WO2008039207A1 - Biochemical applications of a microfluidic serial dilution circuit - Google Patents

Abstract

Methods of use of a microfluidic serial dilution circuit fabricated in a three-layer glass-PDMS-glass device are described. The methods may be automated and an arbitrary number of serial dilutions can be performed. These methods provide high speed, accuracy, sensitivity, and control, while limiting volume and reagent expense in applications including continuous in vitro evolution, biodetection, and standard preparation.

Description

BIOCHEMICAL APPLICATIONS OF A MICROFLUIDIC SERIAL

DILUTION CIRCUIT

Related Application This application claims priority under 35 U. S. C. 119(e) to U.S. Provisional

Application Serial No. 60/827,208 filed September 27, 2006, which application is incorporated herein by reference.

Statement of Government Rights This invention was made at least in part with U.S. Federal Government support under Research Grants 574103 - (08)FGM073438A and 1F32GM073438- 01, awarded by the National Institutes of Health, and National Science Foundation Grant MCB-614614. The United States Government has certain rights in the invention.

Background

The processes of Darwinian evolution that occur in nature can be recapitulated in the laboratory, leading to the development of nucleic acid or protein molecules with properties that conform to selection constraints imposed by the experimenter. In vitro evolution involves establishing a heterogeneous population of macromolecules, often through the introduction of genetic variation by mutation and/or recombination, and carrying out repeated rounds of selective amplification based on the physical or catalytic properties of those molecules. One aspect of directed evolution is the application of a selection scheme that distinguishes molecules that have the desired properties from those that do not.

Conventional methods for continuous in vitro evolution involve repeated manual serial transfer steps that are carried out in an ad hoc manner with regard to the time interval between transfers, accompanied by electrophoretic analysis of the products of each time interval. Days or weeks of effort and substantial amounts of expensive reagents must be devoted to these experiments, limiting the ability to obtain molecules with novel functional properties. Biosensors are analytical tools containing biologically active materials, such as enzymes or antibodies, used in conjunction with a device that will translate a biochemical interaction of those enzymes or antibodies with a target into a quantifiable signal such as light or electric pulse. Biosensors are useful in the detection of small molecules and protein targets for diagnostic purposes. Biological systems utilized by biosensors include whole cell metabolism, ligand binding and antibody- antigen reactions. Biosensor methods including the use of Western blotting and enzyme linked immunosorbent assay (ELISA) often suffer from low sensitivity and specificity, long assay times, and the need for substantial amounts of expensive reagents .

What is needed are methods that are useful in multiple applications, including continuous in vitro evolution and instantaneous, quantitative biodetection. The methods should be automated and highly sensitive, they should demonstrate short assay time and use limited amounts of reagents, and offer exponential amplification, so that the desired evolved molecules or targets for bioassays can be detected even if they are very rare in the population.

Summary of the Invention

The invention described herein provides automated methods for conducting serial dilution, performed on a nano- to micro- scale with consistent and reproducible metering of reagents in a serial fashion. Serial dilution is applicable to numerous biological, biochemical, and chemical methods.

The methods described herein are contemplated to be applicable to any application that employs serial dilution. Additionally, any application that further employs sorting, separating and/or amplifying reagents after dilution, is contemplated. For example, the methods are useful for preparing sets of standards for laboratory use, including but not limited to preparing heavy metal standards for in situ water/environmental monitoring. In addition, the methods are useful for conducting biochemical reactions, such as chemical synthesis or chemical analysis. The methods contemplate preparing serial dilutions of a drug candidate or protein target for dose-response studies. The methods can also be used for amplification of nucleic acids, as in PCR applications. Serially diluting a target DNA or RNA for the purposes of performing parallel real-time PCR assays to calibrate for target concentration is contemplated, for specific applications including, but not limited to, assaying bacterial contamination, assaying toxic biologicals, or determining viral loads. The methods can also be used for amplification of catalytic RNA, as in directed evolution, and in screening libraries of biological molecules. The methods can also be used for biodetection, as in determining the presence of a molecule in a sample, or used in cell culture applications, as in isolating single cells prior to culture or prior to flow cytometry. The invention described herein provides automated methods for conducting serial dilution, wherein the dilution is performed on a micro scale with consistent and reproducible metering and mixing of reagents in a serial fashion. The methods can be used in conducting biochemical reactions, such as chemical synthesis or chemical analysis. For example, the methods can be used for amplification of catalytic RNA or biodetection, such as determining the presence of a molecule in a sample.

The invention also provides an automated method of conducting a reaction in which substrate molecules and catalytic RNA molecules are reacted in nanoliter or microliter quantities. The reaction is serially repeated under conditions that assure consistent fluidic metering. In some embodiments, a population of catalytic RNA molecules is primed into a microfluidic serial dilution circuit and the substrate molecules and additional reaction components are subsequently flushed into the circuit. Conversely, in other embodiments, the substrate molecules and additional reaction components are primed into a microfluidic serial dilution circuit and the catalytic RNA molecules are subsequently flushed into the circuit to mix together, forming an admixture.

In some embodiments, the admixture is maintained for a sufficient period of time and under predetermined reaction conditions to allow the catalytic RNA molecule to ligate to the substrate, thereby producing ligation products, which are then reverse-transcribed into cDNAs that contain a functional promoter. In a preferred embodiment, the cDNAs are transcribed to generate progeny ribozymes that may be isolated for further study. In a preferred embodiment, the reactions are conducted under mutagenic conditions.

The invention described herein also provides methods of engineering catalytic RNA molecules in vitro that have ligase activity, by first obtaining a population of catalytic RNA molecules, then introducing genetic variation into the population to produce a population of mutants, then selecting individuals from the population that meet predetermined selection criteria including a binding affinity for substrate molecules. The selected individuals from the variant population are then amplified and separated from the remainder of the variant population. These methods are automated, performed on a micro scale and are repeated in a serial fashion, with consistent and reproducible metering of reagents and products. The invention described herein also provides an automated method for preparing a set of standard samples using serial dilution, performed with consistent and reproducible metering and mixing of reagents. The invention in all aspects may be performed using a microfluidic serial dilution circuit adapted for periodic, sequential, serial and/or episodic delivery of reagents, diluents and products.

Brief Description of the Figures Figure 1. Schematic of the microfluidic serial dilution circuit. Fluidic channels are shown in black and pneumatic features are shown in gray. The input and output fluidic access reservoirs (1.1 -mm diameter) are labeled R; and R₀, respectively. The five membrane valve deflection chambers are labeled A, B, C, I, and O on their respective pneumatic lines. Valves A, B, and C are two-way valves and are continuous only when open. Input and output valves I and O are bus valves, connecting R, and R₀ to the mixing loop. When open, I and O allow flow from R; and R₀ to and from the mixing loop. Fluidic continuity is preserved within the mixing loop even when I and O are closed. The boxed diagram depicts a cross section of the device at a two-way valve junction, showing the fluidic and manifold wafers, the PDMS membrane, the fluidic channel and discontinuity, and the corresponding valve displacement chamber. Figure 2. Serial dilution circuit pumping program schematics and epifluorescence stills. Still frames are 50-ms exposures. The circuit maybe initially primed with fluorescein dye. Fluid flow paths are indicated with gray arrows overlaid on the circuit schematic. The flush program may be used for diluent flushing and carryover isolation, and may be accomplished by serially actuating I, A, B, and O while keeping C closed. Buffer may be pumped from Ri to R₀, clearing the right side of the mixing loop while isolating the carryover aliquot on the left side (frames 1-4). An example of an open valve can be seen in frame 2, in which B is open and the entire valve may be filled with the concentrated dye solution. The mix program may be used to mix the diluent and the isolated carryover by serially actuating A, B, and C while I and O are kept closed (frames 5-8). The output reservoir, Ro, was manually evacuated in the time between frame 7 and frame 8 for the purpose of visualizing the fully mixed sample.

Figure 3. Quantitative evaluation of serial dilution. (A) Three consecutive serial dilutions of fluorescein dye solution (300 nM in TAE buffer) into TAE buffer were monitored using confocal fluorescence microscopy. The detector position is indicated in the inset circuit schematic. The second and third dilutions are shown in the five-fold magnified inset. Serial dilutions were performed by executing flush{\ 00,60) followed by wά(100,120). (B) A standard curve for 10 μM fluorescein was constructed from the average fluorescence intensity of the sample concentrate, and the intensity obtained after each of four consecutive six-fold dilutions. Each data point represents the average of eight independent experiments. The log plot exhibits excellent linearity over the three detectable orders of magnitude (R² - 0.999). Figure 4. Dependence of carryover fraction on device geometry. The carryover fraction was related to the arc subtended by valves I and O. The inset indicates the angle measurement, θ. CF = -0.02 + 0.005 θ; R² = 0.998.

Figure 5. Mixing reproducibility. A solution of fluorescein dye was diluted using a circuit with a carryover fraction of 0.12. Two separate devices were operated with identical pumping parameters:_c/7w5/z(100,90), mzx(100,120). The five profiles are offset by 200 CPS for clarity. The start of the flush and mix programs is indicated by arrows. The inset contains an overlay of the five replicates and a sample fit of an exponentially damped sinusoid. Diluent flushing and mixing are highly reproducible, with mixing transients agreeing in fit within 1%.

