WO2005082041A2 - Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription - Google Patents

Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription Download PDF

Info

Publication number
WO2005082041A2
WO2005082041A2 PCT/US2005/006067 US2005006067W WO2005082041A2 WO 2005082041 A2 WO2005082041 A2 WO 2005082041A2 US 2005006067 W US2005006067 W US 2005006067W WO 2005082041 A2 WO2005082041 A2 WO 2005082041A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
specific
primer
pcr
target
Prior art date
Application number
PCT/US2005/006067
Other languages
French (fr)
Other versions
WO2005082041A3 (en
Inventor
Antonette C. Allen
Francis Chiafari
Michael Mitas
David Coles
Original Assignee
Brt Laboratories, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brt Laboratories, Inc. filed Critical Brt Laboratories, Inc.
Publication of WO2005082041A2 publication Critical patent/WO2005082041A2/en
Publication of WO2005082041A3 publication Critical patent/WO2005082041A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • This invention relates generally to the field of diagnosing a disease by detecting gene-specific markers in a tissue sample, using RT-PCR. Specifically, the invention relates to a panel of truncated gene-specific reverse transcription primers that can enhance detection of a cancer gene in a tissue sample.
  • PET paraffin-embedded tissues
  • PET samples can be used for RT-PCR analysis.
  • the introduction of real-time RT-PCR has helped to overcome some of the difficulties of analyzing degraded RNA due to the fact that this technology has been optimized for the sensitive amplification and detection of short gene fragments (3,1,4).
  • the results obtained from PET sample analysis are highly dependent on the efficiency of reverse transcription.
  • two priming methods are commonly used in cDNA synthesis: oligo(dT) primers and random hexamers. Oligo(dT) primers anneal to the poly(A) tail of mRNA.
  • this invention in one aspect, relates to a target-specific reverse transcription (RT) primer comprising 10-16 nucleotides.
  • the invention relates to a target-specific polymerase chain reaction (PCR) primer comprising a nucleic acid selected from the group consisting of 5'-CCAAATGCGGCA-3', 5'-TGCAGTTCTGTGA-3', 5'-GCAGTGACTTCGT- 3', 5'-TGAAGTACACTGG-3', 5'-AGCCACTTCTGC-3', 5'- TGTAGCTGTTGCA3', 5'-GCCACCATTACCT-3' and 5'-
  • PCR polymerase chain reaction
  • GAACCAACTCAGGC-3' and further comprising at least 5 additional 3' target-specific nucleotides.
  • the invention relates to a target-specific PCR primer, wherein the primer is selected from the group consisting of 5 '-
  • GCCGTGTGAACCATGTGACTTT 5'-CGGATGAAACTCTGAGCAATGT, 5'- GCCAACAAAGCTCAGGACAAC, 5'- CGCAGCTCAGGAAGAATGTG, 5'- AGTGCTCAAGGACATCGAGACG, 5'- GGGCCACTGTCGCATCATGATTGG, 5'-ACCATCCTATGAGCGAGTACCC and 5'-CCCTGGAAGCCTGCAAATT.
  • the invention in another aspect, relates to a RT-PCR method comprising a) reverse transcribing RNA using a target-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product; and b) amplifying the DNA product using a target-specific forward PCR primer and a target-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer.
  • the invention in another aspect, relates to a method of detecting a cancer marker in formalin-fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using a marker-specific RT primer comprising 10- 16 nucleotides to produce a target-specific DNA product and b) amplifying the DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of an amplification product indicating the presence of the cancer marker in the tissue.
  • the invention in yet another aspect, relates to a method of detecting a cancer in formalin-fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using an RT primer specific for a marker for the cancer, wherein the primer comprises 10-16 nucleotides, to produce a marker-specific DNA product and b) amplifying the marker-specific DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of a the marker-specific amplification product indicating the presence of the cancer in the tissue.
  • the present invention overcomes the problems in the art by preserving the enhanced nature of signal detection of gene-specific pruning and preventing primer- dimer formation.
  • the present invention provides novel short primers (10-16 nucleotides in length) that corresponded to the 5 '-end of the reverse primer used for PCR.
  • the use of a panel of truncated gene-specific primers during reverse transcription is superior to the use of random hexamers, ultimately resulting in significant and unexpected enhancement of gene fragment detection from PET samples containing highly degraded RNA.
  • Fig. 1 shows that a panel of truncated gene-specific primers used in reverse transcription enhances gene detection in PET samples.
  • RNA from 80 micron sections of formalin-fixed, paraffin-embedded breast (A and B), lung (C) and colon (D) cancer tissues was isolated and reverse transcribed using either random hexamers (open bars), a single gene-specific primer (•_ ⁇ . « constructive mam, pip, KS1/4, PSE, CEA; filled bars; A), or a panel of truncated gene-specific primers (striped bars).
  • PCR was performed using primers for genes indicated in the figure.
  • Gene detection signals are expressed as cycle threshold (Ct) values.
  • nucleic acid includes mixtures of nucleic acids.
  • Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
  • the present invention provides a target-specific reverse transcription (RT) primer comprising 10-16 nucleotides.
  • target-specific or “gene-specific” is meant that the primer amplifies only a nucleic acid from a particular target nucleic acid sequence or a particular gene sequence.
  • the RT primer of the invention can be used not only to reverse transcribe RNA in the transcription step of a reverse transcription-polymerase chain reaction (RT-PCR), but it can also be contained in a target-specific reverse PCR primer for amplification of a DNA product in a RT-PCR.
  • RT-PCR reverse transcription-polymerase chain reaction
  • the truncated, gene-specific RT primer of this invention is the 5'- portion of a reverse PCR primer sequence, wherein the melting temperature of the RT primer is about 5°C to about 20°C lower than the melting temperature of the corresponding reverse PCR primer.
  • the melting temperature of an RT primer of the invention can be 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C or 20°C lower than the melting temperature of a corresponding PCR primer.
  • the melting temperature of an RT primer of the invention is from about 40°C to about 42°C
  • the melting temperature of a PCR primer is the typical melting temperature for a PCR primer, i.e. about 60°C.
  • the 5'- 10 to 16 nucleotides of any reverse PCR primer can be identified as a functional truncated, gene-specific RT primer if the melting temperature of the 5'- 10 to 16 nucleotide sequence is about 5°C to about 20°C lower than the melting temperature of the corresponding reverse PCR primer.
  • a person of skill can design and screen RT primers of the invention for use in the RT-PCR methods of the invention by determining that a 5'- 10 to 16 nucleotides of a PCR reverse primer has a melting point from about 40°C to about 42°C, and the melting temperature of the corresponding PCR reverse primer is about 60°C.
  • To calculate the melting temperature of various primers there are well-known computer programs available that take into account salt concentrations, % GC content and nucleotide length.
  • An example of a computer program is Primer Express® software, available through ABI (Foster City, CA).
  • a further routine option is to empirically calculate the melting temperature of the putative RT primer that consists of the 5' nucleotides of the reverse PCR primer to be used in the RT-PCR protocol.
  • nucleic acid refers to single or multiple stranded molecules which may be DNA or RNA, or any combination thereof, including modifications to those nucleic acids.
  • the nucleic acid may represent a coding strand or its complement, or any combination thereof.
  • Nucleic acids may be identical in sequence to the sequences which are naturally occurring for any of the moieties discussed herein or may include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. These nucleic acids can also be modified from their typical structure.
  • Such modifications include, but are not limited to, methylated nucleic acids, the substitution of a non-bridging oxygen on the phosphate residue with either a sulfur (yielding phosphorothioate deoxynucleotides), selenium (yielding phosphorselenoate deoxynucleotides), or methyl groups (yielding methylphosphonate deoxynucleotides), a reduction in the AT content of AT rich regions, or replacement of non-preferred codon usage of the expression system to preferred codon usage of the expression system.
  • the primers of the present invention are capable of interacting with various cancer genes as disclosed herein.
  • the cancer genes can be detected in a primary cancerous tumor and in a secondary (metastatic) cancerous tumor.
  • the target-specific primers of the present invention are capable of interacting with any target nucleic acid based on the present teaching.
  • Nucleic acids capable of detection with the present primers or methods include viral RNA or DNA (e.g., HIV, retroviruses, cytomegalovirus, adenovirus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis E virus, Herpes I virus, Herpes II virus, influenza virus, polio virus, vaccinia and smallpox virus), genes upregulated in response to infection by pathogens and genes whose expression patterns are of interest.
  • viral RNA or DNA e.g., HIV, retroviruses, cytomegalovirus, adenovirus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis E virus, Herpes I virus, Herpes II virus, influenza virus, polio virus, vaccinia and smallpox virus
  • the primers are used to support DNA amplification reactions.
  • the primers will be capable of being extended in a sequence- specific manner.
  • Extension of a primer in a sequence-specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer.
  • Extension of the primer in a sequence-specific manner therefore, includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription or reverse transcription. Techniques and conditions that amplify the primer in a sequence-specific manner are preferred.
  • the primers are used for the DNA amplification reactions, such as PCR or direct sequencing.
  • the primers can also be extended using non-enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner.
  • the disclosed primers hybridize with a gene or region of a gene or they hybridize with the complement of a gene or complement of a region of a gene.
  • the present invention provides a panel of truncated gene-specific RT primers that can be used to increase the likelihood of detecting a cancer gene in a tissue, compared to using random hexamers.
  • a panel of primers directed to breast cancer genes 2 m, mam, PIP, KS1/4, PSE and CEA can be used.
  • a panel of primers directed to m 2 tn, CEA, CK19, mud, and lunx can be used.
  • a primer of the invention is a nucleotide sequence that is specific for a cancer gene.
  • Such a primer that is "specific," for example, for a breast cancer gene, a lung cancer gene or a colon cancer gene is a nucleic acid that contains a sufficient number of contiguous nucleotides to be unique.
  • a primer of the invention must be of sufficient size to distinguish it from other known sequences, most readily determined by comparing any nucleic acid primer comprising 10-16 nucleotides to the nucleotide sequences of nucleic acids in computer databases, such as GenBank. Such comparative searches are standard in the art.
  • the present RT primers can be at least about 10 to about 16 nucleotides in length. That is, a primer can be 10, 11, 12, 13, 14, 15 or 16 nucleotides in length.
  • RT primers of the invention can be 12, 13 or 14 nucleotides in length.
  • Representative examples of RT primers of the invention include, but are not limited to, CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA(SEQ ID N0:2), GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID N0:4), AGCCACTTCTGC (SEQ ID N0:5), TGTAGCTGTTGCA(SEQ ID N0:6), GCCACCATTACCT (SEQ ID N0:7) and GAACCAACTCAGGC (SEQ ID NO:8) ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGTTGGand GTGTGAGGCCAT.
  • the present invention provides a reverse PCR primer comprising at its 5'- end 10 to 16 target-specific nucleotides that correspond to an RT primer to be used in conjunction with the reverse PCR primer in an RT-PCR protocol.
  • the reverse PCR primer can have about 5 to about 9 additional target-specific nucleotides.
  • a reverse PCR primer can have 5, 6, 7, 8 or 9 additional target-specific nucleotides at its 3'- end.
  • a nucleic acid useful as a PCR primer will be at least about 15 to about 25 nucleotides in length, depending upon the specific nucleotide content of the sequence.
  • a person of skill would be able to routinely design the RT and PCR primers to be used in conjunction in the present RT-PCR method. It is the relationship between the RT primer and the reverse PCR primer as described herein that provides a key advantage to the RT and PCR primers.
  • the present invention also provides examples of target-specirlc PCR primers comprising a nucleic acid selected from the group consisting of 5'- CCAAATGCGGCA-3' (SEQ ID NO:l), 5'-CTGCAGTTCTGTGA-3' (SEQ ID NO:2), 5'-GCAGTGACTTCGT-3' (SEQ ID NO:3), 5'-TGAAGTACACTGG-3' (SEQ ID NO:4), 5'-AGCCACTTCTGC-3' (SEQ ID NO:5), 5'- TGTAGCTGTTGCA3' (SEQ ID NO:6), 5'-GCCACCATTACCT-3' (SEQ ID NO:7), 5'-GAACCAACTCAGGC-3' (SEQ ID NO:8), 5'- ACCAATTGCAGAAGAC-3', 5'-ATCCCCTTGGCAA-3', 5'-
  • a target-specific PCR primer of the invention can be a reverse primer.
  • a reverse PCR primer include, but are not limited to,
  • CTGCAGTTCTGTGAGCCAAAG SEQ ID NO: 10
  • a target-specific forward PCR primer of the invention can be selected from the group consisting of 5 '-GCCGTGTGAACCATGTGACTTT (SEQ ID NO: 17),
  • AGTGCTCAAGGACATCGAGACG SEQ ID NO:21
  • 5'- GGGCCACTGTCGCATCATGATTGG SEQ ID NO:22
  • the present invention further provides pairs of PCR primers, comprising a forward primer and a reverse primer, that can be used in the PCR step of the RT- PCR method of the invention.
  • primer pairs include, but are not limited to, nucleic acids having the sequences identified as SEQ ID NO: 17 and SEQ ID NO:9; SEQ ID NO:18 and SEQ ID NO:10; SEQ ID NO:19 and SEQ ID NO:l 1; SEQ ID NO:20 and SEQ ID NO:12; SEQ ID NO:21 and SEQ ID NO:13; SEQ ID NO:22 and SEQ ID NO:14; SEQ ID NO:23 and SEQ ID NO:15 and SEQ ID NO:24 and SEQ ID NO: 16.
  • other pairs of PCR primers can be used to identify the following markers: SBEM, ErbB2, EpCam, PDEF, HoxC6 and POTE.
