosialo-GM2. In one embodiment of the present invention, a cancer cell is contacted with a monoclonal antibody or antigen-binding fragment thereof that specifically binds to monosialo-GM2. Such anti-monosialo-GM2 antibodies (anti-GM2) may be human, humanized, or chimeric. Antibodies may also originate from a mammal such as a hamster, rabbit, mouse, guinea pig, rat, and the like. Additionally, the complement determining regions (CDRs) of an anti-monosialo-GM2 antibody may be grafted into the framework regions of another antibody (CDR grafting).

One example of a chimeric antibody that may be used with the present invention has a light chain having the amino acid sequence of SEQ ID NO:21 and a heavy chain having the amino acid sequence of SEQ ID NO:22. Another chimeric antibody may have substitutions at various positions within the framework regions. For example the chimeric antibody may include an amino acid sequence comprising SEQ ID NO:21 (e.g., in which isoleucine at linear position 52 is replaced with valine) or SEQ ID NO:22 (e.g., in which threonine at linear position 78 is replaced with lysine). The invention further features an antibody, or antigen-binding fragment thereof, in which the antibody comprises a complementary determinant region (CDR) with an amino acid sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.

Additionally, three hamster antibodies have been identified that specifically bind to monosialo-GM2. These antibodies are designated herein as DMFIO.62.3, DMF10.167.4, and DMF10.34.36. Hybridoma cell lines that produce these monoclonal antibodies that specifically bind to monosialo-GM2 have been deposited with the ATCC under Accession No. PTA-377 (DMFIO.62.3), Accession No. PTA-405 (DMF10.167.4), or Accession No. PTA-404 (DMFIO.34.36). As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural references unless the content clearly dictates otherwise.

An "isolated nucleic acid sequence" is a nucleic acid sequence that is substantially free of the genes that flank the nucleic acid sequence in the genome of the organism in which it naturally occurs. The term therefore includes a recombinant nucleic acid sequence incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic nucleic acid sequence of a prokaryote or eukaryote. It also includes a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment.

An antibody that "specifically binds" to monosialo-GM2 binds to monosialo-GM2, but that does not recognize and bind to other molecules in a sample, such as a biological sample that naturally includes monosialo-GM2.

"Conservative" amino acid substitutions are substitutions in which one amino acid residue is replaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Any one of a family of amino acids can be used to replace any other members of the family in a conservative substitution.

The terms "polypeptide, peptide, and protein" are used interchangeably herein to refer to a chain of amino acid residues.

An "antigen-binding fragment" of an antibody is a portion of the antibody that is capable of binding to an epitope on an antigen (for example, monosialo-GM2) bound by the full antibody.

An "epitope" is a particular region of an antigen (for example, monosialo-GM2) to which an antibody binds and which is capable of eliciting an immune response.

An "isolated" antibody is an antibody that is substantially free from other naturally- occurring organic molecules with which it is naturally associated.

A "reporter group" is a molecule or compound that has a physical or chemical characteristic such as luminescence, fluorescence, enzymatic activity, electron density, or radioactivity that can be readily measured or detected by appropriate detector systems or procedures. "Contacting" a cell with an antibody includes both in vivo and in vitro methods whereby an antibody may specifically, bind to an antigen. The antigen can be expressed on the surface of a cell. Such methods include for example administering a solution containing the antibody (e.g. through an injection or other methods known in the art) to a mammal. Additionally, in vitro methods of contacting a cell with an antibody include adding the antibody to a solution or cell culture dish in which the test cells are growing.

The practice of the present invention will employ, unless indicated specifically to the contrary, conventional methods of virology, immunology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art, many of which are described below for the purpose of illustration. Such techniques are explained more fully in the literature. See, e.g., Sambrook, et al. Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al. Molecular Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., 1985); Transcription and Translation (B. Hames & S. Higgins, eds., 1984); Animal Cell Culture (R. Freshney, ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

Brief Description of the Drawings and Sequence Listing Figure 1 is a diagrammatic representation of ganglioside biosynthesis. It employs the following abbreviations: Cer, ceramide; Glc, glucose; Gal, galactose; GalNAc, N- acetylgalactosamine; Sia, sialic acid; LacCer, lactosylceramide. This figure is adapted from Takamiya et al., Proc. Natl. Acad. Sci. USA 93:10662 (1996).

Figure 2 is a bar graph depicting the ganglioside binding activity of the hamster monoclonal antibodies designated DMF 10.167.4 and DMF 10.62.3. It employs the following abbreviations: As = asialo, Ms = monosialo, Ds = disialo, Ts = trisialo, and Ls = lysosialo and Chl/Meth = Chloroform Methanol diluent.

Figure 3 is a bar graph showing levels of monosialo-GM2 expression on renal carcinoma lines.

Figure 4 is a bar graph showing that a anti-monosialo-GM2 antibody blocks T-cell apoptosis induced by SK-RC-54 renal carcinoma cells.

SEQ ID NO: 1 is the polynucleotide sequence of an antisense primer for the light chain of a chimeric anti-monosialo-GM2 antibody.

SEQ ID NO: 2 is the polynucleotide sequence of a sense primer for the light chain of a chimeric anti-monosialo-GM2 antibody. SEQ ID NO: 3 is the polynucleotide sequence of an anti-sense primer for the heavy chain of a chimeric anti-monosialo-GM2 antibody.

SEQ ID NO: 4 is the polynucleotide sequence of a sense primer for the heavy chain of a chimeric anti-monosialo-GM2 antibody.

SEQ ID NO: 5 is the polynucleotide sequence of the NJ of DMFIO.62.3. SEQ ID NO: 6 is the polynucleotide sequence of the VDJ of DMFIO.62.3.

SEQ ID NO: 7 is the polynucleotide sequence the VJ-C (light chain) of a chimeric anti-monosialo-GM2 antibody.

SEQ ID NO: 8 is the polynucleotide sequence of the VDJ-C (heavy chain) of a chimeric anti-monosialo-GM2 antibody. SEQ ID NO: 9 is the polynucleotide sequence of the VJ of DMF10.167.4.

SEQ ID NO: 10 is the polynucleotide sequence of the NDJ of DMF10.167.4.

SEQ ID NO: 11 is the polynucleotide sequence of the NJ of DMF10.167.4 with its endogenous leader sequence.

SEQ ID NO: 12 is the polynucleotide sequence of the NDJ of DMF10.167.4 with its endogenous leader sequence. SEQ ID NO: 13 is the amino acid sequence of CDR3 of the light chain of DMF10.167.4 andDMF10.62.3.

SEQ ID NO: 14 is the amino acid sequence of CDR2 of the light chain of DMF10.167.4 and DMF10.62.3. SEQ ID MO: 15 is the amino acid sequence of CDR1 of the light chain of

DMF10.167.4 and DMF10.62.3.

SEQ ID NO: 16 is the amino acid sequence of CDR3 of the heavy chain of DMF10.167.4 and DMFlO.62.3.

SEQ ID NO: 17 is the amino acid sequence of CDR2 of the heavy chain of DMF10.167.4 and DMFIO.62.3.

SEQ ID NO: 18 is the amino acid sequence of CDR1 of the heavy chain of DMF10.167.4 and DMFIO.62.3.

SEQ ID NO: 19 is the amino acid sequence of the NJ of DMFIO.62.3.