Figure 6. Mixing transients at variable valve actuation times. (A) Mixing transients were generated with variable actuation times and aligned to time t = 0. (B) Standard deviations as a function of time are plotted as solid lines, sampling valve actuation times of 300, 200, 100, and 50 ms. The standard deviation window width maybe the period of the oscillation for each transient. A dashed line at σ_w;_n = 300 CPS indicates the threshold for complete mixing. Mixing times (•) measured at different valve actuation times are plotted discretely with respect to the left axis. Mixing times determined by this method exhibited about 5% standard error.

Figure 7. Continuous evolution of RNA ligase ribozymes. Ribozymes catalyze attachment of a chimeric DNA-RNA oligonucleotide to their own 5' end. The substrate has the sequence of an RNA polymerase promoter and contains one or more ribonucleotides at its 3 ' end. Open and solid lines represent DNA and RNA, respectively.

Figure 8. RNA serial transfer plot. The circuit loop was first seeded with DNA encoding the parent RNA ligase ribozyme. After seeding, the lines were flushed with diluent solution containing only substrate, enzymes, and buffer components. Fluorescence signal was correlated with aggregate RNA (and DNA) concentration, and each rise in fluorescence represents one log of growth. When the pre-determined growth threshold signal was exceeded, fresh diluent was flushed in, reducing the fluorescence to background, followed by cyclically mixing the carryover into the diluent to initiate the next cycle of growth. Sixty serial transfers (enumerated above each transfer), representing 60 logs of growth, were achieved in 6 hours with complete automation. Products that were synthesized on-chip yielded product was amplified externally and subjected to gel electrophoresis.

Figure 9. Auxiliary Input for serial dilution circuit. Input line X draws from reservoir Rx and meets the standard input line at bus valve I. The control valve X modulates the amount of fluid that is delivered. Figure 10. Competitive inhibitors to enhance substrate specificity. Standard substrate (S) and two alternative substrates (Il and 12) that act as competitive inhibitors in the context of continuous evolution. Il differs from S at positions -9 through -11 ; 12 differs from S at position -5 (relative to the 3 ' end of the 17-nucleotide promoter sequence). Diagram of the ligase ribozyme is shown at the right, indicating the region of template-substrate interaction (dashed box).

Figure 11. Modified bases within the mutagenic dNTP analogs that can be employed in continuous evolution, a, 5-Br-uracil; b, inosine; c, 8-oxo-guanine; d, dihydro-[4,5-C][l-2]oxazin-7-one. Figure 12. Sequence and secondary structure of the B16-19 variant of the class I ligase ribozyme, indicating two sites for insertion of an aptamer domain. Left, insertions can replace the distal portion of either the P5 or P7 stem (dashed boxes). Right, either the theophylline (theo) or FMN aptamer can be joined to the ribozyme by stems of varying length (dashed lines).

Detailed Description of the Invention Definitions

As used herein, the term "automated" describes a device or method that is operated or carried out by computers or other non-human technological controls. An entire device or method may be automated, or portions of the device or method may be automated.

As used herein, the term "auxiliary input" refers to an additional or supplemental input that is connected to the microfiuidic circuit to deliver a component or components of a desired reaction, such as substrate, dNTPs, inhibitors, mutagens, and the like.

As used herein, the term "base pair"(bρ) is generally used to describe a partnership of adenine (A) with thymine (T) or uracil (U), or of cytosine (C) with guanine (G), although it should be appreciated that less-common analogs of the bases A, T, C, and G may occasionally participate in base pairings. Nucleotides that normally pair up when DNA or RNA adopts a double stranded configuration may also be referred to herein as "complementary bases". As used herein, the term "biosensor" refers to an analytical tool containing biologically active materials, such as enzymes or antibodies, used in conjunction with a device that will translate a biochemical interaction of those enzymes or antibodies with a target into a quantifiable signal such as light or electric pulse. Biosensors are useful in the detection of small molecules, protein targets and whole cells for diagnostic purposes. Biological systems utilized by biosensors include whole cell metabolism, ligand binding and antibody-antigen reactions. The term "biodetection" refers to the biosensor activity of detecting small molecules, protein targets, or entire cells. As used herein, "chimeric" means a structure comprising nucleic acid from at least two different species, such as ribonucleic acid and deoxyribonucleic acid. "Chimeric" also means a structure comprising DNA or RNA which is linked or associated in a manner which does not occur in the "native" or wild type of the species. "Complementary nucleotide sequence" or a "complementary sequence" generally refers to a sequence of nucleotides in a single-stranded molecule of DNA or RNA that is sufficiently complementary to that on another single strand to specifically hybridize to it with consequent hydrogen bonding.

As used herein, the term "isolated" refers to in vitro preparation and isolation of a synthetic product, e.g., nucleic acid, from association with other components that is associated with, e.g., components of a reaction mixture. For example, an "isolated nucleic acid molecule" includes a polynucleotide of genomic, cDNA, RNA, or synthetic origin or some combination thereof. An isolated nucleic acid molecule means a polymeric form of nucleotides of at least 2 bases in length, at least 5 bases in length, or at least 10 bases in length, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA.

As used herein, "kcat" is a rate constant corresponding to the slowest step or steps in the overall catalytic pathway. It represents the maximum number of molecules of substrate which can be converted into product per enzyme molecule per unit time. Kcat is often known as the turnover number. As used herein, "Km" refers to the Michaelis-Menten constant for an enzyme, defined as the concentration of the specific substrate at which a given enzyme yields one-half its maximum velocity in an enzyme catalyzed reaction. The values give a useful indication of the affinity of the enzyme for the involved substrate.

As used herein, a "ligase" is an RNA sequence that is capable of catalyzing the co valent joining of a substrate to the same or another RNA sequence.

"Nucleotide" generally refers to a monomelic unit of DNA or RNA consisting of a sugar moiety (pentose), a phosphate group, and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via the glycosidic carbon (1 'carbon of the pentose) and that combination of base and sugar is a "nucleoside". When the nucleoside contains a phosphate group bonded to the 3' or 5' position of the pentose, it is referred to as a nucleotide. A sequence of operatively linked nucleotides is typically referred to herein as a "nucleotide sequence", and grammatical equivalents, and is represented herein by a formula whose left to right orientation is in the conventional direction of 5'-terminus to 3'-terminus, unless otherwise specified.

The term "naturally occurring nucleotides" referred to herein includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" referred to herein includes nucleotides with modified or substituted sugar groups and the like. The term "oligonucleotide linkages" referred to herein includes oligonucleotides linkages such as phosphorothioate, phosphorodithioate, phophoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoroamidate, and the like. An oligonucleotide can include a label for detection, if desired.

"Oligonucleotide" generally refers to a polymer of single- or double-stranded nucleotides. As used herein, "oligonucleotide" and its grammatical equivalents will include the full range of nucleic acids. An oligonucleotide will typically refer to a nucleic acid molecule comprised of a linear strand of naturally occurring and modified nucleotides linked together by naturally occurring and non-naturally occurring oligonucleotide linkages. An oligonucleotide may be chimeric. An oligonucleotide may comprise both RNA and DNA components. The exact size will depend on many factors, which in turn depends on the ultimate conditions of use, as is well known in the art. Oligonucleotides of the invention can be either sense or antisense oligonucleotides. "Polymerase chain reaction" or "PCR" refers to a procedure or technique in which amounts of a preselected fragment of nucleic acid, RNA and/or DNA, are amplified as described in U.S. Patent No. 4,683,195. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers comprising at least 7-8 nucleotides. These primers can be identical or similar in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, and the like. See generally Mullis et al. (1987); Erlich, (1989). Thus, PCR-based cloning approaches rely upon conserved sequences deduced from alignments of related gene or polypeptide sequences.

As used herein, the term "prime" or "priming" means to fill the microfluidic circuit with fluid in order to prepare the circuit for subsequent steps. In some embodiments, the priming step comprises the addition of a population of ribozymes, or double-stranded DNA encoding ribozymes, or cDNA, or other "seed," to the circuit. Subsequently, diluent/reaction mixture is added to the circuit and mixing occurs. Alternatively, the circuit may be primed with the reaction mixture prior to the addition of the DNA or RNA seed.

As used herein, the term "progeny ribozymes" describes ribozymes that are generated after one or more rounds of in vitro evolution seeded with a "parent" ribozyme. Progeny ribozymes identified by the present invention may include one or more mutations not typically found in the parent ribozymes. In various alternative embodiments, an progeny ribozyme molecule of the present invention may have any number or combination of various mutations, which maybe caused by mutagenic conditions employed in the methods. As used herein, the term "ribozyme" is used to describe an RNA-containing nucleic acid that is capable of functioning as an enzyme. In the present disclosure, the term "ribozyme" includes endoribonucleases and endodeoxyribonucleases of the present invention. The term "ribozyme" encompasses an RNA sequence that has ligase activity; that is, being capable of catalyzing the covalent joining of a substrate to the ribozyme. The term "ribozyme" also encompasses amide bond- and peptide bond-cleaving nucleic acid enzymes of the present invention. Other terms used interchangeably with ribozyme herein include "enzymatic RNA" and "catalytic RNA", which should be understood to include ribozymes and enzymatically active portions or derivatives thereof. A "catalytic RNA population" can be a sample of homogenous catalytic RNAs, or can be a heterogeneous sample of catalytic RNAs. Catalytic or enzymatic RNA molecules of the present invention may be described as having ligase, amide-cleaving, amide bond-cleaving, amidase, peptidase, or protease activity. These terms may be used interchangeably herein.