  • These primer pairs can be matched with the RT primers taught herein to provide exemplary primer sets for a highly sensitive and specific RT-PCR method that can be used in a variety of tissues, but is particularly advantageous in preserved, embedded tissues.
  • an RT-PCR method comprising a) reverse transcribing RNA using a target-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product and b) amplifying the DNA product using a target-specific forward PCR primer and a target-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer.
  • the RT-PCR method can be used to detect a gene in any type of tissue whether it is preserved or non-preserved.
  • An advantage of the present primers and RT-PCR methods is that they can be used to identify specific nucleic acids in tissue that has low levels of RNA or DNA.
  • Tissues with low levels of nucleic acids include body fluids (e.g., peripheral blood, urine, cerebrospinal fluid, pulmonary lavage, gastric lavage, bile, vaginal secretions, seminal fluid, aqueous humor and vitreous humor).
  • body fluids e.g., peripheral blood, urine, cerebrospinal fluid, pulmonary lavage, gastric lavage, bile, vaginal secretions, seminal fluid, aqueous humor and vitreous humor.
  • Another advantage of the present primers and RT-PCR methods is that they can be used to identify specific nucleic acids in tissues in which the nucleic acids are often highly degraded or otherwise modified from their native state. Examples of these tissues include fixed (e.g., formalin-fixed) tissues, and embedded (e.g., paraffin- embedded) tissues.
  • the method can be used on fixed, embedded tissue, fresh tissue and fresh-frozen tissue and body fluids.
  • the method of the present invention can be used to amplify any specific nucleic acid target and has the same advantages over oligo(dT) primers and random hexamers in a RT-PCR, regardless of the target gene.
  • gene targets include, but are not limited to, a breast cancer gene, for example, • 2 m, mam, PIP, KS1/4, PSE, CEA, lung and colon cancer genes, for example, % jm, CEA, CK19, mucl, and lunx and esophageal cancer, for example, • 2 , SBEM, ErbB2, EpCam, PDEF, CEA, HoxC6 and POTE.
  • the reverse PCR primer comprises the RT primer on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end.
  • Representative examples of the reverse PCR primers comprise a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2), GCAGTGACTTCGT (SEQ ID NO:3),
  • TGAAGTACACTGG SEQ ID NO:4
  • AGCCACTTCTGC SEQ ID NO:5
  • TGTAGCTGTTGCA SEQ ID NO:6
  • GCCACCATTACCT SEQ ID NO:7
  • GAACCAACTCAGGC SEQ ID NO: 8
  • ACCAATTGCAGAAGAC ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end.
  • a reverse PCR primer can be selected from the group of nucleic acids identified as, for example, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO: 16, and the following nucleotide sequences: 5'- ACCAATTGCAGAAGACTCAGC, 5'-ATCCCCTTGGCAATCTGCA, 5'- TGAAGTACACTGGCATTGACGA, 5 '-AGCCACTTCTGCACATTGCTG, 5 '- AAAGCGCGTTGGCGATCT and 5 '-GTGTGAGGCCATGCTTGTTTG.
  • the present invention further provides an RT-PCR method that utilizes pairs of PCR primers, comprising a forward primer and a reverse primer.
  • primer pairs include, but are not limited to, nucleic acids having the sequences identified as SEQ ID NO:17 and SEQ ID NO:9; SEQ ID NO:18 and SEQ ID NO:10; SEQ ID NO:19 and SEQ ID NO:ll; SEQ ID NO:20 and SEQ ID NO:12; SEQ ID NO:21 and SEQ ID NO:13; SEQ ID NO:22 and SEQ ID NO:14; SEQ ID NO:23 and SEQ ID NO: 15 and SEQ ID NO:24 and SEQ ID NO: 16.
  • Additional pairs of PCR primers of the invention include the following nucleotide sequences: F 5'-
  • the RT-PCR method of the invention can utilize the PCR primer pairs, matched with the RT primers taught herein, to provide examples of a highly sensitive and specific RT- PCR method that can be used for a variety of tissues and targets, but is particularly advantageous in preserved, embedded tissues or for targets that are expected to be present at low levels.
  • the RT-PCR method of the invention provides a reverse transcription step that results in a mean 16 (+/- 5.2) -fold increase in signal detection compared to priming with random hexamers.
  • the reverse transcription step results in fold increases in signal detection of 1.3 for CK19, 5 for CEA, 9 ⁇ o ⁇ PSE, 17 to 41 for ⁇ , mam, PIP and KS1/4, and 66 for mud compared to priming with random hexamers. That is, the mean-fold increase in signal detection compared to priming with random hexamers is from about 10.8-fold to about 21.2-fold.
  • target-specific RT primers and target-specific PCR primers for more than one target can be used in a single reaction.
  • the temperature range used during the RT step allows the primers to hybridize to their specific RNA template in the reverse transcription reaction, but not during the PCR step.
  • the primers of the invention can be used as a panel of primers while preserving the enhanced nature of signal detection of gene-specific priming and preventing primer-dimer formation.
  • Another aspect of the invention is a method of detecting a cancer marker in a formalin-fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using a marker-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product and b) amplifying the DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of an amplification product indicating the presence of the cancer marker in the tissue.
  • Another aspect of the invention is a method of detecting cancer in formalin- fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using an RT primer specific for a marker for the cancer, wherein the primer comprises 10-16 nucleotides, to produce a marker-specific DNA product and b) amplifying the marker-specific DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of a the marker-specific amplification product indicating the presence of the cancer in the tissue.
  • a marker for a cancer for example, breast, lung, colon and esophageal cancer, can be CK19, CEA, PSE, ' 2 m, mam, PIP, mud, SBEM, ErbB2, EpCam, PDEF, HoxC6 and/or POTE.
  • forward PCR primers that can be used according to the methods of the invention include, but are not limited to, nucleic acids having the sequence identified as SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID.NO:23, SEQ ID NO:24 and the following nucleotide sequences: 5'-CCACTGCTCGTAAAGACATTCC, 5'- CTGGTGACACAGCTTATGCCCT, 5'- CGCAGCTCAGGAAGAATGTG, 5'- AGTGCTCAAGGACATCGAGACG, 5'-CCTGGATGCAGCGAATGAA and 5'- TTGCTGGAACATGCGACTGAT.
  • a reverse PCR primer comprises a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2), GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID NO:4), AGCCACTTCTGC (SEQ ID NO:5), TGTAGCTGTTGCA (SEQ ID NO:6), GCCACCATTACCT (SEQ ID NO:7) and GAACCAACTCAGGC (SEQ ID NO:8) ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT on its 5' end, and further comprises at least about 5 to about 20 additional target-specific nucleotides on its 3' end.
  • marker-specific RT primers and marker-specific PCR primers for more than one marker can be used in a single reaction.
  • reverse PCR primers that can be used according to the methods of the invention include, but are not limited to, nucleic acids identified as SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and the following nucleotide sequences: 5'- ACCAATTGCAGAAGACTCAGC, 5'- ATCCCCTTGGCAATCTGCA, 5 '- TGAAGTACACTGGCATTGACGA, 5 '- AGCCACTTCTGCACATTGCTG, 5 '-AAAGCGCGTTGGCGATCT and 5'- GTGTGAGGCCATGCTTGTTTG.
  • Example 1 In an effort to preserve the enhanced nature of signal detection of gene- specific priming and prevent primer-dimer formation, short primers (12-14) nucleotides in length) that corresponded to the 5 '-end of the reverse primer used for PCR were designed (Table 1).
  • the annealing temperatures for the resulting primers are 40° to 42°C, a range that allows the primers to hybridize to their specific template in the reverse transcription reaction, but not during PCR. It was hypothesized that the use of a panel of truncated gene-specific primers during reverse transcription would be superior to the use of random hexamers, ultimately resulting in significant enhancement of gene fragment detection from PET samples containing highly degraded RNA.
  • RNA was extracted using an equal volume of phenol:chloroform:isoamyl (125:24:1) solution (Sigma). The aqueous layer containing RNA was transferred to a new 1.5 mL tube. After adding 2 • g of glycogen and one volume of isopropanol, precipitation was performed at- 80°C for 1-2 hours. After centrifugation at 12,000 rpm for 30 minutes (4°C), the RNA pellet was washed with 70% of ethanol and air-dried at room temperature.
  • Amp® 5700 Sequence Detection System (Foster City, CA).
  • the standard reaction volume was 10 • L and contained IX QuantiTect SYBR Green PCR Master Mix (Qiagen), 0.1 U AmpErase® UNG enzyme (PE Biosystems); 0.7 • L cDNA template; and 0.25 • M of both forward and reverse primer (Table 1).
  • Ct cycle threshold
  • l.C and PIP in one of the breast cancer specimens were easily detected when a panel of truncated gene-specific primers was used, whereas priming with hexamers did not always result in signal detection.
  • the lunx gene was not detected with either random hexamers or gene-specific primers. It was also observed that using RNA from fresh frozen tissues, a panel of truncated gene-specific primers worked as well as oligo(dT) primers but better than random hexamers (an average of 4.2 (+/- 1.1) Ct units increase in signal detection).
  • RNA from a 80 micron section of formalin-fixed, paraffin-embedded breast cancer tissue was isolated and reverse transcribed in separate reactions using: either single truncated gene-specific primers (• m, mam, pip, KS1/4, PSE, or CEA), or a panel of truncated gene-specific primers containing all six primers.
  • a reaction without reverse transcriptase was included as a negative control.
  • real-time PCR was performed using specific forward and reverse primers. In this experiment (Fig.1 A), it was observed that reverse transcription with a panel of truncated gene-specific primers was comparable in efficiency to reverse transcription with single truncated gene-specific primers, supporting the approach of simultaneous reverse transcription for multiple genes.
  • the signal detection from PET samples is significantly enhanced when a panel of truncated gene-specific primers is used, making this approach suitable for high throughput multi-marker molecular analysis.
  • This modification facilitates the use of stored PET samples with known clinical outcome, opening an enormous resource for retrospective clinical studies to validate the use of diagnostic and/or prognostic genetic markers, and to define the genetic pathogenesis of different diseases.
  • RT-PCR was performed to detect markers found in esophageal cancer.
  • Table 2 provides examples of the RT and PCR primers used.
  • uncated gene -specif ic primers for reverse transcription correspond 5' -end of reverse primers designed for PCR.
  • Lunx is a Superior Molecular Marker for Detection of Non-Small Lung Cell Cancer in Peripheral Blood
  • lunx 10/24, 42%), mud (5/24, 21%), and CK19 (5/24, 21%) were overexpressed in 14/24 (58%) peripheral blood samples obtained from NSCLC patients.
  • Oligonucleotides All primers were designed according to the method taught herein. In addition to having the appropriate target specificity and melting temperature, they also spanned at least one intron, and failed to amplify negative control cDNA in which reverse transcriptase enzyme was omitted. Sequences of the internal control • 2 -microglobin PCR primers were: 5' GCCGTGTGAACCATGTGA (forward) and 5' CCAAATGCGGCATCTTCA (reverse). Other sequences (previously described [22]) were: lunx, CCCTGGAAGCCTGCAAATT (F) GAACCAACTCAGGCAGGACTTT (R); KS1/4, CGCAGCTCAGGAAGAATGTG
  • Synthetic lunx fragment for gene copy determination ccctggaagcctgcaaattucucugcuugauggacuuggccccuccccauucaaggucuucuggacagccuca cagggaucuugaauaaagtcctgcctgagttggttc.
  • Peripheral Blood Specimens Peripheral Blood Specimens. Peripheral blood specimens (10-20mL) were collected using K 3 EDTA tubes (Vacutainer®) and immediately placed on ice. Samples were then processed using a porous barrier density gradient centrifugation media (OncoQuick®, Hexal Gentech, Holzmün, Germany) per manufacturer instructions. Briefly, Pre-cooled 50 mL centrifugation tubes containing 15 mL of separation medium below a porous barrier were filled with peripheral blood and centrifuged at 1600g for 20 min. The entire volume of the upper compartment was then collected and washed for 10 min at 200g. Cells were pelleted and evaluated as described below.
  • RNA isolation and gene-specific cDNA synthesis Total cellular RNA was isolated from pelleted cells using a guanidinum thiocyanate-phenol-chloroform solution (RNA STAT-60TM; TEL-TEST, Friendswood, TX). Briefly, pelleted cells recovered from peripheral blood specimens were resuspended in 1 ml of RNA STAT-60TM. Total RNA was isolated as per manufacturer's instructions with the exception that 1 1 of a 50 mg/ml solution of glycogen (Sigma, St. Louis, MO) was added to the aqueous phase prior to addition of isopropanol. Final RNA pellet was dissolved in 50 1 of lx RNA secure buffer (Ambion, Austin, TX).
  • Complementary DNA cDNA was made from 5 g of total RNA using 200 U of M-MLV reverse transcriptase (Promega, Madison, WI) and the following gene- specific RT primers (70 « ng each): CCAAATGCGGCAT ( 2 -microglobi ), TGAAGTACACTGG (KSI/4), GAACCAACTCAGGC (lunx), GCCACCATTACCT (mud), TGATTCTGCCGC (CK19),
  • GTTCCCATCAATCAG CEA
  • AGCCACTTCTGC PSE
  • Final reaction volume 20 1.
  • the annealing temperature was in accordance with standard RT conditions, i.e., approximately 40-42°C.
  • Real-time RT-PCR was performed on a PE Biosystems Gene Amp® 5700 Sequence Detection System (Foster City, CA). All reaction components were purchased from PE Biosystems. Standard reaction volume was 10 1 and contained IX SYBR Green PCR Buffer, 3.5mM MgCl 2 , 0.2mM each of dATP, dCTP, dGTP, and 0.4mM of dUTP, 0.25U AmpliTaq Gold®, 0.1U AmpErase® UNG enzyme, 0.7 1 cDNA template, and 0.25mM of forward and reverse primer.
  • PBDG porous barrier density gradient
  • Ghossein RA Carusone L, Bhattacharya S: Molecular detection of micrometastases and circulating tumor cells in melanoma prostatic and breast carcinomas. In Vivo 2000, 14:237-250 18. Datta YH, Adams PT, Drobyski WR, Ethier SP, Terry VH, Roth MS :
  • RNA extracted from paraffin-embedded human tissues is amenable to analysis by PCR amplification. Biotechniques 11:304,
  • Lunx is a superior molecular marker for detection of non-smaU lung cell cancer in peripheral blood. J Mol Diagn 5:237-242.

