WO2007117432A2 - Methods and compositions for modulating angiogenesis and tumor growth - Google Patents

Abstract

The present invention relates to methods and compositions for modulating angiogenesis and tumor growth. In particular, the present invention provides methods and compositions for modulating, studying, and treating angiogenesis and tumor growth in diseases characterized by female preponderance by inhibiting P-selectin.

Description

METHODS AND COMPOSITIONS FOR MODULATING ANGIOGENESIS AND

TUMOR GROWTH

This application was supported in part by NIH grants ROl AI040987, ROl HL058695, and ROl AR048267, and by a Veteran's Administration Merit Review Grant. The government may have certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates to methods and compositions for modulating angiogenesis and tumor growth. In particular, the present invention provides methods and compositions for modulating, studying, and treating angiogenesis and tumor growth in diseases characterized by female preponderance by inhibiting P-selectin.

BACKGROUND OF THE INVENTION Angiogenesis is a normal body process where new capillary blood vessels are generated from pre-existing blood vessels. The generation of new blood vessels is fundamental in healing, reproduction, and embryonic development in the human body. The building and remodeling of blood vessels is a critical event in the formation of every organ, and the relationship between blood vessels and the tissues they serve is tightly balanced between stasis, growth, and regression. However, abnormal angiogenesis does occur, and results in either excessive or insufficient blood vessel growth. For instance, conditions such as ulcers, strokes, and heart attacks may result from the absence of angiogenesis normally required for natural healing. In the other extreme, excessive blood vessel proliferation is a key process in promoting tumor growth and progression in all types of cancers. Increased angiogenesis signifies a poor prognosis for those afflicted with cancer.

There are a number of factors that contribute to angiogenesis that are targets for breast, and other cancer, treatments. For example, growth factors and other chemical signaling molecules normally present in the body are known to contribute to blood vessel proliferation to tumor cells, and these types of compounds are targets of anti-angiogenic research and potential future therapies.

What is needed are novel ways of studying, understanding and treating abnormal angiogenesis, tumor growth and progression in breast, and other cancers. Finding ways of treating cancers with novel anti-angiogenic therapies will serve to halt the growth of new blood vessels that bring nutrients to cancer cells by starving the tumor of what it needs to grow and survive, thereby giving cancer suffers new hope for survival and/or a better prognosis.

SUMMARY OF THE INVENTION

The present invention relates to methods and compositions for modulating angiogenesis and tumor growth. In particular, the present invention provides methods and compositions for modulating, studying, and treating angiogenesis and tumor growth in diseases characterized by female preponderance by inhibiting P-selectin. P-selectin (P-sel) is a member of the selectin family of cellular adhesion molecules that mediates leukocyte rolling and extravasation, particularly during inflammation. P- selectin expression is increased in a number of chronic inflammatory diseases such as rheumatoid arthritis,

Angiogenesis is essential in tumor growth and progression, and hence plays a critical role in breast cancer development, invasion, and metastasis. Angiogenesis depends on a variety of factors including cytokines like vascular endothelial growth factor (VEGF), basic fibroblast growth factor (hFGF), and interleukin-8 (IL-8). It is known that a member of the selectin family of cellular adhesion molecules, E-selectin, is an angiogenic factor. Increased soluble P-selectin (sP-sel) and P-sel ligands have been detected in several human carcinomas, and it has been shown that P-sel deficiency decreases tumor growth and metastasis in an animal model using human colorectal carcinoma cells, however until now, P-selectin has not been associated with cancer angiogenesis.

The hormonal estrogen system has been associated with female type cancers (e.g., breast, uterine), where tumor growth is associated with estrogen delivery of growth signals to its hormonal receptors. With less estrogen in the body, the hormone receptors receive fewer growth signals, and cancer growth can be slowed. Hormonal therapy can be an effective treatment regimen against cancers that shows female preponderance, that is cancers that are hormone receptor positive (e.g., estrogen receptor positive). Breast cancers can be either estrogen receptor positive or negative, and therapies that target the estrogen receptor positive breast cancers include anti-estrogen therapies that block the ability of estrogen to turn on and stimulate the growth of breast cancer cells. For example, aromatose inhibitors, selective estrogen receptor modulators, and estrogen receptor down-regulators are all forms of anti-estrogen therapies. Since estrogen is made in the ovaries, a more extreme form of anti-estrogen therapy is to surgically remove the ovaries thereby eliminating the source of estrogen production. Chemotherapy is used as a therapy for all types of cancers, including estrogen associated cancers. Indeed, anti-estrogen therapy is used as an adjuvant to chemotherapy. Chemotherapy is effective against cancer cells because the drugs used interfere with rapidly dividing cells. Unfortunately, there are many healthy cells in the human body that rapidly divide as part of their normal tissue maintenance processes, and chemotherapy drugs are non-selective, that is the drugs target all rapidly dividing cells whether they be cancerous or healthy. Other treatment and therapy regimens for combating breast cancer include, but are not limited to, those methods and compositions encompassed in U.S. Patent Numbers 6,150,421, 6,962,928, 6,562,380,

4,839,155, 6,690,976, 6,768,925, 5,769,779, 6,179,766, 5,362,720, 5,024,833, 6,638,727, 6,096,301, 4,806,561, 6,978,788, 6,288,039, 4,775,660, 4,666,885, 6,894,026, 6,211,239, 5,721,345, 5,496,846, 4,775,661, 6,936,424, 6,861,506, 6,844,325, 6,821,725, 6,713,503, 6,703,426, 6,656,480, 6,638,975, 6,602,907, 6,590,076, 6,586,570, 6,579,973, 6,573,368, 6,518,237, 6,423,496, 6,399,328, 6,387,697, 6,344,550, 6,225,054, 6,136,845, 6,066,616, 5,962,667, 5,939,277, 5,766,571, 5,759,766, 5,753,618, 6,969,518, 6,958,361, 6,828,431, 6,756,477, 6,703,204, 6,680,197, 6,586,572, 6,528,054, 6,489,101, 6,482,600, 6,432,707, 6,429,186, 6,410,507, 6,368,796, 6,358,682, 6,342,483, 6,316,213, 6,306,832, 6,096,718, 5,981,201, 4,612,282, and 4,522,918, all patents incorporated herein in their entireties. The methods of the patents can be used in combination with the methods of the present invention.

Treating estrogen receptor positive cancers with anti-estrogen therapy combined with chemotherapy is critical in potentially eliminating the cancer by slowing down or stopping cancer cell growth. However, equally important is the need to decrease or eliminate the abnormally increased angiogenesis that accompanies the growth and maintenance of these cancers.

Many selectins, known for their utility as cell adhesion molecules, are affected by estradiol (E2), one of several forms of the female estrogen hormone. Estradiol itself promotes angiogenesis in vitro and in vivo, and E2 therapy is known to induce vascularization in the rabbit myocardium. Further, estradiol activation of the estrogen receptor (ER) in mice can lead to uterine angiogenesis. The present invention demonstates that P-selectin and estradiol, both separately and in combination, are key compounds associated with the growth and maintenance of cancers exhibiting a female preponderance, i.e. those cancers which are estrogen related.

There is a real need for novel ways to treat and study aberrant angiogenesis associated with cancers. It is contemplated that therapies and treatments to inhibit cancer related angiogenesis find utility in helping to stop growth of cancer tumors and eliminate their nutrient supply. Therefore, the present invention relates to methods and compositions for modulating angiogenesis and tumor growth in cancer for therapeutic and research applications.

Thus, in some embodiments, the present invention provides a method for screening for compounds that inhibit angiogenesis and/or tumor growth comprising: providing a sample, providing one or more compounds, contacting the sample with the one or more compounds, detecting inhibition of P-selectin in the sample in the presence of said one or more compounds relative to the absence of said one or more compounds (directly or indirectly), and correlating the inhibition of P-selectin in the sample with a decrease in angiogenesis and/or tumor growth. The present invention is not limited by the nature of the compounds used. Compounds include, but are not limited to, RNA molecules (antisense oligonucleotides, siRNAs, etc.), antibodies, peptide, small molecules, and the like.

