WO2005062871A2

WO2005062871A2 - Tat linear epitope peptides and conjugates thereof for use in therapeutic compositions and assays

Info

Publication number: WO2005062871A2
Application number: PCT/US2004/043022
Authority: WO
Inventors: C. David Pauza; Ilia Tikhonov; Tracy Jean Ruckwardt; Glen Scot Hatfield
Original assignee: University Of Maryland Biotechnology Institute
Priority date: 2003-12-19
Filing date: 2004-12-20
Publication date: 2005-07-14
Also published as: WO2005062871A3

Abstract

The present invention relates to compositions and methods for eliciting a neutralizing antibody response specific to HIV Tat proteins. Also disclosed are vaccines including amino terminus Tat linear epitope peptide fragments having the amino terminus sequence of the HIV Tat protein, conjugated to HIV viral Gag protein. The invention relates as well to the nucleotide sequences encoding the peptide fragments, recombinant vectors carrying the sequences, recombinant host cells including either the sequences or vectors, and recombinant peptides. The invention further includes methods for using the isolated, recombinant peptides in vaccines, assays, and for use in therapeutic applications.

Description

TAT LINEAR EPITOPE PEPTIDES AND CONJUGATES THEREOF FOR USE IN THERAPEUTIC COMPOSITIONS AND ASSAYS BACKGROUND OF THE INVENTION

Field of the Invention

The present invention relates to compositions and methods for eliciting a neutralizing antibody response specific to variable HTV Tat proteins from multiple viral clades, and more particularly, to vaccines comprising linear peptide fragments of the HIV Tat protein conjugated to a viral carrier protein. The invention relates as well to the nucleotide sequences encoding the peptide fragments and conjugated viral carrier proteins, recombinant vectors carrying the sequences, and recombinant host cells. The invention further includes methods for using the isolated, recombinant peptides in vaccines, assays, and for use in preventive and therapeutic applications.

Description of the Related Art

The presence of accessory genes is a unique feature of human immunodeficiency viruses (HIV). Accessory genes of HIV regulate virus expression, modify the host cell, and control virus production. With this added regulatory complexity, HIV gained the ability to vary its replication kinetics from high levels in acute infection, to low levels in clinical latency, rendering the virus a difficult target for therapeutic and prevention strategies. Tat is among the required regulatory genes in the human immunodeficiency virus that encodes for the Tat protein, which is required for virus replication and pathogenesis.

The Tat protein of HIV- 1, a small (14 kD) protein, is the product of two exons within the second half of the viral genome. The first exon codes for amino acids 1-72 and the second exon has varying length open reading frames resulting in Tat proteins ranging from 86 to 102 amino acids and having molecular weights up to 14 kDa. Tat is expressed early after infection and forms a complex with host nuclear proteins and the viral RNA stem-loop structure called TAR (transactivation response element), to relieve a block to transcript elongation and promote the production of full-length viral transcripts. The Tat protein is also released from infected cells and functions as an extracellular factor that modifies bystander cells and favors virus spread.

Tat penetrates T lymphocytes and translocates to the nucleus (41); incidentally inducing the expression of the CXCR4 co-receptor for virus (24, 38), generalized T cell activation (29), and cellular apoptosis that can reduce antiviral immunity (49). Tat also binds to monocyte/macrophages, but remains on the cell surface (50) while inducing the CCR5 viral co- receptor (24), triggering interferon-alpha release (47), and causing the production of TRAIL protein that leads to apoptotic death in uninfected T cells (49). Astrocytes and glial cells in the central nervous system are sensitive to Tat-mediated cytokine dysregulation and cell death, prompting the idea that Tat may be a contributory cause to ATDS-related dementia. The early appearance of Tat during the virus life cycle and the manifold effects of Tat on uninfected bystander cells prompted an effort to develop Tat as a vaccine antigen.

Evidence for the role of extracellular Tat in HIV-1 pathogenesis, along with studies showing a correlation between Tat immunity and prognosis, prompted a search for vaccines against Tat. Protein, peptides, and DNA constructs have been used to immunize nonhuman primates. Most of these studies used an HTV Tat protein antigen (7, 8, 30, 40) or a carboxymethylated form demonstrated to be biologically inert called Tat toxoid (30, 40). Macaques immunized with Tat or Tat toxoid protein developed antibody and lymphoproliferative responses (7, 30, 40). Some macaque antisera neutralized the in vitro activity of Tat (4, 41). Plasmid DNA constructs were used to elicit CTL responses to the SIV Tat protein. The CTL response to SIV Tat was reported to be strong enough to select for Tat escape variants in infected animals (2) but a pre-existing CTL to Tat had no effect on SIV infection (1). Overall, the results of published Tat vaccine studies in nonhuman primates range from complete protection against a challenge virus (7-9, 13), to disease attenuation (18, 30, 42), to no effect (1, 40). In the first clinical studies employing a Tat vaccine, HTV-infected (22) or uninfected control individuals (21) were vaccinated with Tat toxoid and the vaccine was imrnunogenic, eliciting proliferative responses and Tat-binding antibodies.

Immunization with Tat antigen has been studied in nonhuman primates and in HTV-infected individuals. Nonhuman primate studies evaluated the protective effect of Tat alone (1, 7, 8, 18, 22, 30, 40) or in combination with other HIV antigens (53, 42, 54). However, the potential value of Tat as a vaccine antigen is controversial. Published reports of complete or partial protection against virus challenge in macaques contrast with studies showing no protection effects. Generalizations are elusive, partly because each group used different animal models, antigens, and vaccination protocols and also because there are no standardized assays for Tat immune responses.

There have been several studies on the antibody response to Tat protein in HTV-infected individuals and in volunteers immunized with Tat antigens. However, antibody responses to Tat protein immunization have been inconsistent. Recently, Ensoli's group has been studying antibodies from HTV-infected people (55). They collected sera from several geographic regions and screened these sera on a set of peptides representing their immunogen sequence (clade B), or an 86 amino acid Tat protein with the same sequence. The group reported that some sera from each geographic region reacted with the clade B protein and argued that these studies support their view that a single Tat immunogen (whole protein) will be sufficient in all regions of the world.

However, in contrast, the present inventors show high variability in the amino acid residues of Tat and believe that whole HTV Tat protein sequences are not the optimal antigen for mounting a defense against the various virus clades because the cross-reacting antibodies seen in HTV+ people, is likely due to recognition of conformational determinants. Further, vaccines that use whole HIV Tat protein sequences are difficult to produce at scale and the protein retains some activities that may be problematic for human immunization.

Thus, it would be advantageous to develop epitope peptide vaccines that elicit antibodies for linear epitopes and can be easily modified to accommodate for clade variation without the shortcomings of the whole Tat vaccines.

SUMMARY OF THE INVENTION

The present invention relates to identifying amino acids that are essential for antibody binding to the amino terminus, and showing how natural sequence variation distinguishes different clades and how this variation will impact antibody recognition and neutralization of Tat.

hi another aspect, the present invention relates to increasing extracellularTat-neutralizing capacity of Tat antibodies, by eliciting antibodies specific to linear epitopes.

In yet another aspect, the present invention relates to Tat vaccines that neutralize the effects of soluble Tat thereby blocking immune suppression due to soluble Tat and increasing the magnitude and duration of protective immune responses targeting structural antigens.

In another aspect, the present invention relates to immunogenic compositions comprising at least one Tat protein or fragment thereof conjugated to a carrier protein, wherein the Tat protein comprises at least one linear epitope peptide, wherein the linear epitope peptide comprises sequences 1-20 of the amino terminus, 51-70 (basis region) and/ or 82-101 (carboxy region), and wherein the Tat protein elicits production of linear epitope binding antibodies that inhibit entry of soluble Tat into T cell or affecting the dynamics of monocytes, wherem the carrier protein is a viral protein, and more preferably, a HTV gag protein or fragment thereof.

In another aspect, the present invention relates to a therapeutic composition comprising two Tat peptides or fragment thereof wherein each Tat peptide is from a different HTV clade, wherein each Tat peptide comprises from 15 to about 20 amino acid residues from the Tat amino terminus and including amino acid residues 1, 7 and 12, and wherein the peptides are conjugated to a viral carrier protein, and more preferably a HTV gag protein or fragment thereof.

Another aspect of the present invention relates to a method to induce production of neutralizing Tat antibodies that inhibit internalization of Tat into T-cells, the method comprising: administering to a subject a vaccine comprising a nucleotide sequence encoding for an epitopic peptide having at least 15 linear amino acid residues from the amino terminus region of Tat and a viral carrier protein, wherein the amino acid sequence of the epitopic peptide comprises at least amino acid residues 1, 7 and 12 and is administered in an effective amount to induce production of neutralizing Tat antibodies, and wherein the nucleotide sequences are codon optimized for enhanced expression in a mammal.

The therapeutic compositions of the present invention may be administered in combination with at least one antiviral agent: The antiviral agent may include any agent that inhibits entry into a cell or replication therein of an infectious virus, and specifically retroviruses, such as HTV viruses. The antiviral agents include, but are not limited to nucleoside RT inhibitors, CCR5 inhibitors/antagonists, viral entry inhibitors and their functional analogs.

In still another aspect, the present invention relates to a therapeutic method of combating an HTV virus infection, comprising: administering to a patient a composition comprising an effective amount of at least one peptide having at least about 15 to about 21 amino acid residues from the amino terminus region of Tat, preferably conjugated to a carrier protein, wherein the amino acid sequence comprises at least amino acid residues 1, 7 and 12 and is codon optimized for expression in a mammal.

Another aspect of the present invention provides polynucleotide sequences having a nucleotide sequence encoding a peptide having at least about 15 to about 21 amino acid residues from the amino terminus region of HTV Tat and linked to a nucleotide sequence encoding for a viral carrier protein, wherem the amino acid sequence comprises at least amino acid residue 1, 7 and 12 from the amino terminus region of Tat and wherein the nucleotide sequence is codon optimized to enhance expression in a mammal, bacteria or host cell.

Also, the present invention includes antibodies useful in treatment methods and diagnostic methods. Such antibodies can neutralize the Tat protein in vitro and in vivo, and can be useful in inhibiting HTV infection, by passive protection or inducing an immune response.

Methods for producing an antibody include administering a peptide having at least about 15 to about 21 amino acid residues from the amino terminus region of Tat conjugated to HTV gag protein or a fragment thereof, wherein the amino acid sequence comprises at least amino acid residue 1, 7 and 12 from the amino terminus region of Tat.

The present invention provides for isolated and purified codon optimized polynucleotides that encode peptides specific for linear epitopes on the amino terminus of Tat. In a preferred embodiment, the nucleotide sequences of the present invention comprise SEQ ID NOs: 1 or 2 and encode for peptides comprising the amino acid residue sequences of SEQ ID NOs: 3 and 4, respectively.

In another embodiment, the present invention contemplates a fusion protein comprising a linear epitope peptide of the amino terminus of Tat having an amino acid residue sequence of SEQ ID NOs: 3 or 4 and conjugated to an HTV gag protein or fragment thereof. Further, both the 5' and 3' end of the amino acid sequence may be flanked by a HIV gag protein or fragment thereof. In the alternative, the gag protein may be flanked on the 5' and 3' with a Tat linear epitope peptide of the same or different clade.

In addition to the peptide of SEQ ID NO. 3, 4, 6, or 8, additional peptide sequence modification are included, such as minor variations, deletions, substitutions or derivitizations of the amino acid sequence of the sequences disclosed herein, so long as the peptide has substantially the same activity or function as the unmodified peptides. A modified peptide will retain activity or function associated with the unmodified peptide, the modified peptide will generally have an amino acid sequence "substantially homologous" with the amino acid sequence of the unmodified sequence.

In an alternative embodiment, the present invention provides an expression vector comprising a polynucleotide that encodes for a Tat linear epitope peptide of the present invention. Preferably, an expression vector of the present invention comprises a polynucleotide that encodes a peptide comprising the amino acid residue sequence of SEQ ID NOs: 3 or 4 conjugated to a gag protein or fragment thereof, or SEQ ID NOs: 6 or 8.

hi yet another embodiment, the present invention provides a recombinant host cell transfected with a polynucleotide that encodes a Tat linear epitope peptide of the present invention. Preferably, a recombinant host cell of the present invention is transfected with a polynucleotide that encodes for a peptide having an amino acid residue sequence selected from SEQ ID NOs: 3, 4, 6 or 8.

In yet another embodiment, the present invention contemplates a process of preparing a Tat linear epitope peptide of the present invention comprising transfecting a cell with polynucleotide that encodes the Tat linear epitope peptide linked to a gag peptide to produce a transformed host cell and maintaining the transformed host cell under biological conditions sufficient for expression of the peptide. Preferably, the transformed host cell is a eukaryotic cell, such as COS or CHO cell or a prokaryotic cell, such a bacterial cell of Escherichia coli. Even more preferably, a polynucleotide transfected into the transformed cell comprises a nucleotide base sequence that encodes for a Tat amino terminus epitope peptide.

