WO2008115441A1 - Use of glucocorticoids for treatment of congestive heart failure - Google Patents
Use of glucocorticoids for treatment of congestive heart failure Download PDFInfo
- Publication number
- WO2008115441A1 WO2008115441A1 PCT/US2008/003448 US2008003448W WO2008115441A1 WO 2008115441 A1 WO2008115441 A1 WO 2008115441A1 US 2008003448 W US2008003448 W US 2008003448W WO 2008115441 A1 WO2008115441 A1 WO 2008115441A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- glucocorticoid
- dosage form
- heart failure
- amount ranging
- congestive heart
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
- A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/59—Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
- A61K31/593—9,10-Secocholestane derivatives, e.g. cholecalciferol, i.e. vitamin D3
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
Definitions
- the invention relates to methods and dosage forms forms comprising at least one glucocorticoid, wherein the at least one glucocorticoid is administered to a subject in an amount effective to ameliorate aspects of the subject's congestive heart failure.
- CHF Congestive heart failure
- CHF may affect the right side, the left side, or both sides of the heart. As the heart's pumping action is lost, blood may back up into other areas of the body, including the lungs, liver, gastrointestinal tract and extremities. Due to reduced blood flow, some organs of CHF subjects may not receive enough oxygen and nutrients, which damages them and reduces their ability to function properly.
- CHF CHF Symptoms of CHF include but are not limited to: weight gain, swelling of feet and ankles, swelling of the abdomen, pronounced neck veins, loss of appetite, indigestion, nausea and vomiting, shortness of breath with activity, or after lying down for a while, difficulty sleeping, fatigue, weakness, faintness,
- Treatment of CHF can include lifestyle modifications and medication.
- Medications useful in the treatment of CHF comprise: ACE inhibitors such as captopril and enalapril; diuretics such as thiazide, loop diuretics, and potassium-sparing diuretics; digitalis glycosides; angiotensin receptor blockers (ARBs) such as losartan and candesartan; beta-blockers
- the invention relates to methods comprising: administering to a subject suffering from congestive heart failure a dosage form comprising a pharmaceutical carrier and at least one glucocorticoid in an amount ranging from about 0.0001 mg to about 1000 mg.
- the invention relates to methods comprising administering a dosage form comprising a pharmaceutical carrier and at least one glucocorticoid to a subject suffering from congestive heart failure, wherein the at least one glucocorticoid is present in the dosage form in an amount effective to ameliorate aspects of the congestive heart failure.
- Figure 1 shows corticosterone concentration in normal Wistar rat interperidcardial fluid.
- Figure 2 shows corticosterone concentration in normal Wistar rat cardiac tissue.
- Figure 3 shows interstitial collagen deposition in rat cardiac tissue.
- Figure 4 shows echocardiography data as ratios of values at treatment end/treatment start.
- Figure 5 shows heart rates measured in the right carotid artery.
- Figure 6 shows mean right carotid artery blood pressures.
- Figure 7 shows collagen levels in SHHF rat hearts as a function of time.
- Figure 8 shows left ventricular end diastolic pressures at rest.
- Figure 9 shows heart rates during left ventricular contractility measurements.
- Figure 10 shows left ventricular contractility (pressure development rate).
- Figure 11 shows left ventricular relaxation (-dP/dt).
- Figure 12 shows left ventricular epicardial interstitial collagen levels (Sirius Red).
- Figure 13 shows left ventricular gene expression levels of collagens I and III and BNP.
- a dosage form comprising a pharmaceutical carrier and at least one glucocorticoid in an amount ranging from about 0.0001 mg to about 1000 mg.
- the inventors have discovered that the problems in the art noted above can be addressed by providing methods that comprise administering a dosage form comprising a pharmaceutical carrier and at least one glucocorticoid to a subject suffering from congestive heart failure, wherein the at least one glucocorticoid is present in the dosage form in an amount effective to ameliorate aspects of the congestive heart failure.
- Glucocorticoids naturally occurring and synthetic are members of a class of steroid hormones characterized by the ability to bind with the intracellular glucocorticoid receptor (GR), induce nuclear translocation of the GR-glucocorticoid complex and trigger similar effects on gene and protein expression.
- GR glucocorticoid receptor
- Their use in successfully treating CHF is surprising because the classical effects of glucocorticoids include, but are not limited to exacerbation of hypertension, hyperglycemia and hyperlipidemias. These are all contributing factors to CHF, so usefulness of glucocortcoids would seem to be contraindicated.
- the inventors have discovered that, contrary to conventional thinking, glucocorticoids can, in fact, be used to treat CHF, and its related aspects.
- Example 2 in the established spontaneous hypertensive heart failure (SHHF) rat model of CHF, while mean arterial pressure (MAP), heart rate, and echocardiography examinations revealed no differences between treatments, left ventricular contractility, cardiac filling rate, left ventricular end diastolic pressure, and left ventricular epicardial collagen area all improved following treatment with corticosterone.