The present invention also provides a method for treating a subject with a disease demonstrating female preponderance comprising: providing a subject suspected of having a disease demonstrating female preponderance, providing one or more compounds that affect P-selectin activity or expression, and administering the one or more compounds to the subject under conditions such that angiogenesis associated with the disease is reduced. The present invention is not limited by the nature of the subject. In some embodiments, the subject is a human. In some embodiments, the disease is cancer (e.g., breast cancer, uterine cancer). In some embodiments, the cancer is estrogen responsive. In some embodiments, the compound is administered in conjunction with other cancer therapy (e.g., surgery, chemotherapy, radiation therapy, etc.).

In some embodiments, the present invention provides a method of inhibiting angiogenesis and tumor growth in a subject with estrogen receptor positive cancer comprising: providing a subject with an estrogen receptor positive cancer, providing a compound that inhibits P-selectin, and contacting the compound with the subject wherein the compound inhibits P-selectin, thereby decreasing angiogenesis and tumor growth in the patient. The present invention also provides compositions (e.g., for therapeutic or research uses) comprising agents that antagonize P-selectin (e.g., RNAi reagents) either alone or in combination with other agents (e.g., a chemotherapeutic agent that targets estrogen receptor positive cancer).

DESCRIPTION OF THE FIGURES

Figure 1 shows that angiogenesis is defective in P-sel null female mice but not in female wt mice, nor in male P-sel null or wt mice; a) hemoglobin content in aFGF treated Matrigel™ plug following implantation in female P-sel null vs wt mice, b) hemoglobin content in aFGF treated sponge granuloma following implantation in female P-sel null vs wt mice, c) hemoglobin content in aFGF treated Matrigel™ plug following implantation in male P-sel null vs wt mice, d) hemoglobin content in aFGF treated sponge granuloma following implantation in male P-sel null vs wt mice.

Figure 2 shows the effects of P-sel and estradiol on angiogenesis; a) HMVEC induced migration in a P-sel dose responsive manner, b) blockade of P-sel with anti-P-sel significantly decreases P-sel induced migration of HMVECs.

Figure 3 shows the Src contribution to P-sel induced angiogenesis and the interrelationship between P-sel and estradiol; a) P-sel induced migration of HMVEC is inhibited by inhibiting Src with PP2, b) Western blot demonstrating the time dependent increase in amount of Src phosphorylation in P-sel treated HMVECs, c) Western blot demonstrating that Src activation by P-sel and estradiol is blocked by anti-P-sel and PP2, d) Western blot demonstrating that ERK 1/2 induction and phosphorylation by estradiol is blocked by anti-P-sel, e) Src activation by sP-sel is blocked by anti-P-sel and the estradiol antagonist ICI, while estradiol dependent Src activation was blocked only partially by anti- P-sel and strongly inhibited by ICL

Figure 4 shows the activity of the estrogen receptor in estradiol and sP-sel stimulated endothelial cells; a) nuclear extracts of sP-sel or estrogen stimulated HUVECs demonstrate nuclear distribution of the estrogen receptor which is blocked upon treatment with anti-P-sel and ICI, respectively, b) amplification of HUVEC cell DNA following EZ-ChlP™ protocol demonstrates sP-sel and estradiol induced estrogen receptor recruitment to the bFGF promoter was inhibited by anti-P-sel and ICI.

Figure 5 shows that treatment with a P-selectin specific siRNAs diminishes estrogen receptor positive human tumor growth and angiogenesis when compared to estrogen receptor negative tumors; a) estrogen positive tumor growth (volume) is significantly decreased upon treatment with P-selectin specific siRNAs SEQ ED NO:1 (siRNAl) and SEQ IN NO:7 (siRNA2) in estradiol induced MCF estrogen receptor positive human breast cancer cells, whereas the same treatment in MDA-MB-231 estrogen receptor negative human breast cancer cells does not elicit the same decrease in tumor growth, b) quantitation of micro vessels in estradiol induced estrogen receptor positive MCF cells demonstrates angiogenesis is significantly decreased in cells treated with P-selectin specific siRNA (SEQ ID NO:1).

DEFINITIONS

As used herein, the term "sample" is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include tissues and blood products, such as plasma, serum and the like. Such examples are not however to be construed as limiting the sample types applicable to the present invention. As used herein, the term "female preponderance" refers to those cancers that are associated with the presence of estrogen receptors on the tumor cells and are further considered estrogen responsive tumors. As used herein, the term "peptide" refers to a compound comprising from two or more amino acid residues wherein the amino group of one amino acid is linked to the carboxyl group of another amino acid by a peptide bond. A peptide can be, for example, derived or removed from a native protein by enzymatic or chemical cleavage, or can be prepared using conventional peptide synthesis techniques (e.g. solid phase synthesis) or molecular biology techniques (see Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)).

As used herein, the term "peptidomimetic" refers to molecules which are not polypeptides, but which mimic aspects of their structures. For example, polysaccharides can be prepared that have the same functional groups as peptides. A peptidomimetic comprises at least two components, the binding moiety or moieties, and the backbone or supporting structure.

As used herein, the term "antibody" encompasses both monoclonal and polyclonal full length antibodies and functional fragments thereof (e.g. maintenance of binding to target molecule). Antibodies can include those that are chimeric, humanized, primatized, veneered or single chain antibodies.

As used herein, the term "effective amount" of a therapeutic compound (e.g. agent, compound, or drug) is an amount sufficient to achieve a desired therapeutic and/or prophylactic effect, such as to inhibit cancer tumor growth and/or vascularization by angiogenesis.

As used herein, the terms "agent", "compound" or "drug" are used to denote a compound or mixture of chemical compounds, a biological macromolecule such as an antibody, a nucleic acid, or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues that are suspected of having therapeutic properties. The compound, agent or drug may be purified, substantially purified or partially purified.

As used herein, the term "fragment" when in reference to a protein (e.g. "a fragment of a given protein") refers to portions of that protein. The fragments may range in size from two amino acid residues to the entire amino acid sequence minus one amino acid. In one embodiment, the present invention contemplates "functional fragments" of a protein. Such fragments are "functional" if they can bind with their intended target protein (e.g. the functional fragment may lack the activity of the full length protein, but binding between the functional fragment and the target protein is maintained). As used herein, the term "antagonist" refers to molecules or compounds (either native or synthetic) that inhibit the action of a compound (e.g., receptor channel, ligand, etc.). Antagonists may or may not be homologous to these compounds in respect to conformation, charge or other characteristics. Thus, antagonists may be recognized by the same or different receptors that are recognized by an agonist. Antagonists may have allosteric effects that prevent the action of an agonist. Or, antagonists may prevent the function of the agonist.

As used herein, the term "therapeutically effective amount" refers to that amount of the therapeutic agent sufficient to result in amelioration of one or more symptoms of a disorder, or prevent advancement of a disorder, or cause regression of the disorder. For example, with respect to the treatment of cancer, a therapeutically effective amount preferably refers to the amount of a therapeutic agent that decreases the rate of tumor related angiogenesis, decreases the rate of tumor growth, decreases tumor mass, decreases the number of metastases, increases time to tumor progression, or increases survival time by at least 5%, preferably at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%. As used herein, the term "subject" refers to any biological entity that can be used for experimental work. For example, a "subject" can be a mammal such as a mouse, rat, pig, dog, and non-human primate. Preferably the subject is a human.