In yet another aspect, the present invention relates to antibodies, wherein the antibody is immunoreactive with a Tat amino terminus linear epitope peptide of the present invention comprising the steps of: (a) introducing a Tat amino terminus linear epitope peptide of the present invention into a live animal subject; and (b) recovering the antibody

Another aspect of the present invention relates to a method of expressing a Tat linear epitope/Gag peptide of the present invention comprising the steps of: (a) transfecting a recombinant host cell with a polynucleotide that encodes a Tat linear epitope/Gag peptide of the present invention; (b) culturing the host cell under conditions sufficient for expression of the polypeptide; (c) recovering the polypeptide.

Preferably, the host cell is transfected with the polynucleotide of that encodes for a peptide having an amino acid residue sequence selected from SEQ ID NOs: 3, 4, 6, or 8. Alternatively, steps (a), (b) and (c) can be avoided by use of a synthetic polypeptide.

hi another aspect, the present invention contemplates a diagnostic assay kit for detecting the presence of an immunoreactive antibody to a Tat amino terminus linear epitope in a biological sample, where the kit comprises a first container containing at least one Tat amino terminus linear epitope peptide of the present invention capable of immunoreacting with a linear epitope antibody in the biological sample, with the peptide in an amount sufficient to perform at least one assay. Preferably, an assay kit of the invention further comprises a second container containing a second antibody with an indicator that immunoreacts with a binding antibody to the peptide.

In the alternative, antibodies specific for Tat linear epitope peptides of the present invention may be used in assays for the detection of an immune response in an HTV infected patient and determining the specific HIV clade, the method comprising: a) providing HTV Tat linear epitope peptides from HTV clades B and/or C and a scrambled peptide, wherein the scrambled peptide comprises the amino acid residues of the linear epitope peptide and used as a control; ; b) collecting sera from a mammal that is HTV infected; c) incubating the sera in combination with the HTV Tat linear epitope peptides to form a sera/peptide composition; d) adding the sera/peptide composition to ELISA plates coated with intact Tat antigen; e) measuring bound antibodies to the intact Tat antigen and linear epitopes of different clades to determine values of recognition of conformational epitopes of intact Tat antigen relative to the linear epitopes.

Still another aspect, relates to an assay for measuring the proportion of antibodies that bind amino terminus linear or conformational epitopes to detennine effectiveness of Tat vaccines, the assay comprising: a) providing at least one HIV Tat linear epitope peptide and a scrambled peptide, wherein the scrambled peptide comprises the amino acid residues of the linear epitope peptide in a scrambled mode and used as a control; b) collecting sera from a mammal that has been exposed to a Tat vaccine or HTV infected; c) incubating the sera in combination with the HTV Tat linear epitope peptide and the scrambled peptide to form a sera/peptide composition; d) adding the sera/peptide composition to ELISA plates coated with intact Tat antigen; e) measuring bound antibodies to the intact Tat antigen wherein, increased binding to the Tat antigen indicates increased recognition of conformational epitopes of the intact Tat antigen and decreased binding indicates recognition of Tat linear epitope.

The linear epitope peptide may include from about 15 to 20 amino acid residues and range along the 1 to 102 amino acid residues of Tat, including different viral clades, and more preferably the amino terminus epitope comprising residues 7 and 12.

Further, the linear epitope peptides can be used in an assay for adsorption to ELISA plates for measuring sera antibodies and determining binding affinity and region specificity as described in copending application PCT/US2003/40568, the contents of which is incorporated herein in its entirety for all purposes.

Yet, another aspect relates to a method of making a Tat linear epitope peptide/viral carrier protein chimera comprising the steps of: covalently attaching an immunogenic viral carrier protein to the Tat linear epitope peptide to form the chimera. The Tat linear epitope peptide/viral carrier protein chimera may be administered alone or in a pharmaceutical composition as a vaccine in a therapeutically effective amount to elicit an enhanced immune response or a protective immune response in an animal. The chimera may further include a linker or amino acid spacer linking the linear epitope peptide and viral carrier protein.

Other features and advantages of the invention will be apparent from the following detailed description, drawings and claims. BRIEF DESCRIPTION OF THE FIGURES

Figures 1 A, B, C, and D show the peptide competition of Tat toxoid immunized monkey sera binding to Tat. Monkey sera at dilutions between 1 : 100 and 1 : 1000 was preincubated with no peptide (--♦-) or peptides corresponding to the N-terminal region (-"B- ) the-basic domain (--_ r-), both peptides ( - , or scrambled peptides corresponding to both

OD405 was measured after ELISA on 86 aa Tat coated plates.

Figure 2 shows peptide inhibition of Tat neutralization by monoclonal antibody TR1. OD450 values are from p24 ELISA 72 hours after addition of samples to a HeLa line with an integrated provirus lacking Tat. Figure 3 shows the N-terminal responses in representative HTV-1 infected individuals from the placebo (P) group, the Tat toxoid group (TT), and the toxoid plus alum group (TTA). Reactivity to B clade linear peptides (1-3), C clade linear peptides (4-5), a scrambled peptide (6), and whole Tat protein (Tat) were measured by ELISA.

Figure 4 shows responses to the basic domain signature sequence in representative HIV-1 infected individuals from the placebo (P) group, the Tat toxoid group (TT), and the toxoid plus alum group (TTA). Reactivity to B clade linear peptides (19-21), C clade linear peptides (22- 23), a scrambled peptide (24), and whole Tat protein (Tat) were measured by ELISA.

Figure 5 is a blot illustrating restriction digest products showing approximate size of the TG and GT inserts.

Figure 6 is a blot showing antibody binding to Tat in the Tat-gag band lane.

Figure 7 shows additional sequences of other epitopes that are also applicable for including in a Tat-Gag fusion protein of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

The present inventors discovered that antibodies recognizing mainly conformational determinants or Tat proteins are cross-reactive between different HTV clades but poorly neutralizing. Antisera that bind preferentially to Tat linear epitopes are less cross-reactive but more strongly neutralizing. Thus, the present invention relates to the use of an epitope peptide approach to create new Tat immunogens. Such an approach may overcome key obstacles to the development of Tat vaccines, including the substantial difficulty of manufacturing high purity, high activity Tat protein and concerns about the safety of a biologically active product that is thought to have immunosuppressive functions, hi addition, the use of epitope peptides affords the possibility of increasing the relative level of antibodies against minor epitopes.

Concentrating on serum antibody responses against Tat is important because it is believed that the most important effect of a Tat vaccine is to neutralize the effects of soluble Tat that include suppression of immune responses to HTV structural antigens. If blocking of the portion of immune suppression due to soluble Tat is achievable, then the magnitude and duration of protective immune responses targeting structural antigens can be increased. In order to facilitate review of the various embodiments of the invention and provide an understanding of the various elements and constituents used in making and using the present invention, the following terms used in the invention description have the following meanings.

Definitions

A method of treating a viral infection is meant herein to include "prophylactic" treatment or "therapeutic" treatment. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or who exhibits early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease.

The term "therapeutic," as used herein, means a treatment administered to a subject who exhibits signs of pathology for the purpose of diminishing or eliminating those signs.

The term "therapeutically effective amount," as used herein means an amount of compound that is sufficient to provide a beneficial effect to the subject to which the compound is administered. A beneficial effect means rendering a virus incompetent for replication, inhibition of viral replication, inhibition of infection of a further host cell, or increasing CD4 T-cell count, for example.

The term "specific binding," as used herein, in reference to the interaction of an antibody and a protein or peptide, means that the interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope) on the protein; in other words, the antibody is recognizing and binding to a specific protein structure rather than to proteins in general.

The term "antibody,"as used herein, means intact molecules as well as fragments thereof, such as Fa, F(ab')₂, and Fv, which are capable of binding the epitopic determinant.

The terms "peptide," "polypeptide" and "protein," as used herein, are used interchangeably to denote a sequence polymer of at least two amino acids covalently linked by an amide bond.

The term "homologous," as used herein, refers to amino acid sequence similarity between two peptides. When an amino acid position in both of the peptides is occupied by identical amino acids, they are homologous at that position. Thus by "substantially homologous" means an amino acid sequence that is largely, but not entirely, homologous, and which retains most or all of the activity as the sequence to which it is homologous. As used herein, "substantially homologous" as used herein means that a sequence is at least 50% identical, and preferably at least 75% and more preferably 95% homology to the reference peptide.

I. The Invention

The present invention provides DNA segments, purified polypeptides, methods for obtaining antibodies, methods of cloning and using recombinant host cells necessary to obtain and use recombinant Tat amino terminus linear epitope peptides of the present invention, optionally conjugate to a viral carrier protein.

II. Polynucleotides

A. Isolated and Purified Polynucleotides That Encode Tat Amino Terminus Linear Epitope Peptides and Conjugates Thereof.

ha one aspect, the present invention provides an isolated and purified polynucleotide that encodes a Tat amino terminus linear epitope peptide. As used herein, the term "polynucleotide" means a sequence of nucleotides connected by phosphodiester linkages. Polynucleotides are presented herein in the direction from the 5' to the 3' direction. A polynucleotide of the present invention can be a deoxyribonucleic acid (DNA) molecule or ribonucleic acid (RNA) molecule. Where a polynucleotide is a DNA molecule, that molecule can be a gene or a cDNA molecule. Nucleotide bases are indicated herein by a single letter code: adenine (A), guanine (G), thymine (T), cytosine (C), inosine (I) and uracil (U).

A polynucleotide of the present invention can be prepared using standard techniques well known to one of skill in the art. The preparation of a cDNA molecule encoding a Tat amino terminus linear epitope peptide of the present invention is described hereinafter.

The present invention provides an isolated and purified polynucleotide that encodes a Tat amino terminus linear epitope peptide, where the polynucleotide is prepared by a process comprising the steps of constructing a library of cDNA clones from a cell that expresses the polypeptide; screening the library with a labeled cDNA probe prepared from RNA that encodes the polypeptide; and selecting a clone that hybridizes to the probe.

B. Probes and Primers hi another aspect, DNA sequence information provided by the present invention allows for the preparation of relatively short DNA (or RNA) sequences having the ability to specifically hybridize to gene sequences of the selected polynucleotide disclosed herein. In these aspects, nucleic acid probes of an appropriate length are prepared based on a consideration of a selected nucleotide sequence. The ability of such nucleic acid probes to specifically hybridize to a polynucleotide encoding a Tat amino terminus linear epitope peptide lends them particular utility in a variety of embodiments. Most importantly, the probes can be used in a variety of assays for detecting the presence of complementary sequences in a given sample. i certain embodiments, it is advantageous to use oligonucleotide primers. The sequence of such primers is designed using a polynucleotide of the present invention for use in detecting, amplifying or mutating a defined segment of a gene or polynucleotide that encodes a Tat amino terminus linear epitope peptide of the present invention from mammalian cells using PCR technology.

To provide certain of the advantages in accordance with the present invention, a preferred nucleic acid sequence employed for hybridization studies or assays includes probe molecules that are complementary to at least a 5 to 15 nucleotide stretch of a polynucleotide that encodes a Tat amino terminus linear epitope peptide. A size of at least 10 nucleotides in length helps to ensure that the fragment will be of sufficient length to form a duplex molecule that is both stable and selective. Molecules having complementary sequences over stretches greater than 10 bases in length are generally preferred, though, in order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of specific hybrid molecules obtained. Such fragments can be readily prepared by, for example, directly synthesizing the fragment by chemical means, by application of nucleic acid reproduction technology, such as the PCR or by excising selected DNA fragments from recombinant plasmids containing appropriate inserts and suitable restriction enzyme sites.

Accordingly, a polynucleotide probe molecule of the invention can be used for its ability to selectively form duplex molecules with complementary stretches of the gene. Depending on the application envisioned, one will desire to employ varying conditions of hybridization to achieve varying degree of selectivity of the probe toward the target sequence. For applications requiring a high degree of selectivity, one will typically desire to employ relatively stringent conditions to form the hybrids. For example, one will select relatively low salt and/or high temperature conditions, such as provided by 0.02M-0.15M NaCl at temperatures of 50 °C to 70 °C. Those conditions are particularly selective, and tolerate little, if any, mismatch between the probe and the template or target strand.

Of course, for some applications, for example, where one desires to prepare mutants employing a mutant primer strand hybridized to an underlying template or where one seeks to isolate a peptide coding sequence from other cells, functional equivalents, or the like, less stringent hybridization conditions are typically needed to allow formation of the heteroduplex. In these circumstances, one can desire to employ conditions such as 0.15M-0.9M salt, at temperatures ranging from 20 °C to 70 °C. Cross-hybridizing species can thereby be readily identified as positively hybridizing signals with respect to control hybridizations. In any case, it is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide, which serves to destabilize the hybrid duplex in the same manner as increased temperature. Thus, hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results.

In certain embodiments, it is advantageous to employ a polynucleotide of the present invention in combination with an appropriate label for detecting hybrid formation. A wide variety of appropriate labels are known in the art, including radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal.

In general, it is envisioned that a hybridization probe described herein is useful both as a reagent in solution hybridization as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed nucleic acid is then subjected to specific hybridization with selected probes under desired conditions. The selected conditions depend as is well known in the art on the particular circumstances and criteria required (e.g., on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe). Following washing of the matrix to remove non specifically bound probe molecules, specific hybridization is detected, or even quantified, by means of the label.