SEQ ID NO: 20 is the amino acid sequence of the VDJ of DMFIO.62.3. SEQ DD NO: 21 is the amino acid sequence of the VJ-C (light chain) of a chimeric anti-monosialo-GM2 antibody.

SEQ ID NO: 22 is the amino acid sequence of the VDJ-C (heavy chain) of a chimeric anti-monosialo-GM2 antibody.

SEQ ID NO: 23 is the amino acid sequence of the NJ of DMF10.167.4. SEQ ID NO: 24 is the amino acid sequence the NDJ of DMF10.167.4.

SEQ JD NO: 25 is the amino acid sequence of the NJ of DMF10.167.4 with its endogenous leader sequence.

SEQ ID NO: 26 is the amino acid sequence of the VDJ of DMF10.167.4 with its endogenous leader sequence.

Detailed Description

The present invention features antibodies, e.g., monoclonal antibodies that specifically bind to monosialo-GM2 and methods of use of such antibodies. Monosialo- GM2 occurs on a variety of types of tumor cells, including thymic lymphoma, T-cell tumor, a B-cell lymphoma, melanoma, osteosarcoma, myeloma, and acute T-cell leukemia. Expression of monosialo-GM2 has also been observed in a variety of different species, including humans, monkeys, and mice. Importantly, it was demonstrated that monosialo- GM2 is over-expressed on certain metastatic renal carcinoma cell lines. These renal carcinoma cells exhibited the ability to induce apoptosis of T cells. This induced apoptosis was blocked by monoclonal antibodies that specifically bind to monosialo-GM2. The antibodies of the invention can inhibit the induction of T cell apoptosis by a cancer cell.

Three hybridoma cell lines that produce monoclonal antibodies that specifically bind to monosialo-GM2 have been deposited with the ATCC under Accession No. PTA- ^■377 (DMFIO.62.3), Accession No. PTA-405 (DMF10.167.4), or Accession No. PTA- 404 (DMFIO.34.36).

Methods of Making Antibodies

Antibodies are immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. Examples of fragments of irnmunoglobulin molecules include fragments of an antibody, e.g., F(ab) and F(ab')₂ portions, which can specifically bind to monosialo-GM2. Treating the antibody with an enzyme such as pepsin can generate fragments. The term monoclonal antibody or monoclonal antibody composition refers to a population of antibody molecules that contain only one species of an antigen-binding site capable of immunoreacting with a particular epitope of, e.g., a ganglioside, polypeptide, or protein. A monoclonal antibody composition thus typically displays a single binding affinity for the epitope to which it specifically binds.

Immunization

Polyclonal and monoclonal antibodies against monosialo-GM2 can be raised by immunizing a suitable subject (e.g., a hamster, rabbit, goat, mouse, or other mammal) with an immunogenic preparation that contains a suitable immunogen. Immunogens include cells such as cells from immortalized cell lines E710.2.3, RMA-S, CTLL, LB 17.4, A20, WEHI- 231, PBK101A2, C2.3, B16, MC57, WOP-3027, 293T, 143Btk, Jurkat, or Cos, that have all been shown to express monosialo-GM2. Alternatively, the immunogen can be purified or isolated monosialo-GM2. The antibodies raised in the subject can then be screened to determine if the antibodies bind to monosialo-GM2. Such antibodies can be further screened in the assays described herein.

The unit dose of immunogen (e.g., purified monosialo-GM2, tumor cell expressing monosialo-GM2) and the immunization regimen will depend upon the subject to be immunized, its immune status, and the body weight of the subject. To enhance an immune response in the subject, an immunogen can be administered with an adjuvant, such as Freund's complete or incomplete adjuvant.

Immumzation of a subject with an immunogen as described above induces a polyclonal antibody response. The antibody titer in the immunized subject can be monitored over time by standard techniques such as an ELISA using an immobilized antigen, e.g., monosialo-GM2.

Other methods of raising antibodies against monosialo-GM2 include using transgenic mice which express human immunoglobulin genes (see, e.g., Wood et al. PCT publication WO 91/00906, Kucherlapati et al. PCT publication WO 91/10741; or Lonberg et al. PCT publication WO 92/03918). Alternatively, human monoclonal antibodies can be produced by introducing an antigen into immune deficient mice that have been engrafted with human antibody-producing cells or tissues (e.g., human bone marrow cells, peripheral blood lymphocytes (PBL), human fetal lymph node tissue, or hematopoietic stem cells). Such methods include raising antibodies in SCDD-hu mice (see Duchosal et al. PCT publication WO 93/05796; U.S. Patent Number 5,411,749; or McCune et al. (1988) Science 241:1632- 1639)) or Rag-l/Rag-2 deficient mice. Human antibody-immune deficient mice are also commercially available. For example, Rag-2 deficient mice are available from Taconic Farms (Germantown, NY).

Hvbridomas

Monoclonal antibodies can be generated by immunizing a subject with an immunogen. At the appropriate time after immunization, e.g., when the antibody titers are at a sufficiently high level, antibody producing cells can be harvested from an immunized animal and used to prepare monoclonal antibodies using standard techniques. For example, the antibody producing cells can be fused by standard somatic cell fusion procedures with immortalizing cells to yield hybridoma cells. Such techniques are well known in the art, and include, for example, the hybridoma technique as originally developed by Kohler and Milstein, (1975) Nature, 256: 495-497), the human B cell hybridoma technique (Kozbar et al., (1983) Immunology Today, 4: 72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96). The technology for producing monoclonal antibody hybridomas is well known.

Monoclonal antibodies can also be made by harvesting antibody producing cells, e.g., splenocytes, from transgenic mice expressing human immunogloulin genes and which have been immunized with monosialo-GM2. The splenocytes can be immortalized through fusion with human myelomas or through transformation with Epstein-Barr virus (EBV). These hybridomas can be made using human B cell-or EBN-hybridoma techniques described in the art (see, e.g., Boyle et al., European Patent Publication No. 0614984).

Hybridoma cells producing a monoclonal antibody which specifically binds to monosialo-GM2 are detected by screening the hybridoma culture supernatants by, for example, screening to select antibodies that specifically bind to the immobilized monosialo- GM2, or by testing the antibodies as described herein to determine if the antibodies have the desired characteristics.

Hybridoma cells that produce monoclonal antibodies that test positive in the screening assays described herein can be cultured in a nutrient medium under conditions and for a time sufficient to allow the hybridoma cells to secrete the monoclonal antibodies into the culture medium, to thereby produce whole antibodies. Tissue culture techniques and culture media suitable for hybridoma cells are generally described in the art (see, e.g., R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, New York (1980). Conditioned hybridoma culture supernatant containing the antibody can then be collected.

Recombinant Combinatorial Antibody Libraries

Monoclonal antibodies can be engineered by constructing a recombinant combinatorial immunoglobulin library and screening the library with monosialo-GM2. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAP Phage Display Kit, Catalog No. 240612). Briefly, the antibody library is screened to identify and isolate phages that express an antibody that specifically binds to monosialo-GM2. In a preferred embodiment, the primary screening of the library involves screening with an immobilized monosialo-GM2.

Following screening, the display phage is isolated and the nucleic acid encoding the selected antibody can be recovered from the display phage (e.g., from the phage genome) and subcloned into other expression vectors by well-known recombinant DNA techniques. The nucleic acid can be further manipulated (e.g., linked to nucleic acid encoding additional immunoglobulin domains, such as additional constant regions) and or expressed in a host cell.