As used herein, the term "subject suspected of having cancer" refers to a subject that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical). A subject suspected of having cancer may also have one or more risk factors. A subject suspected of having cancer has generally not been tested for cancer. However, a "subject suspected of having cancer" encompasses an individual who has received an initial diagnosis but for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission).

As used herein, the term "subject at risk for cancer" refers to a subject with one or more risk factors for developing a specific cancer. Risk factors include, but are not limited to, gender, age, genetic predisposition, environmental expose, previous incidents of cancer, preexisting non-cancer diseases, and lifestyle. As used herein, the term "characterizing cancer in subject" refers to the identification of one or more properties of a cancer sample in a subject, including but not limited to, the presence of benign, pre-cancerous or cancerous tissue, the stage of the cancer, and the subject's prognosis. Cancers may be characterized by the identification of the expression of one or more cancer marker genes, including but not limited to, the cancer markers disclosed herein.

As used herein, the terms "anticancer agent" and "anticancer drug" refer to any therapeutic agents (e.g., chemotherapeutic compounds and/or molecular therapeutic compounds), radiation therapies, or surgical interventions, used in the treatment of hyperproliferative diseases such as cancer (e.g., in mammals). As used herein, the term "hyperproliferative disease" refers to any condition in which a localized population of proliferating cells in an animal is not governed by the usual limitations of normal growth. Examples of hyperproliferative disorders include tumors, neoplasms, lymphomas and the like. A neoplasm is said to be benign if it does not undergo invasion or metastasis and malignant if it does either of these. A "metastatic" cell means that the cell can invade and destroy neighboring body structures. Hyperplasia is a form of cell proliferation involving an increase in cell number in a tissue or organ without significant alteration in structure or function. Metaplasia is a form of controlled cell growth in which one type of fully differentiated cell substitutes for another type of differentiated cell.

As used herein, the terms "prevent," "preventing," and "prevention" refer to a decrease in the occurrence of pathological cells (e.g., hyperproHferative or neoplastic cells) and/or tumor related angiogenesis in an animal. The prevention may be complete, e.g., the total absence of pathological cells and/or tumor related angiogenesis in a subject. The prevention may also be partial, such that the occurrence of pathological cells and/or tumor related angiogenesis in a subject is less than that which would have occurred without the present invention.

As used herein, the terms "RNA interference" and "RNAi" refer to a process whereby double stranded RNA inhibits gene expression in a sequence dependent manner. Small interfering RNA (siRNA) are small fragments (e.g., about 18-30 nucleotides in length) of sequence specific double stranded RNA whereby introduction of a sequence specific siRNA (e.g., substantially homologous or substantially complementary to the target RNA) into a subject results in post-transcriptional inhibition (e.g., tnRNA is not translated into a protein product) of target mRNA, thereby regulating target gene expression. SiRNAs may also contain additional sequences, for example, linking sequences or loops, as well as stem and other folding structures. The gene to be silenced may be endogenous or exogenous to the organism. The expression of the gene is either completely or partially inhibited. For example, in the present invention RNA interference occurs when P-selectin specific siRNA is utilized to inhibit expression of P-selectin thereby inhibiting tumor angiogenesis, growth, and proliferation.

As used herein "test compound" refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function. Test compounds comprise both known and potential therapeutic compounds. A test compound can be determined to be therapeutic by screening, using the screening methods of the present invention. A known therapeutic compound refers to a therapeutic compound that has been shown (e.g., through animal trial or prior experience with administration to humans) to be effective in such treatment or prevention. As used herein, the term "chemotherapeutic agent" refers to any compound, drug, or agent used to treat various forms of cancer. Chemotherapeutic agents have the ability inhibit cancer cell growth and/or kill cancer cells. Chemotherapeutic agents to be used in conjunction with the compounds of the present invention, include but are not limited to, estrogen receptor blockers, estrogen blockers, and additional oncolytic compounds, drugs and agents as described herein.

DETAILED DESCRIPTION OF THE INVENTION

Angiogenesis is essential in tumor growth, progression, and maintenance, and plays a critical role in cancer development (e.g., breast cancer development, invasion, and metastasis, for example). P-selectin expression is increased in a number of chronic inflammatory diseases, such as rheumatoid arthritis, and several cytokines are known to increase P-sel expression in mouse endothelial cells in vitro and in vivo. Increased P-sel and soluble P-selectin (sP-sel) are associated with several human carcinomas (e.g., colon, lung, breast), and it has been demonstrated that P-sel deficiency decreases tumor growth and metastasis using a human colorectal carcinoma cell line in an animal model. The present invention demonstrates that P-selectin is also involved in angiogenesis, and that regulation of P-selectin has an impact in hyperproliferative disease related angiogenesis.

Many selectins are affected by gonadal hormones, such as estradiol (E2). Estradiol is known to promote angiogenesis in vivo and in vitro by regulating the production of pro- angiogenic factors such as bFGF and VEGF. Estradiol therapy induces collateral and microvascular remodeling in the rabbit myocardium, and E2 induces endothelial cell proliferation and migration through a receptor mediated signaling cascade that involves mitogen activated protein kinase (MAPK). Activation of the estrogen receptor (ER) by estradiol contributes to uterine angiogenesis as suggested by impaired angiogenesis in estrogen receptor null mice. Increased angiogenesis signifies a poor prognosis in breast cancer and estrogen antagonists inhibit angiogenesis thereby improving disease prognosis.

The present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, it is contemplated that P-selectin contributes to angiogenesis and that sP-sel and P-sel are gender selective angiogenic mediators intimately linked to E2 dependent neovascularization; a process that is active in females where angiogenesis is elicited via activation of Src kinase. It is contemplated that P-selectin is a critical component of neovasularization as severe impairment of the angiogenic response is observed in P-sel null female mice. It is further contemplated that P-sel is involved in E2 mediated angiogenic responses on several levels, both transcriptional and non-transcriptional levels, such as E2 dependent bFGF secretion and E2 dependent activation of Src and MAPK kinases ERK 1/2. P-selectin, like estradiol, induces the translocation of the estrogen receptor (ER) to the cell nucleus and activates Src kinase. Moreover, P-sel causes ER nuclear localization and recruitment to the bFGF promoter, which is blocked by an ER antagonist and by an antibody to P-sel (e.g., anti -P-sel), thereby demonstrating that P-sel in a modifier of the estrogen receptor. Anti-P-sel also inhibits estradiol induced angiogenic sprout formation in endothelial cells, which further underscores the requirement for P-sel in angiogenesis and demonstrates that P-sel is a target of estradiol. As an angiogenic factor, estradiol exerts its activity directly on endothelial cells and enhances the secretion of potent angiogenic inducers like VEGF and bFGF. Anti-P-sel blocks E2 dependent bFGF secretion, further demonstrating the link between estradiol and P-sel in female angiogenesis. Therefore, P-sel and estradiol interact to induce angiogenesis.

Src kinases are crucial for cell survival and angiogenesis and are induced as a consequence of estrogen receptor activation. Signalling pathways stimulated in human female microvascular endothelial cells (HMVEC) by sP-sel demonstrate a time dependent increase in Src phosporylation that was inhibited by the Src inhibitor PP2. As well, neovascularization of mouse corneas positively demonstrates the role of Src kinase in sP-sel induced angiogenesis in vivo. Estradiol signaling in endothelial cells involves the activation of both Src and ERKl/2 kinases which is markedly decreased by anti-P-sel. The present invention is not limited to a particular mechanism. Indeed, an understanding of the mechanism is not necessary to practice the present invention. Nonetheless, it is contemplated that not only is P-selectin angiogenesis mediated by Src kinases, but P-sel is also a downstream target of estradiol in endothelial cells.