Ribozymes may be chosen from group I, II, III, or IV introns. Other enzymatic RNA molecules of interest herein are those formed in ribozyme motifs known in the art as "hammerhead" and "hairpin".

As used herein, a "substrate" is defined as a molecule that may be acted upon by a ribozyme. In some embodiments described herein, the substrate is an oligonucleotide. In some embodiments described herein, the substrate is a chimeric oligonucleotide. The substrate may comprise RNA, modified RNA, an RNA-DNA polymer, a modified RNA-DNA polymer, a modified DNA-RNA polymer or a modified RNA-modified DNA polymer. RNA contains nucleotides comprising a ribose sugar and adenine, guanine, uracil or cytosine as the base at the 1 ' position. Modified RNA contains nucleotides comprising a ribose sugar and adenine, thymine, guanine or cytosine and optionally uracil as the base. An RNA-DNA polymer contains nucleotides containing a ribose sugar and nucleotides containing deoxyribose sugar and adenine, thymine and/or uracil, guanine or cytosine as the base attached to the 1 ' carbon of the sugar. A modified RNA-DNA polymer is comprised of modified RNA, DNA and optionally RNA (as distinguished from modified RNA). Modified DNA contains nucleotides containing a deoxyribose or arabinose sugar and nucleotides containing adenine, uracil, guanine, cytosine and possibly thymine as the base. A modified DNA-RNA polymer contains modified DNA, RNA and optionally DNA. A modified RNA-modified DNA polymer contains modified RNA-modified DNA, and optionally RNA and DNA.

"Substrate specificity," as used herein, refers to the specificity of an enzymatic nucleic acid molecule as described herein for a particular substrate, such as one comprising ribonucleotides only, deoxyribonucleotides only, or a composite of both. Substrate molecules may also contain nucleotide analogs. In various embodiments, an enzymatic nucleic acid molecule of the present invention may preferentially bind to a particular region of a hybrid or non-hybrid substrate.

Serial Dilution Serial dilution is among the most fundamental and widely practiced laboratory techniques, with applications ranging from generating sets of standards, to performing in vitro evolution, to culturing cells. Performing serial dilutions by manual pipetting is a mundane and time-consuming task that has limited the execution of highly longitudinal experiments in molecular evolution. Microfiuidic technology presents a practical solution to this problem by automating the fluid handling associated with serial dilution.

The core strengths of microfiuidic technology are integration, high throughput, and low- volume handling. Microfiuidic analogs outperform conventional instrumentation with regard to speed, throughput, and reagent consumption by an order of magnitude or more, and allow integration of sample preparation and analysis in a single device. Precise manipulation of fluids in these devices may be achieved by electrokinetic control, microfabricated membrane valves, or various other approaches to microfiuidic transport and control. The combination of highly ordered flow and precise manipulation allows one to carry out diverse synthetic and analytical methods with remarkable control.

As disclosed in the parent provisional patent application entitled "Microfluidic Serial Dilution Circuit," filed September 27, 2006, a microfiuidic serial dilution circuit that implements these advantageous mixing and scaling characteristics and incorporates sample metering elements has been designed, fabricated, and characterized (see examples below). The methods described herein can thus function on the nanoliter scale and do not geometrically constrain the number of possible serial dilutions. Precise metering of the sample carryover fraction and rapid, reproducible mixing of the diluent with the carryover are achieved in the same structure. The methods employing the circuit may be computer controlled, and the preparation of successive serial dilutions may be fully automated. Fluidic operations, such as diluent flushing, mixing, and priming can be accurately and precisely performed without manual intervention, and performed simultaneously in many parallel circuits. Because the methods employ microfluidic pumping, serially diluted sample aliquots can easily be routed from the dilution circuit to other microfluidic components, such as a separation channel or microreactor.

General Application of the Invention

The invention may be practiced in all aspects through us of a nano to micro fluidic serial dilution circuit adapted with microvalves, microchannels and microreservoirs to enable methods ranging from serial dilution to chemical reaction and analysis. The method is applicable to a wide range of biochemical, chemical and biotechnological processes that employ selection, amplification, and /or identification of certain species within a group. Such methods include amplification of nucleic acids, PCR applications, RNA applications, directed RNA evolution, screening of libraries of biological molecules or small molecules, combinatorial chemistry applications upon libraries of small molecules, cell culture applications such as flow cytometry and other similar applications.

The invention will be exemplified in detail with respect to RNA evolution.

Those of skill will readily understand the parameters, conditions, reagents and reactions applicable in the foregoing fields based on the RNA embodiments discussed below.

Microfluidic-Based Continuous hi Vitro Evolution

Serial dilution is employed in directed evolution experiments in which a population of RNA molecules is made to undergo repeated rounds of selective amplification. In order to evolve molecules with desired properties, the population of RNAs is propagated through many logs of selective growth. This may be accomplished by serially diluting an aliquot of the reaction mixture into fresh reaction medium at regular intervals.

The methods described herein combine biochemical systems for the continuous in vitro evolution of RNA enzymes using micro fluidic technology. They allow Darwinian evolution to be carried out much more rapidly and precisely, and using smaller volumes of reagents, than pipettes and PAGE analysis, with complete control over variables such as population size, mutation frequency, and selection pressure. Continuous in vitro evolution of an RNA ligase is accomplished by challenging a population of RNA molecules in the circuit to perform a desired reaction. In an embodiment like that described below in Example 4, the RNA molecules ligate to their own 5' end an oligonucleotide substrate that contains the sequence of an RNA polymerase promoter element. Molecules that successfully ligate are reverse transcribed to cDNAs that contain a functional promoter, which in turn are transcribed to generate "progeny" ribozymes.

As Darwinian evolution proceeds, mutations are acquired, the catalytic efficiency of ribozymes in the population improves, and the time for reaching a predetermined nucleic acid threshold concentration becomes shorter. The catalytic efficiency (kcat/Km) of the ribozymes increases, and the doubling time for selective amplification decreases. Small aliquots of the growing population are serially diluted in the circuit into a new reaction mixture that contains a fresh supply of the substrate and polymerase enzymes. Reproduction is selective for RNA molecules with ligase activity, and mutations accumulate through error-prone enzymatic replication (Wright and Joyce, 1997).

It is contemplated that any RNA molecule capable of ligating a substrate to itself can be employed in the methods described herein. In a preferred embodiment, attachment of a promoter-containing substrate to a ribozyme that has a reactive group at its 5' end is employed. The reaction succeeds so long as the reactive group can be incorporated during transcription and the product of the RNA-catalyzed reaction can be reverse transcribed to yield complementary DNA that contains the second strand of the promoter. In certain embodiments, the enzymatic RNA molecule is derived from a group I, II, III, or IV intron. In another variation, an enzymatic RNA molecule contemplated herein comprises the portions of a group I, II, III or IV intron having catalytic activity. A preferred embodiment of continuous in vitro evolution can be performed with evolved variants of the group I ligase ribozyme, originally developed by Bartel and Szostak (Bartel and Szostak, 1993; Ekland, et el., 1995). This ribozyme catalyzes the template-directed joining of an oligonucleotide 3 '-hydroxyl and an oligonucleotide 5 '-triphosphate, forming a 3 ',5 '-phosphodiester and releasing inorganic pyrophosphate. The ribozyme Ii gates to its own 5 ' end a chimeric DNA- RNA substrate that contains a sequence of the T7 RNA polymerase promoter (see Figure 7). At the 3' end of the ribozyme is a reverse transcriptase (RT) primer binding site. Reverse transcription of RNAs that have become joined to the substrate yields cDNAs that contain a functional promoter, and only those cDNAs are transcribed to produce progeny RNAs. The ligation junction at the RNA level corresponds to the transcription start site at the DNA level, and the inorganic pyrophosphate released at the time of ligation is restored as the b- and g-phosphates of the NTP that becomes the first residue of the ribozyme. Amplification results from the ability of T7 RNA polymerase to generate multiple copies of RNA per copy of cDNA template.

Example 4 below describes, and Figure 8 shows, the capacity of the microfluidic serial dilution circuit to perform the physical steps used in successful continuous in vitro evolution. In the example, the known ligase ribozyme successfully grew through sixty serial transfers, representing 60 logs of growth (see Figure 8).

The nucleic acid material that will be subjected to evolution that is used to start or "seed" the reaction can include, but is not limited to, an isolated population of ribozymes; the ligated product of a ribozyme and its substrate; a dsDNA copy of the ribozyme/substrate product (i.e. a PCR product); a single-stranded cDNA (i.e. the complement of the ribozyme/substrate product); or the products of a previous burst of continuous evolution. The nucleic acid material that will be subjected to evolution may be introduced into the microfluidic device described herein at starting concentrations ranging from about 0.1 nM - 10 μM; preferably from about 1 nM to 1 μM; and even more preferably from about 10 nM - 100 nM. The nucleotide substrate that is acted upon by a ribozyme can be introduced into the microfluidic device described herein at starting concentrations ranging from about 0.1 nM — 1 mM; preferably about 1 nM - 100 μM; and even more preferably about 1O nM - 10 μM.