Chimeric and Humanized Antibodies

Recombinant forms of antibodies, such as chimeric and humanized antibodies, can also be prepared to minimize the response by a human patient to the antibody. When antibodies produced in non-human subjects or derived from expression of non-human antibody genes are used therapeutically in humans, they are recognized to varying degrees as foreign, and an immune response may be generated in the patient. One approach to minimize or eliminate this immune reaction is to produce chimeric antibody derivatives, i.e., antibody molecules that combine a non-human animal variable region and a human constant region. Such antibodies retain the epitope binding specificity of the original monoclonal antibody, but may be less immunogenic when administered to humans, and therefore more likely to be tolerated by the patient.

Chimeric monoclonal antibodies can be produced by recombinant DNA techniques known in the art. For example, a gene encoding the constant region of a non-human antibody molecule is substituted with a gene encoding a human constant region (see Robinson et al.,

PCT Patent Publication PCT/US86/02269; Akira, et al., European Patent Application

184,187; or Taniguchi, M., European Patent Application 171,496).

A chimeric antibody can be further "humanized" by replacing portions of the variable region not involved in antigen binding with equivalent portions from human variable regions. General reviews of "humanized" chimeric antibodies are provided by Morrison, S. L. (1985) Science, 229:1202-1207 and by Oi et al. (1986) BioTechniques, 4:214. Such methods include isolating, manipulating, and expressing the nucleic acid sequences that encode all or part of an immunoglobulin variable region from at least one of a heavy or light chain. The cDNA encoding the humanized chimeric antibody, or fragment thereof, can then be cloned into an appropriate expression vector. Suitable "humanized" antibodies can be alternatively produced by (complementarity determining region (CDR) substitution (see U.S. Patent 5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988) Science 239:1534; and Beidler et al. (1988) J. Immunol. 141:4053-4060).

Epitope imprinting can also be used to produce a "human" antibody polypeptide dimer that retains the binding specificity of the hamster antibodies specific for monosialo- GM2produced by the hybridoma deposited as ATCC Accession No. PTA-377, Accession No. PTA-405, or Accession No. PTA-404. Briefly, a gene encoding a non-human variable region (NH) with specific binding to an antigen and a human constant region (CHI), is expressed in E. coli and infected with a phage library of human VKC genes. Phage displaying antibody fragments are then screened for binding to monosialo-GM2. Selected human NK genes are recloned for expression of VKCK chains and E. coli harboring these chains are infected with a phage library of human NHCH1 genes and the library is subject to rounds of screening with antigen coated tubes. See Hoogenboom et al. PCT publication WO 93/06213.

Chimeric Anti-Monosialo-GM2 Antibodies

Among other things, the present invention provides chimeric antibodies that are highly specific for monosialo-GM2. Such chimeric antibodies may have the respective Fab and CDR regions from the hamster mAbs designated DMF 10.62.3 and DMF 10.167.4. A chimeric anti-monosialo-GM2 antibody of the present invention can also have Fab or CDR regions of the hamster mAb designated DMF 10.34.36. Alternatively, the chimeric antibody can have the Fab regions of any antibody that specifically binds to monosialo-GM2. Also provided are methods of using these chimeric anti-monosialo-GM2 antibodies in the blocking of T cell apoptosis. An antibody, or antigen-binding fragment thereof, is said to "specifically bind," "immunogically bind," and/or is "irhmunologically reactive" to monosialo-GM2 if it reacts at a detectable level (within, for example, an ELISA assay) to monosialo-GM2, but not to asialo-GM2, disialo-GM2, monosialo-GM3, disialo-GDla, disialo-GDlb, asialo-GMl, monosialo-GMl. lysosialo-GMl, trisialo-GTlb, and/or disialo-GD3.

"Immunological binding," as used herein, generally refers to the non-covalent interactions of the type that occurs between an antibody, or fragment thereof, and an antigen for which the antibody is specific. Immunological binding properties of selected antibodies can be quantified using methods well known in the art. See, generally, Davies et al. Annual Rev. Biochem. 59:439-473 (1990).

An "antigen-binding site," or "binding portion" of an antibody refers to the part of the immunoglobuhn molecule that participates in antigen binding. The antigen binding site is formed by amino acid residues of the N-terminal variable ("V") regions of the heavy ("H') and light ("L") chains. Three highly divergent stretches within the V regions of the heavy and light chains are referred to as "hypervariable regions" which are interposed between more conserved flanking stretches known as "framework regions," or "FWRs". Thus, the term "FWR" refers to amino acid sequences which are naturally found between and adjacent to hypervariable regions in i munoglobulins. In an antibody molecule, the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are disposed relative to each other in three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementary determinant region," or "CDRs."

A monoclonal antibody may be cleaved into various fragments by methods known in the art. The proteolytic enzyme papain preferentially cleaves IgG molecules to yield several fragments, two of which (the "Fab" fragments) each comprise a covalent heterodimer that includes an intact antigen-binding site. Another fragment produced from papain cleavage of an antibody is the Fc (fragment crystallizable). The Fc fragment is constant among a given class of antibodies and mediates binding of a cell or complement to an antibody when the antigen binding sites (Fabs) are occupied by an antigen. The Fc regions are particularly constant within a given species. When a therapeutic monoclonal antibody from a first species is administered to a second species, the immune system of the second species may mount an immune response to the Fc region of the mAb. Such an immune response can lead to the rapid destruction and clearing of the mAb from the second species. Such clearing can limit the efficacy of a therapeutic antibody.

The chimeric mAbs of the present invention may a Fab portion that is derived from a hamster or other mammalian mAb that specifically binds to monosialo-GM2 on tumor cells. The Fc region of this monoclonal antibody can be replaced with the Fc region of a human antibody, which limits undesirable immunological response toward non-human antibodies. Antibodies and antigen-binding fragments have a heavy chain and a light chain complementary determinant region (CDR) set, which are respectively interposed between a heavy chain and a light chain FWR set that provide support to the CDRs and define the spatial relationship of the CDRs relative to each other. As used herein, the term "CDR set" refers to the three hypervariable regions of a heavy or light chain N region. Proceeding from the Ν-terminus of a heavy or light chain, these regions are denoted as "CDRl," "CDR2," and "CDR3" respectively. An antigen-binding site, therefore, includes six CDRs, comprising the CDR set from each of a heavy and a light chain V region. Crystallographic analysis of a number of antigen-antibody complexes has demonstrated that the amino acid residues of CDRs form extensive contact with bound antigen, wherein the most extensive antigen contact is with the heavy chain CDR3. Thus, the molecular recognition units are primarily responsible for the specificity of an antigen-binding site.