Experiments conducted during development of the present invention demonstrated that small interfering RNA (siRNA) inhibit tumor growth of estrogen positive human breast cancer tumor cells in an animal model using severely compromised irnmunodeficient (SCID) mice. When SCID mice are implanted with the ER positive human breast cancer cell line MCF-7, injection of a selective siRNA against P-sel blocks P-sel expression, significantly suppressing growth and angiogenesis. However, the same treatment performed on SCID mice implanted with the ER negative human breast cancer cell line MDA-MB-231 did not block growth and angiogenesis of the tumor, further demonstrating the interdependence of the estrogen system and P-selectin for angiogenic induction, as well as providing a novel route for treating ER positive tumors by selectively targeting P-selectin. Thus, the present invention provides compositions and methods that take advantage of the fact that P-selectin is, for example, a novel angiogenic stimulus that is linked with estradiol dependent angiogenesis. For example, the present invention provides compositions and methods for treating cancers that demonstrate a female preponderance that may be resistant to, or can be used in conjunction with, conventional therapies by providing methods and compositions surrounding the treatment. The present invention also provides compositions and methods for the study of estrogen related angiogenesis in tumor cell growth, proliferation, and maintenance.

In one embodiment, the method of the invention comprises the modulation of P- selectin. In some embodiments, the modulation of P-selectin comprises modulating P- selectin in cancer cells demonstrating a female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.). In some embodiments, modulation of P- selectin in cancer cells further comprises modulation of P-selectin in breast cancer cells, more specifically estrogen receptor positive breast cancer cells. In some embodiments, the modulation of P-selectin comprises a treatment for cancers (e.g., breast, uterine, etc.). In some embodiments, the modulation of P-selectin comprises a treatment for cancers that demonstrate a female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.). In some embodiments, the present invention provides methods, compositions, and kits for use in the modulation of P-selectin. It is contemplated that P-selectin may be modulated using any methods including, but not limited to, biochemical, genetic, and other methods known in the art. Some embodiments of the present invention relate to therapeutic methods and compositions for treating a subject having a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.). In some embodiments, the method of treatment comprises the administration of an antagonist, agent, compound, or drug to a subject having a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.). In some embodiments, the antagonist physically interacts with P-selectin, or the antagonist blocks production of P-selectin, e.g. by inhibiting translation of the P-selectin gene into a protein product, as described herein. In some embodiments, the antagonist is a siRNA that inhibits translation of the P-selectin gene. Some embodiments of a therapeutic method of treatment for a subject having a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.) comprises the administration of an antagonist (e.g., siRNA, antibody, antibody fragment, peptide, peptidomimetic, etc.) to P-selectin. Some embodiments comprise the administration of an antibody, antibody fragment, peptide, compound, agent or drug capable of decreasing estrogen (e.g., estrogen blockers), estrogen receptor binding (e.g., estrogen receptor blockers), or cancer cell growth (e.g., oncolytic agents such as chemotherapy drugs) to a subject having a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.) in conjunction with an antagonist to P- selectin. Estrogen receptor blockers include, but are not limited to, tamoxifen (e.g.,

Nolvadex®, tamoxifen citrate), raloxifene (e.g., Evista®), toremifene (e.g., Fareston®), fulvestrant (e.g., Faslodex®), estrogen receptor specific binding proteins (e.g., full length antibodies or functionally binding fragments thereof, peptides, peptidomimetics) specific to the estrogen receptor and capable of binding to the estrogen receptor thereby disrupting its binding capacity to other cellular entities (e.g., estrogen and analogs thereof). Estrogen blockers include, but are not limited to, aromatase inhibitors such as zoledronic acid (e.g., Zometa®), letrozole (e.g., Femara®), anastrozole (e.g., Arimidex®), exemestane (e.g., Aromasin®), estrogen specific binding proteins (e.g., full length antibodies or functionally binding fragments thereof, peptides, peptidomimetics) specific to estrogen and capable of binding to estrogen thereby disrupting its binding capacity to other cellular entities (e.g., estrogen receptor).

Is some embodiments, the treatment of a cancer demonstrating female preponderance comprises the co-administration of a siRNA specific to P-selectin with other therapeutic compounds, agents, or drugs including, but not limited to, therapeutic compounds, agents or drugs capable of decreasing estrogen, estrogen receptor binding, or cancer cell growth to a subject having a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.) as described herein.

In conjunction with an antagonist of P-selectin (e.g., siRNA, antibody, antibody fragment, peptide, peptidomimetic, etc.), any chemotherapy drug that is routinely used in a cancer therapy context finds use in the compositions and methods of the present invention. For example, the United States Food and Drug Administration maintains a formulary of oncolytic agents approved for use in the United States. International counterpart agencies to the U.S.F.D.A. maintain similar formularies. Table 1 provides a list of exemplary chemotherapeutic agents approved for use in the United States Those skilled in the art will appreciate that product literature and labeling required for all United States approved chemotherapeutics describe approved indications, dosing information, toxicity data, and the like, for the exemplary agents.

Table 1

Numerous other examples of chemotherapeutic compounds and anticancer therapies suitable for co-administration with the disclosed compounds are known to those skilled in the art. Anticancer agents further include compounds which have been identified to have anticancer activity but are not currently approved by the United States Food and Drug Administration or other counterpart agencies or are undergoing evaluation for new uses. Examples include, but are not limited to, 3-AP, ^-O-tetradecanoylphorbol-lS-acetate, 17AAG, 852A, ABI-007, ABR-217620, ABT-751, ADI-PEG 20, AE-941, AG-013736, AGROl 00, alanosine, AMG 706, antineoplastons, AP23573, apaziquone, APC8015, atiprimod, ATN-161, atrasenten, azacitidine, BB-10901, BCX-1777, bevacizumab, BGOOOOl, bicalutamide, BMS 247550, bortezomib, bryostatin-1, buserelin, calcitriol, CCI- 779, CDB-2914, cefixime, cetuximab, CG0070, cilengitide, clofarabine, combretastatin A4 phosphate, CP-675,206, CP-724,714, CpG 7909, curcumin, decitabine, DENSPM, doxercalciferol, E7070, E7389, ecteinascidin 743, efaproxiral, eflornithine, EKB-569, enzastaurin, erlotinib, exisulind, fenretinide, flavopiridol, fludarabine, fiutamide, fotemustine, FR901228, G17DT, galiximab, gefitinib, genistein, glufosfamide, GTI-2040, histrelin, HKI-272, homoharringtonine, HSPPC-96, iloprost, imiquimod, infliximab, interleukin-12, IPI-504, irofulven, ixabepilone, lapatinib, lenalidomide, lestaurtinib, leuprolide, LMB-9 immunotoxin, lonafarnib, luniliximab, mafosfamide, MB07133, MDX- 010, MLN2704, monoclonal antibody 3F8, monoclonal antibody J591, motexafin, MS-275, MVA-MUCl -IL2, nilutamide, nitrocamptothecin, nolatrexed dihydrochloride, nolvadex, NS-9, 06-benzyl guanine, oblimersen sodium, ONYX-Ol 5, oregovomab, OSI-774, panitumumab, paraplatin, PD-0325901, pemetrexed, PHY906, pioglitazone, pirfenidone. pixantrone, PS-341 , PSC 833, PXDl 01 , pyrazoloacridine, Rl 15777, RADOOl , ranpirnase, rebeccamycin analogue, rhuAngiostatin protein, rhuMab 2C4, rosiglitazone, rubitecan, S-I, S-8184, satraplatin, SB-, 15992, SGN-0010, SGN-40, sorafenib, SR31747A, ST1571, SUOl 1248, suberoylanilide hydroxamic acid, suramin, talabostat, talampanel, tariquidar, temsirolimus, TGFa-PE38 immunotoxin, thalidomide, thymalfasin, tipifarnib, tirapazamine, TLK286, trabectedin, trimetrexate glucuronate, TroVax, UCN-I, valproic acid, vinflunine, VNP40101M, volociximab, vorinostat, VX-680, ZD1839, ZD6474, zileuton, and zosuquidar trihydrochloride.