Various embodiments of the disclosed invention contemplate that an enzymatic RNA molecule identified by the present invention includes one or more mutations not typically found in wild-type enzymatic RNA molecules or ribozymes.

In various alternative embodiments, an enzymatic RNA molecule of the present invention may have any number or combination of the various disclosed mutations. For example, a catalytic RNA molecule of the present invention may have 1-5 mutations, 1-10 mutations, 1-15 mutations, 1-20 mutations, 1-25 mutations, 1-30 mutations, or even more. It should be understood that mutations need not occur in 5 -mutation increments~the invention contemplates that any number of mutations may be incorporated into catalytic RNA molecules of the present invention, as long as those mutations do not interfere with the molecules' ability to ligate substrates at specific sites, as disclosed and claimed herein.

As a person of skill in the art will appreciate, nearly every parameter of the continuous evolution methods described herein can be modified by the researcher in order to direct the evolution and generate ribozymes having specific activities. Indeed, vast ribozyme diversity and specificity can be obtained by any number of alterations or selective pressures applied to the system. Depending on the purpose and desired outcome of the experiment, the concentrations of ribozyme, reaction mixture ingredients including substrate, enzymes, and buffer components, can be varied within effective ranges that are known by those of skill in the art. In one embodiment, the researcher can alter the MgCl₂ concentration (Schmitt and Lehman, 1999) or pH (Kϋhne and Joyce, 2003). The methods described herein can be conducted at higher or lower temperature. The test RNA seed may be used to initially prime the system, or may be added in the diluent flush. Likewise, the reaction buffer containing the substrate may be used to initially prime the system or alternatively may be added in the diluent flush.

The dilution carried out in the described methods can be varied or kept constant, and is essentially unlimited. The fluid in the circuit can be diluted by the diluent reaction mixture about 1 :1, about 1:10, about 1:100, about 1 :1000, about 1 : 10,000, and so on. In a preferred embodiment, continuous in vitro evolution is conducted using a series of dilutions of about 1 : 10 to take advantage of the high rate of reaction that occurs under those conditions.

Depending on the application, suitable circuit mixing times range from about 0.1 s - 10 min; preferably about 1 s - 5 min; and more preferably about 10 s - 1 min. In practice, valve actuation times can be in the range of about 0.1 ms - 1 s; preferably about 1 ms - 300 ms; and more preferably about 10 ms - 100 ms.

The circuit loop described herein can be scaled up or down in size, having a diameter ranging from about 0.01 cm — 100 cm; preferably about 0.1 cm — 10 cm; and more preferably about 0.5 cm — 5 cm. Fluid channels, manifold channels, fluid reservoirs and membrane valve dimensions can be adjusted accordingly, in order to obtain effective results within these loop diameter ranges.

In practice, the circuit loop described herein could have a volume of about 1 nL - 1 mL; preferably about 10 nL - 100 μL; more preferably 100 nL - 10 μL; and still more preferably 200 nL - 1 μL.

Biosensor Applications

The methods described herein provide practical applications of microfluidic- based selective amplification, pertaining to the quantitative detection of small molecule and protein targets, such as for use in diagnostics. Amplification of target proteins or small molecules by methods including PCR, ELISA (Engvall and

Permian, 1971), and immuno-PCR (Sano et al., 1992) suffer from the fact that once exponential amplification has been initiated, it is no longer dependent on the presence of the analyte. This is beneficial for sensitivity, but not for specificity. The methods described herein allow the experimenter not only to sense the ligand dynamically during the course of amplification, but also to control and automate the system and reduce the levels of reagents consumed.

RNA molecules called "aptamers" specifically recognize a target ligand (Fitzwater and Polisky, 1996; Ciesiolka et al., 1996). These aptamers are obtained by constructing a library of random-sequence RNAs and carrying out repeated rounds of selective amplification to discover particular RNAs that bind tightly and specifically to the target ligand. Aptamers typically contain 20-50 nucleotides and bind their cognate ligand with a KA of 10^~5— 10 ¹⁰ M. Aptamers have been developed to bind a diverse array of targets ranging from small molecules to proteins, and even whole cells (Morris et al., 1998).

An RNA aptamer can be linked to an RNA enzyme to achieve ligand- dependent control of the enzyme's activity (Tang and Breaker, 1997). Such constructs are termed "aptazymes", and have been developed for applications in biosensing (Seetharaman et al., 2001 ; Hartig et al., 2002; Vaish et al, 2002). For example, the class I ligase ribozyme has been made to operate as an aptazyme that is dependent on a target viral nucleic acid for its activity (Vaish et al., 2003; Kossen et al., 2004). The ribozyme ligates two oligonucleotide substrates in the presence, but not the absence, of the target, and undergoes multiple turnover to provide linear signal amplification that depends on ongoing target recognition. Other ligase ribozymes have been made to operate as aptazymes that are dependent on either a small molecule or protein ligand, albeit without catalytic turnover (Robertson and Ellington, 2001 ; Robertson et al., 2004).

Using the methods described herein, ligase aptazymes can be optimized by being subjected to continuous evolution in a ligand-dependent manner. The concentration of the cognate ligand can be adjusted to control the evolutionary fitness of the continuously evolving ribozymes. These ribozymes can be isolated and analyzed and can subsequently be used to detect small molecule and protein targets that are relevant to analytical biochemistry, environmental monitoring, and other biosensor applications.

The methods described herein employ the microfluidic serial dilution circuit as the processor for evolving ligand-dependent ribozymes and also as the analytical device for diagnostic purposes. Microfluidic systems have been shown to be highly suitable for portable, high-throughput detection of various chemical and biological compounds. In the analytical mode, a sipping capillary can be used to draw up the sample, which can be combined with an amplification mixture that contains the ligand-specific ribozyme. The rate of rise of fluorescence intensity and time between successive dilutions can be used to quantitate the amount of analyte within the sample. The modular nature of microfluidic technology can allow future integration of any sample preprocessing steps, such as filtration, concentration, solid-phase extraction, and reagent mixing.

It is contemplated that the methods described herein may be further employed in biosensor applications including but not limited to: glucose monitoring in diabetes patients; measuring other constituents of blood such as S- adenosylhomocysteine; detecting health related targets, such as amyloid peptide; environmental applications such as the detection of pesticides and river water contaminants; remote sensing of airborne bacteria for example in counter- bioterrorist activities; detection of pathogens; determining levels of toxic substances before and after bioremediation; detection of organophospate, lactic acid, cholesterol, amino acids and nucleotides; detection of antibodies, phospholipases, hormones and growth factors.

Preparation of Standard Samples Despite the near universal need for the preparation of standard samples for use in calibration or quantification of experimental data, little work has been done to miniaturize and to expedite this process. Approaches have included variously configured splitter channels (Jacobson et al., 1999; Chang et al., 2003; Holden et al., 2003) and differential metering of multiple inputs into addressable microfabricated assay wells (Koehler et al., 2002). Each of these approaches to serial dilution requires N independent outputs (splitter branches, end reactors, etc.) for N consecutive dilutions, making them unsuitable for executing an arbitrary number of dilutions. The ideal circuit would automate sample and diluent metering and mixing, while scaling to an arbitrary number of serial dilutions. The microfluidic serial dilution circuit described herein satisfies this, and addresses mixing by reducing effective diffusion lengths and providing a compact geometry for manipulating nanoliter volumes.

The invention is further described by the following examples.

Example 1

Microdevice Fabrication and Design

A three-layer glass-PDMS-glass sandwich structure was fabricated as described (Grover, et al., 2003; Simpson et al., 1998). Features on the fluidic and manifold glass wafer layers were isotropically etched to a depth of 50 μm. The etched fluidic and manifold layers were visually aligned and reversibly bonded to one another with an intervening optically transparent PDMS membrane (250 μm thick, Rogers Corporation, Carol Stream, IL). Visual alignment and reversible bonding was performed in a laminar flow hood to minimize particulate contamination of the clean glass wafers and PDMS membrane. Nylon tubing barbs (1/16") were affixed to the fluidic chip surface at five pneumatic access holes to interface pneumatic control line tubing with the device. All reservoirs and vacuum access holes were drilled with 1.1-mm-diameter diamond-coated drill bits.

A schematic of the microfluidic serial dilution circuit is shown in Figure 1. Fluidic channels are shown in black and pneumatic features are shown in gray. Fluidic channels are 300 μm wide, and valve deflection chambers are 1 mm in diameter. Both layers are 50 μm deep. The input and output fluidic access reservoirs (1.1 -mm diameter) are labeled Rj and R₀, respectively. The five membrane valve deflection chambers are labeled A, B, C, I, and O on their respective pneumatic lines. Valves A, B, and C are two-way valves and are continuous only when open. Input and output valves I and O are bus valves, connecting Rj and R₀ to the mixing loop. When open, I and O allow flow from Ri and R₀ to and from the mixing loop. Fluidic continuity is preserved within the mixing loop even when I and O are closed. The boxed diagram depicts a cross section of the device at a two-way valve junction, showing the fluidic and manifold wafers, the PDMS membrane, the fluidic channel and discontinuity, and the corresponding valve displacement chamber.