As used herein, the term "FWR set" refers to the four flanking amino acid sequences that frame the CDRs of a CDR set of a heavy or light chain V region. Some FWR residues may contact bound antigen; however, FWRs are primarily responsible for folding the N region into the antigen-binding site. The FWR residues directly adjacent to the CDRs are particularly important for the folding of the N region. Within FWRs, certain amino acid residues and certain structural features are very highly conserved. In this regard, all N region sequences contain an internal disulfide loop of around 90 amino acid residues. When the N regions fold into a binding-site, the CDRs are displayed as projecting loop motifs, which form an antigen-binding surface. It is generally recognized that there are conserved structural regions of FWRs that influence the folded shape of the CDR loops into certain "canonical" structures, regardless of the precise CDR amino acid sequence. Further, certain FWR residues are known to participate in non-covalent interdomain contacts which stabilize the interaction of the antibody heavy and light chains. Both the light chain and heavy chain variable regions of antibodies have three complementary determinant regions, CDRs, joined by framework regions, FWR. A monoclonal antibody of the present invention may have a heavy chain CDRl with an amino acid sequence of THYVS (SEQ DD NO: 18), a heavy chain CDR 2 with an amino acid sequence of WIFGGS ART YNQKFQG (SEQ ID NO: 17), and a heavy chain CDR3 with an amino acid sequence of QVGWDDALDF (SEQ DD NO: 16). Additionally, an anti- monosialo-GM2 antibody may have a light chain CDRl with an amino acid sequence of RSSQSLFSGNYNYLA (SEQ DD NO: 15), a heavy chain CDR 2 with an amino acid sequence of YASTRHT (SEQ D NO: 14), and a heavy chain CDR3 with an amino acid sequence of QQHYSSPRT (SEQ DD NO: 13).

Humanized Antibodies

Humanized antibodies may be produced that reduce the undesirable immunological response toward non-human antibodies in a human patient. These humanized antibody molecules can have an antigen-binding site derived from the hamster antibodies. For example, the non-human CDRs described above, can be grafted into human FWR and fused to a human constant domain. Winter et al. Nature 349:293-299 (1991); Lobuglio et al. Proc. Nat. Acad. Sci. USA 86:4220-4224 (1989); Shaw et al. J Immunol. 138:4534-4538 (1987); and Brown et al. Cancer Res.47:3577-3583 (1987). The hamster CDRs may be grafted into a human supporting FWR prior to fusion with an appropriate human antibody constant domain. Riechmann et al. Nature 332:323-327 (1988); Nerhoeyen et al. Science 239: 1534- 1536 (1988); and Jones et al. Nature 321:522-525 (1986). Non-human CDRs can be supported by recombinantly-veneered FWRs. European Patent Publication No. 519,596, published Dec. 23, 1992. These "humanized" molecules are designed to minimize unwanted immunological response toward non-human antihuman antibody molecules that limits the duration and effectiveness of therapeutic applications of those moieties in human recipients. Similarly, "primatized" antibodies are designed to minimize unwanted immunological response toward non-primate anti-primate antibody molecules tht limits the duration and effectiveness of therapeutic applications of those moieties in primate recipients (e.g., humans, chimpanzees, gorillas, orangutans, etc.). The terms "veneered FWRs" and "recombinantly veneered FWRs" refer to the selective replacement of FWR residues from, e.g., a hamster heavy or light chain N region, with human FWR residues in order to provide a xenogeneic molecule comprising an antigen- binding site which retains substantially all of the native FWR folding structure. Veneering techniques are based on the understanding that the ligand-binding characteristics of an antigen-binding site are determined primarily by the structure and relative disposition of the heavy and light chain CDR sets within the antigen-binding surface (Davies et al. Ann. Rev. Biochem. 59:439-473 (1990)). Thus, antigen binding specificity can be preserved in a humanized antibody only wherein the CDR structures, their interaction with each other, and their interaction with the rest of the N region domains are carefully maintained. By using veneering techniques, exterior (e.g., solvent-accessible) FWR residues, which are readily encountered by the immune system, are selectively replaced with human residues to provide a hybrid molecule that comprises either a weakly immunogenic, or substantially non- immunogenic, veneered surface.

The process of veneering makes use of the available sequence data for human antibody variable domains compiled by Kabat et al., in Sequences of Proteins of .-mmunological Interest, 4th ed., (U.S. Dept. of Health and Human Services, U.S. Government Printing Office, 1987), updates to the Kabat database, and other accessible U.S. and foreign databases (both nucleic acid and protein). Solvent accessibilities of N region amino acids can be deduced from the known three-dimensional structure for human and non- human antibody fragments.

There are two general steps in veneering a non-human antigen-binding site. InitiaUy, the FWRs of the variable domains of an antibody molecule of interest are compared with corresponding FWR sequences of human variable domains available databases. The most homologous human N regions are then compared residue by residue to corresponding non- human amino acids. The residues in the non-human FWR that differ from the human counterpart are replaced by the residues present in the human moiety using recombinant techniques well known in the art. Residue switching is carried out with moieties that are at least partially exposed (solvent accessible), and care is exercised in the replacement of amino acid residues that may have a significant effect on the tertiary structure of N region domains, such as proline, glycine and charged amino acids.

In this manner, the resultant "veneered" non-human antigen-binding sites are thus designed to retain the non-human CDR residues, the residues substantially adjacent to the CDRs, the residues identified as buried or mostly buried (solvent inaccessible), the residues believed to participate in non-covalent (e.g., electrostatic and hydrophobic) contacts between heavy and light chain domains, and the residues from conserved structural regions of the FWRs which are believed to influence the "canonical" tertiary structures of the CDR loops. These design criteria are then used to prepare recombinant nucleotide sequences that combine the CDRs of both the heavy and light chain of a non-human antigen-binding site into human-appearing FWRs that can be used to transfect mammalian cells for the expression of recombinant human antibodies that exhibit the antigen specificity of the non-human antibody molecule.

Antibody Fragments

The present invention encompasses new antitumor antibodies and any fragments thereof containing the active binding region of the antibody, such as Fab, F(ab')2, and Fv fragments. Such fragments can be produced from the antibody using techniques well established in the art (see, e.g., Rousseaux et al., in Methods Enzymol., 121:663-69 Academic Press, (1986)). For example, the F(ab') fragments can be produced by pepsin digestion of the antibody molecule, and the Fab fragments can be generated by reducing the disulphide bridges of the F(ab')2 fragments.

Administration

The antibodies described herein can be administered to a subject, e.g., an animal or a human, to image or treat tumors. The antibodies can be administered alone, or in a mixture, e.g., in the presence of a pharmaceutically acceptable excipient or carrier (e.g., physiological saline). The excipient or carrier is selected on the basis of the mode and route of administration. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences (E. W. Martin), a well known reference text in this field, and in the USP/NF (United States Pharmacopeia and the National Formularly). Pharmaceutical Compositions In some embodiments, the present invention concerns formulation of one or more of the anti-monosialo-GM2 antibodies disclosed herein with pharmaceutically acceptable carriers for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy.

A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (e.g., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

Carriers and Buffers

It will be understood that, if desired, a composition as disclosed herein may be administered in combination with other agents as well, such as, e.g., other proteins or various pharmaceutically-active agents. The compositions may thus be delivered along with various other agents as required in the particular instance. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized.

Therefore, in another aspect of the present invention, pharmaceutical compositions are provided comprising one or more of the anti-monsialo-GM2 antibodies described herein in combination with a physiologically acceptable carrier. In certain preferred embodiments, the pharmaceutical compositions of the invention include an anti-monosialo-GM2 mAb for use in prophylactic and/or therapeutic applications.