III. A Tat Linear Epitope/Gag Peptide

In one embodiment, the present invention contemplates isolated and purified Tat linear epitope/Gag peptides. Polypeptides are disclosed herein as amino acid residue sequences. Those sequences are written left to right in the direction from the amino to the carboxyl terminus. In accordance with standard nomenclature, amino acid residue sequences are denominated by either a single letter or a three letter code as indicated below. Amino Acid Residue 3 -Letter Code 1 -Letter Code Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic Acid Asp D Cysteine Cys C Glutamine Gin Q Glutamic Acid Glu E Glycine Gly G Histidine His H Isoleucine He I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp w Tyrosine Tyr Y Valine Val V

Modifications and changes can be made in the structure of a polypeptide of the present invention and still obtain a molecule having Tat amino terminus linear epitope peptide like characteristics. For example, certain amino acids can be substituted for other amino acids in a sequence without appreciable loss of peptide activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide 's biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a polypeptide with like properties.

In making such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art (Kyte, J. and R. F. Doolittle 1982). It is believed that the relative hydropathic character of the amino acid determines the secondary structure of the resultant polypeptide, which in turn defines the interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a similar hydropathic index and still obtain a functionally equivalent polypeptide. In such changes, the substitution of amino acids whose hydropathic indices are within .+-.2 is preferred, those that are within .+-.1 are particularly preferred, and those within .+-.0.5 are even more particularly preferred.

Substitution of like amino acids can also be made on the basis of hydrophilicity, particularly where the biological functional equivalent polypeptide or peptide thereby created is intended for use in immunological embodiments. U.S. Pat. No. 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a polypeptide, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the polypeptide. It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent polypeptide. In such changes, the substitution of amino acids whose hydrophilicity values are within .+-.2 is preferred, those that are within .+-.1 are particularly preferred, and those within .+-.0.5 are even more particularly preferred.

As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine (See Table 1, below). The present invention thus contemplates functional or biological equivalents of a peptide as set forth above.

TABLE 1 Original Residue Exemplary Substitutions Ala Gly; Ser Arg Lys Asn Gin; His Asp Glu Cys Ser Gin Asn Glu Asp Gly Ala His Asn; Gin lie Leu; Val Leu lie; Val Lys Arg Met Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val fie; Leu

Biological or functional equivalents of a polypeptide can also be prepared using site-specific mutagenesis. Site-specific mutagenesis is a technique useful in the preparation of second generation polypeptides, or biologically functional equivalent polypeptides or peptides, derived from the sequences thereof, through specific mutagenesis of the underlying DNA. As noted above, such changes can be desirable where amino acid substitutions are desirable. The technique further provides a ready ability to prepare and test sequence variants, for example, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed.

hi general, the technique of site-specific mutagenesis is well known in the art, as exemplified by Adelman et al., (1983). As will be appreciated, the technique typically employs a phage vector, which can exist in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage (Messing et al., 1981). These phage are commercially available and those of skill in the art generally know their use.

hi general, site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector which includes within its sequence a DNA sequence which encodes all or a portion of the Tat amino terminus linear epitope peptide sequence selected. An oligonucleotide primer bearing the desired mutated sequence is prepared and annealed to the singled-stranded vector, and extended by the use of enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells such as E. coli cells and clones are selected which include recombinant vectors bearing the mutation. Commercially available kits come with all the reagents necessary, except the oligonucleotide primers.

A polypeptide of the present invention is prepared by standard techniques well known to those skilled in the art. Such techniques include, but are not limited to, isolation and purification from tissues known to contain that polypeptide, expression from cloned DNA that encodes such a polypeptide using transformed cells or use of synthetic peptide production systems.

TV. Expression Vectors

The present invention provides expression vectors comprising polynucleotide that encode Tat linear epitope/Gag peptides of the present invention. Preferably, expression vectors of the present invention comprise polynucleotides that encode polypeptides comprising the amino terminus epitope peptides of the present invention.

The nucleotide sequences may be operatively linked to an enhancer-promoter. As used herein, the term "promoter" includes what is referred to in the art as an upstream promoter region, a promoter region or a promoter of a generalized eukaryotic RNA Polymerase TJ transcription unit.

Another type of discrete transcription regulatory sequence element is an enhancer. An enhancer provides specificity of time, location and expression level for a particular encoding region (e.g., gene). A major function of an enhancer is to increase the level of transcription of a coding sequence in a cell that contains one or more transcription factors that bind to that enhancer. Unlike a promoter, an enhancer can function when located at variable distances from transcription start sites so long as a promoter is present.

As used herein, the phrase "enhancer-promote" means a composite unit that contains both enhancer and promoter elements. An enhancer-promoter is operatively linked to a coding sequence that encodes at least one gene product. As used herein, the phrase "operatively linked" means that an enhancer-promoter is connected to a coding sequence in such a way that the transcription of that coding sequence is controlled and regulated by that enhancer-promoter. Means for operatively linking an enhancer-promoter to a coding sequence are well known in the art. As is also well known in the art, the precise orientation and location relative to a coding sequence whose transcription is controlled, is dependent inter alia upon the specific nature of the enhancer-promoter.

An expression vector may include a Tat linear epitopeGag peptide coding regions or coding regions bearing selected alterations or modifications in the specific coding region of the Tat linear epitope/Gag peptide. Exemplary vectors include the mammalian expression vectors of the pCMV family including pCMV6b and pCMV6c (Chiron Corp., Emeryville Calif.) and pRc/CMV and pCR 2.1 Topo ( ivitrogen, San Diego, Calif.).

A DNA molecule of the present invention can be incorporated into a vector using a number of techniques that are well known in the art. For instance, the vector pUC18 has been demonstrated to be of particular value. Likewise, the related vectors M13mpl8 and M13mpl9 can be used in certain embodiments of the invention, in particular, in performing dideoxy sequencing. An expression vector of the present invention is useful both as a means for preparing quantities of a Tat linear epitope peptide-encoding DNA itself, and as a means for preparing the encoded peptides. It is contemplated that where Tat amino terminus linear epitope peptides of the invention are made by recombinant means, one can employ either prokaryotic or eukaryotic expression vectors as shuttle systems. Such a system is described herein which allows the use of bacterial host cells as well as eukaryotic host cells.

Where expression of recombinant polypeptide of the present invention is desired and a eukaryotic host is contemplated, it is most desirable to employ a vector, such as a plasmid, that incorporates a eukaryotic origin of replication. Additionally, for the purposes of expression in eukaryotic systems, one desires to position the Tat linear epitope/Gag peptide encoding sequence adjacent to and under the control of an effective eukaryotic promoter. To bring a coding sequence under control of a promoter, whether it is eukaryotic or prokaryotic, what is generally needed is to position the 5' end of the translation initiation side of the proper translational reading frame of the polypeptide between about 1 and about 50 nucleotides 3' of or downstream with respect to the promoter chosen. Furthermore, where eukaryotic expression is anticipated, one would typically desire to incorporate into the transcriptional unit, which includes the Tat linear epitope/Gag peptide, an appropriate polyadenylation site.

The pRc/CMV vector (available from hivitrogen) is an exemplary vector for expressing a Tat linear epitope/Gag peptide in mammalian cells, particularly COS and CHO cells. A polypeptide of the present invention under the control of a CMV promoter can be efficiently expressed in mammalian cells. The pCMV plasmids are a series of mammalian expression vectors of particular utility in the present invention. The vectors are designed for use in essentially all cultured cells and work extremely well in SV40-transformed simian COS cell lines. The pCMVl, 2, 3, and 5 vectors differ from each other in certain unique restriction sites in the polylinker region of each plasmid. The pCMV4 vector differs from these 4 plasmids in containing a translation enhancer in the sequence prior to the polylinker. While they are not directly derived from the pCMVl-5 series of vectors, the functionally similar pCMV6b and c vectors are available from the Chiron Corp. of Emeryville, Calif, and are identical except for the orientation of the polylinker region which is reversed in one relative to the other. The pCMV vectors have been successfully expressed in simian COS cells, mouse L cells, CHO cells, and HeLa cells.

V. Transfected Cells In yet another embodiment, the present invention provides recombinant host cells transformed or transfected with a polynucleotide that encodes a Tat linear epitope/Gag peptide. Means of transforming or transfecting cells with exogenous polynucleotide such as DNA molecules are well known in the art and include techniques such as calcium-phosphate- or DEAE-dextran mediated transfection, protoplast fusion, electroporation, liposome mediated transfection, direct microinjection and adenovirus infection.

The most widely used method is transfection mediated by either calcium phosphate or DEAE- dextran. Although the mechanism remains obscure, it is believed that the transfected DNA enters the cytoplasm of the cell by endocytosis and is transported to the nucleus. Depending on the cell type, up to 90% of a population of cultured cells can be transfected at any one time. Because of its high efficiency, transfection mediated by calcium phosphate or DEAE-dextran is the method of choice for experiments that require transient expression of the foreign DNA in large numbers of cells. Calcium phosphate-mediated transfection is also used to establish cell lines that integrate copies of the foreign DNA, which are usually arranged in head-to-tail tandem arrays into the host cell genome.

The application of brief, high- voltage electric pulses to a variety of mammalian and plant cells leads to the formation of nanometer-sized pores in the plasma membrane. DNA is taken directly into the cell cytoplasm either through these pores or as a consequence of the redistribution of membrane components that accompanies closure of the pores. Electroporation can be extremely efficient and can be used both for transient expression of cloned genes and for establishment of cell lines that carry integrated copies of the gene of interest. Electroporation, in contrast to calcium phosphate-mediated transfection and protoplast fusion, frequently gives rise to cell lines that carry one, or at most a few, integrated copies of the foreign DNA.

Liposome transfection involves encapsulation of DNA and RNA within liposomes, followed by fusion of the liposomes with the cell membrane. The mechanism of how DNA is delivered into the cell is unclear but transfection efficiencies can be as high as 90%.

Direct microinjection of a DNA molecule into nuclei has the advantage of not exposing DNA to cellular compartments such as low-pH endosomes. Microinjection is therefore used primarily as a method to establish lines of cells that carry integrated copies of the DNA of interest.

In another aspect, the recombinant host cells of the present invention are prokaryotic host cells. Preferably, the recombinant host cells of the invention are bacterial cells of Escherichia coli. hi general, prokaryotes are preferred for the initial cloning of DNA sequences and constructing the vectors useful in the present invention. For example, E. coli K12 strains can be particularly useful. Other microbial strains that can be used include E. coli B, and E. coli XI 776 (ATCC No. 31537). These examples are, of course, intended to be illustrative rather than limiting.

In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli can be transformed using pBR322, a plasmid derived from an E. coli species. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR plasmid, or other microbial plasmid or phage must also contain, or be modified to contain, promoters which can be used by the microbial organism for expression of its own polypeptides.

Those promoters most commonly used in recombinant DNA construction include the beta.- lactamase (penicillinase) and lactose promoter systems and a tryptophan (TRP) promoter system. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling a skilled worker to introduce functional promoters into plasmid vectors.

In addition to microorganisms, cultures of cells derived from multicellular organisms can also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years. Examples of such useful host cell lines are AtT-20, VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COSM6, COS-1, COS-7, 293 and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located upstream of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences.

VI. Preparing A Tat Linear Epitope/Gag Peptide

Regulatory Polypeptide

In yet another embodiment, the present invention contemplates a process of preparing a Tat linear epitope/Gag peptide comprising transfecting cells with a polynucleotide that encodes a Tat linear epitope/Gag peptide to produce transformed host cells; and maintaining the transformed host cells under biological conditions sufficient for expression of the polypeptide. As stated above, the transformed host cells may be eukaryotic cells are prokaryotic cells. Following transfection, the cell is maintained under culture conditions for a period of time sufficient for expression of the Tat linear epitope/Gag peptide. Culture conditions are well known in the art and include ionic composition and concentration, temperature, pH and the like. Typically, transfected cells are maintained under culture conditions in a culture medium. Suitable medium for various cell types are well known in the art. In a preferred embodiment, temperature is from about 20 °C to about 50 °C. pH is preferably from about a value of 6.0 to a value of about 8.0, more preferably from about a value of about 6.8 to a value of about 7.8 and, most preferably about 7.4. Other biological conditions needed for transfection and expression of an encoded protein are well known in the art.

Transfected cells are maintained for a period of time sufficient for expression of the Tat linear epitope/Gag peptide. A suitable time depends inter alia upon the cell type used and is readily determinable by a skilled artisan. Typically, maintenance time is from about 2 to about 14 days.

The recombinant Tat linear epitope/Gag peptide is recovered or collected either from the transfected cells or the medium in which those cells are cultured. Recovery comprises isolating and purifying the recombinant polypeptide. Isolation and purification techniques for polypeptides are well known in the art and include such procedures as precipitation, filtration, chromatography, electrophoresis and the like.

VII. Antibodies

h still another embodiment, the present invention provides for antibodies, either polyclonal or monoclonal that are immunoreactive with Tat linear epitope peptides alone or linked to the Gag protein of the present invention. Means for preparing and characterizing antibodies are well known in the art.