Example 2

Pneumatic Control of Device

Computer-controlled pneumatic actuation of the membrane valves was accomplished using a TTL-driven vacuum solenoid valve array (HVOlO, Humphrey, Kalamazoo, MI). On TTL low, the solenoid directs atmospheric pressure output, and the associated membrane valve rests in the closed state. On TTL high, the solenoid switches to vacuum and causes the associated membrane valve to deflect open. The solenoid array may be driven by the digital output of a NI6715 data acquisition PCMCIA card and PC laptop with software written in house (Lab VIEW, National Instruments, Austin, TX).

A sequence of valve states defines a pumping program. A variable hold step interposed between states in the sequence may be the valve actuation time. Three pumping programs were written to manipulate fluid in the serial dilution circuit. The valve sequences of each pumping program are written showing only the open valves at each step, and the hold step is indicated by a comma after each state in the sequence. For example, the program (AB, B) starts with valves A and B open and valves C, I, and O closed. This state may be followed by a hold step, then valve A is closed leaving only B open. The mix pumping program is the valve state sequence (A, AB, B, BC, C, AC), The flush pumping program is the valve state sequence (A, AB, B, BO, IO, IA). The prime pumping program is the valve state sequence (I, ACI, AC, ABCO, BO, O). Looping a pumping program results in continuous pumping (Unger et al., 2000; Grover et al., 2003). Each pumping program can use two input parameters for operation: the valve actuation time (in milliseconds) and the length of time the program is iterated (in seconds).

Fluidic manipulation protocols are described using the format: program (valve actuation time,iteration time), with valve actuation times given in milliseconds and iteration times given in seconds. For example, mix(80,60) indicates that the mix program is run with 80 ms valve actuation time, iterated for 60 s.

Example 3

Flow Visualization and Device Characterization

Methods

Flow in the channels was visualized using a solution of fluorescein dye (10 μM in TAE) and a fiber-coupled epifluorescence microscope (488-nm laser excitation), which has been described (Paegel et al., 2002). Epifluorescence movies of the various pumping programs were acquired using a 12-bit CoolSnap FX CCD (10 fps, 50-ms exposure, 8 x 8 pixel binning, Roper Scientific, Tucson, AZ). The illumination area was about 1.2 cm diameter and the power density was 1 mW/mm².

Confocal fluorescence data were acquired using an inverted microscope fabricated in house. Laser excitation from a frequency-doubled diode laser was coupled into the optical detection train with a dichroic long-pass mirror (505DRLP, Omega Optical, Brattleboro, VT) and focused on the microfluidic channels with an infinite conjugate microscope objective (40X 0.6 NA, Newport, Irvine, CA). Fluorescence was collected with the same objective, spectrally filtered with a bandpass filter (535DF60, Omega Optical), and focused with a 100-mm focal length achromatic lens on a 100-μm pinhole before impinging a photon counting PMT (H7827, Hamamatsu Corp., Japan). For all confocal fluorescence measurements, the detector was positioned in the fluidic channel region bounded by valves A and B.

Fluid handling characteristics of the device were quantitated using confocal fluorescence microscopy. The input reservoir, Rj, was spotted with fluorescein solution and the circuit was run with/»rime(200,30) to prime with dye. A syringe loaded with TAE buffer (the diluent) was used to rinse away residual dye solution in R; and to load diluent. This standard procedure was used to prepare the circuit for each of the following device characterization studies.

The intrinsic carryover fraction (CF) for each serial dilution circuit was determined. The average fluorescence signal of the concentrated dye was measured, then the circuit was run withβush(l 00,60), and the average buffer background fluorescence signal was measured. Finally, the circuit was run with mzx(100,120) to mix the carryover into the diluent. After mixing, the average fluorescence signal of the diluted dye was measured. The ratio of the background-subtracted diluted dye signal to the dye concentrate signal is the CF. To demonstrate multiple serial dilutions of the same sample, a sample of 10 μM fluorescein was diluted in TAE using a mixing loop with CF of 0.2. To increase dynamic range, an OD 1 neutral density filter (Newport) was placed in line to measure the sample concentrate fluorescence intensity. Thereafter, the filter was removed and the fluorescence intensity of each consecutive dilution was measured as described above.

Fluidic handling reproducibility was evaluated by performing replicate dilutions. For each replicate, the circuit was prepared as described. Then the circuit was run withflush(l 00,90), followed by mά(100,120). Mixing was characterized by performing dilutions with variable valve actuation time during the mixing step. The circuit was primed as described, and m/x(x,500) was initiated, where x was systematically varied from 300 ms to 50 ms.

Results and Discussion

Epifluorescence visualization of the pumping programs flush and mix is presented in Figure 2. Diluent was pumped into the circuit through I, then through A and B, and finally out of the circuit through O. A plug of material in the region bounded by valves I and O and containing C was preserved by flush. Frames 1 through 4 show TAE buffer (diluent) being pumping from Rj to R₀ around the right side of the fluorescein dye-primed circuit. A plug of fluorescein dye (carryover) was preserved on the left (frame 4). The carryover and diluent are mixed together in the mix operation by serially actuating valves A, B, and C while keeping valves I and O closed. Frames 5 through 8 show the carryover being mixed into the diluent as the fluid was cyclically pumped, and the fluorescence intensity in the loop homogenizes.

A flush operation coupled to a mix operation constitutes a microfluidic serial dilution. Sample in the loop can be serially diluted many times to bring about consecutive serial dilutions of the concentrated sample. This concept is presented in Figure 3 A. The detector was positioned between valves A and B (Figure 3 A, inset) to observe three consecutive serial dilutions of fluorescein dye concentrate (300 nM). As the dye was cyclically pumped, the concentrated dye signal was acquired. Next, flush{\ 00,60) and /wzx(100,120) were run sequentially to perform the serial dilution. The measured fluorescence was reduced to background as the buffer diluent passes the detector άuήugflush, then a mixing transient was observed during mix as the diluent and carryover mix. Once mixing was complete, the same program sequence was repeated to generate multiple serial dilutions (Figure 3 A, inset).

The construction of a complete series of standards based on a single 10 μM fluorescein standard solution is presented in Figure 3B. The log of the fluorescence intensity after each serial dilution was plotted as a function of the serial dilution cycle number, which is expected to be linear with slope proportional to the log of the carryover fraction (CF) of the circuit.

The intrinsic CF for a circuit may be determined by the fraction of the mixing loop bounded by valves I and O containing valve C. This fraction linearly depends on the angle θ subtended by the arc between valves I and O (Figure 4, inset). The CF of circuits with various θ was measured and plotted as a function of θ (Figure 4). Linear agreement of CF with θ is excellent (R² = 0.998).

The error associated with each CF determination was 1.5%. Oλxήngflush steps the carryover may still be in contact with the flushing diluent stream, so carryover sample near the I and O valve boundaries may diffuse into the diluent stream. As the diluent flush time is increased, more sample diffuses out and the CF decreases. The dependence of CF on flush time was studied using fluorescein dye and buffer, and found to vary by 5% over the range of 30-300 s. Microfluidic devices are characterized by the reproducibility of operations such as mixing and dilution because the flow regime is laminar. This concept is illustrated in Figure 5. A solution of fluorescein dye was diluted using a circuit with a carryover fraction of 0.12. Two separate devices were operated with identical pumping parameters^us/zilOO^O), mzx(100,120). The five profiles are offset by 200 CPS for clarity. The start of the flush and mix programs is indicated by arrows. The inset contains an overlay of the five replicates and a sample fit of an exponentially damped sinusoid.

Replicate observations of a serial dilution conducted on two different devices demonstrate not only the reproducibility of dilutions performed in the same circuit, but also of dilutions performed on different devices. The inset of Figure 5 presents an overlay of the replicates. Given identical fluidic programming, the rate of diluent flushing and the oscillations in the mixing transient are reproduced exactly between replicates. In order to study the reproducibility of the mixing transient quantitatively, a dampened sinusoid was fit to the data. The functional dependence of the damped sinusoid, Ae^~h ύn(ωt) + b, contained least-squares fit parameters A, k, ω, and b, corresponding to the amplitude, damping factor, frequency, and offset after dilution, respectively. Typical R² values ranged from 0.90 to 0.98. Parameter ω was fit with less than 0.3% least-squares error, and the frequency determined from fits of the five replicates agreed within 1 %. A typical fit curve is shown in the Figure 5 inset, offset from the overlay. Values of R² less than 0.95 are attributed to a relatively poor description of damping by the exponential term. Nonetheless, this procedure yielded excellent data on the transient frequency for the purpose of demonstrating the reproducibility of mixing.