It will be apparent that any of the pharmaceutical compositions described herein can contain pharmaceutically acceptable salts of the anti-monosialo-GM2 antibodies. Such salts can be prepared, for example, from pharmaceutically acceptable non-toxic bases, including organic bases (e.g., salts of primary, secondary and tertiary amines and basic amino acids) and inorganic bases (e.g., sodium, potassium, lithium, ammonium, calcium and magnesium

S3-1LS . While any suitable carrier known to those of ordinary skill in the art may be employed in the pharmaceutical compositions of this invention, the type of carrier will typically vary depending on the mode of administration. Compositions of the present invention may be formulated for any appropriate manner of administration, including for example, topical, oral, nasal, mucosal, intravenous, intracranial, intraperitoneal, subcutaneous and intramuscular administration.

Carriers for use within such pharmaceutical compositions are biocompatible, and may also be biodegradable. In certain embodiments, the formulation may provide a relatively constant level of active component release. In other embodiments, however, a more rapid rate of release immediately upon administration may be desired. The formulation of such compositions is well within the level of ordinary skill in the art using known techniques.

Illustrative carriers useful in this regard include microparticles of poly(lactide-co-glycolide), polyacrylate, latex, starch, cellulose, dextran and the like. Other illustrative delayed-release carriers include supramolecular biovectors, which comprise a non-liquid hydrophilic core (e.g., a cross-linked polysaccharide or oligosaccharide) and, optionally, an external layer comprising an amphiphilic compound, such as a phospholipid (see e.g., U.S. Patent No. 5,151,254 and PCT applications WO 94/20078, WO/94/23701 and WO 96/06638). The amount of active compound contained within a sustained release formulation depends upon the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented. The pharmaceutical compositions of the invention will often further comprise one or more buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, gangliosides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), solutes that render the formulation isotonic, hypotonic or weakly hypertonic with the blood of a recipient, suspending agents, thickening agents and/or preservatives. Alternatively, compositions of the present invention may be formulated as a lyophilizate.

Packaging

The pharmaceutical compositions described herein may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials, along with instructions for use, e.g., to treat a specific cancer. Such containers are typically sealed in such a way to preserve the sterility and stability of the formulation until use. In general, formulations may be stored as suspensions, solutions or emulsions in oily or aqueous vehicles. Alternatively, a pharmaceutical composition may be stored in a freeze-dried condition requiring only the addition of a sterile liquid carrier immediately prior to use.

Dosing. Delivery, and Treatment Regimens The development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including e.g., oral, parenteral, intravenous, intranasal, and intramuscular administration and formulation, is well known in the art, some of which are briefly discussed below for general purposes of illustration. In certain circumstances it will be desirable to deliver the pharmaceutical compositions disclosed herein parenterally, intravenously, intramuscularly, or intraperitoneally. Such approaches are well known to the skilled artisan, some of which are further described, for example, in U. S. Patent No. 5,543,158; U. S. Patent No. 5,641,515 and U. S. Patent No. 5,399,363. In certain embodiments, solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally will contain a preservative to prevent the growth of microorganisms. Illustrative pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (for example, see U. S. Patent No. 5,466,468). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and/or by the use of surfactants. The prevention of the action of microorganisms can be facilitated by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

In some embodiments, for parenteral administration in an aqueous solution, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. Moreover, for human administration, preparations will of course preferably meet sterility, pyrogenicity, and the general safety and purity standards as required by FDA Office of Biologies standards.

In another embodiment of the invention, the compositions disclosed herein may be formulated in a neutral or salt form. Illustrative pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.

The carriers can further comprise any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.

The anti-monosialo-GM2 antibody compositions described herein may be used in therapeutic methods for the treatment of cancer. For example, a pharmaceutical composition containing the anti-monosialo-GM2 antibodies, may be admimstered to a human patient. Such pharmaceutical compositions may be administered either prior to or following surgical removal of primary tumors and/or treatment such as administration of radiotherapy or conventional chemotherapeutic drugs. Administration of the antibody compositions may be by any suitable method, including administration by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, intradermal, anal, vaginal, topical and oral routes. Routes and frequency of administration of the therapeutic compositions of the present invention, as well as dosage, will vary from individual to individual, and may be readily established using standard techniques. In general, the pharmaceutical compositions may be administered by injection (e.g., intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration) or orally.

An appropriate dosage and treatment regimen provides the active compound(s) in an amount sufficient to provide therapeutic and or prophylactic benefit. Such a response can be monitored by establishing an improved clinical outcome (e.g., more frequent remissions, complete or partial, or longer disease-free survival) in treated patients as compared to non- treated patients. Typically, a suitable dose is an amount of a compound that, when administered as described above, is capable of promoting an anti-tumor response, and is at least 10-50% above the basal (i.e., untreated) level.

The most effective mode of administration and dosage regimen for the compositions of this invention depend upon the severity and course of the disease, the patient's health and response to treatment, and the judgment of the treating physician. Accordingly, the dosages of the compositions should be titrated to the individual patient. An effective dose of the antibody composition of this invention is in the range of from about 1 ug to about 5000 mg, preferably about 1 to about 500 mg, or preferably about 100-200 mg.

Examples

The following examples are given to illustrate various embodiments that have been made of the present invention. It is to be understood that the following examples are not comprehensive or exhaustive of the many types of embodiments that can be prepared in accordance with the present invention.

Example 1. Biological Characterization of Hamster Monoclonal Antibody DMF 10.167.4

The hamster monoclonal antibody (mAb) DMF 10.167.4 and the clonally related antibody DMF10.62.3 bind to the cell surface of murine thymic lymphoma cells. Antibodies DMF 10.167.4 and DMFIO.62.3 were derived from the same fusion. Three hamster monoclonal antibodies (DMF 10.62.3, DMF 10.167.4, and DMF 10.34.36), were raised against E710.2.3 mouse thymic lymphoma cells, that bound to a cell surface ligand on a large number of cell lines including a few normal primary lines as well as tumor cell lines.

The DMF 10.167.4 mAb antibody was tested for ganglioside specificity. To determine ligand specificity, individual wells of ELISA plates were coated overnight, with monosialo-GM2, asialo-GM2, disialo-GM2, monosialo-GM3, disialo-GDla, disialo-GDlb, asialo-GMl, monosialo-GMl, lysosialo-GMl, trisialo-GTlb, and disialo-GD3 gangliosides (all from Sigma; St. Louis, MO). Wells were blocked for 2 hours with blocking buffer (PBS + 1% BSA) and incubated with primary antibodies, either DMF 10.167.4, DMF 10.62.3, or hamster immunoglobulin (Ig) as a control, diluted 1 μg/ml in blocking buffer for 1 hour. Following 5 washes in PBS, plates were incubated with goat anti-hamster Ig-HRP

(Pharmingen; San Diego, CA) for 1 hour in PBS + 1% BSA. Plates were washed in PBS and developed in TMB substrate for 10 minutes before quenching with 1M NaOH. Absorbance was measured at 450nm-570nm by an ELISA plate reader. (Figure 2). These data show that the DMF 10.167.4 mAb bound specifically only to monosialo-GM2. The structurally related ganglioside monosialo-GM3, lacking 1 terminal galactose residue compared to monosialo- GM2, and monosialo-GMl, possessing one additional galactose residue, were not recognized, nor was the sialic acid deficient ganglioside asialo-GM2. These results suggest that the epitope recognized by DMF10.167.4 mAb consists of a combination of the terminal galactose sugar and the sialic acid residue. A molecular description of these gangliosides is shown in Figure 1. Treatment of monosialo-GM2 with neuraminidase A, which cleaves off the sialic acid residue, led to a loss of DMF10.167.4 binding as measured by ELISA (data not shown), further validating the epitope specificity of this mAb.