Abstract

The present invention provides truncated gene-specific primers in panels that can be used during the reverse transcription step of RT-PCR to increase signal detection of cancer gene markers in a tissue sample. Also provided are forward and reverse primers for RT-PCR. Methods of using the primers are also provided.

Description

ENHANCED DETECTION OF RNA USING A PANEL OF TRUNCATED GENE-SPECIFIC PRIMERS FOR REVERSE TRANSCRIPTION
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
This invention relates generally to the field of diagnosing a disease by detecting gene-specific markers in a tissue sample, using RT-PCR. Specifically, the invention relates to a panel of truncated gene-specific reverse transcription primers that can enhance detection of a cancer gene in a tissue sample.
BACKGROUND ART
Formalin-fixed, paraffin-embedded tissues (PET) are a unique source of research material with the potential of providing biological information in conjunction with known clinical outcome. Specifically, these tissues could be an ideal resource for validating newly discovered genes as diagnostic and/or prognostic molecular markers in retrospective studies. Unfortunately, RNA isolated from PET samples is considered to be a poor material for molecular analyses, since RNA is frequently degraded to 100-200 bp fragments by endogenous and exogenous ribonucleases (RNase) (1). In addition, Masuda et al have shown that RNA, and in particular the poly(A) tail of mRNA, is chemically modified, making it a poor template for cDNA synthesis (2). Despite the technical obstacles in the analysis of PET samples, significant improvements have been made in recent years, and various studies have shown that PET samples can be used for RT-PCR analysis. The introduction of real-time RT- PCR has helped to overcome some of the difficulties of analyzing degraded RNA due to the fact that this technology has been optimized for the sensitive amplification and detection of short gene fragments (3,1,4). The results obtained from PET sample analysis are highly dependent on the efficiency of reverse transcription. Depending on the quality of RNA, two priming methods are commonly used in cDNA synthesis: oligo(dT) primers and random hexamers. Oligo(dT) primers anneal to the poly(A) tail of mRNA. Although this method is preferred with high quality RNA, some studies have also used it for PET analysis (5,2). In the case of degraded mRNA, where the poly(A) tail is often fragmented and/or chemically modified (PET samples), the use of random hexamers is preferred (1,4,6). The major limitation of priming with random hexamers is that any RNA template, not just mRNA, can be primed. There is a third less frequently used priming method that relies on gene- specific primers. Gene-specific reverse transcription is used to increase the specificity of the cDNA synthesis and/or enhance the detection level of low abundance RNA transcripts. Although studies have shown that gene-specific reverse transcription can increase the signal detection for a single gene (7,8), the use of multiple gene-specific primers in a single reaction has been problematic due to the presumed formation of primer-dimers that interfere with the reverse transcription and/or subsequent PCR (9). SUMMARY OF THE INVENTION
In accordance with the purposes of this invention, as embodied and broadly described herein, this invention, in one aspect, relates to a target-specific reverse transcription (RT) primer comprising 10-16 nucleotides.
In another aspect, the invention relates to a target-specific polymerase chain reaction (PCR) primer comprising a nucleic acid selected from the group consisting of 5'-CCAAATGCGGCA-3', 5'-TGCAGTTCTGTGA-3', 5'-GCAGTGACTTCGT- 3', 5'-TGAAGTACACTGG-3', 5'-AGCCACTTCTGC-3', 5'- TGTAGCTGTTGCA3', 5'-GCCACCATTACCT-3' and 5'-
GAACCAACTCAGGC-3', and further comprising at least 5 additional 3' target- specific nucleotides.
In yet another aspect, the invention relates to a target-specific PCR primer, wherein the primer is selected from the group consisting of 5 '-
GCCGTGTGAACCATGTGACTTT, 5'-CGGATGAAACTCTGAGCAATGT, 5'- GCCAACAAAGCTCAGGACAAC, 5'- CGCAGCTCAGGAAGAATGTG, 5'- AGTGCTCAAGGACATCGAGACG, 5'- GGGCCACTGTCGCATCATGATTGG, 5'-ACCATCCTATGAGCGAGTACCC and 5'-CCCTGGAAGCCTGCAAATT.
In another aspect, the invention relates to a RT-PCR method comprising a) reverse transcribing RNA using a target-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product; and b) amplifying the DNA product using a target-specific forward PCR primer and a target-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer. In another aspect, the invention relates to a method of detecting a cancer marker in formalin-fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using a marker-specific RT primer comprising 10- 16 nucleotides to produce a target-specific DNA product and b) amplifying the DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of an amplification product indicating the presence of the cancer marker in the tissue.
In yet another aspect, the invention relates to a method of detecting a cancer in formalin-fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using an RT primer specific for a marker for the cancer, wherein the primer comprises 10-16 nucleotides, to produce a marker-specific DNA product and b) amplifying the marker-specific DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of a the marker-specific amplification product indicating the presence of the cancer in the tissue.
The present invention overcomes the problems in the art by preserving the enhanced nature of signal detection of gene-specific pruning and preventing primer- dimer formation. The present invention provides novel short primers (10-16 nucleotides in length) that corresponded to the 5 '-end of the reverse primer used for PCR. The use of a panel of truncated gene-specific primers during reverse transcription is superior to the use of random hexamers, ultimately resulting in significant and unexpected enhancement of gene fragment detection from PET samples containing highly degraded RNA. Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
BRIEF DESCRIPTION OF THE DRAWINGS
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and together with the description, serve to explain the principles of the invention. Fig. 1 shows that a panel of truncated gene-specific primers used in reverse transcription enhances gene detection in PET samples. RNA from 80 micron sections of formalin-fixed, paraffin-embedded breast (A and B), lung (C) and colon (D) cancer tissues was isolated and reverse transcribed using either random hexamers (open bars), a single gene-specific primer (•_■.«„ mam, pip, KS1/4, PSE, CEA; filled bars; A), or a panel of truncated gene-specific primers (striped bars). PCR was performed using primers for genes indicated in the figure. Gene detection signals are expressed as cycle threshold (Ct) values.
DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the Examples included therein and to the Figures and their previous and following description. Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that this invention is not limited to specific synthetic methods, specific nucleic acids, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a nucleic acid includes mixtures of nucleic acids. Ranges may be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings: "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, the phrase "optionally substituted nucleic acid" means that the nucleic acid may or may not be substituted and that the description includes both unsubstituted nucleic acid and nucleic acid where there is substitution.
The present invention provides a target-specific reverse transcription (RT) primer comprising 10-16 nucleotides. By "target-specific" or "gene-specific" is meant that the primer amplifies only a nucleic acid from a particular target nucleic acid sequence or a particular gene sequence. The RT primer of the invention can be used not only to reverse transcribe RNA in the transcription step of a reverse transcription-polymerase chain reaction (RT-PCR), but it can also be contained in a target-specific reverse PCR primer for amplification of a DNA product in a RT-PCR.
The truncated, gene-specific RT primer of this invention is the 5'- portion of a reverse PCR primer sequence, wherein the melting temperature of the RT primer is about 5°C to about 20°C lower than the melting temperature of the corresponding reverse PCR primer. Thus, the melting temperature of an RT primer of the invention can be 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C or 20°C lower than the melting temperature of a corresponding PCR primer. For example, the melting temperature of an RT primer of the invention is from about 40°C to about 42°C, and the melting temperature of a PCR primer is the typical melting temperature for a PCR primer, i.e. about 60°C. It is contemplated that the 5'- 10 to 16 nucleotides of any reverse PCR primer can be identified as a functional truncated, gene-specific RT primer if the melting temperature of the 5'- 10 to 16 nucleotide sequence is about 5°C to about 20°C lower than the melting temperature of the corresponding reverse PCR primer. Thus, for example, a person of skill can design and screen RT primers of the invention for use in the RT-PCR methods of the invention by determining that a 5'- 10 to 16 nucleotides of a PCR reverse primer has a melting point from about 40°C to about 42°C, and the melting temperature of the corresponding PCR reverse primer is about 60°C. To calculate the melting temperature of various primers, there are well-known computer programs available that take into account salt concentrations, % GC content and nucleotide length. An example of a computer program is Primer Express® software, available through ABI (Foster City, CA). A further routine option is to empirically calculate the melting temperature of the putative RT primer that consists of the 5' nucleotides of the reverse PCR primer to be used in the RT-PCR protocol.
As used herein, the term "nucleic acid" refers to single or multiple stranded molecules which may be DNA or RNA, or any combination thereof, including modifications to those nucleic acids. The nucleic acid may represent a coding strand or its complement, or any combination thereof. Nucleic acids may be identical in sequence to the sequences which are naturally occurring for any of the moieties discussed herein or may include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. These nucleic acids can also be modified from their typical structure. Such modifications include, but are not limited to, methylated nucleic acids, the substitution of a non-bridging oxygen on the phosphate residue with either a sulfur (yielding phosphorothioate deoxynucleotides), selenium (yielding phosphorselenoate deoxynucleotides), or methyl groups (yielding methylphosphonate deoxynucleotides), a reduction in the AT content of AT rich regions, or replacement of non-preferred codon usage of the expression system to preferred codon usage of the expression system. The primers of the present invention are capable of interacting with various cancer genes as disclosed herein. Representative cancer genes that can be detected by the primers of the invention include, but are not limited to, cancer genes related to breast, esophagus, lung, colon, skin, brain, bone, salivary gland, liver, stomach, pancreas, gall bladder, kidney, bladder, prostate, lymphoma, leukemia and sarcoma. The cancer genes can be detected in a primary cancerous tumor and in a secondary (metastatic) cancerous tumor.
The target-specific primers of the present invention are capable of interacting with any target nucleic acid based on the present teaching. Nucleic acids capable of detection with the present primers or methods include viral RNA or DNA (e.g., HIV, retroviruses, cytomegalovirus, adenovirus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis E virus, Herpes I virus, Herpes II virus, influenza virus, polio virus, vaccinia and smallpox virus), genes upregulated in response to infection by pathogens and genes whose expression patterns are of interest. One of skill will recognize the innumerable additional targets for the present primers and methods.
In certain embodiments, the primers are used to support DNA amplification reactions. Typically the primers will be capable of being extended in a sequence- specific manner. Extension of a primer in a sequence-specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer. Extension of the primer in a sequence-specific manner, therefore, includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription or reverse transcription. Techniques and conditions that amplify the primer in a sequence-specific manner are preferred. In certain embodiments the primers are used for the DNA amplification reactions, such as PCR or direct sequencing. It is understood that in certain embodiments the primers can also be extended using non-enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner. Typically, the disclosed primers hybridize with a gene or region of a gene or they hybridize with the complement of a gene or complement of a region of a gene.
The present invention provides a panel of truncated gene-specific RT primers that can be used to increase the likelihood of detecting a cancer gene in a tissue, compared to using random hexamers. To detect breast cancer, for example, a panel of primers directed to breast cancer genes 2m, mam, PIP, KS1/4, PSE and CEA can be used. To detect lung and colon cancer, for example, a panel of primers directed to m 2tn, CEA, CK19, mud, and lunx can be used. Thus, a primer of the invention is a nucleotide sequence that is specific for a cancer gene. Such a primer that is "specific," for example, for a breast cancer gene, a lung cancer gene or a colon cancer gene is a nucleic acid that contains a sufficient number of contiguous nucleotides to be unique. To be unique, a primer of the invention must be of sufficient size to distinguish it from other known sequences, most readily determined by comparing any nucleic acid primer comprising 10-16 nucleotides to the nucleotide sequences of nucleic acids in computer databases, such as GenBank. Such comparative searches are standard in the art. The present RT primers can be at least about 10 to about 16 nucleotides in length. That is, a primer can be 10, 11, 12, 13, 14, 15 or 16 nucleotides in length. Further, the RT primers of the invention can be 12, 13 or 14 nucleotides in length. Representative examples of RT primers of the invention include, but are not limited to, CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA(SEQ ID N0:2), GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID N0:4), AGCCACTTCTGC (SEQ ID N0:5), TGTAGCTGTTGCA(SEQ ID N0:6), GCCACCATTACCT (SEQ ID N0:7) and GAACCAACTCAGGC (SEQ ID NO:8) ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGGand GTGTGAGGCCAT.
The present invention provides a reverse PCR primer comprising at its 5'- end 10 to 16 target-specific nucleotides that correspond to an RT primer to be used in conjunction with the reverse PCR primer in an RT-PCR protocol. At its 3'- end the reverse PCR primer can have about 5 to about 9 additional target-specific nucleotides. Thus, a reverse PCR primer can have 5, 6, 7, 8 or 9 additional target-specific nucleotides at its 3'- end. A nucleic acid useful as a PCR primer will be at least about 15 to about 25 nucleotides in length, depending upon the specific nucleotide content of the sequence. Thus, based on the teaching herein, a person of skill would be able to routinely design the RT and PCR primers to be used in conjunction in the present RT-PCR method. It is the relationship between the RT primer and the reverse PCR primer as described herein that provides a key advantage to the RT and PCR primers. The present invention also provides examples of target-specirlc PCR primers comprising a nucleic acid selected from the group consisting of 5'- CCAAATGCGGCA-3' (SEQ ID NO:l), 5'-CTGCAGTTCTGTGA-3' (SEQ ID NO:2), 5'-GCAGTGACTTCGT-3' (SEQ ID NO:3), 5'-TGAAGTACACTGG-3' (SEQ ID NO:4), 5'-AGCCACTTCTGC-3' (SEQ ID NO:5), 5'- TGTAGCTGTTGCA3' (SEQ ID NO:6), 5'-GCCACCATTACCT-3' (SEQ ID NO:7), 5'-GAACCAACTCAGGC-3' (SEQ ID NO:8), 5'- ACCAATTGCAGAAGAC-3', 5'-ATCCCCTTGGCAA-3', 5'-