The time taken to mix the diluent plug into the carryover plug may be influenced by the pumping rate, or valve actuation time, during cyclic mixing. Figure 6 presents the dependence of the mixing transient morphology on the valve actuation time. As the valve actuation time was decreased from 300 ms to 50 ms, the linear flow velocity increased, and the mixing transient was compressed in time. As the two plugs were pumped through each other, mixing was expedited by the establishment of more diffusion planes. The dependence of mixing time on valve actuation time can be determined qualitatively from Figure 6A. At 50 s, for example, the fluorescence intensity may be still widely varying in the 300-ms case, while the signal has completely steadied in the 50-ms case. A quantitative study of mixing time is presented in Figure 6B. The standard deviation of an rø-second-wide window, <x_Wi_n, was plotted as a function of time to measure signal variance. The window width, n, was normalized by setting it equal to the transient period, 2π/ω, determined by fitting a damped sinusoid to each transient (described above). The deviation predictably drops as mixing proceeds. When the carryover and diluent are completely mixed, the standard deviation of the signal may be limited by the shot noise of the detector, σ_bkg_d- The mixing time is the time taken for cr_wi_n to reach 2 σ_bkgd- At this limit of detection, the observer is theoretically unable to differentiate between contributions to signal variance that arise systematically (as a result of incomplete mixing) versus those that arise randomly (as a result of shot noise).

An analysis of mixing time as a function of valve actuation time, plotted discretely in Figure 6B, reveals that mixing may be expedited as valve actuation time was decreased from 300 ms to 80 ms. The time taken for complete mixing was minimized from >150 s to 22 s over the range of actuation times studied. Further decreasing the valve actuation time from 80 ms to 50 ms did not significantly affect the mixing time. This agrees with measurements of linear flow rate as a function of valve actuation time; valve actuation appears to be limiting at valve actuation times shorter than 80 ms. The flow rate over the range of 80- to 50-ms valve actuation times gradually becomes independent of valve actuation time. Additionally, at higher flow velocities, transverse diffusion is limiting and the mixing time cannot be decreased absent a mechanism for establishing new boundary layers, for example by promoting torsional flow (Johnson et al., 2002; Stroock et al, 2002).

Serial dilution is a common operation in chemical measurements. The construction of a series of standard samples can be time consuming and expensive, requiring many fluid metering steps and expending potentially valuable sample. The circuit described herein carries out serial dilutions in 400 nL, though this is not a limit for circuit size. In practice this circuit could be scaled down or up depending on the desired sample volume. Design constraints would include the valve dead volume and carryover channel volume. This microfluidic circuit can generate an entire standard curve with only the diluent as an input. The standards are prepared in nanoliter quantities, conserving reagent and allowing facile integration with on- chip analytical techniques. For example, on-chip capillary electrophoresis or liquid chromatography could be coupled to the output of this circuit, relying on integrated pumping for standard injection (Karlinsey et al, 2005). This device can execute rapid and automated serial dilutions on the time scale of replication of a population of evolving RNA molecules, opening new avenues of inquiry in molecular evolution.

Example 4

Successful Serial Transfer and Amplification of RNA The methods described herein were used to demonstrate successful automated microfluidic serial transfer and amplification of a population of catalytic RNAs using a dilution factor of 10. As described above and shown in Figure 1, the loop was 1 cm in diameter; fluid channels were 300 μm wide x 50 μm deep; manifold channels were 100 μm wide x 50 μm deep; fluid reservoirs were 1 mm in diameter x 1 mm deep; and membrane valves were 1 mm in diameter x 50 μm deep. The volume of the loop was 400 nanoliters. Incubation actuation was set at 300 ms, mixing valve actuation was set at 80 ms, and mixing time was set at 30 s.

The circuit chip was placed onto an aluminum stage and heated to 37 ⁰C. The circuit loop was first primed with DNA encoding the previously described parent RNA ligase ribozyme (SEQ ID NO. 1 :

5'AGAACAUUACAUUAUAGUGACCAGGAAAAGACAAAUCUGCCCUCAG AGCUUGAGAACAUCUUCGGAUGCAGGGGAGGCAGCUCCCGAUGGAAG UGACGAGCCAGCGUUCUCAACAGUAAUGACUGAACCUAAAAGCCAAU CGCAGGCUCAGC3') (Wright and Joyce, 1997) at a concentration of lOO'nM. After priming with the DNA seed, the device was put into diluent flush mode. Non- mutagenic diluent reaction mixture solution containing only substrate, enzymes, and buffer components was flushed through the circuit. The reaction mixture contained 2.5 μM oligonucleotide substrate (SEQ ID NO. 2:

5 '-CTTGACGTCAGCCTGGACTAATACGACTCACUAUA-S ' ; the T7 RNA polymerase promoter sequence, SEQ ID NO. 3, is underlined and ribonucleotides, SEQ ID NO. 4, are shown in bold), 10 U μl^"1 reverse transcriptase (Stratascri.pt, Stratagene), 2.5 U μl^"1 T7 RNA polymerase, 0.001 U μL^"1 inorganic pyrophosphatase, 2 mM each NTPs, 0.2 mM each dNTPs, 2.5 μM reverse transcription primer (SEQ ID NO. 5: 5'-GCTGAGCCTGCGATTGG-S '), 4 mM dithiothreitol, 15 mM MgCl₂, 50 mM KCl, and 50 mM EPPS (pH 7.5). During the flush mode, the DNA and reaction buffer moved sequentially through the circuit, resulting in the DNA seed being bounded by valves I and O in the region containing valve C, while the reaction buffer was maintained in the remainder of the circuit. The device was then put into mix mode. In the first mixing cycle, the DNA plug was diluted by the reaction buffer to an effective starting concentration of 10 nM.

The formation of new ribozymes was monitored continuously based on homogeneous fluorescence detection using the intercalating dye thiazole orange (λ_em = 535 nm). As selective amplification proceeded, fluorescence intensity increased from baseline to a user-defined growth threshold. When the threshold concentration was reached, the computer initiated an automated serial dilution, as described above.

At each automated serial dilution, reaction mixture excluding the seed was flushed through the circuit, reducing the fluorescence intensity to background. A carryover aliquot of RNAs was then mixed into diluent, and the fluorescence was again allowed to rise to the growth threshold (Figure 8). This process was cyclically repeated, and product fractions were collected from the device to be resolved on agarose gel to confirm product length. Sixty automated microfluidic serial transfers maintained a continuously evolving population of ribozymes over 60 logs of growth in 350 minutes. Example 5

Improvements in Substrate Utilization for In Vitro Evolution

Improvements in ribozyme Km can be obtained by progressively reducing the substrate concentration during the course of continuous evolution.

Evolution can be carried out in the microfluidic system, starting with the advanced population of variants of the B 16- 19 ligase described above. The microfluidic system allows precise control of the concentration of substrate following each serial dilution. The initial concentration of substrate can be about 2 μM, which can be reduced to maintain a time interval of 7—10 min between successive dilutions. Each amplification-dilution cycle can begin with about 2 nM ribozyme, which can be allowed to amplify 10-fold to a threshold concentration of about 20 nM before triggering a 10-fold dilution. Whenever the time taken to reach the threshold falls below 7 min, the concentration of substrate can be reduced by two-fold. This process can be continued for five two-fold reductions until a final substrate concentration of about 62.5 nM is reached. The final concentration of substrate is still in excess of the maximum concentration of ribozyme, for maintaining exponential growth and for selecting ribozymes with improved Km rather than a faster rate of substrate binding. The substrate titration experiments benefit from a second input line to the microfluidic circuit for delivering a variable amount of substrate following serial dilution (see Figure 9). This auxiliary input (input X) can be supplied by a second input reservoir (Rx) and contacts the mixing loop, together with the standard input line, at bus valve I. Input X can be regulated by a control valve that can be modulated to deliver a variable number of pulses of the substrate-containing solution. A fluorescently labeled substrate can be used to calibrate the amount of solution that is delivered as a function of the valve pulse frequency. In subsequent studies, input X can be used to deliver other compounds, such as a competitive inhibitor, mutagenic nucleotide analogue, or allosteric ligand. Individuals can be cloned from the population following adaptation to about

1 μM, about 250 nM, and about 62.5 nM substrate. Based on comparative sequence analysis, representative individuals can be chosen and studied with regard to their catalytic properties.

Example 6 Improvements in Substrate Specificify for In Vitro Evolution

The emergence and evolution of substrate specificity can also be determined in a quantitative manner using the methods described herein. The evolution of substrate specificity can be caused by challenging a population of ligase ribozymes to utilize a substrate that provides strong promoter activity, while rejecting a closely-related substrate that gives rise to a promoter with reduced activity. For example, the standard substrate can have the sequence of the T7 bacteriophage class II promoter, the highest-strength promoter for T7 RNA polymerase (Dunn and Studier, 1983). The ribozyme can contain a template region that is complementary to the last eight nucleotides (positions -1 through -8) of the 17-nucleotide promoter sequence. Two alternative substrates can be prepared (see Figure 10), for example one that contains mutations at positions -9 through -11 and eliminates promoter activity, and another that contains a C-»T change at position -5 and reduces promoter strength by 25-fold (Imburgio et al., 2000). The former is a perfect competitive inhibitor because existing ribozyme variants do not interact with substrate nucleotides beyond the -8 position. Any ribozyme that ligates this mutated substrate is unable to produce progeny. The latter alternative substrate is distinguished based on the subtle difference between a G-T and G-C pair at position -5, which corresponds to a difference in predicted free energy of association with the ribozyme of 2.6 kcal/mol (Freier et al, 1986).