Cell surface binding of hamster monoclonal antibody DMF 10.167.4 was determined by flow cytometric methods (i.e. FACS analysis). Single suspensions of murine thymic lymphoma cells were generated, cells were washed 3 times with ice cold staining buffer (PBS+1%BSA+Azide), and were incubated for 30 minutes on ice with 10 μg ml of Protein A/G purified hamster mAb DMF 10.167.4. The cells were washed three times with staining buffer and then incubated with a 1: 100 dilution of an anti-hamster IgG-FITC reagent (Pharmingen; San Diego, CA) for 30 minutes on ice. Following three washes, the cells were re-suspended in staining buffer containing Propidium Iodide (PI), a vital stain that allows for identification of permeable cells, and analyzed by FACS.

Flow cytometric analysis using the DMF10.167.4 mAb was performed to determine the extent of coverage of monosialo-GM2 surface expression on several types of human tumor cell lines. As summarized in Table 1, 90% of the SCLC lines that were tested were positive for monosialo-GM2 expression. Three lines, NCI-H69, HTB173 and HTB 180 demonstrated weak binding, as approximately 15% of cells were positive for DMF10.167.4 binding, whereas six lines, including HTB 175, HTB 171, DMS79, NCI-H128, NCI-H187, and SHP-77 demonstrated strong binding with greater than 40% of cells staining positive. The SCLC line HTB 172 was negative for monosialo-GM2 expression. For melanoma cell lines, 75% of lines tested expressed monosialo-GM2, with CHL-1, Mel S, and Mel D showing strong positive staining, whereas MTL450-5 cells were negative. In terms of monosialo-GM2 expression on the cell surface of other types of tumor cell lines, two kidney lines, HEK293 and HICK 10-4, were strongly positive, as were the Jurkat T cell and K562 B cell leukemia lines, while the HL 60and THP-1 leukemia lines and the 721 B cell line showed no monosialo-GM2 expression. Representative lines derived from pancreas, breast, prostate, ovarian and myeloma tumors were also analyzed and demonstrated lower extents of coverage (33% to 20%) of monosialo-GM2 expression.

Neither the DMF10.167.4 mAb nor the DMFIO.62.3 mAb was able to recognize monosialo-GM2 in formaMn-fixed or frozen tissues by IHC analysis, suggesting that the epitope recognized by these mAbs is destroyed during the tissue preparation process. Because of this absence of epitope recognition, flow cytometry was used to analyze DMFIO.167.4 mAb reactivity on normal cells obtained from Clonetics Inc. that had been dissociated from normal tissues and propagated in vitro. This analysis revealed that lung and prostate epithelium, as well as prostate stroma, human aortic and umbilical endothelium, and human PBMCs demonstrated no specific binding with this mAb. Human fibroblasts were weakly positive for monosialo-GM2 (less than 10% positive-staining cells). These data confirm the over-expression of monosialo-GM2 on tumor cell lines and the relative lack of monosialo-GM2 expression on normal tissues, making this antigen an appropriate target of therapeutic mAbs. Example 2. Sequence Analysis of cDNA Encoding the Hamster DMF 10.167.4 mAb

To determine the heavy and light chain variable region cDNA sequences of the DMF- 10.167.4 mAb total RNA was isolated from ~2 million cells by extracting the cells with Trizol reagent (Invitrogen Corp.; Carlsbad, CA). First strand cDNA was generated using the Advantage RT for PCR kit (BD Biosciences Clontech; Franklin Lakes, NJ), tailed with dGTP using TdT (Invitrogen Corp.; Carlsbad, CA), and then used as a template for PCR amplification. The PCR was carried out using a 5' sense poly-dCTP oligo with a 3' anti- sense kappa or gamma chain constant region specific oligonucleotiodes for amplification of light and heavy chains, respectively. The products were subcloned into the pCR-Blunt vector (Invitrogen Corp.; Carlsbad, CA) and subjected to sequence analysis. Clones 10.167.4H and 10.167.4L were determined to encode the leader sequence and the heavy chain variable region (VDJ) and light chain variable region (VJ), respectively, of the DMF10.167.4 mAb. The sequences are disclosed herein as SEQ DD NOs: 12 and 11, respectively. The corresponding variable region sequences minus the endogenous leader sequences are disclosed herein as SEQ DD NOs: 10 and 9, respectively, and the corresponding amino acid sequences encoded by the above DNA sequences are disclosed herein as SEQ DD NOs: 26, 25, 24 and 23, respectively.

Example 3. Anti-Ganglioside Antibodies DMF 10.62.3 and DMF 10.167.4 are Clonallv Related

The DMFIO.62.3 antibody disclosed and characterized in U.S. Patent Application No. 09/618,421 is clonally related (i.e. derived from the same parental B cell clone) to the DMF10.167.4 antibody disclosed therein and further characterized herein and, as a consequence thereof, both of these antibodies share functional properties of antigen binding specificity and affinity.

The nucleotide sequences of the immunoglobulin heavy and light chains of the anti- monosialo-GM2 hamster mAb DMFIO.62.3 were determined and compared to the corresponding sequences of hamster mAb DMFIO.167.4. Approximately two million DMF10.62.3 hybrid cells were used to isolate mRNA using Tri-reagent (Gibco; San Diego, CA). First strand cDNA synthesis was carried out using the Advantage RT for PCR kit (BD Biosciences Clontech; Franklin Lakes, NJ). PCR amplification was performed using specific constant region and degenerate consensus leader oligonucleotide primers provided in the Ig- prime kit (Novagen, Inc.; Madison, WI). PCR products were subcloned into the pCR-Blunt

5 vector (Invitrogen Corp.; Carlsbad, CA) and subjected to sequencing analysis. Clones 10.62.3L and 10.62.3H were determined to encode the light variable region (VJ) and heavy variable region (VDJ), respectively, of the DMFIO.62.3 mAb. The sequence of the light chain and heavy chain variable regions of the DMF10.167.4 mAb were compared to another hamster mAb, DMFIO.62.3, which also was determined to bind to monosialo-GM2. o The amino acid sequence of the VJ and VDJ of DMFIO.62.3 are disclosed as SEQ DD

NOS: 19 and 20 respectively. The nucleotide sequence of the VJ and the VDJ of DMFIO.62.3 are disclosed as SEQ DD NOS: 5 and 6 respectively. The sequence of DMFIO.62.3 and DMFIO.167.4 were substantially similar with a single residue change in the light chain variable region and a single residue change in the heavy chain variable region. 5 The isoleucine at linear position 52 of the of the light chain variable region of DMFIO.167.4 as defined in SEQ DD NO: 23 is replaced with valine in SEQ DD NO: 19, and the threonine at linear position 78 of the heavy chain variable region of DMFIO.167.4 as defined in SEQ DD NO: 24 is replaced with lysine in SEQ DD NO: 20. These modifications are not within the CDRs of the hamster antibodies. 0 The near identity of the variable regions and identity of CDR3 confirm that the

DMFIO.62.3 and DMFIO.167.4 mAbs are clonally related and, consequently, share functional properties such as antigen binding specificity and affinity.