- SHHF spontaneous hypertensive heart failure
- MAP mean arterial pressure
- heart rate heart rate
- echocardiography examinations revealed no differences between treatments, left ventricular contractility, cardiac filling rate, left ventricular end diastolic pressure, and left ventricular epicardial collagen area all improved following treatment with corticosterone.
- systemic side effects can be reduced by use of local drug administration.
- certain forms of local drug administration such as intrapericardial administration, can provide therapeutic local concentration of drug(s) while reducing the systemic concentration of the drug.
- Reduced systemic concentration of glucocorticoids, coupled with an effective concentration of at least one glucocorticoid in heart tissue, can provide effective treatment of CHF according to the present invention while reducing the undesirable side effects of the at least one glucocorticoid elsewhere in the body.
- the results of Example 1, as shown in Figures 1 and 2 demonstrate that it is possible to achieve a higher concentration of corticosterone in rat interpericardial fluid and heart tissue using local administration versus that following systemic administration of the same amount of drug.
- Example 2 using the SHHF rat model of CHF it can be seen in a dose dependent fashion that corticosterone positively affects left ventricular contractility and relaxation, left ventricular end diastolic pressure, and left ventricular epicardial collagen area (see Figures 8, 9, 10, 11, and 12) while not affecting heart rate and blood pressure.
- corticosterone administration reduces mRNA expression of Type I and III collagen, and B-type natriuretic peptide (BNP) (see Figure 13).
- BNP B-type natriuretic peptide
- the SHHF rat model has been established as a model of CHF with predictive utility in screening compounds for safety and efficacy in humans.
- elevated interstitial collagen levels are a histological and biochemical feature of aged ( ⁇ 40 week) SHHF rats, a condition also observed in myocardial tissue from CHF patients.
- the data in Figures 3 and 7 was obtained generally using the procedure as described in Example 3.
- a reduction of interstitial collagen expression has been associated with improved cardiac function in SHHF rats and CHF patients.
- Glucocorticoid ⁇ means members of a class of steroid hormones (naturally occurring and synthetic) characterized by the ability to bind with the intracellular glucocorticoid receptor (GR), induce nuclear translocation of the GR-glucocorticoid complex and trigger similar effects on gene and protein expression.
- Glucocorticoids can be grouped into roughly three classes of compounds, based on the their relative potency as compared to Cortisol typically defined as GR receptor binding affinity and/or activity in an in vitro or in vivo assay.
- Low potency glucocorticoids can be defined as those glucocorticoids having a potency from about 0.25 times to about 4 times the potency of Cortisol.
- Examples of low potency glucocorticoids comprise: aclometasone, corticosterone, Cortisol, cortisone acetate, desonide, hydrocortisone, or prednicarbate.
- Mid-potency glucocorticoids can be defined as those glucocorticoids having a potency from about 5 times to about 12 times the potency of Cortisol.
- Examples of mid-potency glucocorticoids comprise: clobetasone, methylprednisolone, prednisone, prednisilone, or triamcinolone.
- High potency glucocorticoids can be defined as those glucocorticoids having a potency greater than or equal to about 13 times the potency of Cortisol.
- Examples of high potency glucocorticoids comprise: amcinonide, betamethasone, beclomethasone, budenosid, clobetasol, desoximetasone, dexamethasone, diflorasone, fludrocortisones, fluocinonide, flurandrenolide, fluticasone, halcinonide, halobetasol, or mometasone.
- dosage forms according to the invention comprise at least one glucocorticoid in an amount ranging from about 0.0001 mg to about 1000 mg, preferably in an amount ranging from about 0.001 mg to about 500 mg, more preferably in an amount ranging from about 0.001 mg to about 100 mg, even more in an amount ranging from about 0.001 mg to about 50 mg, and yet more preferably in an amount ranging from about 0.01 mg to about 30 mg.
- administering means providing a drug to a patient in a manner that is pharmacologically useful.
- Subject is used interchangeably with “individual” and means any human with which it is desired to practice the present invention.
- the term “subject” does not denote a particular age, and the present systems are thus suited for use with subjects of any age, such as infant, adolescent, adult and senior aged subjects
- a subject may comprise a patient.
- “Suffering from” means diagnosed with, or suspected as having, a particular medical condition.
- Congestive heart failure means a structural or functional cardiac disorder that impairs the ability of the heart to fill with or pump a sufficient amount of blood throughout the body. Aspects of congestive heart failure mean the structural or functional changes due to congestive heart failure that can be observed clinically. In embodiments, aspects of congestive heart failure comprise: cardiac hypertrophy, reduced cardiac contractility, reduced cardiac output, pressure & volume overload hypertrophy, myocardial dysfunction, cardiac remodeling, post-myocardial infarction heart failure, and/or cardiopathy.
- Dosage form means a composition suitable for pharmaceutical administration. Additional information regarding dosage forms useful in the practice of the invention is found elsewhere herein.