Briefly, a polyclonal antibody is prepared by immunizing an animal with an immunogen comprising a polypeptide or polynucleotide of the present invention, and collecting antisera from that immunized animal. A wide range of animal species can be used for the production of antisera. Typically an animal used for production of anti-antisera is a rabbit, a mouse, a rat, a hamster or a guinea pig. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies. As is well known in the art, a given polypeptide or polynucleotide may vary in its immunogenicity. It is often necessary therefore to couple the immunogen (e.g., a polypeptide or polynucleotide) of the present invention) with a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide or a polynucleotide to a carrier protein are well known in the art and include glutaraldehyde, M maleimidobenzoyl-n-hydroxysuccinimide ester, carbodiimide and bis-biazotized benzidine.

As is also well known in the art, immunogenicity to a particular immunogen can be enhanced by the use of non specific stimulators of the immune response known as adjuvants. Exemplary and preferred adjuvants include complete Freund's adjuvant, incomplete Freund's adjuvants and aluminum hydroxide adjuvant.

The amount of immunogen used of the production of polyclonal antibodies varies inter alia, upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal. The production of polyclonal antibodies is monitored by sampling blood of the immunized animal at various points following immunization. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored.

Typically, a monoclonal antibody of the present invention can be readily prepared by a technique which involves first immunizing a suitable animal with a selected antigen (e.g., a polypeptide or polynucleotide of the present invention) in a manner sufficient to provide an immune response. Rodents such as mice and rats may be used. Spleen cells from the immunized animal are then fused with cells of an immortal myeloma cell. Where the immunized animal is a mouse, a preferred myeloma cell is a murfne NS-1 myeloma cell.

The fused spleen/myeloma cells are cultured in a selective medium to select fused spleen/myeloma cells from the parental cells. Fused cells are separated from the mixture of non fused parental cells, for example, by the addition of agents that block the de novo synthesis of nucleotides in the tissue culture media. Exemplary and preferred agents are aminopterin, methofrexate, and azaserine. Aminopterin and methofrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purfne synthesis. Where aminopterin or methofrexate is used, the media is supplemented with hypoxanthine and thymidine as a source of nucleotides. Where azaserine is used, the media is supplemented with hypoxanthine. This culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in icroliter plates, followed by testing the individual clonal supernatants for reactivity with an antigen polypeptide. The selected clones can then be propagated indefinitely to provide the monoclonal antibody.

By way of specific example, to produce an antibody of the present invention, mice or rabbits are injected infraperitoneally with between about 1-200 ug of an antigen comprising a polypeptide of the present invention. B lymphocyte cells are stimulated to grow by injecting the antigen in association with an adjuvant such as complete Freund's adjuvant. At some time (e.g., at least two weeks) after the first injection, the mice or rabbits are boosted by injection with a second dose of the antigen mixed with incomplete Freund's adjuvant. A few weeks after the second injection, mice are tail bled and the sera titered by immunoprecipitation against radiolabeled antigen. Preferably, the process of boosting and titering is repeated until a suitable titer is achieved. The spleen of the mouse or rabbit with the highest titer is removed and the spleen lymphocytes are obtained by homogenizing the spleen with a syringe. Typically, a spleen from an immunized animal contains approximately 5 X 10 ⁷ to 2 X 10 ⁸ lymphocytes.

Mutant lymphocyte cells known as myeloma cells are obtained from laboratory animals in which such cells have been induced to grow by a variety of well-known methods. Myeloma cells lack the salvage pathway of nucleotide biosynthesis. Because myeloma cells are tumor cells, they can be propagated indefinitely in tissue culture, and are thus denominated immortal. Numerous cultured cell lines of myeloma cells from mice and rats, such as murine NS-1 myeloma cells, have been established.

Myeloma cells are combined under conditions appropriate to foster fusion with the normal antibody-producing cells from the spleen of the mouse or rat injected with the antigen/polypeptide of the present invention. Fusion conditions include, for example, the presence of polyethylene glycol. The resulting fused cells are hybridoma cells. Like myeloma cells, hybridoma cells grow indefinitely in culture. Hybridoma cells are separated from unfused myeloma cells by culturing in a selection medium such as HAT media (hypoxanthine, aminopterin, thymidine). Unfused myeloma cells lack the enzymes necessary to synthesize nucleotides from the salvage pathway because they are killed in the presence of aminopterin, methofrexate, or azaserine. Unfused lymphocytes also do not continue to grow in tissue culture. Thus, only cells that have successfully fused (hybridoma cells) can grow in the selection media. Each of the surviving hybridoma cells produces a single antibody. These cells are then screened for the production of the specific antibody immunoreactive with an antigen/polypeptide of the present invention. Single cell hybridomas are isolated by limiting dilutions of the hybridomas. The hybridomas are serially diluted many times and, after the dilutions are allowed to grow, the supernatant is tested for the presence of the monoclonal antibody. The clones producing that antibody are then cultured in large amounts to produce an antibody of the present invention in convenient quantity.

By use of a monoclonal antibody of the present invention, specific polypeptides of the invention can be recognized as antigens, and thus identified. Once identified, those polypeptides can be isolated and purified by techniques such as antibody-affinity chromatography. hi antibody- affinity chromatography, a monoclonal antibody is bound to a solid substrate and exposed to a solution containing the desired antigen. The antigen is removed from the solution through an immunospecific reaction with the bound antibody. The polypeptide is then easily removed from the substrate and purified.

Vπi. Pharmaceutical Compositions

In a preferred embodiment, the present invention provides pharmaceutical compositions comprising at least one Tat linear epitope/Gag peptide of the present invention and a physiologically acceptable carrier. More preferably, a pharmaceutical composition comprises a Tat amino terminus linear epitope peptide conjugated Gag, as described herein.

In the alternative, the pharmaceutical composition of the invention may comprise a polynucleotide that encodes a Tat linear epitope peptide of the present invention linked to a nucleotide sequence encoding an HTV viral protein in a physiologically acceptable carrier.

The HTV viral carrier protein may include, but is not limited to the gag, env, nef proteins or fragments thereof, and more preferably the carrier protein is gag.

A composition of the present invention is typically administered parenterally in dosage unit formulations containing standard, well-known nontoxic physiologically acceptable carriers, adjuvants, and vehicles as desired. The term parenteral as used herein includes intravenous, intramuscular, intraarterial injection, or infusion techniques. Injectable preparations, for example sterile injectable aqueous or oleaginous suspensions, are formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.

Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution, hi addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of inj ectables .

The compositions of the invention are administered in substantially non toxic dosage concentrations sufficient to ensure the release of a sufficient dosage unit of the present peptides into the patient to provide the desired inhibition of Tat into the T cells. The actual dosage administered will be determined by physical and physiological factors such as age, body weight, severity of condition, and/or clinical history of the patient.

Further, the therapeutic compositions according to the present invention may be employed in combination with other-therapeutic agents for the treatment of viral infections or conditions. Examples of such additional therapeutic agents include agents that are effective for the treatment of viral infections or associated conditions such as immunomodulatory agents such as thymosin, ribonucleotide reductase inhibitors such as 2-acetylpyridine 5-[(2-chloroanilino) thiocarbonyl) thiocarbonohydrazone, interferons such as alpha -interferon, 1- beta -D-arabinofuranosyl-5-(l- propynyι)uracil, 3'-azido-3'-deoxythymidine, ribavirin and phosphonoformic acid.

LX. Screening Assays

hi yet another aspect, the present invention contemplates a process of screening for cross-reactive antibodies that interact with different clades of HIV, the process comprising the steps of providing a Tat linear epitope peptide of the present invention and testing the ability of antisera to interact with that peptide.

Screening assays of the present invention generally involve determining the ability of antibodies in antisera to bind to the peptide. The peptides of the present invention can be coupled to a solid support. The solid support can be agarose beads, polyacrylamide beads, polyacrylic beads or other solid matrices capable of being coupled to proteins. Well known coupling agents include cyanogen bromide, carbonyidiimidazole, tosyl chloride, and glutaraldebyde.

hi a typical screening assay for identifying antibodies in antisera for Tat amino terminus linear epitope peptides, one employs an amount of an amino terminus linear epitope peptide in an appropriate assay buffer at an appropriate pH. The antisera is added to the admixture in convenient concentrations and any interaction between antibodies and the peptide is monitored.

Accordingly, it is proposed that this aspect of the present invention provides those of skill in the art with methodology to measure the proportion of serum antibodies that bind Tat amino terminus linear epitope peptides. Antisera is mixed with Tat amino terminus linear epitope peptides of the present invention and is then transferred to an ELISA with Tat protein. If the antisera contain antibodies that bind linear epitopes, the preincubation with the Tat amino terminus linear epitope peptides of the present invention will reduce binding to the Tat protein.

In the alternative, antibodies specific for Tat amino terminus linear epitope peptides of the present invention may be used in assays for the detection of HTV-1 tat protein. Further these specific antibodies can be administered to a patient to neutralize soluble Tat in an HTV infected patient.

X. Assay Kits

hi another aspect, the present invention contemplates diagnostic assay kits for detecting the presence of antibodies specific for Tat amino terminus linear epitope peptides of the present invention in biological samples, where the kits comprise a first container containing at least one Tat amino terminus linear epitope peptide capable of immunoreacting with antibodies in biological samples, in an amount sufficient to perform at least one assay. Preferably, assay kits of the invention further comprise a second container containing a second antibody that immunoreacts with the first antibody.

The following examples are illustrative of synthetic procedures that may be advantageously utilized to make compounds of the present invention.

Example 1

Four healthy rhesus macaques were immunized by infradermal and intramuscular injection of Tat toxoid, prepared according to regime set forth in reference (30). The Tat Toxoid antigen doses ranged from 20-60μg protein for each injection. Sera were collected 8-12 days after the last immunization and stored at -130°C until used.

A competition binding assay was established that used soluble peptides to compete with whole Tat antigen on the plate, to measure the proportion of antibodies that bind the linear amino terminus epitope peptide. Also, peptides for a second major epitope (basic region, aa 57-60) were tested to determine if they compete with full-length Tat antigen for serum antibody binding.

Lastly, the two peptides were combined to determine if they competed for antibody binding to

Tat protein. Specifically, dilutions of sera from Tat-immunized rhesus macaques (1:100- 1:100,000) were incubated with 50 μg/mL of peptide (N-terminal peptide;

MEPVDPRLEPWKHPGSQPKT (SEQ ID NO: 9), basic domain peptide;

SYGSKKRRQRRRPPQDNQTH (SEQ ID NO: 10), scrambled N-terminal peptide;

DPGTVEPKPLHPERKQMPWS (SEQ ID NO: 11), or scrambled basic domain peptide;

QKRHRQHTGRAQYRSRSKRN (SEQ ID NO: 12)) for 30 minutes before the serum/peptide mix was added to the Tat coated plate. Unbound antibodies were removed by washing.

Secondary antibody incubation and color development were the same as for the standard ELISA as set forth below.

Peptides (1 μg/well) or 86 amino acid Tat protein (kindly provided by Aventis Pasteur, Inc. Toronto, Canada) at 100 ng/well, were adsorbed to ELISA plates (Costar, Cambridge, MA) by overnight incubation at 4°C in 100 niM carbonate buffer, pH 9.5. The coated plates were washed and then treated with 50 rnM Tris HC1, pH 7.8, 0.15M NaCl, 0.05% Tween 20, 1% bovine serum albumin (ELISA buffer). The wells were filled with monoclonal antibody solution at 0.5μg/mL or monkey serum diluted in ELISA buffer, and incubated for one hour. After four washes with ELISA buffer, secondary antibodies (anti-mouse IgG-alkaline phosphatase conjugate for the monoclonal antibody samples, and anti-monkey IgG alkaline phosphate conjugate for the monkey serum samples) were added for one hour at a 1:5,000 dilution. After four more washes, PNPP substrate solution was added and plates were incubated at 37°C for 30 minutes before the optical density was measured at 405nm. The baseline was determined for BSA-coated wells without peptide or Tat, that were overlayed with each serum dilution. Positive wells in the ELISA had A405nm values > 2 standard deviations above the mean of background wells after subtracting the mean background values. Peptide competition assay: 100 ng of an 86 amino acid Tat protein (Aventis Pasteur) were incubated overnight at 4°C to bind this protein to plastic, 96 well assay plates. It was found that in all four animals, preincubating sera with a N-terminal peptide matched to the immunogen sequence, abrogated most of the antibody binding to Tat protein on the plate (Figures 1 A, B, C and D). The basic peptide alone had a lesser capacity to block antibody binding. When the amino terminus and basic region epitope peptides were combined, serum antibody binding to Tat protein was virtually eliminated. Scrambled (control) peptides having the same composition but with different sequences, did not compete for antibody binding to Tat. Serum antibodies to a linear N-terminus region comprised the dominant response in immunized rhesus macaques and together with a sub-dominant basic region epitope, account for nearly all of macaque antibody responses to Tat linear epitopes.