TGAAGTACACTGG-3', 5'-AGCCACTTCTGC-3', 5'-AAAGCGCGTTGG-3' and 5'-GTGTGAGGCCAT-3' and further comprising at least 5 additional 3' target- specific nucleotides. A target-specific PCR primer of the invention can be a reverse primer.
Representative examples of a reverse PCR primer include, but are not limited to,
5'-CCAAATGCGGCATCTTCAAA (SEQ ID NO:9), 5'-
CTGCAGTTCTGTGAGCCAAAG (SEQ ID NO: 10), 5'-
GCAGTGACTTCGTCATTTGGAC (SEQ ID NO:ll), 5'- TGAAGTACACTGGCATTGACGA (SEQ ID NO:12), 5'-
AGCCACTTCTGCACATTGCTG (SEQ ID NO:13), 5'-
TGTAGCTGTTGCAAATGCTTTAAGAAGAAGC (SEQ ID NO:14), 5'-
GCCACCATTACCTGCAGAAAC (SEQ ID NO: 15) and 5'-
GAACCAACTCAGGCAGGACTTT (SEQ ID NO: 16), 5'- ACCAATTGCAGAAGACTCAGC, 5 '-ATCCCCTTGGCAATCTGCA, 5 '-
TGAAGTACACTGGCATTGACGA, 5'-AGCCACTTCTGCACATTGCTG, 5'-
AAAGCGCGTTGGCGATCT and 5'-GTGTGAGGCCATGCTTGTTTG.
A target-specific forward PCR primer of the invention can be selected from the group consisting of 5 '-GCCGTGTGAACCATGTGACTTT (SEQ ID NO: 17),
5'-CGGATGAAACTCTGAGCAATGT (SEQ ID NO:18), 5'-
GCCAACAAAGCTCAGGACAAC (SEQ ID NO:19), 5'-
CGCAGCTCAGGAAGAATGTG (SEQ ID NO:20), 5'-
AGTGCTCAAGGACATCGAGACG (SEQ ID NO:21), 5'- GGGCCACTGTCGCATCATGATTGG (SEQ ID NO:22), 5'-
ACCATCCTATGAGCGAGTACCC (SEQ ID NO :23) and 5 '- CCCTGGAAGCCTGCAAATT (SEQ ID NO:24), 5'-
CCACTGCTCGTAAAGACATTCC, 5'-CTGGTGACACAGCTTATGCCCT, 5'- CGCAGCTCAGGAAGAATGTG, 5'- AGTGCTCAAGGACATCGAGACG, 5'- CCTGGATGCAGCGAATGAA and 5'-TTGCTGGAACATGCGACTGAT. The present invention further provides pairs of PCR primers, comprising a forward primer and a reverse primer, that can be used in the PCR step of the RT- PCR method of the invention. Examples of the primer pairs include, but are not limited to, nucleic acids having the sequences identified as SEQ ID NO: 17 and SEQ ID NO:9; SEQ ID NO:18 and SEQ ID NO:10; SEQ ID NO:19 and SEQ ID NO:l 1; SEQ ID NO:20 and SEQ ID NO:12; SEQ ID NO:21 and SEQ ID NO:13; SEQ ID NO:22 and SEQ ID NO:14; SEQ ID NO:23 and SEQ ID NO:15 and SEQ ID NO:24 and SEQ ID NO: 16. As shown in Table 2, below, other pairs of PCR primers can be used to identify the following markers: SBEM, ErbB2, EpCam, PDEF, HoxC6 and POTE. These primer pairs can be matched with the RT primers taught herein to provide exemplary primer sets for a highly sensitive and specific RT-PCR method that can be used in a variety of tissues, but is particularly advantageous in preserved, embedded tissues.
Further provided by the present invention is an RT-PCR method comprising a) reverse transcribing RNA using a target-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product and b) amplifying the DNA product using a target-specific forward PCR primer and a target-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer. The RT-PCR method can be used to detect a gene in any type of tissue whether it is preserved or non-preserved. An advantage of the present primers and RT-PCR methods is that they can be used to identify specific nucleic acids in tissue that has low levels of RNA or DNA. Tissues with low levels of nucleic acids include body fluids (e.g., peripheral blood, urine, cerebrospinal fluid, pulmonary lavage, gastric lavage, bile, vaginal secretions, seminal fluid, aqueous humor and vitreous humor). Another advantage of the present primers and RT-PCR methods is that they can be used to identify specific nucleic acids in tissues in which the nucleic acids are often highly degraded or otherwise modified from their native state. Examples of these tissues include fixed (e.g., formalin-fixed) tissues, and embedded (e.g., paraffin- embedded) tissues. Thus, the method can be used on fixed, embedded tissue, fresh tissue and fresh-frozen tissue and body fluids.
The method of the present invention can be used to amplify any specific nucleic acid target and has the same advantages over oligo(dT) primers and random hexamers in a RT-PCR, regardless of the target gene. Examples of gene targets include, but are not limited to, a breast cancer gene, for example, • 2m, mam, PIP, KS1/4, PSE, CEA, lung and colon cancer genes, for example, %jm, CEA, CK19, mucl, and lunx and esophageal cancer, for example, • 2 , SBEM, ErbB2, EpCam, PDEF, CEA, HoxC6 and POTE. Examples of other targets include viral or other pathogens' RNA/DNA, which maybe present at low levels in many tissues. In one aspect of the RT-PCR method of the invention, the reverse PCR primer comprises the RT primer on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end. Representative examples of the reverse PCR primers comprise a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2), GCAGTGACTTCGT (SEQ ID NO:3),
TGAAGTACACTGG (SEQ ID NO:4), AGCCACTTCTGC (SEQ ID NO:5), TGTAGCTGTTGCA (SEQ ID NO:6), GCCACCATTACCT (SEQ ID NO:7), GAACCAACTCAGGC (SEQ ID NO: 8), ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end. Thus, according to the method of the invention, a reverse PCR primer can be selected from the group of nucleic acids identified as, for example, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO: 16, and the following nucleotide sequences: 5'- ACCAATTGCAGAAGACTCAGC, 5'-ATCCCCTTGGCAATCTGCA, 5'- TGAAGTACACTGGCATTGACGA, 5 '-AGCCACTTCTGCACATTGCTG, 5 '- AAAGCGCGTTGGCGATCT and 5 '-GTGTGAGGCCATGCTTGTTTG.
The present invention further provides an RT-PCR method that utilizes pairs of PCR primers, comprising a forward primer and a reverse primer. Examples of the primer pairs include, but are not limited to, nucleic acids having the sequences identified as SEQ ID NO:17 and SEQ ID NO:9; SEQ ID NO:18 and SEQ ID NO:10; SEQ ID NO:19 and SEQ ID NO:ll; SEQ ID NO:20 and SEQ ID NO:12; SEQ ID NO:21 and SEQ ID NO:13; SEQ ID NO:22 and SEQ ID NO:14; SEQ ID NO:23 and SEQ ID NO: 15 and SEQ ID NO:24 and SEQ ID NO: 16. Additional pairs of PCR primers of the invention include the following nucleotide sequences: F 5'-
CCACTGCTCGTAAAGACATTCC, R 5 '-ACCAATTGCAGAAGACTCAGC; F 5'-CTGGTGACACAGCTTATGCCCT, R 5'-ATCCCCTTGGCAATCTGCA; F 5'- CGCAGCTCAGGAAGAATGTG, R 5'- TGAAGTACACTGGCATTGACGA; F 5'- AGTGCTCAAGGACATCGAGACG, R 5'- AGCCACTTCTGC AC ATTGCTG; F 5 '-CCTGG ATGCAGCGAATGAA, R 5 '-AAAGCGCGTTGGCGATCT; and F 5'- TTGCTGGAACATGCGACTGAT, R 5'-GTGTGAGGCCATGCTTGTTTG. The RT-PCR method of the invention can utilize the PCR primer pairs, matched with the RT primers taught herein, to provide examples of a highly sensitive and specific RT- PCR method that can be used for a variety of tissues and targets, but is particularly advantageous in preserved, embedded tissues or for targets that are expected to be present at low levels.
The RT-PCR method of the invention provides a reverse transcription step that results in a mean 16 (+/- 5.2) -fold increase in signal detection compared to priming with random hexamers. The reverse transcription step results in fold increases in signal detection of 1.3 for CK19, 5 for CEA, 9 ϊoτPSE, 17 to 41 for ^ , mam, PIP and KS1/4, and 66 for mud compared to priming with random hexamers. That is, the mean-fold increase in signal detection compared to priming with random hexamers is from about 10.8-fold to about 21.2-fold.
Because the annealing temperatures used for the target-specific RT primers during reverse transcription are from about 40°C to about 42°C, target-specific RT primers and target-specific PCR primers for more than one target can be used in a single reaction. The temperature range used during the RT step allows the primers to hybridize to their specific RNA template in the reverse transcription reaction, but not during the PCR step. Thus, the primers of the invention can be used as a panel of primers while preserving the enhanced nature of signal detection of gene-specific priming and preventing primer-dimer formation.
Another aspect of the invention is a method of detecting a cancer marker in a formalin-fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using a marker-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product and b) amplifying the DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of an amplification product indicating the presence of the cancer marker in the tissue.
Another aspect of the invention is a method of detecting cancer in formalin- fixed, paraffin-embedded tissue, comprising a) reverse transcribing RNA from the tissue using an RT primer specific for a marker for the cancer, wherein the primer comprises 10-16 nucleotides, to produce a marker-specific DNA product and b) amplifying the marker-specific DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of a the marker-specific amplification product indicating the presence of the cancer in the tissue.
A marker for a cancer, for example, breast, lung, colon and esophageal cancer, can be CK19, CEA, PSE, '2m, mam, PIP, mud, SBEM, ErbB2, EpCam, PDEF, HoxC6 and/or POTE.
Representative examples of forward PCR primers that can be used according to the methods of the invention include, but are not limited to, nucleic acids having the sequence identified as SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID.NO:23, SEQ ID NO:24 and the following nucleotide sequences: 5'-CCACTGCTCGTAAAGACATTCC, 5'- CTGGTGACACAGCTTATGCCCT, 5'- CGCAGCTCAGGAAGAATGTG, 5'- AGTGCTCAAGGACATCGAGACG, 5'-CCTGGATGCAGCGAATGAA and 5'- TTGCTGGAACATGCGACTGAT. A reverse PCR primer comprises a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2), GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID NO:4), AGCCACTTCTGC (SEQ ID NO:5), TGTAGCTGTTGCA (SEQ ID NO:6), GCCACCATTACCT (SEQ ID NO:7) and GAACCAACTCAGGC (SEQ ID NO:8) ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT on its 5' end, and further comprises at least about 5 to about 20 additional target-specific nucleotides on its 3' end. Thus, there can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 additional target-specific nucleotides on its 3'- end. The marker- specific RT primers and marker-specific PCR primers for more than one marker can be used in a single reaction. Representative examples of reverse PCR primers that can be used according to the methods of the invention include, but are not limited to, nucleic acids identified as SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and the following nucleotide sequences: 5'- ACCAATTGCAGAAGACTCAGC, 5'- ATCCCCTTGGCAATCTGCA, 5 '- TGAAGTACACTGGCATTGACGA, 5 '- AGCCACTTCTGCACATTGCTG, 5 '-AAAGCGCGTTGGCGATCT and 5'- GTGTGAGGCCATGCTTGTTTG. Examples of PCR primer pairs of the invention that can be used to detect a cancer marker, for example, CK19, CEA, PSE, '2m, mam, PIP, and/or mud include nucleic acids having the sequences identified as SEQ ID NO: 17 and SEQ ID NO:9; SEQ ID NO: 18 and SEQ ID NO: 10; SEQ ID NO: 19 and SEQ ID NO:l 1; SEQ ID NO:20 and SEQ ID NO: 12; SEQ ID NO:21 and SEQ ID NO: 13; SEQ ID NO:22 and SEQ ID NO: 14; SEQ ID NO:23 and SEQ ID NO: 15 and SEQ ID NO:24, SEQ ID NO: 16 and the following pairs of nucleotide sequences F 5 '- CCACTGCTCGTAAAGACATTCC, R 5 '-ACCAATTGCAGAAGACTCAGC; F 5'-CTGGTGACACAGCTTATGCCCT, R 5'-ATCCCCTTGGCAATCTGCA; F 5'- CGCAGCTCAGGAAGAATGTG, R 5 '- TGAAGTACACTGGCATTGACGA; F 5'- AGTGCTCAAGGACATCGAGACG, R 5'- AGCCACTTCTGCACATTGCTG; F 5'-CCTGGATGCAGCGAATGAA, R 5 '-AAAGCGCGTTGGCGATCT; and F 5'- TTGCTGG AACATGCGACTGAT, R 5 '-GTGTGAGGCCATGCTTGTTTG .
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.
Example 1 In an effort to preserve the enhanced nature of signal detection of gene- specific priming and prevent primer-dimer formation, short primers (12-14) nucleotides in length) that corresponded to the 5 '-end of the reverse primer used for PCR were designed (Table 1). The annealing temperatures for the resulting primers are 40° to 42°C, a range that allows the primers to hybridize to their specific template in the reverse transcription reaction, but not during PCR. It was hypothesized that the use of a panel of truncated gene-specific primers during reverse transcription would be superior to the use of random hexamers, ultimately resulting in significant enhancement of gene fragment detection from PET samples containing highly degraded RNA. To test this hypothesis, RNA from 20, 40, 60, and 80 micron sections of formalin- fixed, paraffin-embedded breast (n=2), colon (n=l) and lung (n=l) cancer tissues was first isolated following the method of Stanta and Schneider (7) with some modifications. PET sections were deparaffinized twice with 1ml of xylene at 37°C for 20 min. The pellet was washed with 0.5 mL of 100% ethanol (at 4°C) and air-dried at room temperature. The pellet was resuspended in 140 • L of pre-chilled RNA lysis isolation buffer (please specify) and 60 • L of 20 mg/mL proteinase K, and incubated at 45°C for one hour. RNA was extracted using an equal volume of phenol:chloroform:isoamyl (125:24:1) solution (Sigma). The aqueous layer containing RNA was transferred to a new 1.5 mL tube. After adding 2 • g of glycogen and one volume of isopropanol, precipitation was performed at- 80°C for 1-2 hours. After centrifugation at 12,000 rpm for 30 minutes (4°C), the RNA pellet was washed with 70% of ethanol and air-dried at room temperature.
Finally, the pellet was dissolved in 50 • L of DEPC-water and stored at -20°C. RNA was quantified by spectrophotometry at 260 nm.
In reverse transcription reactions, cDNA was made from 5 • g of total RNA using either 150 ng of random hexamers or 500 ng of a panel of truncated gene- specific primers (breast cancer panel: *2m, mam, PIP, KS1/4, PSE, CEA; lung and colon cancer panel: '2m, CEA, CKI9, mud, lunx, KS1/4; see Tablel). RNA was reverse transcribed with 200 U of M-MLV reverse transcriptase (Promega, Madison, WI) in a reaction volume of 20 • L (10 min at 70 °C, 50 min at 42 °C, 15 min at 70 °C). Real-time RT-PCR analyses were performed on a PE Biosystems Gene
Amp® 5700 Sequence Detection System (Foster City, CA). The standard reaction volume was 10 • L and contained IX QuantiTect SYBR Green PCR Master Mix (Qiagen), 0.1 U AmpErase® UNG enzyme (PE Biosystems); 0.7 • L cDNA template; and 0.25 • M of both forward and reverse primer (Table 1). The initial step of PCR was 2 min at 50°C for AmpErase® UNG activation, followed by a 15 min hold at 95 °C. Cycles (n=40) consisted of a 15 sec denaturation step at 95°C, followed by a 1 min annealing/extension step at 60°C. The final step was a 60°C incubation for 1 min. All reactions were performed in triplicate. Real-time RT-PCR data were quantified in terms of cycle threshold (Ct) values. Ct values are inversely related to the amount of starting template; high Ct values correlate with low levels of gene expression, whereas low Ct values correlate with high levels of gene expression. The threshold for cycle of threshold (Ct) analysis was set at 0.1 relative fluorescence units. The fold difference in signal detection was calculated using the formula AE' Ct, where AE is amplification efficiency and Ct = Ct random hexamers" Ct gene-specific primers-