Preferred conventional anticancer agents for use in co-administration with antagonists of P-selectin (e.g., siRNA, antibody, antibody fragment, peptide, peptidomimetic, etc.) include, but are not limited to, doxorubicin, fluorouracil, cyclophosphamide, paclitaxel, docetaxel, methotrexate, epirubicin, gemcitabine, vincristine, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, zoledronic acid, letrozol, anastrozole, and exemestane. These agents can be prepared and used singularly, in combined therapeutic compositions, in kits, or in combination with immunotherapeutic agents, and the like.

For a more detailed description of anticancer agents and other therapeutic agents, those skilled in the art are referred to any number of instructive manuals including, but not limited to, the Physician's Desk Reference and to Goodman and Gilman's "Pharmaceutical Basis of Therapeutics" tenth edition, Eds. Hardman etal., 2002, incorporated herein in its entirety.

In some embodiments the present invention provides methods of storage and administration of the antagonist, agent, compound, or drug in a suitable environment (e.g. buffer system, adjuvants, etc.) in order to maintain the efficacy and potency of the agent, compound, or drug such that its usefulness in a method of treatment of a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.) is maximized. For example, protein agents, chemicals or nucleic acids benefit from a storage environment free of proteinases and other enzymes or compounds that could cause degradation of the protein, chemical, or nucleic acid.

A preferred embodiment is contemplated where the antagonist, agent, compound, or drug is administered to the individual as part of a pharmaceutical or physiological composition for treating a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.). Such a composition can comprise an antagonist and a physiologically acceptable carrier. Pharmaceutical compositions for co- therapy can further comprise one or more additional therapeutic agents. The formulation of a pharmaceutical composition can vary according to the route of administration selected (e.g., solution, emulsion, capsule). Suitable pharmaceutical carriers can contain inert ingredients that do not interact with the antagonist P-selectin function and/or additional therapeutic agent(s). Standard pharmaceutical formulation techniques can be employed, such as those described in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA. Suitable physiological carriers for parenteral administration include, for example, sterile water, physiological saline, bacteriostatic saline (saline containing about 0.9% benzyl alcohol), phosphate-buffered saline, Hank's solution, Ringer's-lactate and the like. Methods for encapsulating compositions (such as in a coating of hard gelatin or cyclodextran) are known in the art (Baker, et al, "Controlled Release of Biological Active Agents", John Wiley and Sons, 1986). The particular co-therapeutic agent selected for administration with an antagonist of P-selectin will depend on the type and severity of the cancer being treated as well as the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs.

In some embodiments the therapeutic agent is administered by any suitable route, including, for example, orally (e.g., in capsules, suspensions or tablets) or by parenteral administration. Parenteral administration can include, for example, intramuscular, intravenous, intraarticular, subcutaneous, or intraperitoneal administration. In some embodiments, the method of administration of the therapeutic agent is by direct injection into, or adjacent to, the tumor. The therapeutic agent (e.g., P-selectin antagonist, nucleic acid, additional therapeutic agent) can also be administered transdermally, topically, by inhalation (e.g., intrabronchial, intranasal, oral inhalation or intranasal drops) or rectally. Administration can be local or systemic as indicated. The preferred mode of administration can vary depending upon the particular agent chosen. A timed-release, subcutaneous mode of administration is also contemplated. For example, a therapeutic agent is inserted under the skin either by injection, and/or by placing a solid support that has been previously impregnated or which contains (e.g., a capsule) the therapeutic agent, under the skin. An effective amount of the therapeutic agent is then released over time (e.g., days, weeks, months, and the like) such that the subject is not required to have a therapeutic agent administered on a daily basis.

Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, wherein each preferably contains a predetermined amount of the active ingredient; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. In other embodiments, the active ingredient is presented as a bolus, electuary, or paste, etc. In some embodiments, tablets comprise at least one active ingredient and optionally one or more accessory agents/carriers and are made by compressing or molding the respective agents. In some embodiments, compressed tablets are prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g., povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g., sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose) surface-active or dispersing agent. Molded tablets are made by molding in a suitable machine a mixture of the powdered compound (e.g., active ingredient) moistened with an inert liquid diluent. Tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach. Formulations suitable for parenteral administration include aqueous and nonaqueous isotonic sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, and liposomes or other microparticulate systems which are designed to target the compound to blood components or one or more organs. In some embodiments, the formulations are presented/formulated in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include such further agents as sweeteners, thickeners and flavoring agents. It also is intended that the agents, compositions and methods of this invention be combined with other suitable compositions and therapies. Still other formulations optionally include food additives (suitable sweeteners, flavorings, colorings, etc.), phytonutrients (e.g., flax seed oil), minerals (e.g., Ca, Fe, K, etc.), vitamins, and other acceptable compositions (e.g., conjugated linoelic acid), extenders, and stabilizers, etc.

When co-administration of an antagonistic therapeutic agent (e.g., P-selectin antagonist, nucleic acid) and an additional therapeutic agent is indicated or desired for treating a subject having a cancer demonstrating female preponderance (e.g., estrogen receptor related cancers such as breast, uterine, etc.), the antagonistic therapeutic agent can be administered prior to, concurrently with, or subsequent to administration of the additional therapeutic agent. When the antagonistic therapeutic agent and the additional therapeutic agent are administered at different times, they are preferably administered within a suitable time period to provide substantial overlap of the pharmacological activity of the agents. The treating physician will be able to determine the appropriate timing for coadministration of antagonistic therapeutic agents and an additional therapeutic agent.

In other embodiments, the present invention provides methods of screening compounds for their ability to inhibit P-selectin. In some embodiments, the present invention provides drug-screening assays (e.g., to screen for drugs effective in inhibiting P- selectin). For example, the present invention contemplates methods of screening for compounds that modulate (e.g., decrease) the expression level or activity of P-selectin. In one embodiment, the expression level of P-selectin or its activity is detected in vivo in a subject upon administration of a candidate compound. In some embodiments, the expression level or activity of P-selectin is detected using an in vitro assay, for example, an enzyme-linked immunosorbent assay (ELISA), or other assays (e.g., protein and nucleic acid blots) which utilize a labeled (e.g., fluorescent, luminescent, colorimetric, radioactive) compound for detection of a protein or gene product or activity, chemotaxis assays as described herein, and other assays that are understood by those skilled in the art. In other embodiments, the expression level of P-selectin can be detected using PCR techniques as described herein. Antagonists of P-selectin can be identified, for example, by screening libraries or collections of molecules, such as the Chemical Repository of the National Cancer Institute, as described herein or using other suitable methods. Antagonists thus identified find use in the therapeutic methods described herein. Another source for identifying potential antagonists of P-selectin are combinatorial libraries, which can comprise many structurally distinct molecular species. Combinatorial libraries can be used to identify compounds or to optimize a previously identified compound. Such libraries can be manufactured by well-known methods of combinatorial chemistry and can be screened by suitable methods, such as those described in Molecular Cloning: A Laboratory Manual Sambrook J et al Eds, Cold Harbor Spring Laboratory Press.