5 Example 4. Human Myeloma Cell-Surface Binding By DMFIO.167.4 mAb

To determine if monosialo-GM2 is expressed on the surface of myeloma cells and ^• recognized by the DMF10.167.4 mAb, 1 x 10⁶ cells were incubated with lOμg/ml irrelevant hamster IgG or DMF10.167.4 mAb on ice, then washed 3 times with staining buffer (PBS + 1% BSA + Azide). Cells were then incubated with FITC-conjugated anti-hamster IgG on 0 ice, and then washed 3 times with staining buffer. Cells were resuspended in staining buffer containing propidium iodide, a vital stain that distinguishes permeable cells from viable cells, then analyzed by flow cytometry. As demonstrated by the increase in the mean fluorescent intensity (MFI) values of the DMFIO.167.4 mAb compared to irrelevant hamster IgG, which is a measurement of the relative binding ability, the DMFIO.167.4 mAb was shown to recognize and bind to monosialo-GM2 on the surface of several human myeloma cell lines, including DP-6 (Irrelevant: 3.03 vs. DMFIO.167.4: 93.81), OPM-2 (2.82 vs. 488.1), U266 (1.86 vs. 232.7), RPMI-8226 (6.14 vs. 150.8) and NCI-H929 (4.2 vs. 62.7). These data indicate that the DMFIO.167.4 mAb recognizes monosialo-GM2 on a number of myeloma cell lines. Example 5. Human Melanoma Cell Surface Binding By DMFIO.167.4 mAb

To determine if monsialo-GM2 is expressed on the surface of melanoma cells and recognized by the DMFIO.167.4 mAb, 1 x 10⁶ CHL-1 cells were incubated with lOμg/ml irrelevant hamster IgG or DMF10.167.4 mAb on ice, then washed 3 times with staining buffer (PBS + 1% BSA + Azide). Cells were then incubated with FTTC-coηjugated anti- hamster IgG on ice, and then washed 3 times with staining buffer. Cells were resuspended in staimng buffer containing propidium iodide, a vital stain that distinguishes permeable cells from viable cells, then analyzed by flow cytometry. As demonstrated by the increase in the mean fluorescent intensity (MFI) values of the DMF10.167.4 mAb compared to irrelevant hamster IgG, which is a measurement of the relative binding ability, the DMFIO.167.4 mAb was shown to recognize and bind to monosialo-GM2 on the surface of the CHL-1 melanoma cell line (Irrelevant: 3.2 vs. DMFIO.167.4: -100). These data indicate that the DMFIO.167.4 mAb recognizes monosialo-GM2 on melanoma cells.

Example 6. Human Small Cell Lung Cancer (SCLC) Surface Binding By DMF10.167.4 mAb

To determine if monosialo-GM2 is expressed on the surface of SCLC cells and recognized by the DMF10.167.4 mAb, 1 x 10⁶ cells from numerous SCLC cell lines were incubated with lOμg ml irrelevant hamster IgG or DMF10.167.4 mAb on ice, then washed 3 times with staining buffer (PBS + 1% BSA + Azide). Cells were then incubated with FITC- conjugated anti-hamster IgG on ice, and then washed 3 times with staining buffer. Cells were resuspended in staining buffer containing propidium iodide, a vital stain that distinguishes permeable cells from viable cells, then analyzed by flow cytometry. As demonstrated by the increase in the mean fluorescent intensity (MFI) values of the DMFIO.167.4 mAb compared to irrelevant hamster IgG, which is a measurement of the

5 relative binding ability, the DMFIO.167.4 mAb was shown to recognize and bind to monosialo-GM2 on the surface of the SCLC cell lines, including NCI-H69 (Irrelevant: 3.6 vs. DMFIO.167.4: 22.3), NCI-H128 (4.79 vs 115.49), HTB 171 (10.44 vs. 673.85), HTB 173 (4.04 vs 20.91), HTB 175 (6.18 vs 730.46), DMS79 (8.38 vs 31.65), HTB 180 (6.21 vs 39.98), NCI-H187 (7.37 vs 374.5) and SHP-77 (5.69 vs 140.1). These data indicate that the o DMFIO.167.4 mAb recognizes monosialo-GM2 on SCLC cells.

Example 7. Generation of an Anti-monosialo-GM2 Hamster-Human Chimeric Monoclonal Antibody 5 An anti-GM2 chimeric monoclonal antibody (ChGM2 mAb) was constructed with the variable regions of a hamster mAb and the constant regions of a human mAb. The light chain variable region of the ChGM2 mAb has the amino acid sequence of the light chain variable region of DMFIO.167.4 SEQ DD NO: 23; and the heavy chain variable region of the ChGM2 mAb has the amino acid sequence of the heavy chain variable region of 0 DMF10.167.4 of SEQ DD NO: 24. The constant region of the ChGM2 mAb is from a human IgG 1 isotype determined to have significant homology to the constant region of the anti- monosialo-GM2 hamster antibodies. The ChGM2 mAb has the light chain nucleotide sequence of SEQ DD NO: 7 and a heavy chain nucleotide sequence of SEQ DD NO: 8. Additionally, a chimeric antibody of the present invention may have the variable regions of 5 the DMF10.62.3 monoclonal antibody.

The chimeric anti-monosialo-GM2 monoclonal antibody (mAb) was generated by fusing the hamster anti-monosialo-GM2 DMFIO.167.4 mAb variable region domains to human IgGl and kappa constant region domains. Multiple allotype (and isotype) constant regions could be used including f , a, z and combinations thereof for the heavy chain and 1, 2, 3, and combinations thereof for the light chain. Litwin, S.D. Immunol Sel. (1989) 43:203-

236.

For chimeric generation, the DMFIO.167.4 heavy (H) chain cDNA template) was

PCR amplified using a 5' sense oligo (GTCGGCCGGAAGGGCCTTGGCCCAGGTCCAGCTGCAGCAGTCTG) SEQ ID NO: 4 and a 3' anti-sense oligo

(ATGCTGGGCCCTTGGTGGAGGCTGAGGAGACAGTGACTTGGGTCCCTTGACC)

SEQ DD NO: 3, restriction endonuclease digested with Sfil and Apal and subcloned into an expression vector containing the human IgGl constant region domains. Likewise, the DMF10.167.4 light (L) chain cDNA template was PCR amplified using a 5' sense oligo

(ACTGGCCGGAAGGGCCTTGGCCGATATCGTGATGACACAGTCTCCA) SEQ DD

NO: 2 and a 3' anti-sense oligo

(AGACAGATGGCGCCGCCACGGTCCGTTTGATTTTCAGCTTGGTGCC) SEQ DD NO:

1, restriction endonuclease digested with Sfil and Kasl and subcloned into an expression vector containing the human kappa constant region domain. These H and L chain expression constructs whose ORFs are defined by SEQ DD NOS: 7, 8, 21, 22 were transfected into

CHO-K1 (ATCC No. CCL-61) cells to produce a chimeric anti-monosialo-GM2 mAb that was subsequently purified by protein A column chromatography

Example 8. Anti-monosialo-GM2 Antibody Blocks Induction of T Cell Apoptosis Monosialo-GM2 is a ganglioside that is expressed on a variety of tumor cells including myeloma, melanoma, and small cell lung cancer. GangUosides may contribute to a tumor cell's ability to evade cellular immunity by inducing apoptosis in T cells.