Example 2

Fine mapping of amino terminus epitopes with monoclonal antibodies The N-terminus epitope was fine mapped using two mouse monoclonal antibodies against Tat. TRl (41) and C3.2.D7 (11) antibodies were tested on a peptide array where each peptide was modified by the substitution of three sequential alanines for the immunogen sequence. The TRl murine monoclonal antibody was derived in the present inventors laboratory (41). The C3.2.D7 murine monoclonal antibody was isolated in the laboratory of Prof. Chandra (11). Both antibodies are of the IgG2a isotype, they bind Tat protein at the amino terminus epitope, and both neutralize Tat transactivation. A peptide array was used for fine mapping of the N-terminal antibody response and included the N-terminal clade B 15-mer, along with five peptides generated by sequentially substituting three amino acids at a time with alanine residues. Control (Tat sequence): MEPVDPRLEPWKHPG (SEQ ID NO: 13). First substitution: AAAVDPRLEPWKHPG (SEQ ID NO: 14). Second substitution: MEPAAARLEPWKHP (SEQ ID NO: 15). Third substitution: MEPVDPAAAPWKHPG (SEQ ID NO: 16). Fourth substitution: MEPVDPRLEAAAHPG (SEQ ID NO: 17). Fifth substitution:

MEPVDPRLEPWKAAA (SEQ ED NO: 18). It was found that substitution of the first three amino acids with alanine did not affect binding for either of the monoclonal antibodies. Substitution of the second "triplet" abrogated peptide binding by the TRl antibody, but did not affect binding of C3.2.D7. Neither monoclonal antibody was able to bind when the third triplet of amino acids was replaced with alanines. However, some reactivity of the TRl antibody but not the C3.2.D7 antibody, was observed when the fourth triplet was substituted. Peptides substituted at the fifth triplet were bound by both antibodies. For the TRl monoclonal antibody, amino acid 10 residues 4-9 were most important for binding to the peptide epitope; for C3.2.D7, residues 7-12 were most important as shown in Table 1A. Table 1A

Results of the alanine scan peptide array are shown in Table 2A.

Table 2A

1 : 100 dilutions of sera from all four macaques reacted strongly with whole Tat protein and to the clade B amino terminus epitope peptide. Alanine substitutions for amino acids 4, 5, and 6 reduced binding with sera from two animals (95011 and 96061). However, binding for all sera were reduced by alanine substitutions of amino acids 7-9 or 10-12, showing that positions 7-12 are critical for antibody recognition of the Tat amino terminus. When these positions were altered, binding was reduced to baseline levels. When the final three amino acids in the 15mer were substituted with alanine, the binding was not affected. This pattern mimicked the performance of murine monoclonal antibodies and confirmed the importance of amino acids 4-12 for macaque serum antibody binding to the N-terminus of Tat.

These studies indicate the presence of at least two overlapping, linear antibody epitopes within the N-terminal fifteen amino acids of the Tat protein. Results of the peptide scan (Table IB) showed that both of these amino acid positions were critical for monoclonal antibody binding.

Table IB

Within the region important for binding these monoclonal antibodies (amino acids 4-12), there were frequent substitutions at two positions, amino acids 7 and 12. Substitutions at position 7 abrogated binding of the TRl monoclonal antibody and substitutions at position 12 abrogated binding of the C3.2.D7 antibody. It was noted that amino acids 7 and 12 are highly variable in Tat sequences (19, 41). Macaque sera and monoclonal antibodies recognize similar N-terminus epitopes.

hi order to define individual amino acids that impacted monoclonal antibody binding, an array of peptides was used with amino acid substitutions reflecting natural variation in the Tat N- terminus. The specificity of immune macaque sera was tested further by binding to peptides that were systematically altered, sera were diluted and tested.

Three clade B and two clade C peptides were used, as well as a scrambled control peptide. Specifically the peptide array contained five N-terminal 20-mers: three represent Clade B Tat sequences, two are a Clade C sequences (B.-.NL43E9: MEPVDPRLEPWKHPGSQPKT (SEQ ID NO: 19), B.AU.MBCD36: MEPVDPKLEPWKHPGSQPRT (SEQ ID NO: 20), B.US.SF2 MEPVDPNLEPWKHPGSQPRT (SEQ ID NO: 21), Consensus C

MEPVDPNLEPWNHPGSQPKT (SEQ ID NO: 22), and C.BW.96BW17 MDPVDPSLEPWNHPGSQPKT (SEQ ID NO: 23), Los Alamos HTV database). A sixth, negative control peptide (DPGTVEPKPLHPERKQMPWS (SEQ ID NO: 24)) was generated by randomly scrambling the 20 N-terminal amino acids from the consensus clade B sequence so that no sequence of three amino acids or longer in the scrambled peptide matched any of the other five corresponding peptide sequences. Peptides were synthesized using Fmoc chemistry with HATU/DEEA activation at the Biopolymer Core Facility, Department of Microbiology and Immunology, University of Maryland School of Medicine.

At a 1 : 1000 dilution, differences in reactivity were observed (Table 2B).

Table 2B

Each serum bound the clade B (immunogen) peptide. Two distinct patterns were observed for binding to variant N-terminal peptides. Sera from two macaques (95011 and 96032) had higher binding to a peptide matching the immunogen compared to other clade B or consensus clade C sequences. Despite having some binding to all Tat sequences, the highest binding was to the clade B immunogen sequence. The remaining two macaques (95042 and 96061) had lower binding to heterologous N-terminal sequences, but overall had higher reactivity to clade B than to clade C sequences.

To further investigate the differences in reactivity, endpoint tifrations were done for the two macaques with the highest reactivity to Tat (95011 and 96032). These data show that amino acid changes at positions 7 and 12 caused up to 8-fold differences in binding (Table 3).

Table 3

Example 3

Sequence-specific Tat neutralizing antibodies

It was next tested whether antibody neutralization of Tat function was affected by amino terminus variation. CD4+ HeLa cells were used with an integrated provirus lacking Tat function, to measure viral transactivation by extracellular, clade B Tat protein. Cells were seeded into a 96 well plate at 20,000 cells per well and incubated overnight. The cells were then washed three times with warmed serum-free RPMI, before they were overlayed with RPMI containing 0.1% ultrapure BSA (Panvera, Madison, WI) and 500 ng/well of HTV Tat protein for 90 minutes. Other experimental samples involved adding Tat that was preincubated for 30 minutes with monoclonal antibodies at a 2.5-fold molar excess (12.5 μg Tat: lμg TRl monoclonal antibody, or control IgG2a), or samples in which the monoclonal antibodies were preincubated with B or C clade N-terminal peptides at a 100-fold molar excess (20μg/peptide: 12.5μg antibody) for 30 minutes prior to adding the Tat protein. All treatments were overlayed on the indicator cells for 90 minutes, then removed and replaced with DMEM containing 10% heat inactivated FBS. Culture fluids were collected 72 hours later and cell-free virus was detected with a commercial antigen-capture ELISA for the p24 capsid protein (R&D Systems, Minneapolis, MN).

It was found (Figure 2) that when Tat protein was preincubated with the TRl monoclonal antibody, transactivation was reduced. Competition for antibody neutralization was conducted by preincubating TRl with a B clade amino terminus peptide and the results showed that transactivation was restored. Substituting a C clade peptide having asparagine at both positions 7 and 12 in place of the arginine/lysine found in clade B, failed to block antibody neutralization of Tat.

Example 4

Antibodies from HIV+ individuals recognize the Tat amino terminus

Sera were also obtained from 31 HIV+ individuals receiving antirefroviral therapy. All had vRNA < 50 copies/ml of plasma and CD4+ T cell counts >200/mm³ at the time of sampling. Volunteers provided informed consent and the protocol was approved by the Institutional Review Board for the University of Maryland, Baltimore. Tat binding antibodies was detected in every specimen; 23 of the 31 sera also had positive binding to amino terminus peptides. The consensus clade B sequence (SEQ ID NO: 19) was recognized most frequently as shown in Table 4.

Table 4

The other B clade sequences (SEQ ED NOS: 20 and 21) with changes at either position 7 or 12 were recognized by 32% and 45% of sera respectively, and the clade C sequences (SEQ ED NO: 22 and 23) were recognized by less than 30% of the serum samples. The peptide recognition pattern showed that changes at amino acid 7 and 12 affected human antibody binding to the Tat amino terminus. The highest binding occurred when these amino acids were arginine and lysine respectively. Importantly, the sequence containing Arg7 and Lys 12 is characteristic of clade B Tat and is not found in consensus sequences from other clades as shown in Table 5. Table 5

The most frequent sequences in non-B clades are Asn7 and Asnl2.

As shown above in Table 4, both of these changes reduced binding by the human sera (from individuals presumed to have clade B virus infections in Baltimore), showing a focus on the B clade sequence and a lack of cross-reaction with more common amino terminus sequences found in non-B clade viruses.

The above results provide a quantitative analysis for the proportion of macaque antibodies that recognize the N-terminus and depend on amino acid sequences at positions 4-12. Changing amino acids (positions 7 and 12) within this region abrogated antibody binding. These results indicate the presence of two, overlapping linear epitopes or a single, complex epitope within the N-terminus. Natural variation in Tat protein sequences includes substitutions at amino acids 7 and 12, both of which lowered antibody recognition by monoclonal, macaque, and human antibodies. The consensus clade B sequence includes Arg7 and Lys 12, making clade B Tat distinct from all other clade consensus sequences at these critical antibody recognition sites. Antibodies directed at the amino terminus can neutralize Tat protein functions in vitro, and natural sequence variation will affect both antibody binding and neutralization. Recently- obtained NMR structures placed the N-terminus of Tat within the core of the Tat protein (3, 20, 31). However, apparent burying of the N-terminus does not preclude the generation of antibodies to this immunodominant domain.

Example 5

Antibody Responses to whole Tat protein in HIV-1+ volunteers:

Antibody response to Tat was analyzed in a cohort of volunteers who were virally suppressed for at least three months. Two-fold serum dilutions were screened in an ELISA for binding to whole Tat protein. Antibodies to Tat were detected in all sera tested, with endpoint tifrations between 80 and 1280, and geometric mean of 560. Tat-binding antibodies were not detected in two different serum pools from HlV-negative donors (not shown) at greater than a 1:20 dilution.

Thirty-two HTV-1+ volunteers were enrolled in the Tat toxoid trial at the Institute of Human Virology (Baltimore, MD). Volunteers between the ages of 18-60 were receiving stable antiretroviral therapy for at least 3 months with CD4+ cell counts greater than 300/μl and HTV-1 vRNA below 50 copies/mL in plasma. The institutional review board approved the study protocol prior to initiation of the study, and all volunteers provided written informed consent. One volunteer withdrew after the first immunization due to personal reasons. This individual was excluded from the analysis, because week 16 (post-immunization) sera were not available.

Patients were randomly assigned to three arms of the study. Each HTV-1+ volunteer received a total of 4 intramuscular injections at 2 week intervals (weeks 0, 2, 4, and 6) followed by a 5th injection at week 12. Volunteers were divided into three groups. One group received only phosphate buffered saline (8 patients in the placebo group). The second group was immunized with lOOμg of Tat toxoid in PBS (11 patients), and the third was immunized with lOOμg of Tat toxoid in alum (12 patients). Sera was screened one month after the final immunization. Sera were collected from clot tubes and stored at -80°C. This study compared sera from week 0 (prior to the first immunization) and week 16 (one month after the final immunization).

Antibodies to the full-length Tat protein (86 amino acid form) were measured for each patient before the first immunization (week 0) and 4 weeks after the final immunization (week 16). 100 ng of Tat (Aventis Pasteur, Toronto, Canada) was adsorbed to each well of an ELISA plate (Costar, Cambridge, MA) by overnight incubation at 4°C in 100 niM carbonate buffer, pH 9.5. The coated plates were washed and treated with 50mM Tris HC1, pH 7.8, 0.15M NaCl, 0.05% Tween 20, 1% bovine serum albumin (ELISA buffer). The plates were washed three times with ELISA buffer prior to adding dilute patient sera and incubation for one hour at 30° C. After four washes with ELISA buffer, a 1:5000 dilution of secondary antibody (anti-human IgG-alkaline phosphatase conjugate, Sigma) was added for one hour at 30°C. Four more washes with ELISA buffer were done prior to PNPP substrate solution addition and incubation at 37°C for 30 minutes. Optical density was measured at 405nm. The baseline was determined for each serum dilution using wells coated with only BSA. Positive wells in the ELISA had A405nm values > 2 standard deviations above the mean of background (BSA) wells after subtracting the mean background value.

In the group immunized with Tat protein alone, three of eleven volunteers had a two-fold increase in their antibody response to Tat, one of which had a four-fold increase. The geometric mean titer for binding antibody was slightly increased after immunization, from 601 to 682. Responses were higher in the Tat toxoid plus alum immunized group, with six of 12 experiencing a two-fold increase, one of which had a four-fold increase in antibody binding, as shown in Table 6.

Table 6

Anti-Tat Geomean Titers and fold- response to Tat toxoid immunization

Group (number of patients) Pre-immunization Post-immunization 2-fold increase

Placebo (8) 453 494 1/8 (12%)

Tat Toxoid (TTX) alone (11) 601 682 3/11 (27%)

TTX plus Alum (12) 604 806 6/12 (50%)

Combined Tat groups (23) 603 744 9/23 (39%)

The Tat plus alum group showed a larger increase in geometric mean antibody titer, going from 604 before to 806 after immunization. In terms of response rate and geometric mean antibody titers, Tat toxoid plus alum was roughly twice as effective as Tat toxoid alone for increasing antibody responses in HlV-infected individuals. Tat-binding antibodies were identified in all HTV+ individuals examined in this study. Binding titers ranged from approximately 80 to >1,200, but were easily distinguished from background in all cases. Most individuals also had antibodies directed to the linear epitope within the Tat amino terminus, and these responses were specific to clade B protein sequences as expected for an inner city population from Baltimore that is predominantly infected with clade B HIV-l.