In some embodiments, drug screening assays are performed in animals. Any suitable animal can be used including, but not limited to, baboons, rhesus or other monkeys, mice, or rats. Animal models of cancer demonstrating a female preponderance are generated, and the effects of candidate drugs on the animals are measured. The expression level or activity of P-selectin can be detected using any suitable method, including, but not limited to, those disclosed herein (e.g., tissue analysis, nucleic acid analysis, angiogenic analysis, etc.). The present invention is not limited by the nature of the antagonist used in the therapeutic or screening methods of the invention. In one embodiment, RNA interference of the P-selectin gene is accomplished when the antagonist is a nucleic acid such as a siRNA, which inhibits the translation of the mRNA encoding P-selectin. Creation and use of siRNA sequences is well known by those skilled in the art. Specialized software such as BLOCK- IT™ RNAi Designer (Invitrogen Corporation) designs targeted RNAi molecules to user defined sequences, and reference manuals (e.g., Harmon GJ ed., 2003, RNAi: A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, p.436.) to RNA interference applications are readily available, and are incorporated by reference herein in their entireties. For example, siRNA target sequences against P-selectin can be identified by using the P-selectin nucleic acid sequence found in GenBank (NM_011347, incorporated herein in its entirety) in conjunction with BLOCK-iT™ RNAi Designer. In some embodiments, siRNA target sequences against P-selectin target, for example, the nucleotide region between 1261 and 1681 as found in GenBank Accession No. NM_011347. Exemplary siRNAs of the present invention include, but are not limited to, GCUCUUGGUGGGAGCAAGUGUGAUA (SEQ ID NO: 1 ), GGCACUUCACAGACUUAGUGGCCAU (SEQ ID NO:2), GGAUUGGUAUCCGAAAGATCAACAA (SEQ ID NO:3), GGCAAGUGGAAUGAUGAACCCUGUU (SEQ ID NO:4), GCAAGUGUGAUAAGAUGCCUGGCUA (SEQ ID NO:5), GGGAAUUCCACCUACAAAUCCACAU (SEQ ID NO:6), GGACUUUGAGCUACUGGGAUCUGAA (SEQ ID NO:7), GCUUUGGUCCGAACACCACUUGUUA (SEQ ID NO:8), GGACACUCCUGGCUCUGCUAAGAAA (SEQID NO:9), and CCAAAGCACCCAAAGAUCAUUGUUU (SEQIDNO:10).

In some embodiments, an antagonist of P-selectin does not significantly inhibit the function of other related cellular proteins (e.g., additional selectin family members such as E-selectin). Such P-selectin antagonists can be identified by suitable methods, such as by suitable modification of the methods described herein. For example, cells that do not express P-selectin but do express one or more other related cellular proteins (e.g., additional selectin family members such as E-selectin) can be screened for protein specificity. Such cells or cellular fractions (e.g., membranes, nuclei) obtained from such cells can be used in a suitable binding or activity assay. For example, if a cell lacks P-selectin and contains only E-selectin, the P-selectin antagonists can be assayed for their capacity to inhibit expression or activity of the E-selectin relative to the P-selectin.

In another embodiment, the antagonist of P-selectin is an agent that inhibits mammalian P-selectin. Preferably, the antagonist of P-selectin is a compound that is, for example, a small organic molecule, natural product, protein (e.g., antibody, peptide fragment), nucleic acid, or peptidomimetic. Antagonists of P-selectin can be prepared and/or identified using suitable methods, such as the methods described herein or suitable modifications thereof. Examples of antagonists of P-selectin are found in the following references, all of which are incorporated herein in their entireties; US Patent Nos. 5,807,745, 5,602,230, 5,378,464, 6,033,667 6,969,517, Cecconi O et al., 1994, J. Biol.

Chem. 269:15060-6, Nelson RM et al., 1993, Blood 82:3253-8, Todderud G et al., 1992, J. Leukoc. Biol. 52:85-8, Aruffo A et al., 1992, Proc. Natl. Acad. Sci. 89:2292-6, Rivera- Chavez F et al., 1998, J. Trauma-Injury Inf. Crit. Care 45:440-5, Hayashi Y et al., 2000, ASAIO J. 46:334-7, Yanaba K et al., 2004, J. Leuk. Biol. 76:374-82, Bedard PW et al., 2005, J. Thromb. Haem. VoI 3, Suppl. 1, Abst. No. OR390, Wei M et al., 2004, J. Biol. Chem. 279:29202-10, Borgstrom P et al., J. Clin. Invest. 99:2246-53, Theoret JF et al., 2001, J. Pharmacol. Exp. Ther. 298:658-64, Molenaar TJ et al., 2002, Blood 100:3570-7, Melrose J et al., J. Immunol. 161 :2457-64, Murohara T et al., 2004, Circulation 110:141-8, Aigner S et al., 1998, FASEB J. 12:1241-51. The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof. EXAMPLE 1- In vivo angiogenesis assays using Matrigel ™ plug, Hydron pellets, sponge granuloma, and corneal angiogenesis techniques

Three different implantation angiogenic assays, Matrigel™ plug, sponge granuloma, and corneal micropocket were performed on both female and male P-sel null and wt mice to assay for in vivo angiogenesis associated with P-sel.

Matrigel™ plug assays were performed in P-sel null and wt C57/BL6 mice of both sexes. Each mouse was injected subcutaneously on the ventral aspect of the abdomen with 500μl growth factor reduced Matrigel™ Basement Membrane Matrix (BD Biosciences, Beford, MA) containing lng/ml acidic fibroblast growth factor (aFGF). Plugs were removed seven days post-implantation, homogenized, and assayed for hemoglobin content using Drabkin's Method as defined in Park CC₅ et al., 2001, J. Immunol. 167:1644-53, incorporated herein in its entirety.

The mouse sponge granuloma model of inflammatory angiogenesis was performed in both female and male P-sel null and wt mice as previously described (Park CC, 2001) using Ing/sponge of acidic fibroblast growth factor (aFGF). Polyvinyl alcohol sponges were implanted in the dorsal area, extracted eight days post-implantation, homogenized, and assayed for hemoglobin content as previously described.

Mouse corneal micropocket assays were performed on P-sel null and wt mice of both sexes as previously described in Koch AE, et al., 1992, Science 258:1798-1801 , incorporated herein in its entirety. Corneas were examined seven days-post implantation and photographed. Vessels growing from the limbus toward the implant containing the pro- angiogenic basic fibroblast growth factor (bFGF, 10OnM) or recombinant sP-sel (5OnM, gift from Dr. McEver, Universiity of Oklahoma, Oklahoma City, OK) were considered as a positive response. Significantly weaker angiogenic responses were seen in female P-sel null mice compared to their wt counterparts in all three assays, whereas there were no significant differences seen comparing the male P-sel null with wt mice (Figures la-d). Hemoglobin content was significantly higher in female wt mice in both the Matrigel™ and sponge models (3.5 and 2.9 fold higher, respectively) when compared to the P-sel null females (Figures la-b). Qualitative corneal assays where the pro-angiogenic bFGF was contained in the implant also showed reduced angiogenesis toward the implant in P-sel null female mice when compared to wt female mice, however no such reduction in angiogenesis is seen in either male genotype. Therefore, decreased angiogenesis is demonstrated in female P-sel null mice when compared to wt female mice, while decreased angiogenesis is not seen in male P-sel null or wt mice showing that the role of P-sel in angiogenesis is gender selective.

Corneal angiogenesis assays were performed on P-selectin null mice after Hydron pellets impregnated with soluble P-sel were administered to the mice. It was demonstrated that the administration of the soluble P-sel Hydron pellets to the mice restored angiogenesis in the P-selectin null mice. Further, Hydron pellets impregnated with VEGF (to induce angiogenesis) were applied to male and female P-selectin null mice and wild type control mice. The VEGF-induced angiogenesis was impaired in female P-selectin null mice as compared to the female wild type control mice. These data further demonstrate the gender selective role of P-sel in angiogenesis.

EXAMPLE 2- In vitro endothelial cell chemotaxis assay

To determine the effect of sP-sel on endothelial cells, experiments were performed to examine the ability of sP-sel to induce human female microvascular endothelial cell (HMVEC) chemotaxis in a modified Boyden chamber assay.