To determine if monosialo-GM2 is present on renal cell carcinoma, various cell Unes were tested for monosialo-GM2 expression using flow cytometry. The renal cell Unes tested were derived from patients with metastatic (met) renal cell carcinoma SK-RC-54 (lung met), SK-RC -45ρ (adrenal met), SKRC-45L (adrenal met and variant of 45P), SK-RC-26b (lymph node met), SK-RC-13 (brain met), SK-RC-9 (brain met), SK-RC-28 (kidney primary). Ebert, T. et al., Cancer Research 50: 5531-5536 (1990). Cells were washed in PBS and stained with 10 μg/ml of either irrelevant primary or the anti-monosialo-GM2 antibody (DMFIO.167.4). Cells were washed again and then primary antibody was detected using anti-hamster FITC labeled secondary antibody. RC54, RC45P, RC45L, RC26, RC28 but not RC9 were positive for monosialo-GM2 expression. For each line, 10-90% of total cells were positive for monosailo-GM2 expression. The RC54 cells expressed the highest levels of surface monosialo-GM2.

To determine whether monosialo-GM2 would mediate T cell apoptosis, T cells were cocultured with the monosialo-GM2 expressing kidney carcinoma line RC54. Anli-GM2 antibody was added to the medium to determine if blocking monosialo-GM2 with the anti- GM2 antibody would suppress T cell apoptosis. T cells were cocultured for 72 hrs under the following conditions: 1) with media alone, 2) media and irrelevant IgG, 3) RC54 tumor cells with 0.32 mg/ml of irrelevant IgG, 4) RC54 tumor cells with 0.16 μg ml of anti-GM2 and 5) RC54 tumor cells and 0.32 μg/ml of anti-GM2 antibody. Cells were then fixed in 4% formaldehyde, permeabilized in 10% saponin buffer and stained with terminal deoxynucleotidyl transferase (TdT). TdT is able to detect DNA strand breaks that occur during cellular apoptosis and levels can be quantitated by flow cytometry. RC54 tumor cells were shown to induce apoptosis of T cells in the absence or presence of irrelevant IgG. T cell apoptosis levels were roughly 65% in the absence of any anti-GM2 antibody. However, when either 0.16 μg/ml or 0.32 μg ml of anti-GM2 antibody was added to the cells there was a dramatic decrease in the ability of the RC54 cells to induce apoptosis of the T cells. In the presence of anti-GM2 antibody the T cell apoptosis levels were only about 30%.

Thus, the anti-GM2 monoclonal antibody was able to prevent apoptosis of T cell by the tumor cell expressed monosialo-GM2. This suggests that monsiaolo-GM2 plays a direct role in the abiUty of the RC54 tumor cells to induce apoptosis of T cells. Over-expression of monosialo-GM2 by tumors may allow tumor ceUs to suppress immune function and evade immune surveillance. Additionally, contacting the monosialo-GM2 expressing cell with an antibody that specifically binds to monosialo-GM2 may block this immunosuppression. Antigen binding fragments or other molecules that show a specific binding to monosialo- GM2 may also be used to block the induction of T cell apoptosis. These results were particularly surprising because of the anti-GM2 antibody's known propensity to induce apoptosis in tumor cells and because the concentration of the antibody used was substantially below the levels at which induction of tumor apoptosis has been shown. Accordingly, the anti-GM2 antibodies may be used to block T-cell destruction enabling a host's immune system to control the cancerous cells.

Other Embodiments It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

We claim:

1. A method of inhibiting induction of T-cell apoptosis by a cancer cell comprising contacting the cancer cell with an anti-monosialo-GM2 antibody or antigen- binding fragment thereof.

2. The method of claim 1, wherein the antibody is a selected from the group consisting of chimeric antibody, a humanized antibody, a human antibody, and a primatized antibody.

3. The method of claim 1, wherein the anti-monosialo-GM2 antibody is DMFIO.167.4.

4. The method of claim 1, wherein the cancer cell over-expresses monosialo- GM2.

5. The method of claim 3, wherein the cancer cell is selected from the group consisting of renal carcinoma, thymic lymphoma, T-cell lymphoma, B-cell lymphoma, melanoma, osteosarcoma, acute T-cell leukemia, small cell lung cancer, and myeloma.

6. The method of claim 1, wherein the anti-monosialo-GM2 antibody comprises a Ught chain amino acid sequence of SEQ DD NO:21 and a heavy chain amino acid sequence of SEQ D NO:22.

7. The method of claim 6, wherein isoleucine at Unear position 52 of the sequence of the light chain variable region of SEQ DD NO:21 is replaced with valine and threonine at linear position 78 of the sequence of the heavy chain variable region of SEQ DD NO:22 is replaced with lysine.

8. The method of claim 1, wherein the antibody comprises light chain complementary determinant regions (CDRs) with an amino acid sequence of SEQ DD NO: 13, SEQ DD NO: 14, and SEQ DD NO: 15, and heavy chain CDRs with an amino acid sequence of SEQ DD NO: 16, SEQ DD NO: 17, and SEQ DD NO: 18.

9. The method of claim 1, wherein the antibody is selected from the group consisting of DMF 10.62.3, DMF 10.167.4, DMF 10.34.36, a chimeric antibody having the variable regions of DMF 10.62.3, DMF 10.167.4, or DMF 10.34.36, and an antibody having the CDR regions of DMF 10.62.3, DMF 10.167.4, or DMF 10.34.36.

10. A method of inhibiting induction of T-cell apoptosis by a cancer comprising contacting the cancer cell with an anti-monosialo-GM2 antibody or antigen-binding fragment thereof, wherein the cancer cell over-expresses monosialo-GM2.

11. The method of claim 10, wherein the cancer cell is selected from the group consisting of renal carcinoma, thymic lymphoma, T-cell lymphoma, B-cell lymphoma, melanoma, osteosarcoma, acute T-cell leukemia, small cell lung cancer, and myeloma.

12. The method of claim 10, wherein the anti-monosialo-GM2 antibody comprises a light chain amino acid sequence of SEQ DD NO:21 and a heavy chain amino acid sequence of SEQ DD NO:22.

13. The method of claim 11 , wherein isoleucine at Unear position 52 of the sequence of the Ught chain variable region of SEQ DD NO:21 is replaced with valine and threonine at Unear position 78 of the sequence of the heavy chain variable region of SEQ DD NO:22 is replaced with lysine.

14. The method of claim 10, wherein the antibody comprises light chain complementary determinant regions (CDRs) with an amino acid sequence of SEQ DD NO: 13, SEQ DD NO: 14, and SEQ DD NO: 15, and heavy chain CDRs with an amino acid sequence of SEQ DD NO: 16, SEQ DD NO: 17, and SEQ DD NO: 18.

15. The method of claim 10, wherein the antibody is selected from the group consisting of DMF 10.62.3, DMF 10.167.4, DMF 10.34.36, a chimeric antibody having the variable regions of DMF 10.62.3, DMF 10.167.4, or DMF 10.34.36, and an antibody having the CDR regions of DMF 10.62.3, DMF 10.167.4, or DMF 10.34.36.

16. The method of claim 10, wherein the antibody is a selected from the group consisting of chimeric antibody, a humanized antibody, a human antibody, and a primatized antibody.