- “Pharmaceutical carrier” means a pharmaceutically acceptable material that is pharmacologically inactive with respect to congestive heart failure.
- pharmaceutical carriers may comprise materials as described elsewhere herein.
- Systemic administration means administration in a manner that provides for systemic absorption and distribution.
- “Local administration” means administration in a manner that provides for absorption and distribution in a specific region or tissue of a subject.
- glucocorticoids useful in the practice of this invention may be varied depending upon the nature of the glucocorticoids, including such characteristics as potency and/or pharmacokinetic properties, and the condition of the subject.
- Dosage forms according to the invention may be administered via a variety of routes. Routes of administration that are conventionally useful include systemic and local routes.
- Systemic routes include but are not limited to: buccal, oral, inhalation, intravenous, intramuscular, nasal, transdermal, subcutaneous, and the like.
- Administration of dosage forms according to the invention via local routes of administration may provide certain benefits versus systemic administration.
- certain forms of local administration such as the intrapericardial administration described in Hermans, can provide enhanced local concentration of drugs while reducing the systemic concentration of the drug.
- Hermans fails to describe any administration of glucocorticoids to a subject suffering from congestive heart failure or related aspects thereof, Hermans' concept of local administration of drugs for pharmacokinetic and pharmacodynamic advantage can be usefully employed in the practice of the present invention.
- Local routes include but are not limited to: interpericaridal, intrapericaridal, intramyocardial, intraperivascular, and interpericardium.
- Various methods for such local routes may be adapted for use in the practice of the present invention, including use of intravascular catheters, percutaneous injection, and the like.
- Inventive dosage forms and methods may be used to administer glucocorticoids via a bolus administration or infusion.
- the choice of whether to use a bolus injection or an infusion may be based on a number of parameters, including the pharmacokinetic properties of the glucocorticoid, the condition of the subject, and the like.
- dosage forms may be useful in the practice of this invention. Such dosage forms can be prepared using procedures well known in the pharmaceutical art.
- the dosage forms comprise a pharmaceutical carrier and at least one glucocorticoid.
- Pharmaceutical carriers may be utilized, in certain embodiments, to enhance stability of the at least one glucocorticoid, facilitate administration of the dosage forms, provide increased dissolution or dispersion, and the like.
- Information on pharmaceutical carriers useful in the practice of the present invention may be obtained from a variety of sources, including Remington: The Science and Practice of Pharmacy, 20th Edition, A.
- the forms of the at least one glucocorticoid utilized in a particular pharmaceutical formulation are selected (e.g., salts) to possess suitable physical characteristics (e.g., water solubility) that are required for the formulation to be efficacious.
- Dosage forms suitable for buccal (sub-lingual) administration include lozenges comprising at least one glucocorticoid in a flavored base, usually sucrose, and acacia or tragacanth, and pastilles comprising the at least one glucocorticoid in an inert base such as gelatin and glycerin or sucrose and acacia.
- Dosage forms suitable for parenteral administration comprise sterile aqueous preparations of at least one glucocorticoid. These dosage forms are preferably administered intravenously, although administration can also be effected by means of subcutaneous, intramuscular, or intradermal injection, etc., and in accordance with the lists of routes of administration noted elsewhere herein. Injectable dosage forms are commonly based upon injectable sterile saline, phosphate-buffered saline, oleaginous suspensions, or other injectable carriers known in the art and are generally rendered sterile and isotonic with the blood.
- the injectable dosage forms may therefore be provided as a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, including 1,3-butanediol, water, Ringer's solution, isotonic sodium chloride solution, fixed oils such as synthetic mono- or diglycerides, fatty acids such as oleic acid, and the like.
- a nontoxic parenterally acceptable diluent or solvent including 1,3-butanediol, water, Ringer's solution, isotonic sodium chloride solution, fixed oils such as synthetic mono- or diglycerides, fatty acids such as oleic acid, and the like.
- Such injectable dosage forms are formulated using suitable dispersing or setting agents and suspending agents.
- Solid dosage forms for oral administration of at least one glucocorticoid include capsules, tablets, pills, powders, and granules.
- a dosage form containing at least one glucocorticoid is formed by the incorporation of any of the normally employed excipients, such as, for example, pharmaceutical grades of mannitol, lactose, starch, pregelatinized starch, magnesium stearate, sodium saccharine, talcum, cellulose ether derivatives, glucose, gelatin, sucrose, citrate, propyl gallate, and the like.
- Such solid dosage forms may include formulations, as are well known in the art, to provide prolonged or sustained delivery of the drug to the gastrointestinal tract by any number of mechanisms, which include, but are not limited to, pH sensitive release from the dosage form based on the changing pH of the small intestine, slow erosion of a tablet or capsule, retention in the stomach based on the physical properties of the formulation, bioadhesion of the dosage form to the mucosal lining of the intestinal tract, or enzymatic release of the active drug from the dosage form.