Human female microvascular endothelial cells (passage 5-10, Cambrex, Walkersville, MD) were maintained in endothelial cell basal media (EBM) supplemented with Cambrex media supplements and 5% fetal bovine serum (FBS). Phosphate buffered saline was utilized as a negative control and bFGF (6OnM, R&D Systems Inc., Minneapolis, MN) was utilized as a positive control. sP-sel was used as a test substance in conjunction with DMSO (vehicle control), an inhibitor of Src kinase (PP2,10μM, Calbiochem, San Diego, CA), or an inhibitor of G-protein (pertussis toxin, 500ng/ml, Sigma Chemical Co., St. Louis, MO). For blocking studies, sP-sel was pre-incubated with rabbit anti-human P-sel (BD Pharmingen, San Diego, CA) or its isotype IgG (lOμg/ml) control for 30 min. at 37⁰C prior to addition to the chemotaxis assay. Assays were performed in a modified Boyden Chamber.

Soluble P-selectin induced HMVEC migration in a dose dependent manner (Figure 2a). At lμM sP-sel, basal HMVEC migration was enhanced by 60% (P<0.05). Preincubation of cells with rabbit anti-human P-sel significantly decreased sP-sel chemotaxis (Figure 2b), thereby demonstrating that the migration effect was specifically due to sP-sel. The Src inhibitor, PP2, inhibited sP-sel dependent migration of HMVEC cells, whereas the G-protein inhibitor, pertussis toxin, had minimal effect on HMVEC migration (Figure 3 a), thereby demonstrating that the Src family kinases play a role in P-sel induced angiogenesis. EXAMPLE 3-In vivo corneal endothelial cell morphogenesis assay

Experiments were performed to study the interrelationship between P-sel and estradiol mediated angiogenesis and endothelial cell signaling. P-selectin null and wt mice were euthanized and corneas removed and placed in phenol red free growth factor reduced Matrigel™ Basement Membrane Matrix as described in Amin MA₅ et al., 2003 Circ. Res. 93:321-9, incorporated herein in its entirety. Estradiol (5OnM, Sigma Chemical Co.) was added to wt mouse corneas in the presence or absence of anti-P-sel (lOμg/ml) to examine the relationship between estradiol and P-sel. In another experiment, corneas from wt mice were utilized in the presence or absence of PP2, pertussis toxin, and anti-P-sel with sP-sel (5OnM) to determine the affect of these inhibitors and anti-P-sel on corneal vascular sprouting. Corneas were photographed on day nine following treatment. For estradiol studies, cells were maintained in phenol red free EBM and dialyzed FBS as phenol red can produce estradiol like effects. Basic FGF induced weaker endothelial vascular sprout formation from corneas extracted from the female P-sel null mice when compared to the wt controls, and corneas extracted from wt mice produced weaker angiogenesis in response to estradiol in the presence of anti-P-sel when compared to the IgG control, thereby demonstrating a link between P-sel angiogenesis and estradiol. Soluble P-selectin induced endothelial cell sprouting from female wt mice excised corneas was also inhibited by PP2, but not pertussis toxin, further demonstrating the role of Src kinases in P-sel induced angiogenesis.

EXAMPLE 4- In vitro assays to study Src contribution to sP-sel induced angiogenesis

To further investigate Src kinase activation in signal transduction by P-sel, signaling events in sP-sel stimulated HMVECs were examined. As well, the MAPK signaling pathway using ERK 1/2 was examined as estradiol activated MAPK pathways can be downstream targets of estrogen receptors in endothelial cells.

After serum starving HMVEC cells cultured in EBM with 5% FBS for one hour, the cells were stimulated with sP-sel or estradiol in the presence or absence of anti-human P-sel, the MAPK (ERK 1/2) inhibitor PD98059, PP2, and pertussis toxin. Post-stimulation the cells were lysed and cellular proteins were visualized by Western blot analysis as described in Amin MA, 2003 and Kumar P, et al., 2003, Blood 101 :3960-8, incorporated herein in its entirety. For estradiol studies, cells were maintained in phenol red free EBM and dialyzed FBS. In another assay, human umbilical vein endothelial cells (HUVEC) were treated for 30 min. with sP-sel and estradiol in the presence of PP2, anti-P-sel, or the estradiol antagonist ICI. Cell extracts we^'re collected and Src activation analyzed by Western blot analysis with antibodies against active, phosphorylated Src (Santa Cruz, Santa Cruz, CA). To assess 5 loading, the Western blots were stripped and re-probed for Src.

Src phosphorylation increased over time in sP-sel treated HMVECs (Figure 3b, n=2), and pre-treatment with Src inhibitor PP2 substantially inhibited sP-sel activated Src kinase. Src activation by estradiol was also blocked by PP2 and anti-P-sel (Figure 3 c, n=2), thereby demonstrating that both E2 and sP-sel induce Src activation. Anti-P-sel also 0 diminished estradiol induced ERK1/2 when measuring for active ERK 1/2 (Figure 3d, n=2), thereby demonstrating that E2 induced ERK 1/2 activation is P-sel dependent. Src activation was abolished by both ICI and anti-P-sel (Figure 3e), demonstrating that P-sel activates Src via the estrogen receptor in endothelial cells as does estradiol.

S EXAMPLE 5- Estrogen receptor α (ERa) nuclear localization

To further elucidate the relationship between estradiol and P-sel, experiments where HUVECs were stimulated with E2 and sP-sel in the presence of ICI or anti-P-sel were performed, and nuclear localization of the estrogen receptor was examined.

HUVECs were grown to near confluence in 60mm tissue culture plates. Cells were 0 incubated with P-sel or ICI (1 μM) for one hour and treated with estradiol or sP-sel for an additional 30 minutes. Nuclear extracts were collected using a rapid technique for extraction of DNA binding proteins from limited numbers of mammalian cells as described in Andrews NC and DV Faller, 1991, Nucleic Acids Res. 19:2499, incorporated herein in its entirety. Briefly, endothelial cells (1.5 x 10⁶) were washed with cold PBS and resuspended 5 in 1 OmM Hepes, 1.5mM MgCl₅, 1 OmM KCl, 0,5mM dithiothreitol (DTT), and

200μl/sample of a mixture of protease/phosphatase inhibitors, and incubated for 10 min. on ice. Nuclei were pelleted and resuspended in 2OmM Hepes, 1.5mM MgCl_s, 42OmM NaCl, 0.2mM EDTA, 0.5mM DTT, 25% glycerol, and 50μl/sample of a mixture of protease/phosphatase inhibitors, and incubated 20 min. on ice. Extracts were cleared of 0 debris and subjected to Western blot analysis.

Nuclear localization of ERa can be seen in both sP-sel and estradiol stimulated cells, which can be reversed by either anti-P-sel or ICI, respectively (Figure 4a), thereby demonstrating that E2 and P-sel are potentially engaged in a form of synergy whereby the angiogenic effects of sP-sel or estradiol are mediated via the estrogen receptor, as both estradiol and sP-sel induce ER nuclear translocation.