A representative experiment with 80 micron sections of formalin-fixed, paraffin-embedded breast, colon and lung cancer tissues is shown in Figure 1. Overall, gene-specific priming for all samples analyzed (20, 40, 60 and 80 micron sections of four cancer tissues) resulted in an average of 16- (+/- 5.2) fold increase compared to priming with random hexamers. On a per gene basis, the most significant increase was seen in mud, where the gene expression signal increased on an average of 6 Ct units (66-fold). » 2m, mam, PIP and KS1/4 signals increased an average of 4.4 to 5.4 Ct units (17- to 41 -fold). The smallest increase was seen in PSE, CEA, and CK19 signals with an average of 3.2, 2.3 and 0.6 Ct units (9-, 5- and 1.3-fold) increase, respectively. Of note, some of the gene expression signals that were undetectable (Ct=40) using random hexamers were detected using a panel of ' truncated gene-specific primers. For example, CEA and KS1/4 in the paraffin- embedded lung tumor (Fig.l C), and mud in colon tumor (Fig.l D) were not detected using reverse transcription with random hexamers, while priming with a panel of truncated gene-specific primers resulted in a detectable signal. Also, mud in lung cancer (Fig. l.C) and PIP in one of the breast cancer specimens (Fig.l.B) were easily detected when a panel of truncated gene-specific primers was used, whereas priming with hexamers did not always result in signal detection. The lunx gene was not detected with either random hexamers or gene-specific primers. It was also observed that using RNA from fresh frozen tissues, a panel of truncated gene-specific primers worked as well as oligo(dT) primers but better than random hexamers (an average of 4.2 (+/- 1.1) Ct units increase in signal detection).
Interestingly, in cases of frozen RNA samples where results with oligo(dT) primers were poor (suggesting RNA degradation), gene-specific priming was superior to oligo(dT) and random hexamer priming. This result is consistent with the hypothesis that truncated gene-specific primers used in reverse transcription enhance the detection of gene fragments in degraded RNA samples.
To determine whether a panel of truncated gene-specific primers is as effective as a single truncated gene-specific primer, RNA from a 80 micron section of formalin-fixed, paraffin-embedded breast cancer tissue was isolated and reverse transcribed in separate reactions using: either single truncated gene-specific primers (• m, mam, pip, KS1/4, PSE, or CEA), or a panel of truncated gene-specific primers containing all six primers. A reaction without reverse transcriptase was included as a negative control. For each reverse transcription reaction, real-time PCR was performed using specific forward and reverse primers. In this experiment (Fig.1 A), it was observed that reverse transcription with a panel of truncated gene-specific primers was comparable in efficiency to reverse transcription with single truncated gene-specific primers, supporting the approach of simultaneous reverse transcription for multiple genes.
As demonstrated by quantitative real-time PCR, the signal detection from PET samples is significantly enhanced when a panel of truncated gene-specific primers is used, making this approach suitable for high throughput multi-marker molecular analysis. This modification facilitates the use of stored PET samples with known clinical outcome, opening an enormous resource for retrospective clinical studies to validate the use of diagnostic and/or prognostic genetic markers, and to define the genetic pathogenesis of different diseases.
Table 1. Primers for gene-specific reverse transcription and real-time PCR
Gene Sequence of selected primer pair Reference
β2m F 5'-GCCGTGTGAACCATGTGACTTT (10) R 5 ' -CCAAATGCGGCATCTTCAAA mam F 5 ' -CGGATGAAACTCTGAGCAATGT (11) R 5 ' -CTGCAGTTCTGTGAGCCAAAG PIP F 5'- GCCAACAAAGCTCAGGACAAC (11) R 5 ' - GCAGTGACTTCGTCATTTGGAC
KS1/4 F 5'- CGCAGCTCAGGAAGAATGTG (12) R 5 ' - TGAAGTACACTGGCATTGACGA
PSE F 5'- AGTGCTCAAGGACATCGAGACG (13) R 5 ' - AGCCACTTCTGCACATTGCTG
CEA F 5'- GGGCCACTGTCGCATCATGATTGG (12) R 5 ' - TGTAGCTGTTGCAAATGCTTTAAGAAGAAGC mucl F 5 ' -ACCATCCTATGAGCGAGTACCC (11,12) R 5'-GCCACCATTACCTGCAGAAAC lunx F 5' - CCCTGGAAGCCTGCAAATT (14,12) R 5 ' - GAACCAACTCAGGCAGGACTTT *Truncated gene -specif ic primers for reverse transcription (underlined sequences) correspond to 5' -end of reverse primers designed for PCR.
Example 2
According to the methods of the present invention as taught above, RT-PCR was performed to detect markers found in esophageal cancer. Table 2 provides examples of the RT and PCR primers used.
phageal cancer analysis le 2 Primers for real-time PCR and gene-specific reverse transcription Sequences of primer pairs3 Ref Ace. # Size of the intron(s ) F 5' -GCCGTGTGAACCATGTGACTTT (10) NM_004048 626 bp R 5' -CCAAATGCGGCATCTTCAAA 1,246 bp F 5' -CCACTGCTCGTAAAGACATTCC AF414087 1,300 bp
M R 5' -ACCAATTGCAGAAGACTCAGC F 5' -CTGGTGACACAGCTTATGCCCT N _004448 135 i2 R 5' -ATCCCCTTGGCAATCTGCA F 5' - CGCAGCTCAGGAAGAATGTG (12) NM_002354 3,879 bp am R 5' - TGAAGTACACTGGCATTGACGA F 5' - AGTGCTCAAGGACATCGAGACG (13) NM_012391 2,835 bp
T R 5' - AGCCACTTCTGCACATTGCTG F 5' - GGGCCACTGTCGCATCATGATTGG (12) NM_004363 1,831 bp
1 R 5' - TGTAGCTGTTGCAAATGCTTTAAGAAGAAGC
Figure imgf000027_0001
F 5'-CCTGGATGCAGCGAATGAA NM_OO4503 732 bp R 5'-AAAGCGCGTTGGCGATCT F 5'-TTGCTGGAACATGCGACTGAT NM_174981 1 ,300 bp R 5'-GTGTGAGGCCATGCTTGTTTG
'm, β2-microglobin; mam, mammaglobin; PIP; prolactin -inducible protein; KS1/4, epithelial cell ssion molecule; PSE, prostat -specif ic Ets factor; CEA, carcinoembryonic antigen; mud , mucin . 9, cytoJcera in 19; lunx, lung and nasal epithelium carcin oma associated gene .
"uncated gene -specif ic primers for reverse transcription (underlined sequences) correspond 5' -end of reverse primers designed for PCR.
Example 3
Lunx is a Superior Molecular Marker for Detection of Non-Small Lung Cell Cancer in Peripheral Blood In this example, we used a novel strategy to enrich tumor cells from the peripheral blood of 24 Stage I-IV NSCLC patients and determined expression levels for six cancer-associated genes (lunx, mud, KS1/4, CEA, CK19, and PSE). Using thresholds established at three standard deviations above the mean observed in 15 normal controls, we observed that lunx (10/24, 42%), mud (5/24, 21%), and CK19 (5/24, 21%) were overexpressed in 14/24 (58%) peripheral blood samples obtained from NSCLC patients. Patients that overexpressed either KS1/4 (n=2) or PSE (n=l) also overexpressed either lunx or mud. In patients with presumed curable and resectable Stage I-II disease (n=7), at least one marker was overexpressed in 3 (43%) patients. In advanced Stage III-IV patients (n=17), at least one marker was overexpressed in 11 patients (65%). These results provide evidence that circulating tumor cells can be detected in NSCLC patients by a high throughput molecular technique. Further studies are needed to determine the clinical relevance of gene overexpression.
Oligonucleotides. All primers were designed according to the method taught herein. In addition to having the appropriate target specificity and melting temperature, they also spanned at least one intron, and failed to amplify negative control cDNA in which reverse transcriptase enzyme was omitted. Sequences of the internal control • 2-microglobin PCR primers were: 5' GCCGTGTGAACCATGTGA (forward) and 5' CCAAATGCGGCATCTTCA (reverse). Other sequences (previously described [22]) were: lunx, CCCTGGAAGCCTGCAAATT (F) GAACCAACTCAGGCAGGACTTT (R); KS1/4, CGCAGCTCAGGAAGAATGTG
(F),
TGAAGTACACTGGCATTGACGA (R); CK19,
CATGAAAGCTGCCTTGGAAGA (F),
TGATTCTGCCGCTCACTATCAG (R); CEA, GGGCCACTGTCGCATCATGATTGG (F,
TGTAGCTGTTGCAAATGCTTTAAGAAAGAAGC (R); PSE,
AGTGCTCAAGGACATCGAGACG (F), AGCCACTTCTGCACATTGCTG (R).
Synthetic lunx fragment for gene copy determination: ccctggaagcctgcaaattucucugcuugauggacuuggcccccuccccauucaaggucuucuggacagccuca cagggaucuugaauaaagtcctgcctgagttggttc.
Peripheral Blood Specimens. Peripheral blood specimens (10-20mL) were collected using K3 EDTA tubes (Vacutainer®) and immediately placed on ice. Samples were then processed using a porous barrier density gradient centrifugation media (OncoQuick®, Hexal Gentech, Holzkirchen, Germany) per manufacturer instructions. Briefly, Pre-cooled 50 mL centrifugation tubes containing 15 mL of separation medium below a porous barrier were filled with peripheral blood and centrifuged at 1600g for 20 min. The entire volume of the upper compartment was then collected and washed for 10 min at 200g. Cells were pelleted and evaluated as described below.
RNA isolation and gene-specific cDNA synthesis. Total cellular RNA was isolated from pelleted cells using a guanidinum thiocyanate-phenol-chloroform solution (RNA STAT-60™; TEL-TEST, Friendswood, TX). Briefly, pelleted cells recovered from peripheral blood specimens were resuspended in 1 ml of RNA STAT-60™. Total RNA was isolated as per manufacturer's instructions with the exception that 1 1 of a 50 mg/ml solution of glycogen (Sigma, St. Louis, MO) was added to the aqueous phase prior to addition of isopropanol. Final RNA pellet was dissolved in 50 1 of lx RNA secure buffer (Ambion, Austin, TX). RNA was quantified by UV absorbance at 260 nm. Complementary DNA (cDNA) was made from 5 g of total RNA using 200 U of M-MLV reverse transcriptase (Promega, Madison, WI) and the following gene- specific RT primers (70«ng each): CCAAATGCGGCAT ( 2-microglobi ), TGAAGTACACTGG (KSI/4), GAACCAACTCAGGC (lunx), GCCACCATTACCT (mud), TGATTCTGCCGC (CK19),
GTTCCCATCAATCAG (CEA), AGCCACTTCTGC (PSE). Final reaction volume was 20 1. The annealing temperature was in accordance with standard RT conditions, i.e., approximately 40-42°C.
Real-time RT-PCR. Real-time RT-PCR was performed on a PE Biosystems Gene Amp® 5700 Sequence Detection System (Foster City, CA). All reaction components were purchased from PE Biosystems. Standard reaction volume was 10 1 and contained IX SYBR Green PCR Buffer, 3.5mM MgCl2, 0.2mM each of dATP, dCTP, dGTP, and 0.4mM of dUTP, 0.25U AmpliTaq Gold®, 0.1U AmpErase® UNG enzyme, 0.7 1 cDNA template, and 0.25mM of forward and reverse primer. Initial step of RT-PCR was 2 min at 50°C for AmpErase® UNG activation, followed by a 10-min hold at 95°C. Cycles (n=40 first round) consisted of a 15 sec melt at 95°C, followed by a 1 min annealing/extension at 60°C. The final step was a 60°C incubation for 1 min. All reactions were performed in triplicate and a negative control lacking cDNA was included. For a blood sample to be considered evaluable, we set a cutoff value for the 2-microglobin internal control gene at < 25 (corresponding to approximately 2x104 gene copies).
Reliable detection of 20 lunx eene copies by real-time PCR. To determine whether a single round of real-time RT-PCR could be used for the sensitive detection of NSCLC, we first performed studies on a synthetic fragment encoding a portion of lunx, a gene previously shown to be expressed in metastatic lymph nodes of NSCLC patients [21, 22]. Ct values for various fragment dilutions were obtained and plotted as a function of initial fragment copy number. Figure 2 demonstrates a strong linear relationship between the Q value and the log of fragment copy number (R2 = 0.9981). Reliable fluorescent signals were obtained for reactions containing as few as 20 gene copies (Figure 2; log value = 1.4). In contrast, reliable fluorescent signals were not obtained for samples that contained only 2 gene copies, regardless of the fluorescent threshold setting used for real-time measurements. These data provide evidence that a single round (as opposed to two) of real-time PCR reliably amplifies >20 gene copies, a result amenable to detection of circulating tumor cells in peripheral blood.
Detection of lunx gene expression in peripheral blood of NSCLC patients. To assess the ability of real-time RT-PCR to detect circulating tumor cells in the peripheral blood of NSCLC patients, samples from 15 healthy volunteers and 24 patients with Stage I-IV NSCLC were obtained. Tumor cells were first enriched from peripheral blood by a newly developed porous barrier density gradient (PBDG) centrifugation system [27]. The depletion of mononuclear cells in the enriched cell fraction after PBDG centrifugation is approximately 300- to >500-fold [27, 29] .
Mean tumor cell recovery rates for PBDG are comparable to that achieved by ficoll purification [27, 29]]. Previous studies in the breast cancer setting have shown that the upper limit of detection using real-time RT-PCR is one cancer cell among 5 x 108 peripheral blood cells (29). Using a single round of real-time PCR (40 cycles), we determined expression levels for five genes associated with NSCLC: lunx, KS /4, mud, CKI9, and CEA [22], as well as one gene (PSE) associated with prostate [30] and breast cancer [31 , 32]. Mean expression levels of the cancer-associated genes were normalized to 2- microglobin using Q-gene software [33]. We observed that in the normal control peripheral blood samples, expression of the lunx gene was not detectable (Figure 3). For other genes, expression was detected in a limited number of patients: mud and CK19 (four samples), CEA and PSE (3 samples), and KS1/4 (2 samples) (Figure 3). Based on data obtained from the normal control population, we set threshold values for marker positivity at three standard deviations beyond the mean normalized expression values of each respective gene (Figure 3; horizontal lines). Assuming a normal distribution of the control peripheral blood samples, three standard deviations corresponds to a test specificity level of 99.9%. In the control patient group, no gene was overexpressed above threshold levels.
In the peripheral blood samples derived from NSCLC patients (n=24), we observed that 14/24 (58%) overexpressed at least one marker gene (Figure 3, Table 3). The gene most highly overexpressed was lunx (10/24 samples (42%)). mud and CKI9 were each overexpressed in 5/20 (21%) of patients, three of whom overexpressed both markers. Overexpression of KS1/4 and PSE was observed in 2 and 1 patients, respectively, all of who overexpressed either lunx or mud (Table 1). In patients with presumed curable and resectable Stage I-II disease (n=7), lunx was overexpressed in 2 (29%) blood samples.
Conclusion. The ability to detect nucleic acid fragments by PCR is directly proportional to gene copy number, fragment amplification efficiency, and detection threshold, and inversely porportional to the formation of primer dimers. Due to their extremely low concentration (and hence, gene copy numbers), the molecular detection of cancer cells in peripheral blood has proven challenging compared to other unpreserved tissues such as lymph node. In this study, we provide evidence that the use of realtime PCR and SYBR Green I chemistry allows for reproducible detection of 20 copies of an aritificial lunx sequence by PCR cycle number 36 (Figure 2). These results provide evidence that a single round of real-time RT-PCR is sufficient for detection of genes present in low abundance.
Using a single round of real-time PCR, we analyzed the peripheral blood of NSCLC patients for expression of five genes associated with NSCLC: lunx, KS1/4, mud, CK19, and CEA [22]. With respect to normal control samples, overexpression of at least one gene was observed in 14/24 (58%) NSCLC patients. Of Stage I-II patients (n=7), 3 (43%) were positive for at least one marker, while 11/17 (65%) Stage III-IV patients were marker positive. Ten NSCLC blood samples were positive for lunx, providing evidence that this marker was the most sensitive for detection of circulating NSCLC cells.
The results described in this paper provide evidence that lunx was the most sensitive marker for detection of circulating NSCLC cells.
Table 3. Detection of Gene Overexpression in NSCLC Patients
Figure imgf000035_0001
18 IV 62 — 1 19 IV 62 — - 20 IV 74 1 - 21 IV 46 1 - 22 IV 77 — 1 23 IV 67 1 24 IV 52 1 — 1 1
Total: 10 5 5 2 1
'No overexpression of the respective gene is indicated by " — "; overexpression is indicated by "1".
Literature Cited
1. Miller JD, Gorenstein LA, Patterson GA: Staging: the key to rational management of lung cancer. Ann Thorac Surg 1992, 53:170-178