- Liquid dosage forms for oral administration of at least one glucocorticoid include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs, optionally containing pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, glycerol, ethanol and the like. These compositions can also contain additional adjuvants such as wetting, emulsifying, suspending, sweetening, flavoring, and perfuming agents.
- a carrier such as, for example, water, saline, aqueous dextrose, glycerol, ethanol and the like.
- additional adjuvants such as wetting, emulsifying, suspending, sweetening, flavoring, and perfuming agents.
- Topical dosage forms that comprise at least one glucocorticoid include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and aerosols, and may contain appropriate conventional additives such as preservatives, solvents to assist drug penetration and emollients in ointments and creams. Topical application may be once or more than once per day depending upon the usual medical considerations.
- glucocorticoids according to the invention can be administered in intranasal form via topical use of suitable intranasal dosage forms.
- the dosage forms may also contain compatible conventional carriers, such as cream or ointment bases and ethanol or oleyl alcohol for lotions. Such carriers may be present as from about 1% up to about 98% of the formulation, more usually they will form up to about 80% of the formulation.
- Transdermal administration is also possible. Dosage forms suitable for transdermal administration can be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Such patches suitably contain at least one glucocorticoid in an optionally buffered, aqueous solution, dissolved and/or dispersed in an adhesive, or dispersed in a polymer. A suitable concentration of the at least one glucocorticoids is about 0.01% to about 35 wt%, preferably about 0.01 wt % to about 15 wt%, based on the total weight of the dosage form.
- the at least one glucocorticoid may be conveniently delivered in the form of an aerosol spray from a pump spray device not requiring a propellant gas or from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, tetrafluoroethane, heptafluoropropane, carbon dioxide, or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, tetrafluoroethane, heptafluoropropane, carbon dioxide, or other suitable gas.
- the aerosol spray dosage unit may be determined by providing a valve to deliver a metered amount so that the resulting metered dose inhaler (MDI) is used to administer the at least one glucocorticoid in a reproducible and controlled way.
- MDI metered dose inhaler
- Such inhaler, nebulizer, or atomizer devices are known in the art, for example, in PCT International Publication Nos. WO 97/12687 (particularly FIG. 6 thereof, which is the basis for the commercial RESPIMAT® nebulizer); WO 94/07607; WO 97/12683; and WO 97/20590.
- Rectal administration can be effected utilizing unit dose suppositories in which the compound is admixed with low-temperature melting water-soluble or insoluble solids such as fats, cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights, or fatty acid esters of polyethylene glycols, or the like.
- the at least one glucocorticoid may be a minor component, preferably from about 0.05 to about 10% by weight, with the remainder being the base component., based on total weight of the dosage form.
- the at least one glucocorticoid is formulated with an acceptable carrier or excipient.
- the carrier or excipient can be a solid or a liquid, or both, and is preferably formulated with the at least one glucocorticoid as a unit- dose composition, for example, a tablet, which can contain from 0.05% to 95% by weight of the active compound, based on the total weight of the dosage form.
- Such carriers or excipients include inert fillers or diluents, binders, lubricants, disintegrating agents, solution retardants, resorption accelerators, absorption agents, and coloring agents.
- Suitable binders include starch, gelatin, natural sugars such as glucose or beta.
- Lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like.
- Disintegrators include starch, methyl cellulose, agar, bentonite, xanthan gum, and the like.
- Pharmaceutically acceptable carriers encompass all the foregoing additives and the like.
- the rats underwent a surgical procedure to install pericardial and intravenous catheters and minipumps. Construction of the pericardial catheters and the procedure to install the catheter into the pericardial space were conducted as described by Hermans, which has been discussed above.
- the pericardial catheters consisted of silicone tubing (internal diameter: 0.51 mm; external diameter 0.94 mm, Degania Silicone, Degania Bet, Israel), which, by assembling its endings with a polyolefin shrinking sleeve (Farnell Compounds, Maarssen, the Netherlands), was shaped as a loop (length appr. 2 cm, width appr. 1 cm). Silicone glue was applied in the middle of the loop, to create two separate chambers (one used for fluid injection, the second closed, i.e. connected to a closed ending). The fluid infusion chamber was provided with holes by use of a 25-gauge perforator.
- the endings of the silicone tubing were connected to (polyethylene) PE- 10 tubing (i.d. 0.28 mm, e.d. 0.61 mm, Portex Limited, Kent, UK). Before installment, the catheter and the polyethylene extensions were gas sterilized and filled with sterile test solution before installment.
- rats were anesthetized by i.p. injection of 60 mg/kg sodium pentobarbitone (Nembutal, Sanofi Sante, Maassluis, the Netherlands) and placed on a heating pad, kept at 37 0 C. A high midline thoracotomy was performed and a retractor applied. Following careful cleavage of the sternohyoid muscle, thymus lobules were separated to expose the upper part of the pericardium. A small incision in the pericardial sac was made with iris scissors and the loop catheter inserted. The pericardial sac was closed by sealing it to the thymus with histoacryl tissue glue (Braun Mels Heidelberg Germany).