Using the methods described herein, continuous evolution of substrate specificity can be carried out beginning with about 2 μM substrate and about 0.5 μM competitive inhibitor, allowing the concentration of ribozyme to increase from about 10 to about 100 nM during each cycle of amplification. The concentration of inhibitor can be increased as tolerated by the evolving population, employing an auxiliary input to deliver the inhibitor. This can result in the evolution of ribozymes with an extended template domain that is perfectly complementary to the substrate and forms one or more base mismatches with the inhibitor. Alternatively, the ribozyme can evolve negative determinants that disrupt binding and/or ligation of the inhibitor. Discrimination against the inhibitor that is mutated at position -5 might exploit differences in helical geometry between a G-T wobble pair and G-C Watson-Crick pair, although as the concentration of the inhibitor becomes highly elevated it can be more advantageous to allow ligation of the inhibitor and compensate for its weak promoter strength by improving catalytic rate.

The evolution process can be continued until either the concentration of inhibitor reaches about 50 μM or until no further increases can be tolerated. Individual ribozymes can be isolated from the final evolved population, sequenced, and analyzed to determine kcat and Km values for the ligation reaction employing either the substrate or the inhibitor. A discrimination factor can be calculated, which is the ratio of kcat/Km values for these two reactions. The degree to which the inhibitor disrupts the reaction can be assessed by measuring the saturation profile for substrate ligation in the presence of varying concentrations of the inhibitor. The kinetic data, together with sequence and secondary structural information, can be used to formulate a biochemical explanation for the evolved phenotype.

Example 7 Alteration of Mutation Rates for In Vitro Evolution

Microfluidic-based evolution can be used to examine differing mutation rates in the face of varying stringencies of selection. Stringent selection, which provides a strong selective advantage to the most advantageous individuals in the population, should allow a higher frequency of mutations to be tolerated. However, once those individuals come to dominate the population and compete with related individuals that have a comparably high fitness value, it is likely that a lower maximum frequency of mutations will be tolerated.

Mutation frequency can be adjusted by adding Mn²⁺ to the continuous evolution mixture and using an auxiliary input to deliver varying amounts of one or more dNTP analogs that increase the error rate of reverse transcriptase and T7 RNA polymerase (Figure 11). These analogs only are introduced at the DNA level so as not to alter the chemical composition of the ribozyme. They include: 5-Br-dUTP, which promotes C-»T and T— »C changes (Hutchinson and Stein, 1977; Mott et al., 1984); deoxyinosine 5 ' triphosphate (dITP), which promotes C->T and T->C changes and a lower level of A→T and A— >C changes (Spee et al., 1993); 8-oxo- dGTP, which promotes T->G and A-4C changes (Pavlov et al., 1994); and a bicyclic analog of Λ^-ethoxy-dCTP (containing the base analog dihydro-[4,5-C][l- 2]oxazin-7-one), which promotes A— »G, G-»A, C— >T and T— >C changes (Zaccolo et al., 1996). All of these compounds are commercially available from TriLink Biotechnologies.

Studies can be carried out in the absence of stringent selection pressure to determine the frequency of mutations that can be achieved with the various dNTP analogs in the context of continuous in vitro evolution. The frequency of accumulated mutations can be assessed by converting the RNAs to corresponding double-stranded DNAs, denaturing, and measuring the kinetics of reannealing as a function of concentration (obtaining Cot curves; Britten and Kohne, 1968). These data can be confirmed by cloning and sequencing representative individuals from the population. Error rates of about 0.01-1% per nucleotide position per cycle of amplification and dilution are expected. The highest error rates likely are achieved using theλ^-ethoxy-dCTP compound (Zaccolo et al., 1996).

The stringency of selection can be adjusted either by reducing the concentration of substrate or by introducing a competitive inhibitor, based on information gained from the studies described above. Varying frequency of mutation and selection stringency can be applied to the evolving population, exploring the maximum error rate that can be tolerated before the population loses the capacity to maintain heritable genetic information. The trajectory of phenotypic improvement can be compared for the various lineages. Sequence analysis can be carried out for cloned individuals isolated from populations that exhibit the most rapid improvement in phenotype, as well as those that become non-viable due to excessive mutagenesis. The former are expected to exhibit a high level of genetic variation distributed about one or more consensus sequences, while the latter are expected to show a progressive loss of sequence relatedness among individuals in the population.

Example 8 Development and Optimization of Aptazymes for use in Biodetection

RNA enzymes can be constructed that are dependent on an allosteric ligand for their catalytic activity. The concentration of ligand can be used to control the catalytic rate of the enzyme, which will determine its rate of exponential amplification in the context of micro fluidic-based continuous evolution. The exponential response and the ability to sense the ligand repeatedly during selective amplification can provide high sensitivity and specificity of ligand detection. This system can be used as an assay platform for detecting ligands that are relevant to analytical biochemistry, environmental monitoring, and other biosensor applications.

There are two preferred sites for insertion of an aptamer domain within the class I ligase ribozyme, located at the distal end of either the P5 or P7 stem (see Figure 12). Each of these stem-loop regions can be replaced by a different stable secondary structural element without diminishing the molecule's catalytic activity (Ekland et al., 1995). As a test case, each can be replaced by either of two different aptamer domains, one that binds theophylline with a K_& of about 0.4 μM (Jenison, et al., 1994) and another that binds flavin mononucleotide (FMN) with a K_& of about 0.5 μM (Burgstaller and Famulok, 1994). The aptamer domain can be connected to the ribozyme by stems of varying length (3-5 base pairs) and predicted stability (- ΔG° = 3-8 kcal mol^"1). When optimized, the stem and unoccupied aptamer domain should not provide enough stability to support the active structure of the ribozyme, but binding of the ligand to the aptamer domain should provide additional stability that results in catalytic activity. A connecting stem can be chosen for each location that provides full activity in the presence of the ligand (>10 min^"1) and greatly reduced activity in its absence. A ligand-dependent rate enhancement of 10 -fold is anticipated, but a rate enhancement of only 10 -fold is required. This is because ligase ribozymes with a catalytic rate of ≤O.l min^"1 are likely to become reverse transcribed before they can react in the context of the continuous evolution system, and thus cannot undergo sustained amplification (Wright and Joyce, 1997).

Aptazymes that are dependent on either theophylline or flavin mononucleotide (FMN) can be made to undergo continuous evolution in the microfluidic format. The amplification profile of each aptazyme can be determined as a function of the concentration of the ligand. Changes in ligand concentration can affect ribozyme activity based on the degree of saturation of the aptamer domain, but are expected to have a more profound effect on the amplification profile due to the exponential nature of the system. A calibration curve can be established that relates the absolute concentration of the ligand to three different growth parameters: the rate of rise of RNA copy number, the time taken to reach a threshold concentration of RNA, and the time interval between thresholds that trigger successive serial dilution events. Using the methods described herein, ligase aptazymes can be optimized by being subjected to continuous evolution in a ligand-dependent manner. The concentration of the cognate ligand can be adjusted to control the evolutionary fitness of the continuously evolving ribozymes. These ribozymes can be isolated and analyzed and can subsequently be used to detect small molecule and protein targets that are relevant to analytical biochemistry, environmental monitoring, and other biosensor applications.

Two different "strains" of aptazymes can be co-evolved, each dependent on a different ligand. By controlling the concentration of each ligand, it is possible to control the relative fitness of the two strains. Experiments can be performed in which the concentration of the two ligands is made to oscillate, either rising together or rising in an opposing manner. The effect of these alterations on the population size and tempo of genetic alteration can be determined for each strain. An oscillating environment is expected to drive more rapid genetic change compared to a static environment. The system for microfluidic-based continuous evolution of aptazymes can be established as an assay platform for the quantitative analysis of various small molecule and protein ligands. The theophylline and FMN aptamers are well-studied motifs that can be used to validate the system, but the system is applicable to a broad range of aptamers, many of which have not been well characterized. One example that can be investigated is an aptamer that binds the chemical carcinogen methylenedianiline with a K_& of 0.45 μM, but has poor affinity for aniline alone (Brockstedt et al, 2004). This 40mer RNA was developed for potential applications in monitoring facilities that use methylenedianiline in the manufacture of polyurethane and other plastics (International Agency for Research on Cancer, 1986). The aptamer can be inserted blindly into the class I ligase ribozyme at the preferred site and with the preferred connecting stem, based on studies conducted with the theophylline and FMN aptamers. Ligand concentrations of about 0.01 to about 10 μM can be tested in the assay format, which should correspond to observed catalytic rates of about 0.2 to about 10 min^"1, and should result in substantial differences in the rate of ligand-dependent exponential amplification. Similar experiments can be carried out using an RNA aptamer that binds chicken egg white lysozyme with a K^ of 31 nM (Cox and Ellington, 2001). The lysozyme aptamer can be inserted in the preferred manner within the class I ligase. Micro fluidic-based continuous evolution can be carried out in the presence of about 1 to about 1000 nM lysozyme, again corresponding to anticipated catalytic rates of about 0.2-10 min^"1 and much greater differences in the rate of selective amplification. The lowest concentrations challenge the limits of detection because it may be necessary to maintain ligand in excess of aptazyme in order to achieve exponential amplification. Calibration curves can be established to demonstrate the limits of quantitative detection for both methylenedianiline and lysozyme.

References

The following references are not admitted to be prior art to the present application, although some of the references are in fact prior art.