2. Mountain CF, Dresler CM: Regional lymph node classification for lung cancer staging. Chest 1997, 111 : 1718- 1723 3. Martini N, Bains MS, Burt ME, Zakowski MF, McCormack P, Rusch VW, Ginsberg RJ: Incidence of local recurrence and second primary tumors in resected stage I lung cancer. J Thorac Cardiovasc Surg 1995, 109:120-129 4. Pantel K, Cote RJ, Fodstad O: Detection and clinical importance of micrometastatic disease. J Natl Cancer Inst 1999, 91:1113-1124 5. Cote RJ, Beattie EJ, Chaiwun B, Shi SR, Harvey J, Chen SC, Sherrod AE, Groshen S, Taylor CR: Detection of occult bone mairrow micrometastases in patients with operable lung carcinoma. Ann Surg 1995, 222:415-423; discussion 423-415
6. Kubuschok B, Passlick B, Izbicki JR, Thetter O, Pantel K: Disseminated tumor cells in lymph nodes as a determinant for survival in surgically resected non- small-cell lung cancer. J Clin Oncol 1999, 17: 19-24
7. Passlick B, Kubuschok B, Izbicki JR, Thetter O, Pantel K: Isolated tumor cells in bone marrow predict reduced survival in node-negative non-small cell lung cancer. Ann Thorac Surg 1999, 68:2053-2058
8. Mitas M, Mikhitarian K, Walters C, Baron PL, Elliott BM, Brothers TE, Robison JG, Metcalf JS, Palesch YY, Zhang Z, Gillanders WE, Cole DJ: Quantitative real-time RT-PCR detection of breast cancer micrometastasis using a multigene marker panel. Int J Cancer 2001 , 93 : 162- 171
9. Gerhard M, Juhl H, Kalthoff H, Schreiber HW, Wagener C, Neumaier M: Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol 1994, 12:725-729 10. Mori M, Mimori K, Ueo H, Karimine N, Barnard GF, Sugimachi K, Akiyoshi T: Molecular detection of circulating solid carcinoma cells in the peripheral blood: the concept of early systemic disease. Int J Cancer 1996, 68:739-743
11. Battaglia M, Pedrazzoli P, Palermo B, Lanza A, Bertolini F, Gibelli N, Da Prada GA, Zambelli A, Perotti C, Robustelli della Cuna G: Epithelial tumour cell detection and the unsolved problems of nested RT-PCR: a new sensitive one step method without false positive results. Bone Marrow Transplant 1998, 22:693-698
12. Zach O, Kasparu H, Krieger O, Hehenwarter W, Girschikofsky M, Lutz D: Detection of circulating mammary carcinoma cells in the peripheral blood of breast cancer patients via a nested reverse transcriptase polymerase chain reaction assay for mammaglobin mRNA. J Clin Oncol 1999, 17:2015-2019
13. Grunewald K, Haun M, Urbanek M, Fiegl M, Muller-Holzner E, Gunsilius E, Dunser M, Marth C, Gastl G: Mammaglobin gene expression: a superior marker of breast cancer cells in peripheral blood in comparison to epidermal-growth-factor receptor and cytokeratin-19. Lab Invest 2000, 80:1071-1077 14. Ballestrero A, Coviello DA, Garuti A, Nencioni A, Fama A, Rocco I,
Bertorelli R, Ferrando F, Gonella R, Patrone F: Reverse-transcriptase polymerase chain reaction of the maspin gene in the detection of bone marrow breast carcinoma cell contamination. Cancer 2001, 92:2030-2035
15. Berois N, Varangot M, Aizen B, Estrugo R, Zarantonelli L, Fernandez P, Krygier G, Simonet F, Barrios E, Muse I, Osinaga E: Molecular detection of cancer cells in bone marrow and peripheral blood of patients with operable breast cancer. Comparison of CK19, MUCl and CEA using RT-PCR. Eur J Cancer 2000, 36:717- 723
16. Slade MJ, Smith BM, Sinnett HD, Cross NC, Coombes RC: Quantitative polymerase chain reaction for the detection of micrometastases in patients with breast cancer [published erratum appears in J Clin Oncol 1999 Apr;l 7(4): 1330]. J Clin
Oncol 1999, 17:870-879
17. Ghossein RA, Carusone L, Bhattacharya S: Molecular detection of micrometastases and circulating tumor cells in melanoma prostatic and breast carcinomas. In Vivo 2000, 14:237-250 18. Datta YH, Adams PT, Drobyski WR, Ethier SP, Terry VH, Roth MS :
Sensitive detection of occult breast cancer by the reverse-transcriptase polymerase chain reaction. J Clin Oncol 1994, 12:475-482
19. Raj GV, Moreno JG, Gomella LG: Utilization of polymerase chain reaction technology in the detection of solid tumors. Cancer 1998, 82:1419-1442 20. von Knebel Doeberitz M, Lacroix J: Nucleic acid based techniques for the detection of rare cancer cells in clinical samples. Cancer Metastasis Rev 1999, 18:43-
64
21. Iwao K, Watanabe T, Fujiwara Y, Takami K, Kodama K, Higashiyama M, Yokouchi H, Ozaki K, Monden M, Tanigami A: Isolation of a novel human lung- specific gene, LUNX, a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Int J Cancer 2001, 91:433-437
22. Mitas M, Cole DJ, Hoover L, Fraig MM, Mikhitarian K, Block MI, Hoffman BJ, Hawes RH, Gillanders WE, Wallace MB: Real-Time RT-PCR Detects KS1/4 mRNA in Mediastinal Lymph Nodes from Patients with Non-Small Cell Lung Cancer. Clin. Chem. 2003, 49:312-315
23. Weston W, LeClair E, Trzyna W, McHugh K, Nugent P, Lafferty C, Ma L, Tuan R, RM G: Differential display identification of plunc, a novel gene expressed in embryonic palate, nasal epithelium, and adult lung. J Biol Chem 1999, 274:13698- 24. Bingle CD, Bingle L: Characterisation of the human plunc gene, a gene product with an upper airways and nasopharyngeal restricted expression pattern. Biochim Biophys Acta 2000, 1493:363-367
25. Sung YK, Moon C, Yoo JY, Pearse D, Pevsner J, Ronnett GV: Plunc, a member of the secretory gland protein family, is up-regulated in nasal respiratory epithelium after olfactory bulbectomy. J Biol Chem 2002, 277: 12762-12769
26. Perez MS, Walker LE: Isolation and characterization of a cDNA encoding the KS1/4 epithelial carcinoma marker. J. Immunol. 1989, 142:3662-3667
27. Rosenberg R, Gertler R, Friederichs J, Fuehrer K, Dahm M, Phelps R, Thorban S, Nekarda H, Siewert JR: Comparison of Two Density Gradient Centrifugation Systems for the Enrichment of Disseminated Tumor Cells in Blood. Cytometry 2002, 49:150-158
28. Bieche I, Olivi M, Champeme MH, Vidaud D, Lidereau R, Vidaud M: Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer. Int J Cancer 1998, 78:661-666
29. Baker M, Mikhitarian K, Hoda R, Brescia F, Kneuper-Hall R, Mitas M, Cole D, Gillanders W: Molecular detection of breast cancer cells in the peripheral blood of advanced stage breast cancer patients using multi-marker real-time RT-PCR and a novel porous barrier density gradient centrifugation technology. Clin Can Res 2003, in press
30. Oettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, Boltax J, Grail F, Dube A, Weiss A, Brown L, Quinn G, Kas K, Endress G, Kunsch C, Libermann TA: PDEF, a novel prostate epitheUum-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J Biol Chem 2000, 275:1216-1225 31. Ghadersohi A, Sood AK: Prostate Epithelium-derived Ets Transcription
Factor mRNA Is Overexpressed in Human Breast Tumors and Is A Candidate Breast Tumor Marker and A Breast Tumor Antigen. Clin Cancer Res 2001, 7:2731-2738
32. Mitas M, Mikhitarian K, Hoover L, Lockett MA, Kelley L, Hill A, Gillanders WE, Cole DJ: Prostate-specific ets (PSE) factor: a novel marker for the detection of metastatic breast cancer in axillary lymph nodes. British Journal of Cancer 2002, 86:899-905
33. Muller PY, Janovjak H, Miserez AR, Dobbie Z: Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 2002, 32:1372-1374, 1376, 1378-1379 34. Peck K, Sher YP, Shih JY, Rofϊler SR, Wu CW, Yang PC: Detection and quantitation of circulating cancer cells in the peripheral blood of lung cancer patients. Cancer Res 1998, 58:2761-2765
35. Lacroix J, Becker HD, Woerner SM, Rittgen W, Drings P, von Knebel Doeberitz M: Sensitive detection of rare cancer cells in sputum and peripheral blood samples of patients with lung cancer by preproGRP-specific RT-PCR. Int J Cancer 2001, 92:1-8
36. Kurusu Y, Yamashita J, Ogawa M: Detection of circulating tumor cells by reverse transcriptase-polymerase chain reaction in patients with resectable non-small- cell lung cancer. Surgery 1999, 126:820-826 37. Yamashita JI, Kurusu Y, Fujino N, Saisyoji T, Ogawa M: Detection of circulating tumor cells in patients with non-small cell lung cancer undergoing lobectomy by video-assisted thoracic surgery: a potential hazard for intraoperative hematogenous tumor cell dissemination. J Thorac Cardiovasc Surg 2000, 119:899- 905 38. Yamashita J, Matsuo A, Kurusu Y, Saishoji T, Hayashi N, Ogawa M:
Preoperative evidence of circulating tumor cells by means of reverse transcriptase- polymerase chain reaction for carcinoembryonic antigen messenger RNA is an independent predictor of survival in non-small cell lung cancer: a prospective study. Journal Thorac Cardiovasc Surg 2002, 124:299-305
39. Matsunaga H, Hangai N, Aso Y, Okano K, Kawamura M, Kobayashi K, Kambara H, Hoger JH, Mitsuhashi M: Application of differential display to identify genes for lung cancer detection in peripheral blood. Int J Cancer 2002, 100:592-599
40. Karsai A, Muller S, Platz S, Hauser MT: Evaluation of a homemade SYBR green I reaction mixture for real-time PCR quantification of gene expression. Biotechniques 2002, 32:790-792, 794-796
41. Leutenegger CM, Higgins J, Matthews TB, Tarantal AF, Luciw PA, Pedersen NC, North TW: Real-time TaqMan PCR as a specific and more sensitive alternative to the branched-chain DNA assay for quantitation of simian immunodeficiency virus RNA. AIDS Res Hum Retroviruses 2001, 17:243-251
42. Zhong X, Kaul S, Eichler A, Bastert G: Evaluating GA733-2 mRNA as a marker for the detection of micrometastatic breast cancer in peripheral blood and bone marrow. Arch Gynecol Obstet 1999, 263 :2-6
43. de Graaf H, Maelandsmo G, Ruud P, Forus A, Oyjord T, Fodstad O, Hovig E: Ectopic expression of target genes may represent an inherent limitation of RT- PCR assays used for micrometastasis detection: studies on the epitheUal glycoprotein gene EGP-2. Int J Cancer 1997, 72:191-196 44. Alberti S, Nutini M, Herzenberg L: DNA methylation prevents the ampUfication of TROP1, a tumor-associated cell surface antigen gene. Proc Natl Acad Sci U S A 1994, 91:5833-5837
45. Robinson R, Royston D: Comparison of monoclonal antibodies AUA1 and BER EP4 with anti-CEA for detecting carcinoma cells in serous effusions and distinguishing them from mesothelial cells. Cytopathology 1993, 4:267-271 46. Bergsagel P, Victor-Kobrin C, Timblin C, Trepel J, Kuehl W: A murine cDNA encodes a pan-epitheUal glycoprotein that is also expressed on plasma cells. J Immunol 1992, 148:590-596
47. Ross A, Lubeck M, Steplewski Z, Koprowski H: Identification and characterization of the C017-1A carcinoma-associated antigen. Hybridoma 1986 Jul;5 . 1986; 5:S21-28
48. ' Strnad J, Hamilton A, Beavers L, Gamboa G, Apelgren L, Taber L, Sportsman J, Bumol T, Sharp J, Gadski R: Molecular cloning and characterization of a human adenocarcinoma/epithelial cell surface antigen complementary DNA. Cancer Res 1989, 49:314-317 49. Tomita Y, Arakawa F, Yamamoto T, Kuwahara M, Watanabe R, Iwasaki H, Kikuchi M, Kuroki M: Molecular identification of a human carcinoma-associated glycoprotein antigen recognized by mouse monoclonal antibody FU-MK-1. Jpn J Cancer Res 2000; 91,231-238
50. Calabrese G, Crescenzi C, Morizio E, Palka G, Guerra E, Alberti S: Assignment of TACSTDl (alias TROPl, M4S1) to human chromosome 2p21 and refinement of mapping of TACSTD2 (alias TROP2, Ml SI) to human chromosome lp32 by in situ hybridization. Cytogenet Cell Genet 2001, 92:164-165
51. Velders M, Litvinov S, Warnaar S, Gorter A, Fleuren G, Zurawski V, Jr., Coney L: New chimeric anti-pancarcinoma monoclonal antibody with superior cytotoxicity-mediating potency. Cancer Res 1994, 54:1753-1759
52. Helfrich W, ten Poele R, Meersma G, Mulder N, de Vries E, de Leij L, Smit E: A quantitative reverse transcriptase polymerase chain reaction-based assay to detect carcinoma ceUs in peripheral blood. Br J Cancer 1997, 76:29-35
53. Szala S, Froehlich M, ScoUon M, Kasai Y, Steplewski Z, Koprowski H, Linnenbach A: Molecular cloning of cDNA for the carcinoma-associated antigen
GA733-2. Proc Natl Acad Sci U S A 1990, 87:3542-3546 54. Lindahl M, Stahlbom B, Tagesson C, Weston W, LeClair E, Trzyna W,
McHugh K, Nugent P, Lafferty C, Ma L, Tuan R, Greene R: Identification of a new potential airway irritation marker, palate lung nasal epitheUal clone protein, in human nasal lavage fluid with two-dimensional electrophoresis and matrix-assisted laser deso tion/ionization-time of flight. Electrophoresis 2001, 22:1795-1800 55. Ghafouri B, Stahlbom B, Tagesson C, Lindahl M, Weston W, LeClair E, Trzyna W, McHugh K, Nugent P, Lafferty C, Ma L, Tuan R, Greene R: Newly identified proteins in human nasal lavage fluid from non-smokers and smokers using two-dimensional gel electrophoresis and peptide mass fingerprinting. Proteomics 2002, 2:112-120
Throughout this application, various pubUcations are referenced. The disclosures of these pubUcations in their entireties are hereby incorporated by reference into this appUcation in order to more fuUy describe the state of the art to which this invention pertains.
It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
References 1. Specht, K., T. Richter, U. MuUer, A. Walch, M. Werner and H. Hofler. 2001.
Quantitative gene expression analysis in micro dissected archival formalin-fixed and paraffin-embedded tumor tissue. Am J Pathol 158:419-429.
2. Masuda, N., T. Ohnishi, S. Kawamoto, M. Monden and K. Okubo. 1999. Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples. Nucleic Acids Res 27:4436-4443.
3. Goldsworthy, S.M., P.S. Stockton, C.S. Trempus, J.F. Foley and R.R. Maronpot. 1999. Effects of fixation on RNA extraction and ampUfication from laser capture microdissected tissue. Mol Carcinog 25:86-91. 4. Godfrey, T.E., S.H. Kim, M. Chavira, D. W. Ruff, R.S. Warren, J.W. Gray and R.H. Jensen. 2000. Quantitative mRNA expression analysis from formalin-fixed, paraffin-embedded tissues using 5' nuclease quantitative reverse transcription- polymerase chain reaction. J Mol Diagn 2:84-91.
5. Coombs, N.J., A.C. Gough and J.N. Primrose. 1999. Optimisation of DNA and RNA extraction from archival formalin-fixed tissue. Nucleic Acids Res 27:el2.
6. Korbler, T., M. Grskovic, M. Dominis and M. Antica. 2003. A simple method for RNA isolation from formalin-fixed and paraffin-embedded lymphatic tissues. Exp Mol Pathol 74:336-340.
7. Stanta, G. and C. Schneider. 1991. RNA extracted from paraffin-embedded human tissues is amenable to analysis by PCR amplification. Biotechniques 11:304,
306, 308.
8. Corey, E. and M.J. Corey. 1998. Detection of disseminated prostate ceUs by reverse transcription-polymerase chain reaction (RT-PCR): technical and clinical aspects. Int J Cancer 77:655-673. 9. Dennis, P., E.A. Edwards, S.N. Liss and R. Fulthorpe. 2003. Monitoring gene expression in mixed microbial communities by using DNA microarrays. Appl Environ Microbiol 69:769-778.
10. Baker, M.K, K. Mikhitarian, W. Osta, K. CaUahan, R. Hoda, F. Brescia, R. Kneuper-HaU, M. Mitas, D.J. Cole and W.E. GiUanders. 2003. Molecular detection of breast cancer cells in the peripheral blood of advanced-stage breast cancer patients using multimarker real-time reverse transcription-polymerase chain reaction and a novel porous barrier density gradient centrifugation technology. Clin Cancer Res 9:4865-4871.
11. Mitas, M., K. Mikhitarian, C. Walters, P.L. Baron, B.M. ElUott, T.E. Brothers, J.G. Robison, J.S. Metcalf, Y.Y. Palesch, Z. Zhang, W.E. Gillanders and D.J. Cole. 2001. Quantitative real-time RT-PCR detection of breast cancer micrometastasis using a multigene marker panel. Int J Cancer 93:162-171..
12. Mitas, M., D.J. Cole, L. Hoover, M.M. Fraig, K. Mikhitarian, M.I. Block, BJ. Hoffman, R.H. Hawes, W.E. GiUanders and M.B. WaUace. 2003. Real-time reverse transcription-PCR detects KS1/4 mRNA in mediastinal lymph nodes from patients with non-small ceU lung cancer. Clin Chem 49:312-315.
13. Mitas, M., K. Mikhitarian, L. Hoover, M.A. Lockett, L. KeUey, A. Hill, W.E. GiUanders and D.J. Cole. 2002. Prostate-Specific Ets (PSE) factor: a novel marker for detection of metastatic breast cancer in axiUary lymph nodes. Br J Cancer 86:899- 904.
14. Mitas, M., L. Hoover, G. Silvestri, C. Reed, M. Green, A.T. Turrisi, C. Sherman, K. Mikhitarian, D.J. Cole, M.I. Block and W.E. GiUanders. 2003. Lunx is a superior molecular marker for detection of non-smaU lung cell cancer in peripheral blood. J Mol Diagn 5:237-242.