- the polyethylene extensions were guided to the neck. Following a small loading bolus injection of 20 ⁇ l of sterile test-solution, the infusion extension was connected to a primed osmotic minipump (Alzet 2ml4, Durect, Cupertino, USA) filled with sterile test solution, using a small piece of PE-60. The closed extension was created by melting the end of the PE-10.
- a primed osmotic minipump Alzet 2ml4, Durect, Cupertino, USA
- Intravenous catheters consisted of a tapered construction (filled with sterile test solution) of a PE-10 tip (hinged to enable insertion into the femoral vein and attachment), connected to PE-50, which in turn was connected to PE-60. With the rats still being under pentobarbitone anesthesia, the femoral vein was temporarily ligated, after which a small incision was made in the femoral vein with iris scissors. The catheter tip was inserted into the vein for about 4 cm to enter the vena cava, following fixation of the cathether with 3-0 silk and removal of the temporary ligation.
- the PE-60 part of the canula was guided to the neck, following a small loading bolus injection with 100 ⁇ l of test-solution via the canula, which was then connected to a primed osmotic minipump (Alzet 2ml4, Durect, Cupertino, USA) filled with sterile test solution.
- Osmotic minipumps Alzet 2ml4, Durect, Cupertino, USA
- These pumps provided a substantially constant infusion rate for at least 4 weeks.
- Total treatment time was 4 weeks for all animals.
- the rats were randomly assigned into 5 groups of 3-5 rats per group.
- the groups were as follows:
- corticosterone high dose IPC 60 micrograms/day
- corticosterone low dose IPC 15 micrograms/day
- corticosterone high dose IV 60 micrograms/day
- corticosterone low dose IV 15 micrograms/day
- Group (1) a high dose (60 ug/day) of corticosterone hemisuccinate intrapericardially and vehicle intravenously;
- Group (2) a low dose (15 ug/day) of corticosterone hemisuccinate intrapericardially and vehicle intravenously;
- Group (3) a high dose (60 ug/day) of corticosterone hemisuccinate intravenously and vehicle intrapericardially;
- Group (4) a low dose (15 ug/day) of corticosterone hemisuccinate intravenously and vehicle intrapericardially.
- Corticosterone hemisuccinate was purchased from Sigma (St Louis, MO).
- mice were anesthetized with pentobarbitone (60 mg/kg Lp.), following blood withdrawal from the aorta to sacrifice the animals and to be able to determine plasma levels of corticosterone.
- Pericardial fluid was collected and the hearts harvested following brief rinsing with saline. Hearts were cut in 3 slices and shock frozen. All samples were stored at -80 0 C until analysed.
- heart sections were weighed and homogenized in 5 volumes of 1 mM EDTA milliQ water. For plasma and pericardial fluid, corresponding amounts of 1 mM of EDTA were added.
- steroids were extracted with 12 volumes of diethylether, followed by transfer of the organic phase to conic tubes and evaporation of the solvent under a stream of nitrogen at 37 0 C.
- Steroids were collected in the cone of the tube by rinsing the tube twice with 0.2 ml of acetone and evaporation of the acetone.
- 30 microliters of acetone were added, to re-dissolve the steroids.
- 60 microliters of sulphuric acid (98%) were added to convert the steroids into fluorescent derivatives. Steroids were allowed to react for 20 minutes in the dark.
- Detection was fluorescence at excitation wavelength 367 nm emission 532 nm (at Shimadzu RF- 10AxI). Peak areas of corticosterone and internal standard were calculated and ratios were compared with a calibration curve to calculate corticosterone concentrations of the samples.
- Example 2 Study of aspects of CHF in spontaneous hypertensive heart failure rats after IPC or IV administration of corticosterone
- SHHF rats originally obtained from Charles River, Boston, USA
- SHHF rats were housed at the animal facilities of the University of Maastricht with a 12-hour light/dark cycle and had free access to standard rat chow and tap-water. Experiments were performed according to institutional guidelines and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).
- the rats underwent a surgical procedure to install pericardial and intravenous catheters and minipumps according to the procedure of Example 1.
- corticosterone high dose IPC 60 micrograms/day
- corticosterone low dose IPC 6 micrograms/day
- Group (1) a high dose (60 ug/day) of corticosterone hemisuccinate intrapericardially and vehicle intravenously;
- Group (2) a low dose (6 ug/day) of corticosterone hemisuccinate intrapericardially and vehicle intravenously;
- Group (3) a high dose (60 ug/day) of corticosterone hemisuccinate intravenously and vehicle intrapericardially;
- Corticosterone hemisuccinate was purchased from Sigma (St Louis, MO)
- Hearts were harvested for histological analysis in order to determine fibrillar interstitial and perivascular collagen accumulation by collagen specific Picro Sirius Red staining and subsequent light microscopy.