Bartel, D.P. & Szostak, J.W. Science 1993 261, 1411-1418.

Britten, R.J. & Kohne, D.E. Science 1968, 161, 529-540.

Brockstedt, U., Uzarowska, A., Montpetit, A., Pfau, W. & Labuda, D. Biochem.

Biophys. Res. Comm. 2004, 313, 1004-1008. Burgstaller, P. & Famulok, M. Angew. Chemie 1994, 33, 1084-1087.

Chang, J. K.; Heo, Y. S.; Bang, H.; Cho, K.; Chung, S.; Chung, C; Han, D. C.

Biotechnol. Bioprocess Eng. 2003, 8, 233-239. Ciesiolka, J., Illangasekare, M., Majerfeld, L, Nickles, T., Welch, M., Yarus, M. &

Zinnen, S. Methods Enzymol. 1996, 267, 315-335. Cox, J.C. & Ellington, A.D. Bioorg, Med. Chem. 2001, 9, 2525-2531. Dunn, JJ. & Studier, F.W. J. MoI Biol. 1983, 166, 477-535. Ekland, E.H., Szostak, J.W. & Bartel, D.P. Science 1995, 269, 364-370. Engvall, E. & Perlman, P. Immunochemistry 1971, 8, 871-S74. Fitzwater, T. & Polisky, B. Methods Enzymol. 1996, 267, 275-301. Freier, S JVL, Kierzek, R., Jaeger, J.A., Sugimoto, N., Caruthers, M.H., Neilson, T.

& Turner, D.H. Proc. Natl. Acad. ScL USA 1986, 83, 9373-9377. Grover, W. H.; Skelley, A. M.; Liu, C. N.; Lagally, E. T.; Mathies, R. A. Sens.

Actuators, B 2003, 89, 315-323.

Hartig, J.S., Najafi-Shoushtari, S.N., Grϋne, L, Yan, A., Ellington, A.D. & Famulok, M. Nature Biotechnol. 2002, 20, 717-722.

Holden, M. A.; Kumar, S.; Castellana, E. T.; Beskok, A.; Cremer, P. S. Sens.

Actuators, B 2003, 92, 199-207.

Hutchinson, F. & Stein, J. Molec. Gen. Genet. 1977, 152, 29-36. Imburgio, D., Rong, M., Ma, K. & McAllister, W.T. Biochemistry 2000, 39, 10419- 10430.

International Agency for Research on Cancer IARC 'Monographs on the Evaluation of the Carcinogenic Risk of Chemical to Humans 1986, 39, 347-365. Jacobson, S. C; Ermakov, S. V.; Ramsey, J. M. Anal. Chem. 1999, 71, 3273-3276. Jacobson, S. C; McKnight, T. E.; Ramsey, J. M. Anal. Chem. 1999, 71, 4455-4459. Jenison, R.D., Gill, S.C., Pardi, A. & Polisky, B. Science 1994 263, 1425-1429. Johnson, TJ., Ross, D. & Locascio, L.E. Anal. Chem. 2002, 74, 45-51. Karlinsey, J. M.; Monahan, J.; Marchiarullo, D. J.; Ferrance, J. P.; Landers, J. P.

Anal. Chem. 2005, 77, 3637-3643. Koehler, J.; Vajjhala, S.; Coyne, C; Flynn, T.; Pezzuto, M.; Williams, M.; Levine,

L. Assay Drug Dev. Technol. 2002, 1, 91-96.

Kossen, K., Vaish, N.K., Jadhav, V.R., Pasko, C, Wang, H., Jenison, R., McSwiggen, J. A. & Polisky, B. Chem. Biol 2004, 11, 807-815.

Kϋhne, H. & Joyce, G.F. J. MoI. Evol. 2003, 57, 292-298. Morris, K.N., Jensen, K.B., Julin, CM., Weil, M. & Gold, L. Proc. Natl. Acad. Sd.

USA 1998, 95, 2902-2907.

Mott, J.E., van Arsdell, J. & Platt, T. Nucleic Acids Res. 1984, 12, 4139-4152. Paegel, B. M.; Yeung, S. H. L; Mathies, R. A. Anal. Chem. 2002, 74, 5092-5098. Pavlov, Y.I., Minnik, D.T., Izuta, S. & Kunkel, T.A. Biochemistry 1994, 33, 4695-

4701.

Robertson, M.P. & Ellington, A.D. Nature Biotechnol 2001, 19, 650-655. Robertson, M.P., Knudsen, S.M. & Ellington, A.D. RNA 2004 10, 114-127. Sano, T., Smith, CL. & Cantor, CR. Science 1992 258, 120-122. Schmitt, T. & Lehman, N. Chem. Biol. 1999, 6, 857-869. Seetharaman, S., Zivarts, M., Sudarsan, N. & Breaker, R.R. Nature Biotechnol.

2001, 19, 336-341.

Simpson, P. C; Roach, D.; Woolley, A. T.; Thorsen, T.; Johnston, R.; Sensabaugh, G. F.; Mathies, R. A. Proc. Natl. Acad. Sci. USA 1998, 95, 2256-2261.

Spee, J.H., de Vos, W.M. & Kuipers, O.P. (1993) Nucleic Acids Res. 1993, 21, 777-

778. Siioock, A. D.; Dertinger, S. K. W.; Ajdari, A.; Mezic, L; Stone, H. A.; Whitesides,

G. M. Science 2002, 295, 647-651. Tang, J. & Breaker, R.R. Chem. Biol. 1997, 4, 453-459.

Unger, M. A.; Chou, H. P.; Thorsen, T.; Scherer, A.; Quake, S. R. Science 2000, 255, 113-116. Vaish, N.K., Dong, F., Andrews, L, Schweppe, R.E., Ahn, N.G., Blatt, L. &

Seiwert, S.D. Nature Biotechnol. 2002, 20, 810-815.

Vaish, N.K., Jadhav, V.R., Kossen, K., Pasko, C, Andrews, L.E., McSwiggen, J.A., Polisky, B. & Seiwert, S.D. RNA 2003, 9, 1058-1072.

Wright, M. C; Joyce, G. F. Science 1997, 276, 614-617. Zaccolo, M., Williams, D.M., Brown, D.M. & Gherardi, E. J. MoI. Biol. 1996, 255,

589-603.

All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain details herein may be varied considerably without departing from the basic principles of the invention.

Claims

WHAT IS CLAIMED IS:

1. A dilution method comprising conducting an automated serial dilution on a nano to micro scale with reproducible nano to micro metering and mixing of diluents.

2. A reaction method comprising conducting an automated biochemical reaction on a nano to micro scale, wherein one or more of the steps of the biochemical reaction are performed in a serial fashion, with reproducible nano to micro metering and mixing of reagents, diluents, and products.

3. The method of claim 2, wherein-the biochemical reaction is chemical synthesis or chemical analysis.

4. The method of claim 3, wherein the chemical synthesis is amplification of catalytic RNA.

5. The method of claim 3, wherein the chemical analysis comprises biodetection.

6. The method of claim 5, wherein the biodetection comprises determining the presence of a molecule in a sample.

7. A method of conducting an automated reaction comprising reacting substrate molecules and catalytic RNA molecules in nano to micro volume quantities and serially repeating the reaction under conditions that assure reproducible metering and mixing of the nano to micro volumes.

8. The method of claim 7, wherein a population of catalytic RNA molecules is primed into a nano to micro fluidic serial dilution circuit and the substrate molecules and additional reaction components are subsequently flushed into the circuit.

9. The method of claim 7, wherein the substrate molecules and additional reaction components are primed into a microfluidic serial dilution circuit and the catalytic RNA molecules are subsequently flushed into the circuit.

10. The method of claim 8 or 9, wherein the substrate molecules, reaction components and RNA molecules are admixed to form an admixture.

11. The method of claim 10, wherein the admixture is maintained for a sufficient period of time and under predetermined reaction conditions to allow the catalytic RNA molecule to ligate to the substrate, thereby producing ligation products.

12. The method of claim 11, wherein the ligation products are reverse- transcribed into cDNAs that contain a functional promoter.

13. The method of claim 12, wherein the cDNAs are transcribed to generate progeny ribozymes.

14. The method of claim 13, wherein the progeny ribozymes are isolated.

15. The method of any one of claims 4, 7, 8, 9, 10, 11, 12, 13 or 14, wherein the method is conducted under mutagenic conditions.

16. A method of generating catalytic RNA molecules in vitro that have ligase activity, comprising the following steps: a. obtaining a population of catalytic RNA molecules; b. introducing genetic variation into the population to produce a variant population; c. selecting individuals from the variant population that meet predetermined selection criteria including a binding affinity for substrate molecules; d. amplifying the selected individuals from the variant population; and e. separating the selected individuals from the remainder of the variant population, wherein the method is automated, performed on a nano to micro scale and is repeated in a serial fashion, with reproducible metering of reagents and products.

17JA method for preparing a set of standard samples using automated serial dilution, wherein the dilution is performed on a nano to micro scale with reproducible metering of reagents.

18. A method according to any of the preceeding claims wherein an automated microfluidic serial dilution circuit optionally and controllably coupled to reactant and/or diluent reservoirs is used to perform the dilution or reaction.