Post-exposure immunization with Tat protein increased the antibody responses in some volunteers, but did not alter the clade specificity for the amino terminus epitope and did not elicit antibodies to a signature sequence of the immunogen. Antibody responses to the HTV-1 Tat protein are common in chronic infection, despite long-term viral suppression after HAART. These antibodies can be manipulated by post-exposure immunization and seem to react well with a proven Tat-neufralizing epitope in the protein amino terminus. These results show for the first time, routine detection of Tat-binding antibodies in a clinical cohort. Since only individuals with chronic infection were examined, it is also possible that Tat antibodies may not appear early in HTV disease or in very rapid progressors. Routine detection of Tat-binding antibodies in this treated cohort, suggests that this immune response is a common feature of HTV-1 infection. Lastly, the question of whether antibodies to Tat are affected by post-exposure immunization was addressed. The best results were obtained with Tat toxoid in alum, but the response rates in this group were only 50% and the increase in antibody levels was modest. However, increased antibody titers were observed after immunization, with a range of responses from none, to substantial elevations. Despite the increased antibody levels in some individuals, a broadening of the antibody response was not detected. The amino terminus responses were still restricted to B clade proteins and there were no detectable antibodies to an antigenic signature sequence at positions 57-60 of the immunogen. This is likely an example of original antigenic sin, wherein new primary responses are not generated after immunization, instead we see increase levels of pre-existing antibodies.

Example 6

The issue of clade-specificity in the Tat-binding antibodies was explored in the human antisera. Others have reported that Tat-binding antibodies from individuals in many geographic regions (presumably infected with a broad variety of clades) were infrequent (around 13 to 25% of serum specimens tested), and were uniformly cross-reactive with a clade B Tat protein. This result was intended to support a plan to prevent HTV-1 infection by a vaccine consisting only of Tat protein antigen, and using the clade B protein to protect against other clade infections in Africa and elsewhere. However, the results set forth herein confirm that the antibody response to critical, neutralizing epitopes of Tat, are clade-specific.

The amino terminus contains two overlapping epitopes and monoclonal antibodies to either can neutralize Tat protein in a transactivation assay. The amino terminus sequences of clade B Tat define an unique group, wherein clade B is different from the consensus sequence of nearly all other Tat proteins known from other viral clades. It was determined herein that antibodies to the dominant neutralizing epitope in the amino terminus are not cross-reacting. The data included herein show that clade B infections result in antibodies to clade B amino teπninus sequences, that do not react with clade C amino terminus epitopes that represent the more common sequence among all HTV strains world-wide.

The 20-mer peptide arrays and testing methods described hereinabove in Example 2 were used for this example. Reactivity to the linear N-terminal peptides was scored positive if the OD405 i was higher than two standard deviations above the background value for BSA. Positive reactivity to the amino-terminus linear epitope was found in more than 50% of infected volunteers prior to immunization; 4/8 in the placebo group, 9/11 in the Tat toxoid group, and 8/12 in the toxoid plus alum group. This pattern was not changed substantially by therapeutic immunization, with only one additional individual in the toxoid group, and one in the toxoid plus alum group sera-converting in the post-immunization serum specimens.

Despite small changes in number of individuals with reactivity to the N-terminus, several individuals immunized with Tat had quantitatively higher responses to the N-terminus after immunization. Figure 3 shows representative examples of individuals in each group (P=placebo, TT=Tat toxoid, TTA=Tat toxoid plus alum) before and after immunization. In most cases, individuals that had an increase in the antibody titer to whole Tat protein had a concomitant increase in reactivity to the N-terminus. Reactivity to B clade N-terminal peptides (grey) was higher than that to C clade peptides (white), demonstrating only partial, if any, cross-reaction. Clade specificity is evident both before and after immunization with a B clade immunogen in a population that we expect to mainly have clade B HTV infections. Changes in the N-terminal peptide set reflect naturally occurring sequences, with amino acid substitutions focusing on amino acid positions 7 and 12. The consensus B clade N-terminal sequence contains an arginine at position 1, and a lysine at position 12, in stark contrast with the consensus sequences of every other dominant clade (A, C, D, etc.) throughout the world, in which both amino acid positions 7 and 12 are asparagines.

Example 7

De novo response to immunization with Tat toxoid was explored by looking at a unique sequence that is present in the immunogen and rarely found in circulating HIV-l strains. The 57RPPQ60 sequence in the immunogen is relatively rare (<15%) in B clade isolates (41). Response to this region was not found prior to immunization in any of the individuals screened (Figure 4). Despite five immunizations with Tat toxoid that contains the 57RPPQ60 sequence, detecting a response in human beings to this signature sequence (Figure 4) was not found.

Example 8

Tat and Gag Fusion Polypeptides

Amino acid sequence MEPVD PRLEP WKHPG SQPKT (41) (SEQ ID NO: 19) represents the first 20 amino acids of the N-term of Tat. The sequence coding for this amino acid was optimized for increased and enhanced expression according to methods well known to those skilled in the art. Specifically the optimized codon sequence can be determined by codon usage of highly expressed genes or using software designed to optimize the gene sequence such as Prot- 2-DNA™ available from DNA 2.0 hie. The sequence was initially optimized for human codon usage, then adjusted by choosing alternate codons to improve production in both bacterial and human cells. The adjustments were mainly to eliminate repetitively used codons and instead use alternate codons to increase the sequence diversity. The codon optimized B and C clade sequences (SEQ ED NO: 1 and 2 ) were constructed from overlapping primers. They are approximately 25 long and overlap by 5 nucleotides at each end.

The synthetic genes were constructed by taking the central primers that overlap at their 3' ends, and annealing them in solution. A blunt-end fragment was generated with DNA polymerase (Klenow fragment). This fragment was denatured, then annealed to the next set of primers going outward, and the process was repeated until all primers were incorporated into the sequence. Then the terminal primers (5' and 3' ends of the gene) were used to reamplify the full length fragment. The full length amplification primers are (including the translation termination codon) for B and C as follows : 5': ATGGAGCCAGTAGATCCTAGAC (SEQ ID NO: 50) 3': TCACTGATGGACCGGATCTGTC (SEQ ID NO: 51) 5': ATGGAGCCCGTGGACCCCAACCTGGAGCCC (SEQ ID NO: 52) 3': TACGTCGAAGGGGTCGGTCTCGGTCTTGG (SEQ ED NO: 53)

In the alternative, Tat proteins (clade B or clade C sequences) are produced in E. coli from expression plasmids containing a sequence that is codon-optimized for translation in human cells. The expression plasmids produce Tat as a NusA fusion protein, that is purified, cleaved, and then Tat is chromatographed on Heparin-Agarose columns. The resulting material (approximately 75% Tat with NusA and bacterial protein contaminants) is further purified to homogeneity by reverse phase HPLC. The final material is tested for purity by SDS-PAGE, western blotting, and mass spectrometry. From 1 liter of bacterial culture, 350 Mg of highly purified Tat protein is normally obtained. The protein is assayed for activity by transfecting HeLa cells that carry a Tat- defective HIV provirus (37). Virus particles are release (> 50 pg p24 protein per ml) within 3 days after adding between 0.2 and 1.0 ug/ml to HeLa cell cultures.

Six primers were constructed for the PCR directed development of overhangs and the construction of Tat-gag and Gag-tat fusion sequences for insertion into a TOPO TA cloning system such as that available from hivitrogen ®

The primers are constructed to allow Taq DNA Polymerase to make copies of the specific segments and adds a single deosyadenosine (A) to the 3' ends of the PCR products: Table 7

Following a two-step PCR procedure, Tat-gag and Gag-tat DNA bands were extracted from agarose gel and Topo cloning was performed with Taq attached A-overhangs as described in the literature available with the hivitrogen system. Five Tat-gag and five Gag-tat clones were placed in the TOPO cloning system. Following Topo cloning, minipreps were performed on the ten clones from the overnight cultures. The first two Tat-gag (TG) and Gag-tat (GT) clones in the topo plasmid were Eco RI digested to approximate the size of the insert prior to sequencing. Restriction digest products were run an agarose gel and it appeared that the size of the insert was correct as shown in Figure 5.

Restriction digests was also performed on additional Gag-tat (Sma-Not) and Tat-gag (Eco-Not) PCR products from the topo clones. The PGEX-5X-2 plasmid was also digested with Sma and Not or Eco and Not and gel extracted. Ligation of Tat-gag or Gag-tat to PGEX was performed via a Promega ligation kit. DH5α cells were transformed with the PGEX plasmid containing either Tat-gag or Gag-tat. PGEX transformed DH5α colonies were obtained and miniprep performed to obtain Gag-tat and Tat-gag in PGEX. Also, Tat-gag in PGEX in Ros-Gam cells were prepared and Ros-Gam transformed cells were selected with chloramphenicol and cabenicillin.

Expression was induced with EPTG and protein bound to a GST column and then cleaved from the column with Factor Xa cleavage solution. Eluted protein was visualized as a ~30kda band on a protein gel. Initial Western blot was performed without all controls but showed antibody binding to Tat in the Tat-gag lane as shown in Figure 6. Tat-gag sequences from Ros-Gam cells was obtained and aligned to the theoretical Tat-gag sequence (SEQ ID NO: 31).

Table 8 and Figure 7 provide sequences of other epitopes that are also applicable for including in a Tat-Gag fusion protein. The accompanying table compares differences within the amino- terminus region, the basic region, and the carboxy-terminus among several HTV-1 clades. Core amino acids for mapped epitopes are shown in bold.

Table 8 . ii , ^• ιui :„3i it,.;i "^,ιi"..'' "-! i e: ii--^'

* Consensus D sequence is truncated at aa 86. This collection of epitope peptides covers the majority of known HTV sequences and shows that clade variation will impact antibody recognition of neutralization of Tat. The present invention envisions two types of immunogen, a monovalent and bivalent versions.

In the monovalent version, the coding region for the epitope peptide is introduced at the 5 ' end of the p27 expression construct. For the bivalent version, the epitope peptides are positioned at both the 5' and 3' ends of p27 Gag. The bivalent version may be required to cross-link surface immunoglobulin in order to trigger specific B cell expansion and antibody production. In order to guard against intramolecular recombination in the bivalent construct, the second epitope peptide sequence is made from alternate codons so that the nucleotide sequences are different even though the amino acid sequence is preserved. The Gag carrier protein provides Th epitopes that promote T-cell help and increase antibodies to the epitope peptides. The p27 Gag protein is highly immunogenic and the use of a viral protein as carrier ensures that T-cell help will be boosted during virus challenge in order to elicit anamnestic responses to the epitope peptides. Further, the epitope peptides can be modified by adding a Cys to the carboxy-terminus. Modified peptides are then conjugated to p27 Gag protein. The p27 Gag protein may be previously reacted with a maleimide ester thereby providing for the modified p27 Gag protein to carry between 3 and 5 peptides.

A p27 Gag expression construct (56) is used to make fusion constructs with the Tat peptide at the amino terminus of the p27 Gag (5 ' constructs), and subsequently add a second copy of the epitope peptide sequence at the carboxy-terminus of Gag (5'+ 3' construct). In order to minimize intramolecular recombination between similar sequences at the ends of Gag, alternative codons are used so that he nucleotide sequences are dissimilar even though the amino acid sequences are maintained. The fusion proteins are expressed under control of the LacZ promoter using a GST expression vector. Expressed fusion proteins are purified by glutathione affinity chromatography and the GST portion is removed by Factor Xa cleavage while bound to the column. hi the alternative, purified p27 Gag protein is modified with the cross-linker SMCC or sulfo- SMCC. These cross linkers are based on maleimide that is connected to a NHS-ester through a spacer arm. The Gag protein is dissolved in PBS, pH7.2, the cross linker is added in DMSO and incubated at room temperature for 1 hour. The excess cross linker is removed on a desalting column. The Tat (with a carboxy-terminus Cys residue) is mixed with the maleimide-activated Gag protein, then incubated for 2 hours at 4°C. The peptide-Gag conjugate is passed over a desalting column and then stored in aliquots at -20°C. The peptide-Gag conjugate is run on a SDS-PAGE along side of Gag protein. The increase in mass is estimated by the change in Gag mobility, then calculate the average number of peptides bound per Gag molecule (usually in the range of 3-5). The SDS-PAGE is then transferred to a nylon membrane and the presence of epitope peptide is confirmed using monoclonal antibodies (for epitope peptides A and B) or rabbit antiserum (for epitope peptide C) in a western blot.