- the apical parts of the hearts were embedded in Tissue-tek and frozen in freezing 2-methyl-butane in liquid nitrogen.
- Cryostat cross-sections (6 ⁇ m) were prepared, air dried, fixed in 10% buffered formalin for 1 hour and washed for 30 min followed by 5 min in distilled water. After 5 min in 0.2% Phosphomolybdic acid for prevention of background staining all sections were stained for 90 min with 0.1% Sirius red (Polyscience, Warrington PA, USA) in saturated picric acid . Before coversliping with Entelan all sections were rapidly dehydrated by subsequent sequential dipping in 70 v/v %, 96 v/v ethanol/milliQ, and 100% ethanol, followed by xylene.
- Collagen volume fraction of each section was determined using a computer image analyzing system (Leica Q-Win). Interstitial collagen density of heart sections was evaluated in the left ventricle (LV) subepicardial myocardium regions. Ten fields from each region (magnification x20) were randomly selected for analyses and the area stained was calculated as percentage of the total area within a field.
- Perivascular collagen was expressed as ratio of the area of the collagen surrounding the vessel divided to the area of the coronary arteries media in order to correct for differences in vessel size (magnification x20 or x40). We calculated an average value for interstitial and perivascular fibrosis or each animal.
- transthoracic echocardiography was performed under isoflurane anesthesia in part of the rats (5-7 per group) using the SONOS 5500 echocardiography system equipped with a 15-MHz linear-array transducer (Philips Medical Systems Corp., Netherlands).
- rats were anesthetized with 2-3% isoflurane (Abbott Laboratories, Kent, UK) placed on a heating pad, kept at 37 0 C with transducer placed on the left hemithorax.
- the 2- dimensional parasternal long- and short- axis view of the left ventricle and the parasternal short axis M-mode tracings were recorded. Results of the echocardiography are shown in Figure 4.
- FS percent LV fractional shortening
- FS (LVIDd LVIDs)/LVIDd x 100, where LVIDd and LVIDs are end-diastolic and end-systolic left ventricle internal dimensions, respectively.
- End-diastolic (EDV) and end-systolic volumes (ESV) were calculated from left ventricle systolic (LVAs) and diastolic (LVAd) areas via the method of discs.
- RNA expression analyses were performed as follows: Heart samples (i.e. basal side of the hearts) were shock frozen in liquid nitrogen for RNA. Total RNA from the LV was isolated using the Ultraspec Il kit (Bioteckx), according to the instructions of the manufacturer.
- RNA concentrations were adjusted to 100ng/ ⁇ l
- 100 ng heat denatured RNA and 200 pmol random hexamer primers (Pharmacia, Uppsala Sweden) were transferred to a Ready-To-Go first strand bead (Pharmacia, Uppsala Sweden) tube and the volume adjusted to 33 ⁇ l.
- the reaction (1 hour at 37 0 C) was stopped by heat inactivating (2 minutes at 94 0 C) the transcriptase and samples were cooled to 4 "C.
- PCR-primers (Sigma Genosys) were selected based on published primers/cDNA sequences and had the following sequences (5' -> 3'):
- CGGAGACACCGCCACTTG (5'-primer PGK 1 ), AAGGCAGGAAAATACTAAACAT (3'-primer PGK 1), GCTGCTTTGGGCAGAAGATAGA (5'-primer brain natriuretic peptide (BNP)), ACAACCTCAGCCCGTCACA(3'-primer BNP), CGAAGGCAACAGTCGATTCA (5'-primer procollagen ( ⁇ 1) type I), GGTCTTGGTGGTTTTGTATTCGAT (3'-primer procollagen ( ⁇ 1) type I), TCCTGAAGATGTCCTTTGATGTACAG (5'-primer procollagen ( ⁇ 1) type III) and TTCAGAGACTTCTTTACATTGCCATT (3'-primer procollagen ( ⁇ 1) type III),
- initial gene concentrations were derived by comparing signals with standard curves. Validity of the procedure was checked by constructing melting curves for every sample.
- SHHF spontaneous hypertensive heart failure
- Hearts were harvested for histological analysis in order to determine fibrillar interstitial and perivascular collagen accumulation by collagen specific Picro Sirius Red staining and subsequent light microscopy.
- the apical parts of the hearts were embedded in Tissue-tek and frozen in freezing 2-methyl-butane in liquid nitrogen.
- Cryostat cross-sections (6 ⁇ m) were prepared, air dried, fixed in 10% buffered formalin for 1 hour and washed for 30 min followed by 5 min in distilled water. After 5 min in 0.2% Phosphomolybdic acid for prevention of background staining all sections were stained for 90 min with 0.1% Sirius red (Polyscience, Warrington PA, USA) in saturated picric acid .
- the finely ground aclometasone, some of the corn starch, lactose, microcrystalline cellulose, and polyvinylpyrrolidone are mixed together, the mixture is screened and worked with the remaining corn starch and water to form a granulate which is dried and screened.