Claims

What is claimed is:
1. A target- specific reverse transcription (RT) primer comprising 10-16 nucleotides.
2. The target-specific reverse transcription' primer of claim 1, wherein the primer is a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2), GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID NO:4), AGCCACTTCTGC (SEQ ID NO:5), TGTAGCTGTTGCA (SEQ ID NO:6), GCCACCATTACCT (SEQ ID NO:7), GAACCAACTCAGGC (SEQ ID NO:8) and ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT.
3. A target-specific polymerase chain reaction (PCR) primeχ ompr-sing a nucleic acid selected from the group consisting of 5'-CCAAATGCGGCA-3' (SEQ ID NO:l), 5'-CTGCAGTTCTGTGA-3' (SEQ ID NO:2), 5'-GCAGTGACTTCGT- 3' (SEQ ID NO:3), 5'-TGAAGTACACTGG-3' (SEQ ID NO:4), 5'- AGCCACTTCTGC-3' (SEQ ID NO:5), 5'-TGTAGCTGTTGCA3' (SEQ ID NO:6), 5'-GCCACCATTACCT-3' (SEQ ID NO:7) and 5'-GAACCAACTCAGGC-3' (SEQ ID NO:8), 5'-ACCAATTGCAGAAGAC-3', 5'-ATCCCCTTGGCAA-3', 5'- TGAAGTACACTGG-3', 5'-AGCCACTTCTGC-3', 5'-AAAGCGCGTTGG-3' and 5'-GTGTGAGGCCAT-3', and further comprising at least 5 to about .29 additional 3' target-specific nucleotides.
4. The target-specific PCR primer of claim 3, wherein the primer is a reverse primer.
5. The target-specific PCR primer of claim 4, wherein the primer is selected from the group consisting of 5 '-CCAAATGCGGCATCTTCAAA (SEQ ID N0:9), 5'-CTGCAGTTCTGTGAGCCAAAG (SEQ ID NO: 10), 5'- GCAGTGACTTCGTCATTTGGAC (SEQ ID NO: 11), 5'- TGAAGTACACTGGCATTGACGA (SEQ ID NO:12), 5'- AGCCACTTCTGCACATTGCTG (SEQ ID NO: 13), 5'- TGTAGCTGTTGCAAATGCTTTAAGAAGAAGC (SEQ ID NO: 14), 5'- GCCACCATTACCTGCAGAAAC (SEQ ID NO: 15), 5'- GAACCAACTCAGGCAGGACTTT (SEQ ID NO:16), 5'- ACCAATTGCAGAAGACTCAGC, 5'-ATCCCCTTGGCAATCTGCA, 5'- TGAAGTACACTGGCATTGACGA, 5'-AGCCACTTCTGCACATTGCTG, 5'- AAAGCGCGTTGGCGATCT and 5 '-GTGTGAGGCCATGCTTGTTTG.
6. A target-specific PCR primer, wherein the primer is selected from the group consisting of 5'-GCCGTGTGAACCATGTGACTTT (SEQ ID NO:17), 5'- CGGATGAAACTCTGAGCAATGT (SEQ ID NO: 18), 5'- GCCAACAAAGCTCAGGACAAC (SEQ ID NO:19), 5'- CGCAGCTCAGGAAGAATGTG (SEQ ID NO:20), 5'- AGTGCTCAAGGACATCGAGACG (SEQ ID NO:21), 5'- GGGCCACTGTCGCATCATGATTGG (SEQ ID NO:22), 5'- ACCATCCTATGAGCGAGTACCC (SEQ ID NO:23), 5'- CCCTGGAAGCCTGCAAATT (SEQ ID NO:24) and 5'-
CCACTGCTCGTAAAGACATTCC, 5'-CTGGTGACACAGCTTATGCCCT, 5'- CGCAGCTCAGGAAGAATGTG, 5'- AGTGCTCAAGGACATCGAGACG, 5'- CCTGGATGCAGCGAATGAA and 5'-TTGCTGGAACATGCGACTGAT.
7. An RT-PCR method comprising: a) reverse transcribing RNA using a target-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product; and b) ampUfying the DNA product using a target-specific forward PCR primer and a target-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer.
8. The RT-PCR method of claim 7, wherein the method is appUed to formaUn fixed, paraffin-embedded tissue.
9. The RT-PCR method of claim 7, wherein the reverse PCR primer comprises the RT primer on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end.
10. The RT-PCR method of claim 7, wherein the reverse transcription step utilizes an annealing temperature from about 40°C to about 42°C.
11. The RT-PCR method of claim 7, wherein the reverse PCR primer comprises a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2) , GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID NO:4), AGCCACTTCTGC (SEQ ID NO:5), TGTAGCTGTTGCA (SEQ ID NO:6), GCCACCATTACCT (SEQ ID NO:7), GAACCAACTCAGGC (SEQ ID NO:8), and ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT. on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end.
12. The RT-PCR method of claim 7, wherein the reverse transcription step results in fold increases in signal detection of 1.3 for CK19, 5 for CEA, 9 for PSE, 17 to 41 for • 2m, mam, PIP and KS1/4, and 66 for mud compared to priming with random hexamers.
13. The RT-PCR method of claim 7, wherein the reverse transcription step results in a mean 16 (+/- 5.2)- fold increase in signal detection compared to priming with random hexamers.
14. The method of claims 7, 8, 9, 10, 11, 12 or 13, wherein target-specific RT primers and target-specific PCR primers for more than one target are used in a single reaction.
15. A method of detecting a cancer marker in formalin-fixed, paraffin-embedded tissue, comprising, a) reverse transcribing RNA from the tissue using a marker-specific RT primer comprising 10-16 nucleotides to produce a target-specific DNA product; and b) amplifying the DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of an ampUfication product indicating the presence of the cancer marker in the tissue.
16. A method of detecting cancer in formalin-fixed, paraffin-embedded tissue, comprising, a) reverse transcribing RNA from the tissue using an RT primer specific for a marker for the cancer, wherein the primer comprises 10-16 nucleotides, to produce a marker-specific DNA product; b) ampUfying the marker-specific DNA product using a marker-specific forward PCR primer and a marker-specific reverse PCR primer, wherein the reverse PCR primer comprises the RT primer, the presence of a the marker-specific ampUfication product indicating the presence of the cancer in the tissue.
17. The methods of claim 15 or 16, wherein the marker is selected from the group consisting of CK19, CEA, PSE, *2m, mam, PIP, mud, SBEM, ErbB2, EpCam, PDEF, HoxC6 and POTE.
18. The RT-PCR method of claim 15 or 16, wherein the reverse PCR primer comprises the RT primer on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end.
19. The RT-PCR method of claim 15 or 16, wherein the reverse transcription step utilizes an annealing temperature from about 40°C to about 42°C.
20. The method of claim 15 or 16, wherein the reverse PCR' primer comprises a nucleic acid selected from the group consisting of CCAAATGCGGCA (SEQ ID NO:l), CTGCAGTTCTGTGA (SEQ ID NO:2), GCAGTGACTTCGT (SEQ ID NO:3), TGAAGTACACTGG (SEQ ID NO:4), AGCCACTTCTGC (SEQ ID NO:5), TGTAGCTGTTGCA (SEQ ID NO:6), GCCACCATTACCT (SEQ ID NO:7), GAACCAACTCAGGC (SEQ ID NO:8), ACCAATTGCAGAAGAC, ATCCCCTTGGCAA, TGAAGTACACTGG, AGCCACTTCTGC, AAAGCGCGTTGG and GTGTGAGGCCAT on its 5' end, and further comprises at least 5 additional target-specific nucleotides on its 3' end.
21. The method of claims 15 or 16, wherein marker-specific RT primers and marker-specific PCR primers for more than one marker are used in a single reaction.
PCT/US2005/006067 2004-02-27 2005-02-28 Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription WO2005082041A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US54855204P 2004-02-27 2004-02-27
US60/548,552 2004-02-27