Balb/c mice are immunized with 10 ug of either fusion construct or chemical conjugate immunogens. The control group (X) receives 10 ug of purified Tat protein and another control group (XI) is immunized with 10 ug of p27 Gag. The antigens are dissolved in normal saline and polyphosphazene adjuvant (Adjumer) is added to a final concentration of 0.25 mg/ml. Four weeks after the primary immunization, mice are boosted with the same mixture then sacrificed 10 days later and used for total blood collection. Mice are immunized in groups of 5. Immune sera from each animal are tested at a 1:500 dilution to determine whether the animals responded uniformly to the immunization. Then the sera are combined, for a more accurate titration and further characterization. Likely, 0.5 to 0.75 ml of serum per animal is collected with a peptide- specific antibody titers in the range of > 1:5,000.

hi the first immunization study, groups of 5 mice are immunized with one of the fusion or chemically-conjugated preparations, whole Tat antigen, or the p27 Gag carrier protein. The immunization schedule (single agents) is as set forth in Table 9:

Mouse Epitope Chem. p27 Gag Tat (101 aa) p27 Gag

Group* Peptide Conjugate fusion**

I A yes no no no

II A no yes/5' no no in A no yes/5' + 3' no no

TV B yes no no no

V B no yes/5' no no

VI B no yes/5' + 3' no no vπ C yes no no no

X none no no yes no

XI none no no no yes * Each group contains 5 mice.

** 5' means one copy of epitope peptide is linked to the Gag amino terminus. 5' + 3 ' means one copy of epitope peptide is linked to the amino terminus and a second copy is linked to the carboxyl terminus.

The single agent immunization study produces 55 sera for individual testing in the Tat neutralization assay as described above.

REFERENCES

Various references are cited herein, the entire disclosure of each such reference is incorporated herein by reference in their entireties, as are the following references:

1. Allen, T. M., L. Mortara, B. R. Mothe, M. Liebl, P. Jing, B. Galore, M.

Piekarczyk, R. Ruddersdorf, D. H. O'Connor, X. Wang, C. Wang, D. B. Allison, J. D. Altman, A. Sette, R. C. Desrosiers, G. Sutter, and D. I. Watkins. 2002. Tat-vaccinated macaques do not control simian immunodeficiency virus SIVmac239 replication. J Virol. 76:4108-4112.

2. Allen, T. M., D. H. 0"Connor, P. Jing, J. L. Dzuris, B. R. Mothe, T. U. Vogel, E. Dunphy, M. E. Liebl, C. Emerson, N. Wilson, K. J. Kunstman, X. Wang, D. B. Allison, A. L. Hughes, R. C. Desrosiers, J. D. Altman, S. M. Wolinsky, A. Sette, and D. I. Watkins. 2000. Tat- specific cytotoxic T lymphocytes select for STV escape variants during resolution of primary viraemia. Nature. 407:386-390.

3. Bayer, P., M. Kraft, A. Ejchart, M. Westendorp, R. Frank, and P. Rosch. 1995. Structural studies of HIV-l Tat protein. JMolBiol. 247:529-535. 4. Belliard, G., A. Romieu, J. F. Zagury, H. Dali, O. Chaloin, R. Le Grand, E. Loret, J. P.

Briand, B. Roques, C. Desgranges, and S. Muller. 2003. Specificity and effect on apoptosis of Tat antibodies from vaccinated and SHIV-infected rhesus macaques and HTV-infected individuals. Vaccine. 21:3186-3199. 5. Brake, D. A., J. Goudsmit, W. J. Krone, P. Schammel, N. Appleby, R. H. Meloen, and C.

Debouck. 1990. Characterization of murine monoclonal antibodies to the tat protein from human immunodeficiency virus type 1. J Virol. 64:962-965.

6. Buonaguro, L., G. Barillari, H. K. Chang, C. A. Bohan, V. Kao, R. Morgan, R. C. Gallo, and B. Ensoli. 1992. Effects of the human immunodeficiency virus type 1

Tat protein on the expression of inflammatory cytokines. J Virol. 66:7159-7167.

7. Cafaro, A., A. Caputo, C. Fracasso, M. T. Maggiorella, D. Goletti, S. Baroncelli, M. Pace, L. Semicola, M. L. Koanga-Mogtomo, M. Betti, A. Borsetti, R. Belli, L. Akerblom, F. Corrias, S. Butto, J. Heeney, P. Verani, F. Titti, and B. Ensoli. 1999. Control of SHTV-89.6P- infection of cynomolgus monkeys by HTV-1 Tat protein vaccine. Nat Med. 5:643-650.

8. Cafaro, A., A. Caputo, M. T. Maggiorella, S. Baroncelli, C. Fracasso, M. Pace, A. Borsetti, L. Semicola, D. R. Negri, P. Ten Haaft, M. Betti, Z. Michelini, I. Macchia, E. Fanales- Belasio, R. Belli, F. Corrias, S. Butto, P. Verani, F. Titti, and B. Ensoli. 2000. SHTV89.6P pathogenicity in cynomolgus monkeys and control of viral replication and disease onset by human immunodeficiency virus type 1 Tat vaccine. JMedPrimatol. 29:193-208.

9. Cafaro, A., F. Titti, C. Fracasso, M. T. Maggiorella, S. Baroncelli, A. Caputo, D. Goletti, A. Borsetti, M. Pace, E. Fanales-Belasio, B. Ridolfi, D. R. Negri, L. Semicola, R. Belli, F.

Corrias, I. Macchia, P. Leone, Z. Michelini, P. ten Haaft, S. Butto, P. Verani, and B. Ensoli. 2001. Vaccination with DNA containing tat coding sequences and unmethylated CpG motifs protects cynomolgus monkeys upon infection with simian/human immunodeficiency virus (SHTV89.6P). Vaccine. 19:2862-2877.

10. Caselli, E., M. Betti, M. P. Grossi, P. G. Balboni, C. Rossi, C. Boarini, A. Cafaro, G. Barbanti-Brodano, B. Ensoli, and A. Caputo. 1999. DNA immunization 18 with HTV-1 tat mutated in the trans activation domain induces humoral and cellular immune responses against wild-type Tat. J Immunol. 162:5631-5638.

11. Demirhan, I., A. Chandra, O. Hasselmayer, and P. Chandra. 1999. Intercellular traffic of human immunodeficiency λdms type 1 fransactivator protein defined by monoclonal antibodies.

FEBS Lett. 445:53-56.

12. Demirhan, I, A. Chandra, F. Mueller, H. Mueller, P. Biberfeld, O. Hasselmayer, and P. Chandra. 2000. Antibody spectrum against the viral fransactivator protein in patients with human immunodeficiency vims type 1 infection and Kaposi's sarcoma. JHum Virol. 3:137-143.

13. Ensoli, B., and A. Cafaro. 2000. Control of viral replication and disease onset in cynomolgus monkeys by HTV-1 TAT vaccine. JBiol Regul Homeost Agents. 14:22-26. 14. Frankel, A. D., and J. A. Young. 1998. HTV-1: fifteen proteins and an RNA. Annu Rev Biochem. 67:1-25.

15. Gallo, R. C. 1999. Tat as one key to HTV-induced immune pathogenesis and Tat (correction of Pat) toxoid as an important component of a vaccine. Proceedings of the National Academy of Sciences of the United States of America. 96:8324-8326.

16. Garcia, J. A., D. Harrich, L. Pearson, R. Mitsuyasu, and R. B. Gaynor. 1988. Functional domains required for tat-induced transcriptional activation of the HTV-1 long terminal repeat. Embo J. 7:3143-3147.

17. Gatignol, A., and K. T. Jeang. 2000. Tat as a transcriptional activator and a potential therapeutic target for HEV-l. -4.t Pharmacol. 48:209-227.

18. Goldstein, G., K. Manson, G. Tribbick, and R. Smith. 2000. Minimization of chronic plasma viremia in rhesus macaques immunized with synthetic HTV-1 Tat peptides and infected with a chimeric simian/human immunodeficiency vims (SHTV33). Vaccine. 18:2789-2795.

19. Goldstein, G., G. Tribbick, and K. Manson. 2001. Two B cell epitopes of HTV-1 Tat protein have limited antigenic polymorphism in geographically diverse HTV-1 strains. Vaccine. 19:1738-1746.

20. Gregoire, C, J. M. Peloponese, Jr., D. Esquieu, S. Opi, G. Campbell, M. Solomiac, E. Lebrun, J. Lebreton, and E. P. Loret. 2001. Homonuclear (l)H-NMR assignment and structural characterization of human immunodeficiency vims type 1 Tat Mai protein. Biopolymers. 62:324- 335.

21. Gringeri, A., E. Santagostino, M. Muca-Perja, H. Le Buanec, B. Bizzini, A. Lachgar, J. F. Zagury, J. Rappaport, A. Bumy, R. C. Gallo, and D. Zagury. 1999. Tat toxoid as a component of a preventive vaccine in seronegative subjects. J Acquir Immune Defic Syndr Hum Retrovirol. 20:371-375.

22. Gringeri, A., E. Santagostino, M. Muca-Perja, P. M. Mannucci, J. F. Zagury, B. Bizzini, A. Lachgar, M. Carcagno, J. Rappaport, M. Criscuolo, W. Blattner, A. Bumy, R. C. Gallo, and D. Zagury. 1998. Safety and immunogenicity of HTV-1 Tat toxoid in immunocompromised HTV- 1-infected patients. JHum Virol. 1 :293-298.

23. Hinkula, J., C. Svanholm, S. Schwartz, P. Lundholm, M. Brytting, G. Engsfrom, R. Benthin, H. Glaser, G. Suffer, B. Kohleisen, V. Erfle, K. Okuda, H. Wigzell, and B. Wahren. 1997. Recognition of prominent viral epitopes induced by immunization with human immunodeficiency vims type 1 regulatory genes. J Virol. 71:5528-5539.

24. Huang, L., I. Bosch, W. Hofrnann, J. Sodroski, and A. B. Pardee. 1998. Tat protein induces human immunodeficiency vims type 1 (HTV-1) coreceptors and promotes infection with both macrophage-fropic and T-lymphotropic HTV-1 strains. J Virol. 72:8952-8960.

25. Kuppuswamy, M., T. Subramanian, A. Srinivasan, and G. Chinnadurai. 1989. Multiple functional domains of Tat, the trans-activator of HTV- 1, defined by mutational analysis. Nucleic Acids Res. 17:3551-3561.

26. Li, C. J., D. J. Friedman, C. Wang, V. Metelev, and A. B. Pardee. 1995. Induction of apoptosis in uninfected lymphocytes by HTV-1 Tat protein. Science. 268:429-431. 27. Noonan, D., and A. Albini. 2000. From the outside in: extracellular activities of HIV Tat. Adv Pharmacol. 48:229-250.

28. Opi, S., J. M. Peloponese, Jr., D. Esquieu, G. Campbell, J. de Mareuil, A. Walburger, M. Solomiac, C. Gregoire, E. Bouveret, D. L. Yirrell, and E. P. Loret. 2002. Tat HIV-l primary and tertiary stmctures critical to immune response against non-homologous variants. J Biol Chem. 277:35915-35919.

29. Ott, M., S. Emiliani, C. Van Lint, G. Herbein, J. Lovett, N. Chirmule, T. McCloskey, S. Pahwa, and E. Verdin. 1997. hnmune hyperactivation of HTV-1 -infected T cell mediated by Tat and the CD28 pathway. Science. 275: 1481-1485.

30. Pauza, C. D., P. Trivedi, M. Wallace, T. J. Ruckwardt, H. Le Buanec, W. Lu, B. Bizzini, A. Burny, D. Zagury, and R. C. Gallo. 2000. Vaccination with tat toxoid attenuates disease in simian/HTV-challenged macaques. Proc Natl Acad Sci USA. 97:3515-3519.

31. Peloponese, J. M., Jr., C. Gregoire, S. Opi, D. Esquieu, J. Sturgis, E. Lebrun, E. Meurs, Y. Collette, D. Olive, A. M. Aubertin, M. Witvrow, C. Pannecouque, E. De Clercq, C. Bailly, J. Lebreton, and E. P. Loret. 2000. 1H-13C nuclear magnetic resonance assignment and sfructural characterization of HTV-1 Tat protein. CRAcad Scilll. 323:883-894.

32. Rana, T. M., and K. T. Jeang. 1999. Biochemical and functional interactions between HTV-1 Tat protein and TAR RNA. Arch Biochem Biophys. 365:175-185.

33. Rappaport, J., S. J. Lee, K. Khalili, and F. Wong-Staal. 1989. The acidic amino-terminal region of the HTV-1 Tat protein constitutes an essential activating domain. New Biol. 1:101-110.

34. Reddy, M. V., M. Desai, J. Jeyapaul, D. D. Prasad, T. Seshamma, D. Palmeri, and S. A. Khan. 1992. Functional analysis of the N-terminal domain of Tat protein of the human immunodeficiency vims type 1. Oncogene. 7:1743-1748.

35. Rice, A. P., and F. Carlotti. 1990. Structural analysis of wild-type and mutant human immunodeficiency vims type 1 Tat proteins. J Virol. 64:6018-6026.

36. Richardson, M. W., J. Mirchandani, P. Silvera, E. G. Regulier, C. Capini, P. M. Bojczuk, J. Hu, E. J. Gracely, J. D. Boyer, K. Khalili, J. F. Zagury, M. G. Lewis, and J. Rappaport. 2002.

Immunogenicity of HTV-1 TTT and SHTV 89.6P Tat and Tat toxoids in rhesus macaques: induction of humoral and cellular immune responses. DNA Cell Biol. 21:637-651. 37. Sadaie, M. R., E. Tschachler, K. Valerie, M. Rosenberg, B. K. Felber, G. N. Pavlakis, M. E. Klotman, and F. Wong-Staal. 1990. Activation of tat-defective human immunodeficiency vims by ultraviolet light. New Biol. 2:479-486. 38. Secchiero, P., D. Zella, S. Capitani, R. C. Gallo, and G. Zauli. 1999. Extracellular HTV-1 tat protein up-regulates the expression of surface CXC-chemokine receptor 4 in resting CD4+ T cells. J Immunol. 162:2427-2431.

39. Secchiero, P., D. Zella, S. Curreli, P. Mirandola, S. Capitani, R. C. Gallo, and G. Zauli. 2000. Pivotal role of cyclic nucleoside phosphodiesterase 4 in Tat-mediated CD4+ T cell hyperactivation and HTV type 1 replication. Proc NatlAcad Sci USA. 97:14620-14625.

40. Silvera, P., M. W. Richardson, J. Greenhouse, J. Yalley-Ogunro, N. Shaw, J. Mirchandani, K. Khalili, J. F. Zagury, M. G. Lewis, and J. Rappaport. 2002. Outcome of simian- human immunodeficiency vims strain 89.6p challenge following vaccination of rhesus macaques with human immunodeficiency virus Tat protein. J Virol. 76:3800-3809.

41. Tikhonov, I., T. J. Ruckwardt, G. S. Hatfield, and C. D. Pauza. 2003. Tat-neutralizing antibodies in vaccinated macaques. J Virol. 77:3157-3166.

42. Verrier, B., R. Le Grand, Y. Ataman-Onal, C. Terrat, C. Guillon, P. Y. Durand, B. Hurfrel, A. M. Aubertin, G. Sutler, V. Erfle, and M. Girard. 2002. Evaluation in rhesus macaques of Tat and rev-targeted immunization as a preventive vaccine against mucosal challenge with SHTV-BX08. DNA Cell Biol. 21:653-658.

43. Viscidi, R. P., K. Mayur, H. M. Lederman, and A. D. Frankel. 1989. Inhibition of antigen-induced lymphocyte proliferation by Tat protein from HTV-1. Science. 246: 1606-1608.

44. Voss, G., K. Manson, D. Montefiori, D. I. Watkins, J. Heeney, M. Wyand, J. Cohen, and C. Bmck. 2003. Prevention of disease induced by a partially heterologous AIDS vims in rhesus monkeys by using an adjuvanted multicomponent protein vaccine. J Virol. 77: 1049-1058.

45. Westendorp, M. O., R. Frank, C. Ochsenbauer, K. Strieker, J. Dhein, H. Walczak, K. M. Debatin, and P. H. Krammer. 1995. Sensitization of T cells to CD95-mediated apoptosis by HTV- 1 Tat and gpl20. Nature. 375:497-500.

46. Westendorp, M. O., M. Li-Weber, R. W. Frank, and P. H. Krammer. 1994. Human immunodeficiency vims type 1 Tat upregulates interleukfn-2 secretion in activated T cells. J Virol. 68:4177-4185.

47. Zagury, D., A. Lachgar, V. Chams, L. S. Fall, J. Bernard, J. F. Zagury, B. Bizzini, A. Gringeri, E. Santagostino, J. Rappaport, M. Feldman, A. Bumy, and R. C. Gallo. 1998. Interferon alpha and Tat involvement in the immunosuppression of uninfected T cells and C-C chemokine decline in AEDS. Proc NatlAcad Sci USA. 95:3851-3856.

48. Zauli, G., and D. Gibellini. 1996. The human immunodeficiency vims type-1 (HTV-1) Tat protein and Bcl-2 gene expression. Leuk Lymphoma. 23:551-560.

49. Zhang, M., X. Li, X. Pang, L. Ding, O. Wood, K. Clouse, I. Hewlett, and A. I. Dayton. 2001. Identification of a potential HTV-induced source of bystander-mediated apoptosis in T cells: upregulation of trail in primary human macrophages by HIV-l tat. J Biomed Sci. 8:290- 296. 50. Ensoli, B., R. Gendelman, P. Markham, V. Fiorelli, S. Colombini, M. Raffeld, A. Cafaro, H. K. Chang, J. N. Brady, and R. C. Gallo. 1994. Synergy between basic fibroblast growth factor and HTV-1 Tat protein in induction of Kaposi's sarcoma. Nature. 371 :674-680. 51. Yang, Y., I. Tikhonov, T. J. Ruckwardt, M. Djavani, J. C. Zapata, C. D. Pauza, and M. S. Salvato. 2003. Monocytes treated with human immunodeficiency vims Tat kill uninfected CD4(+) cells by a tumor necrosis factor-related apoptosis-induced ligand-mediated mechanism. J Virol. 77:6700-6708. 52. Osterhaus, A. D., C. A. van Baalen, R. A. Gruters, M. Schutten, C. H. Siebelink, E. G. Hulskotte, E. J. Tijhaar, R. E. Randall, G. van Amerongen, A. Fleuchaus, V. Erfle, and G. Sutter. 1999. Vaccination with Rev and Tat against ADDS. Vaccine. 17:2713-2714.

53. Stittelaar, K. J., R. A. Gruters, M. Schutten, C. A. van Baalen, G. van Amerongen, M. Cranage, P. Liljesfrom, G. Sutter, and A. D. Osterhaus. 2002. Comparison of the efficacy of early versus late viral proteins in vaccination against STV. Vaccine. 20:2921-2927.

54. Vogel, T. U, M. R. Reynolds, D. H. Fuller, K. Vielhuber, T. Shipley, J. T. Fuller, K. J. Kunstman, G. Sutter, M. L. Marthas, V. Erfle, S. M. Wolinsky, C. Wang, D. B. Allison, E. W. Rud, N. Wilson, D. Montefiori, J. D. Altman, and D. I. Watkins. 2003. Multispecific vaccine- induced mucosal cytotoxic T lymphocytes reduce acute-phase viral replication but fail in long- term control of simian immunodeficiency vims STVmac239. J Virol. 77:13348-13360.

55. Butto, S., V. Fiorelli, A. Tripiciano, M. J. Ruiz-Alvarez, A. Scoglio, F. Ensoli, M. Ciccozzi, B. Collacchi, M. Sabbatucci, A. Cafaro, C. A. Guzman, A. Borsetti, A. Caputo, E.

Vardas, M. Colvin, M. Lukwiya, G. Rezza, and B. Ensoli. 2003. Sequence Conservation and Antibody. Cross-Recognition of Clade B Human Immunodeficiency Vims (HIV) Type 1 Tat Protein in HTV-1 -Infected Italians, Ugandans, and South Africans. J Infect Dis. 188:1171-1180. 56. Steger, K. K., and Pauza, C. D. (1997). Immunization of Macaca mulatta with aroA- attenuated Salmonella typhimurium expressing STV p27 antigen. J. Med. Primatol. 26, 44-50.

Claims

CLAIMS That which is claimed is:

1. An immunogen composition comprising: a) a polypeptide comprising at least one HTV Tat linear epitope peptide or fragment thereof linked to a carrier protein, wherein carrier protein is a gag protein or fragment thereof; or b) a nucleotide sequence encoding the polypeptide of (a).

2. The composition according to claim 1, wherein the HTV Tat linear epitope peptide comprises an amino terminus linear epitope peptide.

3. The composition according to claim 1, wherein the HTV Tat linear epitope peptide comprises amino acid sequences from amino terminus of clade B or clade C peptides.

4. The composition according to claim 1, wherein the HTV Tat linear epitope peptide comprises at least one amino acid residues of 7, 12, 57-59 or 93-94.

5. The composition according to claim 1, wherein the HTV Tat linear epitope peptide comprises sequences 1-20 of the amino terminus, 51-70 (basis region) or 82-101 (carboxy region).

6. The composition according to claim 1, wherein the HTV Tat linear epitope peptide is conjugated to the HIV Gag protein.

7. The composition according to claim 1, wherein the HTV Tat linear epitope peptide is fused to the 5' end of the Gag peptide.

8. The composition according to claim 1, wherein one HTV Tat linear epitope peptide is linked to the 5' end of the Gag protein and another HTV Tat linear epitope peptide is linked to the 3' end of the Gag protein.

9. The composition according to claim 8, wherein the HTV Tat linear epitope peptide is located in the amino terminus and comprises at least amino acid residues 1, 7 and 12.

10. The composition according to claim 9, wherein one of the Tat linear epitope protein is a viral B clade and the other is a viral C Clade.

11. The composition according to claim 2, wherein the Tat linear epitope protein comprises from 15 to 20 amino acid residues.

12. The composition according to claim 1, wherein the nucleotide sequence is codon optimized for enhanced expression in mammals, bacteria or insect larvae.

13. The therapeutic composition according to claim 1, further comprising a pharmaceutically acceptable carrier.

14. A method to induce production of neutralizing Tat antibodies that inhibit internalization of Tat into T-cells, the method comprising: administering to a mammal a polypeptide comprising at least one HTV Tat linear epitope peptide or fragment thereof linked to a carrier protein, wherein carrier protein is a gag protein or fragment thereof; or administering a nucleotide sequence encoding the polypeptide of (a) to the mammal for expression of the nucleotide sequence therein.

15. The method according to claim 14, wherein the Tat linear epitope protein comprises at least amino acid residues 1, 7 and 12 and is administered in an effective amount to induce production of neutralizing Tat antibodies.

16. The method according to claim 14, wherein the nucleotide sequence is codon optimized for enhanced expression in a mammal.

17. A method for producing an antibody comprising: administering to a mammal a peptide having at least about 15 to about 20 amino acid residues from the amino terminus region of Tat conjugated to HTV gag protein or a fragment thereof, wherein the amino acid sequence comprises at least amino acid residue 1, 7 and 12 from the amino terminus region of Tat.

18. The method according to claim 9, wherein the peptide comprises SEQ ID NOs: 6 or 8.

19. An expression vector comprising a polynucleotide that encodes for a polypeptide consisting of a Tat linear epitope peptide linked to a carrier protein, wherein the carrier protein is a gag protein ΌΓ fragment thereof, wherein the polynucleotide is codon optimized for enhanced expression in mammals or bacteria.

20. The expression vector according to claim 19, wherein the polynucleotide encodes for an amino terminus linear epitope peptide.

21. The expression vector according to claim 19, wherein the Tat linear epitope peptide comprises amino acid sequences from amino terminus of clade B or clade C peptides.

22. The expression vector according to claim 19, wherein the HTV Tat linear epitope peptide comprises sequences 1-20 of the amino terminus, 51-70 (basis region) or 82-101 (carboxy region).

23. An assay for the detection of an immune response in an HTV infected patient and determining the specific HTV clade, the method comprising: a) providing HTV Tat amino terminus linear epitope peptides from HTV clades B and/or C and a scrambled peptide, wherein the scrambled peptide comprises the amino acid residues of the HTV Tat amino terminus linear epitope peptide in a scrambled mode for use as a control; b) collecting sera from a mammal that is HTV infected; c) incubating the sera in combination with the HTV Tat linear epitope peptides to form a sera/peptide composition; d) adding the sera/peptide composition to ELISA plates coated with intact Tat antigen; e) measuring bound antibodies to the intact Tat antigen and amino terminus linear epitopes of the different clades to determine values of recognition of conformational epitopes of intact Tat antigen relative to the binding of amino terminus Tat linear epitopes.

24. An assay for measuring the proportion of antibodies that bind amino terminus linear or conformational epitopes to determine effectiveness of Tat vaccines to generate neutralizing antibodies of soluble Tat proteins, the assay comprising: a) providing at least one HTV Tat linear epitope peptide and a scrambled peptide, wherein the scrambled peptide comprises the amino acid residues of the linear epitope peptide in a scrambled mode to be used as a control; b) collecting sera from a mammal that has been exposed to a Tat vaccine or HTV infected; c) incubating the sera in combination with the HTV Tat linear epitope peptide and the scrambled peptide to form a sera/peptide composition; d) adding the sera/peptide composition to ELISA plates coated with intact Tat antigen; e) measuring bound antibodies to the intact Tat antigen wherein increased binding to the Tat antigen indicates increased recognition of conformational epitopes of the intact Tat antigen and decreased binding indicates recognition of Tat linear epitope.

25. The assay according to claim 24, wherein the Tat linear epitope peptide comprises from about 15 to 20 amino acid residues from the amino terminus epitope.

26. A method to increase immune response to a Tat vaccine by increasing recognition of Th epitopes thereby promoting T-cell activation; the method comprising introducing an immunogen comprising an HTV Tat linear epitope peptide conjugated to a HTV Gag protein.

27. The method according to claim 26, wherein the HTV Tat linear epitope peptide comprises sequences 1-20 of the amino terminus, 51-70 (basis region) or 82-101 (carboxy region).

28. The method according to claim 27, wherein the HIV Tat linear epitope peptide comprises at least amino acid 7 and amino acid 12; amino acids 57-59 or amino acids 93-94.

29. The method according to claim 26, wherein the immunogen is a fusion construct comprising a coding region of the HTV Tat linear epitope peptide linked to the 5' end of the Gag coding construct.