- the sodium-carboxymethyl starch and the magnesium stearate are added and mixed in and the mixture is compressed to form tablets of a suitable size.
- TOTAL 90 The prednisone, corn starch, lactose, and polyvinylpyrrolidone are thoroughly mixed and moistened with water. The moist mass is pushed through a screen with a 1 mm mesh size, dried at about 45.degree. C. and the granules are then passed through the same screen. After the magnesium stearate has been mixed in, convex tablet cores with a diameter of 6 mm are compressed in a tablet-making machine. The tablet cores thus produced are coated in known manner with a covering consisting essentially of sugar and talc. The finished coated tablets are polished with wax.
- the clobetasone and corn starch are mixed and moistened with water.
- the moist mass is screened and dried.
- the dry granules are screened and mixed with magnesium stearate.
- the finished mixture is packed into size 1 hard gelatine capsules.
- the prednisilone is dissolved in water at its own pH or optionally at pH 5.5 to 6.5 and sodium chloride is added to make it isotonic.
- the solution obtained is filtered free from pyrogens and the filtrate is transferred under aseptic conditions into ampoules which are then sterilized and sealed by fusion.
- the ampoules contain 5 mg, 25 mg, and 50 mg of active prednisilone as desired.
- the suspension is transferred into a conventional aerosol container with a metering valve.
- a metering valve Preferably, 50 microliters of suspension are delivered per spray.
- the beclomethasone may also be metered in higher doses if desired (e.g., 0.02% by weight).
- Clobetasol is combined with sterile Ringer's solution to form a sterile clobetasol solution having a concentration of 0.01 wt% clobetasol.
- lntrapericardial fluid communication is established in a subject according to the teachings of United States Published Patent Application 2006/0229492 to Gelfand et al. ("Gelfand”). Instead of introducing the injectable heart constrainer of Gelfand, the clobetasol solution is infused at a rate sufficient to provide 0.25 mg of clobetasol in the pericardial space. The introducing catheter is then withdrawn, and the incisions closed, again according to the teachings of Gelfand, and coupled with standard surgical techniques.
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP08742104A EP2139491A1 (en) | 2007-03-16 | 2008-03-14 | Use of glucocorticoids for treatment of congestive heart failure |
CA002681476A CA2681476A1 (en) | 2007-03-16 | 2008-03-14 | Use of glucocorticoids for treatment of congestive heart failure |
US12/449,904 US20100113406A1 (en) | 2007-03-16 | 2008-03-14 | Use of glucocorticoids for treatment of congestive heart failure |
AU2008229481A AU2008229481A1 (en) | 2007-03-16 | 2008-03-14 | Use of glucocorticoids for treatment of congestive heart failure |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US91837007P | 2007-03-16 | 2007-03-16 | |
US60/918,370 | 2007-03-16 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2008115441A1 true WO2008115441A1 (en) | 2008-09-25 |
Family
ID=39472603
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2008/003448 WO2008115441A1 (en) | 2007-03-16 | 2008-03-14 | Use of glucocorticoids for treatment of congestive heart failure |
Country Status (5)
Country | Link |
---|---|
US (1) | US20100113406A1 (en) |
EP (1) | EP2139491A1 (en) |
AU (1) | AU2008229481A1 (en) |
CA (1) | CA2681476A1 (en) |
WO (1) | WO2008115441A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3876946A4 (en) * | 2018-11-08 | 2022-08-03 | Board of Regents of the University of Nebraska | Compositions and methods for the treatment of peripheral artery disease and cardiopulmonary diseases |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5002067A (en) * | 1989-08-23 | 1991-03-26 | Medtronic, Inc. | Medical electrical lead employing improved penetrating electrode |
US5009229A (en) * | 1989-12-06 | 1991-04-23 | Medtronic, Inc. | Steroid eluting intramuscular lead |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6046187A (en) * | 1996-09-16 | 2000-04-04 | Children's Medical Center Corporation | Formulations and methods for providing prolonged local anesthesia |
US6610674B1 (en) * | 1999-09-28 | 2003-08-26 | University Of Pennsylvania | Method of treating inflammatory conditions with progesterone analogs |
WO2002057450A2 (en) * | 2000-11-29 | 2002-07-25 | Curagen Corporation | Proteins and nucleic acids encoding same |
-
2008
- 2008-03-14 AU AU2008229481A patent/AU2008229481A1/en not_active Abandoned
- 2008-03-14 EP EP08742104A patent/EP2139491A1/en not_active Withdrawn
- 2008-03-14 CA CA002681476A patent/CA2681476A1/en not_active Abandoned
- 2008-03-14 WO PCT/US2008/003448 patent/WO2008115441A1/en active Application Filing
- 2008-03-14 US US12/449,904 patent/US20100113406A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5002067A (en) * | 1989-08-23 | 1991-03-26 | Medtronic, Inc. | Medical electrical lead employing improved penetrating electrode |
US5009229A (en) * | 1989-12-06 | 1991-04-23 | Medtronic, Inc. | Steroid eluting intramuscular lead |
Non-Patent Citations (4)
Title |
---|
GUTNER L B ET AL: "The use of prednisone in congestive heart failure.", THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES SEP 1957, vol. 234, no. 3, September 1957 (1957-09-01), pages 281 - 286 passi, XP009101413, ISSN: 0002-9629 * |
ISHIDA ET AL: "Hypereosinophilic syndrome with generalized myasthenia gravis", JOURNAL OF PEDIATRICS, MOSBY-YEAR BOOK, ST. LOUIS, MO, US, vol. 128, no. 3, 1 March 1996 (1996-03-01), pages 369 - 372, XP005142621, ISSN: 0022-3476 * |
LIU CHAO ET AL: "Potent potentiating diuretic effects of prednisone in congestive heart failure", JOURNAL OF CARDIOVASCULAR PHARMACOLOGY, vol. 48, no. 4, October 2006 (2006-10-01), pages 173 - 176, XP009101412, ISSN: 0160-2446 * |
STRATTE ET AL: "Multimodal management of diffuse neonatal hemangiomatosis", JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY, C.V. MOSBY, ST. LOUIS, MO, US, vol. 34, no. 2, 1 February 1996 (1996-02-01), pages 337 - 342, XP022403653, ISSN: 0190-9622 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3876946A4 (en) * | 2018-11-08 | 2022-08-03 | Board of Regents of the University of Nebraska | Compositions and methods for the treatment of peripheral artery disease and cardiopulmonary diseases |
Also Published As
Publication number | Publication date |
---|---|
CA2681476A1 (en) | 2008-09-25 |
EP2139491A1 (en) | 2010-01-06 |
US20100113406A1 (en) | 2010-05-06 |
AU2008229481A1 (en) | 2008-09-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2730277B1 (en) | Drug carrier and drug carrier kit for inhibiting fibrosis | |
EP1202736B1 (en) | Nicotine in therapeutic angiogenesis and vasculogenesis | |
US7919577B2 (en) | Adrenocorticotropic hormone analogs and related methods | |
JP2021042248A (en) | Treatment of diastolic cardiac dysfunction with trpv2 receptor agonist | |
EP2416783B1 (en) | Improved glucocorticoid therapy | |
US20100158973A1 (en) | Therapeutic uses of cannabidiol compounds | |
EP3058074B1 (en) | Oral delivery of angiotensin converting enzyme 2 (ace2) or angiotensin-(1-7) bioencapsulated in plant cells | |
CN115427065A (en) | GLP-1R and GCGR agonists, formulations, and methods of use | |
WO2014153221A2 (en) | Acth for treatment of acute respiratory distress syndrome | |
TWI452032B (en) | Compositions for treating kidney disorders | |
CN101378775B (en) | Combination of somatostatin-analogs with different selectivity for human somatostatin receptor subtypes | |
Wang et al. | Xinyang Tablet inhibits MLK3-mediated pyroptosis to attenuate inflammation and cardiac dysfunction in pressure overload | |
JP2022523821A (en) | Istaloxime-containing intravenous formulation for the treatment of acute heart failure (AHF) | |
US20100113406A1 (en) | Use of glucocorticoids for treatment of congestive heart failure | |
TW200422042A (en) | Methods and reagents for the treatment of diseases and disorders associated with increased levels of proinflammatory cytokines | |
JP6110587B2 (en) | Pharmaceutical composition for preventing peritoneal adhesion | |
WO2006088875A2 (en) | Intranasal administration of modulators of hypothalamic atp-sensitive potassium channels | |
JP7050893B2 (en) | Angiotensin II receptor blocker for the prevention or treatment of systemic diseases in cats | |
WO1998034636A1 (en) | Medicinal compositions for treating cardiac diseases caused by cardiac hypertrophy | |
US8017575B2 (en) | Treatment of insulin resistance by modulating somatostatin using somatostatin receptor antagonists | |
FOWLER et al. | Curtailment of the uterotrophic action of estrogen by impaired histamine liberation in the alloxan-diabetic rat: reversal by insulin and by adrenalectomy | |
George et al. | Long-term effects of B-type natriuretic peptide infusion after acute myocardial infarction in a rat model | |
Lim et al. | Impact of Conversion From Cyclosporine to Tacrolimus on Glucose Metabolism and Cardiovascular Risk Profiles in Long-Term Stable Kidney Transplant Recipients | |
Baehr et al. | Gene Therapy for Cardiomyopathy associated with Duchenne Muscular Dystrophy in a Pig Model | |
WO2024006207A1 (en) | An n-terminal domain androgen receptor inhibitor and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08742104 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12449904 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2008229481 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2681476 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2008229481 Country of ref document: AU Date of ref document: 20080314 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2008742104 Country of ref document: EP |