EXAMPLE 6-Chromatin immunoprecipitation assay HUVECs were grown to confluency in 100mm tissue culture dishes and treated for one hour with P-sel, estradiol, anti-P-sel, or ICI. The chromatin immunoprecipitation assay (ChIP) was performed using the EZ-ChIP™ Kit (Upstate Biotechnology, Lake Placid, NY) with minor adjustments to the manufacturer's protocol as described in Kazi AA, et al., 2005, MoI. Endocrinol. 19:2006-19 and Shang Y et al., 2000, Cell 103:843-52, both references incorporated herein in their entireties. Formaldehyde was directly added to the culture media to a final concentration of 1% and the cells were incubated for 20 min. at 37°C. The cells were washed with PBS at 4°C and lysed for 10 min. in 1% SDS, 1OmM Tris-HCl, pH 8.0. Cells were subsequently sonicated with three- 10 sec. pulses in a Branson Sonifϊer 450 and the debris removed by centrifugation. Sonication was optimized to produce, on average, lkb DNA fragments. Aliquots were taken to control for DNA input, and the remainder diluted 1OX with 0.01% SDS, 1% Triton X-100, ImM EDTA, 1OmM Tris HCl, pH 8.0, 15OmM NaCl and a mixture of protease and phosphatase inhibitors. Following dilution, either anti-Era AER311 (Neomarkers, Fremont, CA) rabbit IgG (negative control, Santa Cruz, Santa Cruz, CA) or anti-Pol II (positive control) was added to the aliquots prior to overnight incubation at 4°C. DNA-protein complexes were isolated using salmon sperm DNA linked to protein A agarose beads and extracted with 1% SDS and 0.1 M NaHCO₃. Cross-linking was reversed at 65°C for five hours, and the proteins were removed with proteinase K and extracted with phenol/chloroform. The DNA was redissolved and PCR performed using bFGF (Genbank AFO 19634, incorporated herein in its entirety) promoter primers 5'-TTGCCAAGGAGACAGGATTTATT-S' (SEQ ID

NO:11) and 5'-AACCTTACGTGACCAAGCAACT-S' (SEQ ID NO:12), which yielded a 382bp amplification product. The resulting product was re-amplified using nested primers.

Estrogen receptor binding to the bFGF promoter was increased in the presence of estradiol and sP-sel and inhibited by both anti-P-sel and the estradiol antagonist ICI (Figure 4b). Enzyme-linked immunosorbent assay results also showed that induction of bFGF secretion caused by estradiol was dependent on P-sel, as bFGF secretion was severely diminished by anti-P-sel. These results help to confirm the interdependence between E2 and P-sel, and show that both estradiol and P-sel induce bFGF secretion by binding to the bFGF promoter.

EXAMPLE 7-Tumorigenicity assay using P-sel specific siRNA To assess the effect of P-sel on estradiol mediated tumor growth and angio genesis, experiments were performed to examine the role of P-sel in the progression of human breast cancer in a mouse model.

The effect of P-selectin on estradiol-mediated tumor growth and tumor angiogenesis was examined in vivo in SCID mice (4-6 week old males) using two human breast cancer cell lines; the estrogen receptor positive MCF-7 and estrogen negative MDA-MB-231. Some mice were subcutaneously implanted with 60 day time release estradiol pellets (Innovation Research, Sarasota, FL) which released 0.72 mg/day estradiol. On day three following implantation, 2 x 10⁶ of either MCF-7 or MDA-MB-231 were mixed with 1 x 10⁶ HMVECs in 200μl Matrigel™, and the cell/Matrigel™ suspensions were injected subcutaneously on the left or right ventral sides, respectively, of the same mouse. Starting on day nine, the mice were given daily intraperitoneal injections of 4μg siRNA against P-sel (control mice were injected with a non-specific scrambled siRNA). P-sel specific siRNA were identified and ordered using the BLOCK-iT™ RNAi Designer software (Invitrogen, Carlsbad, CA) with the P-sel sequence found in Genbank Accession No. NM_011347. The P-sel specific siRNA sequences used were 1 ) GCUCUUGGUGGGAGC AAGUGUG AUA (SEQ ID NO:1) with the non-specific scrambled siRNA control sequence for SEQ ID NO:1 being GCUUGGUAGGGAACGUGUGGUCAUA (SEQ ID NO: 13) and 2) GGACUUUGAGCUACUGGGAUCUGAA (SEQ ID NO:7) with the non-specific scrambled siRNA control sequence for SEQ ID NO: 7 being GGAAGUUAUCGGGUCCUAGUUCGAA (SEQ ID NO: 14). Mouse tumors were measured twice weekly on days 6 to 32. Tumor volumes (V) were calculated as

(mm). At the end of the study, the mice were sacrificed and tumor samples were collected, fixed, paraffin embedded, and sectioned for further analysis. Some sections were stained with hematoxylin and eosin (H&E), while some of the tumor tissue sections were deparaffinized, and antigen retrieval was performed in a decloaking chamber (Biocare Medical, Walnut Creek, CA) for 20 tnin. at 120⁰C. The tissue sections were subsequently treated with peroxide block solution for 5 min. followed by 30 min. of incubation with anti-von Willebrand factor (Dako, Denmark) at room temperature. Slides were further incubated for 30 min. with horseradish peroxidase labeled polymer using the Dako EnVision™+System and developed with 3-amino-9-ethylcarbazole (AEC) chromagen. Microvessel numbers were counted in five random, high power (200X) microscopic fields per tissue section and expressed as an angiogenic score of the sum of blood vessels counted/five high power fields.

The addition of P-selectin specific siRNAs to tumors resulted in a drastic reduction in both vascularity and size of the estrogen receptor positive MCF-7 tumors, but not that of estrogen receptor negative MDA-MB-231 tumors (Figure 5a). Immunostaining of the tumor sections for either von Willebrand's factor or H&E also showed reduced angiogenesis in the siKNA treated, estrogen receptor positive MCF tumor sections, but not the siRNA treated, estrogen receptor negative MDA tumor sections. Figure 5b further demonstrates the decrease in angiogenesis in estrogen receptor positive tissue sections upon application of P- selectin specific siRNA SEQ ID NO:1. Therefore, tumor growth and angiogenesis is inhibited by P-selectin specific siRNAs in treatment of estrogen receptor positive human breast cancer tumors.

AU publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Claims

CLAIMS:We claim:

1. A method for screening for compounds that inhibit angiogenesis or tumor growth comprising: a) providing a sample, b) providing one or more compounds, c) contacting said sample with said one or more compounds, d) detecting inhibition of P-selectin in said sample in the presence of said one or more compounds relative to the absence of said one or more compounds, and e) correlating the inhibition of P-selectin in said sample with a decrease in angiogenesis or tumor growth.

2. The method of claim 1, wherein said one or more compounds is a siRNA.

3. The method of claim 1, wherein said one or more compounds is an antibody.

4. A method for treating a subject with a disease demonstrating female preponderance comprising: a) providing a subject suspected of having a disease demonstrating female preponderance, b) providing one or more compounds that affect P-selectin activity or expression, and c) administering said one or more compounds to said subject under conditions such that angiogenesis associated with said disease is reduced.

5. The method of claim 4, wherein said subject is a human.

6. The method of claim 4, wherein said disease is a cancer.

7. The method of claim 6, wherein said cancer is from a list consisting of breast and uterine cancer.

8. The method of claim 7, wherein said breast cancer is estrogen responsive.

9. The method of claim 7, wherein said uterine cancer is estrogen responsive.

10. The method of claim 4, wherein said one or more compounds comprises a siRNA.

11. The method of claim 4, where said one or more compounds comprises an antibody.

12. The method of claim 4, further comprising the step of co-administering a chemotherapeutic agent.

13. A method of inhibiting angiogenesis and tumor growth in a subject with estrogen receptor positive cancer comprising: a) providing a subject with an estrogen receptor positive cancer, b) providing a compound that inhibits P-selectin, and c) contacting said compound with said subject wherein said compound inhibits said P-selectin thereby decreasing angiogenesis and tumor growth in said subject.

14. The method of claim 13, wherein said subject is from a list consisting of mouse, rat, pig, dog, non-human primate, human.

15. The method of claim 13, wherein said estrogen receptor positive cancer is from a list consisting of breast and uterine cancer.

16. The method of claim 13, wherein said compound is a siRNA.

17. The method of claim 13, wherein said compound is an antibody.

18. A composition comprising a siRNA that inhibits expression of P-selectin comprising SEQ IN NO: 1 or SEQ ID NO:7.

19. The composition of claim 18, wherein said siRNA comprises SEQ ID NO:1.

20. The composition of claim 18, wherein said siRNA comprises SEQ ID NO:7.

21. A composition comprising an antagonist of P-selectin and a chemotherapeutic agent that targets estrogen receptor positive cancer cells.