Publications (2)

Publication Number Publication Date
WO2005082041A2 true WO2005082041A2 (en) 2005-09-09
WO2005082041A3 WO2005082041A3 (en) 2009-06-11

Family

ID=34911005

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2005/006292 WO2005084254A2 (en) 2004-02-27 2005-02-25 Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription
PCT/US2005/006067 WO2005082041A2 (en) 2004-02-27 2005-02-28 Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2005/006292 WO2005084254A2 (en) 2004-02-27 2005-02-25 Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription

Country Status (2)

Country Link
US (1) US7981616B2 (en)
WO (2) WO2005084254A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006138716A2 (en) * 2005-06-17 2006-12-28 Brt Laboratories, Inc. Thermodynamically defined gene specific primers

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2744916A4 (en) 2011-07-13 2015-06-17 Primeradx Inc Multimodal methods for simultaneous detection and quantification of multiple nucleic acids in a sample
US20140005058A1 (en) * 2012-06-28 2014-01-02 Caldera Health Ltd. Methods and materials for the diagnosis of prostate cancers
JP7184373B2 (en) * 2020-01-29 2022-12-06 学校法人九州文化学園 Ex vivo test method for intestinal tumor

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801016A (en) * 1995-03-29 1998-09-01 Japan Tobacco Inc. DNA fragment, recombinant vector containing the same and method for expressing foreign genes using the same

Family Cites Families (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US616952A (en) * 1899-01-03 Detachable hinge
US5274087A (en) * 1986-08-13 1993-12-28 Molecular Diagnostics, Inc. cDNA coding for carcinoembryonic antigen (CEA)
US6040138A (en) * 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6346413B1 (en) * 1989-06-07 2002-02-12 Affymetrix, Inc. Polymer arrays
US6406844B1 (en) * 1989-06-07 2002-06-18 Affymetrix, Inc. Very large scale immobilized polymer synthesis
US6416952B1 (en) 1989-06-07 2002-07-09 Affymetrix, Inc. Photolithographic and other means for manufacturing arrays
US5143854A (en) * 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
DK0519338T3 (en) * 1991-06-20 1996-10-28 Hoffmann La Roche Improved Methods for Nucleic Acid Amplification
US6309823B1 (en) * 1993-10-26 2001-10-30 Affymetrix, Inc. Arrays of nucleic acid probes for analyzing biotransformation genes and methods of using the same
EP0732929B1 (en) 1993-10-29 2008-05-14 The Brigham And Women's Hospital, Inc. Therapeutic use of cis-element decoys in vivo
US5773213A (en) * 1994-06-06 1998-06-30 Brigham & Women's Hospital Method for conducting sequential nucleic acid hybridization steps
DE69637552D1 (en) * 1995-03-17 2008-07-10 Wayne John Cancer Inst Detection of breast metastases using a multi-marker test
US5668267A (en) * 1995-05-31 1997-09-16 Washington University Polynucleotides encoding mammaglobin, a mammary-specific breast cancer protein
WO1996039535A1 (en) * 1995-06-06 1996-12-12 Jan Vijg Method of and apparatus for diagnostic dna testing
US5882856A (en) * 1995-06-07 1999-03-16 Genzyme Corporation Universal primer sequence for multiplex DNA amplification
US5854033A (en) * 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US5837442A (en) * 1995-11-29 1998-11-17 Roche Molecular Systems, Inc. Oligonucleotide primers for amplifying HCV nucleic acid
AUPO188396A0 (en) 1996-08-26 1996-09-19 Insearch Limited Detection of protozoan parasites
US5958349A (en) * 1997-02-28 1999-09-28 Cepheid Reaction vessel for heat-exchanging chemical processes
US5843721A (en) * 1997-07-03 1998-12-01 Tularik Inc. Nucleic acids encoding human NIK protein
GB9719044D0 (en) 1997-09-08 1997-11-12 Inst Of Ophthalmology Assay
EP1179585B1 (en) * 1997-12-24 2008-07-09 Cepheid Device and method for lysis
US6660228B1 (en) 1998-03-02 2003-12-09 Cepheid Apparatus for performing heat-exchanging, chemical reactions
US6037129A (en) * 1998-05-28 2000-03-14 Medical University Of South Carolina Multi-marker RT-PCR panel for detecting metastatic breast cancer
US6306643B1 (en) * 1998-08-24 2001-10-23 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis
US6245517B1 (en) * 1998-09-29 2001-06-12 The United States Of America As Represented By The Department Of Health And Human Services Ratio-based decisions and the quantitative analysis of cDNA micro-array images
US6431476B1 (en) * 1999-12-21 2002-08-13 Cepheid Apparatus and method for rapid ultrasonic disruption of cells or viruses
AU2736400A (en) 1999-01-27 2000-08-18 University Of South Florida Inhibition of stat3 signal transduction for human cancer therapy
US6251601B1 (en) * 1999-02-02 2001-06-26 Vysis, Inc. Simultaneous measurement of gene expression and genomic abnormalities using nucleic acid microarrays
US6300069B1 (en) 1999-05-03 2001-10-09 Qiagen Gmbh Generation and amplification of nucleic acids from ribonucleic acids
CA2374423C (en) 1999-05-28 2013-04-09 Cepheid Apparatus and method for analyzing a liquid sample
JP4495866B2 (en) 1999-05-28 2010-07-07 セフィード Cartridge for controlling chemical reactions
SE9902410D0 (en) 1999-06-24 1999-06-24 Cavidi Tech Ab Reverse transcriptase assay kit, use thereof and method for analysis of RT activity in biological samples
US6403037B1 (en) 2000-02-04 2002-06-11 Cepheid Reaction vessel and temperature control system
US6783934B1 (en) 2000-05-01 2004-08-31 Cepheid, Inc. Methods for quantitative analysis of nucleic acid amplification reaction
US8048386B2 (en) 2002-02-25 2011-11-01 Cepheid Fluid processing and control
US6374684B1 (en) 2000-08-25 2002-04-23 Cepheid Fluid control and processing system
US6312929B1 (en) 2000-12-22 2001-11-06 Cepheid Compositions and methods enabling a totally internally controlled amplification reaction
JP4808365B2 (en) 2001-03-02 2011-11-02 ユニバーシティ オブ ピッツバーグ オブ ザ コモンウェルス システム オブ ハイヤー エデュケイション PCR method
JPWO2003055973A1 (en) 2001-12-26 2005-05-12 オリンパス株式会社 Reaction vessel and reaction vessel holding mechanism
US6819027B2 (en) 2002-03-04 2004-11-16 Cepheid Method and apparatus for controlling ultrasonic transducer
US20040101859A1 (en) 2002-11-25 2004-05-27 Cepheid Compositions, methods and kits for polynucleotide amplification reactions and microfluidic devices
US7824857B2 (en) * 2003-12-02 2010-11-02 Musc Foundation For Research Development Methods and compositions for diagnosing epithelial cell cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801016A (en) * 1995-03-29 1998-09-01 Japan Tobacco Inc. DNA fragment, recombinant vector containing the same and method for expressing foreign genes using the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE 0 NATIONAL INSTITUTES OF HEALTH 27 October 1999 Database accession no. AJ 246858 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006138716A2 (en) * 2005-06-17 2006-12-28 Brt Laboratories, Inc. Thermodynamically defined gene specific primers
WO2006138716A3 (en) * 2005-06-17 2007-05-31 Brt Lab Inc Thermodynamically defined gene specific primers

Also Published As

Publication number Publication date
WO2005084254A3 (en) 2006-08-10
US7981616B2 (en) 2011-07-19
WO2005084254A2 (en) 2005-09-15
WO2005082041A3 (en) 2009-06-11
US20080233563A1 (en) 2008-09-25

Similar Documents

Publication Publication Date Title
Mitas et al. Lunx is a superior molecular marker for detection of non-small lung cell cancer in peripheral blood
Vlassov et al. Circulating nucleic acids as a potential source for cancer biomarkers
US9075063B2 (en) Methylation analysis to determine the presence of cancer cells
KR101443214B1 (en) A composition, kit and microarray for diagnosing the risk of lung cancer recurrence in a patient after lung cancer treatment or a lung cancer patient
Kufer et al. Heterogeneous expression of MAGE-A genes in occult disseminated tumor cells: a novel multimarker reverse transcription-polymerase chain reaction for diagnosis of micrometastatic disease
Zamani et al. Deregulation of miR-21 and miR-29a in cervical cancer related to HPV infection
US7767390B2 (en) Methods for evaluating drug-resistance gene expression in the cancer patient
US20070172857A1 (en) Primer and method for detecting lymph node metastasis
EP2918679A1 (en) Method for detecting gastric polyp and gastric cancer using marker gene of gastric polyp and gastric cancer-specific methylation
Treece et al. Gastric adenocarcinoma microRNA profiles in fixed tissue and in plasma reveal cancer-associated and Epstein-Barr virus-related expression patterns
US10266900B2 (en) Method for detecting precancerous lesions
AU2016283063A1 (en) Methods of diagnosing bladder cancer
Gahan Circulating nucleic acids in plasma and serum: diagnosis and prognosis in cancer
WO2007098444A2 (en) Methods for analysis of extracellular rna species
Cheung et al. The potential of circulating cell free RNA as a biomarker in cancer
JP2010516234A5 (en)
Aihara et al. Mammaglobin B as a novel marker for detection of breast cancer micrometastases in axillary lymph nodes by reverse transcription‐polymerase chain reaction
US7785842B2 (en) Comparative analysis of extracellular RNA species
Moul et al. Absent ras gene mutations in human adrenal cortical neoplasms and pheochromocytomas
WO2005082041A2 (en) Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription
Goessl Diagnostic potential of circulating nucleic acids for oncology
Bacolod et al. Application of Multiplex Bisulfite PCR–Ligase Detection Reaction–Real-Time Quantitative PCR Assay in Interrogating Bioinformatically Identified, Blood-Based Methylation Markers for Colorectal Cancer
Schmitz et al. Differential expression of microRNA 181b and microRNA 21 in hyperplastic polyps and sessile serrated adenomas of the colon
Laner et al. Hypomethylation of the XIST gene promoter in prostate cancer
WO2011112880A2 (en) Hypermethylation biomarkers for detection of head and neck squamous cell cancer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase